article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
most of the dual infections cause a diagnostic dilemma and require a high degree of suspicion in susceptible individuals. however, dual infections with mucormycosis may follow a fulminant course and may be associated with higher mortality and morbidity. we hereby report coinfection of pulmonary tuberculosis (tb) with mucormycosis in a diabetic male that worsened rapidly in spite of the antimicrobial therapy targeted toward the same. a 72-year - old nonsmoker male, known case of diabetes mellitus type ii since 10 years, on oral hypoglycemic agents, presented with the complaints of altered sensorium with low - grade fever associated with pain abdomen and vomiting and was diagnosed to have severe urinary tract infection. he was being managed in the ward for diabetic ketoacidosis for the same and was doing well until the 9 day of admission when he developed cough, expectoration, and difficulty in breathing. subsequently, the patient was intubated and transferred to intensive care unit (icu) for mechanical ventilation with synchronized intermittent mandatory ventilation mode and further managed according to the institutional protocol. all routine biochemical and hematological investigations including the chest x - ray (cxr) were sent. blood sugar levels were found to be 460 mg% and total lymphocyte count was 1200 mm, and urine ketones were found to be positive. arterial blood gas on the day of admission at fio2 of 0.6 had a pao2/fio2(pf) ratio of 261. empirical antibiotic therapy and vasopressor support with noradrenaline (0.5 g / kg / min) was started as per protocol. sputum examination undertaken in the ward itself was negative for acid fast - bacilli (afb). the cxr showed bilateral cavitary lesions in all the zones on the very 1 day of icu admission. with a high index of suspicion for fungal pneumonia based on the clinical and radiological findings and negative sputum for afb, antifungal (caspofungin 70 mg intravenous [iv ] loading dose followed by 50 mg iv once daily) however, no clinical improvement was noticed over 5 days, and radiological deterioration was evident by the appearance of new cavitary lesions developing over every 24 h [figure 1 ]. the pf ratio also started deteriorating consistently with the values of 161 on the 3 day falling to 114.5 on the 9 day with fio2 going up to 0.9. with patient condition deteriorating as evidenced by higher ionotropic support and decreasing pf ratio, bronchoalveolar lavage (bal) was performed, and wastings were sent for afb staining, pyogenic culture, and fungal culture. subsequently, antitubercular treatment was also initiated as per the revised national tuberculosis control program guidelines for the same. although the potassium hydroxide wet mount revealed no fungal elements, fungal culture showed growth of rhizopus species on the 2 day of inoculation [figure 2 ], following which amphotericin b (in the dose of 0.5 mg / kg iv loading dose followed by 1 mg / kg once daily) was introduced as per culture sensitivity. on the 11 day, the pf ratio had further fallen to 71 on fio2 of 1.0. however, the patient failed to improve and succumbed on the 12 day of admission to icu. multiple cavitatory lesions on day 5 lactophenol cotton blue mount showing rhizopus microsporus species (lcb 200) opportunistic fungal organisms such as candida species, aspergillus species, mucor species, and cryptococcus neoformans may be encountered in diabetic patients who are usually immunocompromised by virtue of the disease itself. diabetes mellitus may predispose to mucormycosis in 3688% of patients which is a serious, potentially fatal fungal infection that needs a high degree of suspicion for the diagnosis. patients with uncontrolled hyperglycemia, particularly those with ketoacidosis, are the most susceptible and it may be the first manifestation in patients with undiagnosed diabetes mellitus. the most common presentation is rhino - orbital - cerebral involvement followed by pulmonary infection. patients with diabetes are prone to develop tb and have high chances of treatment failure. a large proportion of people with diabetes further developing tb are not diagnosed, or diagnosed too late, may be due to lack of awareness on the part of the patient to report early for any development of chest symptoms. coinfection with pulmonary tb and mucormycosis in immunocompromised patients may present a diagnostic dilemma owing to similar clinical presentation and need a high degree of clinical suspicion and early aggressive treatment. both clinical entities in addition, the radiological features of consolidation, cavitation, infiltrates, and effusion are common to both the diseases and, therefore, histopathological examination or culture sensitivity should be undertaken at the earliest to make definitive diagnosis. it is possible that the high relapse cases, treatment failures, resistance, and high mortality associated with tb infection are partly attributed to coinfection with opportunistic fungal pathogens and drug - resistant non - tb bacteria. in the present case, an immunocompromised state prevailing as a result of diabetes and tb made the patient prone to acquire coinfection with mucormycosis. although cavitation was evidenced on the very 1 day of admission to icu, negative sputum examination in the ward made tb an unlikely diagnosis. however, conclusive diagnosis was made only after bal which demonstrated the presence of afb on smear and ubiquitous filamentous fungus rhizopus species, of mucorale order, colonization on culture. there are isolated reports of coinfection of mucormycosis and tb in immunocompromised patient where the patients were successfully treated. in the present case, the unfavorable outcome may be the result of delayed diagnosis which was probably missed for the first 8 days in a ward where primarily the focus was on treating diabetic ketoacidosis. meanwhile, the hyperglycemic environment that favors immune dysfunction (e.g., damage to the neutrophil function, depression of the antioxidant system, and humoral immunity) flared up coinfection of mucormycosis with latent tb progressing to active tb and followed a fulminant course. latent tb and drug - resistant tb in patient with diabetes make them susceptible to opportunistic infections with potentially fatal fungal infections. simultaneous infection with mycobacterium tuberculosis and mucormycosis is a rare finding and requires high clinical vigilance. now - a days, it is imperative to consider fungal infections as an important differential diagnosis. early and aggressive treatment targeting the isolated organisms may help reduce the mortality and morbidity. meanwhile, screening the patients with diabetes for coinfections, especially in nonresolving pneumonias are imperative and should be practiced in a protocolized form in early stages of diabetes. | herein, we present the case report of an adult male diabetic patient who had coinfection with mycobacterium tuberculosis and mucormycosis, which otherwise is a rare clinical entity. diabetes mellitus may predispose a patient to tuberculosis (tb) infection which further weakens immune system thus making him susceptible to other fungal or bacterial infections which may pose various treatment difficulties. therefore, there is a need for mycological and bacteriological investigations in patients with pulmonary tb to rule out secondary coinfections thus contributing to better management. |
research into tumor cell metabolism has recently entered a new age (cairns., 2011 ; kroemer and pouyssegur, 2008). although this field was actively explored in the pre - genomics era, the discovery of tumor suppressor genes and oncogenes dampened interest in metabolism as a potential source of cancer cell specificities and related therapeutic targets. however, although the study of tumor - associated genes has led to the identification of oncoproteins as new therapeutic targets, a cure for cancer is still far away. scientists in the cancer field are therefore reconsidering earlier metabolic discoveries using the molecular tools that are now available. the altered metabolism of cancer cells compared with normal cells confers a selective advantage for their survival and proliferation. as the primary tumor expands, it outgrows the diffusion limits of its local blood supply, leading to hypoxia. among other effects, hypoxia induces the expression of hypoxia - inducible factor (hif), a transcription factor that initiates a range of responses, including angiogenesis and various pro - survival mechanisms (denko, 2008). cellular metabolism is consecutively shifted towards the glycolytic pathway (i.e. glucose to lactate) through the increased expression of glycolytic enzymes and glucose transporters, together with a decreased dependence on the oxidative pathway (i.e. pyruvate to lactate to acetyl - coa). in parallel, stimulation of angiogenesis leads to chaotic development of the tumor vasculature, which only alleviates hypoxia to a limited temporal and spatial extent, further selecting for tumors that constitutively upregulate glycolysis. the warburg effect describes this capacity of tumor cells to exploit glycolysis (i.e. without coupling to the krebs cycle and mitochondrial respiratory chain) even in the presence of oxygen (cairns., 2011). the expression of oncogenes such as those encoding for myc and ras, and/or loss of tumor suppressor genes such as p53, also promote the glycolytic pathway by acting on the same metabolic factors as those regulated by hif (levine and puzio - kuter, 2010). lactate, the end product of glycolysis, is produced in large excess in tumors in response to the specific characteristics of the tumor microenvironment and the genetic features of tumor cells. importantly, lactate also constitutes an alternative metabolic fuel for cancer cells (sonveaux., 2008 ; feron, 2009 ; whitaker - menezes., 2011), which is a phenomenon that has been well characterized in non - tumor tissues, including in skeletal muscle, brain and liver (brooks, 2009 ; gladden, 2004). oxidative tumor cells can use lactate instead of (or in addition to) glucose, thereby sparing available glucose, which can, in turn, diffuse deeper into the tumor to fuel hypoxic cells located farther away from tumor blood vessels (sonveaux. the use of lactate as an energy source requires the conversion of lactate into pyruvate (and back) as well as the transport of lactate into and out of tumor cells by way of specific transporters. lactate dehydrogenase (ldh) isoforms and a family of monocarboxylate transporters (mcts), respectively, regulate these processes. in this article and the accompanying poster, we describe lactate shuttles that involve these two lactate - related proteins in certain types of healthy tissues and tumor cells. given their importance as controllers of tumor cell metabolism, the components of lactate shuttles might actually be promising therapeutic targets for cancer. ldhs catalyze the interconversion of pyruvate and lactate, with concomitant interconversion of nadh and nad. these enzymes are homo- or hetero - tetramers composed of m and h protein subunits that are encoded by the ldha and ldhb genes, respectively. five isoforms are therefore possible : ldh-1 [four h subunits (4h) ], ldh-2 (3h1 m), ldh-3 (2h2 m), ldh-4 (1h3 m) and ldh-5 (4 m) (see poster) ; a third gene, ldhc (also known as ldhx), is reportedly expressed in testes and sperm (holmes and goldberg, 2009). ldh enzymes with a high m - subunit content (often referred to as ldha proteins) are abundant in white skeletal muscle (rapid twitch glycolytic fibers), in which they reduce pyruvate into lactate. ldha and pyruvate dehydrogenase kinase (pdk) are upregulated in solid tumors in response to hypoxia in a hif-1-dependent manner. pdk inactivates pyruvate dehydrogenase (pdh) and prevents the import of pyruvate into the mitochondrial matrix, whereas ldha reduces the pyruvate into lactate and thereby regenerates the nad stock necessary to maintain the glycolytic flux. in tumors, the glucose - to - lactate glycolytic pathway can also occur in the presence of oxygen, an observation described as the warburg effect (feron, 2009 ; cairns., 2011). this is actually observed in most proliferating cells and occurs because dividing cells need to produce more biosynthetic intermediates to duplicate cell biomass and dna (feron, 2009). as long as glucose is available, nad regeneration makes glycolysis self - sufficient and a crucial carbon source for protein, lipid and nucleotide biosynthesis. ldha expression is also induced by a variety of oncogene products, including myc (shim., 1997), and might therefore contribute to the rapid consumption of pyruvate, the accumulation of which is potentially damaging. lactate that is produced from hypoxia - induced or oncogene - driven ldha expression also needs to be removed to avoid acidification of the intracellular compartment : this function is fulfilled by dedicated transporters called mcts (see below). ldh enzymes with high h - subunit content (often referred to as ldhb proteins) are mainly found in aerobic tissues (such as heart and brain), where they convert lactate into pyruvate. transcriptional silencing of ldhb expression caused by aberrant methylation of the gene promoter region has been reported in gastric and prostate cancers (maekawa., 2003 ; leiblich., 2006), thereby reinforcing the idea that tumors preferentially express ldh isoenzymes with a high ldha gene product content (ldh-5>ldh-4>ldh-3). in colorectal cancer, suppression of ldhb transcript in a more invasive phenotype was even proposed to account for a large part of the warburg metabolic switch (i.e. independently of hypoxia - induced changes in ldha expression) (thorn., 2009). mcts constitute a family of 14 transporters [also known as solute carrier 16 (slc16) proteins ] that carry single - carboxylate molecules across biological membranes (halestrap and price, 1999 ; halestrap and meredith, 2004 ; kennedy and dewhirst, 2010). the mct proteins are predicted to have 12 transmembrane domains, with the n- and c - termini facing the intracellular side of the membrane and a large cytosolic loop between domains 6 and 7 (see poster). transmembrane domains are well conserved and mcts differ mainly in their n- and c - termini and intermediary loop sequences. four members of the mct family (mct1-mct4) have been described to be proton - linked mcts. at physiological ph, mct1 is the most widely expressed mct and plays an active role in the uptake of lactate in the heart, skeletal muscle and red blood cells, as well as in the liver (for gluconeogenesis) (halestrap and meredith, 2004). mct2 is less ubiquitous and has been reported to play key roles in neurons at the postsynaptic density, and mct3 expression is limited to the retinal pigment epithelium and choroid plexus epithelia (halestrap and meredith, 2004). mct4 is primarily expressed in highly glycolytic cells, such as white (rapid twitch) muscle fibers, and is upregulated in response to hypoxia (ullah., 2006). the affinity for lactate and pyruvate differs between mcts, as reflected by the michaelis constant (km) value for each (i.e. the substrate concentration at which the transport rate is half of maximum) (see poster). in particular, the low km value of mct1 for lactate indicates that, when expressed in a cell, this transporter is the predominant regulator of lactate fluxes. as discussed below, mct1 and mct4 are the two major mcts expressed in tumor cells and represent promising targets for therapy. mct1, mct3 and mct4 associate with the chaperone protein basigin (also known as cd147, emmprin or ox-47), whereas embigin (also known as gp70) is the preferred binding partner of mct2 (wilson., 2005 ; the current consensus on the mechanism of mct1-mct4 transporters is that monocarboxylate - proton symport occurs via a rapid equilibrium - ordered mechanism, with proton binding followed by monocarboxylate binding (halestrap and meredith, 2004 ; halestrap and price, 1999). lactate export in response to high glycolytic flux (see above) is not the only function of mcts : lactate can also be taken up by various specialized cells in a variety of tissues. circulating lactate can be used by the liver for gluconeogenesis (cori cycle) (miller., 2002b ; roef., 2003) or directly consumed by oxidative cells located near to glycolytic lactate - producing cells. this symbiosis system referred to as the cell - cell lactate shuttle (brooks, 1985 ; brooks, 1998) has been extensively studied in skeletal muscle and brain, and was more recently documented in tumors (sonveaux., 2008 ; vegran., 2011). in addition to lactate exchange between cells, an intracellular lactate shuttle paradigm (brooks, 1998 ; brooks., 1999) was proposed to account for the apparently paradoxical conversion of exogenous lactate into pyruvate in glucose - fuelled cells. although lactate shuttles were identified only recently in tumors (see below), this process has been described in skeletal muscle for several years. accumulation of lactate in contracting skeletal muscle was originally thought to be the consequence of anaerobic glycolysis (wasserman, 1984). however, lately, numerous studies have documented that lactate can be produced and used continuously under fully aerobic conditions [for reviews and historical perspectives, see gladden and brooks (gladden, 2004 ; brooks, 2009) ]. during exercise, white glycolytic (rapid twitch) muscle fibers produce lactate and release it into the blood (skelton., 1995), mainly via the mct4 transporter ; a large part (one third) of plasma lactate is then transported into red blood cells via mct1 (garcia., 1994). when exercise is prolonged, but also during recovery from short - term exercise, lactate is taken up from the muscle interstitial fluid or back from the blood to red oxidative (slow twitch) muscle fibers (brooks, 2000 ; gladden, 2000 ; miller., 2002a) similarly, the heart and brain are active consumers of lactate, which, under conditions of increased circulating lactate concentrations, can represent up to 60% and 25% of the metabolic fuel for these organs, respectively (stanley, 1991 ; ide and secher, 2000 ; gertz., 1988). tracer studies indicate that essentially all of the lactate taken up by these organs is oxidized (stanley, 1991 ; van hall., 2009), suggesting that there is little carbon exchange from lactate to other metabolites. of note, whereas cardiac muscle mainly takes up lactate from the blood, in the brain, lactate exchange between neighboring cells has been documented (bouzier - sore., 2003). pellerin and magistretti originally reported that neurons can metabolize lactate originating from astrocytes in vitro (see poster) (pellerin and magistretti, 1994). the symbiosis in this case is further reinforced by the production and release of glutamate from neurons : glutamate is consecutively taken up by astrocytes together with na, thus requiring (na, k)-atpase activation to restore ionic homeostasis. glycolysis is in turn stimulated in response to reduced atp levels and glutamine synthesis from glutamate. as a consequence, lactate concentration rises in astrocytes and then lactate moves outward through mct4 into the extracellular space, driving lactate influx into the surrounding neurons via mct2. however, stoichiometric analyses do not support a strict lactate exchange between the two cell types, and it is generally accepted that glycolysis is also directly coupled to oxidative metabolism in astrocytes (mangia., 2003). a common requirement of the capacity of muscle and brain cells to use lactate is the presence of oxygen. in tumors, the temporal and/or local deficit in oxygen imposes an additional layer of regulation to the cell - cell lactate shuttle (see below). the concept of the intracellular lactate shuttle originates from the need to understand how oxidation of lactate to pyruvate can occur in well - oxygenated tissues, including in skeletal muscle, cardiac muscle and liver. this phenomenon is indeed paradoxical, considering that the vmax of ldh is the highest of any enzyme in the glycolytic pathway and that the reaction equilibrium constant for the pyruvate - to - lactate conversion is more favorable than for the reverse reaction (brooks, 2000 ; brooks, 1998 ; brooks., 1999). because of thermodynamic issues related to the conversion of lactate into pyruvate inside mitochondria, and the lack of undisputable evidence of significant mitochondrial ldh activity (yoshida., 2007), a consensus is emerging that suggests that differential concentrations of lactate and pyruvate are present in different subcellular regions. if one considers that mitochondria can act as a sink for pyruvate (into which it is taken up and used for the krebs cycle), it can be proposed that there exists a steep pyruvate gradient between the plasma membrane and mitochondria. in other words, pyruvate concentrations are the lowest close to mitochondria, making lactate concentrations relatively high in this remote cytosolic location away from the plasma membrane. as a consequence, in the immediate vicinity of mitochondria, lactate and nad can be converted back to pyruvate and nadh before they are taken up into mitochondria (stainsby and brooks, 1990 ; gladden, 2004). the nature of the transporter that brings pyruvate into mitochondria is unclear : mcts [in particular mct2, which has a high affinity for pyruvate (yoshida., 2007) ] and a six transmembrane helix structure known as mitochondrial pyruvate carrier (mpc) (kuan and saier, jr, 1993 ; sugden and holness, 2003) have been described. the intracellular lactate shuttle model provides a framework to understand how (millimolar) lactate exchange and conversion into its more oxidized analog pyruvate can be used to maintain the redox balance in the cytosol and mitochondria. the presence of cell - cell and intracellular lactate shuttles gives rise to the notion that glycolytic (i.e. glucose to lactate) and oxidative (i.e. lactate to pyruvate to acetyl - coa) pathways can simultaneously co - exist and even be linked in a given cell. in the following section, we comment on recent findings documenting that these different modes of lactate exchange, which are physiological in essence, can be usurped by tumors. we recently reported that both oxidative cancer cells and endothelial cells lining tumor blood vessels can take up lactate released by glycolytic tumor cells (sonveaux., 2008 ; vegran., the cell - cell and intracellular lactate shuttle concepts identified in non - cancer tissues can be applied in this context and open up exciting avenues, with concrete therapeutic perspectives. using cervix cancer cells as an in vitro model of oxidative cancer cells, we documented that lactate derived from glycolytic tumor cells could be used as a main source of metabolic fuel (sonveaux., 2008). as a consequence, aerobic tumor cells (i.e. those located near to blood vessels) spare glucose, which can then diffuse a greater distance into the tumor to nourish glycolytic cells. exogenous lactate uptake by oxidative tumor cells occurs through the high - affinity lactate transporter mct1, whereas glycolysis - derived lactate is released through the low - affinity lactate transporter mct4 (sonveaux., 2008), recapitulating the cell - cell lactate shuttling processes observed in muscle and brain (see above). interestingly, alteration in this symbion can have dramatic consequences (sonveaux., 2008). inhibition of mct1 can shift the preference of oxidative tumor cells towards using glucose, thereby reducing the amount of glucose that can reach hypoxic tumor cells and altering their survival (see poster). inhibition of mct4 has instead the potential to directly target hypoxic tumor cells and promote their death by intracellular lactic acid accumulation. chatham and colleagues previously reported that, in rat heart, the production of lactate via glycolysis and the oxidation of exogenous lactate are functionally separate metabolic pathways (chatham., 2001). this observation, which is in line with the intracellular lactate shuttle hypothesis, further supports the paradigm of preferential (or at least co - existing) fuelling of mitochondrial respiration in tumors by exogenous lactate (sonveaux., 2008). this model might, in particular, apply in the context of cyclic hypoxia, in which tumor cells must switch from using glucose to an alternative source of energy to survive during periods of ischemia (denko, 2008). tumor - associated fibroblasts have also been documented to participate in lactate homeostasis in tumors (see poster). koukourakis and colleagues reported that preferential expression of mct1 and ldh-1 together with elevated pdh activity in tumor fibroblasts supports the metabolic use of lactate produced by tumor cells, and thereby prevents the development of a hostile acidic environment (koukourakis. by contrast, lisanti and colleagues documented that tumor - associated fibroblasts can instead undergo aerobic glycolysis and feed adjacent oxidative cancer cells with the released lactate (bonuccelli., 2010 ; whitaker - menezes., more recently, we reported that lactate can also enter tumor endothelial cells through mct1 (vegran., 2011). this study not only showed that lactate can favor the survival of serum - starved endothelial cells, but, more interestingly, that lactate can directly initiate pro - angiogenic signaling. we found that lactate stimulates an autocrine pathway involving nuclear factor-b (nfb) and interleukin-8 [il-8 ; also known as c - x - c chemokine 8 (cxcl8) ], which drives endothelial cell migration and tube formation. il-8-specific blocking antibodies and il-8-targeted sirna both prevented lactate - induced angiogenesis. using human colorectal and breast cancer models in mice, we further documented that lactate that is released from tumor cells through mct4 (but not mct1) is sufficient to stimulate il-8-dependent angiogenesis and tumor growth (vegran., 2011). importantly, we also documented the anti - angiogenic potential of mct1 and mct4 inhibition through the blockade of endothelial cell lactate uptake and the reduction in extracellular lactate availability, respectively (see poster). these findings establish a dual role for lactate in tumors : it acts as both a metabolic fuel and a signaling molecule, positioning lactate at the intersection of key processes in cancer progression, namely tumor metabolism and angiogenesis. therefore, although lactate shuttles are physiologically active in some types of healthy tissue, the specific characteristics of some tumors make the regulators of cellular lactate handling, namely mcts and ldhs, potential anti - cancer targets. metabolic symbions that we and others have described between oxidative and glycolytic tumor cells but also between tumor cells and stromal cells, including endothelial cells and fibroblasts offer diverse rationales to support the development of mct and ldh inhibitory strategies. however, as for all new anti - cancer therapies, the extent to which tumors are addicted (feron, 2010) to these pathways (i.e. to lactate transport and conversion), and the capacity to therapeutically target these pathways without altering healthy tissues (bouzin and feron, 2007), will determine the success of these new therapeutic avenues in the anti - cancer drug armamentarium. | hypoxia and oncogene expression both stimulate glycolytic metabolism in tumors, thereby leading to lactate production. however, lactate is more than merely a by - product of glycolysis : it can be used as a metabolic fuel by oxidative cancer cells. this phenomenon resembles processes that have been described for skeletal muscle and brain that involve what are known as cell - cell and intracellular lactate shuttles. two control points regulate lactate shuttles : the lactate dehydrogenase (ldh)-dependent conversion of lactate into pyruvate (and back), and the transport of lactate into and out of cells through specific monocarboxylate transporters (mcts). in tumors, mct4 is largely involved in hypoxia - driven lactate release, whereas the uptake of lactate into both tumor cells and tumor endothelial cells occurs via mct1. translating knowledge of lactate shuttles to the cancer field offers new perspectives to therapeutically target the hypoxic tumor microenvironment and to tackle tumor angiogenesis. |
obstructive sleep apnea (osa) is a clinical disorder characterized by recurrent episodes of upper airway collapse during sleep. it is well known that osa patients have an increased risk of cardiovascular disease (cvd) and death [14 ]. many factors play a role in pathogenesis of atherosclerosis, such as systemic inflammation, oxidative stress, increased vascular endothelial growth factor, adhesion molecules, and coagulant factors. recent studies have shown that osa patients without cvd risk factors have increased endothelial dysfunction and atherosclerosis. carotid intima - media thickness (imt) is used as a marker for the detection of early endothelial defect and subclinical atherosclerosis. recent studies suggest the presence of osa is independently associated with increased carotid imt. however, many patients with osa have other concomitant disease or risk factors, such as diabetes, cardiovascular disease, hypertension, hyperlipidemia, obesity, and smoking. therefore, it is difficult to determine a direct association between atherosclerosis and osa. on the other hand, several studies have reported that patients with osa have increased platelet activation and aggregation [1113 ]. some clinical studies have reported that mpv could be regarded as new predictor for atherosclerosis [1416 ]. a few studies have reported an association between mpv and sleep apnea [1719 ]. however, there is a lack of research directly examining the relevance between mpv and carotid intima - media thickness in sleep apnea. regarding the association between osa and cardiovascular disease, we aimed to detect early finding of atherosclerosis by measuring carotid intima - media thickness and to examine the association between mpv and imt and osa severity. the subjects were selected consecutively from the sleep disorders clinic of our institution between october 2014 and march 2016. the patients underwent physical examination, chest x - ray, respiratory function test, and routine blood analysis before polysomnography (psg). study subjects were categorized into 4 groups according to apnea - hypopnea index (ahi) : control (ahi 126 mg / dl or current use of antidiabetic drugs or insulin. hyperlipidemia was defined as having a previous diagnosis of hyperlipidemia, lipid - lowering medication use, a serum ldl cholesterol > 160 mg / dl, or serum total cholesterol > 240 mg / dl. we excluded patients who met the exclusion criteria detailed above and those who had chronic pulmonary, renal, liver diseases, malignant diseases, or chronic inflammatory diseases. according to above criteria, we excluded 224 patients for the following reasons : prevalent diabetes mellitus (n=30), hypertension (n=72), diabetes mellitus and hypertension (n=33), ischemic heart disease (n=20), chronic lung disease (n=11), hyperlipidemia (n=15), chronic renal failure (n=4), and being a smoker (n=39). standard overnight polysomnography was performed with a 62-channel embla n7000 device (medcare flage, iceland). the physiological signals monitored included eeg, eog, chin emg, ecg, bilateral anterior tibial muscle emg, nasal airflow, respiratory effort (thorax and abdomen movements), oxygen saturation, tracheal microphone, and body position. the average number of episodes of apnea and hypopnea per hour of sleep were taken as the apnea - hypopnea index (ahi). oxygen desaturation index (odi) was taken as the number of decreases in desaturation > 4% per hour of sleep. patients were categorized in terms of osa severity as follows : an ahi 126 mg / dl or current use of antidiabetic drugs or insulin. hyperlipidemia was defined as having a previous diagnosis of hyperlipidemia, lipid - lowering medication use, a serum ldl cholesterol > 160 mg / dl, or serum total cholesterol > 240 mg / dl. we excluded patients who met the exclusion criteria detailed above and those who had chronic pulmonary, renal, liver diseases, malignant diseases, or chronic inflammatory diseases. according to above criteria, we excluded 224 patients for the following reasons : prevalent diabetes mellitus (n=30), hypertension (n=72), diabetes mellitus and hypertension (n=33), ischemic heart disease (n=20), chronic lung disease (n=11), hyperlipidemia (n=15), chronic renal failure (n=4), and being a smoker (n=39). standard overnight polysomnography was performed with a 62-channel embla n7000 device (medcare flage, iceland). the physiological signals monitored included eeg, eog, chin emg, ecg, bilateral anterior tibial muscle emg, nasal airflow, respiratory effort (thorax and abdomen movements), oxygen saturation, tracheal microphone, and body position. the average number of episodes of apnea and hypopnea per hour of sleep were taken as the apnea - hypopnea index (ahi). oxygen desaturation index (odi) was taken as the number of decreases in desaturation > 4% per hour of sleep. patients were categorized in terms of osa severity as follows : an ahi 0.05). as expected, ahi and oxygen desaturation index (odi) were found to be significantly different between groups (p0.05). ahi / or odi (95% ci, 0.001 to 0.002, p=0.001), age (95% ci, 0.005 to 0.009, p<0.001), and hdl cholesterol (95%ci, 0.003 to 0.000, p=0.036) were found to be independent predictors of imt. roc analysis showed that using a cut - off level of 0.56, carotid imt predicted the presence of osa with a sensitivity of 64% and specificity of 82% (auc, 0.796 ; 95% ci, 0.683 to 0.855 ; p<0.001) (figure 2). the auc of mpv shown no significant correlation with osa (auc, 0.496 ; 95% ci, 0.377 to 0.614, p=0.946). the existence of endothelial dysfunction and cardiovascular risk in patients with osa has been supported by many studies [16,27 ]. during the last decade, imt has been a frequently investigated parameter for the determination of subclinical atherosclerosis in osa patients. recently, mpv also began to be used for the same purpose as a new parameter. in this study, we evaluated the carotid imt and mpv in patients with osa and tried to determine the associations among each other and osa severity. carotid intima - media thickness is frequently used in clinical trials but no international consensus exists on its value for early atherosclerosis. generally, normal values for carotid imt are thought to be around 0.5 mm in young adults. age, sex, ethnicity, and presence of risk factors may affect the values, and these factors should be considered. the mean age of our study population was 44.510.2 years and mean carotid imt was 0.590.12 mm. according to some clinical trials, intima - media thickness over 0.8 this result may be explained by the fact that participants were relatively young and many of the severe osa patients with atherosclerosis were excluded because of comorbid disease or atherosclerotic risk factors. one of the main results of the present study is that carotid arterial stiffness among osa patients was found to be increased compared to controls, consistent with the findings of previous studies. in case - control studies, a direct association between increased carotid imt and osa has been shown [2933 ]. unlike these previous studies, in our study we classified the subjects into 4 groups and found that the values of carotid imt in each osa group (mild, moderate, and severe) were higher than in controls. furthermore, we revealed that carotid imt is effective in predicting of osa and may be used in predicting the presence and severity of osa before polysomnography. we also found a positive correlation between carotid imt and apnea - hypopnea index (ahi). intima - media thickness was found to be positively correlated with oxygen desaturation index (odi) and time duration with oxygen saturation < 90% (t90), and negatively correlated with min spo2 and mean spo2. all these results lead us to conclude that hypoxemia has a strong effect on carotid imt. chronic repetitive nocturnal hypoxia, oxidative stress, and sympathetic nervous system hyperactivity are thought to be responsible for the endothelial damage. many studies have shown that hypoxemia is the most important risk factor for this process. reports in the literature show that carotid imt is evidence of early alterations in vascular morphology. in this study we also found that age, ahi / or odi, and hdl are independent determinants of imt. in the regression analysis, effects of ahi and odi were found to be identical ; therefore, either of them can be used as an independent predictor of imt. defining independent predictors of odi, which is a marker of nocturnal hypoxia, supports the view that hypoxia might be responsible for atherogenesis. gunnarson. reported that baseline ahi is an independent predictor of increased carotid imt and plaque in long - term follow - up. the second main topic of our study was to investigate the usefulness of mean platelet volume (mpv) in osa. the association between osa and mpv has been previously investigated in a limited number of studies [1719,38 ] and conflicting results were found. reported that mpv was higher in patients with severe osa compared to controls and subjects with mild - moderate osa. however, the authors did not exclude patients with cardiovascular risk factors such as hypertension, hyperlipidemia, and active smoking, which could lead to elevated mpv. in another study, enrolling 200 osa patients without any overt cardiac disease or diabetes, mpv was shown to be unrelated to osa severity. in the present study, we could not find any significant differences in terms of mpv levels between osa patients and the control group. we also found no significant associations between mpv and apnea - hypopnea index and other polysomnographic parameters. there is no research directly examining the relation between mpv and carotid intima - media thickness in sleep apnea. mpv was shown to be associated with carotid atherosclerosis in males ; however, no similar relationship between these 2 markers was found in females. in another study, the relation between mpv and subclinical atherosclerosis was investigated in type 2 diabetes mellitus patients, revealing that mpv was not associated with subclinical atherosclerosis. we found only a weak correlation between carotid imt and mpv values, suggesting that the mpv level may increase in the more advanced stages of atherosclerosis. in the present study, the lack of association between osa severity and mpv suggests that use of platelet markers could be less useful in osa patients. due to the conflicting results on this issue, this is a single - center study with a relatively small sample size and we have no information regarding long - term outcomes of the patient groups. the strength of our study is that the confounding effects of cardiovascular disease or risk factors on carotid atherosclerosis and mpv were eliminated by excluding patients with these characteristics. our findings suggest that osa patients have increased carotid stiffness and that carotid imt is a more reliable marker for predicting osa severity than is mpv. | backgroundobstructive sleep apnea (osa) is known to be closely associated with cardiovascular disease. carotid intima - media thickness (imt) is widely used for assessment of atherosclerosis. mean platelet volume (mpv) is a new marker associated with atherothrombosis. in this study, we aimed to detect early atherosclerosis by measuring carotid intima - media thickness and to investigate the relationship between mpv and imt and osa severity.material/methodsthe study population consisted of 158 patients who underwent polysomnography and did not have any overt cardiac disease or risk factors. carotid imt was measured by ultrasonography. blood samples were taken for mpv determination. subjects were divided into 4 groups according to osa severity : control, mild, moderate, and severe osa.resultsthe patients with osa (mild, moderate, severe) had an increased carotid imt (0.590.2, 0.600.1, 0.640.1, respectively) compared to controls (0.500.1, p<0.05). there were no differences found between groups regarding mean platelet volume. carotid imt was found to be positively correlated with age, systolic blood pressure, apnea - hypopnea index (ahi), oxygen desaturation index (odi), and time duration with oxygen saturation < 90% (t90), and negatively correlated with minimum spo2 and mean spo2. mpv was not correlated with osa severity or other parameters. carotid imt was found to be effective in predicting the presence of osa [auc=0.769 (0.683, 0.855), p<0.001) ] but mpv was not found to be effective [auc=0.496 (0.337,0.614) p=0.946)].conclusionsosa patients appear to have increased carotid imt suggestive of an atherosclerotic process. carotid imt could be a more useful indicator than mpv in these patients. long - term prospective studies are needed to confirm these results. |
the numbers of children and adolescents under 18 years of age receiving ssi have almost quadrupled from 1989 (275,000) to the current level of approximately 1 million (social security administration, 1996). along with an income benefit, ssi enrollment brings medicaid insurance in almost all states, even where the recipient might usually be ineligible because of age or household income (national commission on childhood disability, 1995 ; perrin and stein, 1991). medicaid, already the largest public insurer for children, has gained many additional childhood recipients through ssi eligibility. estimates of current public expenditures for the child and adolescent ssi program range up to $ 10 billion, approximately 60 percent for cash benefits and 40 percent for associated medicaid expenditures (national commission on childhood disability, 1995). this tremendous growth in the child and adolescent ssi program followed at least three major policy changes in the past several years : (1) the publication of new guidelines by the social security administration (ssa) for determining mental health disability in children in 1990, substantially increasing the access to ssi of children with mental health conditions (social security administration, 1990a) ; (2) the supreme court zebley decision, which led to new rules for determining disability among children with multiple conditions and for assessing how health conditions affect the functioning of children (sullivan v. zebley, 493 u.s. 521, 1990) ; and (3) a major effort by ssa to identify potential child recipients in the late 1980s and the early 1990s, partially under congressional mandate. the additional expenditures for these children (through the direct ssi cash benefit and the associated medicaid coverage) represent one of the largest new investments in child health and welfare in the united states. insofar as many children with chronic health conditions lack access to health insurance (fox and newacheck, 1990 ; newacheck., 1995), these new expenditures may have extended insurance coverage to many children who previously lacked it. nonetheless, this increasing investment has generated much media and congressional interest in the program (u.s. department of health and human services, 1995 ; u.s. general accounting office, 1994), along with allegations that children without major disabilities who receive benefits from other public programs, such as aid to families with dependent children (afdc), have overstated their disability status in order to qualify for ssi and increase their monthly cash benefit from relatively low afdc levels to higher ssi levels (woodward and weiser, 1994). congressional concern about program growth led to the formation of a national commission on childhood disability in 1995 and to the inclusion of major changes in ssi eligibility for children and adolescents as part of the changes in welfare enacted in 1996 (u.s., we examined whether the ssi expansions brought in a large number of new children to medicaid or whether the changes primarily extended cash benefits to children (mainly receiving afdc) who had previously received public health insurance. in addition, we determined whether children with certain types of disabilities were more or less likely to have had medicaid coverage prior to ssi enrollment. we predicted that more new ssi enrollees in later years would likely have had previous medicaid enrollment, because of both medicaid eligibility expansions unrelated to ssi and greater public awareness of the availability of the ssi benefit. we also expected that difficulties in access to health insurance for children with disabling conditions might have an opposite effect, with those new ssi enrollees who have more evidence of medical service need being less likely to have previous medicaid enrollment. determining whether large numbers of children received new access to health insurance could suggest that such benefits result in improved opportunities for medical management of their disabilities, especially with the growth of medicaid managed care. furthermore, providing better estimates of actual medicaid expenditures and determining whether these represent additional expenditures or ones that would have been engendered even without the ssi expansions helps medicaid programs to plan the design of their benefit packages for children and adolescents. answers to these questions will also help clarify how much of a shift from state to federal expenditures resulted from the growth in ssi enrollment. we examined medicaid enrollment files and claims data from 4 years (1989 - 92) for four states (california, georgia, michigan, and tennessee). these years included the key program policy changes already noted and allow examination of their effects on enrollment. these four states provide diversity with respect to medicaid program eligibility (use of optional eligibility categories), covered services (e.g., inpatient and outpatient mental health services), and income levels for public welfare assistance (and related non - ssi medicaid eligibility). on the other hand, the relatively larger enrollment (both ssi and medicaid) in california accounts for large proportions of the children studied here, and the aggregate sample therefore likely better represents larger and more urban states with relatively generous medicaid programs. state medicaid data came from the hcfa tape - to - tape project and were supplied by the main hcfa contractor (medstat group, santa barbara, california). available medicaid files included all paid claims (for physician services, hospital and outpatient department care, long - term care, drugs, and laboratory), as well as enrollment data that indicate the child 's basis for eligibility each month (ssi or other medicaid eligibility). previous claims and enrollment data were also available for new ssi recipients previously enrolled in medicaid, and we used these data to determine prior medicaid status. enrollment files also indicate the type of prior medicaid eligibility, which we categorized as afdc or other. most children in the other category include those eligible through medicaid expansions to increasingly older age categories in higher income groups (pear, 1988). it also includes a small number of medicaid medically needy children, where subtracting their expenditures for health services from household income brought them to financially eligible levels. this last category, although including households with children with high - cost disabilities, accounted for a very small percent (about 5 percent) of medicaid enrollees during the study years. study data elements also included the child 's age, sex, and race / ethnicity (categorized as white, black, other, and unknown). the initial sample included all ssi recipients, 021 years of age, during the 4 years in the four states. we used medicaid eligibility categories of blind or disabled to define ssi - eligible medicaid recipients. we examined new ssi enrollees by month and determined in each case whether a new enrollee had had medicaid coverage in any of the previous 6 months. insofar as many medicaid recipients have intermittent enrollment and might be missed when using only the previous month, we considered a child previously enrolled if he or she had medicaid coverage in any of the previous 6 months to capture intermittent episodes of enrollment. because we were unable to examine a full 6 months of previous medicaid enrollment for children prior to july 1989, our analyses include only children identified as new ssi enrollees on or after july 1989. similarly, we excluded children newly enrolled in ssi from july through december 1992, insofar as we used medical claims data for 6 months subsequent to first ssi enrollment to determine the presence of a chronic condition. we defined three time periods during the 4 years of study to distinguish the impacts of changes in program policy : july 1989 to june 1990 (prior to the changes in policy), july 1990 to june 1991 (transition), and july 1991 to june 1992 (post - policy changes). thus, these time periods allow examination of the effects of new mental health criteria and the zebley decision on ssi enrollment. we then calculated rates of previous medicaid enrollment by state for each time period to determine how these rates changed during the study. we next determined whether an ssi child had a chronic health condition that led to one or more medicaid claims at any time from july 1989 through december 1992. classification of conditions as chronic came from previously reported categorizations of international classification of disease, 9th revision (icd-9) codes (gortmaker, perrin,. this approach is conservative, insofar as a child might have a chronic health condition for which treatment was sought, but the claim might be labeled with another diagnosis or purpose for visit. for these determinations, we used diagnostic information from all inpatient, outpatient, emergency department, laboratory, and institutional claims. we used kaplan - meier life table methods and all available claims data for new ssi enrollees to estimate the proportion of children who would have had a chronic condition claim if the child had had ssi enrollment throughout the study years (cox and oakes, 1984). (children with fewer months of ssi enrollment will have less likelihood of having a claim for a chronic condition. the kaplan - meier approach permits estimation of likely results had the children been enrolled throughout all study years.) we categorized chronic conditions into three groups : chronic physical health conditions, mental retardation, and primary mental health conditions other than mental retardation, again using icd-9 codes. we determined the rates with which these condition groups were found among ssi enrollees with and without previous medicaid coverage during the periods prior to, during, and after the policy changes. we then used logistic regression models to determine whether children enrolling in ssi in later time periods or with a claim for a chronic health condition were more likely to have been covered by medicaid prior to ssi. during the 4-year study period, the number of new ssi enrollees in these states grew by approximately 112 percent (table 1). during this same period, approximately 45 percent of new ssi enrollees had had no medicaid coverage in the 6 months prior to ssi enrollment. this rate decreased from 53 percent across the four study states in 1989 to 39 percent by 1992 (figure 1). table 2 indicates demographic characteristics of ssi children and adolescents in the study states in 1989 and 1992. although the ssi group includes more older children (consistent with a later onset of disabling conditions), over the 4-year period, the age distribution changed, with increasing numbers of preschool children enrolled. as in most samples of children with disabilities, the ssi group had a preponderance of males. among the more common chronic conditions identified by means of analyses of medicaid claims for these children receiving ssi are cerebral palsy, epilepsy, mental retardation, asthma, spina bifida, hydrocephalus, and psychotic disorders (table 3). the major changes in ssi policy for children and adolescents led to large numbers of new enrollees, many without previous medicaid coverage. using the life table approach previously described for analyzing medicaid claims, approximately 51 percent of these new ssi enrollees would have had a claim for an identified chronic health condition visit or service identified in the medicaid files if they had been eligible for the full 3 years. these data show substantially higher rates of claims for chronic conditions among children who had had previous medicaid coverage (table 4). children and adolescents in california without previous medicaid coverage were slightly less likely than their counterparts in the other states to have claims for any chronic condition. most claims were for chronic physical conditions, with few claims for mental retardation or other mental health conditions (and especially few among the new ssi enrollees who had no previous medicaid coverage). these low rates of claims with mental health or retardation diagnoses could indicate that the ssi population actually has low rates of these conditions, although it is far more likely that a medical claims approach rarely identifies these conditions. children with mental retardation and no related physical conditions use relatively few medical services, especially ones that would carry a label of mental retardation. similarly, medicaid coverage of both inpatient and outpatient mental health services limits the use of such services by children with other mental health conditions and thus the likelihood of finding a mental health claim through our procedures. results of the logistic regressions (table 5) indicate that, after controlling for age, sex, and race / ethnicity, children who enrolled after implementation of the ssi policy changes were substantially more likely to have had medicaid coverage previously than were children enrolled prior to these changes. children with medical visits for chronic health conditions were also more likely to have been covered by medicaid prior to their ssi enrollment. (the low rates of claims for mental health and mental retardation diagnoses did not permit further analysis by type of chronic condition.) we ran similar analyses for children with and without any medicaid claims and found no significant differences in these results. almost one - half of the new ssi enrollees in the study states were not previously enrolled in medicaid. many children in these states who had had no previous public health insurance therefore received it as a result of their ssi eligibility. the likelihood that children had previous medicaid enrollment increased during the 4 years of study, although even by 1992, more than one - third of new enrollees had no prior public health insurance. the findings indicate that increasing numbers of families who had previous medicaid coverage for their children with disability through afdc or other eligibility obtained coverage through ssi. our data, however, provide no direct evidence concerning the mechanisms by which welfare recipients or other medicaid households were able to transfer their children with disability from non - ssi medicaid to ssi. the findings of increased previous medicaid enrollment after the policy changes could reflect efforts of states to transfer some afdc recipients to ssi rolls as a way of shifting some state costs to the federal government. states participate in paying for welfare benefits, but ssi payments are paid by the federal government (except for state supplements to the federal cash payments). the afdc savings to states represent the marginal increase to the family benefit for that child ; these savings may be offset by supplements to the federal ssi cash benefit, which most states provide. for example, in 1994, for a household with two children receiving afdc, tennessee would have saved $ 30 per month in state afdc costs by moving the second child from afdc to ssi. california would have experienced a net cost increase of $ 28 per month because california (unlike tennessee) supplements the federal ssi cash benefit. for households, however, the financial advantage of ssi over afdc can be substantial, representing a severalfold increase in the cash benefit. increased enrollment could also reflect greater awareness among hospitals, community and parent groups, and local agencies (such as early intervention programs) of the new ssi rules and among families heightened awareness of the program in general. as hospitals and other agencies developed more knowledge of these programs, they would be more likely to refer children with chronic health problems to ssi, especially those not otherwise covered by medicaid. ssa, through its child - find programs, also worked actively to enroll children with disabilities during these years. increased enrollment of children with identified chronic health conditions could also reflect expected changes after the zebley decision, which allowed children with multiple physical conditions easier access to the ssi program. income - eligibility requirements for ssi and non - ssi medicaid (whether from afdc or other sources) have long differed, with children in households with incomes up to almost 185 percent of the poverty level eligible for ssi. increasing numbers of children, however, became eligible for non - ssi medicaid through changing economic eligibility standards during the study period, unrelated to the changes in ssi eligibility. these changing standards particularly affected children 6 - 9 years of age in households with incomes up to 100 percent of the poverty level. enrollment of these children newly eligible from broader income categories has markedly lagged behind their eligibility, with estimates of only about one - third actually enrolling in medicaid. some of the growth in previous medicaid enrollment among the later ssi enrollees presumably reflects these medicaid expansions covering more non - afdc children, at higher ages and higher family incomes. these households too would have financial incentives to enroll their children in ssi where possible, insofar as their non - ssi medicaid coverage carried no associated cash benefit. data from ssa indicate greater increases in numbers of children with mental health conditions than with other chronic conditions during the study period. during the 1989 - 94 period, where the total numbers of child and adolescent recipients increased fourfold, the numbers with a primary diagnosis (for ssi eligibility) of a mental health condition other than mental retardation increased eightfold (social security administration, 1990b, 1995). nevertheless, these medicaid data suggest that most children receiving ssi have chronic physical conditions ; these data also provide little information regarding transfer from afdc or other medicaid eligibility groups to ssi of children with mental retardation or mental health conditions. as already indicated, the low rates of children identified with mental retardation or other mental health conditions likely reflect limitations in the use of medical claims data for these populations. mental retardation usually does not lead to a specific medical claim with that diagnosis, so this category may be particularly under - represented in medicaid data. many services for this population come from the education system, typically resulting in few if any medicaid claims. furthermore, medicaid limits on mental health benefits and on payment of non - mental health providers for these services decrease the likelihood of identifying these conditions in medicaid claims files. similarly, ssa data may overestimate the numbers of children with mental health conditions, insofar as the disability determination process tends to code the diagnosis for which it is easiest for the child to get benefits. the finding that almost one - half of new ssi enrollees had no previous medicaid coverage suggests that about 320,000 children and adolescents with disabilities nationwide obtained new public health insurance during the 5 years following recent policy changes (44 percent of the total increase in enrollment since 1989). the ssi program thus appears to be an important source of health insurance for many children and adolescents with disabilities. whether our data can be extrapolated nationally, however, can not be determined, insofar as the states demonstrated major variations, and our sample included none of the so - called 209b states, which (unlike most states) do not provide automatic access to medicaid as a consequence of ssi enrollment. california, for example, has had a large afdc program, making it more likely that ssi children there would have had medicaid coverage prior to ssi. the findings also indicate that a substantial proportion of current medicaid expenditures for this population would have occurred even without the expansion of the ssi program. the higher rates of medical visits for chronic conditions (which typically engender high medical costs) among ssi enrollees who previously had medicaid also support this notion. current estimates of yearly medicaid expenditures for the child and adolescent ssi populations are approximately $ 4 billion. thus, assuming that about 45 percent of new ssi enrollees were also new to medicaid, approximately $ 1.75 billion represents medical expenditures that resulted specifically from the recent expansions of the child and adolescent program. how the recent welfare changes will affect the ssi program and these findings is unclear. as of december 1997, more than 100,000 children and adolescents had lost their ssi benefits, although the 1997 balanced budget agreement specifically required that these children retain their medicaid benefits even if no longer eligible for ssi. furthermore, the social security commissioner announced in late december 1997 that concerns regarding the disability determination process would lead to a review of many of these recently denied child and adolescent cases. in general, reducing access of vulnerable populations to health care saves program dollars but may have unintended adverse outcomes, often costing more than the savings realized. these vulnerable populations of children commonly face both chronic illness and poverty, and financial barriers to health care may particularly affect their health status, growth, and development (newacheck. almost one - half of the new ssi enrollees in the study states were not previously enrolled in medicaid. many children in these states who had had no previous public health insurance therefore received it as a result of their ssi eligibility. the likelihood that children had previous medicaid enrollment increased during the 4 years of study, although even by 1992, more than one - third of new enrollees had no prior public health insurance. the findings indicate that increasing numbers of families who had previous medicaid coverage for their children with disability through afdc or other eligibility obtained coverage through ssi. our data, however, provide no direct evidence concerning the mechanisms by which welfare recipients or other medicaid households were able to transfer their children with disability from non - ssi medicaid to ssi. the findings of increased previous medicaid enrollment after the policy changes could reflect efforts of states to transfer some afdc recipients to ssi rolls as a way of shifting some state costs to the federal government. states participate in paying for welfare benefits, but ssi payments are paid by the federal government (except for state supplements to the federal cash payments). the afdc savings to states represent the marginal increase to the family benefit for that child ; these savings may be offset by supplements to the federal ssi cash benefit, which most states provide. for example, in 1994, for a household with two children receiving afdc, tennessee would have saved $ 30 per month in state afdc costs by moving the second child from afdc to ssi. california would have experienced a net cost increase of $ 28 per month because california (unlike tennessee) supplements the federal ssi cash benefit. for households, however, the financial advantage of ssi over afdc can be substantial, representing a severalfold increase in the cash benefit. increased enrollment could also reflect greater awareness among hospitals, community and parent groups, and local agencies (such as early intervention programs) of the new ssi rules and among families heightened awareness of the program in general. as hospitals and other agencies developed more knowledge of these programs, they would be more likely to refer children with chronic health problems to ssi, especially those not otherwise covered by medicaid. ssa, through its child - find programs, also worked actively to enroll children with disabilities during these years. increased enrollment of children with identified chronic health conditions could also reflect expected changes after the zebley decision, which allowed children with multiple physical conditions easier access to the ssi program. income - eligibility requirements for ssi and non - ssi medicaid (whether from afdc or other sources) have long differed, with children in households with incomes up to almost 185 percent of the poverty level eligible for ssi. increasing numbers of children, however, became eligible for non - ssi medicaid through changing economic eligibility standards during the study period, unrelated to the changes in ssi eligibility. these changing standards particularly affected children 6 - 9 years of age in households with incomes up to 100 percent of the poverty level. enrollment of these children newly eligible from broader income categories has markedly lagged behind their eligibility, with estimates of only about one - third actually enrolling in medicaid. some of the growth in previous medicaid enrollment among the later ssi enrollees presumably reflects these medicaid expansions covering more non - afdc children, at higher ages and higher family incomes. these households too would have financial incentives to enroll their children in ssi where possible, insofar as their non - ssi medicaid coverage carried no associated cash benefit. data from ssa indicate greater increases in numbers of children with mental health conditions than with other chronic conditions during the study period. during the 1989 - 94 period, where the total numbers of child and adolescent recipients increased fourfold, the numbers with a primary diagnosis (for ssi eligibility) of a mental health condition other than mental retardation increased eightfold (social security administration, 1990b, 1995). nevertheless, these medicaid data suggest that most children receiving ssi have chronic physical conditions ; these data also provide little information regarding transfer from afdc or other medicaid eligibility groups to ssi of children with mental retardation or mental health conditions. as already indicated, the low rates of children identified with mental retardation or other mental health conditions likely reflect limitations in the use of medical claims data for these populations. mental retardation usually does not lead to a specific medical claim with that diagnosis, so this category may be particularly under - represented in medicaid data. many services for this population come from the education system, typically resulting in few if any medicaid claims. furthermore, medicaid limits on mental health benefits and on payment of non - mental health providers for these services decrease the likelihood of identifying these conditions in medicaid claims files. similarly, ssa data may overestimate the numbers of children with mental health conditions, insofar as the disability determination process tends to code the diagnosis for which it is easiest for the child to get benefits. the finding that almost one - half of new ssi enrollees had no previous medicaid coverage suggests that about 320,000 children and adolescents with disabilities nationwide obtained new public health insurance during the 5 years following recent policy changes (44 percent of the total increase in enrollment since 1989). the ssi program thus appears to be an important source of health insurance for many children and adolescents with disabilities. whether our data can be extrapolated nationally, however, can not be determined, insofar as the states demonstrated major variations, and our sample included none of the so - called 209b states, which (unlike most states) do not provide automatic access to medicaid as a consequence of ssi enrollment. california, for example, has had a large afdc program, making it more likely that ssi children there would have had medicaid coverage prior to ssi. the findings also indicate that a substantial proportion of current medicaid expenditures for this population would have occurred even without the expansion of the ssi program. the higher rates of medical visits for chronic conditions (which typically engender high medical costs) among ssi enrollees who previously had medicaid also support this notion. current estimates of yearly medicaid expenditures for the child and adolescent ssi populations are approximately $ 4 billion. thus, assuming that about 45 percent of new ssi enrollees were also new to medicaid, approximately $ 1.75 billion represents medical expenditures that resulted specifically from the recent expansions of the child and adolescent program. how the recent welfare changes will affect the ssi program and these findings is unclear. as of december 1997, more than 100,000 children and adolescents had lost their ssi benefits, although the 1997 balanced budget agreement specifically required that these children retain their medicaid benefits even if no longer eligible for ssi. furthermore, the social security commissioner announced in late december 1997 that concerns regarding the disability determination process would lead to a review of many of these recently denied child and adolescent cases. in general, reducing access of vulnerable populations to health care saves program dollars but may have unintended adverse outcomes, often costing more than the savings realized. these vulnerable populations of children commonly face both chronic illness and poverty, and financial barriers to health care may particularly affect their health status, growth, and development (newacheck., 1994 ; perrin., 1994) | the supplemental security income (ssi) program for children and adolescents has experienced a fourfold enrollment growth since 1989. most ssi recipients also receive medicaid, and ssi growth could therefore lead to major new medicaid expenditures if new ssi recipients were not previous medicaid enrollees. using medicaid claims for 1989 - 92, we determined whether ssi expansions included many children new to medicaid as well as whether children with certain disabilities were more likely to have had medicaid prior to ssi enrollment. rates of new ssi enrollees without previous medicaid coverage decreased from 53 percent in 1989 to 39 percent by 1992. |
the incidence of infections due to extended - spectrum -lactamase (esbl)-producing bacteria has increased rapidly in recent years and poses a worldwide threat to health care. the close relationship between esbl production and multidrug resistance leaves only a few treatment options for infections commonly caused by enterobacteriaceae.1 patients with an infection caused by esbl - producing bacteria are at risk for therapeutic failure or even death because there is often a delay before the correct antibiotic treatment is given.2 in international comparisons, there have so far been only a few nosocomial outbreaks of plasmid - mediated esbl - producing bacteria in sweden.3,4 further, compared with other european countries, the prevalence of esbl in bacterial isolates from feces and blood has long been relatively low in sweden, found in less than 3% of escherichia coli, although this proportion is increasing.5,6 poor hand hygiene and lack of food hygiene facilitates the spread of esbl - producing enterobacteriaceae.710 known risk factors for colonization or onset of infection with esbl - producing enterobacteriaceae from different studies are antibiotic use, prolonged and/or recent hospital stay, severe illness, recent surgery, bladder catheterization or other invasive medical devices, residence in a long - term care facility, international travel, and age 65 years and older.1,4,1114 however, the positive predictive value of these risk factors is low.15 it is important to identify patients who are at risk for infection with esbl - producing bacteria, especially in low endemic countries, in order to reduce mortality, to avoid spread of resistant bacteria in hospitals, and to minimize the number of patients receiving unnecessary treatment with broad - spectrum antibiotics.2 the aim of this study was to perform a case - control survey of swedish patients to identify risk factors for developing an infection with esbl - producing e. coli in a low endemic country. we performed a case - control survey in the department of medical microbiology laboratory at skne university hospital, malm, sweden, that serves a population of about 470,000 people. we used a computerized database to identify patients with growth of esbl - producing e. coli in urine or blood cultures and an equal number of controls matched for age and gender with non - esbl - producing e. coli in urine and blood cultures diagnosed between january and october 2008. both groups were asked the same questions regarding risk factors, including stomach problems, urinary catheter, endoscopic procedures, recurrent urinary infections, medication for stomach ulcers, hospital stay, length of hospital stay, antibiotic consumption, comorbid conditions, occupation, visiting abroad, and finally, if the patient thought that they had received adequate information about esbl when infected (table 1). urine and blood samples were examined for e. coli using phenotyping tests according to national guidelines.16,17 the e. coli strains were screened for cephalosporin resistance using a cefadroxil disk. e. coli strains resistant to cefadroxil were analyzed for esbl production by inoculation on agar plates with medium selective for cephalosporin resistance (chromid esbl, biomerieux clinical diagnostics, marcy - ltoile, france) and synergy testing with discs containing ceftazidime, cefotaxime, and amoxicillin - clavulanic acid.16,18 statistical methods included analysis of a contingency table (fisher s exact test), odds ratios (or), and calculation of 95% confidence intervals (ci) for the parameters, computed using the method of clopper and pearson for binomial data and mann whitney using statistical power calculations, we concluded that a study population of just over 100 participants (including those who did not answer) should be enough to obtain significant results. the prevalence of risk factors was calculated as the percentage of risk factors among patients in each group. odds ratios and 95% ci were calculated to evaluate the strength of any association that emerged. an unadjusted p - value < 0.05 was considered to be statistically significant. analysis was performed using graph pad software (graph pad software, inc., la jolla, ca, usa) and the responses from the returned questionnaires were compiled in excel. ethical approval for the study was obtained from the research ethics committee at the university of lund. we performed a case - control survey in the department of medical microbiology laboratory at skne university hospital, malm, sweden, that serves a population of about 470,000 people. we used a computerized database to identify patients with growth of esbl - producing e. coli in urine or blood cultures and an equal number of controls matched for age and gender with non - esbl - producing e. coli in urine and blood cultures diagnosed between january and october 2008. both groups were asked the same questions regarding risk factors, including stomach problems, urinary catheter, endoscopic procedures, recurrent urinary infections, medication for stomach ulcers, hospital stay, length of hospital stay, antibiotic consumption, comorbid conditions, occupation, visiting abroad, and finally, if the patient thought that they had received adequate information about esbl when infected (table 1). urine and blood samples were examined for e. coli using phenotyping tests according to national guidelines.16,17 the e. coli strains were screened for cephalosporin resistance using a cefadroxil disk. e. coli strains resistant to cefadroxil were analyzed for esbl production by inoculation on agar plates with medium selective for cephalosporin resistance (chromid esbl, biomerieux clinical diagnostics, marcy - ltoile, france) and synergy testing with discs containing ceftazidime, cefotaxime, and amoxicillin - clavulanic acid.16,18 statistical methods included analysis of a contingency table (fisher s exact test), odds ratios (or), and calculation of 95% confidence intervals (ci) for the parameters, computed using the method of clopper and pearson for binomial data and mann whitney using statistical power calculations, we concluded that a study population of just over 100 participants (including those who did not answer) should be enough to obtain significant results. the prevalence of risk factors was calculated as the percentage of risk factors among patients in each group. odds ratios and 95% ci were calculated to evaluate the strength of any association that emerged. an unadjusted p - value < 0.05 was considered to be statistically significant. analysis was performed using graph pad software (graph pad software, inc., la jolla, ca, usa) and the responses from the returned questionnaires were compiled in excel. ethical approval for the study was obtained from the research ethics committee at the university of lund. during the study period, 109 patients of median age 65 (range 295) years suffering from urinary tract infection or bacteremia with esbl - producing e. coli and 109 controls of median age 65 (295) years, with non - esbl - producing e. coli in urine or blood were included. of these 218 patients, six had moved out from the county and five had died. no significant difference in response rates were seen between the groups, ie, 53% (n = 58) in the esbl group and 49% (n = 53) in the control group. the cases and controls who replied to the survey were well matched for age and gender (table 1). patients with esbl - producing e. coli had a significantly (p < 0.05) higher rate of travel to asia including turkey and the middle east including egypt (14/58) than the non - esbl - positive group (4/53). a hospital stay during the previous year (p < 0.04) and especially for more than one month (p = 0.01) was a risk factor for infection with esbl - producing e. coli (8/58). no patient in the esbl - negative group had stayed in hospital for more than one month. a stay in the surgical department was also a risk factor (p < 0.01). treatment with antibiotics in general during the previous year was more common (p = 0.09) and with quinolones in particular (p = 0.06) in cases than in controls. we could not find any other statistically significant differences between the groups regarding civil status, accommodation, comorbid conditions (including urinary tract problems), intubation, endoscopies, catheterization, medication other than antibiotics, relatives who had been abroad, or history of travelers diarrhea. in the esbl group, 34 of 58 (39%) thought that the information given by their physician about their esbl colonization was inadequate. in this case - control study, we found that travelling to countries in which esbl is high endemic, such as asia, the middle east, and turkey, was a significant risk factor (with an unadjusted p - value < 0.05) for contracting a urinary tract or bloodstream infection with esbl - producing e. coli. we also found that a hospital stay longer than one month and especially in a surgical ward could be a risk factor for acquiring esbl - producing e. coli infections. however, because many of these patients had also received antibiotic treatment with quinolones we could not determine if it was the hospital stay or the antibiotic treatment that was the cause for acquiring esbl - producing e. coli. however, in this explorative phase, it was more important to identify possible predictors than to rule out false ones. second, different e. coli strains could be influenced by different risk factors, but because this was a retrospective study and several isolates were not available for examination, we could not perform multilocus sequence typing or use polymerase chain reaction methods to investigate the molecular epidemiology of the different e. coli strains and we could not characterize the esbl enzymes. further, the matching criteria selected in this case - control study were age and gender, which could conceal age and gender as potentially significant risk factors. the results of this study correspond well with the results of other published studies reporting a high rate of fecal colonization of esbl - producing e. coli after international travel to countries outside europe, especially to the middle east and asian countries which have a much higher prevalence of esbl - producing enterobacteriaceae.1922 in a study from sweden, tngden showed a high rate of esbl - producing bacteria in fecal fora, mostly from patients having travelers diarrhea, who were cultured before and after international travel.13 in another study, we found a very high rate of esbl - producing e. coli in patients with travelers diarrhea who had traveled outside europe (36%) and especially to asia (41%) and the middle east (50%).12 notably, this is not the same as acquiring an infection caused by esbl - producing bacteria because they could be normal inhabitants of the gastrointestinal tract and could stay there as a subdominant population. laupland performed a case - control study published in 2008 which identified that foreign travel was an important risk factor for developing community - onset esbl - producing e. coli infections in calgary, canada, especially if patients had travelled to india or to the middle east.23 our results from this swedish case - control study match the results reported by laupland, ie, the acquisition of esbl - producing bacteria is also a risk for becoming infected with these bacteria. like lautenbach, we also found that a long hospital stay could be a significant risk factor for infection with esbl - producing bacteria, but we could not determine if the patients had acquired the esbl - producing e. coli during their hospital stay.24 a possibility is that the patients had been unrecognized carriers before admission to hospital and due to selective pressure (antibiotic consumption), esbl - producing e. coli had appeared. in another study, we investigated the prevalence of esbl - producing bacteria in hospitalized patients and patients from primary health care centers in 2008 and 2010. the prevalence of esbl - producing bacteria increased in both groups during the study period, but we did not notice any hospital spread or outbreaks during this time, indicating that the patients had acquired their esbl - producing e. coli in the community.5 having invasive medical devices was not a risk factor in our study, but this could be of more importance in patients with esbl - producing klebsiella species than in esbl - producing e. coli.25 to prescribe correct empiric antibiotic treatment in patients with severe septicemia / septic shock is of great importance for survival.2,26 in this study, we would have identified 22 of 58 (38%) patients with esbl - producing e. coli if we had considered the significant risk factors that we found in our study before giving antibiotics. however, the majority of patients with esbl - producing e. coli would not have been detected if only addressing these risk factors. only a few patients in our study, ie, four of 53 (8%), with non - esbl - producing e. coli would have received an unnecessary broad - spectrum antibiotic. a long stay in hospital (for more than one month) or asking the patient about international travel to the middle east or asia are important factors to consider when predicting if a patient would be at risk of having an infection with esbl - producing e. coli or not. rapid microbiologic diagnostic tests and high clinical suspicion with careful evaluation are currently the only instruments we have to identify these patients. disciplined antibiotic stewardship, adherence with hand hygiene routines, and infection control methods in hospitals are vital. the incidence of esbl - producing bacteria in hospitals should be carefully monitored in the future and patients with esbl - producing bacteria should receive better information. | backgroundit is important to identify patients who are at risk for infections with extended - spectrum -lactamase (esbl)-producing bacteria in order to reduce mortality, to avoid spread of resistant bacteria in hospitals, and to minimize the number of patients receiving unnecessary treatment with broad - spectrum antibiotics. a case - control survey among swedish patients was performed at skne university hospital to identify risk factors for developing an infection with esbl - producing escherichia coli in a low endemic country.methodswe used a computerized database to identify patients with growth of esbl - producing e. coli (n = 109) in urine or blood cultures and an equal number of controls matched for age and gender with non esbl - producing e. coli in urine and blood diagnosed between january and october 2008. we used unadjusted p-values.resultspatients with esbl - producing e. coli had a significantly (p < 0.05) higher likelihood of having traveled to asia including turkey and the middle east including egypt (14/58) than the non - esbl - positive group (4/53). hospital stay during the previous year (p < 0.04), especially for more than one month, was another significant (p = 0.01) risk factor for infection with esbl - producing e. coli (8/58). a stay in the surgical department was a further risk factor (p < 0.01).conclusionin this study, we identified 22 of 58 (38%) patients with esbl - producing e. coli by considered significant risk factors before starting antibiotics. |
for 40 years, the use of osseointegrated implants has shown to be a supplementary modality for treating full or partial edentulism. since the early 1990s, providing shorter treatment periods to patients has become a major focus first via the one - stage surgical technique and then through the immediate loading protocol. delivering a fixed prosthesis on the same day of the last extractions supported by immediate implants has quickly become a major challenge. patients can therefore never be left without teeth and the treatment length is ultimately shortened. these protocols provide multiple benefits : (1) only one surgical session, (2) immediate loading of a temporary prosthesis allowing for a reduction of the patient 's discomfort and facilitating his return to social and professional life, (3) avoiding the resorption of hard tissues, the two - thirds of this reduction occurring during the first 3 months, (4) guiding the soft tissue healing for an optimal aesthetic environment and minimal recession, and (5) taking advantage of the extraction socket healing potential. nevertheless, if treatments by immediate implants associated with deferred loading have a long clinical history and offer good results, low scientific evidence exists for their combination with immediate function. 2001 obtained success rates of 80% and 82.4%, respectively, for immediately loaded implants in postextraction sites. 2002 as well as by grunder 2001 with survival rates of 100% and 97.3%, respectively, for similar protocols in the mandible. 2009 that in spite of achieving predictable osteointegration when implants were placed in fresh extraction sockets, the occurrence of buccal bone resorption may limit the use of this surgical approach. more recently, villa and rangert 2005 reported a 100% success rate for the treatment of 20 patients with 97 implants placed in postextraction sites and combined with early function. they demonstrated that, with an appropriate biomechanical, surgical, and medical protocol considering preservation of high implant stability and controlled inflammatory response, implants may be successfully osseointegrated when immediately placed and early - loaded in postextraction sites. moreover, the few studies available on immediate implants in postextraction sites supporting immediate full - arch rehabilitation are focused on the surgical part of the procedure and clearly lacked comprehensive prosthetic protocols whereas the nobelguide concept (nobelbiocare ab) presents a step by step treatment procedure that is known to be meticulous and successful. the purpose of this study is to evaluate the effectiveness of a protocol combining a computed tomographic scan - derived surgical template with an immediate implant placement in postextraction sites together with immediate temporization and loading. in this prospective case series study, clinical and radiological data analysis were carried out over a two and half years period, on a total of 14 consecutively treated subjects (mean age 58.14 years) to be restored with fixed full arches prosthesis : 6 women and 8 men were treated via immediate implantation combined to cad - cam technology (nobelguide, nobelbiocare ab). the authors defined the following inclusion criteria in patient selection : noncontributory medical history such as uncontrolled diabetes, and osteoporosis.adequate bone volume and density for conventional dental implant placement as determined by cbct without the need for bone or soft - tissue grafts, patients requiring clearance of all remaining maxillary teeth, no infected sockets. adequate bone volume and density for conventional dental implant placement as determined by cbct without the need for bone or soft - tissue grafts, patients requiring clearance of all remaining maxillary teeth, consider the following : heavy smokers and/or confirmed bruxing subjects, the total or partial lack of the above 4 inclusion criteria.during preliminary evaluation, medical history and subjects ' consent were collected. a total of 99 implants with external hexagon (nobelspeedy and nobelbiocare ab) and oxidized surface (ti - unite groovy and nobelbiocare ab) were inserted and loaded immediately after surgery via previously manufactured lab - made prosthesis (table 1). all surgeries were performed by one clinician and procedures were preplanned according to the collected data. outcome measures were prosthesis and implant success, biologic and prosthetic complications, pain, oedema, and radiographic marginal bone levels evaluation at surgery and then at 6, 12, 18, and 24 months. heavy smokers and/or confirmed bruxing subjects, the total or partial lack of the above 4 inclusion criteria. impressions were made as for conventional partial removable denture, followed by intermaxillary relation registration. a trial denture was fabricated, tried in subject 's mouth to validate the accuracy of the interarch relationship, and then processed to obtain a radiographic template according to the nobelguide protocol (e.g., with at least 6 radiographic markers) (figure 1). a first cone beam computed tomography (cbct) ridge (shape and volume) were regularized according to both the clinical findings and the cbct findings (figure 2). two parameters were of particular consideration, the data collected during the periodontal examination and the prosthetic needs. the clinical findings included the probing depth, initial radiographic survey, and the preliminary planning following the first cbct. in case of reduced prosthetic space, an additional osteotomy was performed but with caution, as resorption inevitably follows any surgical procedure. still, a subcrestal leveling of the implants at the planning phase was programmed with implant platform positioned 2 mm under the coronal part of the vestibular alveolar crest. teeth that have been removed on the modified master model were replaced with denture teeth. the radiographic template was also altered so to be used for a second cbct (e.g., scanning of the prosthesis itself) without any modification of the radiographic markers ' position. finally, subject 's data and prosthesis data were loaded into the procera software (proceracaddesign, nobelbiocare ab) and a high resolution 3d model was then created. however, it seemed to be more effective with this immediate implants procedure (figure 3) for the following reasons : (1) implant 's length and diameter were easier to choose to assure enough primary bone anchorage, (2) remaining bone areas could be used more effectively, and (3) implant positioning was made according to the prosthetic project which was perhaps the most difficult objective to fulfill in such procedures. otherwise, the implant placement would be more dependent on the remaining bone volume than on the prosthetic project and the procedure a hands - free one. the surgical template was ordered and data were also used to prepare a master model that allows for the fabrication of an all - acrylic resin fixed prosthesis (figure 4) before the surgical session. the surgical procedure was performed under local anesthesia with articaine chlorhydrate containing epinephrine 1 : 100,000 (alpha spe, dentsply). all subjects were sedated with diazepam (valium 10 mg, roche, basel, switzerland). antibiotics amoxicillin 875 mg and clavulanic acid 125 mg (augmentin 2 g, glaxo smith kline) were given 1 hour prior to surgery and daily for 6 days thereafter. corticoids (solupred 60 mg, sanofi aventis) were administered daily from the day of surgery until 4 days postoperatively. analgesics, 500 mg mefenamic acid (ponstan forte, wilton parkhouse, wilton place, dublin 2, ireland), were given on the day of surgery and postoperatively for the first 4 days if needed. three stages were followed in the procedure (figure 5).as with immediate complete denture cases, the remaining teeth were extracted, followed by osteotomy and/or soft tissue management when needed. this regularization allowed for correct repositioning of the soft tissues close to the conditions of an edentulous ridge. it was reported from the master cast to the mouth via a transparent replica of the surgical stereolithographic guide (nobelguide), fabricated in occlusion. once made, these corrections secured an exact repositioning of the stereographic guide on the ridge.positioning of the surgical template in the correct interarch relationship. the difficulties of repositioning the vestibular flap were countered by a strict positioning of the surgical guide(s) in the correct interarch relation for a precise transfer of the surgical planning.implant placement per se. as with immediate complete denture cases, the remaining teeth were extracted, followed by osteotomy and/or soft tissue management when needed. this regularization allowed for correct repositioning of the soft tissues close to the conditions of an edentulous ridge. it was reported from the master cast to the mouth via a transparent replica of the surgical stereolithographic guide (nobelguide), fabricated in occlusion. once made, these corrections secured an exact repositioning of the stereographic guide on the ridge. the difficulties of repositioning the vestibular flap were countered by a strict positioning of the surgical guide(s) in the correct interarch relation for a precise transfer of the surgical planning. expandable abutments (guided abutments, nobelbiocare ab) were mounted in the provisional restoration. the bridge was then positioned over the implants and screw - retained by manual tightening. the correct centric relation was verified and minor occlusal adjustments were performed when needed (figure 6). the subjects were enrolled in an implant maintenance program (table 2) and a soft diet was instructed for 2 months. after 4 months, the prostheses were removed and the implants were individually tested for stability. if the implants were judged stable, the definitive fixed prosthesis was made as follows : two ceramic restorations (procera implant bridge zirconia, nobel biocare ab), seven metal - ceramic restorations, and fife hybrid prostheses (figure 7). subjects were examined at 1 week and at 1, 3, 6, and 12 months after the surgery. examination included the assessment of prosthesis stability, peri - implant soft - tissue conditions, correct occlusion, and individual implant stability with the prosthesis removed at the 4-month follow - up. to be classified as surviving, the implants were required to fulfill the following criteria : clinical stability, subject reported function without any discomfort, absence of suppuration, infection, or radiolucent areas around the implants. periapical radiographs (figure 8) were made at implant insertion and then at 6-month intervals. the film was oriented with a conventional radiograph holder (rinn xcp, dentsply rinn), manually positioned for an estimated orthogonal position of the film. marginal bone remodeling was calculated as the difference between readings at the examination and the baseline value at time of surgery. the radiographs were grouped as follows : implant insertion, 6 months, 1-year follow - up, 1-year and half follow - up, and 2-year follow - up. two implants in two different subjects were lost after 4 months at time of substituting the provisional restorations with the permanent ones : one implant in the first molar position in one heavy bruxing subject and the other in the second premolar position and that already was not stable at the time of placement. slight oedema was recorded for 11 subjects and moderate or severe oedema for the remaining three. one of them practically did not follow the instructions of soft food diet in the first few months. the handling of these problems necessitated the repair of the prostheses, adjustment of occlusion, and night guard fabrication. the radiographic assessment of marginal bone level concerning the 66 implants available at the end of the 2-year follow - up period showed a mean marginal bone loss of approximately 0,9 mm. immediate implant placement in fresh extraction sockets has been investigated in several clinical studies, showing clear scientific evidence that osseointegration may be successfully achieved [11, 15 ]. later, the growing need for avoiding temporary removable prostheses after surgery led to considering immediate loading of implants inserted in fresh extraction sockets, even in the chronically infected alveolar bone. however, the few studies available on immediate implants in postextraction sites supporting immediate full - arch rehabilitation show lack of homogeneity and comprehensive protocols. the number of studies investigating the clinical and radiological outcome of guided implant placement seems to confirm the high predictability of 3d planning software and indicate that immediate loading of oral implants yield acceptable to excellent results in full arch prosthetic restorations. this preliminary study clearly demonstrates the high precision of transferring the virtual planning to the surgical field via the computer - aided technology even with extractions performed in the same surgical session. as in any extraction / implantation procedure, the presence of enough supra - alveolar bone is crucial for the primary stability of the fixture. the benefits provided by computer - based planning seem to be superior with immediate implants cases in postextraction sites. even without the use of the surgical template, there is a better match between the planned and the used implant when planning is done in a three - dimensional mode [1820 ]. the preoperative choice of correct implant length and diameter can provide good primary stability through maximum filling of the extraction sockets and optimal engagement of the extra - apical alveolar bone. while no axial instability of any of the implants was observed, the insertion of some of the implants blocked at couples inferior to the recommended 35 ncm. no adverse consequences were seen as these implants were connected to the others via a passive prosthesis. knowing that primary stability measurements show significant correlations with different bone densities [2123 ], the lesser density in the edentulous posterior regions could explain the encountered problems of stability, in opposition to the extraction sites where it was possible to engage in the nasal cortical bone. (1) the remaining bone volume is used with more efficiency and predictability, (2) implant placement is made according to the prosthetic plan, and (3) the immediate cross - arch splinting of the freshly installed implant, another key factor for success [18, 19, 2426 ], is easily obtained via the prefabricated prosthesis [27, 28 ]. the changes in marginal bone level were similar to those observed in the studies of ganeles and wismeijer in 2004 and glauser. in 2005 on immediate loading and of sanna. in 2007 on immediate loading and flapless surgery. it can therefore be concluded that the applied protocol may improve the results of such prosthetic treatments renowned to be complex and unpredictable. it also offers a more adequate biomechanical environment for the implants, one that is prosthetically driven. however, the successful use of this approach requires advanced clinical experience, surgical judgment, and proper case selection. further studies with larger sample size, including control groups (full - arch immediate implant rehabilitations with delayed healing or with the absence of extraction sockets), are necessary to confirm the suggested protocol. within the limitations of this study, combining a computed tomographic scan - derived surgical template to an immediate implant placement in postextraction sites together with immediate temporization and loading seems to be a predictable therapy, with high survival rate at 2-year period and valid functional and aesthetic results when applied in selected cases. the applied protocol provides a safer procedure for both surgeon and patient and may become the gold standard for such treatments. more clinical trials and follow - up studies are necessary before final conclusions can be drawn in relation to the long - term safety and efficacy of this proposed protocol. | statement of problem. low scientific evidence is identified in the literature for combining implant placement in fresh extraction sockets with immediate function. moreover, the few studies available on immediate implants in postextraction sites supporting immediate full - arch rehabilitation clearly lack comprehensive protocols. purpose. the purpose of this study is to report outcomes of a comprehensive protocol using cad - cam technology for surgical planning and fabrication of a surgical template and to demonstrate that immediate function can be easily performed with immediate implants in postextraction sites supporting full - arch rehabilitation. material and methods. 14 subjects were consecutively rehabilitated (13 maxillae and 1 mandible) with 99 implants supporting full - arch fixed prostheses followed between 6 and 24 months (mean of 16 months). outcome measures were prosthesis and implant success, biologic and prosthetic complications, pain, oedema evaluation, and radiographic marginal bone levels at surgery and then at 6, 12, 18, and 24 months. data were analyzed with descriptive statistics. results. the overall cumulative implant survival rate at mean follow - up time of 16 months was 97.97%. the average marginal bone loss was 0,9 mm. conclusions. within the limitations of this study, the results validate this treatment modality for full - arch rehabilitations with predictable outcomes and high survival rate after 2 years. |
ossification of the posterior longitudinal ligament (opll), a result of heterotopic ossification, can induce spinal canal stenosis and lead to the development of severe myelopathy. there have been numerous studies of surgical techniques or clinical outcomes for opll of the cervical spine.1 in contrast, there are only a few reports regarding opll of the lumbar spine, and its clinical characteristics have not yet been well established because the number of patients who require surgical treatment is quite low.2 to our knowledge, there has been only six reports of surgically treated lumbar opll published in english.7 according to the data in the database for the spinal injuries center in fukuoka, japan, during the past 27 years, although 6,192 patients underwent operations for degenerative lumbar spine diseases, only ten underwent surgery for lumbar opll.2 thus, the frequency of lumbar opll requiring surgical treatment was remarkably low, indicating a lack of awareness of the disease even among orthopedic surgeons. we have recently witnessed that radiculopathy due to lumbar opll was found to be the cause of chronic right lower abdominal pain in a japanese man.8 after encountering this unusual case, we thought that lumbar opll should be considered to be a factor for not only orthopedic symptoms but also abdominal symptoms. because abdominal symptoms are common in the primary care setting,9 we tried to clarify the incidence of lumbar opll in an outpatient clinic in japan where primary care physicians are working. we analyzed consecutive outpatients making their first visit to the department of general medicine, asahikawa medical university hospital, between april 2009 and march 2012. as we have recently demonstrated,913 the hospital consists of 602 beds in which approximately 250 doctors are working to address almost all medical problems. among them, four or five primary care physicians are working in the department of general medicine. during the period, we analyzed the patients (n = 393) who received abdominal and pelvic computed tomography (ct) scan to clarify their several problems such as abdominal symptoms, origins of fever, high level of tumor markers, and so on. since it has been widely established that ct is a useful tool for detecting and accurately locating opll,14 lumbar opll was diagnosed by the ct scan according to a previous report.2 all data were drawn from medical records and the computerized physician order entry system in the hospital. each parameter such as age, sex, body mass index (bmi), and clinical presentation was investigated from the source. analyzed comorbid conditions included diabetes mellitus, systemic hypertension, dyslipidemia, and cigarette smoking. statistical analysis was performed by fisher s exact test, and student s t - test for age and bmi. a level of p < 0.05 was considered to be statistically significant. statistical analysis was performed by fisher s exact test, and student s t - test for age and bmi. a level of p < 0.05 was considered to be statistically significant. lumbar opll was diagnosed by ct according to a previous report.2 representative images are shown in figure 1. as shown in this figure, opll was diagnosed when an apparent ossification of the ligament causing more than 10% canal stenosis was revealed with ct. out of 393 patients who underwent abdominal and pelvic ct scan, 33 (8.4%) were diagnosed with lumbar opll. all 33 patients diagnosed with lumbar opll detected by ct scan did not complain of main symptoms related to spinal stenosis, such as intermittent claudication. table 1 shows the clinical characteristics of 33 patients with lumbar opll in this study. when compared with patients without lumbar opll (n = 360), there was no significant difference in gender, bmi, presence of hypertension, diabetes mellitus or hyperlipidemia, and smoking habit, while a significant difference was identified in age in patients with lumbar opll. as clearly demonstrated in table 2, the incidence of lumbar opll increased in the elderly. the highest incidence was observed in male patients aged 5069 years and female patients aged 7089 years. among 33 opll patients, seven patients complained of lower abdominal pain as their chief complaint. in the unique case mentioned earlier, the patient s pain was considered to be dependent on lumbar opll as reported in our recent publication;8 in another case, advanced colon cancer was considered to be the cause of abdominal pain. in the remaining five cases, the pain was diagnosed as functional gastrointestinal disorders after careful examination, but we could not completely exclude the possibility that the abdominal pain in the five patients was related to lumbar opll., lumbar opll might be involved in the symptom, and was followed by consultation with the department of orthopedic surgery in our hospital. opll is more common in east asian populations, particularly in the japanese;15 the prevalence of opll is highest in japan, at a rate of 1.9%4.3%.16 although a number of authors have reported on opll of the cervical spine, few have discussed opll of the lumber spine.7 the number of reports regarding lumbar opll has been limited, and its prevalence and regional difference remain unclear. a lack of evidence may be a result of a large majority of lumbar opll possibly being asymptomatic, as described below. clinical presentations in patients with opll correspond to the level and magnitude of spinal cord compression. cervical and thoracic opll typically manifests with signs and symptoms of myelopathy, while the lumbar disease usually manifests with signs and symptoms related to spinal stenosis.3,17,18 matsunaga have demonstrated that after 30 years, myelopathy - free rates as high as 71% have been reported among patients who had no myelopathy when the cervical opll was first diagnosed. although we do not have any evidence that the time - course changes in lumbar opll are similar to cervical opll, these results led us to speculate that a large majority of lumbar opll patients are asymptomatic. in fact, all patients with lumbar opll detected in this study did not complain of spinal stenosis - mediated symptoms as described above. we do not know at this moment whether lumbar opll is indeed rare in the general population, or whether physicians are not aware of the presence of lumbar opll. in the present study, out of 393 patients who underwent abdominal and pelvic ct scans, 33 (8.4%) were diagnosed as lumbar opll, indicating for the first time the incidence of lumbar opll in japan. according to previous data, the prevalence of cervical and thoracic opll in japanese and east asian countries has ranged from 1.9%4.3%.15 these results suggest that the frequency of lumbar opll is not much lower than that of cervical and thoracic opll.1 kobashi have demonstrated a higher frequency of diabetes mellitus among japanese men and women with opll,19 suggesting that diabetes mellitus may play a role in the development of opll. the present results demonstrated that there was no relationship between the presence of diabetes mellitus and lumbar opll. the discrepancy may be due to the difference in pathophysiology between cervical and lumbar opll. because of a lack of evidence whether pathogenesis is common in patients with cervical and lumbar opll, further studies on this issue are needed. the present study also showed a lack of association of hypertension, hyperlipidemia, and bmi with lumbar opll. the present study clearly demonstrated for the first time that lumbar opll is highly identified in elderly people. based on these findings, we should pay special attention in elderly patients and work to determine whether they may have lumbar opll. although the presence of lumbar opll by itself does not necessarily mean a clinical problem, we should keep in mind that lumbar opll is possibly involved in not only spinal stenosis - mediated symptoms, but also radiculopathy - related symptoms seen in the primary care setting, such as abdominal pain.8 | purposelittle is known about the prevalence and epidemiological characteristics of lumbar ossification of the posterior longitudinal ligament (opll). we analyzed the rate of lumbar opll in an outpatient unit where primary care physicians are working in japan, to better understand the epidemiological characteristics of the disease.methodswe analyzed consecutive, first - time visiting outpatients who received abdominal and pelvic computed tomography (ct) scan at the department of general medicine, asahikawa medical university hospital, japan, between april 2009 and march 2012. each parameter such as age, sex, and clinical presentation was investigated.resultsout of 393 patients who underwent abdominal and pelvic ct scan, 33 (8.4%) were diagnosed as lumbar opll. when compared with patients without lumbar opll (n = 360), there was no significant difference in gender, body mass index (bmi), presence of hypertension, diabetes mellitus or hyperlipidemia, and smoking habit, while the age in patients with lumbar opll was significantly higher.conclusionthese results suggest for the first time that lumbar opll is frequently observed in elderly people in the primary care setting, in japan. |
primary cutaneous apocrine gland carcinoma, a subtype of sweat gland carcinoma, is an extremely rare malignant neoplasm [1, 2, 3 ]. most of these neoplasms involve the axilla, but lesions can also occur elsewhere on the skin. most often, they are indolent and slowly developing, but some are rapidly progressive and extremely aggressive [1, 4, 5, 6 ]. the treatment of choice is wide local excision with clear margins, with or without lymph node dissection [1, 3, 5, 7 ]. a 67-year - old man presented to our hospital with an ulcerated nodule in the right axilla measuring 1 0.8 cm. the nodule had been present for more than 3 years, but only grew in size over the past 6 months. bilateral breast examination, skin examination and complete lymph node survey were unremarkable. ultrasound examination and a mammogram revealed no significant lesions in either breast, consistent with the physical examination. microscopic examination revealed a well - to - moderately differentiated adenocarcinoma which contained ductal and glandular structures with obvious apocrine features. in addition, the cytoplasm of the tumour cells contained pas - positive diastase - resistant granules without iron - staining granules. the tumour tissue invaded the papillary and reticular dermis and ulcerated the epidermis without extension to the subcutaneous tissue (fig. 1, fig. the immunohistochemical study showed that the tumour cells were positive for ker7, ema and e - cadherin and negative for cea, sloop and psa. no oestrogen or progesterone receptors were detected, making the diagnosis of male breast cancer metastaticto the axilla unlikely (fig. cutaneous apocrine gland carcinoma, a subtype of sweat gland carcinoma, is a very rare malignant neoplasm arising in areas of high apocrine sweat gland density. to date, only few cases (about 50 cases ] have been reported in the literature. these lesions occur primarily in the axilla, but can also occur elsewhere on the skin [1, 2, 3 9 ]. apocrine adenocarcinoma usually develops de novo but has also been observed to arise in association with other benign tumours such as apocrine adenoma and apocrine hyperplasia [10, 11 ]. most of the neoplasms are relatively indolent and slowly developing over months to years, but some are rapidly progressive and extremely aggressive. they mostly present as nodules or masses 23 cm in size, without any additional symptoms [1, 3, 5, 6 ]. one third of the patients have regional lymph node involvement at diagnosis. also, some patients have died from metastases to the lungs, liver, bone, brain and kidney [1, 3, 5 ]. the histologic picture likes as an adenocarcinoma that may be well, moderate or poorly differentiated [1, 3, 9 ]. the cytoplasm of the tumour cells contains pas - positive, diastase - resistant granules and often iron - positive granules [1, 7, 9, 12 ]. the differential diagnosis of apocrine gland carcinoma from metastatic mammary adenocarcinoma is not possible on morphological grounds, and immunohistochemistry, except for a few cases, does not allow distinction between them. malignant sweat gland tumours are often positive for oestrogen and progesterone receptors, and these markers are therefore of limited usage in differential diagnosis [1, 3, 9 ]. features that favour the diagnosis of a primary apocrine gland carcinoma are the presence of neoplastic glands high in the dermis, apocrine glands near the tumour and intracytoplasmic granules of iron. the treatment of choice is wide local excision with clear margins, with or without regional lymph node dissection. postoperative radiotherapy and chemotherapy in patients with moderately or poorly differentiated tumours have been used as adjunctive treatments but have shown little benefit on mortality [1, 3, 5, 13, 14 ]. there is a high incidence of local recurrence (28% in one report ], and prophylactic nodal dissection does not reduce the incidence of local recurrence. primary apocrine carcinoma of sweat glands is a very rare tumour, and there are no guidelines for the treatment of recurrent or metastatic disease. | cutaneous apocrine gland carcinoma, a subtype of sweat gland carcinoma, is a very rare malignancy, and only few cases have been reported in the literature. many of these carcinomas are indolent and slowly developing, but some are rapidly progressive. the treatment of choice is wide local excision with clear margins, with or without lymph node dissection. we report a case of a 67-year - old man who came to our hospital with an ulcerated nodule in the right axilla measuring 1 0.8 cm. histological evaluation showed features of an apocrine gland carcinoma arising in an area of high apocrine gland density. |
research on materials used for hard / soft tissue regeneration has focused on those that are degradable and capable of stimulating new tissue formation. in this context, they can be prepared in different forms : blocks, rods, powder, fibres, or microtubes according to the intended application [14 ]. for instance, bulk glasses have been proven to enhance new bone formation and to reduce the number of staphylococcus aureus and methicillin resistant staphylococcus aureus (mrsa) that are normally associated with bone infection in an in vitro model designed for that purpose. glass fibres were also shown to allow for the formation of prototypic muscle fibre and to reduce the number of staphylococcus epidermidis that are mostly associated with biomaterials - related infection. they demonstrated better sealing ability than the commercially available gutta percha filling material when incorporated as powder into polycaprolactone matrix and used as root canal filling material. furthermore, they can be potentially used for other applications such as augmentation of alveolar ridge, treatment of peri - implantitis or infection associated with dry socket that occasionally occurs after tooth extraction, and cell - delivery vehicle to inaccessible areas (e.g., advanced periodontitis). currently, for the treatment of osseous defects, atrophic alveolar ridge as an example, autograft represents the gold standard modality for such application, but the material supply is often a problem. guided bone regeneration technique is another approach ; nevertheless, providing enough space for bone regeneration is always a problem. bioactive glasses as perioglas and biogran that can be easily molded and packed into the bony defect are also used ; however, the compromise between the particle sizes and degradation to produce particles favourable for osteogenesis without inducing inflammation is always a dilemma. phosphate glasses with large particle sizes and even a combination of different particles sizes and compositions can be used as an alternative. under such circumstances, it is feasible to make the highly degrading particles close to the bony wall of the defect to provide room for formation of new bone and also to allow for the growth of vascularisation that represents a common problem with alloplastic materials. the center of the defect, however, could be filled with particles having a relatively low degradation to provide some support for the newly formed bone. our previous work showed that inclusion of tio2 (15 mol%) into glasses with 30 mol% cao, 20 mol% na2o, and 50% mol p2o5 improved the direct cell response, that is, when cells directly seeded on the material surface. in another study, it was also reported that the extract of pbg containing 40 mol% cao enhanced cell growth and antigen expression of bone cells, that is, indirect cell contact. having pbg combining good cellular response at both direct and indirect contact level, and hence better clinical efficacy, is the main aim of the present study. therefore, the scope of this study is to produce glasses having both 40 mol% cao and 05 mol% tio2 and to assess their potential application for the treatment of a variety of osseous defects in oral and maxillofacial regions, including ridge augmentation, sinus elevation, extraction sites, cystectomies and apicoectomies, and periodontal and peri - implant defects via : (a) evaluation of their mechanical properties represented in biaxial flexural, three - point bending, and characteristic strength as well as young 's modulus and (b) determination of biological properties of these glasses by assessing their effect on osteoblast - like cells behaviour (viability, attachment, proliferation, and differentiation) and on human primary osteoblasts (cytoskeleton organization, cell spreading, and maturation). these glasses are designed to be soluble, thus allow any defective tissues to grow within and occupy the space voided as they degrade. moreover, the released ions will markedly influence cell attachment, spreading, proliferation, differentiation, and, therefore, function. glass rods of 15 mm diameter were prepared using nah2po4, caco3, p2o5, and tio2 (bdh, poole, uk, all chemicals were > 98% purity) as precursors by the conventional melt quenching process. these glasses contain 0, 1, 3, and 5 mol% tio2 and they are encoded as cnp, cnpt1, cnpt3, and cnpt5, respectively. each rod was then sectioned into approximately 1 mm thick discs using a testbourne diamond saw with methanol as a coolant / lubricant. discs from each composition were subjected to a series of grinding steps on one side using a series of waterproof silicon carbide papers : p no. 120 for 30 seconds at 300 rpm to flatten the surface, then p no. 500, 1000, and 2400, respectively, for 1 min at 500 rpm to smoothen the surfaces, and finally p no. 4000 for 2 min to get a smooth mirror - finish surface on a struers rotopol-11 (struers, uk). these discs were used for biaxial flexural test and biological assessment. for three - point bending test, however, each glass specimen was fabricated into bars of approximately 2 mm thickness, 4 - 5 mm width, and approximately 14 mm in length. each specimen was ground to the required size from a disc shape using a struers rotopol 11 and then subsequently ground on one side as described above. the mechanical characterisation was performed on glasses with 0 and 5 mol% tio2. at least 25 specimens of each group were subjected to a biaxial flexural strength test using a zwick hc10 servo hydraulic testing frame (zwick ltd.). each disc was placed on a supporting circle with a diameter of 12 mm. the polished surface of the specimen was the tension side, while the unpolished surface was loaded with a point load at a crosshead speed of 1 mm / min and with a 1 kn load cell until failure occurred. the load to failure (n) of each specimen was recorded and the biaxial flexural strength (mpa) was calculated using (1) where f is the strength (mpa), w the fracture load (n), ds the diameter of the support circle (12 mm), b the diameter of the areas with uniform load (= 2b/3) (mm), b the thickness of the disc (mm), and d is the diameter of disc (mm). for v, the poisson 's ratio, three - point bend test as carried out on 8 specimens from each group in order to determine young 's modulus for these glasses, as the biaxial flexure standard test model (ball on ring) did not provide the necessary formula to be able to obtain this value. these tests were also carried out on a zwick hc10 testing frame and loaded at a crosshead speed of 1 mm / min with a 1 kn load cell. the testing jig was composed of three beams, two of which act as support beams that are 12.48 mm apart, and the third acting as the loading beam. as stated in the previous section, tests were carried out with the polished side in tension. the bending strength and young 's modulus were calculated from the following (2), respectively, (2)b=3pl2bd2,eb = ml34bd3, where b is the bending strength (mpa), p is the load at failure (n), l is the support span (mm), b is the width of the specimen (mm), d is the thickness of the specimen (mm), eb is young 's modulus (gpa), and m is the gradient of the elastic region of the load - displacement curve. biaxial flexural strength data were analysed using independent t - test at a significant level of p <.05. in addition, the biaxial flexural strength data was also analysed statistically with the weibull distribution using the winsmith weibull 0.2 software program. the weibull modulus was calculated using (3)pf(c)=1exp [(c0)m ], where pf(c) is the probability of failure, c the fracture strength, 0 the characteristic strength (pf(c) = 63.2%), and m is the weibull modulus. accordingly, plotting in [in 1/(1 pf) ] against in will provide a slop with the value of the weibull modulus. glass discs were sterilised by dry heating at 180c for three hours, and pretreated by incubation in a growth medium (dulbecco 's modified eagles medium (dmem, gibco), 10% fetal calf serum (fcs), and 1% penicillin and streptomycin (p / s) solution (gibco)) for 24 hours at 37c humified atmosphere incubator of 5% co2 in air. cells were cultured at a density of 3 10 cells / disc, and the growth medium was changed every three days. after 1, 3, and 7 days of culture, samples were stained for 1 hour with a standard growth medium containing 1 l / ml live / dead staining (calcein am / propidium iodide). then, the cell viability was assessed in three dimensions using confocal microscopy (bio - rad, usa), and the samples were scanned using a 20x lens. projection images were created by superimposing the z - stack images that were captured throughout the construct thickness using imagej software (national institute of health). after 1 day of culture, samples were overnight fixed with 3% glutraldehyde in 0.1 m sodium cacodylate buffer (agar scientific ltd., samples were then dehydrated in graded alcohol, critically dried in hexamethyldisilazane (hmds, taab laboratories ltd., berkshire, uk) for 1 min, and finally left to air dry. the dried samples were then mounted on aluminum stub, sputter coated with gold - palladium alloy, and viewed using a scanning electron microscope (jsm 5410lv, jeol, usa). the proliferation of cells grown directly on the surface of glass discs (for up to 7 days) or in the presence of glass extract (for up to 5 days) was conducted using alamar blue assay. the absorbance of each sample was measured at 530 nm (a530) and 590 nm (a590) using a fluroskan ascent plate reader (labsystems, helsinki, finland). the glass extract was prepared by incubating the pbg discs into 3 ml the growth medium for 24 h, and then the medium was used as nutrient for cells. in these experiments, human primary osteoblasts cells (promocell, uk) were seeded on the samples with density 10 cells / disc and incubated with growth medium (modified eagles medium (-mem gibco), 10% fcs, and 1% p / s). the test, the sterilised samples were washed with hepes saline (hs, sigma aldrich) and ultrapure sterilized water. samples for the experiment were not preincubated in the media to avoid binding of the protein and other media components to the surface, which may result in some differences in cells response. cytoskeletons were assessed for cells on the samples after 3 days in culture (early time point). the cells were fixed in 4% formaldehyde / pbs, with 1% sucrose at 37c for 15 min and then washed in pbs. following this, the cells were permeabilised in a perm buffer (10.3 g sucrose, 0.292 g nacl, 0.06 g mgcl2, 0.476 g hepes buffer, and 0.5 ml triton x, in 100 ml distilled water, ph 7.2) at 4c for 5 min and subsequently incubated in 1% bsa / pbs at 37c for 5 min. the cells were stained simultaneously with rhodamine phalloidin (1 : 100 in 1% bsa / pbs, molecular probes, or, usa) and anti--tubulin primary antibody (1 : 100 in 1% bsa / pbs ; tub 2.1 monoclonal antihuman raised in mouse, (igg1) sigma, uk) for 1 h at 37c. next the samples were next washed in 0.5% tween 20/pbs (5 min 3) and a secondary antibody (1 : 50 in 1% bsa / pbs monoclonal horse antimouse (igg), vector laboratories, uk) was added for 1 h at 37c. the samples were then washed in tween 20/pbs, and fitc conjugated streptavidin was added (1 : 50 in 1% bsa / pbs, vector laboratories, uk) for 30 min at 4c. cells spreading, area of cells contact, on the glass samples was evaluated using imagej software (wayne rasband, national institute of mental health, bethesda, maryland, usa). on the actin images the calculated total area of cells on each sample was presented as a percentage of the sample surface area. cells were incubated for 21 days as a late time point. at this time, the cells typically prepare to mineralize (if osteoblast differentiation is supported) by secreting bone - specific extracellular matrix proteins (e.g., osteocalcin and osteopontin) just prior to bone formation. here, both proteins (osteocalcin and osteopontin) were stained (immunofluorescence) after 21 days in culture as previously described. statistical analysis was applied using a one way anova test for the biological assessment study while independent t - test for the mechanical study using spss for windows (release 12, spss uk ltd., uk). one way anova was then followed by dunnett (2-sided) t - test that treated thermanox as a control and compared all other groups against it. the mean difference was considered to be significant at the 0.5 level and 95% confidence interval. the mean biaxial flexural strength was 79.5 18.5 and 83.5 19.4 mpa for cnpt5 and cnp glass, respectively, figure 1(a). the bending strength values were 83.7 16.1 and 87.4 22.1 mpa for cnpt5 and cnp, respectively. this can also be said when comparing the biaxial flexure values against the bending strength values for each glass composition, figure 1(a). young 's modulus (eb) data obtained from the load deflection curve of the three - point bending test gave values of 17.4 3.8 and 15.3 3.6 gpa for cnpt5 and cnp, respectively, figure 1(a). independent t - test indicated that there was no statistical significant difference between these sets of result also. the characteristic strength () of cnpt5 glass was 86.7 mpa which is lower than that observed for cnp glasses (91.0 mpa). the 95% confidence intervals of characteristic strength identified no significant difference between cnpt5 and cnp glasses, where the confidence intervals overlapped for both compositions (from 81.26 to 92.5 mpa for cnpt5 and from 84.8 to 97.7 mpa for cnp glasses). furthermore, weibull modulus for cnpt5 (4.9) showed no difference to that of cnp glasses (4.9), but the 95% confidence intervals for weibull modulus also identified no significant difference between these two glasses (the 95% confidence interval ranged from 4.0 to 6.0 for cnpt5 while from 3.9 to 6.3 for cnp glasses), figures 1(b) and 1(c). after 1 day of culture, live cells were detected on the surfaces of all glass discs, but not as confluent as on thermanox positive control, figures 2(a), 2(b), 2(c), 2(d), and 2(e). after 3 days of culture, there was an increase in the density of hos cells growing on the surface of all tested glass compositions compared to day 1 of culture except cnp sample, figures 2(f), 2(g), 2(h), 2(i), and 2(j). at day 7, however, all glass surfaces supported high cell viability as well as the positive control so that the cells covered all studied surfaces, figures 2(k), 2(l), 2(m), 2(n), and 2(o). after 1 day of culture, hos cells presented with well spread morphology on all tested glass compositions in a manner comparable to the positive control cells. those grown on the surface of cnp and cnpt1 showed lower density than the positive control cells. cells growing on cnpt3 and cnpt5 glass discs, however, showed similar density to the positive control cells, figure 3. at day 1 of culture, all tested glass compositions except cnp showed no significant (p.05) differences in cell number compared with the positive control surface. cnp sample, however, supported significantly (p <.05) lower cell numbers than other tested samples. as it can be clearly seen and as a function of time, the number of cells growing on the surfaces of all tested glass compositions showed an increase compared to those at day 1 of culture. this increase was highly significant between either days 1 or 5 and 7 of culture, but not between days 1 and 5 of culture, figure 4(a). regarding the compositional differences, there were no significant differences in cell number growing on cnpt1, cnpt3, and cnpt5 and positive control at days 1 and 5. at day 7, however, there was significantly lower cell number on cnpt3 and cnpt5 than the positive control. cells growing on cnp showed significantly lower number than the positive control cells at days 1 and 5 but not at day 7. a similar trend of increasing cell number with time was also seen when cells grown in the presence of the glass extract. moreover, the cells managed to grow at similar rate to the positive control cells cultured in normal growth medium at different time points, figure 4(b). assessment of the cytoskeleton after 3 days in culture revealed significant differences between the glass samples depending on tio2 content. in general, it was observed that with the increase of tio2 content, the organization of the cytoskeleton also increased. three main proteins were assessed in this study ; actin, which is a major structural protein, gives information on the general condition of the cells ability to adhere and spread ; tubulin is another structural protein and is important in cell metabolism as vesicles are moved in and out of the cell (endocytosis and exocytosis) along the tubulin microtubules [17, 18 ]. these proteins are important in the investigation of cell signalling, proliferation, and differentiation. the number of the cells growth on cnp was clearly limited and the cells were very small ; their cytoskeletons were not developed, figure 5. cells grown on cnpt and cnpt3 samples were quite well developed, with pronounced stress (actin) fibres and well - organized tubulin network radiating from the centre of the cells, but the cytoskeleton structures was less developed than those observed for control samples. cells grown on cnpt5, however, had large size, high spread, very well - developed actin and tublin networks, and was comparable to those gown on positive control samples, figure 5. analysis of the surface area of cells grown on each sample, as a measure of cell spreading, showed that with increasing tio2 content, the surface area increased. the calculated surface area for cells grown on cnp was far below 1%, which demonstrated that cells did not spread well on those samples. the surface area recorded for cells grown on cnpt5 was higher than that for positive control cells, figure 6. assessment of functional osteoblast marker proteins after 21 days in culture revealed differences between the samples depending on tio2 content, figure 6. positive expression of osteocalcin (oc) was only evidenced for cells grown on cnpt3 and cnpt5 samples. osteopontin (opn), however, was evidenced for cells growing on all studied samples except cnp samples that showed no viable cells on their surfaces at this time point, figure 7. moreover, there was a major difference in the morphology of cells grown on different samples. cells grown on cnpt1 and cnpt3 were typically small, but the density was reasonably high. those grown on cnpt5, however, had well developed structure and clear and well - organized morphology, which was similar to the positive control cells. bone regeneration research has mostly focused on degradable materials that are capable of stimulating bone regrowth. pbg are controllably degradable and can be prepared in different forms and compositions to support bone regrowth. highly degradable (dynamic) surfaces, however, would not allow for maintained cells attachment. the degradation products could also adversely affect cells function, for example, antigen expression. the main challenge was producing glasses that endorse cells to form new tissues, continuously replacing these degraded glasses. they also release degradation products (extracts) that are vital for the function of those cells in their vicinity (indirect contact). it was hypothesised that combination of tio2 (15 mol%) that proved to significantly improve direct cell growth on pbg surfaces, with the highest possible cao (40 mol%), known to produce tolerable extracts, could improve the cellular response at both direct and indirect contact level. additionally, it might improve pbg mechanical properties and allow for easy pbg shaping at chair side time. the aim of this study was, therefore, to test the mechanical and biological performance of these glasses. knowledge of the mechanical properties is a crucial requirement for evaluating the possibility of using these glasses in biomedical applications. a previous study examined the effect of altering the tio2 content on numerous physical properties relating to the 50 p2o540 cao10 na2o system. the findings showed that as a result of varying the ti content by a few percent, there were significant differences in the physical properties, and the data seemed to exhibit a good correlation. in order to examine whether this is reflected in the mechanical behaviour, this study was carried out using cnpt5 and cnp. by comparing the results of these two compositions, we can make a reasonable assumption as to whether or not further results will exhibit a correlation. as the results indicated, incorporation of tio2 had no effect on the biaxial flexural strength or the bending strength. moreover, the addition of tio2 did not significantly (p.05) enhance the modulus when compared with the un - doped glasses. as reported in the literature, the yield strength and modulus of natural cortical bone vary from 104121 mpa and 120 gpa, respectively. therefore, according to the results obtained in this study, the strength as well as the modulus profiles for cortical bone can be matched. moreover, the bending strength of tio2-doped glass developed in this study is higher than those recorded for bioglass (4060 mpa), while its young 's modulus is lower (3035 gpa). a previous study commented that structural changes which occur as result of tio2 addition greatly influence the degradation properties and are attributed to the increase in crosslink density and strengthening of the phosphate network. incorporation of 5 mol% tio2 reduces the degradation rate by two orders of magnitude from 0.017 to 0.0008 mg / mm / h. these structural changes, however significantly they are improving the chemical stability of tio2 doped glasses, have not shown to improve their bulk mechanical properties, as stipulated above. moreover, the weibull distribution plots indicate no significant changes in the mode or type of failure for these glasses. it is also interesting to note that the bend strength values from the two different testing modes show no statistically significant difference, indicating the applicability of the biaxial flexure test as a reliable method for determining bend strength in brittle materials. in assessing the potential of a new material for biomedical application, generally, in vitro cell culture is commonly used as a simple screening method to experiment the cell - material interaction. the success of this material initially depends on its ability to encourage cells to attach and adhere to its surface. these two protein - dependant processes determine the next cellular events such as proliferation and differentiation. for bone regeneration, cell lines, as a representative of osteoblastic behaviour, were commonly employed, taking into account that they showed different differentiation behaviours from the primary cells. therefore, in this study, osteoblasts cell lines were used to initially assess the glass biocompatibility, while human primary osteoblasts were used to assess cytoskeleton organisation and differentiation. bone formation processes usually involve cell proliferation, extracellular matrix production, maturation, and then mineralisation. during the first two stages, the cells increase in number and produce extracellular matrix proteins as type i collagen or fibronectin. after the downregulation of proliferation, proteins associated with the osteoblastic phenotype can be detected. at the beginning of mineralisation, cells tend to produce alkaline phosphatase (alp) as an early mineralisation marker and proteins such as sialoprotein, osteopontin (op), and osteocalcin (oc) as late mineralisation markers. the findings from both cell viability and attachment studies suggested that inclusion of 40 mol% cao into the glass produced an improvement in osteosarcoma cells attachment, viability and proliferation when compared with our previous work carried on glasses having 30 mol% cao [25, 26 ]. more interestingly, the osteosarcoma cells grown in the presence of the glass extracts as if in the standard growth medium. this confirms the hypothesis that using high cao and very small tio2 content did improve not only the biological response at the direct contact level but also in the surrounding vicinity of the glass structure. the glasses used in this study were shown to be more hydrophilic than hydroxyapatite since the water contact angle reported for hydroxyapatite was 48 while about 11 for these glasses. these contact angles are also lower than other titanium phosphate glasses prepared by navarro. as well known, the cell response to a material is affected by the surface properties such roughness, wettability, or surface free energy which are of paramount importance as they directly affect cell adhesion and differentiation. the absence of clear differences between the tested compositions with osteosarcoma cells can be also referred to the absence of any significant differences in surface properties, as roughness (all samples are prepared to the same mirror finish appearance) and contact angles. analysis of primary osteoblast cytoskeleton organization and area of contact with the underlying substrates, on the other hand, indicated that increasing tio2 content was vital to improve cells behaviour on the glass surfaces. both the cytoskeleton organization and surface area were the greatest on glass samples with the highest tio2 content and cells showed better developed structures than observed on positive control samples. it is believed that tio2, which in concomitant with high biocompatibility, might have acted as a chemical cue modulating cells response. it can be speculated this was also due to change to the degradation rate or due to some differences in protein bonding to the substrate which is particularly important in the early days experiments. on the other hand, cells on those samples were undeveloped, and their sizes, shapes, and structures indicated that this substrate did not support their growth. this may be associated with the greatest rate of the samples degradation (1 - 2 orders of magnitude higher than those doped with tio2 according to the amount of tio2 incorporated into the glass) which might have caused cells detachment. it is also possible that the amount of released element was too high for the cells which impaired their growth. compared to the previous work with 30 mol% cao, glasses with 40 mol% cao showed improved osteosarcoma cells attachment, viability, and proliferation. the extracts from glasses containing 40 mol% cao and/or tio2 supported normal growth of osteosarcoma cells as the normal growth medium. the effect of tio2 as a modifying oxide into 40 mol% cao containing glasses was not significant on mechanical strength and modulus. it, however, had had significant on primary osteoblast cells development, cytoskeleton organisation, area of spreading on the substrate, and maturation / mineralization process. | this study challenged to produce phosphate - based glasses (pbg) for the treatment of osseous defects. the glasses contained, among other components, 40 mol% cao and 15 mol% tio2. the mechanical performance and in vitro biocompatibility using both human osteosarcoma and primary osteoblasts were carried out. incorporation of tio2 into pbg had no significant effect on strength and modulus. these glasses encouraged attachment and maintained high viability of osteosarcoma cells similar to the positive control surface. cells grown directly (on glasses) or indirectly (in the presence of glass extracts) showed similar proliferation pattern to the positive control cells with no significant effect of tio2 detected. increasing tio2 content, however, has a profound effect on cytoskeleton organization and spreading and maturation of primary osteoblasts. it is believed that tio2 might have acted as a chemical cue - modulating cells response, and hence the substrates supported maturation / mineralization of the primary osteoblasts. |
latinos constitute the largest and most rapidly growing ethnic group in the us. currently and over the past twenty years, non - latino adolescent alcohol use has declined, use among latino youth has remained high. the latino population continues to grow and is at a high risk because of the trends in demographics. latino youths have a higher high school dropout rate, a higher proportion of families living in poverty, and the highest fertility rate compared to other minority groups. in addition, there are numerous alcohol - related problems reported by young drinkers, such as interpersonal problems, impaired school and work performance, risky sexual behaviors, and drunk driving [46 ]. for many reasons, such as limited access to the population and an increased diversity of the latino population, research on latino adolescent alcohol use is sparse and many studies group all latino subgroups together, making it difficult to understand differences and similarities between groups [7, 8 ]. study findings on a variety of health outcomes, including substance use, have shown differences by latino subgroup [9, 10 ]. this study focuses on mexican american youth because of the lack of specific knowledge on parenting in this subgroup of latinos. in addition, various studies have shown that mexican americans, compared to other latino subgroups such as puerto rican 's, have unique family composition, cultural attitudes, and substance use [11, 12 ]. it has been demonstrated that family mechanisms, in particular parenting styles, may be of important influence on substance use tendencies among young individuals. baumrind 's theoretical framework of parenting delineated four dimensions to parenting styles : permissive, authoritarian, authoritative, and uninvolved. one of the critical ideas from baumrind 's four quadrants of parenting styles is that parenting revolves around issues of warmth and control. the categorization of these two characteristics, warmth and control, creates a typology of four parenting styles. permissive parents are nondirective and are lenient and are warm and loving ; authoritarian parenting is associated with low parental warmth and stricter rules ; authoritative parenting is associated with high parental warmth and clear limits that are negotiated ; uninvolved parent scan be rejecting and neglectful [14, 15 ]. baumrind 's seminal studies showed that authoritative parenting, or warm and firm parenting, has higher levels of adolescent competence and psychosocial maturity than their peers who were raised by parents who were permissive, authoritarian, or uninvolved parents. dozens of studies over the past fifteen years that all used different methods, samples, and measures reached the same conclusion that authoritative parenting is associated with advantages in adjustment, school performance, and psychosocial maturity [16, 17 ]. research on parenting styles and alcohol use among non - latinos indicates that authoritative parenting is associated with less alcohol use [18, 19 ]. the majority of research on parenting and adolescent outcomes has been conducted with european american families, and increasingly with families of color. there has been surprisingly little empirical research on the role of parenting and the role it plays for alcohol use in mexican american adolescents. in light of this, this paper will investigate the connection between parenting and alcohol use for mexican american youth. the literature characterizes mexican american families as having strong loyalty and closeness to the extended family (familismo), interdependent relationships among different generations, and a hierarchical family structure with clear expectations for parent and child roles. this type of family structure is often characterized as authoritarian based on the strong emphasis on parental respect (respeto) and authority [14, 21, 22 ]. in addition to the hierarchical family structure where parents have authority [23, 24 ], the parent - youth relationships are also informed by cultural norms of personalismo and simpatia, which place an emphasis on warm personal relationships. this dual cultural emphasis on warmth and control some literature has also described mexican american parents as relaxed and permissive toward their children, which has been interpreted as an acceptance of the adolescents ' individuality [23, 25 ]. parenting is embedded in the culture of a group, and in an effort to understand parenting, the cultural context must be considered. acculturation is the social and psychological influences that occur due to continuous contact between individuals from different cultures. vega. found that composite measures of adolescent and parent acculturation are better predictors of alcohol use than the gaps between adolescent and parent acculturation. parenting styles may be more fluid than what the traditional cultural norms suggests and depend on parents ' adherence to traditional values, acculturation level, and the larger context of their lives. within the cultural context, parenting practices among mexican american families can range in a variety of ways, and it is not entirely clear how acculturation relates to parenting styles. the parent - youth relationship is another important dynamic to consider when looking at family mechanisms, particularly in latino families. the interactions, behaviors, and emotions exchanged between parents and their adolescents can be warm or hostile. the type of parenting style used is often a reflection of how the parents were raised. however, the parent - youth relationship is a unique set of interactions that has been linked to adolescent problem - solving behaviors and feelings of being able to control events that can affect him or her [29, 30 ]. the protective influences of latino family centeredness and familismo include support, counseling, advice giving, and modeling of behaviors. the support and advice giving in a latino family builds a relationship between the youth and parent that is above and beyond the typical parenting style. the high quality of parent - youth relationships has been linked to the positive development of adolescents in multiple domains such as depressive symptoms, aggression, and substance use [31, 32 ]. mexican american families are often considered to be highly child - centered, with parent - youth relationships often viewed as more important than the marital relationship. the meaning and influence of parenting practices and the parent - youth relationship may differ across ethnic groups. parental practices are often shaped by culture - specific norms and by ecological factors, such as the process of acculturation. there have been few investigations on the relationship of parenting style to adolescent alcohol use among mexican american youth specifically. a national sample on latino adolescents utilizing the add health data indicated that high amounts of parental warmth, control, and parent - youth relationship decreased alcohol use. however, acculturation of the parent (parent place of birth) did not influence parenting and the study did not investigate the findings for mexican american youth. a study of alcohol and other drug use among adolescents found that a positive relationship with the father was associated with less use of alcohol among the latino subsample. another study of latino preadolescents found lower rates of smoking initiation among youth who reported higher levels of parental monitoring and communication about problems with parents. research that included a subsample of latino youth of approximately ages between 11 and 13 found that parental monitoring was associated with adolescents ' lower use of drugs. thus, while parental control and warmth have been associated with less drug use, the research that was conducted thus far with latino youth has several key limitations. first, research has been conducted with latino samples that reflect substantial diversity with respect to culture, historical context, and history in the us this paper will address this gap by investigating mexican american families. second, the literature has not examined the relationship of acculturation level and the influence it may have on a parenting style and alcohol use for mexican american families. third, there has been little examination of the independent and combined influence of the role that the parent - youth relationship plays in relationship to parenting and its connection to alcohol use. the present study addresses these gaps in its investigation of the relationship between mexican american parenting style, the parent - youth relationship, and adolescent alcohol use while taking into consideration the parents ' acculturation level. based on prior theoretical and empirical work, the study is guided by the following hypotheses.h1 : mexican american parents who are high in control and those parents who are low in warmth (authoritarian parenting) will have adolescents who use alcohol less compared to those with high amounts of control and high warmth (authoritative parenting). the hypothesis is that mexican american adolescents respond better to authoritarian parenting, as this is a traditional cultural norm. h2 : those parents using high warmth will have a positive parent - youth relationship. those parents who have a favorable view of their relationship with their adolescent will have adolescents who use alcohol less. more acculturated parents use authoritative parenting (less controlling).h4 : acculturated youth and families will have high levels of alcohol use, low levels of control, high levels of warmth, and a good parent - youth relationship. mexican american parents who are high in control and those parents who are low in warmth (authoritarian parenting) will have adolescents who use alcohol less compared to those with high amounts of control and high warmth (authoritative parenting). the hypothesis is that mexican american adolescents respond better to authoritarian parenting, as this is a traditional cultural norm. those parents who have a favorable view of their relationship with their adolescent will have adolescents who use alcohol less. acculturated youth and families will have high levels of alcohol use, low levels of control, high levels of warmth, and a good parent - youth relationship. the data used for this paper is from the national longitudinal study of adolescent health (add health) based in the university of north carolina at chapel hill. add health is a school based, longitudinal study of the health - related behaviors of adolescents and their outcomes in young adulthood. add health uses a clustered sampling design that is school - based so that the school is the initial point of contact between the researchers and the respondents a self - administered questionnaire was taken in schools between september 1994 and april 1995 during a class period for grades 712. all of these students (83,105) were used as a sampling frame to identify a stratified (by grade and gender) random sample of 16,044 adolescents. these 16,044 students comprise the core sample and were used for in - home interviews. ninety - five percent of the respondents for the in - home interview were female head of households, 88% of which were the biological mother ; the remaining were grandmothers, step mothers, or aunts. one year later, the wave 2 in - home sample was composed of adolescents who participated in the first wave of the in - home component and resulted in 10,547 participants. the response rate for wave 1 is 79%, and the response rate for wave 2 is 88%. for the purpose of this study only the adolescents who responded that they were mexican american and had data on alcohol use behaviors for waves 1 and 2 were used for this sample n = 956. adolescents were asked about how often they consume alcohol and how often they get drunk in the past 12 months, responses ranged from almost every day, three to five times a week, one or two days a week, two or three days a month, once a month or less or one or two days in the past year, or never. the drinking and getting drunk questions were asked in wave 1 and wave 2. youth were asked if their parents allow them to make their own decisions about (a) the time you must be home on weekend nights ? (b) the people you hang around with ? (c) what you wear ? (d) how much television you watch ? (e) which television programs you watch ? (f) what time you got to bed on week nights ? (g) what you eat ? a scale was created where the sum of the 7 questions was divided by 7, then multiplied by 100, giving a percentage. youth were asked how warm and loving their mother / father was towards them options ranged 5 = strongly agree, 4 = agree, 3 = neither agree nor disagree, 2 = disagree, 1 = strongly disagree, where high numbers indicate high warmth. mother and father warmth were averaged together with a pearson correlation of.151, p <.001. parents were asked : how often would it be true for you to make each of the following statements about your child 1 : you well with him / her ; indicator no. 2 : this was measured using a 5-point scale starting at always, often, sometimes, seldom, and never. where higher numbers indicate a better relationship. youth were asked how many of their three best friends drink alcohol at least once a month, and responses ranged from 0 to 3, peer alcohol use was used as covariate. income was measured by a question in the parent questionnaire that asked about total income before taxes for everyone in the household, income was used as a covariate. parental acculturation level that was measured by parent place of birth indicated that almost half of the parents were born inside the us (46%) with 54% born outside of the us most of the mexican american adolescents were born in the us (83%). about half of the adolescents spoke primarily english in the home (56%), indicating that 44% of the sample spoke primarily spanish in the home. gender was divided almost equally among adolescents with slightly more females with 52% and males with 48%. the adolescents in the sample ranged from 7th grade to 12th grade at wave 1. twelve percent of the sample were in the seventh grade, 12% in 8th grade, 13% in 9th grade, 24% in 10th grade, 19% in 11th grade, and 18% in 12th grade, and 3% of the sample refused to answer or was not in a school that had traditional grade levels. income levels indicated that 64% of the families earned less than $ 34,000 annually (table 1). parental warmth measured on a scale of 1 to 5 ranging from very low warmth to very high warmth had mostly parents indicating very high or high warmth (63%) and the rest (37%) indicting very low, low, or average warmth. adolescents indicated that parental control on a scale of 0 to 100 that 18% were not controlling, 62% were slightly controlling, and 19% were very controlling with only 2% being totally controlling (table 2). the first, well together (py1), found most parents saying often or always (88%) with the remaining indicating never, seldom, or sometimes (12%). the second parent - youth relationship variable (py2), asking parents if they make decisions together with their adolescent, found that 70% often or always make decisions together and 30% never, seldom, or sometimes make decisions together. the third parent - youth relationship variable (py3) asked the parents if they trust their adolescent and found that 85% always or often trust them and 15% never, seldom, or sometimes trust them (table 2). structural equation modeling (sem) is used for an analysis of the effects between identified independent variables. the model for this analysis the data was analyzed using mplus and the appropriate sample weights created by the addhealth staff [38, 41, 42 ]. the p value for the multivariate index was statistically significant (p < 0.05). examination of univariate indices of skewness and kurtosis revealed only two variables with absolute skewness values and kurtosis values above 2.0, the getting drunk variables from wave 1 and wave 2. given the presence of nonnormality the mplus analysis utilizing sample weights, a complex analysis was used using mlr, maximum likelihood estimation with robust standard errors, which is robust to nonnormality. the bollen - stine bootstrapped chi - square test yielded a value of 88.665, with degrees of freedom of 36, and a p value of 0.001. the root mean square error of approximation (rmsea) was 0.039, which was less than 0.08 indicating good model fit. the p value for the test of close fit was 0.958, which was nonsignificant indicating good model fit. the test of close fit provides a one - sided test of the null hypothesis that the rmsea equals.05, and this is what is called a close - fitting model. the comparative fit index was 0.986 which was higher than 0.95, indicating again good model fit. the tucker - lewis index (tli) was 0.97, indicating a very good fit. inspection of the residuals and modification indices revealed no significant points of ill fit in the model. the residuals are in standardized form and are reflective of unexplained variance in the endogenous variables. path coefficients for parent place of birth affecting parental control did result in statistical significant coefficients for mexican american youth. on average, for parents born inside the us, parental control would decrease by.003 for mexican american youth (p <.001) compared to those parents born outside the u.s. on average if english was spoken at home, parental control would decrease by.098 compared to those who spoke spanish at home (p <.001). if english was spoken at home, the parent - youth relationship decreases by.043 compared to if spanish was spoken in the home (p <.001). if the adolescent was born in the us, alcohol use at wave 1 increased by.043 compared to those who were born outside the us (p <.001). if the adolescent was born in the us parental control decreased by.002 compared to if the adolescent was born outside the us (p <.001). if they were born in the us parental warmth increased by.027 compared to if the adolescent was born outside the us (p <.001). for every one unit increase in parental warmth, the parent - youth relationship increases by 0.259 (p <.001). parental control on the parent - youth relationship did not result in statistically significant coefficients. for every one unit increase in the parent - youth relationship, adolescent alcohol use is 0.189 units lower for mexican american youth (p <.001). a one unit increase in parental warmth results in alcohol use at wave 1 decreasing by 0.129 (p <.001). for mexican american youth, parental control does not significantly influence the use of alcohol. for mexican american youth, every additional friend who uses alcohol, parental control decreases by.007 (p <.001). for every additional friend who uses alcohol, alcohol use in wave 1 income did significantly influence parental warmth for mexican american youth ; for every one thousand dollar increase in income, parental warmth increased by 5.314 (p <.001). for every one thousand dollar increase in income, parental control decreased by.098 (p <.001). the results of this study contribute to the understanding of how family mechanisms, specifically parenting and the parent - youth relationship, influence the use of alcohol for mexican american adolescents and the impact of acculturation on these factors. few studies are able to investigate within latino subgroups. however, these subgroups are often very different in their cultural values and in their decision to use substances. for these reasons, the dependent variable of alcohol use was measured once at wave 1 and again one year later at wave 2. none of the variables used in the model significantly predicted alcohol use at wave 2. in this model, there is no prediction of change or no activity with intent to have an impact one year later. this may be due to the short - time period of one year from wave 1 to wave 2, and therefore sustained changes may have had difficulty becoming apparent. one of the most interesting findings for mexican american adolescents was the influence of acculturation on family mechanisms. mexican american parents who are more acculturated, or born inside the us, and those who spoke english in the home had lower levels of parental control compared to less acculturated parents. this relationship was expected, given that if the parent is more acculturated their parenting style would become more similar to non - latinos, and there would be less parental control. for mexican american youth, if the adolescent was born in the us, there was more parental warmth and less control, compared to less acculturated youth. this finding confirms the idea that acculturation does have influence parenting for mexican american families. interestingly, a previous model testing a latino sample showed that there was no relationship between parental acculturation and parental control. the finding for mexican american families indicates the increased influence of acculturation on parenting that does not exist in other studies looking at other subgroups of latinos. this strengthens the rationale to continue to do research on subgroups of latinos, as acculturation is creating differential effects on behaviors and outcomes. various reasons for this difference in the level of acculturation on parenting necessitate further investigation, including the community characteristics and a more in - depth examination of the acculturation process for the parent, youth, and family. language spoken at home, a measure of family acculturation level, also had an influence on the parent - youth relationship. if english was spoken in the home, there was a decrease in the parent - youth relationship. this could possibly be contributed to a widening gap between the parent and youth as distance is created from the original culture. traditional latino families may have a stronger connection with their youth, and as the family moves toward being more acculturated and speaking more english in the home, the parent and the youth relationship suffers. the influence of language on the parent - youth relationship and the adolescent place of birth impact on parental warmth and control are unique to mexican american families. there have been very few research studies that show the impact of acculturation on parenting style. however, there is contradictory evidence. some studies show that the gap between the child and parent acculturation levels lead to more alcohol use, while others have found that the overall level of parent and child acculturation determines alcohol use [28, 45 ]. martinez found that family acculturation level is a better construct rather than differences in parent and adolescent acculturation when predicting substance use. this model does not support the finding of martinez where acculturation of the youth is the only direct predictor of alcohol use for adolescents. similar to delva., who found that acculturation level was measured by preferred language spoken, mexican adolescents were more likely to use alcohol or marijuana. acculturation has an impact on level of warmth, control, and the parent - youth relationship for mexican american families. although there is an effect of parent place of birth on parental control, parental control does not have a significant effect on alcohol use. the large latino sample (n = 1887) consisted of 51% mexican american, 30% other subgroups such as cubans and south americans, and 19% puerto rican youth. the mexican american subgroup could be pulling down the covariate estimate while the other subgroups in the latino group are pulling the covariate up. this suggests differences among latino subgroups around the understanding of parental control in relation to alcohol use. it is possible that there are cultural differences for the way parental control is practiced or the way that adolescents perceive parental control. the differences with the mexican american youth compared to a latino sample in mogro - wilson 's can be explained by the other subgroups not analyzed. parenting in a warm and loving manner, as interpreted by youth, was related to a decrease in alcohol use for mexican - american youth. in addition the more warmth and love showed to the youth was also related to a better parent - youth relationship which decreases alcohol use. the importance of warmth found in this mexican american sample is consistent with cultural norms that stress nurturing of the child in the context of a respect and a strong family [23, 34, 47 ]. the present study is unique in providing evidence for the role of the parent - youth relationship and the role of acculturation on warmth. this research indicated that the stronger the parent - youth relationship mexican american youth used less alcohol. the parent - youth relationship is an important construct in family mechanisms that can have an impact on alcohol use beyond typical parenting constructs of warmth and control. this finding highlights the importance of the parent - youth relationship in the use of alcohol and indicates the importance to target this construct in interventions and prevention. parenting interventions should include aspects of building and strengthening parent - youth relationships, activities to foster the growth of the relationship, make decisions together, and build trust. limitations of the study include the age of the data ; the data for this study was collected in 1995 ; however, there has been little change in alcohol use over time for this population. comparing the 1995 add health data to national alcohol use rates based on the monitoring the future study, the rates used in the present study are similar to the national use rates. the monitoring the future study national use rates for hispanic youth show in 2009 when asked if they have ever used alcohol, 19% of eighth graders responded that they had used alcohol, and 34% of tenth graders and 40% of twelfth graders indicated they had drank in the past year. the add health sample of mexican american adolescents used in this study indicates more alcohol usage with 35% of 8th graders reported using alcohol, 53% of tenth graders and 57% of twelfth graders. in addition to changes in alcohol use over time, there may also be changes in family dynamics that occur over time that are impossible to predict, and this adds to the limitations of the present study. in addition to the date of data collection, there are measurement issues such as the construct of parental control. the measure used for parental control was unable to indicate negotiation, an important aspect of parenting, and this limits the findings. in addition, the parent - youth relationship would have benefited from a well - validated questionnaire such as the alabama parenting questionnaire or the egna minnen av barndoms uppfostran measuring acculturation by language spoken at home and how long the individual has been in the country still holds validity. many researchers continue to conceptualize and measure individual acculturation in a unilinear way [51, 52 ]. the variety of acculturation measures also shows that there is no consistent way to measure acculturation in the field. for these reasons and due to constraints of the secondary data set, however, this is a unidimensional way to measure acculturation, and the use of better measures of acculturation should be used in the future to see if the results are similar. studies have demonstrated that proxy acculturation items, such as place of birth and language spoken at home, can be useful to assess acculturation in situations where use of a more comprehensive acculturation scale is impractical. this study confirms the importance of the family as a protective factor for alcohol use in adolescence for mexican americans. parenting and the relationship the parent has with their youth influences an adolescent 's choice to use alcohol. the role of parents to reduce the risk taking behavior of alcohol use is a strong finding. the present study used combined scores of parental warmth and control of the mother and father ; however, separating these differences to see what kind of contribution the mother versus the father in the role of parenting would be valuable. extended research on other subgroups of latinos would be useful in understanding the similarities and differences between mexican american and other subgroups, such as puerto ricans. further qualitative research would be useful in describing the parenting styles and practices in diverse groups of mexican american families. it would be valuable to examine if parenting characterized by warmth is viewed as more consistent with mexican american cultural norms. further research that measures acculturation bidimensionally and its influence on parenting and the parent - youth relationship would prove useful to the understanding of alcohol use. parental warmth can function as a protective factor for mexican american families in preventing alcohol use. however, this is in the context of the parent - youth relationship, which is a necessary component to the model. this model found no relationship between parental control and alcohol use for mexican american families. parental warmth plays a large role in adolescent alcohol use, as warmth increases the parent - youth relationship improves and alcohol use decreases. this paper supports the idea that mexican american families have a protective quality of high warmth and a good parent - youth relationship, and as they acculturate the parent - youth relationship decreases and alcohol use increases. few interventions to prevent underage drinking have specifically targeted latino youth or families [54, 55 ]. further research is needed to design culturally appropriate interventions that are likely to be accepted among latino families. programs designed to improve parental warmth and caring behaviors toward the youth and programs to promote positive parent - youth relationships are likely to reduce adolescent alcohol use. interventions that focus on relationship building, across the acculturation divide between the youth and parent, could help promote a positive parent - youth relationship. in addition focusing on trust building activities and making joint decisions between the parent and the youth could provide a protective factor from using alcohol in adolescence. | the purpose of this study is to further the understanding of how parenting and the relationship between the parent and the youth influence adolescent alcohol use in mexican american families, with particular attention to acculturation. results indicated that parental warmth is a strong factor in predicting adolescent alcohol use among mexican adolescents. the parent - youth relationship played an important role in lowering alcohol use for mexican american youth. acculturation has an impact on the level of warmth, control, and the parent - youth relationship for mexican american families. findings indicate that there are unique family mechanisms for mexican american families that should be considered when developing prevention and treatment options. |
ethics statement - this study was in accordance with the ethical standards of the national ethical clearance committee of brazil as well as with the ethical committee for human research of the oswaldo cruz foundation (cep - fiocruz) and the evandro chagas clinical research institute (cep - ipec / fiocruz) and with the helsinki declaration of 1975, as revised in 1983. patients and controls - the study included healthy subjects (hs) (n = 18) and two cohorts of cl patients : patients with active disease (pad) (n = 14), showing ulcerated skin lesions, and pcc (n = 11), evaluated eighty day after the beginning of treatment, at which time clinical cure was defined as full epithelialisation of ulcerated lesions, regression of crust, desquamation and infiltration. all adults included were between 18 - 60 years of age with a mean age of 35.1 13.2 years. all hs enrolled in this study were from nonendemic areas in rj, showing neither a previous history of leishmaniasis nor any other comorbidity. 2000) and were recruited at the leishmaniasis surveillance laboratory, ipec / fiocruz. the diagnosis of leishmaniasis was based on clinical and epidemiological evidence ; positive montenegro skin test (mst) and parasitological exams. all patients were submitted to meglumine antimoniate treatment independent of their enrolment in our study, according to the guidelines of the brazilian ministry of health (svs / ms 2010). we investigated clinical and epidemiologic information, such as age, sex, number and diameter of lesion at active phase and evolution period. patients who presented with comorbidity, reactivation of cl, reinfection or nonresponse to antimonial therapy were excluded from the study. analysis of the v repertoire and cell phenotyping - venous blood was collected from cl patients and hs in heparinised tubes and peripheral blood mononuclear cells (pbmc) were obtained by ficoll - hypaque density gradient centrifugation (sigma aldrich, usa). v repertoire and cell phenotype staining was performed as previously described (barral - netto., we performed six - colour cell surface staining using the iotest beta mark tcr - v repertoire kit (beckman coulter inc, usa), which contains eight tubes with three antibodies in each against the following tcr - v chains : v1, v2, v3, v4, v5.1, v5.2, v5.3, v7.1, v7.2, v8, v9, v11, v12, v13.1, v13.2, v13.6, v14, v16, v17, v18, v20, v21.3, v22, v23 belonging to 19 of 26 v human families known. these 24 v chains cover 70% of the t - lymphocyte tcr - v repertoire in a normal individual. the staining protocol included one aliquot of the v repertoire kit, which combines tcr antibodies labelled with fluorescein isothiocyanate (fitc), phycoerythrin (pe) or both pe and fitc, with one aliquot of each monoclonal antibody anti - cd8 allophycocyanine (apc), anti - cd45ra pe - texas red, anti - cd27 pe - cyanine 7 (beckman coulter) and anti - cd3 apc - cyanine 7 (bd biosciences, usa). this antibody combination allowed us to simultaneously identify the v repertoire of total cd8 t - lymphocytes and the v repertoire of nave, lde, cm and em subsets. the staining was performed in phosphate - buffered saline containing 0.1% sodium azide (sigma aldrich) and 2% foetal calf serum (sigma aldrich) and incubated for 30 min at 4c, protected from light and finally washed for subsequent acquisition in a flow cytometer. flow cytometry - fifty - thousand events were acquired in by beckman coulter cyan adp (beckman coulter) or bd facsaria ii (becton & dickinson, usa) flow cytometers. all flow cytometry data were analysed using kaluza 1.2 software (beckman coulter) where the distribution of the cd8 t - lymphocyte tcr - v repertoire was determined. in this manner, the total cd8t - lymphocytes was determined in a cd3 vs. cd8 dot - plot created from a region encompassing lymphocyte population in a side vs. forward dot - plot. to evaluate nave, lde, cm and em cd8 + t - lymphocyte subsets, a cd27 vs. cd45ra dot - plot was created based on cd3cd8region. simultaneously, tcr - v repertoire distributions were determined by analysing the frequency of 24 v families, three for each staining tube based on fitc vs. pe dot - plot, gated on five different populations : total, nave, lde, cm and em cd8t - cell subsets (fig. 1). to ensure confidence in cytofluorimetric v analyses from different dates, the limits for the regions created in v dot - plots, quadrant markers and histograms were set, each time, based on nonstaining cells and negative isotypic controls. additionally, fluorescence compensation adjustments were performed based on single - labelled samples. 1:representative flow cytometry protocol to determine v repertoire of total cd8 + t - lymphocyte and subpopulations. peripheral blood mononuclear cells from cutaneous leishmaniasis patients were stained ex vivo with cd3-allophycocyanine - cyanine (apc) 7, cd8-apc, cd45ra - pe - texas red, cd27-pe - cyanine 7 and 24 different anti - v monoclonal antibodies conjugated with fluorescein isothiocyanate (fitc), phycoerythrin (pe) and fitc - pe. the lymphocytes were gated on forward (fsc) vs. side (ssc) scatter dot - plot (a) and cd8 + t - lymphocytes were defined by double positive staining to cd3 and cd8 (cd3+cd8 +) (b). based on lymphocyte gate we analysed the expression of three different v families (in each of the 8 tubes) (c) and cd8 + t lymphocyte subsets were defined by cd45ra and cd27 staining as late - differentiated effector (lde) (cd45ra+cd27-), early - differentiated (nave) (cd27+cd45ra+), late - differentiated effector memory (em) (cd45ra - cd27-) and central memory (cm) (cd45ra - cd27 +) (d). we also performed the v analysis of nave (e), lde (f), em (g) and cm (h) cd8 + t - lymphocytes. statistical analysis - for a comparison of the means between groups, the mann - whitney u nonparametric test was applied. correlation analyses were performed using spearman s correlation coefficient and were reported with its associated r and p - value. all statistical calculations and graphical representations of data were obtained using the graphpad prism v.5.0 software (graphpad software inc, usa). clinical characteristics of cl patients - all patients were from endemic areas in rj and were included in this study after informed consent and donation of peripheral blood. all cl patients received glucantimetherapy, as suggested by the brazilian ministry of health (svs / ms 2010) and, at the end of therapy, all of them showed epithelialised lesions with an absence of erythema and were considered clinically cured. the duration of lesion ranged from one - six months and the largest measured diameter of the ulcers varied from 15 - 60 mm (mean 42.18 12.51 mm). basic demographic and clinical information of the studied groups are summarised in table. tableclinical information of patients included in this study hspadpccvolunteers (n) sex (m / f)18 11/714 9/511 8/3age (years)29 9.735.7 13.441 15.1lesions (n)na11diameter of lesion [(mm) mean sd]na42 12.5141.4 13.98mst (mm) duration of disease [(months) median (range)]na na11.71 3.6 2 (1 - 6)12.3 3.68 2 (1 - 5)hs : healthy subjects ; m / f : male / female ; mst : montenegro skin test ; na : not applicable ; pad : patients with active disease ; pcc : patients clinical cured ; sd : standard deviation. hs : healthy subjects ; m / f : male / female ; mst : montenegro skin test ; na : not applicable ; pad : patients with active disease ; pcc : patients clinical cured ; sd : standard deviation. definition of tcr - v repertoire of total cd8 t - lymphocytes - due to the diversity of the cd8 t - lymphocyte tcr repertoire, the antigenic specificity of these cells and the role they play in a cl - associated immune response is of fundamental importance to assess the preferential expression of certain clones, associating them with active disease and the healing process. to this end, we determined the frequency of total cd8 t - lymphocytes expressing 24 tcr v chains in cl pad and pcc as well as in hs. in these three groups, we observed a polyclonal distribution of these v families. in a comparative analysis between groups, we observed a significant difference in frequencies of total cd8 t - lymphocytes expressing v2, v9, v13.2, v18 and v23 chains in pad compared to hs and/or to pcc (fig. 2). pad showed lower frequencies of cd8t - cells expressing v2 (mean 2.5% 1.9%) and v13.2 regions (mean 1.8% 1.5%) compared to hs (v2 : mean 5.6% 3.1% ; v13.2 : mean 3.8% 1.6% ; p < 0.01 and p < 0.05, respectively). conversely, pad showed higher frequencies of cd8 t - lymphocytes expressing v9 (mean 2.9% 0.6%) and v18 (mean 1.8% 0.4%) when compared to hs (v9 : mean 0.6% 0.1% ; v18 : 0.3% 0.1% ; p < 0.05 and p < 0.01, respectively). these results suggest that during the active phase of disease there is a down - modulation in the frequencies of cd8 t - lymphocytes expressing v2 and v13.2 and an up - modulation of cd8 t - lymphocytes expressing v9 and v18. in pcc, the normal distribution of v18 appears to be restored, whereas frequencies of cd8 t - lymphocytes expressing v9 remain high. in contrast, pcc showed higher frequencies of total cd8 t - lymphocytes expressing v18 (mean : 1.3% 0.4%) and v23 (mean 4.1% 1.7%) when compared to hs (v18 : mean 0.3% 0.1% ; v23 : mean 1.3% 1% ; p < 0.05 and p < 0.01, respectively), whereas the frequency of cd8 t - lymphocytes expressing v13.2 was higher (3.6% 0.85%) when compared to pad (mean 1.8% 1.5% ; p < 0.05) (fig. 2:24 v chain repertoire profile of total cd8 + t - lymphocytes. a : v chains 1 - 7.1 ; b : v chains 7.2 - 13.6 ; c v chains 14 - 23. statistical analyses were performed by mann - whitney u test. hs : healthy individuals (white bars ; n = 18) ; pad : patients with active disease (grey bars ; n = 14) ; pcc : patients clinically cured (black bars ; n = 11) ; : p < 0.05 ; : p < 0.01. evaluation of tcr - v repertoire of memory, lde and nave cd8 t - lymphocyte subsets - to evaluate a link between the type of cd8 t subsets and the diversity of the v repertoire of these cells, we also performed a detailed analysis of the distribution and alterations of v repertoire in nave and lde, cm and em cd8 t - lymphocytes in cl patients and hs. these frequencies were obtained by a gating strategy according to the expression of cd45ra and/or cd27 (see subjects, materials and methods) : cd27cd45ra (nave), cd45racd27(lde), cd45racd27- (em) and cd45racd27 (cm) (fig. 1). the subset analysis showed a polyclonal distribution of tcr v repertoires ; hence, all 24 v chains were expressed in the tcr of these four subpopulations (data not shown). frequencies of lde cd8 t - lymphocytes expressing v12 and v22 in cl patients - an analysis of the v repertoire of lde cd8 t - lymphocytes revealed that two v families appeared to expand in the lde cd8 t - lymphocyte subset from cl patients. pad showed higher frequencies of lde cd8 t - lymphocytes expressing v12 (mean 3.8% 1.5%), when compared to both hs (mean 1.1% 0.8% ; p < 0.001) and pcc (mean 2.3% 1.1% ; p < 0.05) (fig. similarly, the frequency of lde cd8 t - lymphocytes expressing v22 was higher in pad (mean 2.1% 1.5%) when compared to hs (mean 0.2% 0.5% ; p < 0.001) and to pcc (mean 1.7% 0.9% ; p < 0.01) (fig. 3:percentage of late - differentiated effector (lde) cd8 + t - lymphocyte expressing v12 (a) and v22 (b). hs : healthy subjects (n = 18) ; pad : patients with active disease (n = 14) ; pcc : patients clinically cured (n = 11) ; : p < 0.05 ; : p < 0.01 ; : p < 0.001. cl patients exhibited higher frequencies of em cd8 t - cell subsets expressing v22 and lower frequencies of both em and cm cd8 t - cell subsets expressing v2 - evaluating em cd8 t - lymphocytes expressing v22, we observed a pronounced clonal expansion in the active cl, as pad showed higher frequencies (mean 2.6% 0.1%) when compared to hs (mean 0.7% 0.1% ; p < 0.001). notably, pcc (mean 0.9% 0.3%) showed similar frequencies of this subset in expressing v22 when compared to hs and lower frequencies compared to pad (p < 0.01) (fig. em cd8 t - cells expressing v2 have lower frequencies in pad (mean 1.6% 0.4% ; p < 0.01) and also in pcc (mean 0.9% 0.2 ; p < 0.01) when compared to hs (3.3% 0.3%) (fig. this contraction of the v2 family was also observed in cm cd8 t - lymphocytes from pcc (mean 2.4% 0.4%) and in pad (mean 1.4% 0.3%), showing lower frequencies of these cells when compared to hs (mean 4.5% 0.3% ; p < 0.01 and p < 0.001, respectively) (fig. another contraction could also be observed in cm cd8 t - lymphocyte clones expressing v 13.2, as pad presented lower frequencies of these cells (mean 0.9% 0.2%) when compared to both hs (mean 2.2% 0.3% ; p < 0.01) and pcc (mean 2.6% 0.3% ; p < 0.001) (fig. 4:percentage of late - differentiated effector memory (em) cd8 + t - lymphocyte expressing v2 (a) and v22 (b) and of central memory (cm) cd8 + t - lymphocyte expressing v2 (c) and v13.2 (d). hs : healthy subjects (n = 18) ; pad : patients with active disease (n = 14) ; pcc : patients clinically cured (n = 11) ; : p < 0.01 ; : p < 0.001. lower frequencies of cd8 t - cells expressing v2 correlate with larger lesion size - due to relationship between clinical features and immune response in cl, we verified whether the frequency of cd8 t - cell expressing v2, v12, v13.2 and v22 was associated with the size of the cl lesion. an analysis of the pad data revealed an inverse correlation between frequencies of em and cm cd8t - cells expressing v2 and lesion size ; the greater the lesion size, the lower the frequency of em and cm cd8 t - lymphocytes expressing v2 (fig. 5). no statistically significant correlation was observed in pcc and in other evaluated v families. 5:correlation analysis between lesion size and frequency of effector memory (em) (a) and central memory (cm) (b) cd8 + t - lymphocyte expressing v2. the lesion size is correlated negatively with frequency of em cm cd8 + t -lymphocytes from patients with active disease (n = 14). the central line represents medians values and the graphs show the best fitted lines with 95% confidence interval. the analysis of the t - cell profiles involved in local or systemic immune responses has been shown to be very important in clarifying many immunoclinical phenomena, including autoimmunity, response to viral or bacterial superantigens, alloimmunity and tumour immunity (gorski. the establishment of an effective immune response against the protozoanleishmania spp is essential to limit or prevent tissue damage and is responsible for cl outcomes. an important characteristic of cl is that most patients, especially in rj, have a satisfactory response to antimonial therapy (de oliveira - neto. therefore, the treatment may be associated with the development of an efficient immune response that is able to control the infection. cl immune response leads to lesion resolution mainly through cd4 t - helper 1 lymphocytes with activation of cd8 t - cells and macrophages / dendritic cells via cytokine production (da - cruz. this response is characterised by an antigenic presentation with the involvement of particular v families to guide to antigen - specific immunological events, including t - cell activation and the triggering of effector and regulatory mechanisms. some authors suggest that cd8 t - lymphocytes have a central role in the process of healing cl resolution (bertho. another study suggests that the high frequencies of cd8 t - lymphocytes in the cl lesion milieu support the hypothesis that these cells may be involved in the healing process of lesions (da - cruz. 2005) and the ifn- production of cd8 t - lymphocytes correlates with the control of infection (rostami. in contrast, some reports have suggested that cytotoxicity may be involved in cl pathology (novais. 2015) and others have shown that the high expression of ifn- increases cytotoxic activity, which may be responsible for the lack of control of the inflammatory response in mucosal leishmaniasis (faria. thus, faced with the paradoxical role of cd8 t - cells linked to immune responses in cl (novais & scott 2015), we may assume that a particular expansion or contraction of specific v in cd8 t - lymphocyte tcr may be associated with disease control or its progression. the analysis of individual t - cell subsets based on their tcr expression is a powerful tool for studying t - cell responses, allowing for the evaluation of the diversity and distribution of different clones in peripheral blood from cl patients. our analysis of the total cd8 t - lymphocyte v repertoire revealed a polyclonal distribution that includes the expression of 24 different v chains by all studied individuals. although all v families included in our study were expressed by cd8 t - cells, we observed a heterogeneity in the frequency of expression of different families that comprise the repertoire, as some chains, such as v3 and v8, had a tendency to be more frequently expressed in the three studied cohorts, whereas others, such as v16 and v18, were less frequently expressed. these data corroborate those reported by others, showing that cd4 and cd8t - lymphocytes from healthy individuals present a nonrandom usage profile of v families (giacoia - gripp. considering that the v repertoire of healthy individuals may serve as a parameter for comparing the v repertoire in cl patients, we may observe a modulation of the repertoire of cd8 t - lymphocytes both in pad and pcc, suggesting an oligoclonal induction of these lymphocytes. according to our analysis of the total cd8t - cell compartment, we observed a disturbance in the expression of some clones / families of tcr / v repertoire, such as that of the v2, v9, v13.2, v18 and v23 families, which showed lower or higher frequencies in cl patients when compared to hs. this may indicate that these clones are involved in the response against l. braziliensis. it is important to highlight that few v chains have been associated with immunopathogenesis of cl to date. in the lesions ofl. braziliensis - infected patients, the expansion of v6 has already been observed (uyemura. 1993) and, in another report, it was suggested that t - lymphocytes expressing v12 are involved in the cl immune response (clarncio. moreover, exposure to leishmania guyanensispreferentially induces cd8 t - lymphocytes expressing v14 (kariminia. in contrast, in chagas disease patients, the preferential expression of v3.1 (menezes. 2004) and v5 (costa. 2000) may be associated with the pathology of this disease. knowing that nave and effector lde, cm and em subsets are inserted in the pool of total cd8 t - lymphocytes, some expansions and contractions of v regions in these subsets may be missed in general population analysis. in this context, a particular evaluation of these cd8t - lymphocyte subset frequencies and their profiles is of great interest to investigate the involvement of specific clones of cd8 t - lymphocyte subsets expressing a particular tcr / v region in the immune response context. therefore, the disturbance of the total cd8 t - lymphocyte repertoire was also observed in at least one of the four analysed cd8 t - lymphocyte subsets, except v18. hence, we determined that these repertoire perturbations may be subset - specific and should be studied individually in each subpopulation, as this expression is not observed in total cd8 t - lymphocyte populations. proposing to more clearly understand the differentiation status of specific subsets of cd8 t - lymphocytes based on v expression, we performed v repertoire analysis of lde, nave, em and cm cd8 t - lymphocytes. the distribution of v-clone cd8t - lymphocyte subsets in the cl patients had not yet been described and an evaluation of differences between the frequencies of these subsets represent one possible method for assessing the role of these cell populations in the cl immune response. t - lymphocytes directly involved in antigen recognition and specific responses may be led to clonal expansion in response to antigenic presentation or to contraction due to chronic re - stimulation and subsequent t - cell death (menezes. 2004, keesen. 2011). in the present report, we observed high frequencies of lde cd8 t - lymphocytes expressing v12 and v22 in pad, which led us to hypothesise that this cell clone selection may be related to this phase of the disease and to the lde roles of these cells. 2006) that showed that the expansion of cd4 and cd8 t - lymphocytes expressing v12 in cl patients was associated with an in vitro proliferation in response to the l. amazonensis antigen. moreover, in vaccinated individuals, the increase in ifn- production by cd4 and cd8t - lymphocytes was associated with higher frequencies of both t - cells expressing v12. in a more recent study, increased frequencies of cd4 t - lymphocytes expressing v12 after stimulation of pbmc in infected cl patients with solublel. these findings suggest that v12 could be expanded by different species of leishmania and could be related to the lde status in cl immune responses (keesen. taking all these data together, we contend that v12 is actually involved in the anti - leishmania t - cell response and that cd8 t - lymphocytes expressing v12 have a central role in the leishmania - specific immune response displaying a lde profile. because pcc showed lower frequencies of lde cd8 t - lymphocytes expressing v12, we hypothesise that these clones are down - modulated after clinical cure. moreover, we were unable to confirm that cd8 t - lymphocytes expressing v12 were associated with protective or deleterious effects, but the lde cd8 t - cells expressing v12 appear to be selected for during active disease, suggesting an involvement of these clones in the cl immune response. a similar phenomenon was observed in the lde cd8 t - lymphocyte subpopulation expressing v22 in pad, suggesting that these clones, as well as v12 cd8 + t - cells, may be associated with a lde role during the active phase of cl. moreover, these v22-expressing clones may be activated and/or differentiated in em cd8 t - lymphocytes, as we observed an expansion of these effector - memory cells expressing v22 during active disease. thus, notably, these data indicate that cd8t - cells expressing v22 may be a candidate clone involved in the effector response as well as in the protective immune response in cl. in contrast, we observed a contraction of em cd8 t - lymphocytes expressing v2 in pad. (2006), who showed that total cd8t - lymphocytes expressing v2, when cultured in the presence of antigens ofl. amazonensis, had a decrease in their frequencies compared to cells cultured without antigen stimulation. these authors attributed such decrease to the apoptosis of these clones after their antigenic stimulation. remarkably, we also observed this decrease in the frequencies of cm cd8 t - lymphocytes expressing v2 from pad and the frequency of these clones appears to be restored in pcc. conversely, pcc showed a lower frequency of em expressing v2 when compared to pad and hs, suggesting a down - modulation of these clones in different subsets, depending on the stage of disease. (2004) identified a decrease in the frequency of activated - cd28-cd8 t - lymphocytes expressing v2 in patients with chagas disease. although leishmania andtrypanosoma are different parasites and drive different pathologies, it is relevant that activated and/or lde cd8t - lymphocyte expressing v2 may be modulated and have a key role in the immune response occurring in these two distinct pathologies. an analysis of the cm cd8 t - lymphocyte repertoire revealed observed small frequencies v2 cd8 t - cells from pad, suggesting a selected down - modulation of these clones in both memory subsets of cd8t - lymphocytes. additionally, the largest lesions found in cl patients were correlated to the low frequency found in em and in cm cd8 t - lymphocytes expressing v2. because lesion size characterises the severity of disease and is considered to be the most significant clinical feature of cl (oliveira. 2011), the low frequency of these memory subsets expressing v2 may be associated with the development or maintenance of the lesions. we still observed low frequencies of both memory subsets expressing v2 in pad, suggesting that these memory cd8 t subsets are down - modulated during active disease. we therefore hypothesise that cd8 t - lymphocytes expressing v2 are an important clone in the protective immune response. in conclusion, we have demonstrated that distinct cd8 t - lymphocyte subsets expressing specific v families are involved in the immune response of cl patients infected with l. braziliensis. particular v expansions suggest that determined tcr / v clones of cd8 t - lymphocytes are selected during the cl immune response during disease and/or after antimonial therapy, supporting the hypothesis that cd8 t - lymphocytes expressing v12 and v22 are involved in a lde anti - leishmania immune response. in contrast, the tcr / v2 contractions in memory cd8 t subsets appear to be a result of the down - modulation of these clones during active disease, which was associated with tissue damage. the identification of antigens inleishmania that activate specific v clones is still lacking and we hope that our results contribute to the definition of preferentially used immunodominant antigens. we therefore argue that expansions or contractions of cd8t - cells expressing v12, v22 and v2 play an important role in the anti - leishmania immune response. moreover, the information gleaned by our study clearly points to specific clonally related cd8 + t subpopulations recruited by the immune system, with the aim of killingleishmania parasites, leading to the resolution of human cl. | in human cutaneous leishmaniasis (cl), the immune response is mainly mediated by t - cells. the role of cd8 + t - lymphocytes, which are related to healing or deleterious functions, in affecting clinical outcome is controversial. the aim of this study was to evaluate t - cell receptor diversity in late - differentiated effector (lde) and memory cd8 + t - cell subsets in order to create a profile of specific clones engaged in deleterious or protective cl immune responses. healthy subjects, patients with active disease (pad) and clinically cured patients were enrolled in the study. total cd8 + t - lymphocytes showed a disturbance in the expression of the v2, v9, v13.2, v18 and v23 families. the analyses of cd8+t - lymphocyte subsets showed high frequencies of lde cd8+t - lymphocytes expressing v12 and v22 in pad, as well as effector - memory cd8 + t - cells expressing v22. we also observed low frequencies of effector and central - memory cd8 + t - cells expressing v2 in pad, which correlated with a greater lesion size. particular v expansions point to cd8 + t - cell clones that are selected during cl immune responses, suggesting that cd8 + t - lymphocytes expressing v12 or v22 are involved in a lde response and that v2 contractions in memory cd8+t - cells are associated with larger lesions. |
it has been suggested previously that the malignant potential of prostate cancer correlates strongly with the size of the primary cancer. reflecting this, numerous studies have also shown that prostate cancer volume correlates with other prognostic indicators and with progression after radical prostatectomy. these observations suggest that obtaining an accurate estimation of tumor volume preoperatively might aid the treatment decision. however, it remains difficult to estimate tumor volume preoperatively on the basis of clinical parameters such as preoperative biopsy data. indeed, there is often significant discord between the extent of cancer detected on biopsy and the tumor volume in the final surgical specimen. moreover, although prostate - specific antigen (psa) is the most widely used tumor marker in clinical practice for the diagnosis, staging, and monitoring of prostate cancer, psa associates only weakly with prostate cancer volume in men treated by radical prostatectomy. the aim of this study was to determine whether it is possible to estimate tumor volume on the basis of preoperative clinical variables and whether such predicted tumor volumes could predict pathologic stage in patients who undergo radical prostatectomy. for this purpose, we developed a regression model composed of several preoperative variables to predict total tumor volume. approval of the study was obtained from the institutional review board of our institution. between 2000 and 2004, 260 radical retropubic prostatectomies for the treatment of prostate cancer were performed at a single institution. the clinical and pathologic data of these patients were obtained from our surgical database and were reviewed retrospectively. patients with positive lymph nodes and who had received neoadjuvant or immediate adjuvant androgen ablation or radiotherapy were excluded from the study. individuals who visited our department for a variety of reasons, such as prostate cancer screening or because of voiding symptoms, were enrolled regardless of whether the visit was primary or referred. patients with high serum psa levels or abnormal digital rectal examination (dre) findings underwent a 12-core needle biopsy ; all biopsies were performed by a single radiologist. the patients ' median age at the time of surgery was 67.2 years (range, 41.8 - 80.7 years). the median preoperative psa level was 8.1 ng / ml (range, 0.7 - 98.0 ng / ml). none of the patients had evidence of nodal disease or distant metastasis on either contrast - enhanced computed tomography or bone scans. the presence of carcinoma in needle biopsy tissue was assessed by a single pathologist (k.c.m). gleason primary and secondary grades with sum scores were assigned, and the number of core biopsy specimens that contained carcinoma was quantified. the radical prostatectomy specimens were handled and processed in a standard manner, in which all prostatic tissue was embedded as previously described. the total tumor volume and the tumor volume of each cancer focus were calculated by using the formula 0.4 length width cross - sectional thickness, i.e., number of cross sections section thickness. the pathologic stages were determined on the basis of the 2002 tnm classification, and a positive surgical margin was defined as the presence of cancer cells in the inked surface of the prostate specimen. the median follow - up period was 17.9 months (range, 1.0 - 75.3 months). biochemical recurrence was defined as detectable psa levels (greater than 0.2 ng / ml on least two occasions), and the time of biochemical recurrence was taken to be the first time psa became detectable. pearson correlation coefficients for the relations between clinical parameters and total tumor volume were generated. stepwise multivariate linear regression was performed to develop a model for predicting tumor volume before radical retropubic prostatectomy. the regression model in this study included age, body mass index, serum psa, biopsy gleason score, number of positive biopsy cores, and clinical stage. differences in tumor volume (v) were calculated by subtracting observed tumor volume (v1) from predicted tumor volume (v2). these differences were plotted against the mean volume by using the approach described by bland and altman : v=(v2-v1)2/(v2+v1). the receiver operating characteristic (roc) curve was used to indicate the ability of the predicted tumor volume to predict several pathologic parameters, namely, extracapsular extension, seminal vesicle invasion, and positive surgical margin. for this, areas under the roc curves were estimated. determining the area under the curve is a suitable way to summarize the overall discriminatory or diagnostic value of a model : the area can range from 0.5 (equivalent to flipping a coin, namely, a useless model) to 1.0 (perfect discrimination). the more the area under the roc curve approached 100% (i.e., the more the roc curve approached the upper left corner), the greater the predictive power. the kaplan - meier method was used to calculate the biochemical recurrence - free survival by predicted tumor volume. all statistical analyses were performed with spss ver. 17.0 (spss inc., chicago, il, usa) programs. approval of the study was obtained from the institutional review board of our institution. between 2000 and 2004, 260 radical retropubic prostatectomies for the treatment of prostate cancer were performed at a single institution. the clinical and pathologic data of these patients were obtained from our surgical database and were reviewed retrospectively. patients with positive lymph nodes and who had received neoadjuvant or immediate adjuvant androgen ablation or radiotherapy were excluded from the study. individuals who visited our department for a variety of reasons, such as prostate cancer screening or because of voiding symptoms, were enrolled regardless of whether the visit was primary or referred. patients with high serum psa levels or abnormal digital rectal examination (dre) findings underwent a 12-core needle biopsy ; all biopsies were performed by a single radiologist. the patients ' median age at the time of surgery was 67.2 years (range, 41.8 - 80.7 years). the median preoperative psa level was 8.1 ng / ml (range, 0.7 - 98.0 ng / ml). none of the patients had evidence of nodal disease or distant metastasis on either contrast - enhanced computed tomography or bone scans. the presence of carcinoma in needle biopsy tissue was assessed by a single pathologist (k.c.m). gleason primary and secondary grades with sum scores were assigned, and the number of core biopsy specimens that contained carcinoma was quantified. the radical prostatectomy specimens were handled and processed in a standard manner, in which all prostatic tissue was embedded as previously described. the total tumor volume and the tumor volume of each cancer focus were calculated by using the formula 0.4 length width cross - sectional thickness, i.e., number of cross sections section thickness. the pathologic stages were determined on the basis of the 2002 tnm classification, and a positive surgical margin was defined as the presence of cancer cells in the inked surface of the prostate specimen. the median follow - up period was 17.9 months (range, 1.0 - 75.3 months). biochemical recurrence was defined as detectable psa levels (greater than 0.2 ng / ml on least two occasions), and the time of biochemical recurrence was taken to be the first time psa became detectable. pearson correlation coefficients for the relations between clinical parameters and total tumor volume were generated. stepwise multivariate linear regression was performed to develop a model for predicting tumor volume before radical retropubic prostatectomy. the regression model in this study included age, body mass index, serum psa, biopsy gleason score, number of positive biopsy cores, and clinical stage. differences in tumor volume (v) were calculated by subtracting observed tumor volume (v1) from predicted tumor volume (v2). these differences were plotted against the mean volume by using the approach described by bland and altman : v=(v2-v1)2/(v2+v1). the receiver operating characteristic (roc) curve was used to indicate the ability of the predicted tumor volume to predict several pathologic parameters, namely, extracapsular extension, seminal vesicle invasion, and positive surgical margin. for this, areas under the roc curves were estimated. determining the area under the curve is a suitable way to summarize the overall discriminatory or diagnostic value of a model : the area can range from 0.5 (equivalent to flipping a coin, namely, a useless model) to 1.0 (perfect discrimination). the more the area under the roc curve approached 100% (i.e., the more the roc curve approached the upper left corner), the greater the predictive power. the kaplan - meier method was used to calculate the biochemical recurrence - free survival by predicted tumor volume. all statistical analyses were performed with spss ver. 17.0 (spss inc., chicago, il, usa) programs. the patient characteristics are listed in table 1. of the 236 patients, 200 (84.7%) were deemed to have clinically localized prostate cancer (t1-t2, n0) on the basis of the initial physical and radiographic evaluation. however, after surgery, extracapsular extension was detected in 74 (31.4%), seminal vesicle involvement was observed in 26 (11.0%), and 75 (31.8%) had positive surgical margins. correlation coefficients between the tumor volume that was determined after radical prostatectomy and various clinical parameters were obtained. the correlations between observed tumor volume and body mass index or biopsy gleason score were low (0.153 and 0.283, respectively). the number of positive biopsy cores correlated more strongly with observed tumor volume (r=0.489, p<0.001). the highest correlation (r=0.677, p<0.001) was found between serum psa and observed tumor volume (table 2). moreover, when the patients were divided into two groups on the basis of clinical stage, the two groups differed significantly in terms of observed tumor volume (6.40.6 for patients with < ct3a vs. 11.31.9 for those with ct3a, p=0.020). the relation between these clinical parameters and observed tumor volume was explored by multiple linear regression analysis. by using the stepwise method described earlier, all explanatory variables were eliminated except for psa and the number of positive biopsy cores. there was a strong correlation between predicted tumor volume and observed tumor volume (r=0.722, p<0.001) (fig. the mean difference in volume measurements was 0.3 ml (range, -1.4 - 1.7 ml ; 95% confidence interval : -0.9 - 1.5 ml) (fig. 2 presents the areas under the roc curves, which indicate the ability of predicted tumor volume to predict pathologic stage. the areas under the roc curves of predicted tumor volume were 68.5% for extracapsular extension, 75.7% for seminal vesicle invasion, and 70.4% for positive surgical margin. the sensitivity and specificity with which various predicted tumor volume levels predicted pathologic stage are also shown in fig. 3 shows the kaplan - meier curves of patients categorized according to predicted tumor volume. the curves revealed that predicted tumor volume correlated significantly with biochemical recurrence - free survival (p<0.001 ; log - rank test) when the patients were stratified into two groups according to the median value (i.e., less than 5 ml or 5 ml or greater). to validate the above formula, the data for another cohort of patients who underwent radical retropubic prostatectomy (n=284), this time between 2005 and 2006, were obtained and reviewed. there was a significant correlation between the predicted tumor volume calculated by using the above formula and the observed tumor volume (r=0.638, p<0.001) (fig. the mean differences in volume measurements amounted to 0.3 ml (range, -1.3 - 2.0 ml ; 95% confidence interval : -0.9 - 1.6 ml) (fig. the patients in our series are not representative of most patients seen today in north america and western europe, where 75% of those who receive a diagnosis of prostate cancer have nonpalpable disease and tumor volumes that are smaller than those observed in our series. consequently, we performed subgroup analysis by using 66 of the 159 patients whose observed tumor volume was <3 ml. there was a weak correlation between predicted tumor volume and observed tumor volume (r=0.277, p=0.024) (fig. the mean difference in volume measurements was 0.9 ml (range, -0.5 - 2.0 ml ; 95% confidence interval : 0.9 - 1.8 ml) (fig. the size of a tumor is an important reflection of its biology, which is why tumor size has been reported to correlate directly with disease extent and to be an important prognostic indicator for prostate cancer. for example, bostwick found that progression from capsular invasion to seminal vesicle invasion and finally metastasis was linked to increasing tumor volume. others have also noted that small - volume tumors rarely progress, whereas large - volume tumors progress more frequently. however, a method for accurately estimating the tumor volume of prostate cancer before radical prostatectomy is still lacking. although serum psa correlates with cancer volume, its ability to predict tumor size on its own is poor. radiologic imaging techniques often underestimate the tumor volume or even fail to detect the tumor. although histologic grade has been shown to correlate with actual tumor volume, we found that the gleason score derived from preoperative biopsies correlated poorly with the actual tumor volume. furthermore, the needle biopsy - based gleason score was not an independent explanatory variable for tumor volume in this study. because the total tumor volume in the radical prostatectomy specimen correlates with disease extent and may help to predict tumor aggressiveness, we asked whether preoperative parameters could serve collectively to predict preoperative tumor volume. two variables, namely, serum psa and the number of positive needle biopsy cores, were found to be most highly predictive of observed tumor volume. these observations are similar to those made in other studies that investigated the predictive power of tumor extent on needle biopsies. for example, ogawa found that the number of cancer - positive biopsy cores and serum psa were independently predictive of organ - confined disease. moreover, egawa reported that the number of cores with cancer is jointly predictive of extraprostatic extension in a model that incorporates psa, clinical stage, and gleason score. in addition, wills showed that gleason score and the number of cancer - positive cores were the two best predictors of pathologic stage. recently, ochiai found that the number of positive cores obtained during extended biopsy may be a tool for predicting the biological significance of prostate cancer. although actual tumor volume helps to predict tumor aggressiveness, its calculation is time consuming and requires much effort. there are several different ways of estimating the size of tumors in radical prostatectomy specimens, but these methods are not suitable for routine clinical practice. when we established a regression model in which tumor volume was the dependent variable and the predicted tumor volume was the explanatory variable, the regression coefficient was significant at the 5% level with an adjusted r2=0.521. first, because this study was conducted retrospectively, it may suffer from the typical biases of such research, including referral, selection, and inclusion biases. second, at the time of analysis, the median follow - up period of the cohort was only 17.9 months, which hampered our ability to analyze the associations of predicted tumor volume with progression variables. third, the percentage of needle biopsy core length that involved tumor was not reported consistently in our series, which meant that we could not analyze the relationship between this variable and predicted tumor volume. it may be that the percentage of cores with adenocarcinoma is useful for predicting the outcomes of pathologic or biochemical recurrence. however, this limitation may be less serious because the number of positive cores may indicate tumor extent in needle biopsy specimens more quantitatively and reproducibly than visual inspection estimates of the percentages of prostate needle biopsy tissue that contains carcinoma. furthermore, the prostate gland was typically sampled by 12-core biopsies in the present study. increased sampling may improve the ability of tumor extent in needle biopsy specimens to accurately reflect whole - gland tumor volume. the prediction of pathologic stage is a key element in prostate cancer treatment decision - making. we found that tumor volume predicted on the basis of psa levels and the number of positive biopsy cores predicted pathologic stage with reasonable accuracy. thus, this method of preoperatively predicting tumor volume may improve the decision- making regarding patients with prostate cancer. | purposethe purpose of this study was to evaluate whether predicted tumor volume could predict pathologic stage in patients undergoing radical prostatectomy.materials and methodsthe clinical and pathologic data of 236 patients who underwent a 12-core needle biopsy followed by radical prostatectomy were obtained from our database and reviewed retrospectively.resultsobserved tumor volume correlated best with serum prostate - specific antigen (psa) level (r=0.677, p<0.001) and the number of positive biopsy cores (r=0.489, p<0.001). stepwise multiple linear regression analysis was used to develop a model for predicting tumor volume before radical prostatectomy. all explanatory variables except psa and the number of positive biopsy cores were eliminated, yielding the equation ([predicted tumor volume]=0.381x[psa]+0.921x[no. of positive biopsy cores]-0.992). tumor volume predicted by this equation correlated strongly with observed tumor volume (r=0.722, p<0.001). this was also true when a different cohort of 159 patients was analyzed (r=0.638, p<0.001). the areas under the receiver operating characteristic curves of predicted tumor volume were 68.5% for extracapsular extension, 75.7% for seminal vesicle invasion, and 70.4% for positive surgical margin. kaplan - meier curves revealed that predicted tumor volume correlated significantly with biochemical recurrence - free survival (p<0.001 ; log - rank test).conclusionsour findings suggest that tumor volume predicted on the basis of psa levels and number of positive biopsy cores may predict pathologic stage with reasonable accuracy. |
the whi was designed to address the major causes of morbidity and mortality in postmenopausal women (18), including both multicenter clinical trials and an observational study. details of the scientific rationale, eligibility requirements, and baseline characteristics of the participants in the whi have previously been published (1923). briefly, a total of 161,808 women ages 5079 years were recruited at 40 clinical centers throughout the u.s. between 1 september 1993 and 31 december 1998. the whi clinical trial includes four overlapping components : two hormone therapy trials (27,347 women), a dietary modification trial (48,835 women), and a calcium / vitamin d supplementation trial (36,282 women). participants in the observational study included 93,676 women who were screened for the clinical trials but proved to be ineligible or unwilling to participate or were recruited through a direct invitation for the observational study. the study was overseen by institutional review boards at all 40 clinical centers and at the coordinating center, as well as by a study - wide data- and safety - monitoring board. the following participants were excluded from the original cohort of 161,808 for this analysis : 14,849 women who had a history of cancer (except nonmelanoma skin cancer) at baseline, 783 women who enrolled in whi but provided no follow - up information, 217 women who were diagnosed with diabetes before age 20 years and/or who were ever hospitalized for diabetic coma (these were deemed likely to have type 1 diabetes diagnosis and not comparable), and 194 women who had missing values of the main exposures (including diagnosis of diabetes, age at diagnosis, and diabetes treatment). prevalence of diabetes at enrollment was defined by a positive answer to the following question : did a doctor ever say that you had sugar diabetes or high blood sugar when you were not pregnant ?. treated diabetes at enrollment was defined as the participant reporting ever having been treated for diabetes with pills or insulin shots. information on diabetes drug therapy was collected at baseline, when women were instructed to bring all medications that they had used at least once in the previous 2 weeks for review. all medications were matched to the master drug database (mddb ; medi - span, indianapolis, in). women with diabetes were categorized into four mutually exclusive groups based on the drug inventory information : 1) no diabetes medication, 2) metformin alone use, 3) other oral medication use alone (without insulin), and 4) insulin use (alone and with oral medication). thus, for example, if the inventory listed both metformin and insulin, we grouped it into the insulin use group. the duration of diabetes at enrollment was based on the difference between age of the participant when first diagnosed with diabetes and age at enrollment. self - reported type of treatment for diabetes at enrollment was also created by combining the self - reported variables at enrollment : diabetes status and treatment information for diabetes. it was categorized as 1) no diabetes, 2) diabetes not treated with medication, 3) diabetes treated with oral medications alone, and 4) diabetes treated with insulin (alone and with oral medication). incidence of medically treated diabetes was also determined during whi follow - up. the definition of incident diabetes was a positive response to the question on either the semiannual or annual follow - up questionnaires : since the date given on this form has a doctor prescribed for the first time any of the following pills or treatments ?, and subsequent selection of any of the following responses : pills for diabetes, insulin shots for diabetes, or (after 2005) diet and/or physical activity for diabetes. diagnosis of diabetes based on participant self - report was previously evaluated and deemed reliable. a validation study using a randomly selected sample of baseline specimens from the entire whi population has shown that fasting glucose levels 126 mg / dl were seen in 3.4% of 5,884 women without self - reported diabetes. in the clinical trials, 79% of women who self - reported treated diabetes at baseline had a diabetes medication in the baseline medication inventory. in addition, a recent validation study using 715 medical record reviews confirmed 92% of self - reported prevalent diabetes and evidence of diabetes was found in only 5% of women who did not report diabetes (25). incident lung cancer cases were identified by self - administered questionnaires (administered every 6 months in the clinical trial through 2005 and annually in the clinical trial after 2005 and in observational study), with all cases confirmed by medical record review. all primary lung cancer cases were then coded centrally in accordance with the surveillance epidemiology and end results coding guidelines (icd - o code 34.034.9). in the multivariable models, we considered a series of potential confounders based on literature, which were also similar to those considered in a previous publication (26), including age at enrollment (< 55, 5559, 6064, 6569, 7074, and 75 years), ethnicity (american indian or alaska native, asian or pacific islander, black or african american, hispanic / latino, non - hispanic white, and other), education (high school or less, some college / technical training, college or some postcollege, and master s or higher), smoking status (never, former [including years since quitting : 30, 2029, 1019, and < 10 ], and current [including cigarettes smoked per day : < 5, 514, 1524, and 25 ]), bmi (< 18.5, 18.524.9, 25.029.9, 30.034.9, 35.039.9, and 40 kg / m), waist - to - hip ratio (in quintiles), recreational physical activity (total mets per week : < 5, 5 to < 10, 10 to < 20, 20 to < 30, and 30), alcohol intake (nondrinker, past drinker, < 1 drink / month, and current drinker [including frequency : < 1 drink / month, 1 drink / month to < 1 drink / week, 1 to < 7 drinks / week, and 7 drinks / week ]), total energy intake (kilocalories in quintiles), percent calories from fat (in quintiles), total fruit intake (median portion, in quintiles), total vegetable intake (median portion, in quintiles), and history of hormone therapy use (none, estrogen alone, estrogen and progestin, and mixed). for the distribution of demographic characteristics by diabetes status, tests were used to evaluate differences for categorical covariates, and t tests were used for continuous variables. cox proportional hazards regression models were used to estimate hazard ratios (hrs) (95% ci) for the association between diabetes and risk of lung cancer. the underlying time metric in the cox model is follow - up time since enrollment to the following end points : first lung cancer diagnosis, date of death, loss to follow - up (including nonparticipation in the extension study), or end of clinical trial or observational study follow - up (30 september 2010)whichever occurred first. in the multivariable models, we adjusted for age, ethnicity, education, smoking status, bmi, waist - to - hip ratio, alcohol consumption, physical activity, total energy intake, percent calories from fat, total fruit intake and total vegetable intake, history of hormone therapy use, and different treatment assignments in clinical trials (estrogen plus progestin vs. placebo, estrogen alone vs. placebo, or low - fat eating pattern vs. usual diet). different study cohorts (participation in observational study or clinical trials and different treatment assignments for all three clinical trials) were treated as strata in the model in order to take into account possible different baseline hazards in different subgroups and treatment effects. the primary analysis was focused on prevalent diabetes only as an exposure, including diabetes status, treatment of diabetes, and duration of prevalent diabetes at enrollment. in the secondary analysis, we considered all diabetes as an exposure, including incident diabetes newly occurring during whi follow - up. in all analyses including incident diabetes, a time - dependent covariate was generated by taking into account changes in diabetes status during follow - up. that is, we considered women in the nondiabetic group until they were identified as having new - onset diabetes. two sensitivity analyses were performed : one analyzed self - reported type of treatment for diabetes ; the other further adjusted for other comorbidities, including hypertension, high cholesterol, and cardiovascular disease. in addition, since lung cancer is so strongly related to tobacco smoking, we also performed our analyses stratified by smoking status. interactions between diabetes and smoking, and diabetes and hormone therapy use, were tested by entering cross - product terms into the multiplicative models. the proportionality assumption was satisfied for all exposure variables of interest and potential confounding variables based on graphs of scaled schoenfeld residuals (27). all statistical analyses were conducted using sas (version 9.2 ; sas institute, cary, nc). the whi was designed to address the major causes of morbidity and mortality in postmenopausal women (18), including both multicenter clinical trials and an observational study. details of the scientific rationale, eligibility requirements, and baseline characteristics of the participants in the whi have previously been published (1923). briefly, a total of 161,808 women ages 5079 years were recruited at 40 clinical centers throughout the u.s. between 1 september 1993 and 31 december 1998. the whi clinical trial includes four overlapping components : two hormone therapy trials (27,347 women), a dietary modification trial (48,835 women), and a calcium / vitamin d supplementation trial (36,282 women). participants in the observational study included 93,676 women who were screened for the clinical trials but proved to be ineligible or unwilling to participate or were recruited through a direct invitation for the observational study. the study was overseen by institutional review boards at all 40 clinical centers and at the coordinating center, as well as by a study - wide data- and safety - monitoring board. the following participants were excluded from the original cohort of 161,808 for this analysis : 14,849 women who had a history of cancer (except nonmelanoma skin cancer) at baseline, 783 women who enrolled in whi but provided no follow - up information, 217 women who were diagnosed with diabetes before age 20 years and/or who were ever hospitalized for diabetic coma (these were deemed likely to have type 1 diabetes diagnosis and not comparable), and 194 women who had missing values of the main exposures (including diagnosis of diabetes, age at diagnosis, and diabetes treatment). prevalence of diabetes at enrollment was defined by a positive answer to the following question : did a doctor ever say that you had sugar diabetes or high blood sugar when you were not pregnant ?. treated diabetes at enrollment was defined as the participant reporting ever having been treated for diabetes with pills or insulin shots. information on diabetes drug therapy was collected at baseline, when women were instructed to bring all medications that they had used at least once in the previous 2 weeks for review. all medications were matched to the master drug database (mddb ; medi - span, indianapolis, in). women with diabetes were categorized into four mutually exclusive groups based on the drug inventory information : 1) no diabetes medication, 2) metformin alone use, 3) other oral medication use alone (without insulin), and 4) insulin use (alone and with oral medication). thus, for example, if the inventory listed both metformin and insulin, we grouped it into the insulin use group. the duration of diabetes at enrollment was based on the difference between age of the participant when first diagnosed with diabetes and age at enrollment. self - reported type of treatment for diabetes at enrollment was also created by combining the self - reported variables at enrollment : diabetes status and treatment information for diabetes. it was categorized as 1) no diabetes, 2) diabetes not treated with medication, 3) diabetes treated with oral medications alone, and 4) diabetes treated with insulin (alone and with oral medication). incidence of medically treated diabetes was also determined during whi follow - up. the definition of incident diabetes was a positive response to the question on either the semiannual or annual follow - up questionnaires : since the date given on this form has a doctor prescribed for the first time any of the following pills or treatments ?, and subsequent selection of any of the following responses : pills for diabetes, insulin shots for diabetes, or (after 2005) diet and/or physical activity for diabetes. diagnosis of diabetes based on participant self - report was previously evaluated and deemed reliable. a validation study using a randomly selected sample of baseline specimens from the entire whi population has shown that fasting glucose levels 126 mg / dl were seen in 3.4% of 5,884 women without self - reported diabetes. in the clinical trials, 79% of women who self - reported treated diabetes at baseline had a diabetes medication in the baseline medication inventory. the corresponding figure for in addition, a recent validation study using 715 medical record reviews confirmed 92% of self - reported prevalent diabetes and 82% of self - reported incident diabetes. evidence of diabetes was found in only 5% of women who did not report diabetes (25). incident lung cancer cases were identified by self - administered questionnaires (administered every 6 months in the clinical trial through 2005 and annually in the clinical trial after 2005 and in observational study), with all cases confirmed by medical record review. all primary lung cancer cases were then coded centrally in accordance with the surveillance epidemiology and end results coding guidelines (icd - o code 34.034.9). in the multivariable models, we considered a series of potential confounders based on literature, which were also similar to those considered in a previous publication (26), including age at enrollment (< 55, 5559, 6064, 6569, 7074, and 75 years), ethnicity (american indian or alaska native, asian or pacific islander, black or african american, hispanic / latino, non - hispanic white, and other), education (high school or less, some college / technical training, college or some postcollege, and master s or higher), smoking status (never, former [including years since quitting : 30, 2029, 1019, and < 10 ], and current [including cigarettes smoked per day : < 5, 514, 1524, and 25 ]), bmi (< 18.5, 18.524.9, 25.029.9, 30.034.9, 35.039.9, and 40 kg / m), waist - to - hip ratio (in quintiles), recreational physical activity (total mets per week : < 5, 5 to < 10, 10 to < 20, 20 to < 30, and 30), alcohol intake (nondrinker, past drinker, < 1 drink / month, and current drinker [including frequency : < 1 drink / month, 1 drink / month to < 1 drink / week, 1 to < 7 drinks / week, and 7 drinks / week ]), total energy intake (kilocalories in quintiles), percent calories from fat (in quintiles), total fruit intake (median portion, in quintiles), total vegetable intake (median portion, in quintiles), and history of hormone therapy use (none, estrogen alone, estrogen and progestin, and mixed). prevalence of diabetes at enrollment was defined by a positive answer to the following question : did a doctor ever say that you had sugar diabetes or high blood sugar when you were not pregnant ?. treated diabetes at enrollment was defined as the participant reporting ever having been treated for diabetes with pills or insulin shots. information on diabetes drug therapy was collected at baseline, when women were instructed to bring all medications that they had used at least once in the previous 2 weeks for review. all medications were matched to the master drug database (mddb ; medi - span, indianapolis, in). women with diabetes were categorized into four mutually exclusive groups based on the drug inventory information : 1) no diabetes medication, 2) metformin alone use, 3) other oral medication use alone (without insulin), and 4) insulin use (alone and with oral medication). thus, for example, if the inventory listed both metformin and insulin, we grouped it into the insulin use group. the duration of diabetes at enrollment was based on the difference between age of the participant when first diagnosed with diabetes and age at enrollment. self - reported type of treatment for diabetes at enrollment was also created by combining the self - reported variables at enrollment : diabetes status and treatment information for diabetes. it was categorized as 1) no diabetes, 2) diabetes not treated with medication, 3) diabetes treated with oral medications alone, and 4) diabetes treated with insulin (alone and with oral medication). incidence of medically treated diabetes was also determined during whi follow - up. the definition of incident diabetes was a positive response to the question on either the semiannual or annual follow - up questionnaires : since the date given on this form has a doctor prescribed for the first time any of the following pills or treatments ?, and subsequent selection of any of the following responses : pills for diabetes, insulin shots for diabetes, or (after 2005) diet and/or physical activity for diabetes. diagnosis of diabetes based on participant self - report was previously evaluated and deemed reliable. a validation study using a randomly selected sample of baseline specimens from the entire whi population has shown that fasting glucose levels 126 mg / dl were seen in 3.4% of 5,884 women without self - reported diabetes. in the clinical trials, 79% of women who self - reported treated diabetes at baseline had a diabetes medication in the baseline medication inventory. the corresponding figure for in addition, a recent validation study using 715 medical record reviews confirmed 92% of self - reported prevalent diabetes and 82% of self - reported incident diabetes. evidence of diabetes was found in only 5% of women who did not report diabetes (25). incident lung cancer cases were identified by self - administered questionnaires (administered every 6 months in the clinical trial through 2005 and annually in the clinical trial after 2005 and in observational study), with all cases confirmed by medical record review. all primary lung cancer cases were then coded centrally in accordance with the surveillance epidemiology and end results coding guidelines (icd - o code 34.034.9). in the multivariable models, we considered a series of potential confounders based on literature, which were also similar to those considered in a previous publication (26), including age at enrollment (< 55, 5559, 6064, 6569, 7074, and 75 years), ethnicity (american indian or alaska native, asian or pacific islander, black or african american, hispanic / latino, non - hispanic white, and other), education (high school or less, some college / technical training, college or some postcollege, and master s or higher), smoking status (never, former [including years since quitting : 30, 2029, 1019, and < 10 ], and current [including cigarettes smoked per day : < 5, 514, 1524, and 25 ]), bmi (< 18.5, 18.524.9, 25.029.9, 30.034.9, 35.039.9, and 40 kg / m), waist - to - hip ratio (in quintiles), recreational physical activity (total mets per week : < 5, 5 to < 10, 10 to < 20, 20 to < 30, and 30), alcohol intake (nondrinker, past drinker, < 1 drink / month, and current drinker [including frequency : < 1 drink / month, 1 drink / month to < 1 drink / week, 1 to < 7 drinks / week, and 7 drinks / week ]), total energy intake (kilocalories in quintiles), percent calories from fat (in quintiles), total fruit intake (median portion, in quintiles), total vegetable intake (median portion, in quintiles), and history of hormone therapy use (none, estrogen alone, estrogen and progestin, and mixed). for the distribution of demographic characteristics by diabetes status, tests were used to evaluate differences for categorical covariates, and t tests were used for continuous variables. cox proportional hazards regression models were used to estimate hazard ratios (hrs) (95% ci) for the association between diabetes and risk of lung cancer. the underlying time metric in the cox model is follow - up time since enrollment to the following end points : first lung cancer diagnosis, date of death, loss to follow - up (including nonparticipation in the extension study), or end of clinical trial or observational study follow - up (30 september 2010)whichever occurred first. in the multivariable models, we adjusted for age, ethnicity, education, smoking status, bmi, waist - to - hip ratio, alcohol consumption, physical activity, total energy intake, percent calories from fat, total fruit intake and total vegetable intake, history of hormone therapy use, and different treatment assignments in clinical trials (estrogen plus progestin vs. placebo, estrogen alone vs. placebo, or low - fat eating pattern vs. usual diet). different study cohorts (participation in observational study or clinical trials and different treatment assignments for all three clinical trials) were treated as strata in the model in order to take into account possible different baseline hazards in different subgroups and treatment effects. the primary analysis was focused on prevalent diabetes only as an exposure, including diabetes status, treatment of diabetes, and duration of prevalent diabetes at enrollment. in the secondary analysis, we considered all diabetes as an exposure, including incident diabetes newly occurring during whi follow - up. in all analyses including incident diabetes, a time - dependent covariate was generated by taking into account changes in diabetes status during follow - up. that is, we considered women in the nondiabetic group until they were identified as having new - onset diabetes. two sensitivity analyses were performed : one analyzed self - reported type of treatment for diabetes ; the other further adjusted for other comorbidities, including hypertension, high cholesterol, and cardiovascular disease. in addition, since lung cancer is so strongly related to tobacco smoking, we also performed our analyses stratified by smoking status. interactions between diabetes and smoking, and diabetes and hormone therapy use, were tested by entering cross - product terms into the multiplicative models. the proportionality assumption was satisfied for all exposure variables of interest and potential confounding variables based on graphs of scaled schoenfeld residuals (27). all statistical analyses were conducted using sas (version 9.2 ; sas institute, cary, nc). baseline characteristics by diabetes status at enrollment are shown in table 1. compared with women without diabetes, women with diabetes were significantly more likely to be older and have higher bmi, waist - to - hip ratio, physical inactivity, total daily energy intake, and percent calories from fat and were significantly less likely to be white (non - hispanic), have graduated from college, currently drink, ever have smoked, report history of estrogen plus progestin hormone therapy use, and report a family history of cancer (all p values < 0.05). among 8,154 (5.6%) women with diabetes, 24.6% reported no pharmacologic treatment for diabetes and 75.4% reported diabetes treated with pills or insulin shots (47.8% reporting a history of treatment with oral medications only and 27.6% reporting a history of treatment with insulin). according to type of drugs in the current medication inventory at baseline, 39.5% were not treated, 11.4% were treated with metformin alone, 32.0% were treated with other oral medications, and 17.1% were treated with insulin alone or in combination with other drugs (table 1). baseline characteristics of participants by diabetes status among 145,765 women at whi enrollment self - reported diabetes diagnosed at enrollment was not significantly associated with risk of lung cancer (hr 1.09 [95% ci 0.891.33 ]) after adjustment for potential confounders (table 2). however, women with self - reported treated diabetes had a 27% (95% ci 259) excess risk of lung cancer. when diabetes at enrollment was further divided by type of treatments according to the medication inventory, women with diabetes requiring insulin treatment had a significantly higher risk of lung cancer (hr 1.71 [95% ci 1.152.53 ]) compared with women without diabetes, as did those who self - reported use of insulin (1.45 [1.042.04 ]). however, there was no significant association between duration of diabetes and lung cancer risk (table 2). elevated risk was noted when considering treated diabetes at baseline and diagnosed during follow - up, but it did not reach statistical significance (1.12 [0.951.31 ] for treated diabetes). we also examined the impact of bmi and waist - to - hip ratio on the strength of the association between diabetes and lung cancer, comparing analyses adjusted and unadjusted for these factors, and observed that the strength of the association was nearly identical before and after adjustment for bmi and waist - to - hip ratio. since other comorbidities, including hypertension, high cholesterol, and cardiovascular disease, could be mediators, we did not adjust for these factors in our primary models. however, we did a sensitivity analysis by further adjusting for these factors and found that the results were attenuated slightly, but the risk of lung cancer associated with diabetes requiring insulin treatment remained significant (1.61 [1.082.39 ]). hrs (95% ci) for lung cancer incidence associated with diabetes status and treatment of diabetes at baseline we further performed analyses stratified by smoking status (table 3). the overall findings among never smokers were generally similar to those of the entire population, except that there was a statistically significant association of self - reported treatment with oral medications and lung cancer. however, the risk estimates had wide cis, due to small sample sizes. among ever smokers, only women who had insulin in their medication inventory had a significantly elevated risk of lung cancer. in addition, we did not observe that the association between treated diabetes and lung cancer was significantly modified by smoking (table 3) or hormone therapy use (p for interaction = 0.8, data not shown). hrs (95% ci) for lung cancer incidence associated with diabetes status and treatment of diabetes at baseline stratified by smoking status compared with lung cancers in women using metformin, lung cancers in insulin users were somewhat more likely to be non small - cell lung cancer, to be localized, and to be well differentiated. however, none of these differences were significant, due to small sample size (table 4). we also repeated all analyses for non small - cell lung cancer only and found results similar to those for overall lung cancer (data not shown). in this large prospective study in postmenopausal women, women with treated diabetes, especially those requiring insulin, had significantly higher risk of lung cancer. previous epidemiological evidence on the association of diabetes with lung cancer is limited and conflicting (1). compared with that in persons without diabetes, the relative risk of lung cancer in persons with diabetes varied from a significant positive association (9,28,29), or no clear association (1013,15,16), to a significant negative association (14,17). however, in the two studies that reported a significant negative association (14,17), the study by armstrong. (14) measured standardized mortality ratio for lung mortality with the general population as reference. both studies were unable to adjust for important confounders, such as bmi and smoking habits. among studies with no clear association (1013,15,16), two were case - control studies (15,16) ; and three studies had less than 10 cases among women (1113). diabetes was self - reported in all 11 identified studies but one, in which the diagnosis of diabetes was based on hospital discharge records (17). (11) examined abnormal glucose tolerance and the risk of cancer death and found a nonsignificant increase in risk of lung cancer mortality for participants with impaired glucose tolerance (hr 1.57 [95% ci 0.703.54 ]) compared with participants who had normal glucose tolerance. to our knowledge, this is the first prospective study to examine whether the risk of lung cancer incidence is associated with diabetes treatments or duration. our data show that women who were treated for diabetes, especially those requiring insulin, appeared to have higher risk of lung cancer. patients with diabetes begin to require insulin therapy when endogenous insulin production declines, and insulin is more commonly prescribed in those with one or more comorbid conditions that preclude the use of oral medications (1). thus, treated diabetes or diabetes requiring insulin treatment may serve as a marker of more severe diabetes, which may have greater risk of cancer. however, our study did not observe a stronger association with longer duration of diabetes (another marker of diabetes severity). there are a variety of different types and analogs of insulin that may have different pharmacokinetic and pharmocodynamic profiles (30). in addition, studies have reported that patients who have type 2 diabetes and are exposed to both sulfonylureas and exogenous insulin have a significantly increased risk of cancer - related mortality compared with patients exposed to metformin (31,32). somewhat surprisingly, we observed that women with diabetes who did not use any medication treatment had a nonsignificantly lower lung cancer risk. it is possible that women who did not use medications for diabetes had lower lung cancer risk related to unmeasured lifestyle changes or that they visited doctors less often and were thus less likely to have lung cancer detected (surveillance bias). in addition, our study observed that including incident diabetes status as an exposure resulted in a weaker association than results using baseline diabetes status alone. since newly diagnosed patients with diabetes are more likely to be treated with lifestyle or oral medications than with insulin, addition of incident diabetes cases would have been likely to weaken the association with lung cancer. despite inconsistent epidemiological evidence on the association of diabetes and lung cancer, it is biologically plausible that diabetes could increase the risk of lung cancer (33). studies have shown that elevated insulin potentiates the activity of igf - i either via direct upregulation or indirectly through the downregulation of igf - binding protein 1 (34), which can lead to higher risk of lung cancer (35). a hospital - based case - control study also detected a dose - dependent association between plasma igf - i levels and lung cancer risk (36). in addition, it has been proposed that hyperglycemia activates the polyol pathway, increasing the production of sorbitol, which in turn results in cellular stress and a decrease in the intracellular antioxidant defenses (3). studies also show that inadequate glucose control is simultaneously associated with inflammation and decreased lung function in diabetic patients (4,5). the combination of these mechanisms may lead to an increase in cell damage and risk for lung cancer (68). strengths of our study include the prospective cohort design and the large, diverse population well characterized for tobacco use and other potential confounders, including data on waist - to - hip ratio, a better measure of lung cancer risk than obesity (26). limitations include lack of information on diabetes severity such as hba1c levels and information on diabetes therapy only at baseline precluding adjustments over time for change in diabetes management. in addition, patients may change their treatment plans during the course of diabetes. classifying treatment based on the whi current medication inventory collected at baseline however, if this exposure misclassification is nondifferential, it would bias our estimates of effect toward the null. we do not have any reason to suspect that patients who are destined to develop lung cancer were more likely to start insulin ; thus, any misclassification is likely to have resulted in underestimating the lung cancer risk associated with insulin treatment. finally, study of associations of diabetes and lung cancer by cell type or stage was limited by subgroup sample size. diabetes diagnoses were by ongoing self - report and review of diabetes medication use rather than by medical record review. however, this approach has been evaluated (24) and found to have high concordance with a gold standard based on fasting glucose level and medical records. in conclusion, postmenopausal women with treated diabetes, especially those with diabetes requiring insulin treatment, have a significantly increased risk of lung cancer. more large prospective studies are needed to examine whether the increased risk of lung cancer among women with treated diabetes is driven by specific types of oral diabetes drugs, exogenous insulin treatment, high endogenous insulin levels, poor glycemic control, or longer diabetes severity. | objectiveepidemiological evidence of diabetes as a lung cancer risk factor is limited and conflicting. therefore, we assessed associations among diabetes, diabetes therapy, and lung cancer risk in postmenopausal women participating in the women s health initiative (whi) study.research design and methodspostmenopausal women (n = 145,765), ages 5079 years, including 8,154 women with diabetes at study entry were followed for a mean of 11 years with 2,257 lung cancers diagnosed. information on diabetes therapy was collected via two methods (self - reported information on treatment history collected on a questionnaire at baseline and a face - to - face review of current medication containers that participants brought to the baseline visit). lung cancers were confirmed by central medical record and pathology report review. cox proportional hazards regression models adjusted for lung cancer risk factors were used to estimate hazard ratios (hrs) (95% ci) for diagnosis of diabetes and treatment of disease as risk factors for lung cancer.resultscompared with women without diabetes, women with self - reported treated diabetes had a significantly higher risk of lung cancer (hr 1.27 [95% ci 1.021.59 ]), with risks increasing for women with diabetes requiring insulin treatment (1.71 [1.152.53 ]). however, we did not observe a significant association between lung cancer risk and diabetes not treated with medication or with duration of diabetes.conclusionspostmenopausal women with treated diabetes, especially those using insulin, have a significantly higher risk of lung cancer. the influence of diabetes severity and specific classes of therapy for diabetes on lung cancer risk require future study. |
after w. c. von roentgen discovered x - rays in 1896, a german dentist, o. walkhoff, used radiographs for dental diagnosis. at the beginning of the last century, attempts were made to image the whole jaw with intraoral radiography. panoramic technique developed to image the teeth and jaws became an essential element in oral radiology. orthopantomography (opt) became a very popular and widely accepted technique of dental radiography. it is a curved plane tomographic radiographic technique used to depict on a single image the body of the mandible and maxilla, the lower part of the maxillary sinuses, and the temporomandibular joints. opts have a wide variety of uses, including the screening of patients during dental treatment for evidence of cysts, impacted teeth, foreign bodies, and neoplasms. opts are also used to evaluate pathological situations related to the temporomandibular joints and maxillary sinuses and to evaluate mandibular fractures. in addition, opts offer information about the locations of important anatomic structures in the orofacial region which are needed for dental implant planning. the evolution of more precise three - dimensional techniques such as conventional computed tomography (ct), cone beam computed tomography (cbct), and magnetic resonance imaging has improved oral diagnosis and implant treatment planning by virtue of their higher precision. in comparison with ct and other expensive precision radiographs, opt is a simple, low - cost imaging modality with patients being exposed to relatively low dose of radiation. the effective doses may vary significantly among cbct machines ; however, when compared to medical ct, cbct is considered to be a low - dose technique for use in dental implant procedure. the effective dose from cbct examinations could range from 13 to 479 sv with different commercially available cbct machines, while the effective dose from one opt is approximately 1014 sv. on the other hand, the exposure from a maxillomandibular medical ct ranges from 474 to 1160 sv. digital panoramic machines are not significantly different from conventional panoramic units ; thus, it has been suggested that the degree of vertical magnification due to projection geometry is similar for digital and conventional rotational opts. calibrated software - based tools are used to overcome the magnification when measuring vertical dimensions on a digital opt ; the measurements will be more accurate when the magnification of the radiograph is closer to the estimated magnification predetermined by the manufacturer. in 1986, larheim and svanaes investigated the precision of measurements of mandibular linear dimensions in panoramic radiographs and showed that the variability of vertical measurements made from repeated panoramic radiographs was small when patients were properly positioned in the panoramic machine. they reported that the highest reliability was obtained when the same radiographer adjusted the head position and made both exposures. there are a large number of panoramic x - ray machines available from various manufacturers, and the magnification factor varies from one manufacturer to another. this variation results in differences in magnification and in the amounts of distortion and displacement of structures. other factors such as the skills of the examiner and the position of the patient 's head may also reduce the accuracy of the opt. the aim of this study is to evaluate the accuracy of measuring vertical dimensions in the posterior mandibular area on a single digital opt machine, and to determine the margin of error of measurements from opts taken in regular daily practice. the study also evaluated the possible influence of the size of the display screen on the accuracy of measurements. a retrospective review of the files of all implant patients treated at alpha clinic, a private clinic limited to periodontics and dental implants (ramallah, palestine), during the years 20102013 was conducted. after exclusion of non - suitable images, the selection process yielded a total of 20 digital panoramic radiographs taken using the same radiographic machine. these radiographs were taken during the process of treatment for various reasons ; none were taken for the purpose of this study. a total of 27 implants inserted in the posterior segment of the mandible were included for evaluation. eleven (60%) implants were placed in the premolar region and 16 (40%) in the molar region. seven of the selected panoramic radiographs included more than one implant, while six implants were evaluated in two different panoramic radiographs at different time points. these images were taken from the records of 14 patients (6 males and 8 females ; age 2051 years, mean age 34 years) [table 1 ]. implant sites and actual dimensions all implants in the opts selected were placed by a single surgeon (m. a.) who decided the width and length (l) of the implants based on pre - operative cbct images used for treatment planning. the location of dental implants for a partial edentulous ridge was determined clinically, considering the adjacent and opposing teeth. the lengths of dental implants used in the obtained opts ranged between 8 and 13 mm [table 1 ]. only panoramic radiographs with implants in the molar and premolar mandibular regions were included in this study.all panoramic radiographs used in this study were required to be taken using one single radiographic machine : kodak 9000 3d cbct (carestream health, inc. these images were taken as direct opts and not as cbct reconstructions.the panoramic radiograph included had to clearly show the inferior alveolar nerve, the mental foramen, the nasal floor, and the maxillary sinus floor. the clarity of images was subjectively determined by a single dentist (a. ag.) who is experienced in interpreting panoramic radiographs.to avoid measurement mistakes, only root form titanium dental implants covered by covering screw (without healing cap, temporary restoration, or crown) were included in this study. only panoramic radiographs with implants in the molar and premolar mandibular regions all panoramic radiographs used in this study were required to be taken using one single radiographic machine : kodak 9000 3d cbct (carestream health, inc. the panoramic radiograph included had to clearly show the inferior alveolar nerve, the mental foramen, the nasal floor, and the maxillary sinus floor. the clarity of images was subjectively determined by a single dentist (a. ag.) who is experienced in interpreting panoramic radiographs. to avoid measurement mistakes, only root form titanium dental implants covered by covering screw (without healing cap, temporary restoration, or crown) were included in this study. all digital panoramic radiographs were taken at qirrish center for oral radiology (ramallah, palestine) which has one radiographic device for panoramic x - ray (kodak 9000 3d cbct). digital panoramic radiographs were taken under everyday conditions by two skilled technicians according to the manufacturer 's specified posit ion for the patient 's head, but did not follow a strict, standardized protocol to ensure the patient 's precise head position for any research purpose. images were delivered through a compact disk to our office to be stored on our computer for evaluation using a specialized computer software (dental imaging software dis patient file 6.13.0.24, carestream health, inc., 2013) which is designed specifically for storage and interpretation of the digital data received from the x - ray machine (kodak 9000 3d). the vertical length of each included implant shown on digital panoramic radiographs was measured by two independent examiners, who were blind to the actual readings and did not participate in the treatment of the patients. examiner (a) is a pedodontist ; the other examiner (b) is a general dental practitioner with 2 years of experience in dentistry. neither of them was aware of the actual size of the implants used nor were they familiar with the implant systems used at our clinic. each examiner had to examine randomly the x - rays at two different sessions with 1 week interval. at each session, the examiner had to examine each x - ray using a different display screen attached to the computer ; a large screen (ls) of 42 inches 5060 hz 1280 768 pixels at 60 hz (philips 42pfl3606h/12 ; 2011) and a small screen (ss) of 19 inches, 5060 hz 1440 900 pixels at 60 hz (hp nk570a ; 2009). each examiner was requested to use a mouse - driven pointer to select the most apical point and the most coronal point of each implant on the computer software, which will automatically give the estimated distance between these two selected points to the nearest tenth of a millimeter. this reading which represents the measured length of the implant was recorded by the examiner [figure 1 ]. measurement using a computer software tool to determine the vertical dimension of an implant placed in the lower jaw. the radiograph shows the calculated length between the two points selected by the examiner using the computer 's mouse. reliability analysis was assessed using intra - class correlation coefficients and cronbach 's alpha statistic. for each individual examiner, inter - examiner reliability statistics for each type of measured ls and ss were also drawn. this reading which represents the measured length mean ls, mean ss, and l measures were compared using related samples friedman 's two - way analysis of variance (anova). the error between l and measured implant length (for ls and ss) was computed (dls and dss for each examiner, respectively). mean error, dls, and dss values were computed and compared using related samples wilcoxon 's signed rank test. only panoramic radiographs with implants in the molar and premolar mandibular regions were included in this study.all panoramic radiographs used in this study were required to be taken using one single radiographic machine : kodak 9000 3d cbct (carestream health, inc. these images were taken as direct opts and not as cbct reconstructions.the panoramic radiograph included had to clearly show the inferior alveolar nerve, the mental foramen, the nasal floor, and the maxillary sinus floor. the clarity of images was subjectively determined by a single dentist (a. ag.) who is experienced in interpreting panoramic radiographs.to avoid measurement mistakes, only root form titanium dental implants covered by covering screw (without healing cap, temporary restoration, or crown) were included in this study. only panoramic radiographs with implants in the molar and premolar mandibular regions all panoramic radiographs used in this study were required to be taken using one single radiographic machine : kodak 9000 3d cbct (carestream health, inc. the panoramic radiograph included had to clearly show the inferior alveolar nerve, the mental foramen, the nasal floor, and the maxillary sinus floor. the clarity of images was subjectively determined by a single dentist (a. ag.) who is experienced in interpreting panoramic radiographs. to avoid measurement mistakes, only root form titanium dental implants covered by covering screw (without healing cap, temporary restoration, or crown) all digital panoramic radiographs were taken at qirrish center for oral radiology (ramallah, palestine) which has one radiographic device for panoramic x - ray (kodak 9000 3d cbct). digital panoramic radiographs were taken under everyday conditions by two skilled technicians according to the manufacturer 's specified posit ion for the patient 's head, but did not follow a strict, standardized protocol to ensure the patient 's precise head position for any research purpose. images were delivered through a compact disk to our office to be stored on our computer for evaluation using a specialized computer software (dental imaging software dis patient file 6.13.0.24, carestream health, inc., 2013) which is designed specifically for storage and interpretation of the digital data received from the x - ray machine (kodak 9000 3d). the vertical length of each included implant shown on digital panoramic radiographs was measured by two independent examiners, who were blind to the actual readings and did not participate in the treatment of the patients. examiner (a) is a pedodontist ; the other examiner (b) is a general dental practitioner with 2 years of experience in dentistry. neither of them was aware of the actual size of the implants used nor were they familiar with the implant systems used at our clinic. each examiner had to examine randomly the x - rays at two different sessions with 1 week interval. at each session, the examiner had to examine each x - ray using a different display screen attached to the computer ; a large screen (ls) of 42 inches 5060 hz 1280 768 pixels at 60 hz (philips 42pfl3606h/12 ; 2011) and a small screen (ss) of 19 inches, 5060 hz 1440 900 pixels at 60 hz (hp nk570a ; 2009). each examiner was requested to use a mouse - driven pointer to select the most apical point and the most coronal point of each implant on the computer software, which will automatically give the estimated distance between these two selected points to the nearest tenth of a millimeter. this reading which represents the measured length of the implant was recorded by the examiner [figure 1 ]. measurement using a computer software tool to determine the vertical dimension of an implant placed in the lower jaw. the radiograph shows the calculated length between the two points selected by the examiner using the computer 's mouse. reliability analysis was assessed using intra - class correlation coefficients and cronbach 's alpha statistic. for each individual examiner, inter - examiner reliability statistics for each type of measured ls and ss were also drawn. this reading which represents the measured length mean ls, mean ss, and l measures were compared using related samples friedman 's two - way analysis of variance (anova). the error between l and measured implant length (for ls and ss) was computed (dls and dss for each examiner, respectively). mean error, dls, and dss values were computed and compared using related samples wilcoxon 's signed rank test. of all the 20 selected opts, none was excluded due to lack of clarity or for having major distortions. descriptive demographic data about the actual size and location of the implants is presented in table 1. the actual diameters according to the files of the patients ranged between 3.2 and 5.0 mm. the actual lengths according to patient records ranged between 8 and 13 mm ; the most frequently present length was 11.5 mm which was present in 13 radiographs. the minimal and maximal readings by each examiner using the different screens of the 11.5 mm implants at each reading are shown in table 2. measurements from the radiographs of the implants with actual length=11.5 m, m according to each examiner and screen at different time points the intra - examiner reliability (intra - class coefficient measure) was 99.3% and 95.7% for examiner a on ls and ss, respectively [table 3 ]. the intra - examiner reliability (intra - class coefficient measure) was 96.8% and 90.4% for examiner b on ls and ss, respectively [table 3 ]. the inter - examiner reliability (intra - class coefficient measure) for ls was 97.4% for both examiners the inter - examiner reliability (intra - class coefficient measure) for ss was 94. intra - examiner reliability : intra - class coefficients and cronbach 's alpha inter - examiner reliability : intra - class coefficients and cronbach 's alpha for ls, the mean error compared to l was 0.21 mm (sd 0.414 mm) with both raters [table 5 ]. for ss, the mean error compared to l was 0.29 mm (sd 0.452 mm) with both raters [table 5 ]. there were no significant differences between l, mean ls, and mean ss measures (p = 0.891, related samples friedman 's anova). there was no significant difference between the mean errors via ls and ss measures when related samples wilcoxon 's signed rank test was used to compare the median of differences (p = 0.146). the examiners who measured the vertical dimensions of implants on the digital screens were unaware of the details of the patients and implants. although both of them are dentists, they have very minimal experience in dental implantology. they were asked not to try to figure out what were the possible lengths of implants, so that their measurements would not be biased to a certain length. although the dental implants in opts were of various brands, no information was given to the examiners about which types of implants we use in our clinic, in order to avoid any possible bias by the examiner who might try to guess the length of implant and influence the measurements. each examiner was asked to do the measurements twice on different days with at least 1 week interval to measure the intra - examiner reliability. the reliability for repeated measurements was high for both examiners, whether they were using the ls or ss. accuracy of an opt is influenced by patient 's head position, the observer 's experience, and accuracy. all these factors could be eliminated to the minimum if the radiographer was knowing that the opt would be analyzed for research purposes ; thus, the retrospective design of this study gives more realistic results. the calibration of the machine is another factor that can impact the accuracy and reproducibility obtained from digital panoramic radiographs. for this reason, we used all radiographs taken by the same machine to eliminate calibration variations between different devices. two skilled radiographers work at the radiology center where the opts were taken ; either one of them could have taken any of the radiographs we received. there is no information of who was the radiographer of each opt, because they do not write such details in their routine records. not revealing this data makes our study more realistic and reduces the bias, because it has been reported in a previous study that the reproducibility of opts could be different between two different radiographers using the same machine. two different screen sizes were utilized to determine if this factor may influence the accuracy of measuring the vertical length ; however, the inter - class coefficient showed that there were no significant differences in measurements according to screen sizes [table 4 ]. high accuracy was shown in this study [table 5 ], where the maximal error in measurements never exceeded the precautionary safety margin of 2 mm between the drilling position for implant site preparation and any vital anatomic landmark. in the 1980s, a second milestone was reached in the 1990s with the introduction of computerized software applications for two- and three - dimensional diagnostics which could be efficiently used for presurgical planning. probably the use of three - dimensional images may ensure better precision in implant techniques. image magnification and lack of cross - sectional information are the major drawbacks of the image modality of opts for implant surgery planning. thus, it is not possible to confirm that the dimensions of structures shown on opts correspond to the real dimensions of the structures. different authors have reported vertical magnification of opts in the posterior mandibular area to be constant between 125 and 130%. insignificantly slightly higher magnification was observed in the lower premolar area compared to molar area. vazquez., suggested that the implant length measures could be used to evaluate the vertical magnification factor even when the patient 's head position was not strictly standardized before exposure and when measurements were taken by observers with different skill levels and experience. these results are consistent with this study which was performed retrospectively in a daily practice environment. other studies have both confirmed the reliability of vertical dimensions on opts and shown that horizontal assessments are unreliable, especially in the anterior regions. distortions in the anterior area could be caused by the fact that the curvature level of the jaw is different in each individual and can be influenced by patient position during imaging. a tendency to greater enlargements of measurements on opts has been observed in the maxilla compared to the mandible. to rely on the vertical dimension measured on an opt for implant planning, philip worthington has suggested a simple formula which considers magnification of the radiograph, a safety zone margin (12 mm), and the useless thin crestal bone. he suggested that nerve injury should be included in the informed consent, and both radiograph and calculations should be kept in patient 's chart as evidence of meticulous patient care. other important local factors that might influence the accuracy of measuring the vertical height of available bone in the posterior mandibular area using an opt are the bucco - lingual position of the inferior alveolar canal and the bucco - lingual position of crestal peak of alveolar bone. the bucco - lingual positions of these landmarks may result in false estimations of the height of available alveolar bone. the limitation of this study is the small number of radiographs used in this retrospective study. the limitation of this study is the small number of radiographs used in this retrospective study. within the limitations of this study, it seems that digital opt is a reliable and safe imaging modality to evaluate the vertical dimension of the alveolar bone in posterior mandibular (molar and premolar) regions if a well - calibrated machine with a specialized measuring software is used. using a high - quality screen is important ; however, there were no significant differences between the measurements obtained by different screen sizes used in this study. a larger scale study needs to be conducted with more radiographs and examiners to confirm these results. | objectives : orthopantomographs are commonly used for diagnosis in clinical dentistry. although the manufacturers claim a constant magnification effect, the reliability of measuring dimensions on the panoramic radiographs is not clear. the aim of this study was to evaluate the accuracy of measuring vertical dimensions in the posterior mandibular area on digital orthopantomographs.materials and methods : a retrospective survey of 20 orthopantomographs with unrestored implants (only with cover screw) in the mandibular posterior region (molars and premolars) was conducted. all radiographs were taken using the same machine by skilled technicians. two examiners were asked to measure the vertical dimension of the implants seen on the radiographs viewed using two differently sized display screens. inter - examiner and intra - examiner reliability tests were performed. differences between the measured length and the actual length using each screen type were compared.results:high coefficients of reliability were observed on intra- and inter - examiner correlation. the overall reliability of measuring the vertical dimensions of implants between both examiners for the large screen and the small screen were 97.4% (cronbach 's alpha 0.993) and 94.0% (cronbach 's alpha 0.984), respectively. there were no significant differences between the errors seen with either the large screen or the small screen, when each of them was compared to the original length (p = 0.146).conclusion : this study shows that vertical dimensions in the posterior mandibular region (molar and premolars) can be reliably measured on an orthopantomograph using a calibrated machine and special software. |
heterotopic pancreas (hp) is pancreatic tissue that develops in areas other than the normal site of the pancreas, having no anatomical or vascular continuity with the normal pancreas [1, 2 ]. hp of the small intestine, if enlarged, may be diagnosed due to symptoms such as ileus, bowel intussusception, melena and pancreatitis, but it often remains asymptomatic and is incidentally detected on surgery for other diseases or autopsy [3, 4 ]. we encountered 2 patients with jejunal hp incidentally detected by computed tomography (ct) performed for close evaluation of other diseases. these cases are presented with a review of the literature, particularly focusing on ct findings. case 1 was a 57-year - old woman who had been under antihypertensive medication for a few years. when she consulted a local physician due to epigastric and back pain, a tumoral lesion 30 mm in diameter was detected on the dorsal portion of the pancreas head on abdominal ultrasonography, and the patient was referred to our hospital. the mass was suspected to be schwannoma, castleman disease, malignant lymphoma or reactive lymphoid hyperplasia by imaging studies including ct and magnetic resonance imaging. the contrast of the mass was nearly homogeneously enhanced in the arterial phase, and enhancement was sustained in the equilibrium phase, suggesting a submucosal tumor (fig. double contrast intestinal imaging showed a defect of about 14 mm in diameter in the jejunum, and a gently elevated submucosal mass with a smooth mucosal surface was confirmed by subsequent capsule endoscopy (fig. diseases including gastrointestinal stromal tumor and leiomyoma were suspected preoperatively, and laparotomy was performed to simultaneously remove the masses in the head of the pancreas and small intestine. the mass in the head of the pancreas was intraoperatively suspected to be disadherable, with enlarged # 8p and # 13a lymph nodes, and was eventually diagnosed by histopathological examination as reactive lymphoid hyperplasia. also, a tumor 15 mm in diameter was noted in the jejunum 15 cm anally from the ligament of treitz, and an about 10 cm segment of the jejunum was resected with the tumor. it was histopathologically diagnosed as heinrich type 1 hp mainly occupying the submucosa to the muscular layer (fig. case 2 was an 87-year - old woman who presented with fecal occult blood on a health screening and was referred to our hospital. blood tests indicated anemia with a hb level of 9.1 g / dl (normal 12.016.0). as for tumor makers, cea was elevated to 8.4 ng / ml (normal 05.0) and p53 antibody to 3.44 ng / ml (normal 05.0). colonic fiberscopy showed type 2 adenocarcinoma occupying two thirds of the circumference of the sigmoid colon. ct disclosed a mass about 15 mm in diameter in the jejunum in addition to a sigmoid colon tumor accompanied by swollen lymph nodes in the neighboring regions. the image of the jejunal mass was homogeneously contrasted in the atrial phase, and contrast enhancement persisted in the equilibrium phase, suggesting a submucosal tumor (fig. double contrast intestinal imaging showed a gently elevated semispherical mass 14 mm in diameter with a smooth mucosal surface near the ligament of treitz. surgery was performed under laparoscopic guidance to resect the sigmoid colon cancer and jejunal submucosal tumor. after sigmoid colectomy (double stapling technique, d3), a tumor 15 mm in diameter was found in the jejunum 5 cm anally from the ligament of treitz and was removed by wedge resection. it was diagnosed histopathologically to be heinrich type 1 hp seated mainly in the submucosa. ct images were obtained by using multi - detector row ct (mdct) scanner (lightspeed vct, ge healthcare) in both patients. both patients received the contrast agent moiopamin 300 (dose 100 ml) through the median cubital vein. the arterial and equilibrium phases were approximately 35 and 120 s, respectively, after the start of injection. retrospectively, the ct values of the hp tissue and pancreatic parenchyma were calculated in both phases. in the region of interest in the pancreatic parenchyma, ct values were measured at three points in the body of the pancreas by avoiding pancreatic ducts and vessels, and the mean was calculated. concerning hp, the region of interest was determined around the mass in the axial plane that provided the largest image of the mass on ct. the ct values in hp and the pancreatic parenchyma were106 and 100 hu, respectively, in the arterial phase and 101 and 75 hu, respectively, in the equilibrium phase. in case 2, the ct values in hp and the pancreatic parenchyma were 124 and 122 hu, respectively, in the arterial phase and 91 and 77 hu, respectively, in the equilibrium phase. the ct values of hp and pancreatic parenchyma were nearly identical in the arterial phase, but in the equilibrium phase, contrast enhancement persisted longer in hp than in the pancreatic parenchyma. hp lacks both anatomical and vascular continuity with the main body of the pancreas and occurs anywhere from the esophagus to the rectum [1, 2 ]. the incidence of hp varies widely and has been reported in 0.65.6% of autopsy cases and in 0.2% of upper abdominal laparotomies. the distribution of the sites of hp was 30.3% in the duodenum, 26.5% in the stomach, 16.3% in the jejunum, 5.8% in the ileum and 5.3% in meckel diverticulum, indicating that it occurs more frequently near the normal site of pancreatogenesis to the jejunum. these lesions are usually clinically silent but may become symptomatic because of complications such as pancreatitis, obstruction, bleeding or malignant transformation [3, 4 ]. a review of the literature reveals that the significance of hp symptoms is related to the size and mucosal relation of the lesion. in a review of 34 histologically confirmed cases, these authors concluded that lesions associated with signs and symptoms are > 1.5 cm in maximum diameter and are adjacent to or directly involve the mucosa. a definitive hp diagnosis may be established on the basis of histological examination, which additionally allows confirmation of the histological type of hp. heinrich 's classification is commonly accepted, being as follows : type 1 (all elements of a normal pancreatic gland), type 2 (pancreatic gland devoid of pancreatic islet cells), and type 3 (only pancreatic ducts are present). also, there had been no report of delineation of asymptomatic and small jejunal hp = 1.5 cm in diameter by preoperative ct before our cases. on the other hand, ct findings of hp in the stomach and duodenum have recently been reported [7, 8, 9, 10 ]. ct findings of hp in the stomach or duodenum are usually nonspecific and can not distinguish hp from other submucosal tumors. however, ct with arterial, portal and equilibrium phase iv contrast may demonstrate the lesions which enhance similarly with the normal pancreatic tissue. kim. reported that hp with predominantly pancreatic acini shows a homogeneous enhancement pattern, whereas lesions with a mixed composition of acini and cystic ducts show a heterogeneous enhancement. the lesions in both of our patients corresponded to heinrich type 1 with no ductal dilation or fat deposition, and showed homogeneous enhancement similarly to the pancreatic parenchyma in the arterial and equilibrium phases on ct. however, the ct value of the jejunal hp was nearly identical with that of the pancreatic parenchyma in the arterial phase, but was higher in the equilibrium phase in both patients. the cause of the difference in the ct value in the equilibrium phase is unknown, but it may reflect not only the difference in the composition of hp tissue but also atrophy, fibrosis and fat degeneration of the pancreatic parenchyma. as gastric or duodenal hp is difficult to differentially diagnose from other submucosal tumors such as leiomyoma, carcinoid and gastrointestinal stromal tumor by the contrast enhancement pattern on ct or morphology alone, hp of the small intestine is difficult to differentiate from other diseases by ct alone. the detection rate of hp of the small intestine is expected to increase with the future spread of mdct. with increasing case numbers, contrast patterns in particular phases will be evaluated under appropriate conditions, and mdct may contribute to the differential diagnosis of hp of the small intestine. particularly, when it is detected intraoperatively, the judgment is difficult as there is no preoperative informed consent for its resection. since the possibility of its canceration is extremely low and as it grows very slowly, preventive resection has been reported to be unnecessary [11, 12 ]. recently, however, there have been a number of reports of its resection due to melena, ileus, intussusception, etc. even without canceration, and many authors support aggressive resection of resectable hp. in our cases, jejunal hp was detected incidentally during examination for other diseases, and the presence of submucosal masses could be confirmed preoperatively by fluoroscopy and endoscopy of the small intestine. this made it possible to obtain sufficient informed consent from the patients to remove the intestinal submucosal tumor as well as the primary disease and to perform surgery safely. this report presented 2 cases of jejunal hp incidentally detected by ct during examination for other diseases. the frequency of incidental detection of intestinal submucosal tumors is expected to increase with a rise in the frequency of mdct use. while most small lesions of hp are asymptomatic, it may be complicated by ileus and intussusception, and hp is considered to be an important disorder that should be recognized along with gastrointestinal stromal tumor, carcinoid, etc. | heterotopic pancreas (hp) is typically an asymptomatic malformation that can present anywhere along the gastrointestinal tract. it is often detected incidentally on surgery for other diseases or autopsy. we encountered 2 patients with jejunal hp incidentally detected by computed tomography (ct) performed for close evaluation of other diseases. in a 57-year - old woman diagnosed with reactive lymphoid hyperplasia on the dorsal portion of the pancreas head, ct detected a 15 mm oval - shaped submucosal lesion at the jejunum. in an 87-year - old woman diagnosed with type 2 adenocarcinoma occupying the sigmoid colon, ct detected a round - shaped submucosal tumor 15 mm in diameter in the jejunum. both cases were histologically diagnosed as type 1 hp according to the classification by heinrich. contrast - enhanced ct revealed that the ct analyses of hp and pancreatic parenchyma were nearly identical in the arterial phase, but in the equilibrium phase, contrast enhancement persisted longer in hp than in the pancreatic parenchyma. there has been no report of asymptomatic jejunal hp preoperatively diagnosed by ct. these cases are presented with a review of the literature, particularly focusing on ct findings. |
gemcitabine is a chemotherapy agent frequently elected to treat solid tumors, including breast, colonic, ovarian, pancreatic, and non - small cell lung cancers [112 ]. metastatic gallbladder cancer is a complex and uncommon event [1417 ]. in this report, we describe a case of gallbladder metastatic colonic adenocarcinoma associated with fatal gemcitabine - induced pulmonary toxicity and discuss the histologic appearance of this dysfunction. a 72-year - old male patient experienced an incidental diagnostic of tubular adenocarcinoma inside the gallbladder after elective laparoscopic cholecystectomy for chronic cholecystitis. four days after cholecystectomy, he was submitted to laparotomy aiming radical resection ; however, peritoneal carcinomatosis was observed. the patient was submitted to a tumor screening and a pet scan pointed out a hot - spot in the left colon. this lesion was removed by colonoscopy and a histological examination confirmed a margin - free resection of a tubular adenocarcinoma. the patient was finally scheduled to receive three sections of gemcitabine (1,600 mg / m) once a week. three weeks after the completion of chemotherapy, he developed an important respiratory distress requiring ventilator support. a helicoidal ct scan showed bilateral and diffuse lung infiltrates (fig. 1). a surgical lung biopsy was done and an accelerated usual interstitial pneumonia (uip) (fig. 2), consistent with drug - induced toxicity, was observed. the patient presented with progressive impairment of respiratory function, coagulopathy, hypotension, and acute renal failure despite the use of methylprednisolone pulse therapy, large spectrum antimicrobial therapy, and full respiratory, hemodynamic and dialytic support. he died 1 month later. to assess the probability that the event was caused by gemcitabine we computed a naranjo. average point score, which is based on the direction of causality between the drug and the manifestation of adverse effects. naranjo s method estimates gemcitabine as the probable cause of pulmonary toxicity in the current report.fig. 1a coronal reformatted images demonstrate involvement of all lung zones and predominantly upper lobe distribution of the ground - glass opacities and areas of consolidation. also noted are reticulation and small cysts in the subpleural and basal regions of the lungs. b high - resolution ct image at the level of the main bronchi shows extensive bilateral ground - glass opacities and dependent areas of consolidation. 2lung surgical biopsy specimen showing accelerated usual interstitial pneumonia (uip). a characteristic area of honeycomb change is shown at low magnification (a). at lower left corner (a) higher magnification of area showed in lower left corner (b, c) highlights the fibroblasts and chronic inflammation within alveolar septa and shows associated hyaline membranes (arrow). note also the squamous metaplasia (arrows) of bronchiolar epithelium from adjacent honeycomb area (d). this finding is another sign of superimposed acute lung injury a coronal reformatted images demonstrate involvement of all lung zones and predominantly upper lobe distribution of the ground - glass opacities and areas of consolidation. also noted are reticulation and small cysts in the subpleural and basal regions of the lungs. b high - resolution ct image at the level of the main bronchi shows extensive bilateral ground - glass opacities and dependent areas of consolidation. some emphysema can also be seen lung surgical biopsy specimen showing accelerated usual interstitial pneumonia (uip). a characteristic area of honeycomb change is shown at low magnification (a). at lower left corner (a) higher magnification of area showed in lower left corner (b, c) highlights the fibroblasts and chronic inflammation within alveolar septa and shows associated hyaline membranes (arrow). note also the squamous metaplasia (arrows) of bronchiolar epithelium from adjacent honeycomb area (d). there are several papers reporting pulmonary toxicity due to gemcitabine used as a single agent [18 ] or in combination with other antineoplastic agents [913 ]. the treatment of this event includes early use of steroid therapy administered either as pulses or continuously, mainly using methylprednisolone ; nevertheless, most cases have a dramatic and fatal evolution. our patient obtained fatal evolution in spite of the use of steroids as recommended in the literature. belknap., reviewed data from spontaneous reports to research on adverse drug events and reports of pharmacovigilance (radar) program and appraised the clinical feature of gemcitabine - associated severe acute lung injury. among 178 reports of gemcitabine - induced pulmonary injury (55 from clinical trials and 92 from spontaneous reports) dyspnea, fever, and pulmonary infiltrate were the most frequent symptoms of gemcitabine - induced pulmonary injury. the median time to the diagnosis of this toxicity is 48 days (range 1529) after initiation of gemcitabine. eleven phase ii or phase iii clinical trials enrolling 317 patients identified pulmonary injury rates greater than 10%. highest rates of this toxicity (22 and 42%) were observed in phase iii clinical trials in which patients with hodgkin s disease were treated with gemcitabine and bleomycin. the authors concluded that high rates of gemcitabine - associated severe lung injury were observed, mainly when gemcitabine was combined with other agents that can also cause lung injury. just recently, arrieta., observed that radiotherapy and gemcitabine for locally advanced non - small cell lung cancer is associated with excessive pulmonary toxicity. differently, czarnecki and voss reviewed records of patients with pulmonary toxicity at fda freedom of information (fda - foi) database and observed that there was no substantial difference in pulmonary toxicity with the combination of gemcitabine and taxanes in comparison with gemcitabine alone. indeed, gemcitabine - induced pulmonary toxicity is a dramatic condition. in the current case, the patient presented with rapidly progressive respiratory failure and the lung biopsy showed an accelerated uip complicated by superimposed acute lung injury. most reported cases have occurred in patients with known uip, but the lesion can occur in patients with clinically unrecognized uip. the etiology of acute lung injury in uip is unknown, but most cases are assumed to represent an inherent part of the natural history of uip. histologically, however, the changes can not be separated from other causes of acute lung injury (such as viral infections, aspiration, sepsis, drug reactions, or toxic inhalants), and it is entirely possible that some cases may represent reactions to clinically unrecognized extrinsic lung insults. pathologically, the diagnosis is not usually difficult if all microscopic changes are taken into consideration. classically, there are easily recognizable areas of uip with patchwork pattern and honeycomb change. focus of diffuse alveolar damage (dad) recognizable by larger and more confluent interstitial fibroblast proliferation smaller than fibroblast foci of uip are usually present.. other findings of the diagnosis include squamous metaplasia in bronchiolar epithelium lining honeycomb areas. in the current case, naranjo s method identified gemcitabine as the probable agent of pulmonary toxicity. the liver is the most common site of metastatic dissemination of a colonic tumor ; however, a tumor from this region is very rare. in fact, this is the first report of metastasize inside the gallbladder from a tumor of colon origin. the prognostic of these patients was very poor with most of them achieving < 1-year survival. in summary, physicians should suspect pulmonary toxicity in patients with respiratory distress after gemcitabine chemotherapy, mainly in elderly patients that received high doses of this drug. | gemcitabine is a chemotherapy agent that may cause unpredictable side effects. in this report, we describe a fatal gemcitabine - induced pulmonary toxicity in a patient with gallbladder metastatic adenocarcinoma. a 72-year - old patient was submitted to an elective laparoscopic cholecystectomy, and a tubular adenocarcinoma in the gallbladder was incidentally diagnosed. ct scan and ultrasound before the surgery did not show any tumor. after the surgery a pet scan was positive for a hot - spot in the left colon. the colonic lesion was conveniently removed and the histology evaluation confirmed the diagnosis of adenocarcinoma tubular. the patient was then submitted to three sections of 1,600 mg / m2 of gemcitabine with intervals of 1 week. three weeks later he developed severe respiratory distress. a helicoidal ct scan showed diffuse and severe interstitial pneumonitis, and lung biopsy confirmed accelerated usual interstitial pneumonia consistent with drug - induced toxicity. the patient presented unfavorable evolution with progressive worsening of respiratory function, hypotension, and renal failure. he died 1 month later in spite of methylprednisolone pulse therapy, large spectrum antimicrobial therapy, and full support of respiratory, hemodynamic and renal systems. gemcitabine - induced pulmonary toxicity is usually a dramatic condition. physicians should suspect pulmonary toxicity in patients with respiratory distress after gemcitabine chemotherapy, mainly in elderly patients. |
socioeconomic inequalities in mortality are the most widely documented evidence of social disparities in health globally.1 the recognition that health is not only the result of current circumstances, but rather of multiple processes operating across the entire life course, has led scholars to investigate the association between early - life socioeconomic conditions and adult mortality.210 a systematic review11 shows that socioeconomic characteristics in childhood are important predictors of all - cause mortality in later life, although the association becomes attenuated in models adjusted by adult socioeconomic position. this has led to the conclusion that measuring socioeconomic characteristics at only one point in time is not enough to capture the full extent of socioeconomic inequalities in health.4 however, there are still gaps that need to be explored to better understand the role of childhood socioeconomic conditions on mortality. studies in this field are usually conducted on participants recruited after reaching adulthood,12 with childhood information obtained either from census data (ie, not measured at birth for all participants),3 5 or else from interviews conducted later in childhood2 or during adulthood,13 the latter of which has been shown to underestimate the true association.14 furthermore, most studies are performed in relatively young cohorts,24 6 15 which does not allow tracking of the effects beyond premature mortality (ie, after 70 years of age)16 or investigation of potential variation in the strength of the effect across different age intervals. it is necessary to fill this gap in order to determine how long the impact of childhood socioeconomic conditions lasts throughout the life course. apart from methodological limitations, most epidemiological studies in this area focus only on childhood socioeconomic conditions, for example, parental occupation or other proxies for material living standards. such is the case for mother 's marital status, which can lead to social vulnerability due to the stigma of illegitimacy or to other disadvantages such as reduced material resources or the lack of parental involvement.1719 even in contemporary settings, having an unmarried mother is associated with adverse health and social outcomes in the child and following generations.20 21 several mechanisms (material and psychosocial) have been put forward in the literature to explain how socioeconomic inequalities in childhood translate into disparities in mortality later in life ; and different life - course models have been suggested to describe how such mechanisms might operate (critical, accumulation and sensitive periods).22 thus, childhood socioeconomic conditions could directly influence adult mortality by altering the susceptibility to develop a particular disease already in the uterus through fetal programming (ie, a critical period effect).23 alternatively or additionally, childhood socioeconomic conditions could be linked to adult mortality indirectly through a chain of cumulative disadvantages that materialise in different life - course trajectories, the so - called unhealthy life careers24 (eg, childhood malnutrition contributes to poor cognitive abilities, which leads to poor school performance, which in turn affects job opportunities and later health).24 25 in this paper, we study the long - term effects of early - life socioeconomic and social conditions (measured via familial occupational position and marital status) on all - cause mortality in a cohort of 11 868 participants followed throughout almost their entire lifespan. our specific aims are to assess (1) the effect size across age - specific intervals and (2) the remaining effect after the inclusion of early - life health characteristics and adult socioeconomic characteristics (mediators). our study is based on the uppsala birth cohort multigenerational study (ubcos multigen) (http://www.chess.su.se/ubcosmg/), which contains all live births at the uppsala university hospital, sweden, between 1915 and 1929.26 27 the follow - up was initiated at birth and continued until death, emigration or 31 december 2009, whichever was earliest. from a total of 14 192 live births, we excluded multiple births (n=444), as their growth rate is reduced in the final trimester.28 we then further excluded 11.4% of singleton births because of missing data on birth weight (n=101), gestational age (n=398), parity (n=1), maternal age (n=1), marital status (n=29) or parental occupation (n=1093). among those with missing data on parental occupation were 723 offspring of mothers whose occupation was listed as house - daughter, which is effectively a measure of marital status (house - daughters were typically single women living with their parents at the time of the birth of their child). we also excluded participants if the recorded gestational age was below the biological viability threshold of 22 weeks (n=2) or if the individual could not be traced after their birth (n=255). the main analyses are therefore based on a sample of 11 868 participants. in subanalyses to assess the effect of adult socioeconomic characteristics, we excluded those participants who did not survive to the age of 55 years (n=2092 ; 18%). this decision was made to ensure that we have adult socioeconomic information for all individuals since the information comes from census data (1960 and 1970). also, we excluded observations with missing data on education (n=36), occupation (n=191) and income (n=218) in adulthood. the total sample to study the effect of socioeconomic conditions in adulthood comprises 9441 participants. birth weight was classified into 10 years of education). marital status of the cohort member was categorised into married and unmarried (single / divorced / widowed) based on data collected in 1960. we were guided by our interest in assessing how the effects of marital status and family socioeconomic position varied across different age intervals. the models were stratified by age using the following bands : 10 years of education). marital status of the cohort member was categorised into married and unmarried (single / divorced / widowed) based on data collected in 1960. we were guided by our interest in assessing how the effects of marital status and family socioeconomic position varied across different age intervals. the models were stratified by age using the following bands : 0.05). unfavourable family socioeconomic characteristics at birth and being born to an unmarried mother are associated with higher mortality rates. the effect of family socioeconomic characteristics on all - cause mortality was robust and did not show appreciable variation in strength across age - specific analyses. however, mother 's marital status showed effects of varying strength depending on the age interval studied. the offspring of unmarried mothers had a higher risk of infant mortality compared with the overall effect. the effects of early - life social characteristics on adult mortality persist after the inclusion of adult socioeconomic characteristics (occupation, education and income) and marital status. these findings suggest that the effect of early - life social conditions lasts across the life course. no interactions were found between gender and mother 's marital status or family 's socioeconomic position in their effect on mortality. to the best of our knowledge, this is the first study that investigates the effect of family 's socioeconomic position together with mother 's marital status at birth by age at death within an almost complete representative cohort. in contrast to most previous studies on early - life socioeconomic inequalities in mortality, we included mother 's marital status as a social variable and explored its effect on mortality before and after the inclusion of family socioeconomic position. we found that mother 's marital status and family 's socioeconomic position have independent effects on mortality in mutually adjusted analyses, and without any evidence of an interaction between them. this finding suggests that family 's socioeconomic position and mother 's marital status involve different dimensions of social stratification with specific effects on mortality throughout life. since we did not find previous studies with similar designs and settings, the comparison of the results can only be partial. consistent with previous studies,2 4 5 34 we found an association between childhood socioeconomic position and mortality. in line with most studies,24 6 but not all,5 35 the effect of early - life social characteristics on all - cause mortality was not fully mediated by adult socioeconomic characteristics. our findings therefore add further evidence to the observation that only measuring adult socioeconomic characteristics will not accurately capture the full extent of socioeconomic differences in mortality.4 our findings are consistent with one study in the uk2 that showed higher death rates at age 26 - 54 among manual workers born in 1946 and with another study in sweden3 that showed higher death rates at age 2540 among manual workers born between 1946 and 1955, although our results differ from one study from england and scotland13 that did not find any effect of parental occupation on mortality at ages 3564 among individuals born between 1937 and 1939. the comparison between cohorts from similar contexts does not support the thesis that socioeconomic inequalities in mortality might not have been observed before world war ii due to the combination of high virulence of diseases where all social groups were equally exposed together with the inefficacy of medical treatments.36 the effect of marital status is consistent with the results of two further studies, one on infant mortality34 and the other on mortality over 50 years of age.37 our results are also consistent with an earlier study using the same data but with a shorter follow - up of these data which found that there was a lower probability of reaching 80 years of age among the offspring of single mothers.19 this study is based on a representative,38 nearly complete cohort of individuals followed during almost their entire lifespan. this data material allowed us to estimate age - varying hrs and also to study the effect of childhood socioeconomic conditions on mortality at old age, whereas previous studies could only focus on younger groups.2 3 in contrast to other studies,35 13 information on socioeconomic conditions was measured for all participants at the time of birth, which increases comparability among the participants. unlike past research,25 we additionally explored the effect of marital status and its interaction with family socioeconomic position. owing to the small sample size, we could not study the children of divorced (n=21, 0.18%) and widowed (n=59, 0.50%) women as a separate group. we acknowledge that the grouping of children of single, divorced and widowed women together may introduce heterogeneity. likewise, since we only have information on marital status, we can not identify those mothers who were cohabiting with the child 's father or otherwise receiving his support. another potential source of heterogeneity lies in the fact that family 's socioeconomic position and mother 's marital status were measured at only a single point in time (the child 's birth), meaning that we are unable to examine the dynamics of these over time. this might especially be a problem if the cumulative life - course model is the one that best describes the association between childhood conditions and adult mortality. a further limitation is the lack of information on parental education and income, which has been shown to be complementary information that captures different dimensions of social stratification.39 in addition, although our study was well powered at older ages, we were forced to use relatively broad age intervals at younger ages (eg, 119 years). in this study, we did not conduct a detailed mediation analysis, and so are unable to examine the underlying mechanisms of the effects we observed. insofar as the inclusion of birth weight and gestational age in our study did not substantially change the strength of the association, it seems likely that these are not important mediators of the effects observed. however, we lacked data on other plausible mediators such as cognitive abilities or personality, and therefore are unable to examine how far these might lie on the pathway between early - life social conditions and mortality. finally, in contrast to other cohort studies,2 5 the uppsala birth cohort was relatively less affected by world war ii. nonetheless, sweden was not exempt from experiencing other external shocks ; the spanish flu (19181920) may have influenced older participants of the cohort, and the great depression (19291939) may have particularly influenced individuals born in the 1920 as the crisis took place during their early childhood. concerning migration, we did not expect serious distortions as the proportion of out - migrants was only 1.42%. this might be due to the fact that sweden, unlike other countries, such as the uk, started expanding its social security system from this time,40 thereby buffering any adverse effects of the crisis. using a representative and an almost complete cohort, our study confirms that early - life socioeconomic conditions have a long - standing effect on all - cause mortality, regardless of adult socioeconomic characteristics. further studies in other settings should confirm this pattern and elaborate on the mechanisms through which being born to a family of high socioeconomic position and/or a married mother might protect individuals from premature death. our findings are based on all - cause mortality, a summary measure of health at the population level. although many plausible biological and social pathways for a long - term effect of early - life social conditions on later health have been proposed, further studies looking at specific causes of death might better elucidate the underlying disease - specific mechanisms. previous studies have, for example, found that the association between parental social characteristics and all - cause mortality is predominately driven by cardiovascular disease5 7 and stroke in particular.13 studies looking at early - life socioeconomic effects on adverse health outcomes later in life should also consider family composition and mother 's marital status. our findings suggest that marital status has a specific effect on mortality, that is not explained or modified by the role of family socioeconomic position. further studies should confirm this result and assess the specific mechanisms through which different social characteristics (inasmuch as they represent different dimensions of social stratification) influence health and mortality differently across ages. unfavourable family socioeconomic characteristics at birth and being born to an unmarried mother are associated with higher mortality rates. the effect of family socioeconomic characteristics on all - cause mortality was robust and did not show appreciable variation in strength across age - specific analyses. however, mother 's marital status showed effects of varying strength depending on the age interval studied. the offspring of unmarried mothers had a higher risk of infant mortality compared with the overall effect. the effects of early - life social characteristics on adult mortality persist after the inclusion of adult socioeconomic characteristics (occupation, education and income) and marital status. these findings suggest that the effect of early - life social conditions lasts across the life course. no interactions were found between gender and mother 's marital status or family 's socioeconomic position in their effect on mortality. to the best of our knowledge, this is the first study that investigates the effect of family 's socioeconomic position together with mother 's marital status at birth by age at death within an almost complete representative cohort. in contrast to most previous studies on early - life socioeconomic inequalities in mortality, we included mother 's marital status as a social variable and explored its effect on mortality before and after the inclusion of family socioeconomic position. we found that mother 's marital status and family 's socioeconomic position have independent effects on mortality in mutually adjusted analyses, and without any evidence of an interaction between them. this finding suggests that family 's socioeconomic position and mother 's marital status involve different dimensions of social stratification with specific effects on mortality throughout life. since we did not find previous studies with similar designs and settings, the comparison of the results can only be partial. consistent with previous studies,2 4 5 34 we found an association between childhood socioeconomic position and mortality. in line with most studies,24 6 but not all,5 35 the effect of early - life social characteristics on all - cause mortality was not fully mediated by adult socioeconomic characteristics. our findings therefore add further evidence to the observation that only measuring adult socioeconomic characteristics will not accurately capture the full extent of socioeconomic differences in mortality.4 our findings are consistent with one study in the uk2 that showed higher death rates at age 26 - 54 among manual workers born in 1946 and with another study in sweden3 that showed higher death rates at age 2540 among manual workers born between 1946 and 1955, although our results differ from one study from england and scotland13 that did not find any effect of parental occupation on mortality at ages 3564 among individuals born between 1937 and 1939. the comparison between cohorts from similar contexts does not support the thesis that socioeconomic inequalities in mortality might not have been observed before world war ii due to the combination of high virulence of diseases where all social groups were equally exposed together with the inefficacy of medical treatments.36 the effect of marital status is consistent with the results of two further studies, one on infant mortality34 and the other on mortality over 50 years of age.37 our results are also consistent with an earlier study using the same data but with a shorter follow - up of these data which found that there was a lower probability of reaching 80 years of age among the offspring of single mothers.19 this study is based on a representative,38 nearly complete cohort of individuals followed during almost their entire lifespan. this data material allowed us to estimate age - varying hrs and also to study the effect of childhood socioeconomic conditions on mortality at old age, whereas previous studies could only focus on younger groups.2 3 in contrast to other studies,35 13 information on socioeconomic conditions was measured for all participants at the time of birth, which increases comparability among the participants. unlike past research,25 we additionally explored the effect of marital status and its interaction with family socioeconomic position. owing to the small sample size, we could not study the children of divorced (n=21, 0.18%) and widowed (n=59, 0.50%) women as a separate group. we acknowledge that the grouping of children of single, divorced and widowed women together may introduce heterogeneity. likewise, since we only have information on marital status, we can not identify those mothers who were cohabiting with the child 's father or otherwise receiving his support. another potential source of heterogeneity lies in the fact that family 's socioeconomic position and mother 's marital status were measured at only a single point in time (the child 's birth), meaning that we are unable to examine the dynamics of these over time. this might especially be a problem if the cumulative life - course model is the one that best describes the association between childhood conditions and adult mortality. a further limitation is the lack of information on parental education and income, which has been shown to be complementary information that captures different dimensions of social stratification.39 in addition, although our study was well powered at older ages, we were forced to use relatively broad age intervals at younger ages (eg, 119 years). in this study, we did not conduct a detailed mediation analysis, and so are unable to examine the underlying mechanisms of the effects we observed. insofar as the inclusion of birth weight and gestational age in our study did not substantially change the strength of the association, it seems likely that these are not important mediators of the effects observed. however, we lacked data on other plausible mediators such as cognitive abilities or personality, and therefore are unable to examine how far these might lie on the pathway between early - life social conditions and mortality. finally, in contrast to other cohort studies,2 5 the uppsala birth cohort was relatively less affected by world war ii. nonetheless, sweden was not exempt from experiencing other external shocks ; the spanish flu (19181920) may have influenced older participants of the cohort, and the great depression (19291939) may have particularly influenced individuals born in the 1920 as the crisis took place during their early childhood. concerning migration, we did not expect serious distortions as the proportion of out - migrants was only 1.42%. this might be due to the fact that sweden, unlike other countries, such as the uk, started expanding its social security system from this time,40 thereby buffering any adverse effects of the crisis. using a representative and an almost complete cohort, our study confirms that early - life socioeconomic conditions have a long - standing effect on all - cause mortality, regardless of adult socioeconomic characteristics. further studies in other settings should confirm this pattern and elaborate on the mechanisms through which being born to a family of high socioeconomic position and/or a married mother might protect individuals from premature death. our findings are based on all - cause mortality, a summary measure of health at the population level. although many plausible biological and social pathways for a long - term effect of early - life social conditions on later health have been proposed, further studies looking at specific causes of death might better elucidate the underlying disease - specific mechanisms. previous studies have, for example, found that the association between parental social characteristics and all - cause mortality is predominately driven by cardiovascular disease5 7 and stroke in particular.13 studies looking at early - life socioeconomic effects on adverse health outcomes later in life should also consider family composition and mother 's marital status. our findings suggest that marital status has a specific effect on mortality, that is not explained or modified by the role of family socioeconomic position. further studies should confirm this result and assess the specific mechanisms through which different social characteristics (inasmuch as they represent different dimensions of social stratification) influence health and mortality differently across ages. this study suggests that both mother 's marital status and family 's socioeconomic position in early childhood have an effect on mortality across the lifespan. the effect of marital status is strongly associated with mortality during the first year of life. these findings support the importance of improving early - life conditions in order to enhance healthy ageing. studies have shown that socioeconomic characteristics in childhood are important predictors of all - cause mortality in later life. however, studies in this field are usually conducted in relatively young cohorts, and have not investigated the potential for variation in the strength of the effect across different age intervals. our study is based on an exceptional data set that follows a cohort of individuals born between 1915 and 1929 across their lifespan. this material allowed us to assess, for the first time, the effect of early - life social characteristics on mortality at different age intervals from birth to old adult ages. this study shows that the adverse effect of social conditions is associated with a lower survival at all ages. this early - life effect extends to other categories such as marital status that conferred (and to some extent still confers) a socially disadvantaged position in society. the effect of family socioeconomic position did not show appreciable variation in the strength of the association across age - specific analyses ; however, marital status shows a stronger effect for infant mortality. our findings led to the conclusion that only measuring adult social characteristics does not accurately capture the full extent of socioeconomic differences in mortality. this evidence supports the importance of improving early - life conditions in order to enhance healthy ageing. | backgroundample evidence has shown that early - life social conditions are associated with mortality later in life. however, little attention has been given to the strength of these effects across specific age intervals from birth to old age. in this paper, we study the effect of the family 's socioeconomic position and mother 's marital status at birth on all - cause mortality at different age intervals in a swedish cohort of 11 868 individuals followed across their lifespan.methodsusing the uppsala birth cohort multigenerational study, we fitted cox regression models to estimate age - varying hrs of all - cause mortality according to mother 's marital status and family 's socioeconomic position.resultsmother's marital status and family 's socioeconomic position at birth were associated with higher mortality rates throughout life (hr 1.18 (95% ci 1.12 to 1.26) for unmarried mothers ; 1.19 (95% ci 1.12 to 1.25) for low socioeconomic position). while the effect of family 's socioeconomic position showed little variation across different age groups, the effect of marital status was stronger for infant mortality (hr 1.47 (95% ci 1.23 to 1.76) ; p=0.04 for heterogeneity). the results remained robust when early life and adult mediator variables were included.conclusionsfamily's socioeconomic position and mother 's marital status involve different dimensions of social stratification with independent effects on mortality throughout life. our findings support the importance of improving early - life conditions in order to enhance healthy ageing. |
cervical radiculopathy is caused by the compression of the cervical nerves or nerve roots1. a herniated intervertebral disc, the common symptoms of cervical radiculopathy involve pain, muscle weakness spreading into the neck and upper extremities, loss of sensation2, and proprioception deficits3. although the symptoms experienced by patients with cervical radiculopathy vary, the symptoms generally appear at certain regions and with specific characteristics depending on the level of nerve compression. the treatment options for cervical radiculopathy can be divided into surgical and conventional treatments, both of which aim to reduce pain and symptoms, increase nerve function, and prevent recurrence of cervical radiculopathy. no study with a high level of evidence has proved that surgical intervention alone for cervical radiculopathy is effective4. surgical interventions are often combined with conventional nonsurgical treatments, such as medications, use of a cervical collar, cervical traction, and manual therapy. these conventional treatments, however, have not been proven effective by studies with a high level of evidence either5, 6. among the methods used for pain and symptom relief in cervical radiculopathy, however, no systematic review has been made summarizing the effects of the exercise training on cervical radiculopathy, either as an alternative to surgery or as a post - operative treatment option. the present study searched the literature to determine the treatment effects of exercise interventions for patients with cervical radiculopathy after receiving nonsurgical or surgical treatments. studies from january 1997 to may 2014 found on four online databases (i.e., medline, cinahl, scopus and pubmed) were searched using the following key words : (a) cervical radiculopathy or cervical spondylotic radiculopathy ; (b) exercise training or physiotherapy. the selection criterion was that the exercise programs used to treat the radiculopathy must be detailed in the articles. review articles or studies involving patients with the whiplash syndrome or low back disorders were excluded. individual assessors were assigned and conducted the literature search of each of the databases using the search terms listed above. all of the identified relevant articles were then collectively presented to one of the authors who then determined their eligibility and inclusion for further analysis. the quality of the identified studies was assessed using the physiotherapy evidence database (pedro) scale, a scale that is used to assess the strength of the evidence in therapeutic research. the pedro scale consists of 11 items and has been shown to be reliable and valid9. the total score of the pedro scale ranges from 0 to 10 points, and studies with high, medium, and low quality are accredited 610 points, 45 points, and 03 points, respectively. the levels of evidence of the identified studies were evaluated using the oxford centre for evidence - based medicine (ocebm) levels of evidence. based on the definition of ocebm, studies are classified as levels 1 to 5 according to the research design structure and the highest evidence level (level 1) is given to systematic literature reviews of randomized controlled trials (rcts). the therapeutic effectiveness and outcomes of the identified studies were classified based on the three major components of the international classification of functioning, disability and health (icf) model : (1) body function and structure, including the numeric pain rating scale (nprs), visual analogue scale (vas), craniovertebral angle, peak - to - peak amplitude of dermatomal somatosensory evoked potentials (dsep) as an assessment of nerve root function, pain location chart, global rating of change scale (groc), grip strength, active range of motion (arom), neck endurance, manual dexterity, and arm elevation during neck extension ; (2) activity and participation, including the neck disability index (ndi), patient - specic functional scale (psfs), coping strategies questionnaire, and disability index rating (dir) ; and (3) personal factors, including the mood adjective check list, hospital anxiety and depression scale, patient satisfaction, and fear - avoidance beliefs questionnaire (fabq). eleven studies that met our search terms and inclusion criteria were examined in this study (fig. 1fig. all the studies were categorized as ocebm levels 1 and 2, indicating a high level of evidence. table 1table 1.pedro and oxford centre for evidence - based medicine levels of evidence of the included articlesarticlepedrolevels of evidence 1234567891011totalexercise interventiondiab, 201210111100011117ifritz, 201411111100111118iijoghataei, 200412110100110116ikuijper, 200913111100010116inar, 201414110100011116iyoung, 200915111100111118ipost - surgical exercise interventionengquist, 201316111100000115iipeolsson, 201317111100100116iisurgery vs. exercise interventionpersson, 199718111100011117ipersson, 200119111100011117ipersson, 199820111100011117i provides quality assessments of the 11 studies according to the pedro scale. because exercise was employed as the main intervention, the practice of blinding the research participants and surveying personnel was impractical ; consequently, no scores were obtained for questions 5 and 6 of the pedro assessment. nevertheless, most of the studies scored 6 to 8 points and thus were categorized as high - quality studies. flowchart of the selection of articles in the six studies10, 11, 12, 13, 14, 15 of non - surgical exercise interventions, not all the participants were diagnosed as having cervical radiculopathy using the magnetic resonance imaging (mri) or computed tomography (table 2table 2.summary of the six studies involving exercise intervention without surgical treatmentsstudy designbasic dataintervention(s)outcomes measure & follow - upoutcomediab. 201210rct2 groupsn : 96 age : 46.1mri : no mentioncontrol group (48)ultrasound and infraredexercise group (48)4 times / week for 10 weeksexercise, ultrasound, and infraredposture corrective exercise program strengthening (12rep3set) : deep cervical flexors, shoulder retractors stretching (30s3set) : cervical extensors, pectoral musclespeak - to - peak amplitude of dermatomal somatosensory evoked potentials, craniovertebral angle, vasfollow up : 10-week, 6-month10-week, 6-month : signicant difference between the exercise & control groups adjusted to baseline value of outcome for all measured.201411rct3 groupsn:86age : 46.9neck/ arm pain : 4.22.1/4.32.4dosage : 3 times / week, 2 weeks 2 times / week, 2 weeksexercise group (28)1. scapular - strengthening exercisesmechanical traction+exercise group (31)supine, 15 minutes, 5.44 kgover - door traction group (27)sit, 15 minutes, 3.639.07 kgndi, nprs (neck, arm), patients self - reported global rating of change from beginning of treatment to presentfollow up : 4-week, 6-month, 12-monthmechanical traction+exercise group v.s. exercise group: lower disability and pain in mechanical traction+exercise group no significance for ndi,.200412rct2 groupsn : 30age : 47mridosage : 3 times / week, 10 physical therapy sessionscontrol group (15)electrotherapy/ exercise treatmentexercise : isometric strengthening neck exercise8 seconds for 25 repetitions each (twice a day), dailyexperimental group (15)cervical traction and electrotherapy / exercise treatmentgrip strengthfollow up:5th sessions, 10th sessions5th sessions : greater change of grip strength in experimental group10th sessions: significant increase in grip strength compared with pretreatment no significant difference between.200913rct3 groupsn:205age : 47.1mri:1. diagnosis by doctor2. no mentionneck/ arm pain : 6.22.8/7.21.9semi - hard collar group (69)36 weeksphysiotherapy & home exercises group (70)mobilizing and stabilizing the cervical spinetwice a week for 6 weekscontrol group (66)continuation of daily activities as much aspossible without specific treatmentvas (neck, arm), ndi, treatment, satisfaction, work statusfollow up : 3-week, 6-week, and 6-month3-week and 6-week : reduced neck and arm pain in semi - hard cervical collar group and physiotherapy & home exercises group6-month: no or limited pain no significant differences for other measurementsnar,201414rct (the description of rct is not clear.)2 groupsn:30age : 44.5mri:1. diagnosis by doctor2. no mentionneck pain : 7.1 + 1.0once daily, 10 days, 6 days / weekcontrol group (15)1. isometric neck exercises for flexion, extension, side flexion and rotation with manual resistance. sitting position, 10 repetitions, 6 seconds hold.experimental group (15)ict, ift, isometric neck exercises & neural mobilizationvasfollow - up : no significancepain decreased significantly for both groupsgreater change of pain in the experimental.200915rct2 groupsn:81age : 47.1diagnosis by ptneck pain : 6.51.7dosage : 4.2 weeksmtex traction group (45)manual therapy, exercise, & intermittent cervical tractionmtex group (36)manual therapy, exercise, & sham intermittent cervical tractionexercise1. scapular strengtheningnprs, psfs, ndi.fabq, groc, patient satisfaction, grip strengthfollow up : 2-week, 4-weekno signicant differences between groups). the duration of exercise interventions ranged from 10 days to 10 weeks, while the exact time of each intervention session was not clearly defined. the exercise intervention items incorporated strength training (eg, isometric exercises of the deep cervical flexor muscles, shoulder retraction muscles, and scapular muscles) and stretching exercises (stretches for the neck and chest muscles). the outcome measures primarily focused on pain (vas or nprs) and disability (ndi). the results of these six studies indicate that patients in the exercise groups exhibited alleviated pain and reduced levels of disability. a significantly increased peak - to - peak amplitude of dsep, elevated grip strength, and improved craniovertebral angle to lessen the forward head posture (fhp) were also reported. among the five studies that involved a surgical control group, two studies16, 17 were published by the same research group and had identical participants (table 3table 3.summary of the two studies with post - surgical exercise interventionreferencesstudy designbasic dataintervention(s)outcomes measure & follow -. medical exercise(1) neck stabilization and endurance(2) strengthening of the scapular muscles(3) stretching of neck and shoulder muscles(4) thoracic mobilization (all performed with postural correction)2. education(1) pain management was conducted by 1 time / week for the rst 14 weeks(2) physiology of pain, stress, exercise, breathing technique, coping, pacing, and ergonomicsacdf+postoperative exercise group (31)ndi, vas (neck, arm)signicant reduction in ndi, neck pain, & arm pain compared with baseline for both groupsgreater reduction of neck pain intensity in acdf+postoperative exercise group at 6-month & 12-monthno signicant between - group difference for arm pain intensity &. 201317as aboveas aboveas abovearom, neck muscle endurance, hand strength, manual dexterity, arm elevation during neck extensionfollow up : 6-month, 1-year, 2-yearno signicant differences between the two treatmentsboth groups showed improvements over time in neck muscle endurance, manual dexterity, and right - hand grip strength). after being diagnosed as having cervical radiculopathy by mri, the participants in these two studies received exercise treatments that continued for 3 months after surgery. the protocols involved in the post - surgical exercise interventions were similar to those in the nonsurgical exercise interventions, with nursing education additionally incorporated. the outcome measurements were pain, disability, range of motion of the cervical joint, muscular endurance, and hand dexterity. compared with patients in an exercise - only group, the patients who received post - surgical exercise interventions experienced favorable improvements in terms of neck pain at the initial stage of the post - surgical exercise intervention. however, no significant difference was observed between the two groups at the 2 year follow - up testing. regarding neck disability, no significant difference was observed between the exercise and control groups before and after the patients received treatments. while no significant differences in cervical joint angle and neck muscular endurance were found between the two groups, both groups demonstrated a post - treatment increase in neck muscle endurance. the other three studies with surgical control groups18,19,20 compared the outcomes between the surgical and exercise treatments, and they were also published by the same research group (table 4table 4.summary of the three studies that involved a comparison between surgery and exercise interventionreferencesstudy designbasic dataintervention(s)outcomes measure & follow -. 199718rct4 groupsn : 81 + 30age : 47.5mri, ctsurgical decompression with fusion group (27)exercise group (27)1. neck and shoulder stretching2. flexibility exercises3. tens, heat3045 minutes / time, 15 times/3 monthsneck collar (27)daytime for 3 monthscontrol (30)vas, hand grip strength, pinch strengthfollow up:3-month and 12-month post treatment3-month : greater improvement of pain intensity, muscle weakness and sensory loss in surgery group12-month : no significant differences between surgical and conservative therapy. 200119rct3 groupsn:81age : 47.5mri, ctneck pain : 5.02.1surgical decompression with fusion group (27)exercise group (27)neck collar (27)mood adjective check list, hospital anxiety and depression scale, coping strategies questionnaire, vas, disability index rating (dir)follow up:3-month and 12-month post treatmentgreater improvement of pain in surgery group but no differences after one yeargreater improvement in the surgery and exercise groups than in collar group after 3. 199820rct4 groupsn : 81 + 30age : 47.5mri, ctsurgical decompression with fusion group (27)exercise group (27)neck collar (27)control (30)vas, muscle tenderness, shoulder motion, neck romfollow up:3-month and 12-month post treatmentlower pain intensity in surgery and exercise groups than in collar grouplower muscle tenderness in surgery group than in exercise and collar groupsgreater improvement of shoulder motion insurgery group than in collar groupsignificantly greater neck rom in exercise group than in collar group at pre - treatment and 3-month post treatment but no difference at 12-month). the participants were all recruited after being diagnosed as having cervical radiculopathy by mri. unlike the exercise interventions employed in the studies mentioned above, aerobic exercise was performed in these studies. outcome measurements included pain and disability as well as a questionnaire for assessing physical function and psychological state. at the initial stage, surgical treatment showed a favorable effect in terms of the neck pain ; however, no significant difference was observed between the two groups at 1 year follow - up. no differences were observed between the two types of treatment regarding improvements in the cervical joint angle, range of motion of the shoulder joint, or anxiety. our systematic review indicates that exercises for patients with cervical radiculopathy primarily incorporated strength training and stretching of the neck muscles. exercise intensity ranged from twice per week to once per day, with intervention periods lasting from 10 days to 10 weeks. strength training of the neck and chest can increase the proprioception of patients and promote muscle strength balance around the neck, thereby potentially reducing pain, strengthening body function, and preventing recurring injury21. cervical radiculopathy is frequently associated with inactivity and thus the aerobic capacity of patients may decrease rapidly and their deconditioned state may prevent them from participating in strength training22. consequently, aerobic exercise training should be considered as one of the exercise programs for patients with cervical radiculopathy. neck stretching exercises can maintain the active range of motion and normal function of the neck, avoiding scarring, adhesion, and repetitive micro - trauma of the neck5. based on the results of the 11 studies, it is our conclusion that the overall effect of exercise interventions is two - fold : (1) improving body structure and function : pain reduction, fhp reduction, increase of peak - to - peak amplitude of dsep, and enhanced grip strength, neck muscle endurance, and manual dexterity ; (2) facilitating activity and social participation : decreased neck disability and improved patient self - care ability for daily life. the primary difference between the effects of the surgical and exercise treatments or between those of the post - surgical exercise and exercise - only treatments pertained to pain, especially within the first year of receiving the interventions as no significant differences were reported between the two approaches after one year. in previous studies, although short - term pain was reduced substantially in the control group, no evident improvement was shown in fhp. however, both pain and fhp significantly improved in the exercise group, which was accredited to the amelioration of muscle balance following exercise training. the increased peak - to - peak amplitude of the dsep suggests that exercise interventions may improve the function of patients nervous systems10. many of the 11 reviewed studies of exercise interventions also included other auxiliary physical treatments. the primary purpose of the auxiliary physical treatments was to relieve pain, which may have influenced the treatment effect of the exercise interventions. the baseline conditions of the patients in each study differed, such as the intensity of pain (tables 24). in addition, not all diagnoses of cervical radiculopathy were confirmed by mri, and the therapeutic doses varied substantially. these factors might have influenced the treatment efficacy and by extension, the validity of the results of meta - analysis. first, three studies exclusively comparing outcomes between surgical and physical treatments18,19,20 were from the same research group (hereinafter referred to as the first research group), and the participants in these studies possibly overlapped. in addition, two studies that compared exercise - only treatment and post - surgical exercise treatment16, 17 were also conducted by the same research group with identical participants (hereinafter referred to as the second research group). because the first research group provided vas data at different stages and the second research group showed vas data as changes between the pre- and post - treatment periods, making direct comparison and meta - analysis impossible. regarding the range of motion of the cervical spine, the first research group considered the sum of the angles in three orthogonal planes, whereas the second research group provided separate angle data for each plane ; consequently, direct comparison and meta - analysis were not possible in this instance. second, the first research group indicated that no exercise treatments was performed by the patients within 3 months of receiving surgical treatment, but it was not clearly stated whether exercise through self - participation or other methods was prohibited within this 3-month period. therefore, the results obtained at 1 year after surgery may not be treated as the exclusive effects of the surgical intervention. third, thus far, patients receiving post - surgical exercise treatment have only been followed for up to 2 years16, 17.thus, the long - term effect of exercise treatment beyond 2 years remains unknown. fourth, these studies did not detail or classify the severity of the nerve root compression experienced by the patients ; therefore, the variation in the baseline conditions among the participants may also have influenced treatment effects. our systematic review of eleven randomized controlled trial studies indicates that nonsurgical treatments were mostly combined with multiple treatment patterns and that few studies investigated the effects of post - surgical exercise treatment. the exercise treatments for cervical radiculopathy involved deep cervical flexor muscle training, posture correction, and muscle stretching. it appears that exercise treatment can improve body structure and function, as well as the activity participation of the patients. however, these studies were not focused on assessing personal factors and the environment. future studies are warranted in order to incorporate the icf model in the assessment, and to yield more evidence capable of verifying that post - surgical exercise interventions are beneficial for patients with radiculopathy. | [purpose ] cervical radiculopathy is a clinical condition associated with pain, numbness and/or muscle weaknesses of the upper extremities due to a compression or irritation of the cervical nerve roots. it is usually managed conservatively but surgical intervention is sometimes required for those who fail to respond adequately. this study performed a literature review to determine the effects of exercise on non - operative and post - operative cervical radiculopathy patients. [methods ] the pubmed, medline, cinahl and scopus databases were searched to identify relevant articles published from january 1997 to may 2014, which explicitly stated that an exercise program was employed as an intervention for cervical radiculopathy. the therapeutic effectiveness and outcomes were then classified based on the international classification of functioning, disability and health (icf) model. [results ] eleven studies were identified and included in the final analysis. in these studies, the main forms of exercise training were specific strengthening and general stretching exercises. levels of evidence were graded as either i or ii for all studies according to the oxford centre for evidence - based medicine. the pedro scale score of these studies ranged from 5 to 8. [conclusion ] a review of eleven high - level evidence and high - quality studies revealed that, based on the icf model, exercise training is beneficial for improving the body function as well as activity participation of cervical radiculopathy patients. |
to date, safety data of immune checkpoint inhibitors in patients with an underlying autoimmune disease are scarce. this report provides information of the use of immune checkpoints inhibitors in real - world clinical practice, such in patients with autoimmune disorders. although our patient presented with a grade 4 immuno - related colitis, a complete response was observed after two infusions of ipilimumab. autoimmune diseases may not be an absolute contraindication for immune checkpoints inhibitors in those patients that can potentially benefit from them. each patient should be individually assessed depending on the therapeutic options available and the status of the underlying autoimmune condition. ipilimumab, a fully human antibody against ctla-4 (cytotoxic t - lymphocyte antigen 4), is an immune - checkpoint receptor inhibitor approved for the treatment of metastatic melanoma. as a result of its mechanism of action and subsequent activation of the immune system, ipilimumab is associated with immune - related adverse events (iraes), being dermatitis and colitis the most frequently reported.1 clinical trials with ipilimumab and other immune - checkpoint inhibitors have excluded patients with underlying autoimmune diseases because of the concern of the activation of the immune system and the possibility of induction or exacerbation of the disease, and even the development of ipilimumab - related adverse side effects. (a) was taken on 2 september, 2014 and (b) was taken 12 weeks after first dose of ipilimumab, on 5 november, 2014. we can observe regression in number and size of multiples skin metastases on the left limb and less swelling. we report the case of a patient with a braf - mutant metastatic melanoma and a medical history of rheumatoid arthritis (ra). ipilimumab induced a complete response, with no exacerbation of her ra but the patient developed a life - threatening diarrhoea - colitis. a 51-year - old woman presented in august 2010 with pain and swelling of small joints of hands and feet and morning stiffness. blood tests showed elevated acute phase reactants, a negative rheumatoid factor and a highly positive anticyclic citrullinated peptide antibody. treatment with low - dose prednisone (10 mg / day) and methotrexate, with rapid increase to 20 mg orally of methotrexate once a week, was started. the patient persisted with high disease activity and 8 months later biological therapy with rituximab (an anti - cd20 monoclonal antibody) was initiated. the patient presented a good response to rituximab (cycles of 2 doses of 1000 mg separated by 2 weeks, every 6 months), achieving a sustained clinical remission since april 2012. almost simultaneously to the diagnosis of the ra, she was diagnosed with a superficial spreading melanoma on her left lower limb, breslow 1.57 mm, clark level iv, in july 2010. she underwent wide excisional surgery and selective sentinel node dissection with evidence of micrometastases in the two biopsied lymph nodes. left groin lymphadenectomy was indicated with evidence of a total of five affected nodes (ajcc stage iiia, pt2an2a). interferon was discussed but was finally ruled out as an adjuvant option because of the underlying ra. two years later she experienced several non - surgical locoregional recurrences in left lower limb. after 3 months she initiated intralesional interleukine-2 (9 million international units (miu) weekly) because of progressive skin nodules, until january 2013 when multiple skin metastases appeared involving most of the left lower limb. subsequently, she underwent an isolated hyperthermic perfusion of the left leg with melfalan (100 mg, 41c) and tumour necrosis factor (tnf) (2 mg) with no benefit. as molecular analysis demonstrated a braf v600 mutation, she started systemic treatment with vemurafenib (960 mg orally twice daily) plus cobimetinib / placebo (60 mg once daily for 21 days, followed by 7 days off) within the context of a clinical trial in september 2013. nine months later, braf inhibitor therapy was stopped because of disease progression with the appearance of liver metastases by ct scan. the limited treatment options and adequate ra symptomatic control, with no need for treatment during the previous year (ie, rituximab had been withheld due to persistent disease remission) were taken into account. after considering potential risks related to her underlying autoimmune disorder or the development of severe iraes ipilimumab (3 mg / kg every 3 weeks, planned for a total of 4 doses) was initiated on 3rd october. on 25th october 2014, the patient was admitted to hospital after two doses of ipilimumab due to grade 4 diarrhoea and hypovolemic shock from gastrointestinal losses. she was started on methylprednisolone 1 mg / kg iv (intravenous), empirical piperacillin / tazobactam and parenteral fluid replacement without improvement of grade 3 diarrhoea. a full colonoscopy showed erythematous mucosa, loss of normal vascular pattern and multiple ulcers (figure 1). owing to the lack of response to steroids, treatment with infliximab (5 mg / kg iv) was initiated. after 7 days diarrhoea improved, the patient tolerated oral diet and was finally discharged 1 month later on tapering oral prednisone 1 mg / kg. no ra reactivation was observed despite immunosupressive therapies targeted to control the irae described. during admission a ct scan performed at week 12 post - ipilimumab showed a complete response of metastatic liver disease (figure 2). moreover a skin examination revealed flat blue - pigmented lesions on the left limb (figure 3) that were biopsied, confirming a complete regression of melanoma with presence of melanophages in the dermis. two weeks after discharge, the patient was readmitted with an exacerbation of her colitis symptoms with grade 3 diarrhoea when she was still on oral prednisone 30 mg daily. repeated stool cultures were negative for bacterial growth and the toxin test for c. difficile was positive. she was also started on oral vancomycin (250 mg every 6 h) with partial resolution of symptoms. after negativisation of toxin with at least two confirmatory tests, a second dose of infliximab 5 mg / kg was administered with gradual improvement of diarrhoea. during the hospitalisation, a second colonoscopy was suggestive of chronic ipilimumab - mediated colitis with numerous infiltrating t cells. the patient continued with oral tapering steroid therapy and was finally discharged 3 weeks post second admission. by june 2015, after 9 months after the first dose of ipilimumab, the patient remains in complete response, maintaining an ecog performance status of 0 and her ra remains in clinical remission. we present the case of a patient with an autoimmune disease and metastatic braf - mutant melanoma, who achieved a remarkable response with ipilimumab with no reactivation of her ra, though experienced a life - threatening immune - mediated enterocholitis. after progression on several therapies, including braf inhibitors, we considered and discussed extensively with the patient the administration of ipilimumab because of the lack of alternatives and effective therapies at that time and stability of clinical activity of her ra. the role of ctla-4 in tumour cells evasion from the immune system has been proved thoroughly. ctla-4 is a cell surface coreceptor strongly associated with attenuation of t - cell activation, and is an essential component of regulatory systems implied in peripheral immune tolerance. binding of ctla-4 to cd80/cd86 provides a control signal that suppresses ongoing t - cell activation. based on this rational a ctla4-ig, abatacept, its efficacy and safety were demonstrated in multiple trials and is currently approved for the treatment of moderate to severe ra after failure to methotrexate or other disease - modifying antirheumatic drugs including anti - tnf.2 autoimmune diseases affect approximately 5% of population. clinical trials involving immunotherapies for the treatment of cancer systematically excluded patients with these disorders because drugs targeting molecules affecting mechanisms of self - tolerance could result in the development of autoimmune disease symptoms. however, advances in immunobiology have entailed the incorporation of immunotherapies, such as anti - ctla4 and anti - pd1 antibodies, into the daily activity of oncologists in a broad sort of cancers and experience in the management and decision - making process for patients with autoimmune diseases is lacking. the case herein reported shows how these patients can benefit from immunooncological treatments without worsening the underlying autoimmune disease. to our knowledge, these autoimmune diseases comprise ra (one case), multiple sclerosis (one case), ulcerative colitis (uc) (two cases) and behcet disease (one case).35 although most of these patients seemed to benefit from immunotherapies, only in one of the cases reported, authors described a severe steroid - refractory colitis in a patient with uc, being unable to distinguish between an aggravation of the uc or an iraes. in the case of ra, the patient maintained treatment with weekly metotrexate 15 mg and low - dose prednisone through the ipilimumab course and experienced no disease reactivation (only slight increase of bilateral knee pain that was consistent with known osteoarthrosis rather than ra and was effectively treated with celecoxib). however, our patient presented a high - grade enterocolitis without worsening of her ra. although gastrointestinal adverse effects such as diarrhoea and colitis are among the most frequent iraes described in the literature for ipilimumab and this event may be completely independent of the underlying diagnosis of ra, we can not exclude an immune - based predisposition. until specific trials and immunobiology of cancer and autoimmune diseases shed light into the role of the immune checkpoint inhibitors in both situations, clinicians should be cautious. in the meantime, the clinical experience of single cases should be taken into account and autoimmune diseases may not be considered an absolute contraindication but a special condition in which risks and benefits must be thoroughly evaluated. | immune checkpoint inhibitors, such as ipilimumab (an anti - ctla4 antibody), have become a commonly used therapy in cancer. to date, safety data of patients with underlying autoimmune disease is limited. we present a case of a patient with rheumatoid arthritis who was diagnosed of a braf - mutant metastatic melanoma. the patient was treated with ipilimumab and presented with high - grade colitis requiring immunosuppressors. despite of the immune - related adverse event, no exacerbation of the rheumatoid arthritis was observed and the patient achieved a complete response. this case report contributes to the scarce literature on the use of immune checkpoint inhibitors in patients with an underlying autoimmune condition. |
this was a multi - institute, single - group clinical trial conducted at seoul st. approval was granted by the respective institutional review boards of each institute, and a clinical trial permit was obtained from the ministry of food and drug safety. this study was carried out in accordance with the tenets of the declaration of helsinki. at the screening visits, the investigators informed the subjects of the complete details of the clinical trial, after which the subjects signed a written consent form. we then obtained demographic information, history of ocular diseases, and current disease information from each subject and determined visual acuity, refractive error, corneal topography, slit - lamp microscopy, corneal endothelial cell count, central corneal thickness (cct), intraocular pressure, schirmer 's test result, and tear break - up time. the inclusion criteria for subjects were as follows : (1) age between 7 and 49 years, (2) myopic refractive error of -0.75 to -6.0 diopters (d) and astigmatic refractive error of 1.25 to 4.0 d, (3) radius of corneal curvature within the range of 46.00 to 39.75 d (7.34 to 8.5 mm), (4) horizontal corneal diameter larger than 11.0 mm, (5) occupation and environment allowing wear of lenses for more than 7 hours during sleep, (6) ability to follow instructions during the clinical trial, and (7) willingness to participate in the clinical trial and provide signed written consent. the exclusion criteria were : (1) schirmer test result less than 10 mm or tear break - up time shorter than 10 seconds, (2) abnormal findings during slit - lamp microscopy ; inflammation, erosions, ulcers, or angiogenesis in the cornea after wearing the lens for a 30-minute trial period, (3) allergies, (4) eye diseases that would have made participation in the trial difficult as judged by the investigator, (5) contraindication for wearing contact lenses, (6) wearing of rgp lenses within the 2 weeks prior to the screening visit, (7) diagnosed strabismus, (8) past corneal refractive surgery, (9) pregnancy, nursing, or planning to become pregnant, and (10) significant disease that would have made participation in the clinical trial difficult as judged by the investigator. candidates who met any one of the above criteria were excluded from the trial. at the first visit (day 1), subjects tried the toric orthokeratology lenses prescribed at the screening visit and were informed of the precautions that must be taken when wearing the lenses, as well as the potential adverse reactions. slit - lamp microscopy was performed, the refractive error was measured, and any adverse reactions to wearing the lenses were assessed. fit was confirmed during slit - lamp microscopy, along with determination of abnormal corneal findings. to confirm fit, we verified that there was pressure on the cornea, and that a space was maintained between the back of the toric orthokeratology lens and the cornea. while monitoring the changes in the kerato - conjunctiva, the ocular status in each subject 's anterior segment moderate to severe scores in this test were considered as indicators of an adverse reaction. any other clinically significant findings in the kerato - conjunctiva were also recorded as adverse reactions. in cases of poor lens all subjects were instructed to wear the lenses for an average of 7 hours during sleep and to not wear the lenses during the day. the second visit (day 2) took place 1 day after wearing the toric orthokeratology lenses overnight. both uncorrected visual acuity and refractive error were measured, and slit - lamp microscopy was performed. the same tests were repeated after 1, 2, and 3 weeks of lens wear. on the last visit (week 4), in addition to performing the tests described above, corneal endothelial cell count and cct were measured. the toric orthokeratology lenses used in the trial were toric lk lens (lucid korea, bonghwa, korea). the primary outcome measures in this study were myopic and astigmatic refractive errors after toric orthokeratology lens use. for convenience of analysis, secondary study outcomes included visual acuity, corneal curvature, time to reach the target uncorrected vision of 16 / 20 after wearing the lenses. to assess safety, slit - lamp microscopy was performed, and the ocular status score in the anterior segment was recorded. corneal endothelial cell count and cct were also measured, and the total incidence of adverse reactions was evaluated. statistical analyses of myopic and astigmatic refractive errors were performed using a two - tailed, paired t - test. for all other outcomes we used a two - tailed, paired t - test or wilcoxon 's signed - rank test as appropriate. the change in ocular status score in the anterior segment, as determined using slit - lamp microscopy, was input into a split table (frequency, ratio) and analyzed using bowker 's test. for all statistics, a p - value < 0.05 was considered significant. for missing values and when subjects dropped out before the trial was completed, the data from the subject was not included in our analysis. at the screening visits, the investigators informed the subjects of the complete details of the clinical trial, after which the subjects signed a written consent form. we then obtained demographic information, history of ocular diseases, and current disease information from each subject and determined visual acuity, refractive error, corneal topography, slit - lamp microscopy, corneal endothelial cell count, central corneal thickness (cct), intraocular pressure, schirmer 's test result, and tear break - up time. the inclusion criteria for subjects were as follows : (1) age between 7 and 49 years, (2) myopic refractive error of -0.75 to -6.0 diopters (d) and astigmatic refractive error of 1.25 to 4.0 d, (3) radius of corneal curvature within the range of 46.00 to 39.75 d (7.34 to 8.5 mm), (4) horizontal corneal diameter larger than 11.0 mm, (5) occupation and environment allowing wear of lenses for more than 7 hours during sleep, (6) ability to follow instructions during the clinical trial, and (7) willingness to participate in the clinical trial and provide signed written consent. the exclusion criteria were : (1) schirmer test result less than 10 mm or tear break - up time shorter than 10 seconds, (2) abnormal findings during slit - lamp microscopy ; inflammation, erosions, ulcers, or angiogenesis in the cornea after wearing the lens for a 30-minute trial period, (3) allergies, (4) eye diseases that would have made participation in the trial difficult as judged by the investigator, (5) contraindication for wearing contact lenses, (6) wearing of rgp lenses within the 2 weeks prior to the screening visit, (7) diagnosed strabismus, (8) past corneal refractive surgery, (9) pregnancy, nursing, or planning to become pregnant, and (10) significant disease that would have made participation in the clinical trial difficult as judged by the investigator. at the first visit (day 1), subjects tried the toric orthokeratology lenses prescribed at the screening visit and were informed of the precautions that must be taken when wearing the lenses, as well as the potential adverse reactions. slit - lamp microscopy was performed, the refractive error was measured, and any adverse reactions to wearing the lenses were assessed. fit was confirmed during slit - lamp microscopy, along with determination of abnormal corneal findings. to confirm fit, we verified that there was pressure on the cornea, and that a space was maintained between the back of the toric orthokeratology lens and the cornea. while monitoring the changes in the kerato - conjunctiva, the ocular status in each subject 's anterior segment moderate to severe scores in this test were considered as indicators of an adverse reaction. any other clinically significant findings in the kerato - conjunctiva were also recorded as adverse reactions. in cases of poor lens all subjects were instructed to wear the lenses for an average of 7 hours during sleep and to not wear the lenses during the day. the second visit (day 2) took place 1 day after wearing the toric orthokeratology lenses overnight. both uncorrected visual acuity and refractive error were measured, and slit - lamp microscopy was performed. the same tests were repeated after 1, 2, and 3 weeks of lens wear. on the last visit (week 4), in addition to performing the tests described above, corneal endothelial cell count and cct were measured. the toric orthokeratology lenses used in the trial were toric lk lens (lucid korea, bonghwa, korea). the primary outcome measures in this study were myopic and astigmatic refractive errors after toric orthokeratology lens use. for convenience of analysis, the astigmatic refractive error represented only corneal astigmatism not lenticular astigmatism. secondary study outcomes included visual acuity, corneal curvature, time to reach the target uncorrected vision of 16 / 20 after wearing the lenses. to assess safety, slit - lamp microscopy was performed, and the ocular status score in the anterior segment was recorded. corneal endothelial cell count and cct statistical analyses of myopic and astigmatic refractive errors were performed using a two - tailed, paired t - test. for all other outcomes we used a two - tailed, paired t - test or wilcoxon 's signed - rank test as appropriate. the change in ocular status score in the anterior segment, as determined using slit - lamp microscopy, was input into a split table (frequency, ratio) and analyzed using bowker 's test. for all statistics, a p - value < 0.05 was considered significant. for missing values and when subjects dropped out before the trial was completed, the data from the subject was not included in our analysis. in this clinical trial, a total of 79 eyes (44 subjects) were screened at one of two trial - conducting institutes ; 40 eyes (21 subjects, 50.63%) were excluded after screening, leaving a total of 39 eyes (23 subjects, 49.37%) to be tested after lens use. details of the subjects ' eyes at registration are presented as a schematic diagram in fig. the mean age was 21.81 8.89 years, with a range of 7 to 39 years. there were no pregnancies among the 19 women of childbearing age that were included in the study. the mean myopic refractive error changed from -3.65 1.62 to -1.05 1.64 d after wearing the lenses for 4 weeks, which constituted a statistically significant decrease of 2.60 2.21 d (p < 0.001). the correction of myopia by toric or - thokeratology lenses resulted in a superior refractive state (table 2 and fig. the mean astigmatic refractive error changed from 2.07 0.83 to 1.44 0.99 d after wearing the lenses for 4 weeks, which constituted a statistically significant decrease of 0.63 0.98 d (p = 0.001). the correction of astigmatism by toric orthokeratology lenses resulted in a superior refractive state (table 2 and fig. the mean uncorrected and corrected visual acuities at the screening visit were 2.14 0.80 and 0.05 0.13 logmar, respectively. the equivalent values after wearing the toric orthokeratology lenses for 4 weeks were 0.12 0.30 and 0.01 0.04 logarithm of the minimal angle of resolution (logmar), respectively. the difference in uncorrected visual acuity was -2.03 0.91 logmar, which was statistically significant (p < 0.001). the difference in corrected visual acuity was -0.04 0.14 logmar, which was not statistically significant (p = 0.156) (table 3). after wearing the lenses for 1 week, corrected visual acuity was greater than 16 / 20 in 29 eyes (93.55%). all of the eyes achieved a corrected visual acuity greater than 16 / 20 after wearing the lenses for 2 weeks. at the screening visit, the mean corneal curvature was 42.54 1.06 d, and the mean corneal diameter was 11.78 0.28 mm. after wearing the toric orthokeratology lenses for 4 weeks, the mean corneal curvature was 40.92 1.38 d and the mean corneal diameter was 11.76 0.35 mm. a representative topographic pattern of corneal astigmatism is shown in fig. 4a and 4b. after treatment, the difference in corneal curvature was -1.62 0.96 d, which was statistically significant (p < 0.001). however, the difference in corneal diameter was -0.02 0.35 mm, which was not statistically significant (p = 0.710). the mean cct values before and after wearing the lenses were 560.21 38.64 and 545.76 61.37 m, respectively. the mean difference was -14.45 37.46 m, which constituted a statistically significant decrease (p = 0.047) (table 4). cells / mm, which increased by 40.72 207.67 cells / mm to 3,237.28 277.25 cells / mm after 4 weeks of toric orthokeratology lens use. however, this difference was not statistically significant (p = 0.300). the difference in hexagonality was -0.07 12.07, which was also not statistically significant (p = 0.976). the coefficient of variation before and after wearing the lenses was 0.31 0.05 and 0.33 0.07. the difference of 0.02 0.06 was statistically significant (p = 0.027) (table 4). the efron grading scale scores during the trial were normal for all eyes in all categories except for corneal staining, in which 38 eyes (97.44%) were normal, and one eye (2.56%) was graded as trace before wearing the lenses. after 4 weeks of lens use, 25 eyes (80.65%) were normal, four eyes (12.90%) were graded as trace, and two eyes (6.45%) were graded as mild. the difference in grading before and after lens use was not statistically significant (p = 0.815). a total of five adverse reactions developed in five subjects, consisting of one case of conjunctival hyperemia (3.23%), one case of foreign body sensation in the eyes (3.23%), and two cases of, the adverse reactions ceased after the patients were prescribed additional artificial tears and were provided additional education regarding the proper wear and removal of the lenses. the mean myopic refractive error changed from -3.65 1.62 to -1.05 1.64 d after wearing the lenses for 4 weeks, which constituted a statistically significant decrease of 2.60 2.21 d (p < 0.001). the correction of myopia by toric or - thokeratology lenses resulted in a superior refractive state (table 2 and fig. the mean astigmatic refractive error changed from 2.07 0.83 to 1.44 0.99 d after wearing the lenses for 4 weeks, which constituted a statistically significant decrease of 0.63 0.98 d (p = 0.001). the correction of astigmatism by toric orthokeratology lenses resulted in a superior refractive state (table 2 and fig. the mean uncorrected and corrected visual acuities at the screening visit were 2.14 0.80 and 0.05 0.13 logmar, respectively. the equivalent values after wearing the toric orthokeratology lenses for 4 weeks were 0.12 0.30 and 0.01 0.04 logarithm of the minimal angle of resolution (logmar), respectively. the difference in uncorrected visual acuity was -2.03 0.91 logmar, which was statistically significant (p < 0.001). the difference in corrected visual acuity was -0.04 0.14 logmar, which was not statistically significant (p = 0.156) (table 3). after wearing the lenses for 1 week, corrected visual acuity was greater than 16 / 20 in 29 eyes (93.55%). all of the eyes achieved a corrected visual acuity greater than 16 / 20 after wearing the lenses for 2 weeks. at the screening visit, the mean corneal curvature was 42.54 1.06 d, and the mean corneal diameter was 11.78 0.28 mm. after wearing the toric orthokeratology lenses for 4 weeks, the mean corneal curvature was 40.92 1.38 d and the mean corneal diameter was 11.76 0.35 mm. a representative topographic pattern of corneal astigmatism is shown in fig. 4a and 4b. after treatment, the difference in corneal curvature was -1.62 0.96 d, which was statistically significant (p < 0.001). however, the difference in corneal diameter was -0.02 0.35 mm, which was not statistically significant (p = 0.710). the mean cct values before and after wearing the lenses were 560.21 38.64 and 545.76 61.37 m, respectively. the mean difference was -14.45 37.46 m, which constituted a statistically significant decrease (p = 0.047) (table 4). the mean corneal endothelial cell count at the screening visit was 3,196.55 237.80 cells / mm, which increased by 40.72 207.67 cells / mm to 3,237.28 277.25 cells / mm after 4 weeks of toric orthokeratology lens use. the difference in hexagonality was -0.07 12.07, which was also not statistically significant (p = 0.976). the coefficient of variation before and after wearing the lenses was 0.31 0.05 and 0.33 0.07. the difference of 0.02 0.06 was statistically significant (p = 0.027) (table 4). the efron grading scale scores during the trial were normal for all eyes in all categories except for corneal staining, in which 38 eyes (97.44%) were normal, and one eye (2.56%) was graded as trace before wearing the lenses. after 4 weeks of lens use, 25 eyes (80.65%) were normal, four eyes (12.90%) were graded as trace, and two eyes (6.45%) were graded as mild. the difference in grading before and after lens use was not statistically significant (p = 0.815). a total of five adverse reactions developed in five subjects, consisting of one case of conjunctival hyperemia (3.23%), one case of foreign body sensation in the eyes (3.23%), and two cases of, the adverse reactions ceased after the patients were prescribed additional artificial tears and were provided additional education regarding the proper wear and removal of the lenses. with the introduction of orthokeratology by wesley and jessen in the early 1960s, many clinicians and researchers have attempted to correct myopia using rigid contact lenses ; however, these attempts have been limited by patient discomfort and hypoxic corneal damage. the development of rgp lens material combined with advancements in contact lens manufacturing technology has led to the development of overnight orthokeratology, which enables patients to wear myopia - correcting contact lenses during sleep. in overnight orthokeratology, the reverse - geometry lens is designed with both a flatter central curvature and steeper peripheral curvature such that a tear reservoir can be formed, and the lens is precisely placed in the corneal center. in 2000, nichols. reported that overnight orthokeratology by the programmed application of rgp contact lenses with a reverse geometrical design is an effective means of temporarily reducing myopia. furthermore, they suggested a possible mechanism of corneal remodeling through central corneal thinning. a number of clinical trials to date have concluded that orthokeratology can effectively reduce moderate to high myopia, and control the progression of myopia. in addition, several reports have addressed the correction of astigmatism using orthokeratology lenses, although these effects are typically insufficient due to lens decentration. to address the issue of decentration, chen. examined the efficacy of toric orthokeratology in correcting myopia combined with moderate to high astigmatism. in their study, subjects aged 6 to 12 years with myopia of 0.50 to 5.00 d and with with - the - rule astigmatism of 1.25 to 3.50 d were fitted with toric orthokeratology lenses. they reported that manifest myopia was significantly reduced from 2.53 1.31 to 0.41 0.43 d (p < 0.001), and that astigmatism was also decreased from 1.91 0.64 to 0.40 0.39 d (p < 0.001) after 1 month of lens wear. similarly, in 2013, chen. conducted a non - randomized clinical study in which toric orthokeratology was found to effectively control myopia in children with accompanying moderate - to - high astigmatism. to our knowledge, this is the first prospective, multi - center clinical trial to have investigated the effectiveness of toric orthokeratology in korea. specifically, we evaluated the effectiveness and safety of toric orthokeratology lenses in patients with both myopia and astigmatism. patients wore the toric orthokeratology lenses during sleep for an average of 7 hours and for up to 4 weeks (28 days). the results showed than overnight toric orthokeratology reduced both myopia and astigmatism, although the degree of chance in astigmatism was relatively small. we attributed this small change to a weakened effect of the toric orthokeratology lenses to reshape the cornea during the night, as the subjects in this study visited our institute primarily in the afternoon. thus, additional studies regarding the clinical effectiveness of toric orthokeratology in correcting astigmatism are needed. unlike astigmatism, uncorrected visual acuity was significantly improved in our study, although there was no change in corrected visual acuity. thus, our results suggest that toric orthokeratology lenses do not change the ocular features associated with corrected visual acuity, which reflects the safety of this approach. a number of studies have suggested that various ocular parameters (corneal thickness in particular) are modifiable or predictive values for myopic reduction in orthokeratology. in 2000, lui and edwards reported that cct is the most predictive value of myopic reduction based on the results of a randomized controlled clinical trial involving 14 subjects who wore orthokeratology lenses during the daytime. specifically, they suggested that a thicker initial central cornea is associated with a greater reduction in myopia.. conducted a meta - analysis that included a total of 10 studies with 339 eyes from 239 patients in order to assess the change to cct by orthokeratology lens use in myopic patients. they found that cct was reduced significantly between 1 day and 1 week, and that the most significant reduction occurred between 1 day and 1 month. in our study, cct was significantly decreased (p = 0.005) after 4 weeks of lens wear but remained within the normal range. this might have been due to the reverse - geometry lens pressing down on the corneal center, causing rearrangement of the epithelium. among the five adverse reactions noted in five subjects during our trial, reactions exclusively concerning the lenses comprised four cases (12.90%), all of which were mild in nature and recovered fully. according to silt - lamp microscopy and other examinations of ocular parameters, there were no significant changes except for the cct and coefficient of variation, although cct remained within the normal range after 4 weeks. on the other hand, the change in coefficient of variation was considered to be a common effect of all types of contact lenses on corneal polymegathism, and the extent of the increase was not large relative to that noted in other studies. together, these data indicate that use of toric orthokeratology lenses does not cause any significant changes in ocular conditions. on the basis of these findings, our results suggest that toric orthokeratology lenses do not have any serious harmful effects. one limitation of this clinical trial was that the follow - up period was only 4 weeks. based on our results, the purpose of these studies should be to elucidate further aspects and complications of toric orthokeratology, such as maintenance of lens centration or changes in ocular features. in conclusion, the effectiveness of toric orthokeratology lenses in correcting myopia combined with astigmatism was verified statistically. orthokeratology lenses are currently limited to the correction of myopia ; however, our results provide an experimental basis for broadening the scope of orthokeratology lenses to include the correction of astigmatism. importantly, there were no notable adverse reactions or significant abnormal findings caused by use of toric orthokeratology lenses as determined by silt - lamp microscopy and other examinations. therefore, toric orthokeratology can be considered an effective and safe treatment for correcting visual acuity in patients with combined myopia and astigmatism. | purposethe purpose of this multi - institute, single - group clinical trial was to evaluate the effectiveness and safety of toric orthokeratology lenses for the treatment of patients with combined myopia and astigmatism.methodsa total of 44 patients were included in this clinical trial. the patients ranged in age from 7 to 49 years, with myopia of -0.75 to -6.0 diopters (d) and astigmatism of 1.25 to 4.0 d. after excluding 21 subjects, 23 subjects (39 eyes) were analyzed after toric orthokeratology lens use. the subjects underwent ophthalmologic examination after 1 day and 1, 2, 3, and 4 weeks of wearing overnight toric orthokeratology lenses.resultsa total of 19 subjects (31 eyes) completed the trial after five subjects (eight eyes) dropped out. in the patients who completed the study by wearing lenses for 4 weeks, the myopic refractive error decreased significantly by 2.60 2.21 d (p < 0.001), from -3.65 1.62 to -1.05 1.64 d. the astigmatic refractive error were also significantly decreased by 0.63 0.98 d (p = 0.001), from 2.07 0.83 to 1.44 0.99 d. the mean uncorrected and corrected visual acuities before wearing the lenses were 2.14 0.80 logarithm of the logmar (logmar) and 0.05 0.13 logmar, respectively, which changed to 0.12 0.30 logarithm of the logmar (p < 0.001) and 0.01 0.04 logmar (p = 0.156) after 4 weeks. no serious adverse reactions were reported during the clinical trial.conclusionsour results suggest that toric orthokeratology is an effective and safe treatment for correcting visual acuity in patients with combined myopia and astigmatism. |
pseudotumor cerebri (ptc) is a condition that classically presents with optic disc elevation and edema resulting from increased intracranial pressure in absence of hydrocephalus, space occupying lesion, or any other intracranial disease. studies show that obese women in their childbearing years are most frequently affected with an incidence rate more than a hundred times that of the general population (90/100,000 women vs 0.91.7/100,000 people) (campos and olitsky 1995). the symptom complex of a patient with ptc is variable but commonly includes nausea, emesis, amaurosis fugax, diplopia, tinnitus, retrobulbar pain, and postural headaches (campos and olitsky 1995). although there are few cases of pediatric ptc in literature, current reports suggest that pediatric ptc symptoms are typically less severe as compared to adults and no sexual predilection or correlation with obesity has been shown to exist. symptoms appear to parallel adult - like symptoms the older the child is at time of presentation (raghaven 1997). emotional irritability and somnolence are two key symptoms that appear to more commonly afflict infants and younger children who suffer from pediatric ptc (raghaven 1997). in both the adult or pediatric presentations, preservation of vision and visual field are principle concerns that must be addressed immediately. it has been shown that 85% of the patients presenting with signs and symptoms of ptc possess a visual field abnormality (cincirpini 1999). in pediatric ptc cases, the degree of visual field loss is between 13%38% with 46% of these cases demonstrating an enlarged blind spot (cincirpini 1999). although the cause of pediatric ptc is often a mystery, the contributions of several secondary factors have surfaced including various endocrine disorders and iatrogenic causes (wilson and baker 2005) (table 1). the following report illustrates the toxic contribution of oral levothyroxine therapy (synthroid, abbott laboratories, abbott park, il, usa) employed for the treatment congenital hypothyroidism in precipitating a case of pediatric ptc. congenital hypothyroidism affects approximately 1 in every 4000 infants in the united states and is caused by an infant s inability to produce an adequate level of thyroid hormone (bourgeois and varma 2005). principal causes of this congenital deficiency include a malfunctioning thyroid gland, an iodine deficiency, or defective thyroid metabolism. because of the thyroid hormone s critical role in promoting neuronal myelination for normal central nervous system development during the early postpartum period, supplemental therapy must be initiated early in a child s life (bourgeois and varma 2005). levothyroxine sodium (synthroid, abbott laboratories, abbott park, il, usa) is used as a replacement therapy in the setting of diminished or absent thyroid function due to primary thyroid gland dysfunction or secondary etiologies such as autoimmune destruction, trauma, surgery, radio - ablation, drug - toxicity or infections. synthroid is a synthetic replacement for thyroxine (t4), the principal hormone that is synthesized and released by the thyroid gland. as a therapeutic agent, levothyroxine sodium has a narrow therapeutic range. if the fractions of levothyroxine sodium administered are sub - optimal, the desired reversal of the hypothyroid - state is not attained. unfortunately, the main complication reported to arise in pediatric administration of levothyroxine sodium is usually the result of over - administration of the drug or an allergic reaction to the synthetic formulation (bourgeois and varma 2005). adults with clinically - confirmed thyroid dysfunction often require 1.6 g / kg of levothyroxine per day, whereas pediatric patients often require higher fractions, up to 4 g / kg / day. careful titration of the administered dosages of levothyroxine sodium is performed every 6 weeks after initiating therapy till the desire level of free t4 and tsh are attained. regular assays are collected thereafter to avoid over- or under - medicating patients with thyroid dysfunction. although not life - threatening, negligence of the signs of hypothyroidism (fatigue, dry skin, cold intolerance, and weight gain) in a pediatric patient may have serious repercussions later in life by engendering memory impairment, mental retardation, cardiac dysfunction and myxedema coma. equally significant is the fact that congenital or iatrogenically - induced states of hyperthyroidism can predispose a patient to early - onset osteoporosis and cardiac complications (atrial fibrillation, supraventricular arrhythmias). in light of the significant clinical consequences associated with improper thyroid - replacement therapy, the pediatric dosing schedule of levothyroxine sodium is kept at the minimum dosage which yields normal, stable thyroid function tests without noting tachycardia, palpitations, tremors, agitation, hyperactivity, weight loss, fever or diaphoresis in the child (bourgeois and varma 2005). a standardized dosing regimen has been published to assist in the reduction of deleterious toxic sequelae (bourgeois and varma 2005) (table 2). the neuro - ophthalmic complication of levothyroxine - induced ptc has been reported in literature to arise with the initiation or during the course of therapy in a pediatric setting. the medical community at large must be alert to the signs and symptoms of this neuro - ophthalmic emergency that may be induced in response to toxic levels of levothyroxine sodium and be cognoscente of the fact it may arise in isolation of other more common indicators of iatrogenic - hyperthyroidism. furthermore, clinicians should consider levothyroxine - induced ptc as a situation that warrants re - investigation or adjustment of the current levels of levothyroxine sodium replacement therapy. an 11-year - old caucasian female presented for a routine eye exam complaining of chronic headaches for the last 12 months. she reported supra - nuchal, radiating pain that was rated as an 8 on a 10 point scale. nausea, vomiting, visual aura, amaurosis fugax, phonophobia, diplopia, tinnitus and an altered mental status were not reported. bid (novolin n, nov nordisk pharmaceuticals, princeton, nj, usa), and levothyroxine 100 g p.o. pupils were equal, round with brisk, symmetrical responses to light ; no afferent pupillary defect was noted. manifest refraction yielded a prescription of od : 1.00 0.25 105, os : 0.50 0.75 105 with a + 1.00 add to attain 20/20 ou at all distances and eliminate her near phoria. funduscopic evaluation revealed bilaterally edematous, elevated and non - hemorrhagic optic nerves (figure 1). cup - to - disc ratio was approximated at 0.30 h / v od, 0.30 h / v os. peripheral eye grounds were clear, flat and intact 360 ou. automated humphrey visual field testing (sita - standard, 30 - 2, size iii stimulus) results were deemed unreliable likely owing to the patient s age ; nevertheless mild bilateral blindspot enlargement was discernible. immediate referral to a pediatric neuro - ophthalmologist was initiated with a request for t-1 weighted mri imaging of the patient s head / orbit and lumbar puncture studies including cerebrospinal fluid (csf) cultures and opening pressures. no space - occupying lesion, congenital aterio - venous malformations or hydrocephalus was detected during neuroimaging studies. opening pressures were not recovered by attending physician at the time of the lumbar puncture. after consulting with the patient s endocrinologist, the patient s neuro - ophthalmologist initiated acetazolamide 250 mg bid p.o. (diamox, lederle laboratories, pearl river, ny, usa) in place of modulating her current levothyroxine - therapy. fortunately, the patient was afforded partial relief from her headache pain over the course of the next several weeks. repeated automated perimetry testing has demonstrated stability in the pattern of bilateral blind - spot enlargement. six months after her initial presentation, funduscopic evaluation demonstrates an improved degree of optic nerve head elevation, but a persistent pattern of blindspot enlargement on visual field testing. patient was counseled as to the benefit of a second opinion from another pediatric neuro - ophthalmologist and endocrinologist to ensure that visual morbidity would be minimized. pediatric pseudotumor cerebri (ptc) is a rarely reported phenomenon in neuro - ophthalmology literature. nevertheless, awareness and quick intervention are essential to prevent unnecessary vision loss from this reversible clinical entity. diagnosing pediatric ptc is challenging since children and young adults exhibit a clinical presentation that is unlike that reported in adults manifesting this condition. in considering this diagnosis, the astute clinician must employ a step - wise approach that is in keeping with the criteria listed in the modified dandy criteria to ensure absolute certainty in their diagnosis (smith 1985 ; langford 2002) (table 3). in - depth probing of a patient s medical, social and family history may help to uncover the contributions of a secondary factor in manifesting ptc (wilson and baker 2005) (table 1). when no identifiable cause can be found, it is appropriate to label this clinical entity as idiopathic intra - cranial hypertension. this case report illustrates how medical history questioning provided the basis for determining the cause of the ptc to be a toxic level of levothyroxine. a review of current literature suggests that there are at least half a dozen reports outlining the role levothyroxine played in inducing secondary ptc in a child or young adult (van doop 1983 ; mcvie 1984 ; huseman and torkelson 1985 ; rohn 1985 ; campos and olitsky 1995 ; rovet and ehrlich 1995 ; raghaven 1997 ; williams 1997 ; langford 2002 ; selva 2002). raghavan (1997) described a 5 month old infant who developed ptc shortly after initiation of levothyroxine (50 g / kg) therapy. campos and olitsky (1995) described a case of a 7 year old patient who developed severe, widespread headaches after 1 week of commencing levothyroxine therapy (75 g p.o. this child also reported concomitant symptoms of eye pain, tinnitus, nausea and vomiting. only after titrating the levels of levothyroxine being administered to the patient (50 g / day), did the patient s symptoms resolve over the next few months despite persistent papilledema on a subsequent funduscopic examination. neuroimaging studies and lumbar puncture confirmed a diagnosis of pseudotumor cerebri owing to toxic levothyroxine levels (campos and olitsky 1995). mcvie (1984) described a 13 year old girl whose severe headaches and concurrent papilledema which began after only 3 days of starting levothyroxine therapy resolved once levothyroxine therapy was discontinued and subsequently re - initiated at a level of 50 g / kg. although standardized dosing regimens have been proposed, no clear consensus exists for determining a safe initial dosing schedule for pediatric patients suffering from congenital hypothyroidism to prevent systemic complication from the drug itself. (table 2) the current reported cases infer that the toxicities arising from levothyroxine therapy arise from improper initial dosing selection or dosages that over - shoot the therapeutic window. this in turn suggests that the toxic effects are independent of cumulative dosing of this synthetic hormone. selva (2002) looked at initial dosing schedules of patients with congenital hypothyroidism and suggested titration of the initial dosage is essential to limit levothyroxine s harmful effects on neurologic development. they concluded that initial dosing of 1215 g / kg raised thyroxine levels to target levels within 3 days, normalized thyroid function tests within 2 weeks of initiating therapy and presented few deleterious complications in the majority of patients. because of the variability in patient pharmacokinetic responses to any medication, it is advisable that all children be monitored closely during the initiation phase of levothyroxine therapy to limit the occurrence of neurological side effects. in literature, few authors propose a definitive treatment paradigm or clinically superior therapy to resolve pediatric cases of ptc. two studies suggest that initial modulation of the level of thyroid replacement hormone is often sufficient to promote the resolution of the signs and symptoms of ptc (van dop 1983 ; mcvie 1984). other reports infer that no change to the patient s thyroid replacement regimen is needed, since the signs and symptoms of ptc have the capacity to self - resolve (prendes and mclean 1978). however, if prompt resolution of ptc is warranted, medical intervention using oral carbonic anhydrase inhibitors or immunosuppressive therapy have shown to be effective at reducing csf production and reversing the signs of papilledema in other clinical scenarios (baker 1985). surgical intervention should only be considered if medical therapy fails to achieve an appropriate endpoint, headaches persist, or progressive vision loss ensues. optic nerve sheath fenestration (onsf) is a neuro - ophthalmic procedure designed to create an alternative outflow channel for the csf which encircles the intra - orbital portion of the optic nerve. it is a procedure that is limited almost exclusively to the treatment of ptc and has been shown to manifest significant benefits along with an adequate safety profiles in children suffering from pediatric ptc (lee 1998 ; thuente and buckley 2005). lee (1998) reported on the effects of optic nerve sheath fenestration (onsf) in 12 children who were previously unresponsive to typical pharmacological intervention. they noted that 66% of patients showed improvements in visual acuity, while 17% showed stability and the remaining 17% experienced a worsening in their level of acuity. a similar breakdown was noted with regards to the patient s peripheral vision, with 2/3 of pediatric ptc patients experiencing an improvement or stability in their side - vision ; while 1/3 suffered from continued deterioration following onsf. in a follow - up investigation by thuente and buckley (2005), the outcome of onsf in 17 eyes (12 children) that were previously unresponsive to medical therapy was once again examined. seven of the twelve children only required unilateral onsf to attain an improvement in the degree of papilledema in the contralateral eye. for those who manifested more advanced papilledema at presentation, bilateral onsf was performed within 34 months of this initial surgical intervention. similarly to lee and colleagues (1998) initial investigation, the level of visual acuity and degree of visual field attenuation was more likely to be improved or stabilized following onsf ; these findings were noted to most often arise in conjunction with a regression in the degree of papilledema. as such, the authors surmised that onsf is a safe and effective adjunctive therapy for pediatric cases of medically - unresponsive ptc. pre - cautionary measures should always be taken with pediatric patients receiving levothyroxine therapy for congenital hypothyroidism. despite its widespread use and relatively benign safety profile, we advise considering levothyroxine as a potential cause of secondary ptc especially if the signs and symptoms arise shortly after commencing therapy or arise in a pediatric setting. despite the lack of neuro - ophthalmic literature citing the contributions of presumed levothyroxine - induced pediatric ptc, awareness of this rare clinical occurrence is vital to ensure prompt diagnosis and appropriate management. | papilledema is considered a neuro - ophthalmic emergency because of its capacity to induce irreversible end - organ damage and the often grave nature of its precipitating factor. even more concern is warranted when papilledema presents in a pediatric setting. after excluded the contributions of intracranial masses, congenital malformations, ischemic insults and acute infections, the investigation must focus on determining the contributions of other uncharacteristic causes of pediatric pseudotumor cerebri. pediatric pseudotumor cerebri is a rare clinical entity which shares few commonalities to the adult condition in regards to its predicating factors or symptoms. without adequate medical history questioning, funduscopic evaluation and ancillary testing, the possibility of an erroneous diagnosis is plausible. this case report aims to disclose the toxic role levothyroxine sodium tablets (synthroid, abbott laboratories, abbott park, il, usa) played in inducing pseudotumor cerebri in a pediatric patient being treated for congenital hypothyroidism. |
healthcare - seeking behaviors declined markedly during the ebola epidemic (2), which likely contributed to probable underreporting of measles cases, a fact further substantiated by the lack of fatalities reported to dps. although there are wide variances in estimates of measles case - fatality rates, a large study has suggested an average case - fatality rate of 3.7% for africa (13), which would correspond with 26 deaths from the 702 suspected cases reported in lola during january june 2015. the lack of reported fatalities may also be related to the effect of the ebola epidemic on burial practices ; any families notifying authorities about deaths would be required to conduct safe and dignified burials, a protocol that had been met with resistance by many local groups (2). when the full shipment of vaccines arrived in lola in mid - april, logistical planning was challenged by shortages of personnel, fuel for automobiles, and appropriate vehicles for traversing difficult terrain during the onset of the rainy season. the campaign is estimated to have reached 92% of the target population, but persons in some urban areas and villages were reluctant to receive vaccinations. the launch of the campaign coincided with reduced measles transmission (figure), but further modeling research would be required to assess its effect on the course of the outbreak. in the aftermath of the ebola epidemic,. the front lines of disease surveillance and outbreak detection often occur in rural settings that are understaffed and underresourced. as guinea transitions to a post - ebola phase this reduction would be unfortunate, because the technical and cultural expertise of the doctors from guinea in lola and other similar settings transcends ebola and could be harnessed to support a wide range of public health activities. strengthened investments in local public health systems will be essential to ensure the population of guinea can recover from the ebola epidemic and be better protected from future disease outbreaks. aside from personnel, the public health infrastructure, including surveillance, information and communications technology, and temperature - controlled supply chains, particularly requires attention. meanwhile, great efforts will also be needed to restore and enhance community trust in medicine and public health (2). | during public health crises such as the recent outbreaks of ebola virus disease in west africa, breakdowns in public health systems can lead to epidemics of vaccine - preventable diseases. we report here on an outbreak of measles in the prefecture of lola, guinea, which started in january 2015. |
it also causes damage to deoxyribonucleic acid (dna) and dna - protein cross - links and induces cellular death. there is a direct relationship between the effects of ionizing radiation and the type of tissue receiving the radiation and the absorbed radiation dose. dental radiology represents the most frequently applied radiological diagnostic tool, the enormous diagnostic benefits of which make its use indispensable. however, while individual doses and risks are low, the collective dose is not inconsiderable. patients most commonly receive ionizing radiation to the head, and several studies have shown dental radiography to be associated with an increased risk of meningioma, brain cancer and parotid gland tumors as well as breast cancer [59 ]. four different types of x - ray examination techniques are commonly used in dentistry for diagnostic purposes : posterior bitewings, periapical films, lateral cephalometric radiographs and panoramic radiographs (opg). in addition, cone - beam computerized tomography (cbct) has recently been accepted as an emerging x - ray technology in dentomaxillofacial imaging. all these imaging techniques have been implicated in nuclear alterations of stomatognathic system cells that are closely related to genotoxicity. the fact that imaging may subject regions not specifically under consideration to x - ray radiation warrants an assessment of what types of protective devices can be produced from nano - materials to shield areas of the jaw and the rest of the body outside the area of interest from the harmful effects of x - rays. many techniques are available for evaluating the structural characteristics of materials that have metallic particles. small angle x - ray scattering is one such technique used for the structural characterization of solid and fluid materials in the nanometer (nm) range. measurements are commonly performed in transmission geometry by using a narrow, well - collimated and intense x - ray beam. x - ray absorption is related to the thickness of the material and the atomic numbers of the elements from which it is composed. a narrow beam of mono - energetic photons with an incident intensity of io will have a transmitted intensity of i that can be calculated using the equation ; (eq 1)i / io = exp [(/)x ] where x represents the mass thickness (the mass per unit area) and represents the density of the material through which the ray passes. mass thickness can also be calculated by multiplying the thickness (t) by the density () as x = t, allowing eq1 to be rewritten as (eq 2)lni = lniot once io, i and t values have been established, the linear attenuation coefficient of can be established from the slope of [ln i - t ]. for the evaluation of saxs data, gnom and dammin computer programs are used. gnom is an indirect transform program for small - angle scattering data processing that reads one - dimensional scattering curves (possibly smeared with instrumental distortions) and evaluates a distance distribution function p for monodispersal systems or a size distribution function d for polydispersal systems. gnom creates the function dmax (indicates the nanostructures maximum overall size and can be determined using pair distance distributions of the nano - aggregates) and the input file required for ab - initio modeling. dammin uses small angle x - ray scattering to recreate ab - initio low - resolution shapes of randomly oriented particles in solution (e.g., biological macromolecules). therefore, this study aimed to synthesize and compare a number of new nano - composites capable of protecting the jaw and the rest of the body from the harmful effects of ionizing radiation by absorbing x - rays with saxs analyzing method and to test the availability of designing an intraoral shield and its affect on the image quality of periapical radiography using the most promising nanocomposite (co). four different types of nano - powders [ti, zr (iv), ag and co ] ranging in size from 570 nm were obtained from chemical manufacturers [sigma aldrich (578347 - 10 g, 544760 - 25 g) ; alfa aesar (231 - 158 - 0, 232 - 033 - 3) ] and were mixed in a polymer matrix to create nanocomposites with doping values of 8% in weight, without any additional purification. the matrix was prepared using self - cure acrylic resin powder (akribel, self curing denture acrylic powder, atlas - enta a.., izmir, turkey) and heat - cure acrylic liquid (paladent 20, heraeus, kulzer, hanau, germany) according to the manufacturers instructions. each mixture was poured into a cylindrical plastic mold and polymerized with a special heat - pressure polymerization device (ivomat ip3, ivoclar vivadent ag, schaan, lichtenstein) under 6-bar pressure at 40c for 15 minutes. the composite cylinders were then processed and shaped in rectangular form with 42 mm dimensions and 0.50 cm thickness, using a high - speed dental hand piece (k5plus, kavo, biberach, germany). a 320-grit sic sandpaper (norton, worchester, ma, usa) was used for the surface correction of the samples and polishing procedures were applied with pumice paste. saxs measurement was performed using hecus - saxs system with 50 kv- 50 ma, cuk (=1.54) radiation line collimation and position sensitive detectors (54 m resolution, 1024 channels). 1. effective radius of the nano - aggregations, forms, most probable ab - initio shape and pair - distance distributions of the samples were obtained through analyses of the experimental data. saxs profiles of polymer - based ag, co, zr and ti nano - composites (0.50 cm thick) measured according to q (magnitude of transmitted scattering vector). the x - ray absorbance values of the nano - composites were calculated using the eq 1 (i /io = exp[(/)x ]) and eq2 (lni = lnio t). ti nano - composites (ti - pnm) yielded the most promising values of the four nano - composites tested in terms of x - ray absorption followed by co nano - composites (co - pnm) and ti - pnm (fig. 2). nanoparticle atomic number (z) ; the differences in total transmitted intensities (i) of nano - composites. in this study, co - pnm samples of different thicknesses (0.20, 0.50, 0.57 and 0.60 cm) were prepared, and saxs analysis was performed in order to assess the effects of material thickness on x - ray absorption. prior to saxs testing, sample thickness was confirmed using a digital caliper (tresna, guanglu europa gmbh, essen, germany). an experimental shield was constructed from co - pnm to act as an x - ray protector for the human mandible surrounding tooth # 36 (fig. two layers of pink wax were adapted over teeth # 35, 36 and 37, and the acrylic resin - based mass was adapted directly over the wax. the resin mass was shaped with the aid of a spatula, and the polymerization procedure was completed using a heat - polymerization device. surface correction was performed using laboratory hand - pieces to obtain a uniform thickness of 0.50 cm, as measured by a digital caliper. the prepared matrix was then cut into three pieces, two of which were shortened to provide a clear view of the mesial and distal parts of tooth # 36. the remaining part was adapted to fit over tooth # 36 and the two other parts of the shield to create an easily adaptable, multi - unit stent (fig. four different types of nano - powders [ti, zr (iv), ag and co ] ranging in size from 570 nm were obtained from chemical manufacturers [sigma aldrich (578347 - 10 g, 544760 - 25 g) ; alfa aesar (231 - 158 - 0, 232 - 033 - 3) ] and were mixed in a polymer matrix to create nanocomposites with doping values of 8% in weight, without any additional purification. the matrix was prepared using self - cure acrylic resin powder (akribel, self curing denture acrylic powder, atlas - enta a.., izmir, turkey) and heat - cure acrylic liquid (paladent 20, heraeus, kulzer, hanau, germany) according to the manufacturers instructions. each mixture was poured into a cylindrical plastic mold and polymerized with a special heat - pressure polymerization device (ivomat ip3, ivoclar vivadent ag, schaan, lichtenstein) under 6-bar pressure at 40c for 15 minutes. the composite cylinders were then processed and shaped in rectangular form with 42 mm dimensions and 0.50 cm thickness, using a high - speed dental hand piece (k5plus, kavo, biberach, germany). a 320-grit sic sandpaper (norton, worchester, ma, usa) was used for the surface correction of the samples and polishing procedures were applied with pumice paste. saxs measurement was performed using hecus - saxs system with 50 kv- 50 ma, cuk (=1.54) radiation line collimation and position sensitive detectors (54 m resolution, 1024 channels). 1. effective radius of the nano - aggregations, forms, most probable ab - initio shape and pair - distance distributions of the samples were obtained through analyses of the experimental data. saxs profiles of polymer - based ag, co, zr and ti nano - composites (0.50 cm thick) measured according to q (magnitude of transmitted scattering vector). the x - ray absorbance values of the nano - composites were calculated using the eq 1 (i /io = exp[(/)x ]) and eq2 (lni = lnio t). ti nano - composites (ti - pnm) yielded the most promising values of the four nano - composites tested in terms of x - ray absorption followed by co nano - composites (co - pnm) and ti - pnm (fig. 2). nanoparticle atomic number (z) ; the differences in total transmitted intensities (i) of nano - composites. in this study, co - pnm samples of different thicknesses (0.20, 0.50, 0.57 and 0.60 cm) were prepared, and saxs analysis was performed in order to assess the effects of material thickness on x - ray absorption. prior to saxs testing, sample thickness was confirmed using a digital caliper (tresna, guanglu europa gmbh, essen, germany). an experimental shield was constructed from co - pnm to act as an x - ray protector for the human mandible surrounding tooth # 36 (fig. two layers of pink wax were adapted over teeth # 35, 36 and 37, and the acrylic resin - based mass was adapted directly over the wax. the resin mass was shaped with the aid of a spatula, and the polymerization procedure was completed using a heat - polymerization device. surface correction was performed using laboratory hand - pieces to obtain a uniform thickness of 0.50 cm, as measured by a digital caliper. the prepared matrix was then cut into three pieces, two of which were shortened to provide a clear view of the mesial and distal parts of tooth # 36. the remaining part was adapted to fit over tooth # 36 and the two other parts of the shield to create an easily adaptable, multi - unit stent (fig. saxs profiles calculated using the magnitude of the transmitted scattering vector showed ti to have the highest absorbance value, followed by zr, co and ag, respectively (fig. these findings indicate that ti absorbs the majority of transmitted x - rays, whereas ag scatters the x - rays. 4) were calculated according to eq 1 using the i, io and values given in table 1. logarithmic distributions of the transmitted intensity values (i) showed that 0.20 cm co - pnm had the highest transmission value (16.05) followed by 0.50 cm co - pnm (15.44), 0.57 cm co - pnm (15.07) and 0.60 cm co - pnm (15.06). experimental results about the x - ray absorbance of cobalt nanocomposite logarithmic transmitted intensity as a function of thickness for co nanocomposite. figures 5 and 6 show, respectively, the graphs of the effective radius of the nano - aggregation values and the dmax values for co - pnm of different thicknesses. as seen in fig. 5, the 0.2 cm co - pnm had an effective radius of the nano - aggregation value (77.44) higher than that of the other thicknesses (0.50, 0.57 and 0.60 cm) of co - pnm, which had similar values ranging from 66.2266.34. 6, the 0.20 cm co - pnm had the highest dmax value of the different thicknesses of co - pnm tested. saxs patterns (blue circles) and ab - initio fitting scatter curves of co nano - composites of different thicknesses. standard periapical x - ray radiograph showed that the co - pnm stent appeared as a radiopacity over the occlusal surface of the teeth and did not affect subjective image quality. saxs profiles calculated using the magnitude of the transmitted scattering vector showed ti to have the highest absorbance value, followed by zr, co and ag, respectively (fig. these findings indicate that ti absorbs the majority of transmitted x - rays, whereas ag scatters the x - rays. 4) were calculated according to eq 1 using the i, io and values given in table 1. logarithmic distributions of the transmitted intensity values (i) showed that 0.20 cm co - pnm had the highest transmission value (16.05) followed by 0.50 cm co - pnm (15.44), 0.57 cm co - pnm (15.07) and 0.60 cm co - pnm (15.06). experimental results about the x - ray absorbance of cobalt nanocomposite logarithmic transmitted intensity as a function of thickness for co nanocomposite. figures 5 and 6 show, respectively, the graphs of the effective radius of the nano - aggregation values and the dmax values for co - pnm of different thicknesses. as seen in fig. 5, the 0.2 cm co - pnm had an effective radius of the nano - aggregation value (77.44) higher than that of the other thicknesses (0.50, 0.57 and 0.60 cm) of co - pnm, which had similar values ranging from 66.2266.34. 6, the 0.20 cm co - pnm had the highest dmax value of the different thicknesses of co - pnm tested. saxs patterns (blue circles) and ab - initio fitting scatter curves of co nano - composites of different thicknesses. standard periapical x - ray radiograph showed that the co - pnm stent appeared as a radiopacity over the occlusal surface of the teeth and did not affect subjective image quality. x - rays have been widely used for decades as diagnostic tools in the field of dentistry. studies have clearly shown that ionizing radiation induces cellular death by karyorrhexis, pyknosis and karyolysis. individuals continually exposed to x - rays (for endodontic, orthodontic, implant and other purposes) may later develop cancer as a result of genotoxic / cytotoxic cell differentiation. the literature contains insufficient information regarding the use of nano - materials in providing regional protection from the harmful effects of x - rays on areas of the body and jaw outside the area of consideration. in the field of nanotechnology, both small- and wide - angle x - ray scattering methods have been effectively used to study polymer matrix - based nano - composites. the present study used ti, zr, co and ag nanoparticles in the synthesis of nano - composites. co, ag and ti are transition metals that do not form binary phases in polymeric media and demonstrate negligible solubility. zirconia is a white amorphous powder that shows a homogeneous distribution in a composite matrix. other materials with high mass attenuation coefficients, such as lead (pb), are also widely used to protect biological tissue from the harmful effects of high energy x - rays for many years [2325 ]. the low brittleness, hardness and oxidation characteristics of pb make it very difficult to synthesize nanoparticles from this element. the main reason of using nanoparticles in this study was their low weight in any composite material. thus, ti, zr, co and ag have low weights as in nano - powder form and the materials that will be produced from these materials will not be affected by the nanoparticles of metallic alloys. however, the traditional x - ray protectors that contain pb are very heavy for use [2326 ]. as fig. 1 shows, ti and zr matrixes had lower x - ray scattering angle to transmitted scattering vector ratios than the co and ag matrixes of similar thicknesses. however, as fig. 2 shows, the total transmitted intensities of the nanocomposite matrixes varied in line with their atomic numbers of their constituent nano - composites, so that the ti matrix had the lowest total transmitted intensity, followed by the co matrix. the saxs analysis conducted in this study found ti to have the best x - ray absorption values ; however, due to the high cost of obtaining ti nano - powder, detailed examinations were conducted using the nanocomposite containing co, which was also found to have adequate protective properties. gnom and dammin software analyses used to evaluate the findings of saxs showed that the tested 0.6 cm thick co - pnm sample absorbed the greatest amount of x - ray radiation (figs. 45) or transmitted the lowest x - ray radiation. however, although the maximum absorbance was found for 0.6 cm thickness, 0.5 cm thickness was chosen because in this thickness, the shapes, pair distance distributions and numbers of the nano - aggregations, and surface morphology of the plate are well optimized to cause bigger absorbance. the weight of the protective shield did not increase with an increase in the thickness. with the advances in technology, economical and disposable materials that contain co nano - powder may be produced to protect the health of patients. in this study, an experimental intraoral co - pnm shield was constructed and tested over a human mandible to check the formability of resin matrix after the addition of metallic nano - powder. although the shield appeared as a radiopacity over the occlusal surface of the teeth, this did not affect the visibility of periapical or surrounding tissue. similar shields may be constructed specifically for other parts of the stomatognathic system or any part of the body using co or other nano - powders and may be used for a variety of diagnostic and/or treatment purposes. as the technology advances, shields may be fabricated in thin - film coating, in rubber - dam like form or in plastic mouth guard form, in the future. the co - pnm shield was fabricated only to observe the manipulative property of the acrylic resin and any effect on the diagnosis made based on periapical intraoral films. it was designed over a human mandible that has surrounding soft tissue of the stomatognathic system. in conclusion, the co nanocomposite fabricated in this study was found to have a linear absorption coefficient value () of 2.510.06 cm, indicating that it may be used as a shield material to protect against the harmful effects of x - rays during diagnosis and dental rehabilitation. moreover, the co nanocomposite was found to have an effective radius of the nano - aggregation ranging from 66.22 to 77.94, demonstrating a uniform distribution that can be adequately controlled. in light of these findings, further studies may be undertaken to examine new applications for cobalt nanocomposite in dentomaxillofacial radiology and radiotherapy. | objectives : this study aimed to compare a number of new nano - composites capable of protecting the jaw from ionizing radiation.materials and methods : four different types of nano - powders [ti, zr (iv) oxide, ag and co ] were mixed in a polymer matrix to create nano - composites with doping values of 8% in weight. small - angle x - ray scattering (saxs) analysis was performed using a hecussaxs system with 50 kv- 50 ma. co nano - composites (co - pnm) yielded the most promising values of the four nanocomposites tested in terms of x - ray absorption. thus, 42 cm co - pnm samples of different thicknesses (0.20, 0.50, 0.57 and 0.60 cm) were prepared, and saxs analysis was performed in order to assess the effects of material thickness on xray absorption. an experimental multi part shield was constructed from co - pnm around tooth # 36 to test the effect of nanomaterial on the image quality under x - ray beam.results:logarithmic distributions of the transmitted intensity values (i) showed that 0.20 cm co - pnm had the highest transmission value (16.05) followed by 0.50 cm co - pnm (15.44), 0.57 cm co - pnm (15.07) and 0.60 cm co - pnm (15.06). the 0.2 cm co - pnm had an effective radius of the nano - aggregation value (77.44) lower than that of the other thicknesses (0.50, 0.57 and 0.60 cm) of co - pnm, which had similar values ranging from 66.22 to 66.34. the 0.50 cm co - pnm had the lowest dmax value of the different thicknesses of co - pnm tested.conclusion:co nanocomposite can be used as a protection shield for the harmful effects of dental x - ray. |
antituberculosis drug - induced hepatitis is one of the most prevalent drug - induced liver injuries (1). rifampin (rif), isoniazid (inh), pyrazinamide (pza) and ethambutol (emb) are first line chemotherapeutic agents in treatment of tuberculosis (tb) (2 - 5). among these drugs, hepatotoxicity of inh can be presented as a mild transient elevation in aminotransferases in 10 to 20% of tuberculosis patients to rare cases of overt hepatitis (7) metabolism pathways and toxic metabolites of anti - tb agents play a central role in hepatotoxicity of these agents (8). acetyltransferase-2 (nat2)-mediated acetylation, resulting in acetyl - inh, which is hydrolyzed to acetylhydrazine and isonicotinic acid (9). another important factor in inh - induced hepatotoxicity is genetic variations (6, 9). there are large variations in the inh acetylation capacity suggesting a pharmacogenetic polymorphism of nat2 (10, 11). this variability in the acetylation capacity results from a wide range of n- acetylation activity and has been characterized by bimodal or trimodal distribution (12,13). the frequency of slow and rapid acetylators differs among ethnic populations (14 - 17). although primary studies had suggested that the fast acetylators are more susceptible to developing inh induced hepatotoxicity (17, 18), recent studies showed that the slow acetylators are more vulnerable to inh induced hepatotoxicity (19, 20). still the association between acetylation phenotype and drug - induced hepatotoxicity is controversial (6, 10). the goal of this study was to evaluate relationship of acetylator phenotype and the incidence of antituberculosis drugs - induced hepatotoxicity in iranian pulmonary tb patients. this study was a prospective, cross - sectional one. a total of 50 unrelated patients (age > 18) with newly diagnosed pulmonary tb from the infectious diseases ward from imam referral hospital affiliated to tehran university of medical sciences (tehran, iran) were entered into the study from september 2006 to september 2008. standard tuberculosis treatment regimen in our country is based on who recommendation and includes : inh (5 mg / kg), rif (10 mg / kg), pza (25 mg / kg), emb (15 mg / kg) for the first 2 months followed by inh and rif daily for 4 additional months. who tb diagnosis criteria including (i) a positive culture for mycobacterium tb or (ii) negative culture patient with clinical and radiological features consistent with tb and response to anti - tb treatment or (iii) histological findings consistent with tb and response to anti - tb treatment were used for diagnosis of tb in our hospital (4). patients with human immunodeficiency virus (hiv) infection, hepatic insufficiency (alt or ast > 2 upper limit normal or clinically symptoms of liver diseases such as jaundice and ascites) and renal insufficiency (creatinine clearance less than 50 ml / min based on cockcroft - gault equation), history of smoking (only positive based on individual expression) and chronic alcohol consumption (persons that have history of regular alcohol drinking at least 30 g alcohol daily for 6 months before hospital admission) excluded from the study. for all the patients involved in the study, a complete history and physical examination were administered and patients demographic characteristics, history of smoking, alcohol drinking, drug abuse, concomitant diseases and drugs, status of viral infections and other treatment information were collected. the liver function tests (lft) including aspartate aminotransferase (ast), alanine aminotransferase (alt), alkaline phosphates (alp), direct and total bilirubin and clinical symptoms of drug - induced hepatotoxicity such as anorexia, abdominal pain, nausea and vomiting and right upper quadrant pain were monitored prior to and during anti - tb therapy. the causality of a drug - induced hepatotoxicity was determined using the roussel uclaf causality assessment method (rucam) (21). at the beginning of the anti - tb treatment course and after the overnight fasting, each patient received 300 mg inh (one tablet) orally and then 3 h later, 5 ml of venous blood sample was collected into an edta tube and immediately centrifuged. the plasma samples were then separated and kept frozen at -70c, waiting for analysis. plasma inh and acetyl - inh were measured by a gradient hplc method (22). acetylator phenotype was determined from the metabolic ratio (mr) of acetyl - inh to inh in the plasma samples (23). mr was used to classify the subjects as slow (mr 1.0) (23). hepatotoxicity was defined as (i) the increased levels of liver transaminases more than three times above the normal value (< 40 ul for ast and alt) with any other clinical signs and symptoms, (ii) and the elevation of transaminases more than five times above the normal limit if patients had no symptoms (24). for assessing the effect of age on anti - tb induced hepatotoxicity, patients were divided into two groups : those whose age were < 35 (group a) and those whose age were 35 (group b) (25). data obtained from our study was expressed as mean - values sd, numbers or percentages and was analyzed using the statistical package for social sciences version 16.0. group comparisons for categorical variables were carried out using the chi - square (x) test and fisher s exact test. all statistical tests were based on a two - tailed probability, and a p - value 0.05 was considered significant. the age of the patients ranged from 18 to 86 years with a mean of 47.8 21.9 years. fourteen patients (28%), 8 of 28 males (28.6%) and 6 of 22 females (27.3%) developed hepatocellular type liver injury. the mean age of the patients who developed hepatotoxicity, was 43.1 22.7 years (the age range = 19 - 66 years). among the 50 patients, 20 (40%) were slow acetylators and 30 (60%) were fast acetylators. for evaluation of causality, we used rucam (21). hepatotoxicity induced by anti - tb drugs was classified as probable based on the causality assessment method. hepatotoxicity was manifested in 9 of 20 slow acetylators (45%) and only in 5 of 30 rapid acetylators (16.7%). the mean duration of treatment before the start of hepatotoxicity was 14.6 6.4 days. the application of x test showed a significant difference between the acetylation phenotype and hepatotoxicity (x = 4.778, and p = 0.03). frequencies of n- acetyl transferase 2 phenotype and anti - tuberculosis drug - induced hepatotoxicity in iranian pulmonary tuberculosis patients patients were divided into two groups, due to their ages. from 22 patients in group a (age < 35), seven developed hepatotoxicity, 4 of them were slow acetylators and 3 patients were fast acetylators. twenty eight patients were 35 years old and consequently were categorized in group b. seven patients (5 slow and 2 fast acetylators) in this group developed hepatotoxicity. there was not statistically significant difference in the frequency of inh - induced hepatotoxicity between group a and b (x = 0.284, and p = 0.59). furthermore, there was no association between sex and hepatotoxicity in our study using fisher s exact test (p = 1.00). summary of anti - tuberculosis drug - induced hepatotoxicity based on the age group and n- acetyl transferase-2 acetylation phenotype group a : age < 35 ; group b : age 35 frequency histogram of metabolic ratio (acetyl inh / inh) showed an apparent bimodal distribution with an apparent antimode of acetylation ratio of 1.0, separating the slow acetylators from the fast ones (figure 1). scatter plot of the metabolic ratio of acetyl - inh / inh as a function of inh concentration in plasma following 5 mg / kg dose of inh (n = 50). moreover, as shown in figure 2, there is a lack of correlation between the metabolic ratio (acetyl - inh / inh) and the age of the subjects (r = 0.16). relationship between metabolic ratio (acetyl - inh / inh) and age of iranian. various proportions of rapid and slow acetylators of different populations in relation to the ethnicity and geographic location were reported (26). we have determined the frequency of nat2 polymorphisms, nat2 acetylation profile and also its relationship with the occurrence of anti - tb drug induced hepatotoxicity. our major finding is the association of the slow acetylation profile with anti - tb drug - induced hepatotoxicity in a population of tb patients from iran, which is in accordance with results described by other researchers (6, 27). the present findings contrast sharply with the observations of mitchell, j.r.,. (28), who reported increased susceptibility of anti - tb drug hepatotoxicity in fast acetylators. in contrast, a number of other studies did not find any relationship between acetylator status and drug - induced hepatotoxicity (9, 29). this clear discrepancy among the results of previous studies on acetylation status and anti - tb hepatotoxicity may be due to the different designs of the studies, especially in terms of the methodology for nat2 typing, the anti - tb drugs used, and the criteria for defining anti - tb drug hepatotoxicity. the incidence of antituberculosis drug - induced hepatic dysfunction, ranged from 1% to 36% (6, 9, 28). the rate of anti - tb induced hepatitis in this study was 28%, comparable with 27.7% that reported in iranian patients by sharifzadeh m.,. the wide variation of incidence may depend on the definition of hepatic dysfunction, study design, race, sex, and different concomitant use of antituberculosis drugs. there are possible causes for the higher incidence of antituberculosis drug - induced hepatitis in our study in comparison with some other studies (1). unlike our prospective regular monitoring of liver enzyme test results, kopanoff de. (30) checked the liver function test results only on clinical indication, not for routine monitoring. some studies have evaluated and reported only inh hepatotoxicity (9, 31) but it was documented that concomitant use of other hepatotoxic drugs such as rif and pza can increase the incidence and severity of inh - related hepatic dysfunction (32). this is supported by the following observations. the highest incidence (36%) of anti - tb the prevalence of nat 2 phenotype in a sample of healthy iranian individuals including 88 samples was 32.9% slow, 48.9% intermediate, and 18.2% rapid using pcr - rflp method (33). in another study using pcr - rflp method, the frequency of slow, intermediate and rapid acetylator phenotype was 49.4%, 41.5%, and 9.1% respectively in 229 unrelated healthy subjects from the general tehran population (34). frequency of slow acetylator phenotype in these studies is approximately near to our finding (32.9%, and 49.4% vs. 40%). the discrepancy probably originated from the difference in the methodology used, variations in study subjects (healthy individuals versus patients), the effects of unidentified genetic or environmental factors, and incomplete correlation between reported acetylator phenotypes and corresponding nat2 genotypes. in another study, polymorphism of nat 2 was studied in 74 unrelated healthy iranian volunteers, using sulfamethazine as metabolic probe. the frequency of slow acetylators, determined by using free and total plasma sulfamethazine concentrations, was 78.4% (35). the major finding is that phenotype assignment was dependent on the probe substrate (36). in addition to inh and sulfamethazine, other acetyl - transferase substrates such as caffeine (37) and dapsone (38) have been used as phenotypication probe. on the other hand, in previous studies over iranian population, subjects were healthy volunteers, whereas the tb ones were studied in here. our findings are in agreement with the previous study (9), but another study reported old age as a risk factor for development of hepatotoxicity during the treatment of tb (39). for women, it was reported increased risk of hepatotoxicity but this did not achieve statistical significance (40). | the aim of this study was to determine the association of n - acetyltransferase-2 polymorphisms and anti - tuberculosis drug - induced hepatotoxicity in iranian pulmonary tuberculosis patients. acetylating phenotypes was studied in 50 iranian pulmonary tuberculosis patients using metabolic ratio of plasma acetyl - isoniazid to isoniazid. the association between hepatotoxicity and the n - acetyltransferase-2 phenotype was evaluated by using the chi - square (x2) test.the metabolic ratio had a bimodal distribution with an antimode value of 1.0. based on the metabolic ratio of the mentioned patients, 20 (40%) were slow acetylators and 30 (60%) were fast ones. hepatotoxicity was manifested in 9 of 20 slow acetylators (45%) and only in 5 of 30 rapid acetylators (16.7%). there was a significant difference in the frequency of hepatotoxicity between the slow and fast acetylators (x2 = 4.778, and p = 0.03). sex and age were not found to be risk factors for hepatotoxicity. our findings show that slow acetylation profile is significantly associated with a higher risk of developing hepatotoxicity due to the anti - tb drugs in iranian pulmonary tuberculosis patients. |
enzyme replacement therapy (ert) is currently the major form of treatment for a number of lysosomal storage diseases, although its efficacy varies among the individual disorders. most of these inherited disorders arise from the lack of activity of a single lysosomal enzyme, which leads to the accumulation of the material normally degraded by the enzyme. the build - up of the storage material in the lysosome eventually results in cell and organ dysfunction. the goal of ert is to introduce sufficient amounts of normal enzyme into the lysosomes of the deficient cells to clear the storage material and restore lysosome function. this form of therapy was first used in patients with type 1 gaucher disease, who lack acid -glucocerebrosidase (gba) activity and accumulate glucosylceramide primarily in macrophage type cells. the replacement enzyme, containing n - linked glycans with terminal mannose residues, is infused intravenously and taken up by macrophages via cell surface mannose receptors. the endocytosed enzyme is then transported via endosomes to lysosomes, where it functions with good clinical results in this disorder. because most cell types lack mannose receptors, the replacement enzymes used to treat lysosomal storage disorders that involve cell types other than macrophages use binding to the cation - independent mannose 6-phosphate receptor (ci - mpr) at the cell surface for subsequent delivery to lysosomes. in this regard, studies of a mouse model of gaucher disease have produced evidence for the involvement of multiple cell lineages other than macrophages in the pathophysiology of this disorder, particularly osteoblasts, dendritic cells, and t cells. therefore, a therapy that included these cell types may be of clinical benefit in this disorder. the enzymes used for ert are purified from the secretions of mammalian cells, mostly chinese hamster ovary cells, engineered to produce high levels of the enzyme of interest. the feasibility of this approach is dependent upon the ability of the endogenous glcnac-1-phosphotransferase to phosphorylate mannose residues of the n - glycans of the expressed lysosomal enzyme. some of the replacement enzymes produced by this technique are highly phosphorylated and bind well to the ci - mpr. this includes the pompe disease enzyme (acid -glucosidase [gaa ]) and the alpha - mannosidosis enzyme (lysosomal acid -mannosidase [laman]).5, 6 in addition, the gba currently used in the treatment of gaucher disease contains a very low level of man-6-p. first, the activity of the endogenous glcnac-1-phosphotransferase in the producing cells may be insufficient to effectively phosphorylate the high levels of these enzymes being synthesized. if this were the case, co - transfection of glcnac-1-phosphotransferase with the lysosomal enzyme would be expected to enhance phosphorylation. one potential limitation to this approach is that overexpression of wild - type (wt) glcnac-1-phosphotransferase in mammalian cells can result in a portion of the expressed enzyme remaining inactive because of lack of proteolytic cleavage by the site-1 protease (s1p), which is essential for catalytic activation of the protein. a second possibility is that these two lysosomal enzymes are poor substrates for wt glcnac-1-phosphotransferase compared with other lysosomal enzymes. gba differs from the other lysosomal enzymes in that it is known to be transported to lysosomes by a man-6-p - independent pathway. this fact, plus its very low content of man-6-p, has led to the conclusion that it is not a substrate for glcnac-1-phosphotransferase. during the course of studies to understand the roles of the various domains of the / subunits of glcnac-1-phosphotransferase, we engineered a modified enzyme that bypasses the requirement for proteolytic cleavage, is highly expressed and has good activity toward a panel of endogenous lysosomal enzymes. we then compared the ability of the wt and modified glcnac-1-phosphotransferase to act on a number of poorly phosphorylated lysosomal enzymes when co - transfected into cells. our findings document that it is possible to substantially enhance the phosphorylation of lysosomal enzymes, including gba, that are poor substrates for glcnac-1-phosphotransferase using our modified glcnac-1-phosphotransferase. acid hydrolases synthesized by this procedure display increased binding to man-6-p receptors and enhanced uptake by target cells compared with the enzymes produced by the current procedure. we have reported that the / subunits are able to phosphorylate most lysosomal enzymes in the absence of. therefore, we used a construct encoding only the / precursor as the starting source of mannose phosphorylating activity. proteolytic cleavage of this precursor at k928 to give rise to the and subunits is mediated by the site-1 protease in the golgi, and this process is essential for catalytic competency of the protein.8, 9 the subunit contains two notch modules and a dna methyltransferase - associated protein (dmap) interaction domain that mediate the specific recognition of protein determinants on the lysosomal enzyme substrates (figure 1a). in addition, there are four so - called spacer domains in the / precursor whose functions are beginning to be elucidated. thus, we have reported that spacer-1 (residues 86322) determines the site of cleavage of the / precursor and serves to limit the phosphorylation of non - lysosomal glycoproteins, whereas spacer-2 contains the -subunit binding site.12, 14 besides these domains, the and subunits also harbor four stealth domains that together form the catalytic core of the protein. the stealth domains of all eukaryotic glcnac-1-phosphotransferases are highly conserved and resemble sequences within bacterial proteins that encode sugar - phosphate transferases involved in cell wall polysaccharide biosynthesis. in contrast to the mammalian enzymes, however, the bacterial proteins such as the n. meningitidis glcnac-1-phosphotransferase (figure s1) lack the other domains, with no evidence that proteolytic cleavage is necessary for catalytic activation. thus, we asked if it was possible to engineer a human glcnac-1-phosphotransferase that is not cleaved but retained high catalytic activity toward the n - linked glycans of lysosomal enzymes. we have previously reported that a construct (n1-d ; figure 1a) lacking the region from the notch1 module to the end of dmap (residues 438819) is well expressed and has good catalytic activity toward the simple sugar -methylmannoside (mm) but is unable to phosphorylate lysosomal enzymes. when deletion of this region was combined with removal of spacer-1 (construct s1-d), the expressed protein (figure 1b, lane 5) had similar activity as n1-d toward mm but slightly greater phosphorylation activity toward the lysosomal enzyme panel (figures 1c and 1d), despite only a small amount of the subunit product resulting from this construct (figure 1b, compare lanes 4 and 5). this is in agreement with our recent study that upon removal of spacer-1, the uncleaved / precursor retains some catalytic activity. to determine if it was possible to bypass the requirement for cleavage altogether, construct n1-s3 was made, which extended the deletion from notch1 up to the site-1 protease cleavage site in spacer-3 (residues 438928). this construct, which remained a single - chain molecule, was very highly expressed (figure 1b, lane 6), properly localized to the golgi (figure s2), and was 17-fold more active toward mm than observed with wt / (figure 1c). however, it only phosphorylated the panel of lysosomal enzymes about 30%40% as well as the wt transferase (figure 1e). we also tested the ability of n1-s3 and wt enzyme to phosphorylate the total cellular pool of soluble glycoproteins, which would include proteins other than lysosomal enzymes. for this experiment, cells transfected with either the wt or the modified construct were labeled with [2-h]mannose for 2 hr. the cells were then lysed, and following removal of the membrane fraction by high - speed centrifugation, the supernatants were incubated with ci - mpr beads to bind the man-6-p - containing proteins, and the percentage of total counts bound was determined. as shown in figure 1f, both constructs phosphorylated about 2.6% of the total soluble glycoprotein pool. because n1-s3 had less activity toward lysosomal enzymes than wt, this result indicated that it acted upon non - lysosomal glycoproteins to a greater extent than does the wt enzymes. the final construct (s1-s3) had spacer-1 deleted along with the region from notch1 to the cleavage site in spacer-3 (figure 1a). this construct, like the n1-s3, was expressed at a much higher level than the wt construct (figure 1b, lane 7), localized to the golgi (figure s2), and displayed a 21-fold increase in catalytic activity toward mm over wt / (figure 1c). it also phosphorylated the lysosomal enzyme panel better than observed with n1-s3, ranging from 56%117% of wt level (figure 1e). strikingly, we noted that s1-s3 phosphorylated the total pool of cellular soluble glycoproteins 3-fold greater than n1-s3 and the wt enzyme, consistent with increased phosphorylation of lysosomal enzymes that are poorly phosphorylated by the wt enzyme as well as an enhanced ability to phosphorylate non - lysosomal glycoproteins (figure 1f). to test the latter possibility, we determined the ability of the various constructs to phosphorylate a panel of non - lysosomal glycoproteins, two of which were known to be weak substrates of wt glcnac-1-phosphotransferase, namely, renin and protein o - fucosyltransferase 2 (pofut2).17, 18 phosphorylation was determined by binding to ci - mpr beads followed by western blotting to detect the proteins. as shown in figure 1 g, the s1-s3 construct phosphorylated renin, pofut2, glycopepsinogen (gp), and the von willebrand factor (vwf) a1a2a3 domain, whereas the wt construct only phosphorylated renin weakly in this assay. the n1-s3 construct acted on these proteins as well but to a lesser degree than s1-s3. in an attempt to further reduce human glcnac-1-phosphotransferase to resemble the n. meningitidis enzyme (figure s1), a series of deletions within spacer-4 were generated. however, none of these mutants displayed enzyme activity toward mm (data not shown). on the basis of the above findings, we selected construct s1-s3 along with the wt / precursor construct to co - transfect with plasmids encoding the three poorly phosphorylated lysosomal enzymes (laman, gaa, and gba) and gla as a control for a well - phosphorylated enzyme. in the initial experiment, the constructs were co - expressed in gnptab hela cells, followed by incubation with [2-h]mannose to label the n - linked glycans of the lysosomal enzymes. the media was collected and the secreted proteins were immunoprecipitated and analyzed for their content of glycans containing one or two man-6-p residues. as shown in figure 2, the s1-s3 construct produced 2.1- to 4.9-fold greater phosphorylation of the glycans present on the panel of lysosomal enzymes that were co - expressed with this truncated / precursor relative to wt. next we co - transfected either expi293 cells or mouse d9 l cells (lacking the ci - mpr) with the same plasmids and collected the media after 4872 hr to use as a source of secreted lysosomal enzymes for receptor binding and cell uptake experiments. as a control for phosphorylation mediated by the endogenous glcnac-1-phosphotransferase, cells were transfected with plasmids encoding the lysosomal enzymes but not with the cdnas for the / precursors. a representative coomassie blue - stained sds gel of the media from expi293 cells is shown in figure s3. in all instances, the enzyme secreted by cells co - transfected with the s1-s3 construct bound to the ci - mpr - beads to a much greater extent than observed with the lysosomal enzymes expressed alone in the cells (figure 3). further, with the exception of laman, co - transfection with s1-s3 resulted in significantly greater lysosomal enzyme binding to the ci - mpr - beads than obtained with the wt enzyme. the impact of the increased man-6-p content of the various lysosomal enzymes on their uptake by hela cells is shown in table 1. in all four instances, the enzymes secreted by cells co - transfected with the plasmid encoding the truncated / precursor were internalized many fold better than enzyme secreted by cells using only the endogenous glcnac-1-phosphotransferase. similar results were obtained with co - transfection of the wt / precursor with the exception of gaa, consistent the ci - mpr - bead binding results. most of the uptake was blocked by the presence of 5 mm man-6-p in the media, showing that the uptake is mediated by the ci - mpr. the results with laman were particularly striking, with man-6-p - inhibitable uptake being stimulated by 130- to 153-fold. it is also notable that the gba was internalized to a great extent in a man-6-p - dependent manner. the findings presented here establish that phosphorylation of expressed lysosomal enzymes can be substantially increased by co - transfection with an engineered truncated / precursor of glcnac-1-phosphotransferase and, in some instances, with the wt / precursor. importantly, the subunit, encoded by a different gene, is not required for this effect. the enhanced phosphorylation of the lysosomal enzymes increases their binding to the ci - mpr and uptake by cells. this effect even occurs with lysosomal enzymes such as gla that are well phosphorylated by the endogenous glcnac-1-phosphotransferase. but most important is the finding that this method enhances the phosphorylation and uptake of human laman and gaa, two lysosomal enzymes that are poorly phosphorylated by endogenous glcnac-1-phosphotransferase. in addition, the production of gba containing high levels of man-6-p offers the opportunity to restore enzyme activity to cell types in patients with gaucher disease who lack the mannose receptor. this is of particular interest in light of the reported findings in a mouse model of gaucher disease that cell types other than macrophages are dysfunctional in this disorder. the availability of highly phosphorylated gba could potentially provide additional benefit to the current therapy that is targeted specifically to macrophages. in conclusion, the methods described here have the potential to significantly improve the effectiveness of lysosomal enzymes in ert. in addition to providing better cell uptake, these preparations may allow lower doses to be administered to patients, perhaps at less frequent intervals. the method should be applicable to the production of phosphorylated lysosomal enzymes for other lysosomal storage diseases that may be amenable to ert. expi293 cells (life technologies) were grown in suspension in expi293 expression medium (life technologies). the gnptab hela cell line has been described in detail elsewhere. parental and gnptab hela cells were maintained as a monolayer in dmem (life technologies) containing 0.11 g / l sodium pyruvate and 4.5 g / l glucose, supplemented with 10% (vol / vol) fetal bovine serum (fbs) (atlanta biologicals), 100,000 u / l penicillin, 100 mg / l streptomycin (life technologies), and 2 mm l - glutamine (life technologies). the ci - mpr negative mouse d9 l - cell line has been described. d9 l- cells were maintained as a monolayer in -mem (life technologies) containing 100,000 u / l penicillin and 100 mg / l streptomycin (life technologies). human gnptab - v5/his 8 in pcdna6 and the n1-d deletion construct has been described. constructs s1-d and s1-s3 were generated in two steps as follows : in the first step, the human spacer-1 sequence was replaced with d. discoideum spacer-1 using a 0.5 kb gblocks gene fragment (idt) in a two - stage overlap extension pcr (oe - pcr). nucleotides corresponding to amino acids 438819 or 438928 were subsequently removed in the second step to generate s1-d and s1-s3, respectively. the construct n1-s3 was generated by deleting nucleotides encoding amino acids 438928 from the wt construct. the laman - myc - flag cdna was purchased from origene, while the gaa cdna was a kind gift of eline van meel (leiden university). a c - terminal myc - tag was appended to the gba and gaa c - dna. renin - ha cdna was purchased from addgene (cambridge, ma), while the plasmid, vwf - a1a2a3-strep - pcdna6, was kindly provided by joshua muia and j. evan sadler (washington university school of medicine, st. constructs encoding the wt and s1-s3 / precursors were expressed in gnptab hela by transfection with lipofectatime 3000 (life technologies) according to the manufacturer s protocol. forty - eight hours post - transfection, cells in six - well plates were harvested and lysed in 250 l of buffer a (25 mm tris - cl [ph 7.2 ], 150 mm nacl, 1% triton x-100, and protease inhibitor cocktail). either10 l (wt) or 2 l (s1-s3) of cell extract was incubated in buffer b (50 mm tris - cl [ph 7.4 ], 10 mm mgcl2, 10 mm mncl2, 2 mg / ml bsa, 2 mm atp) in the presence of 75 m udp - glcnac, 1 ci udp-[h]glcnac, and 100 mm -mm in a final volume of 50 l for 1 hr at 37c. the reactions were stopped by the addition of 1 ml of 2 mm edta [ph 8.0 ], and the samples were subjected to qae - sephadex chromatography as previously described. proteins resolved by sds - page under reducing conditions were transferred to nitrocellulose membrane and detected with antibodies as described in the figure legends. the indicated amounts of whole - cell extracts were loaded on the gels. to visualize the subcellular localization of wt / and the s1-s3 mutant, the constructs were transfected into gnptab hela cells using lipofectamine 3000 according to the manufacturer s protocol. twenty - four hours post - transfection, the cells were fixed with 4% formaldehyde (sigma - aldrich) and the / subunits were detected with mouse anti - v5 monoclonal antibody (life technologies). the golgi marker golph4 was detected with rabbit anti - golph4 polyclonal antibody (abcam). the processed cells were mounted in prolong gold antifade mounting medium (life technologies), and the images were acquired with an lsm880 confocal microscope (carl zeiss). labeling experiments were performed with transfected gnptab hela cells as follows : 48 hr post - transfection, cells in 60 mm tissue culture plates were incubated with 50150 ci of [2-h]mannose (perkin elmer) for 2 hr, followed by the addition of complete medium containing 5 mm glucose, 5 mm mannose, and 10 mm nh4cl to stop mannose uptake and induce secretion. the cells were incubated for an additional 3 hr before the medium was collected for analysis. acid hydrolases secreted into the media were immunoprecipitated, and oligosaccharides isolated and analyzed essentially as described in detail previously. because the laman, gaa, and gba cdnas contained a c - terminal myc - tag, 20 l anti - myc monoclonal antibody (santa cruz biotechnology) was pre - bound to 100 l protein g - agarose - plus beads (santa cruz biotechnology) prior to immunoprecipitation of these lysosomal hydrolases from the media. in the case of gla, the secreted enzyme was immunoprecipitated with protein g - agarose - plus beads pre - bound to anti--gal antibody (amicus therapeutics). immunoprecipitated material was treated with endo h (neb) and filtered with ultracel-10k (emd millipore). the filtrate containing the released neutral and phosphorylated high mannose glycans was treated with mild acid to remove any n - acetylglucosamine residues still attached to the phosphate moieties and applied to a qae - column matrix to separate the oligosaccharides bearing zero, one or two man-6-p residues. the retentate containing endo h - resistant complex oligosaccharides was treated with pronase (roche diagnostics) and fractionated on cona - sepharose 4b (ge healthcare). the [2-h]-mannose content of the various fractions was determined, and the percentage phosphorylation was calculated as described. labeling experiments were performed with transfected gnptab hela cells as follows : 48 hr post - transfection, cells in six - well plates were incubated with 10 ci of [2-h]mannose (perkin elmer) for 2 hr. following the 2 hr pulse, cells were rinsed twice with pbs and harvested, then resuspended in detergent - free buffer containing 25 mm tris - cl (ph 7.2) and 150 mm nacl at 4c with a protease inhibitor cocktail (life technologies). cell were lysed by sonication, then subjected to ultracentrifugation at 100,000 g for 1 hr to separate the membrane proteins from the soluble fraction. one hundred microliters of the soluble fraction was then incubated with purified ci - mpr that was covalently conjugated to cyanogen bromide - activated - sepharose 4b in order to pellet the mannose - phosphorylated glycoproteins, while 10 l of the soluble fraction was precipitated by 1.5% phosphotungstic acid to obtain total [2-h]mannose label incorporation into the soluble proteins. this method allowed the accurate quantification of all the mannose - labeled glycoproteins that were phosphorylated by either wt or mutant glcnac-1-pt. l - cells were co - transfected with gaa cdna, along with empty vector, wt / precursor, or s1-s3 mutant. expi293 cells were co - transfected with laman, gba, or gla cdnas, along with either empty vector, wt / precursor, or s1-s3 mutant. the media was harvested after 23 days. for the production of gba, 10 m of compound at3375 (amicus therapeutics) was added to the media to stabilize the secreted enzyme. soluble bovine ci - mpr was purified from fbs and covalently conjugated to cyanogen bromide - activated - sepharose 4b (sigma - aldrich) as described. aliquots of media from 2- to 3-day transfected expi293 cells or mouse d9 l - cells were diluted with buffer a (25 mm tris - cl [ph 7.2 ], 150 mm nacl, and 1% triton x-100) and incubated with the ci - mpr beads at 4c for 1 hr to bind the phosphorylated lysosomal enzymes. the beads were then sedimented, washed with buffer a, and assayed for lysosomal enzyme activity as described.12, 22, 23 the amount of the starting enzyme recovered on the beads was calculated. parental hela cells were plated on a 12-well plate at approximately 80% density 1 day prior to the cell uptake experiment. aliquots of media containing each enzyme from the producing cells were added to the parental hela cells in a final volume of 500 l. for competition experiments, the cells were incubated with the media for 24 hr, and then the cells and media were collected separately. the media and cell extracts were centrifuged at 20,000 g, and the supernatants were assayed for their content of lysosomal enzyme activity. drafted the manuscript, and all authors contributed to editing it to produce the final version. | several lysosomal enzymes currently used for enzyme replacement therapy in patients with lysosomal storage diseases contain very low levels of mannose 6-phosphate, limiting their uptake via mannose 6-phosphate receptors on the surface of the deficient cells. these enzymes are produced at high levels by mammalian cells and depend on endogenous glcnac-1-phosphotransferase / precursor to phosphorylate the mannose residues on their glycan chains. we show that co - expression of an engineered truncated glcnac-1-phosphotransferase / precursor and the lysosomal enzyme of interest in the producing cells resulted in markedly increased phosphorylation and cellular uptake of the secreted lysosomal enzyme. this method also results in the production of highly phosphorylated acid -glucocerebrosidase, a lysosomal enzyme that normally has just trace amounts of this modification. |
composite resins are routinely used as restorative materials in anterior and posterior teeth due to the resins ' excellent aesthetics,1 their strong mechanical and physical properties,2 and their high resistance to dissolution.3 however, despite improvements in resin composite formulations over the years, polymerization shrinkage of the resin matrix is still considered problematic due to unsuccessful direct composite resin restorations.4 the high viscosity and stickiness of the highly filled composite makes insertion and adaptation of the material to the preparation walls difficult.5 poor adhesion between the dentin and restorative material causes gap formation. ultimately, marginal gap formation leads to microleakage, which may be responsible for increased postoperative sensitivity, pulpal inflammation, staining, and recurrent caries.6,7 to receive an excellently sealed, long - term restoration, material adaptation to the cavity walls is important.8 the preheating of resin systems has many benefits. the increased flow can improve the adaptation of the prepared tooth walls, which in turn may reduce microleakage.9 uctasli stated that preheating the treatment did not change the mechanical properties of the composite resin materials so the tested composite resin materials could be preheated because of the clinical advantages like more adaptation to the cavity walls. heating the resin composite prior to placement and polymerizing also increases monomer conversion.11 with increased paste temperature, free radicals and increasing polymer chains become more fluid as a consequence of decreased paste viscosity and they react to a greater extent, resulting in a more complete polymerization reaction and greater crosslinking. the increase in polymerization may lead to improved mechanical properties and increased wear resistance.12 preheating devices are commercially used at a temperature range of 5468c, which is questioned regarding pulp compatibility in deep cavities. nevertheless, only a 0.8c temperature increase was found after placement of a 60c heated composite, but there was a 5c increase upon 20 s light - curing.13 pretreatment of the tooth surface, especially caries removal, is essential for the establishment of a strong bond between the resin and both enamel and dentine.14 lasers have now been demonstrated to be highly effective for in vitro caries removal.15 the advantages of laser use, including decreased disturbance and reduced pain, are now drawing many researchers to investigate a multitude of applications for lasers in dentistry. the er : yag laser (2.94 m) is particularly attractive as its wavelength has the highest absorption by water of any wavelength in current use, and it also has a high affinity for hydroxyapatite.16 in the classical diamond bur preparation, a smear layer remains on the dentine. this smear layer consists of freshly cut tooth structure or tooth debris that forms a coating and becomes smeared on the surface of the preparation. cavity preparation produced by a handpiece bur is smooth in the enamel and dentine surface.17 in contrast, the er : yag laser exposes a typical intertwined patterned surface with open dentin tubuli.18 moreover, this ablation process leaves no hydroxyapatite - depleted collagen on the surface, unlike acid - etching, which exposes a microporous demineralized collagen fibril tissue that can be hybridized using conventional resin - based adhesives.19 the aim of the present study was to evaluate the microleakage of a single type of resin composite following different resin preheating procedures and associated self - etch adhesive systems in class v cavities prepared by either er : yag laser or a high - speed dental bur. the research hypothesis was that the composite with the highest preheating temperature would have the lowest microleakage scores for both laser and bur prepared cavities. with approval from the ethics committee of the faculty of dentistry, gaziantep university (gaziantep, turkey), seventy - two extracted caries and restoration - free permanent human molars were selected and stored in distilled water at 4c for a maximum of 34 weeks. the teeth were cleaned with slurry of pumice and water, rinsed thoroughly with tap water, and then examined macroscopically with magnification for defects in the enamel and dentin. class v cavities were prepared on the buccal surfaces with the occlusal margins in enamel and the gingival margins located 1.5 mm apical to the cemento - enamel junction. cavity dimensions were standardized, (4.0 mm in width, 3.0 mm in height, and 2 mm in depth) using a marked bur. in groups 14, the cavities were prepared with a diamond straight cylinder (008) bur in an air turbine handpiece. these groups were as follows : group 1 : unheated composite resin - room temperature (24 c) composite - control group;group 2 : composite preheated to 37c;group 3 : composite preheated to 54c ; andgroup 4 : composite preheated to 68c. group 1 : unheated composite resin - room temperature (24 c) composite - control group ; group 2 : composite preheated to 37c ; group 3 : composite preheated to 54c ; and group 4 : composite preheated to 68c. an er : yag laser (fidelis plus iii, fotona, 1210 ljubljana, slovenia) was used for cavity preparation in groups 58. the non - contact handpiece (r02) was used at 9.00 w for enamel and 4.00 w for dentin with very short pulse mode. it operated at a wavelength of 2.94 m ; the repetition rate was 30 hz for enamel and 20 hz for dentin. the air was adjusted to the 8 and air was adjusted to 4 on the scale of the laser unit. these groups were as follows : group 5 : unheated composite resin - room temperature (24 c) composite - control group;group 6 : composite preheated to 37c;group 7 : composite preheated to 54c ; andgroup 8 : composite preheated to 68c. group 5 : unheated composite resin - room temperature (24 c) composite - control group ; group 6 : composite preheated to 37c ; group 7 : composite preheated to 54c ; and group 8 : composite preheated to 68c. in this study, all cavities were treated with composite resin (clearfil majesty posterior, kuraray, kuraray medical, osaka, japan). the adhesive used was a bonding agent with 10% microfiller that consists of two bottles : a self - etching primer and a light - cured bonding resin (clearfil se bond, kuraray). the quartz tungsten halogen (hilux 250, 550 mw / cm, benlioglu dental, turkey) was used for polymerization. the filling material was placed at approximately 2 mm increments. for this, three oblique increments were used and each increment was cured for 40 s. the first increment was placed on the axial and mesial cavity walls, the second on the axial and distal cavity walls, and the last increment completely filled the cavity. in the preheated groups, all composite increments were preheated. composite resins in the preheated groups were placed in a unit (calset, addent inc., danbury, ct, usa) set to a temperature of 37, 54, or 68c. this unit was used with the standard tray that heats seven holes. for restorations utilizing the preheated composite, the composite tube was inserted into the hole and composite resin was respectively heated to a temperature of 37, 54, or 68c, and then placed immediately into the tooth cavity after removing the resin from the calset unit. a previous study has shown that there is an approximate 25f decrease in temperature in the 2 min after removing the composite resin from the heating unit.8 therefore, it is important to place the composite as quickly as possible. the surfaces of the restorations were finished with finishing diamonds (finishing diamond, diatech dental ac, heerbrugg, switzerland) and polished with aluminum oxide polishing disks (sof - lex, 3 m espe dental products, st. all specimens were then stored in distilled water at room temperature (24c) for 24 hours. the specimens were thermocycled 5000 times between water baths at 5 c and 55 c with a dwell time in each bath of 15 s and transfer time 5 s. the teeth were then dried superficially and the apex of each tooth was sealed with epoxy cement. the exposed crown and root structure was covered with two coats of nail varnish, leaving a 1 mm window around the cavity margins. the specimens were then immersed in a solution of 0.5% basic fuchsin dye for 24 hours to produce a visible stain. after this procedure, any surface - adhered dye was carefully rinsed away with tap water. dye penetration around the specimens was used to determine the presence of a gap around the restoration. to measure the vertical extent of microleakage, the teeth were bisected longitudinally through the restorations in a buccolingual direction with a low speed diamond saw (isomet, buehler ltd. the sectioned teeth were evaluated with a stereomicroscope (olympus sz4045 trpt, osaka, japan) at 40x final magnification. the degree of microleakage determined through dye penetration was scored according to standardized criteria (0 to 4 ; table 2, figure 1).20 double blinded evaluators measured the slices and then the kappa test was performed. differences in the frequency distribution of scores between groups were assessed using the kruskal - wallis test and assessments within the groups were assessed using the mann - whitney u test. the results of testing were analyzed with statistical software (spss / pc, vers.16 ; spss, chicago, il, usa). with approval from the ethics committee of the faculty of dentistry, gaziantep university (gaziantep, turkey), seventy - two extracted caries and restoration - free permanent human molars were selected and stored in distilled water at 4c for a maximum of 34 weeks. the teeth were cleaned with slurry of pumice and water, rinsed thoroughly with tap water, and then examined macroscopically with magnification for defects in the enamel and dentin. class v cavities were prepared on the buccal surfaces with the occlusal margins in enamel and the gingival margins located 1.5 mm apical to the cemento - enamel junction. cavity dimensions were standardized, (4.0 mm in width, 3.0 mm in height, and 2 mm in depth) using a marked bur. in groups 14, the cavities were prepared with a diamond straight cylinder (008) bur in an air turbine handpiece. these groups were as follows : group 1 : unheated composite resin - room temperature (24 c) composite - control group;group 2 : composite preheated to 37c;group 3 : composite preheated to 54c ; andgroup 4 : composite preheated to 68c. group 1 : unheated composite resin - room temperature (24 c) composite - control group ; group 2 : composite preheated to 37c ; group 3 : composite preheated to 54c ; and group 4 : composite preheated to 68c. an er : yag laser (fidelis plus iii, fotona, 1210 ljubljana, slovenia) was used for cavity preparation in groups 58. the non - contact handpiece (r02) was used at 9.00 w for enamel and 4.00 w for dentin with very short pulse mode. it operated at a wavelength of 2.94 m ; the repetition rate was 30 hz for enamel and 20 hz for dentin. the air was adjusted to the 8 and air was adjusted to 4 on the scale of the laser unit. these groups were as follows : group 5 : unheated composite resin - room temperature (24 c) composite - control group;group 6 : composite preheated to 37c;group 7 : composite preheated to 54c ; andgroup 8 : composite preheated to 68c. group 5 : unheated composite resin - room temperature (24 c) composite - control group ; group 6 : composite preheated to 37c ; group 7 : composite preheated to 54c ; and group 8 : composite preheated to 68c. in this study, all cavities were treated with composite resin (clearfil majesty posterior, kuraray, kuraray medical, osaka, japan). the adhesive used was a bonding agent with 10% microfiller that consists of two bottles : a self - etching primer and a light - cured bonding resin (clearfil se bond, kuraray). the quartz tungsten halogen (hilux 250, 550 mw / cm, benlioglu dental, turkey) was used for polymerization. the filling material was placed at approximately 2 mm increments. for this, three oblique increments were used and each increment was cured for 40 s. the first increment was placed on the axial and mesial cavity walls, the second on the axial and distal cavity walls, and the last increment completely filled the cavity. in the preheated groups, all composite increments were preheated. composite resins in the preheated groups were placed in a unit (calset, addent inc., danbury, ct, usa) set to a temperature of 37, 54, or 68c. this unit was used with the standard tray that heats seven holes. for restorations utilizing the preheated composite, the composite tube was inserted into the hole and composite resin was respectively heated to a temperature of 37, 54, or 68c, and then placed immediately into the tooth cavity after removing the resin from the calset unit. a previous study has shown that there is an approximate 25f decrease in temperature in the 2 min after removing the composite resin from the heating unit.8 therefore, it is important to place the composite as quickly as possible. the surfaces of the restorations were finished with finishing diamonds (finishing diamond, diatech dental ac, heerbrugg, switzerland) and polished with aluminum oxide polishing disks (sof - lex, 3 m espe dental products, st. all specimens were then stored in distilled water at room temperature (24c) for 24 hours. the specimens were thermocycled 5000 times between water baths at 5 c and 55 c with a dwell time in each bath of 15 s and transfer time 5 s. the teeth were then dried superficially and the apex of each tooth was sealed with epoxy cement. the exposed crown and root structure was covered with two coats of nail varnish, leaving a 1 mm window around the cavity margins. the specimens were then immersed in a solution of 0.5% basic fuchsin dye for 24 hours to produce a visible stain. after this procedure, any surface - adhered dye was carefully rinsed away with tap water. dye penetration around the specimens was used to determine the presence of a gap around the restoration. to measure the vertical extent of microleakage, the teeth were bisected longitudinally through the restorations in a buccolingual direction with a low speed diamond saw (isomet, buehler ltd., the sectioned teeth were evaluated with a stereomicroscope (olympus sz4045 trpt, osaka, japan) at 40x final magnification. the degree of microleakage determined through dye penetration was scored according to standardized criteria (0 to 4 ; table 2, figure 1).20 double blinded evaluators measured the slices and then the kappa test was performed. differences in the frequency distribution of scores between groups were assessed using the kruskal - wallis test and assessments within the groups were assessed using the mann - whitney u test. the results of testing were analyzed with statistical software (spss / pc, vers.16 ; spss, chicago, il, usa). the frequency distribution of different degrees of microleakage in the groups is shown in tables 3. group numbers (18) indicate composite resin pre - heating numbers and cavity preparations. there were significant differences between the microleakage scores for the enamel and dentin (p.05). in all restorations there were no significant differences in diamond bur prepared cavities at the gingival or occlusal margins among the preheated groups (p > 0.05). likewise, there were no significant differences in laser prepared cavities at the gingival or occlusal margins among the preheated groups (p>.05). the highest microleakage scores were detected in laser prepared dentin cavities with resin at 37 c and in diamond bur prepared cavities with resin at room temperature (p<.05). figures 2 and 3 depict representative stereomicroscopic images of cavity preparation types and adhesive used. the purpose of this in vitro study was to compare the microleakage of a single type of resin composite following different preheating procedures in class v cavities prepared by either the er : yag laser or high - speed dental diamond bur. the research hypothesis was that the composite with the highest preheating temperature would have the lowest microleakage scores for both laser and bur prepared cavities. but, the differences between the microleakage scores at the highest temperature of preheated composite in laser and bur prepared cavities were not statistically significant. this can be explained by the rapid drop in composite temperature during placing and contouring, also previously mentioned by daronch it takes almost 2 min to complete the steps from removing the composite from the calset device to full cavity filling. it is predicted that when a composite is heated up to 60 c and removed from the device, its temperature drops around 3540% after 40 s.8 the specimens were preheated with a preheating unit (calset, addent inc., used from 10 to 68 c temperatures in their study.21 fres - salgado., danbury, ct, usa) at 68 c in their study.22 external composite heating at 54 c has been reported to significantly increased monomer conversion compared to room temperature composite.23 however, silikas reported that the higher the degree of conversion in resin composites, the higher is the polymerization shrinkage. polymerization shrinkage, along with thermal contraction, might create high interfacial stresses in preheated composites upon thermal equilibrium with harmful effects on marginal adaptation, integrity, and seal.25 fres - salgado reported that a preheating treatment prior to light polymerization, similar to a clinical situation, did not alter the mechanical properties and monomer conversion of the composite but, instead, provided enhanced composite adaptation to cavity walls. wagner reported that a preheating treatment resulted in significantly less microleakage at the cervical margin compared to the other groups and that preheated composite was a valuable adjunct for reducing microleakage. according to the results of this study, no statistically significant difference was found between the preheated groups and the control group (unheated composite) in cervical or occlusal margins. it should be recommended that preheated composite resin be light - cured immediately after placement without any delay. some studies have described the surface alterations of dental hard tissues after er : yag laser irradiation as appearing flaky and scaly or as having irregular surfaces, and these surfaces are thought to be more suitable for composite resin restorations.16, 2730 hossain reported that enamel and dentin surfaces treated with er : yag laser irradiation were capable of decreasing the microleakage of composite resin restorations. cavities prepared with a high - speed diamond bur have a layer of debris. this smear layer can be removed or modified to achieve micromechanical retention of composite resin material to the dental substrate32, depending on the adhesive protocol used. according to the results of the present study, the performance of the er : yag laser, judging by microleakage scores, was similar to that of the diamond bur for class v cavities ; no significant differences were found between the laser and bur cavities, as in agreement with previous studies using the er : yag laser.30 a study by attar compared microleakages at the occlusal and cervical margins following the use of the er : yag laser for cavity preparation with different parameters and adhesive systems. roebuck found microleakages in all groups at both the enamel and the dentin margins. they reported that levels of microleakage were statistically insignificant for both enamel and dentin, except for the 240 mj - treated enamel margins. delme found no statistically significant differences in microleakage between the occlusal and gingival walls in groups where cavities were er : yag - lased and laser - etched and where no acid - etching was used. moldes reported that a significantly lower degree of microleakage was observed when a self - etching adhesive system was used for cavities prepared with both er : yag and er, cr : ysgg lasers in comparison with an etch - and - rinse adhesive system. this can be explained by the ablation of enamel and dentin substrates produced by erbium lasers, which create retentive patterns, absence of a smear layer, and morphological and possibly chemical changes in inorganic and/or organic content of hard tissue. after laser irradiation, there is better interaction and supposed chemical linking of acidic resin monomers with dental substrate residues / by products.31 the self - etching technique simplifies tooth - tissue conditioning with acidic hydrophilic monomers. most products involve bonding bivalent alcohol groups with methacrylic acid and phosphoric acid via ester bonds, or they contain 4-meta (4-methacryloyloxethyl trimellitic acid) or mdp (methacryloyloxy - decyldihydrogenphosphate) as conditioning components.36 current two - step self - etching primers or single - step self - etching adhesives produce simultaneous conditioning and priming effects on dental substrates.37 these systems do not remove the smear layer, instead, modify it and penetrate and the subjacent enamel and dentin, creating a thin hybrid layer37 dependent on ph, composition, and concentration of polymerizable acids.38 the acidic monomers of self - etching adhesives promote conditioning of the smear layer and underlying enamel / dentin substrates, resulting in a typical hybrid layer, which is divided into an upper portion with a thick hybridized smear layer (resin infiltration into the demineralized organic material layer) and a lower portion with a thin and homogeneous true hybrid layer in the demineralized dental substrate.39 in their study, holzmeier reported that clearfil s3 bond, clearfil se bond, clearfil protect bond, adhese, and xenoiii demonstrated comparatively less distinct enamel etching patterns, but their bonds were, surprisingly, not significantly different from those of transbond plus se primer, whose etching pattern was the most distinctive among the self - etching primers. vicente reported that the conditioning effect of transbond plus se primer was similar to that of phosphoric acid - etching. these studies show activities of self - etching adhesive systems. in the current study, we used clearfil se bond. moldes used the etch - and - rinse two - step adhesive system and the self - etch adhesive system in their microleakage study. they reported that neither the occlusal nor the enamel margins demonstrated differences in microleakage for any of the treatments. in the current study, two - step self etch adhesive system was used and less microleakage was observed at the occlusal or enamel margins than at the gingival or dentin margins. there were no significant differences for all groups in regards to the occlusal or enamel margins. wagner reported statistically different amounts of microleakage between the cervical and occlusal margins in class ii cavities. they stated that better sealed interfaces were formed at the occlusal margins than at the cervical margins. the most accepted theory is that the greater amount of enamel at the occlusal margins allows for better sealing and reduced microleakage.26 however, the geometry of the restoration may also have been important ; the longer vertical dimension would result in more composite shrinkage in that direction. in another study, kkemen and snmez41 stated that more microleakage was observed in cervical margins than occlusal margins. in the current study, less microleakage no restorations showed micro - leakage at the enamel - restoration and dentin - restoration along the cavity and axial walls at the occlusal margins. in the present study, dye penetration was chosen because it had previously provided a simple, inexpensive quantitative and comparable method for evaluating various composite restorations.42 the results of the study may not be directly extrapolated to the clinical environment. additional laboratory and clinical studies that evaluate the microleakage of preheated composite resins in class v cavities should be performed to verify the results reported here. microleakage values were higher at gingival margins than at occlusal margins. the use of the er : yag laser at different preheating procedures did not influence the marginal sealing in class v composite resin restorations. conflict of interest : authors indicate that they have not a financial relationship with the organization that sponsored the research. | objectives : this study aimed to evaluate the extent of microleakage of a single type of composite resin (clearfil majesty posterior, kuraray, osaka, japan) following different preheating procedures in class v cavities prepared with a diamond bur or er : yag (erbium : yttrium aluminum garnet) laser.methods:the study randomly divided 72 permanent molar teeth divided into eight groups (n = 9) : g1 : diamond bur unheated composite resin (room temperature-24 c) ; g2 : diamond bur composite preheated to 37 c ; g3 : diamond bur composite preheated to 54 c ; g4 : diamond bur composite preheated to 68 c ; g5 : er : yag laser unheated composite resin (room temperature-24 c) ; g6 : er : yag laser composite preheated to 37 c ; g7 : er : yag laser composite preheated to 54 c ; and g8 : er : yag laser composite preheated to 68 c. the specimens were subjected to a thermal cycling regimen of 5000 cycles between 5 and 55 c ; then they were immersed in a solution of 0.5% basic fuchsin dye for 24 hours. the dyed specimens were sectioned in the buccolingual direction and dye penetration was scored in a blinded manner using a five - point qualitative scale. microleakage scores were analyzed with the kruskall - wallis, mann - whitney u, and wilcoxon tests.results:there were no statistically significant differences between the microleakages of composite applied to cavities prepared by either the er : yag laser or diamond bur (p>.05). statistical analysis revealed significant differences between the enamel and dentin in all restorations (p.05).conclusions : for all groups, microleakage values were higher at gingival margins than at occlusal margins. the use of the er : yag laser at different preheating procedures did not influence the marginal sealing in class v composite resin restorations. |
the normal total body iron content of 34 g is the result of a tight balance between iron absorbed from the gastrointestinal tract and iron lost in stool, sweat and via shed skin cells. if the iron supply or gastrointestinal tract absorption of dietary iron exceeds the amount needed, there is no mechanism to eliminate the excessive iron. this state of presence of iron in excess of what is needed is called iron overload. iron overload diseases are frequently associated with hereditary defects or secondary disturbances of iron metabolism that result from excessive blood transfusions, iron supplementation or iron injections. hereditary hemochromatosis, which is characterized by a genetic predisposition to absorb excess iron from the diet, is the most frequent form of genetic iron overload. iron overload, irrespective of the underlying etiology, has varying manifestations, depending on the organs affected by the excessive iron deposit. it may present as fatigue, skin color changes, abdominal pain, joint pain, irregular menstruation, infertility, impotence, irregular heart rhythm, heart failure, new - onset diabetes or difficulty controlling established diabetes and elevation in liver enzymes. hemochromatosis, the most common genetic iron overload disorder, may also lead to the development of life - threatening complications like cirrhosis and hepatocellular carcinoma. manifestations of iron overload in hemochromatosis are related to mutations of the hfe gene, but not all patients with an inherited hemochromatosis - like phenotype carry pathogenic mutations in the hfe gene. several other genetic mutations involving the hemojuvelin, the hepcidin, the transferrin receptor 2 and the ferroportin gene have been discovered and known to cause manifestations similar to classic hereditary hemochromatosis. the hemojuvelin and hepcidin genes are implicated in causing juvenile hemochromatosis, transferrin receptor 2 gene mutation causes type 3 hemochromatosis, and ferroportin gene mutation leads to ferroportin disease. these diseases were traditionally classified under non - hfe hemochromatosis, but recently the identification of new iron genes has made it possible to distinctly identify these disorders. he had been well until 1 week prior to presentation, when he started feeling short of breath initially on exertion, but later at rest. he was anxious and tremulous. since the onset of symptoms his exercise tolerance had declined from a baseline of more than ten blocks to two blocks. he reported no fever, chest pain, dizziness, syncope, rash or weight loss. medications at the time of presentation included aspirin 81 mg daily, hydrochlorothiazide 12.5 mg daily, diltiazem 30 mg three times a day, losartan 25 mg daily as well as fenofibrate and subcutaneous insulin (70/30) 40 units twice a day. he reported active tobacco use with a five pack year history of smoking, drank three beers daily and had occasionally snorted cocaine, but stopped 2 years earlier. he had been born in us, had studied until 11th grade and had worked in a food store, but was currently unemployed. he was living in an apartment with his wife and was sexually active in a monogamous relationship. his mother and sister have diabetes mellitus and his father had died of an unknown cancer. on examination, he was afebrile. his pulse rate was 100 beats per minute, blood pressure 142/84 mm hg, respiratory rate 18 breaths per minute with oxygen saturation 94% on room air that improved to 100% on 2 liters of oxygen through a nasal cannula, and his body mass index was 28.8. the abdomen was non - distended, soft and non - tender ; the liver was palpable 5 cm below the right costal margin and bowel sounds were normal. he was alert and fully oriented, with motor strength and sensation normal in all extremities. hematocrit was 41.2%, white blood cell count 6.4 10/l and platelet count 245 10/l. the basic metabolic panel including serum sodium, serum potassium, blood urea nitrogen and serum creatinine was normal. the results of liver function tests, iron studies and tests to evaluate other etiologies of elevated transaminases are given in table 1. the blood level of probnp was elevated to 1,002 pg / ml and hemoglobin a1c was 7.8%. the patient was admitted to hospital with an initial impression of systolic congestive heart failure. high levels of serum ferritin in conjunction with the clinical findings of heart failure, hepatomegaly and diabetes mellitus suggested an iron overload state. we expected the transferrin saturation to be > 45%, as seen in hereditary hemochromatosis, the most commonly identified genetic iron overload disorder. dna mutation analysis showed that the patient was heterozygous for c282y mutation and negative for h63d mutation. in a 55-year - old man with features of iron overload elevated ferritin, diabetes mellitus, enlarged liver, elevated liver enzymes and heart failure diseases under the following two categories need consideration : (1) type 1 hemochromatosis hfe hemochromatosis. (2) type 2 hemochromatosis juvenile hemochromatosis : (a) type 2a mutation in hemojuvelin gene ; (b) type 2b mutation in hepcidin gene. (3) type 3 hemochromatosis ferroportin disease : (a) type 4a with low transferrin saturation ; (b) type 4b with high transferrin saturation. (1) iatrogenic : (a) multiple blood transfusions ; (b) parenteral iron therapy ; (c) oral iron therapy. (2) chronic liver disease : (a) alcoholic liver disease ; (b) hepatitis b and c ; (c) porphyria cutanea tarda. (3) anemias : (a) thalassemia major ; (b) chronic hemolytic anemia ; (c) pyruvate kinase deficiency. (4) others : (a) dysmetabolic hyperferritinemia. juvenile hemochromatosis : (a) type 2a mutation in hemojuvelin gene ; (b) type 2b mutation in hepcidin gene. ferroportin disease : (a) type 4a with low transferrin saturation ; (b) type 4b with high transferrin saturation. (1) iatrogenic : (a) multiple blood transfusions ; (b) parenteral iron therapy ; (c) oral iron therapy. (2) chronic liver disease : (a) alcoholic liver disease ; (b) hepatitis b and c ; (c) porphyria cutanea tarda. (3) anemias : (a) thalassemia major ; (b) chronic hemolytic anemia ; (c) pyruvate kinase deficiency. (4) others : (a) dysmetabolic hyperferritinemia. iron overload can manifest as fatigue, joint pain, liver disease, heart disease, hypogonadism, diabetes mellitus and skin pigmentation (bronze skin). features of iron overload with an abnormal gene point towards a differential diagnosis that includes hemochromatosis type 1 (hfe), hemochromatosis type 2, hemochromatosis type 3, hemochromatosis type 4, atransferrinemia and aceruloplasminemia. it is an autosomal recessive disorder due to two mutant alleles, usually c282y, of the hfe gene and is characterized by tissue iron overload with potential for organ disease [2, 4 ]. in a patient with signs of tissue iron overload with increased plasma iron content, as evidenced by hyperferritinemia and increased transferrin saturation, genetic testing for c282y mutation of the hfe gene should be performed for diagnosis of hfe hemochromatosis. approximately 8590% of patients with inherited forms of iron overload are homozygous for c282y mutation in hfe. a very small proportion of patients are compound heterozygotes, and either have one allele with c282y mutation and the other allele with h63d mutation (c282y / h63d), or one allele with c282y mutation and the other allele with s65c mutation (c282y / s65c). the remaining 1015% of patients with inherited forms of iron overload without pathogenic mutations in the hfe gene come under the definition of non - hfe hemochromatosis. ferroportin disease was first described in 1999 as an autosomal dominant disorder with similar features as those of hfe hemochromatosis. clinically, the disease is usually limited to liver disease and mild anemia, however the full spectrum of clinical symptoms typical of hemochromatosis is seen in some patients. it is caused by mutation in the slc40a1 gene, which codes for ferroportin protein. ferroportin protein is expressed in enterocytes, macrophages, kupffer cells, placental cells and hepatocytes, where it plays the role of an iron exporter. ferroportin protein helps in release of both dietary iron from enterocytes as well as iron released by damaged or senescent red blood cells into the circulation (fig. 1). expression of ferroportin, a transmembrane receptor protein, is regulated by its ligand, hepcidin. hepcidin, a negative regulator of iron absorption, binds to ferroportin transmembrane protein during states of excess iron or inflammation. the amount of iron released into the circulation by enterocytes and macrophages is reduced as a result. on the other hand, during states of iron deficiency, there is a decline in the expression of hepcidin, and hence excess iron is released into the circulation. the mutation of ferroportin protein as in the case of ferroportin disease makes it resistant to hepcidin, hence removing the negative regulation and leading to excess iron release into the circulation. in our patient, normal transferrin saturation along with heterozygosity for c282y mutation made the diagnosis of hemochromatosis unlikely. a(hypo)transferrinemia is an extremely rare autosomal recessive disorder of iron overload characterized by severe microcytic anemia, which was not present in this patient. the possibility of ferroportin disease should only be entertained once the more common secondary causes of hyperferritinemia are excluded. secondary or acquired iron overload state, in the absence of an abnormal gene, suggests disorders such as chronic hemolytic anemias, dysmetabolic hyperferritinemia, chronic liver disease due to alcohol, hepatitis b or c, porphyria cutanea tarda and iatrogenic iron overload conditions. in the absence of hepatitis c antibody or hepatitis b surface antigen in our patient, viral hepatitis b or c was very unlikely to be the cause. our patient did not report any history of iron therapy, excluding iatrogenic overload. in the presence of normal hemoglobin and hematocrit, chronic hemolytic anemia was also unlikely to be the cause. alcoholic liver disease was also unlikely to be the cause, as it is associated with elevated transferrin saturation. chronic alcohol use leads to downregulation of hepcidin, which alters the iron hemostasis, causing iron excess. dysmetabolic hyperferritinemia, also known as insulin resistance associated with iron overload, is a much more common disorder than recognized clinically by physicians. it is characterized by the presence of elevated serum ferritin, but normal transferrin saturation in an individual with features of metabolic syndrome. in our overweight patient, who had other features of metabolic syndrome including diabetes mellitus, hypertension and hyperlipidemia, this diagnosis seems most likely, especially in the absence of genetic mutation for hfe hemochromatosis and exclusion of other secondary causes of iron overload (fig. in a patient with signs and symptoms of tissue iron overload and high serum ferritin levels, low or normal transferrin saturation should alert the physician to other primary as well as secondary causes of iron overload besides hemochromatosis. other primary iron overload conditions with normal transferrin saturation include ferroportin disease type a and aceruloplasminemia. dysmetabolic hyperferritinemia, being more prevalent especially in the presence of metabolic syndrome, should be considered as the most likely disorder in such scenarios of high ferritin with normal transferrin saturation. | disturbances in iron metabolism can be genetic or acquired and accordingly manifest as primary or secondary iron overload state. organ damage may result from iron overload and manifest clinically as cirrhosis, diabetes mellitus, arthritis, endocrine abnormalities and cardiomyopathy. hemochromatosis inherited as an autosomal recessive disorder is the most common genetic iron overload disorder. expert societies recommend screening of asymptomatic and symptomatic individuals with hemochromatosis by obtaining transferrin saturation (calculated as serum iron / total iron binding capacity 100). further testing for the hemochromatosis gene is recommended if transferrin saturation is > 45% with or without hyperferritinemia. however, management of individuals with low or normal transferrin saturation is not clear. in patients with features of iron overload and high serum ferritin levels, low or normal transferrin saturation should alert the physician to other primary as well as secondary causes of iron overload besides hemochromatosis. we present here a possible approach to patients with hyperferritinemia but normal transferrin saturation. |
urinary incontinence (ui) is well - known to profoundly affect the qol (quality of life) of women. many cases of ui are stress urinary incontinence (sui), and the success of pelvic floor muscle (pfm) exercise in the management of sui has been confirmed by multiple randomized controlled studies. pfm exercise has been reported to be from 50% to 69% effective at reducing urine loss episodes in women1,2,3,4. many ui cases are the result of pfm weakness, suggesting that risk of ui can be evaluated by pfm. recently, several studies reported that the pfm, as the inner unit along with the transverse abdominal muscle (ta), multifidus muscle, and diaphragm, acts to maintain the stability of the trunk, and the pfm has begun to be used in approaches for not only ui but also lumbar pain5,6,7. in our previous study, we found a significant relationship between the thickness of the ta and the iemg of the levator ani muscle8. this result suggests that changes in the thickness of the ta may be used to indicate changes in the electrical activity of the pfm. the purpose of this study was to devise a new urinary incontinence exercise using co - contraction of both the transverse abdominal muscle and pelvic floor muscle and examine the intervention effect in middle - aged women with stress urinary incontinence. the subjects were fifteen women who had experienced one or more sui events in the past 1 month. the subjects were divided into two groups randomly : the ta and pfm co - contraction exercise group (n=9) and the control group (n=6) (table 1table 1. subject characteristicsage (y)height (cm)weight (kg)exercise group (n= 9)52.1 9.5156.1 6.251.9 5.3control group (n= 6)52.0 7.6161.0 7.455.7 all experimental procedures in this study were reviewed and approved by the ethical review committee of jilin dianli hospital. the thickness of the ta was measured in all subjects under four conditions at random in the supine position. 2) the second condition was maximal contraction of the ta. for this, the subjects were instructed to draw in the lower abdominal wall toward the spine, an action that specifically activates the ta. the subjects were instructed to contract the muscles around the vagina like a drawstring and to lift them internally. 4) the fourth condition was maximal co - contraction of both the ta and pfm. subjects were instructed to draw in the lower abdominal wall toward the spine, an action that specifically activates the ta. when the ta sustained isometric contraction, the subjects were instructed to contract the muscles around the vagina like a drawstring to lift them internally and to keep this position for 3 seconds. under each condition, the subjects were in the supine position with the knees flexed at 90 and a pillow under the head. the three - chamber pressure cells were placed under the lumbar spine, and the subjects were asked to keep the baseline at 40 mmhg. if the pressure of the biofeedback stabilizer decreased under conditions 2, 3, or 4, abdominal muscle re - education was provided by a physical therapist. ultrasound images of the anterolateral abdominal wall were obtained using a sonosite ultrasound (sonosite 180plus, b mode,5 mhz linear transducer). the transducer was positioned adjacent to and perpendicular to the abdominal wall, 25 mm anteromedial to the midpoint between the ribs and ilium on the midaxillary line, and parallel to the muscle fibers of the transversus abdominis9. the same person, a midwife, made the measurements to avoid inter - rater errors. all thickness measurements were of muscle only, that is, between the fascia boundaries. to judge the effect, the measurements were performed before the intervention, 4 weeks after the intervention, and 8 weeks after the intervention. subjects in the exercise group were provided with an 8-week ta and pfm co - contraction training program. the exercises prescribed were 40 repetitions (2 sets of 20 repetitions) of a 3-second co - contraction of both the ta and pfm. the women were told to perform 1 session of exercise 3 times per week. the women in the control group were asked not to exercise at home during the study but were offered the possibility of receiving a treatment at trial completion. to determine whether there were differences between the exercise group and the control group, the independent t - test was performed on subject characteristics. the friedman test and wilcoxon test were performed to investigate the differences between before and after the intervention. there were no significant differences between the exercise group and control group subject characteristics or any measure before the intervention. comparison of the ta thickness between before and after intervention (mm)beforeafter 4 weeksafter 8 weeksexercise group (n= 9)resting state2.5 1.32.5 1.02.7 1.2maximal contraction of ta3.9 1.73.7 1.34.7 1.8maximal contraction of pfm 3.5 1.73.6 1.34.5 1.4maximal co - contraction 3.9 1.04.1 1.35.4 1.4control group (n= 6)resting state2.2 0.72.3 0.42.4 0.7maximal contraction of ta3.6 1.13.6 1.04.2 0.7maximal contraction of pfm 3.4 1.53.7 0.83.6 0.8maximal co - contraction 4.1 1.34.1 0.83.8 0.7values are means sd. p<0.05 (before and after 8 weeks). ta : transverse abdominal muscle, pfm : pelvic floor muscle, maximal co - contraction : maximal co - contraction of both the ta and pfm shows the results for the thickness of the ta. there were significant differences in the thickness of the ta during maximal co - contraction of both the ta and pfm between before and after the 8 weeks exercise. in the control group values are means sd. p<0.05 (before and after 8 weeks). ta : transverse abdominal muscle, pfm : pelvic floor muscle, maximal co - contraction : maximal co - contraction of both the ta and pfm in the exercise group, the cure rates of sui were 55.6% (5/9) after 4 weeks of the intervention and 88.9% (8/9) after 8 weeks intervention, and the control group showed no change. this study investigated the effects of ta and pfm co - contraction exercise on stress urinary incontinence. the exercise group subjects showed not only an increased thickness of the ta during maximal co - contraction of both the ta and pfm but also improved sui. in our previous study, the cutoff value for the thickness of the ta during maximal co - contraction of both the ta and pfm was 5.00 mm. this result indicates that the detectability of the risk of urinary incontinence is high and that quantitative assessment of the risk of ui is possible through measurement of the thickness of the ta during maximal co - contraction of both the ta and pfm10, 11. in the present study, when the sui disappeared, the thickness of the ta was greater than the cutoff value. the ta and pfm co - contraction exercise intervention increases the thickness of the ta and may be recommended to improve sui in middle - aged women. | [purpose ] the purpose of this study was to devise a new urinary incontinence exercise using co - contraction of both the transverse abdominal muscle (ta) and pelvic floor muscle (pfm) and examine the intervention effect in middle - aged women with stress urinary incontinence (sui). [subjects ] the subjects were fifteen women with sui who were divided into two groups : the ta and pfm co - contraction exercise group (n=9) and the control group (n=6). [methods ] participants in the exercise group performed ta and pfm co - contraction exercise. the thickness of the ta was measured before and after 8 weeks of exercise using ultrasound. the thickness of the ta was measured under 4 conditions : (1) at rest, (2) maximal contraction of the ta, (3) maximal contraction of the pfm, and (4) maximal co - contraction of both the ta and pfm. [results ] there were no significant differences among the results of the control group. in the exercise group, the cure rate of sui was 88.9% after the intervention. there were significant differences in the thickness of the ta during maximal co - contraction of both the ta and pfm after the intervention. [conclusion ] the ta and pfm co - contraction exercise intervention increases the thickness of the ta and may be recommended to improve sui in middle - aged women. |
more than one available pathologic examination was available for 10 patients due to tumor recurrence, and for these cases the initial paraffin blocks were used for our study. a total of 118 undergoing craniotomy or stereotactic biopsy in seoul national university bundang hospital from may 2003 to september 2011, and 32 patients received craniotomy or stereotactic biopsy in seoul national university hospital from may 2011 to september 2011. the mean age of 150 glioblastoma patients was 58.8 years with range of 19 to 85 years. the patient group consisted of equal numbers of men and women, 75 patients each. patients with history of an evolution from diffuse or anaplastic astrocytoma were diagnosed as having clinically secondary glioblastoma, and de novo cases were regarded as clinically primary glioblastomas. they consisted of 146 cases of clinically primary glioblastomas and 4 cases of clinically secondary glioblastomas. the mean age of clinically primary and secondary glioblastomas was 59.2 years and 44.0 years, respectively. immunohistochemical staining for p53 and egfr was performed in 150 cases using formalin - fixed paraffin - embedded tumor blocks. idh-1 immunohistochemical stains were performed in 144 cases of glioblastoma for which paraffin blocks were available. briefly, 4-m - thick tissue sections were deparaffinized in xylene and hydrated by immersing in a series of graded ethanol. antigen retrieval was performed in a microwave by placing the sections in epitope retrieval solution (0.01 m citrate buffer, ph 6.0) for 20 minutes ; endogenous peroxidase was inhibited by immersing the sections in 0.3% hydrogen peroxide for 10 minutes.15 sections were then incubated with combinations of egfr (1:150, dako, camarillo, ca, usa), p53 (1:1,000, dako, glostrup, denmark), and/or idh-1 (1:100, dianova, hamburg, germany) antibodies. immunohistochemical stains for egfr were graded as follows : 0 (no cell stained), 1 + (50% cells stained). for statistical analysis, a score of 0 and 1 was considered negative and a score of 2 or 3 was considered positive. nuclear staining of p53 was scored semi - quantitatively in the most prominently stained area of the tissue slides. the percentage of positive cells was counted as follows : cases with 10% cells were considered positive (overexpression of p53), and 50% cells stained). for statistical analysis, a score of 0 and 1 was considered negative and a score of 2 or 3 was considered positive. nuclear staining of p53 was scored semi - quantitatively in the most prominently stained area of the tissue slides. the percentage of positive cells was counted as follows : cases with 10% cells were considered positive (overexpression of p53), and < 10% cells were considered negative. the hematoxylin and eosin stained slides were reviewed and the diagnosis was confirmed according to the who classification of tumors of the nervous system. in cases where the results of immunohistochemical studies were consistent with those of secondary glioblastomas in clinically primary glioblastoma patients with no history of previous diffuse or anaplastic astrocytoma, we searched for histological evidence of an evolution from a diffuse or anaplastic astrocytoma in the background. in addition, we radiologically re - evaluated brain tumor images to detect any lower grade components in the background. all statistical analyses were performed using spss ver. 19.0 (spss inc., chicago, il, usa). among 150 cases, immunohistochemical expression of egfr was noted in 94 cases (62.6%) and p53 was overexpressed in 74 cases (49.3%) (fig. 1a, b, d, e). the typical immunohistochemical feature of primary glioblastoma, egfr(+)/p53(-), was noted in 62 cases (41.3%) while the typical immunohistochemical feature of secondary glioblastoma, egfr(-)/p53(+), was noted in 43 cases (28.7%). immunohistochemical expression of egfr(+)/p53(+) was noted in 31 cases (20.7%) and egfr(-)/p53(-) in 14 cases (9.3%). the inverse correlation between egfr and p53 was statistically significant (independent samples t - test, p<.001). the mean age of egfr(+)/p53(-) immunohistochemically primary glioblastoma patients was 65.4 years and the mean age of egfr(-)/p53(+) immunohistochemically secondary glioblastoma patients was 53.8 years. the mean age of egfr(+)/p53(-) immunohistochemically primary glioblastoma patients was 11.6 years older than that of egfr(-)/p53(+) immunohistochemically secondary glioblastoma patients, the difference of which was statistically significant (p<.001) (table 1). immunohistochemical expression of idh-1 was noted in 16 (11.1%) of 144 total cases (fig. the mean age of idh-1(+) glioblastoma patients was 45.2 years, whereas that of idh-1(-) glioblastoma patients was 60.0 years. positive idh-1 status was significantly correlated with young age (p<.001). among 16 cases of idh-1(+) glioblastomas, 14 cases showed co - expression of p53 (87.5%) and two cases (12.5%) revealed no overexpression of p53 (p=.01). among 128 cases of idh-1(-) glioblastomas, immunohistochemical expression of egfr we also observed a positive correlation between idh-1 and p53, but no correlation between idh-1 and egfr (table 2). clinically secondary glioblastomas were observed in only 4 cases (2.8%) of the 144 cases in our study, which had previously been diagnosed as having diffuse astrocytoma or anaplastic astrocytoma. the proportion of clinically secondary glioblastomas was lower than those of previous studies.1 the mean age of patients with secondary glioblastomas was 44.0 years. all of the clinically secondary glioblastomas expressed idh-1 according to immunohistochemical staining while none expressed egfr. the secondary glioblastomas consisted of three cases with an immunohistochemical profile typical of secondary glioblastomas, idh-1(+)/egfr(-)/p53(+), and one case of idh-1(+)/egfr(-)/p53(-). among 140 cases of clinically primary glioblastoma, immunohistochemical profiles typical of primary glioblastomas, idh-1(-)/egfr(+)/p53(-), interestingly, the immunohistochemical profile associated with secondary glioblastomas, idh-1(+)/egfr(-)/p53(+), was detected in five cases (3.6%) among the 140 clinically primary glioblastomas. the five patients with idh-1(+)/egfr(-)/p53(+) immunohistochemical profiles had no history of lower grade astrocytic tumors ; however, they were young with a mean age of 44.6 years. based on these findings, we requested a neuroradiologist to review the brain magnetic resonance imaging (mri) images of these five cases. nonenhancing, extensively infiltrative components without necrosis were detected at least focally in the peripheral areas of the main tumor, which provided radiological evidence of an evolution from a less malignant precursor lesion. in addition, one case presented with multiple lesions as identified by mri. based on these findings, the five cases of immunohistochemically secondary glioblastomas were combined with the four cases of clinically secondary glioblastomas. following this adjustment, the proportion of clinically and immunohistochemically secondary glioblastomas (6.25%) was similar to those of previous studies.1 clinicopathologic profiles of clinically and immunohistochemically secondary glioblastoma patients are summarized in table 4. to determine the best combination of antibodies for immunohistochemical classification of primary and secondary glioblastomas, we analyzed various combinations of antibodies including expression of single individual antibodies, expression profiles of a combination of two antibodies, and expression profiles of all the three antibodies. specifically, we calculated the statistical measures of the performance of a binary classification tests such as the sensitivity, specificity, accuracy, positive predictive value, and negative predictive value for every antibody combination for identifying immunohistochemically primary glioblastomas (table 5) and immunohistochemically secondary glioblastomas (table 6). with respect to immunostaining with a single antibody, expression of p53 exhibited relatively lower sensitivity, specificity, accuracy, positive predictive value, and negative predictive value compared with expression of idh-1 or egfr. contrary to our expectations, the combination of all three antibodies (idh-1, p53, and egfr) was not the best way for immunohistochemical classification of primary and secondary glioblastomas. rather, combination of two antibodies for idh-1 and egfr produced the best results in distinguishing primary and secondary glioblastomas. specifically, combination of idh-1(-) or egfr(+) was the best way to identify primary glioblastomas (table 5), whereas the combination of idh-1(+) and egfr(-) was best way to identify secondary glioblastomas (table 6). among 150 cases, immunohistochemical expression of egfr was noted in 94 cases (62.6%) and p53 was overexpressed in 74 cases (49.3%) (fig. 1a, b, d, e). the typical immunohistochemical feature of primary glioblastoma, egfr(+)/p53(-), was noted in 62 cases (41.3%) while the typical immunohistochemical feature of secondary glioblastoma, egfr(-)/p53(+), was noted in 43 cases (28.7%). immunohistochemical expression of egfr(+)/p53(+) was noted in 31 cases (20.7%) and egfr(-)/p53(-) in 14 cases (9.3%). the inverse correlation between egfr and p53 was statistically significant (independent samples t - test, p<.001). the mean age of egfr(+)/p53(-) immunohistochemically primary glioblastoma patients was 65.4 years and the mean age of egfr(-)/p53(+) immunohistochemically secondary glioblastoma patients was 53.8 years. the mean age of egfr(+)/p53(-) immunohistochemically primary glioblastoma patients was 11.6 years older than that of egfr(-)/p53(+) immunohistochemically secondary glioblastoma patients, the difference of which was statistically significant (p<.001) (table 1). immunohistochemical expression of idh-1 was noted in 16 (11.1%) of 144 total cases (fig. 1c, f). the mean age of idh-1(+) glioblastoma patients was 45.2 years, whereas that of idh-1(-) glioblastoma patients was 60.0 years. positive idh-1 status was significantly correlated with young age (p<.001). among 16 cases of idh-1(+) glioblastomas, 14 cases showed co - expression of p53 (87.5%) and two cases (12.5%) revealed no overexpression of p53 (p=.01). among 128 cases of idh-1(-) glioblastomas, immunohistochemical expression of egfr was noted in 82 cases (64.1%) (p=.97). we also observed a positive correlation between idh-1 and p53, but no correlation between idh-1 and egfr (table 2). clinically secondary glioblastomas were observed in only 4 cases (2.8%) of the 144 cases in our study, which had previously been diagnosed as having diffuse astrocytoma or anaplastic astrocytoma. the proportion of clinically secondary glioblastomas was lower than those of previous studies.1 the mean age of patients with secondary glioblastomas was 44.0 years. all of the clinically secondary glioblastomas expressed idh-1 according to immunohistochemical staining while none expressed egfr. the secondary glioblastomas consisted of three cases with an immunohistochemical profile typical of secondary glioblastomas, idh-1(+)/egfr(-)/p53(+), and one case of idh-1(+)/egfr(-)/p53(-). among 140 cases of clinically primary glioblastoma, immunohistochemical profiles typical of primary glioblastomas, idh-1(-)/egfr(+)/p53(-), interestingly, the immunohistochemical profile associated with secondary glioblastomas, idh-1(+)/egfr(-)/p53(+), was detected in five cases (3.6%) among the 140 clinically primary glioblastomas. the five patients with idh-1(+)/egfr(-)/p53(+) immunohistochemical profiles had no history of lower grade astrocytic tumors ; however, they were young with a mean age of 44.6 years. based on these findings, we requested a neuroradiologist to review the brain magnetic resonance imaging (mri) images of these five cases. nonenhancing, extensively infiltrative components without necrosis were detected at least focally in the peripheral areas of the main tumor, which provided radiological evidence of an evolution from a less malignant precursor lesion. in addition, one case presented with multiple lesions as identified by mri. based on these findings, the five cases of immunohistochemically secondary glioblastomas were combined with the four cases of clinically secondary glioblastomas. following this adjustment, the proportion of clinically and immunohistochemically secondary glioblastomas (6.25%) was similar to those of previous studies.1 clinicopathologic profiles of clinically and immunohistochemically secondary glioblastoma patients are summarized in table 4. to determine the best combination of antibodies for immunohistochemical classification of primary and secondary glioblastomas, we analyzed various combinations of antibodies including expression of single individual antibodies, expression profiles of a combination of two antibodies, and expression profiles of all the three antibodies. specifically, we calculated the statistical measures of the performance of a binary classification tests such as the sensitivity, specificity, accuracy, positive predictive value, and negative predictive value for every antibody combination for identifying immunohistochemically primary glioblastomas (table 5) and immunohistochemically secondary glioblastomas (table 6). with respect to immunostaining with a single antibody, expression of p53 exhibited relatively lower sensitivity, specificity, accuracy, positive predictive value, and negative predictive value compared with expression of idh-1 or egfr. contrary to our expectations, the combination of all three antibodies (idh-1, p53, and egfr) was not the best way for immunohistochemical classification of primary and secondary glioblastomas. rather, combination of two antibodies for idh-1 and egfr produced the best results in distinguishing primary and secondary glioblastomas. specifically, combination of idh-1(-) or egfr(+) was the best way to identify primary glioblastomas (table 5), whereas the combination of idh-1(+) and egfr(-) was best way to identify secondary glioblastomas (table 6). the present study consisted of 146 clinically primary and 4 clinically secondary glioblastomas, which had immunohistochemical expression of egfr, p53, and idh-1 in 62.6%, 49.3%, and 11.1% of cases, respectively. immunohistochemical profiles of egfr(+)/p53(-), idh-1(-)/egfr(+)/p53(-), and egfr(-)/p53(+) were noted in 41.3%, 40.2%, and 28.7% of cases, respectively. in addition, expression of idh-1 and egfr(-)/p53(+) was positively correlated with young age. our study also showed a positive correlation between idh-1 and p53, but no correlation between idh-1 and egfr. interestingly, 3.6% of clinically primary glioblastomas exhibited the idh-1(+)/egfr(-)/p53(+) immunohistochemical profile which is typical of secondary glioblastomas. targeted molecular therapies and personalized medicine are becoming increasingly important for the treatment of glioblastoma patients as well as other malignant tumors. primary glioblastomas are remarkably different from secondary glioblastomas in many aspects, including their therapeutic responses to egfr tyrosine kinase inhibitors,16 - 18 mmp activation,19 cell signaling pathway,20 patterns of promoter methylation, and expression profiles at the rna and protein levels.1 because molecular subtyping of glioblastomas is very important for personalized medicine,21 distinction of primary and secondary glioblastomas can serve as an initial step for determining the treatment strategy of glioblastoma patients. amplification / overexpression of egfr is a key pathogenesis in the development of primary glioblastomas. egfr amplification and mrna overexpression are strongly associated with an increased level of the egfr protein.22,23 increased level of the egfr protein can be demonstrated as overexpression of egfr by immunohistochemistry. in previous studies, tp53 mutations are present in more than 70% of diffuse astrocytomas, anaplastic astrocytomas, and secondary glioblastomas. in addition, tp53 mutations are noted in lower than 30% of primary glioblastomas.24 in the presence of tp53 mutations, positive staining for p53 can be expected ; however, a few studies concerning tp53 in glioblastomas have reported a higher rate of immunoreactivity than expected based on the actual gene mutation. along these lines, several studies have suggested that various mechanisms of tp53 alteration can result in accumulation of p53 protein.25,26 similarly, immunohistochemical overexpression of p53 was observed in 49.3% of glioblastomas in our study. overexpression of egfr and p53 mutations are known to be mutually exclusive in the evolution of primary and secondary glioblastomas.7 our study revealed an inverse correlation between egfr and p53 that was statistically significant (p<0.001) ; however, 30% of glioblastomas exhibited ambiguous immunoprofiles in our study. the typical immunohistochemical feature of primary glioblastomas, egfr(+)/p53(-), was noted in 41.3% of cases while the typical immunoprofile of secondary glioblastomas, egfr(-)/p53(+), was noted in 28.7% of cases. unexpected immunohistochemical expression of egfr(+)/p53(+) and egfr(-)/p53(-) was noted in 20.7% and 9.3% of cases, respectively. thus, our attempt to classify glioblastomas by the immunohistochemical combination of egfr and p53 revealed certain limitations. because of the inability of egfr and p53 staining to fully distinguish between clinically primary and secondary glioblastomas, we included immunohistochemical staining for idh-1, which is highly related to secondary glioblastoma.8 we then analyzed the expression profiles of triple markers (idh-1, egfr, and p53) with respect to classification of glioblastomas (primary vs secondary). three out of four cases of clinically secondary glioblastomas exhibited the typical immunohistochemical profile consisting of idh-1(+)/egfr(-)/p53(+), while the typical immunoprofile of primary glioblastoma, idh-1(-)/egfr(+)/p53(-), was noted in 41.4% cases. interestingly, the typical immunoprofile of secondary glioblastoma, idh-1(+)/egfr(-)/p53(+), was detected in five cases (3.6%) among 140 clinically primary glioblastomas. the five patients with idh-1(+)/egfr(-)/p53(+) immunoprofile had no history of lower grade astrocytic tumors ; however, they were observed in younger patients with a mean age of 44.6 years and presented with diffuse or multiple lesions on mri images. we suspect that these cases consisted of secondary glioblastomas with subclinical diffuse or anaplastic astrocytomas and very rapid progression from precursor lower grade lesions. the proportion of clinically secondary glioblastomas (2.8%) observed in our study was lower previously observed.1 however, the proportion of clinically and immunohistochemically secondary glioblastomas (6.25%) was similar to those of previous studies. the mean age of secondary glioblastomas was 44.3 years (44.0 years in clinically secondary glioblastomas and 44.6 years in immunohistochemically secondary glioblastomas). conversely, the mean age of clinically primary and immunohistochemically primary glioblastomas was 59.2 years and 59.3 years, respectively. to determine the best combination of antibodies for immunohistochemical classification of glioblastomas, we evaluated the statistical performance of a binary classification test using every combination of antibodies for immunohistochemically primary and secondary glioblastomas. contrary to our expectations, the combination of all three antibodies (idh-1, p53, and egfr) was not the best way to distinguish primary and secondary glioblastomas. rather, combinations of idh-1 and/or egfr performed better for distinguishing primary and secondary glioblastomas. specifically, the combination of idh-1(+) and egfr(-) was the best way to identify secondary glioblastomas, which exhibited perfect statistical significance for sensitivity, specificity, accuracy, positive predictive value, and negative predictive value. likewise, the immunohistochemical combination of idh-1(-) or egfr(+) was the best method for identifying primary glioblastomas. in other words, an idh-1(+)/egfr(-) immunoprofile accurately identified secondary glioblastomas, while idh-1(-)/egfr(+), idh-1(+)/egfr(+), and idh-1(-)/egfr(-) immunoprofiles identified primary glioblastomas. based on these results, the combination of idh-1 and egfr immunohistochemistry, excluding p53, was determined to be a good method for subtyping glioblastomas. this result was attributed primarily to one case of the four clinically secondary glioblastomas that did not express p53, which affected the statistical significance of the data considerably. moreover, the sensitivity of p53(-) was too low (53.3%) in primary glioblastomas, and thus the immunohistochemical overexpression of p53 was not statistically useful for distinguishing primary and secondary glioblastomas. in summary, immunohistochemical expression of egfr, p53, and idh-1 in glioblastomas was observed in 62.6%, 49.3%, and 11.1%, respectively. the immunohistochemical profiles of egfr(+)/p53(-), idh-1(-)/egfr(+)/p53(-), and egfr(-)/p53(+) were noted in 41.3%, 40.2%, and 28.7% of cases, respectively. in addition, expression of idh-1 and egfr(-)/p53(+) was positively correlated with young age. our study demonstrated a positive correlation between idh-1 and p53, but not between idh-1 and egfr. the typical immunoprofile of secondary glioblastomas, idh-1(+)/egfr(-)/p53(+), was detected in 3.6% of clinically primary glioblastomas. the combination of idh-1(-) or egfr(+) was the best method for identifying primary glioblastomas, whereas the combination of idh-1(+) and egfr(-) was the best method for identifying secondary glioblastomas. in conclusion we expect that our results will be useful for determining treatment strategies for patients with glioblastoma. | backgroundglioblastomas may develop de novo (primary glioblastomas, p - gbls) or through progression from lower - grade astrocytomas (secondary glioblastomas, s - gbls). the aim of this study was to compare the immunohistochemical classification of glioblastomas with clinically determined p - gbls and s - gbls to identify the best combination of antibodies for immunohistochemical classification.methodswe evaluated the immunohistochemical expression of epidermal growth factor receptor (egfr), p53, and isocitrate dehydrogenase 1 (idh-1) in 150 glioblastoma cases.resultsaccording to clinical history, the glioblastomas analyzed in this study consisted of 146 p - gbls and 4 s - gbls. immunohistochemical expression of egfr, p53, and idh-1 was observed in 62.6%, 49.3%, and 11.1%, respectively. immunohistochemical profiles of egfr(+)/p53(-), idh-1(-)/egfr(+)/p53(-), and egfr(-)/p53(+) were noted in 41.3%, 40.2%, and 28.7%, respectively. expression of idh-1 and egfr(-)/p53(+) was positively correlated with young age. the typical immunohistochemical features of s - gbls comprised idh-1(+)/egfr(-)/p53(+), and were noted in 3.6% of clinically p - gbls. the combination of idh-1(-) or egfr(+) was the best set of immunohistochemical stains for identifying p - gbls, whereas the combination of idh-1(+) and egfr(-) was best for identifying s-gbls.conclusionswe recommend a combination of idh-1 and egfr for immunohistochemical classification of glioblastomas. we expect our results to be useful for determining treatment strategies for glioblastoma patients. |
cyclic peptides have a number of properties that make them useful for biomedical applications. the constraints of cyclization give them a smaller accessible conformational space than acyclic peptides, which leads to a smaller loss of entropy when they bind to a receptor. they are also very stable because they are not broken down by exopeptidases, which digest peptides by removing residues from the end of the peptide chain. cyclic peptides of all sizes are biologically active, starting from cyclic dipeptides, which are known as diketopiperazines. interesting cyclic tetrapeptides include the antitumor agent trapoxin, the antimalarial apicidin, and the phytotoxic tentoxin. there are also many examples of biologically active cyclic peptides containing five, six, or more peptide groups. understanding the energy landscapes of cyclic peptides will account for their conformational dynamics and provide some insight into their biological activity. small cyclic peptides have very different conformational behavior to acyclic peptides, most significantly with respect to cis / trans isomerization of the peptide groups. cyclic dipeptides have both peptide bonds in the cis conformation because this is the only configuration that allows for closure of the ring. all of the known experimental structures for cyclic tripeptides have all - cis conformations, but ab initio calculations on cyclic triglycine show that the all - cis and trans cis cis isomers are close in energy. many cyclic tetrapeptides exhibit interesting conformational dynamics with slow interconversion of several structures and competition between the cis and trans isomers of the peptide groups. as the size of the ring increases, the cis / trans ratio in cyclic peptides the conformations of cyclic peptides have been explored with a variety of computational techniques. the most stable conformers of several cyclic tetrapeptides have been located either by systematic or monte carlo searches. ab initio methods have been used to study the pathways for conversion between a small number of minima in cyclic tri- and hexapeptides. many larger cyclic peptides, comprising up to ten residues, have also been studied with molecular dynamics. other methods to generate cyclic peptide conformers include dihedral angle sampling, distance geometry methods, and the nccyp method, which uses a combination of coarse - grained and all atom models to generate the conformers of large cysteine - rich cyclic peptides. this is a small enough conformational space for discrete path sampling to sample all of the physically relevant minima and transition states. in this study, we present a detailed analysis of the energy landscape of cyclo-[gly4 ] and compare this to some larger and less strained cyclic peptides as well as an acyclic peptide. we then study a number of peptides where some of the glycine residues are replaced by the l- and d - isomers of alanine, to study the effect of side chains on the backbone of the peptide without the additional expense of large flexible side chains. we also consider substitution by proline, in which the cis and trans isomers are much closer in energy than in other amino acids and which has been shown to promote structural features like -turns. we examine the energy landscapes of several cyclic tetrapeptides, the simplest of which is cyclo-[gly4 ]. we compare this energy landscape with the larger cyclic peptides cyclo-[gly5 ] and cyclo-[gly6 ] and the methyl - capped acegly3nme, which contains four peptide groups and is the acyclic peptide that most closely resembles cyclo-[gly4 ]. we have constructed energy landscapes for all of the cyclic tetrapeptides where one or more of the glycine residues have been replaced by alanine residues (cyclo-[alagly3 ], cyclo-[(alagly)2 ], cyclo-[ala2gly2 ], cyclo-[ala3gly ], and cyclo-[ala4 ]). we also study the conformations of cyclic peptides containing both d- and l - peptides by looking at cyclo-[d - alagly l - alagly ] and cyclo-[(d - ala l - ala)2 ]. many biologically active tetrapeptides contain at least one proline residue, and we study cyclo-[gly3pro ], cyclo-[(glypro)2 ], and the larger cyclic peptides cyclo-[gly4pro ] and cyclo-[gly5pro ]. the initial minima for the discrete path sampling calculations were located with the basin - hopping algorithm as implemented in gmin. initially, pairs of minima for connection were selected with the missing connection algorithm. transition states were located using the doubly nudged elastic band method with interpolation between end points using a cartesian coordinate interpolation scheme and optimized by hybrid eigenvector following in optim. later, pairs of minima for connection were selected using the untrap method to remove artificial frustration. these networks of stationary points are visualized as disconnectivity graphs. we present only the most important disconnectivity graphs here, with the graphs for all the other cyclic peptides discussed in this paper available as supporting information. some of the cyclic peptides studied here are highly symmetrical, with many symmetry equivalent minima and transition states. in the disconnectivity graphs for these compounds, all of the symmetry equivalent isomers are collected together. in the most symmetrical compounds this gives a much smaller number of stationary points. for example, cyclo-[alagly3 ] has 369 minima accessible via transition states less than 30 kcal mol above the global minimum, but cyclo-[gly4 ] has just 54 symmetry unique minima. construction of the database of stationary points for a typical unsymmetrical cyclic tetrapeptide, such as cyclo-[alagly3 ], requires about 24 h walltime on four cores of an intel xeon e5405 cpu with a clock speed of 2.0 ghz. topology files for cyclic peptides prepared using the amber leap program give small energy differences between structures that should be degenerate. this problem was resolved by reordering the atoms defining the improper torsion angles at the point of ring closure. cyclic tetrapeptides are strained molecules, and we must check that the amber force field accurately generates the relative energies of the stationary points. the smallest cyclic tetrapeptide, cyclo-[gly4 ], was chosen for higher level calculations because it is the least computationally demanding in terms of the number of stationary points and the size of each calculation. the energies of all stationary points on the cyclo-[gly4 ] landscape were re - evaluated by single - point density functional theory (dft) calculations at the b3lyp/6 - 31 g level as implemented in nwchem. additionally, the structures of key minima from the amber potential energy surface were reoptimized at the b3lyp/6 - 31 g level.. a cyclic tetrapeptide can be described by up to four different sequences because the starting point for the sequence in a cyclic peptide is arbitrary. we assign the first position in the sequence to the amino acid that is first alphabetically. when labeling conformers, the plane of the ring is defined by the mean plane of the four -carbon atoms. the molecule is oriented with the ring running clockwise, and the peptide groups are labeled as up (u) or down (d) from the position of the peptide oxygen relative to the plane. each minimum is labeled by the sequence of cis / trans and up / down isomers (e.g., ctct - uudd). in the gas phase, both the b3lyp and amber calculations agree on the s4 symmetrical tttt - dudu conformer as the global minimum (figure 1a) of cyclo-[gly4 ]. the energies of all the minima relative to the global minimum show a good correlation between both methods (figure 2a). however, the energy separations in amber are slightly lower than those calculated with b3lyp. the agreement is also good for the transition states up to 30 kcal mol above the global minimum. reoptimization of the tttt - udud conformer at the b3lyp/6 - 31 g level leads to no structural change except for a small increase in the pyramidalization of the nitrogen atoms in the peptide bonds. relative energies of the stationary points on the cyclo-[gly4 ] energy landscape calculated at the b3lyp/6 - 31 g and amber / ff03 levels. points in red are minima, and points in blue are transition states. in the aqueous phase, the agreement between the amber and b3lyp energies is less good but still acceptable (figure 2b). the two methods disagree on the ordering of the most stable structures. in both cases, however, amber prefers the c2 symmetrical uuuu structure, with two of the peptide groups almost perpendicular to the plane of the ring and the other two tilted outward by 15 (figure 1b). with the amber force field, the uuuu conformer is a higher - order saddle point on the potential energy surface in vacuo. breaking the symmetry of this structure followed by minimization leads to the duuu isomer. the uuuu isomer is a minimum on the b3lyp gas - phase potential energy surface, but it lies 29 kcal mol above the dudu global minimum. the relative energies of the cis- and trans - peptides and the barriers between them are strongly dependent on the size of the cyclic peptide ring (table 1). in the acyclic peptide, the most stable isomer containing a cis - peptide is 4.9 kcal mol above the all - trans global minimum and separated from it by a barrier of 21.5 kcal mol (figure 3). in the unstrained cyclic hexapeptide cyclo-[gly6 ], the energies and barriers for the trans cis rearrangement are almost identical to those for the acyclic peptide. reducing the size of the ring to cyclo-[gly5 ] gives a smaller difference of 3.5 kcal mol between the trans and cis isomers and a much smaller barrier to their interconversion of 16.8 kcal mol. in the cyclic tetrapeptide cyclo-[gly4 ] the energy required to introduce a cis - peptide and the barriers to trans. no conformation of the twelve - membered ring can satisfy all of the preferred values of its component bond angles and torsions, and this strain is responsible for lowering the barriers to cis / trans isomerization. the energies and barriers associated with introducing two or more cis bonds into cyclo-[gly4 ] are also much lower than in the acyclic peptide. when two cis - peptides are present, the ctct arrangement is more stable than cctt. disconnectivity graph showing the energy landscape of ace - gly3-nme in water including the 841 minima and 5786 transition states accessible via transition states lower than 30 kcal mol from the global minimum. minima are colored by the number of trans - peptide groups from orange (1) to purple (4). disconnectivity graph showing the energy landscape of cyclo-[gly4 ] in water including the 54 minima and 255 transition states accessible via transition states lower than 30 kcal mol from the global minimum. minima are colored by the number of trans - peptide groups from red (0) to purple (4). all energies are in kcal mol and calculated with the amber ff03 force field in water. in the acyclic peptide, the barriers to rotation of the and torsion angles in the peptide backbone tend to be less than 5 kcal mol (figure 3). these correspond to the transitions between the up and down isomers in the cyclic peptides, which require concerted motion of several torsional angles and vary over a much wider range of energies. in the tttt arrangement of cyclo-[gly4 ], these barriers are all smaller than 5 kcal mol. however, in conformers with at least one cis - peptide arrangement many of the barriers to rotation of the single bonds are much larger. in the case of the ctct isomers some of these barriers are within 12 kcal mol of the cis / trans barriers. these larger barriers occur because up / down isomerization of a cis - peptide requires substantial deformation of the rest of the molecule. the global minimum structure for acegly3nme has a hydrogen bond between the two peptide groups at the ends of the chain (figure 3). the global minimum of the cyclic hexapeptide (figure 5b) and many of the other low - lying structures contain two transannular hydrogen bonds. however, the most stable structure with no hydrogen bonds (figure 5c) is only 0.3 kcal mol less stable then the global minimum. a single hydrogen bond is present in all of the low - lying structures in cyclo-[gly5 ]. in cyclic tetrapeptides, the constraints of the ring make it difficult to form hydrogen bonds without introducing strain into the peptide backbone. in the aqueous phase, the tttt - uuuu global minimum contains no hydrogen bonds, and hydrogen bonding only makes a small contribution to the other tttt structures. as will be discussed in the next section, hydrogen bonding becomes more important to the tttt structures in less polar solvents. if a single cis - peptide bond is introduced, the two peptide groups on either side of this are well aligned to form a hydrogen bond (figure 1c). in the ctct structures, hydrogen bonding becomes impossible because the two cis - peptides point outward in the plane of the ring while the two trans - peptides have to lie perpendicular to the plane of the ring (figure 1d). selected conformers of cyclo-[gly5 ] and cyclo-[gly6 ] optimized with the amber ff03 potential in water. in a low dielectric medium, the dudu conformer of cyclo-[gly4 ] is the most stable by a significant margin (figure 6). the dipoles of the four peptide groups are aligned so that this conformer has no dipole moment. changing the polarity of the solvent distorts this structure due to changes in the hydrogen bonding. in the gas phase each peptide group is hydrogen bonded to the peptide groups at positions i1 and i+1, but these hydrogen bonds are rather bent with n h o angles of 134 and an h the hydrogen bonding becomes much weaker, and the ring relaxes to place the h and o atoms 2.8 apart with an n o angle of 116. increasing the polarity of the solvent stabilizes the polar uuuu isomer, and it is the global minimum for values of r > 15. the duuu and dduu isomers both have small dipole moments and so are stabilized by increasing the polarity of the solvent but not to the same extent as the uuuu isomer. in nonpolar solvents, each of these isomers splits into two minima stabilized by different patterns of hydrogen bonds. the h and c nmr spectra of cyclo-[gly4 ] have been recorded in trifluoroacetic acid (r = 8.4) and show that all four peptide groups are equivalent. the proposed structure was tttt - dudu, which is consistent with the calculations presented here. relative energies of the up / down isomers of tttt cyclo-[gly4 ] as a function of the solvent dielectric constant. the lines represent the uuuu (red), duuu (green), dduu (blue), and dudu (pink) conformations. where multiple structures have the same u / d configuration only the lowest is shown. the relative stabilities of the conformers can be understood in terms of the components of the amber energy (table 2). the tttt - udud isomer has the lowest electrostatic energy because of a favorable alignment of the dipoles of the four peptide groups. if the tttt - udud isomer is moved from polar to nonpolar conditions, the structure becomes distorted by the shortening of the hydrogen bonds. this gives a more favorable electrostatic component of the energy at the expense of worse steric and strain components. the tttt - uuuu isomer has a high electrostatic energy because the four dipoles are almost parallel. however, solvation in water stabilizes conformers with a large dipole moment, such as tttt - uuuu over those with no dipole. the tttt - uuuu conformer has the lowest strain energy, and introduction of cis - peptide bonds leads to increased strain. the components for the gas - phase tttt - dudu isomer are included for comparison. the strain energy includes the bond stretching, angle and torsion terms in the potential. if one of the glycine residues in cyclo-[gly4 ] is replaced with an alanine residue to make cyclo-[alagly3 ], then the four peptide groups are nonequivalent, which gives a much larger number of stationary points (figure 7). the global minimum has a tttt - dddd conformation similar to that seen in cyclo-[gly4 ]. the relative energies of minima containing cis - peptide bonds are similar to those seen in cyclo-[gly4 ] (table 3) as are the barriers to cis / trans transitions (figure 7). if a second alanine residue is introduced to make cyclo-[(alagly)2 ] or [ala2gly2 ], the tttt - dddd conformer is still the global minimum (table 3). the relative energies of the lowest cis isomers and the barriers linking them to the global minimum are similar to those seen in cyclo-[gly4 ]. however, some of the barriers to up down isomerization are larger than those for cis trans isomerization. disconnectivity graph showing the energy landscape of cyclo-[alagly3 ] in water including the 369 minima and 2708 transition states accessible via transition states lower than 30 kcal mol from the global minimum. minima are colored by the number of trans - peptide groups from red (0) to purple (4). if a third alanine residue is added, the relative energies of the tttt and ctct isomers are unchanged, but the cttt isomer becomes less stable. this trend continues with cyclo-[ala4 ], where the most stable cttt and ctct conformers are of similar energy. the electrostatic energy contributions from the interactions of the peptide dipole moments are important in determining the relative energies of the structures (table 4), with the polar dddd structure the most stable in water and the nonpolar udud structure the most stable in vacuo. nmr spectra of cyclo-[ala4 ] show a mixture of several stable conformations. in water, four conformers are observed, with three of these merging at higher temperatures. it is possible that the three signals that merge correspond to the tttt isomer and two cttt isomers, because the downhill barriers separating them are relatively small (figure 8). the ctct isomers are separated by larger downhill barriers and could be the source of the signals that do not merge at high temperatures. in cdcl3, only the tttt and ctct isomers are observed, with none of the cttt isomer. the disconnectivity graphs here show the potential energy surface, but free energy disconnectivity graphs may be more appropriate for studying the relative populations of each conformer. disconnectivity graph showing the energy landscape of cyclo-[ala4 ] in water including the 67 minima and 199 transition states accessible via transition states lower than 30 kcal mol from the global minimum. minima are colored by the number of trans - peptide groups from orange (1) to purple (4). the strain energy includes the bond stretching, angle and torsion terms in the potential. the introduction of d - amino acid residues leads to an increase in the amount of strain. the most stable conformer of cyclo-[d - alagly - l - alagly ] is 2.3 kcal mol less stable than the most stable conformer of cyclo-[(alagly)2 ]. this allows the ring to adopt a chairlike structure, with one of the methyl groups axial to the ring. the most stable tttt structure is tttt - dudd, which is 0.9 kcal mol higher in energy. the tttt - dddd isomer, which is the global minimum in water for all the previously discussed peptides, is 1.7 kcal mol above the global minimum. this conformer places one of the alanine methyl groups close to two of the peptide oxygen atoms below the plane of the ring, which accounts for its destabilization. the global minimum of cyclo-[(d - ala - l - ala)2 ] is 1.7 kcal mol less stable than the global minimum of cyclo-[ala4 ]. the most stable conformers with tttt, cttt, and ctct arrangements are all close in energy (figure 9). the tttt - uuuu isomer is 5.7 kcal mol above the global minimum. due to steric clashes, conformers containing three or four cis - peptides are less stable in this compound than in all other cyclic tetrapeptides (table 3). disconnectivity graph showing the energy landscape of cyclo-[(d - ala - l - ala)2 ] in water including the 116 minima and 524 transition states accessible via transition states lower than 30 kcal mol from the global minimum. minima are colored by the number of trans - peptide groups from orange (1) to purple (4). in the proline containing cyclic tetrapeptides, there are groups of minima with the same pattern of cis / trans and up / down configurations separated by barriers of 23 kcal mol. these minima correspond to distortions of the five - membered rings in the proline residues. due to the conformational restriction imposed by the proline ring, simple up / down isomerizations of the amide group attached to this ring do not occur. the global minimum structure for cyclo-[gly3pro ] has the peptide group in the proline residue in the cis conformation (figure 10). if the proline group is in the trans conformation the ring can not be closed without at least one of the other peptide groups being in an unfavorable conformation. in this cyclic tetrapeptide, the proline residue strongly favors a cis conformation, with several ctct conformers below the most stable one containing a trans proline. however, the barriers to cis trans isomerization of the proline residue are smaller than those for the glycine residues. disconnectivity graph showing the energy landscape of cyclo-[gly3pro ] in water including the 358 minima and 2472 transition states accessible via transition states lower than 30 kcal mol from the global minimum. minima are colored by the number of trans - peptide groups from red (0) to purple (4). as the size of the ring in the cyclic peptide increases, the trans isomer of the proline residue becomes more stable (table 5). the relative energies of the conformers containing cis and trans proline groups in cyclo-[gly5pro ] are very close. this trend is similar to that seen for the glycine residues in cyclic polyglicines of different sizes. trans isomerization of the peptide bond preceding the proline ring does not vary much with the size of the cyclic peptide ring. the global minimum for cyclo-[(glypro)2 ] the lowest all - trans isomer is 5.0 kcal mol above the global minimum and slightly above one ccct conformer (table 3). the predicted preference for a ctct structure is consistent with the available nmr spectra and in agreement with the known crystal structureof cyclo-[(glypro)2 ]. all energies are in kcal mol as calculated with the amber ff03 force field in water and are relative to the global minimum for that cyclic peptide. the energy landscapes of small cyclic peptides are very different from those of larger cyclic peptides and acyclic peptides. as the size of the ring decreases, isomers containing cis - peptide groups become more stable, and the barriers to trans cis isomerization become smaller. in cyclo-[gly4 ], the simplest cyclic tetrapeptide, the global minimum is all - trans, and the energy of the molecule increases when the number of cis - peptide bonds increases. substituting one or two of these glycine residues with alanine gives a much larger number of minima due to the lower symmetry of these molecules, but the energy differences and barriers between these minima are similar to those seen in cyclo-[gly4 ]. introducing more alanine residues leads to higher barriers and destabilization of some minima due to steric crowding. the peptide bonds preceding proline groups have a much smaller preference for the trans conformation in cyclic hexapeptides and adopt the cis conformation in smaller systems. solvation has a substantial effect on the energy landscapes of cyclic tetrapeptides. in nonpolar solvents conformers with no net dipole moment, such as the udud isomers, are the most stable. as the polarity of the solvent increases, isomers with large dipole moments are stabilized and become competitive with, or more stable than, the nonpolar udud conformers. due to the small ring size, the structures including hydrogen bonds have strained geometries. such structures are only stable in nonpolar conditions where the strength of the hydrogen bond overcomes this strain. we have presented the potential energy landscapes of several cyclic tetrapeptides. in the future, we must consider free energy landscapes to obtain a full picture of the conformational dynamics of these molecules. here, we have only considered cyclic tetrapeptides comprising four types of amino acid residue. it is likely that other natural or unnatural amino acids will influence the conformations of cyclic peptides in different ways, and these will also be the focus of future studies. | cyclic tetrapeptides are an important class of biologically active molecules that exhibit interesting conformational dynamics, with slow interconversion of several different structures. we present calculations on their energy landscapes using discrete path sampling. in acyclic peptides and large cyclic peptides, isomers containing cis - peptide groups are much less stable than the all - trans isomers and separated from them by large barriers. strain in small cyclic peptides causes the cis and trans isomers to be closer in energy and separated by much lower barriers. if d - amino acids or proline residues are introduced, isomers containing cis - peptides become more stable than the all - trans structures. we also show that changing the polarity of the solvent has a significant effect on the energy landscapes of cyclic tetrapeptides, causing changes in the orientations of the peptide groups and in the degree of intramolecular hydrogen bonding. |
hospitalized patients, especially those in intensive care units (icus), require specialized care. their critical health conditions make them more dependent on a multidisciplinary team able to provide ethical, humane, and clinical help, especially in their daily activities. most of these patients are not able to perform the simplest activities, including their own oral hygiene. oral hygiene is necessary for patients in icus because it helps to maintain the health of their stomatognathic systems. without proper assistance, finally, changes in salivary flow caused by medications that worsen and unbalance the oral environment may increase biofilm formation. previous reports have suggested that professionals working in brazilian hospitals give little credibility to dental activities such as oral hygiene, and do not usually recognize the close association between oral hygiene and prevention of systemic diseases. health care professionals must be made aware that oral hygiene may improve the health conditions of hospitalized patients. dentistry practice in hospitals aims to prevent and eliminate potential infection sources, including inflammation and painful symptoms caused by oral problems that may directly affect systemic conditions of critically ill patients and jeopardize their recovery. they assess the accumulation of biofilm, tongue coating, dental caries, halitosis, oral lesions, partial or full prosthetics, periodontal disease, and residual fungal diseases within the oral cavity.. however, the balance of oral microflora of patients hospitalized in icus for more than 48 h tends to change. these changes lead to a prevalence of gram - negative bacteria such as staphylococcus aureus, streptococcus pneumoniae, acinetobacter baumanii, haemophilus influenzae, and pseudomonas aeruginosa. studies have correlated biofilm on the tongue with increased levels of gram - negative bacteria. biofilm on tooth surfaces, coated tongues, and periodontal disease tend to aggravate patient clinical conditions because they offer an optimal environment for growth of gram - negative bacteria. therefore, dentists and other professionals involved in caring for critically ill patients should be aware of the need for effective elimination of these factors and prevention of bacterial development in the mouth. nursing technicians are mostly responsible for performing oral hygiene in critically ill patients in icus. these professionals are supervised in the promotional activities of oral health for nurses and medical staff. however, the daily activities of care and work require a lot of attention to intensive care patients. the current study evaluated measures used by healthcare professionals to promote oral health in critically ill patients in icus. it also assessed the major difficulties encountered while carrying out preventive protocols for oral health promotion in icus of hospitals in brasilia, brazil. this cross - sectional survey was conducted with health professionals in the icus of hospitals in brasilia, brazil. the selected hospitals are the largest private hospitals in brasilia, the capital of brazil, with satisfactory quantity and high turnover of patients. thus, the sample of these two hospitals gave more credibility to the study, can demonstrate the real situation of private hospitals in the country. the hospital 1 has 24 icu beds, whereas the hospital 2 has 30 icu beds. 71 participated in the survey and answered the questionnaire. according to flick., renowned author in the area, and oreilly and parker a sample size of 71 professionals was estimated. study participants were selected randomly, according to the availability of time (shift) and working day in icus. the survey included all healthcare professionals in the icus of two private hospitals. a self - administered validated questionnaire adapted from a malaysian study by soh. the questionnaire consisted of a section focused on the oral hygiene protocol performed in the icu, the oral care practiced by these healthcare professionals, the frequency of oral hygiene, and the equipment used for oral hygiene, such as cotton, gauze, spatulas, forceps, and toothbrush. the expert panel agreed on the survey items and supported the number, format, and validity of the questions posed. only one question in the demographic profile (the nurses highest qualification) was rephrased for greater clarity. experts also agreed that the sampling of the questions was adequate and reflected the nurses practice of oral care and supported the face validity. adaptation of the validated questionnaire was made to the reality of behaviors and knowledge of the specific topic in brazil in an attempt to the better approach of the participants of the study and research activities carried out in icus by these professionals [questionnaire ]. the professionals were also asked to identify the type of mouthwash used for oral care. they also responded to questions regarding the support provided by the hospital and their attitudes toward these topics. finally, the participants were asked to provide demographic data such as age, level of qualification, type of icu where they currently worked, and length of service. knowledge of nosocomial pneumonia and its repercussions for the health of critically ill patients are essential for professionals working in icus. the ratio of biofilm, cleaning deficiency, coating buildup lingual, and lung disease exists due to microbial reservoir formation in the oral cavity and oropharynx. the training of these professionals should prioritize these types of information in the icu context. the questionnaire sought information based on protocol published by the department of dentistry and nursing at the brazilian association of intensive medicine, the largest professional society on the subject in brazil. the head researcher distributed a package of envelopes, each containing the questionnaire and guidelines for completing the questionnaire, in a single room of the hospital. participation in this survey did not negatively affect the care of patients in the icus in which the health professionals worked. it was a convenience sample, and the participation of health professionals working in icus was made according to the work period and interest of professionals in the study. ethical approval for this study was granted by the ethical committee of the catholic university of brasilia, caae number 44578215.0.0000.0029, and hospitals authorized to conduct this survey, according to ethical principles of the declaration of helsinki. data were analyzed using the spss statistics for windows, version 17.0 software (spss inc., a one - sample t - test between proportions was performed to identify significant differences between the percentages. this cross - sectional survey was conducted with health professionals in the icus of hospitals in brasilia, brazil. the selected hospitals are the largest private hospitals in brasilia, the capital of brazil, with satisfactory quantity and high turnover of patients. thus, the sample of these two hospitals gave more credibility to the study, can demonstrate the real situation of private hospitals in the country. the hospital 1 has 24 icu beds, whereas the hospital 2 has 30 icu beds. 71 participated in the survey and answered the questionnaire. according to flick., renowned author in the area, and oreilly and parker a sample size of 71 professionals was estimated. study participants were selected randomly, according to the availability of time (shift) and working day in icus. the survey included all healthcare professionals in the icus of two private hospitals. a self - administered validated questionnaire adapted from a malaysian study by soh. the questionnaire consisted of a section focused on the oral hygiene protocol performed in the icu, the oral care practiced by these healthcare professionals, the frequency of oral hygiene, and the equipment used for oral hygiene, such as cotton, gauze, spatulas, forceps, and toothbrush. the expert panel agreed on the survey items and supported the number, format, and validity of the questions posed. only one question in the demographic profile (the nurses highest qualification) was rephrased for greater clarity. experts also agreed that the sampling of the questions was adequate and reflected the nurses practice of oral care and supported the face validity. adaptation of the validated questionnaire was made to the reality of behaviors and knowledge of the specific topic in brazil in an attempt to the better approach of the participants of the study and research activities carried out in icus by these professionals [questionnaire ]. the professionals were also asked to identify the type of mouthwash used for oral care. they also responded to questions regarding the support provided by the hospital and their attitudes toward these topics. finally, the participants were asked to provide demographic data such as age, level of qualification, type of icu where they currently worked, and length of service. knowledge of nosocomial pneumonia and its repercussions for the health of critically ill patients are essential for professionals working in icus. the ratio of biofilm, cleaning deficiency, coating buildup lingual, and lung disease exists due to microbial reservoir formation in the oral cavity and oropharynx. the training of these professionals should prioritize these types of information in the icu context. the questionnaire sought information based on protocol published by the department of dentistry and nursing at the brazilian association of intensive medicine, the largest professional society on the subject in brazil. the head researcher distributed a package of envelopes, each containing the questionnaire and guidelines for completing the questionnaire, in a single room of the hospital. participation in this survey did not negatively affect the care of patients in the icus in which the health professionals worked. it was a convenience sample, and the participation of health professionals working in icus was made according to the work period and interest of professionals in the study. ethical approval for this study was granted by the ethical committee of the catholic university of brasilia, caae number 44578215.0.0000.0029, and hospitals authorized to conduct this survey, according to ethical principles of the declaration of helsinki. data were analyzed using the spss statistics for windows, version 17.0 software (spss inc., a one - sample t - test between proportions was performed to identify significant differences between the percentages. this cross - sectional survey was conducted with health professionals in the icus of hospitals in brasilia, brazil. the selected hospitals are the largest private hospitals in brasilia, the capital of brazil, with satisfactory quantity and high turnover of patients. thus, the sample of these two hospitals gave more credibility to the study, can demonstrate the real situation of private hospitals in the country. the hospital 1 has 24 icu beds, whereas the hospital 2 has 30 icu beds. 71 participated in the survey and answered the questionnaire. according to flick., renowned author in the area, and oreilly and parker a sample size of 71 professionals was estimated. study participants were selected randomly, according to the availability of time (shift) and working day in icus. a self - administered validated questionnaire adapted from a malaysian study by soh., was used in this study. the questionnaire consisted of a section focused on the oral hygiene protocol performed in the icu, the oral care practiced by these healthcare professionals, the frequency of oral hygiene, and the equipment used for oral hygiene, such as cotton, gauze, spatulas, forceps, and toothbrush. the expert panel agreed on the survey items and supported the number, format, and validity of the questions posed. only one question in the demographic profile (the nurses highest qualification) was rephrased for greater clarity. experts also agreed that the sampling of the questions was adequate and reflected the nurses practice of oral care and supported the face validity. adaptation of the validated questionnaire was made to the reality of behaviors and knowledge of the specific topic in brazil in an attempt to the better approach of the participants of the study and research activities carried out in icus by these professionals [questionnaire ]. the professionals were also asked to identify the type of mouthwash used for oral care. they also responded to questions regarding the support provided by the hospital and their attitudes toward these topics. finally, the participants were asked to provide demographic data such as age, level of qualification, type of icu where they currently worked, and length of service. knowledge of nosocomial pneumonia and its repercussions for the health of critically ill patients are essential for professionals working in icus. the ratio of biofilm, cleaning deficiency, coating buildup lingual, and lung disease exists due to microbial reservoir formation in the oral cavity and oropharynx. the training of these professionals should prioritize these types of information in the icu context. the questionnaire sought information based on protocol published by the department of dentistry and nursing at the brazilian association of intensive medicine, the largest professional society on the subject in brazil. the head researcher distributed a package of envelopes, each containing the questionnaire and guidelines for completing the questionnaire, in a single room of the hospital. participation in this survey did not negatively affect the care of patients in the icus in which the health professionals worked. it was a convenience sample, and the participation of health professionals working in icus was made according to the work period and interest of professionals in the study. ethical approval for this study was granted by the ethical committee of the catholic university of brasilia, caae number 44578215.0.0000.0029, and hospitals authorized to conduct this survey, according to ethical principles of the declaration of helsinki. data were analyzed using the spss statistics for windows, version 17.0 software (spss inc., chicago, il, usa). the variables were analyzed using descriptive statistics reported as proportions (percentages). a one - sample t - test between proportions was performed to identify significant differences between the percentages. the study sample consisted of 71 health professionals working in the icus of two private hospitals in brasilia, brazil. among these professionals, the majority (80.3%) were nurse technicians and nurses (41 ; 57.8% and 16 ; 22.5%, respectively). most professionals reported working in the icu between 13 (45.1%) and 46 years (24%), with a typical 12-h workday (70.4%). characteristics of professionals responding to the survey table 2 summarizes the professionals knowledge about coated tongue, biofilms, and nosocomial pneumonia. a significant proportion reported knowing about coated tongue (87.3%) and nosocomial pneumonia (66.2%) (p 0.05). knowledge about coated tongue, biofilm, and nosocomial pneumonia most professionals (97.2%) reported performing activities to promote patient health, 83.1% cleaned the oral cavities of patients in the icu, and 83.7% cleaned the oral cavities of patients with orotracheal intubation (p < 0.05). approximately 46.5% of professionals reported practicing oral care at least twice daily, and 33.8% reported practicing oral care three times daily [table 3 ]. oral care practices in patients in intensive care units the methods for oral care varied [table 3 ], and more than one method was often used. spatulas, gauze, and toothbrushes were the primary materials used by the majority (49.3%) of professionals (p < 0.017). some (28.2%) used only toothbrushes. among 71 professionals, 49.3% reported using a 0.12% chlorhexidine mouthwash (p < 0.017), whereas 16.9% used only toothpaste, and 11.3% used both chlorhexidine and toothpaste. however, it was used bonferroni 's theorem to adjust the critical alpha level (0.05) because the plan involved multiple tests of the same type (0.05/2) most professionals reported having a positive attitude toward providing oral care for icu patients [table 4 ], with 83.1% agreeing that oral care is a high - priority procedure for mechanically ventilated patients (p < 0.05). approximately 80.3% agreed that they had adequate time to perform oral care procedures (p < 0.05), and 76.1% confirmed that they used an aspiration vacuum to perform oral hygiene procedures on icu patients (p < 0.05). however, 56.4% of the professionals felt that the oral cavity was a difficult body area to clean (p < 0.05). this study describes the knowledge of health professionals working in the icus of two private hospitals in brasilia, brazil. the results indicate that the frequency and methods for providing oral care differed among nurses and nursing technicians. although research has been conducted in icus of these hospitals, this study provides important information regarding oral hygiene practices in icus and identified difficulties in providing this care to hospitalized patients. the results showed that over 80% of the professionals in this study were nurses and nursing technicians who performed tasks associated with oral health in patients in icus [table 1 ]. other studies have also reported that daily oral hygiene, mainly the removal of plaque and tongue coatings, is important for health promotion in patients in icus patients ; this care is usually performed by qualified nursing staff who have been trained in specific oral hygiene methods and protocols. this study [table 2 ] observed that 87.3% and 66.2% of the professionals had knowledge regarding tongue coating and nosocomial pneumonia, respectively (p = 0.00 and p < 0.05, respectively). these results are similar to those reported by barnes in which the majority of health professionals were aware of the clinical conditions most frequently present in the oral cavity of icu patients, including tongue coating and systemic problems, especially nosocomial pneumonia. the difficulty of maintaining oral hygiene in intubated patients was a major problem reported by more than 83% of the respondents oral health is a constant concern in icus, especially in intubated patients ; inadequate hygiene can contribute to the accumulation of microbial reservoirs associated with biofilm and tongue coatings, which may lead to systemic harm in these patients. oral health care in the icu is a routine procedure in hospitals [table 3 ], representing 83.1% of the sample (p = 0.00) ; however, in a study by berry., there is no standardization for the frequency, technical preparation, clinical management, time for execution, motivation, and professional capacities, based on information provided by the majority of the study participants. most of the professionals in this study performed oral hygiene at least twice daily [table 3 ], a significant difference compared to other routines (p = 0.025) [table 3 ]. this frequency of oral hygiene in the icu was also reported by sona., soh., and munro., with the aim of reducing biofilm formation and tongue coating, and subsequently reducing the number of hospital infections. mechanical cleaning is an essential activity in oral health care in icus, including the use of toothbrushes, gauze, and wooden spatulas (p = 0.017) ; this method was most commonly used by the professionals in this study [table 3 ], along with chemical cleaning with 0.12% chlorhexidine (83.7% of professionals). combined chemical (0.12% chlorhexidine) and mechanical cleaning should be performed on all hospitalized patients in the icu, as it has been shown to decrease the incidence of opportunistic infections such as nosocomial pneumonia. this practice is primarily indicated for intubated patients because the tube and feeding ducts are niches for the accumulation of gram - negative bacteria. knowledge about the importance of maintaining oral health for prevention of respiratory diseases in the hospital environment, particularly the icu, was also observed in this study [table 4 ], similar to that observed in other studies. these hygienic practices should be standard treatments performed by all professionals working in icus to provide adequate care to hospitalized patients. the majority of health professionals working in the icu in the current study (80.3%) associated oral hygiene activities with other care practices for critical patients [table 4 ] and reported having adequate time to execute these tasks. although they reported some difficulties in performing proper oral hygiene (p = 0.03), most performed them with the help of vacuum aspiration (p < 0.05), a finding similar to those reported in previous studies. it is important for healthcare professionals to seek training on measures and protocols that promote the oral health of patients in icus. the results of the current study reveal differences in practices and knowledge among the healthcare professionals evaluated in this study, indicating the need for additional educational and preparatory activities to improve oral health services performed in the icus evaluated in this study. the results of this study suggest that is necessary to educate icu professionals about the association between dental plaque and systemic condition of patients, improve training of icu professionals, and standardize oral care protocols to promote oral health of patients in icus. | objective : to assess the level of knowledge and difficulties concerning hospitalized patients regarding preventive oral health measures among professionals working in intensive care units (icus).study population and methods : a cross - sectional survey was conducted among 71 health professionals working in the icu. a self - administered questionnaire was used to determine the methods used, frequency, and attitude toward oral care provided to patients in brazilian icus. the variables were analyzed using descriptive statistics (percentages). a one - sample t - test between proportions was used to assess significant differences between percentages. t - statistics were considered statistically significant for p < 0.05. bonferroni correction was applied to account for multiple testing.results:most participants were nursing professionals (80.3%) working 12-h shifts in the icu (70.4%) ; about 87.3% and 66.2% reported having knowledge about coated tongue and nosocomial pneumonia, respectively (p < 0.05). most reported using spatulas, gauze, and toothbrushes (49.3%) or only toothbrushes (28.2%) with 0.12% chlorhexidine (49.3%) to sanitize the oral cavity of icu patients (p < 0.01). most professionals felt that adequate time was available to provide oral care to icu patients and that oral care was a priority for mechanically ventilated patients (80.3% and 83.1%, respectively, p < 0.05). however, most professionals (56.4%) reported feeling that the oral cavity was difficult to clean (p < 0.05).conclusion : the survey results suggest that additional education is necessary to increase awareness among icu professionals of the association between dental plaque and systemic conditions of patients, to standardize oral care protocols, and to promote the oral health of patients in icus. |
colorectal carcinoma (crc) is a common cause of morbidity and mortality worldwide. as a major life - threatening malignancy, crc ranks second to lung carcinoma in men, third to breast cancer and lung cancer in women, and overall second to other cancer types in men and women. approximately 142,820 new cases were diagnosed and 50,830 individuals died because of crc in 2013. clinical and pathological stages at the time of diagnosis largely determine the prognosis of diagnosed patients. the curative rates of crc in t1n0m0, t2n0m0, and t3n0m0 stages are greater than 90%, 85%, and 70%, respectively. therefore, crc screening is an efficient strategy to reduce death caused by this disease. current screening modalities have resulted in a modest decrease in mortality and failed to achieve high public participation. among these modalities, highly sensitive colonoscopy is the standard technique used to detect and remove early lesions, but colonoscopy is invasive and costly. for population - wide screening, simple and noninvasive procedures, such as guaiac or immunochemical stool occult blood testing (fobt), are preferred. however, the performances of these tests are low. as such, molecular tests should be conducted to improve their efficiency. for example, stool aberrant dna methylation has been developed as a biomarker for crc initiation and progression. in this article, this technique was discussed to develop real time polymerase chain reaction (qpcr) dna methylation biomarker test for stool to diagnose crc. stool qpcr dna methylation biomarkers were also examined to predict outcomes and responses to crc chemotherapy. approximately 98% of crc are adenocarcinomas that almost originate from adenomas as generally curable by resection. the peak incidence age of crc is 60 to 70 years, and less than 20% of cases occur before the age of 50 years. genetic and epidemiologic studies have linked crc to several factors, including inherited predisposition, somatic mutation, dietary influence, and preexisting inflammatory disease. two major distinct pathogenic pathways are involved in crc development, and stepwise accumulation of multiple mutations is implicated in these pathways. the first pathway comprisesapc/-catenin characterized by chromosomal instability (cin) that results in the stepwise accumulation of mutations in a series of oncogenes and tumor suppressor genes., the accumulated -catenin translocates to the nucleus and activates the transcription of several genes, such asmyc and cyclin d1.k - ras mutations subsequently occur. further mutation of a putative cancer suppressor gene on 18q21 andtp53 leads to the final emergence of carcinoma, and additional mutation ensues. the accumulation of mutations rather than their occurrence in a specific order is essential for colorectal carcinogenesis. the second pathway is characterized by genetic lesions in dna mismatch repair genes, which are involved in 10% to 15% of sporadic cases. mutations accumulate, but correlated identifiable morphological characteristics have yet to be determined. among these dna mismatch repair genes the loss ofdna mismatch repair genes leads to a hypermutable state. in this state, simple repetitive dna sequences called microsatellites are unstable during dna replication the resulting microsatellites instability (msi) is the molecular signature of defective dna mismatch repair. the loss of mismatch repair then leads to the accumulation of mutations in growth - regulating genes, and thus triggers the emergence of crc. in addition to these pathways, cpg island methylator phenotype (cimp) pathway is also involved in crc development. in the majority of patients diagnosed with crc, these trends are consistent with the effectiveness of crc screening in detecting and removing adenomatous polyps., screening tests can be classified into two categories : invasive (structural) exams and non - invasive tests. invasive exams can be subdivided into endoscopic techniques (colonoscopy, flexible sigmoidoscopy, and capsule endoscopy) and radiological exams (barium enema, computer tomography colonography and magnetic resonance colonography). noninvasive tests can be subdivided into tests that detect blood (fobt) and tests that detect stool dna. among these techniques, colonoscopy remains the gold standard, but this technique is invasive, costly, and burdensome. colonoscopy may also be less protective in the right colon than in the left colon. fobt is a simple, non - invasive, relatively cheap, and frequently used screening test. the detection of dna markers in stool specimens is a relatively new noninvasive screening approach. multi - targeted assays on 21 specific mutations in thek - ras, tp53, andapc, which is a msi marker (bat-26), and dna integrity assay markers has also been developed. nevertheless, their overall sensitivities in detecting crcs and adenomas remain suboptimal, possibly because the accumulation of mutations is essential for colorectal carcinogenesis. the detection of dna mutation may also fail to reflect the progress of carcinogenesis. epigenetics refers to heritable alterations in gene activity and expression unlikely caused by changes in dna sequences and potentially reversible self - propagating molecular signatures. the mechanisms of epigenetics include dna methylation, histone modifications, nucleosome positioning, or noncoding rna. epigenetic modifications, particularly dna methylation in selected gene promoters, are recognized as common molecular alternations in human tumors. among epigenetic markers, methyl groups are added to the 5-position of cytosine by dna methyltransferases (dnmt) to produce 5-methylcytosine, which typically represses gene transcription and modifies dna functions. for instance, the dna methylation of cytosine residues in cpg dinucleotides, which are often clustered in so - called cpg islands, leads to transcriptional silencing of the associated genes. approximately 60% of all human promoters are associated with cpg islands. in the genome of untransformed cells, the dna methylation of many genes and their significance in crc have also been described. the aberrant methylation of cpg islands within gene promoters and first exonic or intronic regions may induce the transcriptional repression of tumor - suppressor genes. hypermethylation is a discrete targeted event within tumor cells and thus causes specific loss of gene expression. hypomethylation usually occurs in advanced stages of tumor development and affects genome to a greater extent than hypermethylation does.. mechanisms of dna methylation in the colorectal carcinoma pathogenesis : the roles of multiple dna methylation biomarkers in colorectal carcinogenesis. cimp is the phenotype of methylated tumor suppressor genes, and tumorigenesis theoretically occurs through progressive genetic silencing even in the absence of genetic mutations. cimp is also referred to as an epigenetic phenomenon because this occurrence involves a temporary genetic change in the target dna sequence, that is, cimp simply triggers a potentially reversible alteration because of methylation. cimp is regarded as a distinct crc subgroup, which is fundamentally different from other colon cancers. cimp tumors exhibit unique pathological features, such as high mutations (kras or braf) rates, proximal location, wild - type p53, mucinous histological type, poor differentiation, and increased occurrence in female and elderly patients. primary crcs can be divided into three subclasses depending on epigenetic and clinical profiles : cimp1, cimp2 and cimp negative. crcs with neither cin nor msi possess a unique methylation pattern and clinical features, including improved prognosis. hypermethylation secondary to cimp possibly leads to msi through mlh1 promoter methylation and subsequent mlh1 mismatch repair gene silencing. dna methylation has been used as a diagnostic crc marker because specific methylation events occurring early in multistep carcinogenesis have been identified and epigenetic gene silencing plays a causative role in crc development. dna methylation analysis may also provide useful prognostic markers of disease progression and response to traditional chemotherapy. adenoma is a neoplastic polyp that ranges from small pedunculated tumors to large sessile lesions. adenomatous polyps are classified into three subtypes on the basis of epithelial architecture : (1) tubular adenomas ; (2) villous adenomas ; (3) tubulovillous adenomas. the risk of crc increases when polyps are larger than 2 cm, villous than tubular, and sessile rather than pedunculated. although colorectal adenomatous polyps are recognized as precursor lesions in most crc cases, only 1%10% of individuals with resected adenomas likely develop invasive cancer. thus, the feasibility of using dna methylation biomarkers to diagnose colorectal adenoma should also be evaluated. different panels have been reported to improve diagnostic accuracy, although no definite biomarker panel has been established. in our comprehensive analysis of available studies on dna methylation biomarkers in stools for crc and adenoma detection, some dna methylation biomarkers, including secreted frizzled - related protein 2 (sfrp2), secreted frizzled - related protein 1 (sfrp1), tissue factor pathway inhibitor 2 (tfpi2), vimentin, and methylguanine dna methyltransferase (mgmt), have been investigated. these markers may also be used to diagnose crc and adenoma in early stages (table 1). major stool dna methylation biomarkers for colorectal cancer sfrps are a family of secreted proteins that can bind townt ligands and frizzled receptors and thus modulate thewnt signaling cascades.wnt signaling cascades play an important role in colorectal carcinogenesis and progression. sfrps are initially and independently identified as soluble factors implicated in early embryonic development and modulators of apoptotic events. alterations in sfrp expression levels have been associated with tumor formation and bone and myocardial disorders. sfrp1 and sfrp2 hypermethylation likely occurs at the onset of all tumor types, including colon carcinomas. epigenetic sfrp1 inactivation is linked to the upregulation ofwnt/-catenin cascade in crc;wnt/-catenin repression has also been considered a mechanism that inhibits tumor cell growth and prevents metastatic invasion (figure 1). sfpr2 and sfrp1 methylation in stool also exnibits high sensitivity and specificity for crc detection. sfrp2 methylation for crc identification in stool samples reaches a sensitivity of 90% and specificity of 77%. a systematic meta - analysis has revealed that the pooled sensitivity and specificity of methylated sfrp2 are 0.71 and 0.94, respectively. the dna stool test of sfrp1hypermethylation also achieves a sensitivity of 89% and specificity of 86% in colorectal neoplasia detection. tfpi2, a member of the kunitz - type serine proteinase inhibitor family, inhibits the tissue factor / factor viia complex and various serine proteinases. the aberrant methylation of tfpi2 promoter cpg islands in human cancer is responsible for the decreased tfpi2 expression during cancer progression. tfpi2 also maintains the stability of tumor environment and inhibits neoplasm invasiveness and growth and metastasis formation (figure 1). tfpi2 gene promoter methylation is detected in the stool of crc patients with a sensitivity of 86.7% and a specificity of 100%. the sensitivity and specificity of fecal tfpi2 methylation assay for crc detection range from 76% to 89% and from 79% to 93%, respectively. vimentin, a major constituent of the intermediate filament family of proteins, is ubiquitously expressed in normal mesenchymal cells and known to maintain cellular integrity. vimentin has been considered as a marker for epithelial - mesenchymal transition (emt), although the molecular aspects of vimentin in the function of tumorigenesis remain unknown. the aberrant promoter methylation of the vimentin gene may contribute to colorectal carcinogenesis (figure 1). the promoter hypermethylation of vimentin in stool is also a sensitive, specific alternative for crc screening. aberrant vimentin methylation is detected in fecal dna from crc patients, with a sensitivity of 46% and a specificity of 90%. mgmt is a suicide enzyme that repairs the pre - mutagenic, pre - carcinogenic and pre - toxic dna damage o6-methylguanine. mgmt also repairs large adducts, which are formed in response to pollutants, carcinogens, methylating agent, and chloroethylating anticancer drugs, on the o6-position of guanine. therefore mgmt is a key node in the defense against commonly found carcinogens and marker of resistance of normal and cancer cells exposed to alkylating therapeutics (figure 1). a meta - analysis suggested that the frequency of mgmt hypermethylation is significantly higher than that in crc, and mgmt gene promoter methylation involved a stepwise carcinogenesis of crc development. the loss of mgmt expression, which is secondary to mgmt gene promoter methylation, may increase the responses to alkylating agents. the methylation stool testing of mgmt is a promising, sensitive, and specific method for early crc detection. stool - methylated mgmt is detected in 48.1% of crc patients and 28.6% of adenoma patients. other stool methylation biomarkers, such as oncostatin m receptor-, human mut l homolog-1, hyperplastic polyposis protein gene, sfrp5, gata4, -1, 4-galactosyltransferase-1, n - myc downstream - regulated gene 4, 2qi4.2, hypermethylated in cancer 1, esr1, phosphatase and actin regulator 3, spastic paraplegia-20 and rassf2, have been proposed to diagnose crc., dna methylation can be measured quantitatively through qpcr, which may be used to monitor disease progression. purified stool dna can be chemically modified by sodium bisulfate to convert all unmethylated cytosine to uracils while leaving methylcytosines unaltered. treated dna retains methylated cytosines, and shows specific changes in the dna sequence. cellular efflux toward the lumen is much greater from crc than from normal epithelium. although crc typically occupies less than 1% of the intestinal surface, tumor - derived dna in stool from patients with crc may account for as much as 14% or 24% of the total recovered dna. exfoliated coloncytes and colonocyte constituents provide a diverse class of candidate stool markers. unlike occult bleeding, which occurs as intermittent leaking into the lumen, furthermore, exfoliated markers are potentially specific because they originate from neoplasm per se, where occult blood emanates from circulation. since the earliest study of abnormal methylation in crc was reported by feinberg and vogelstein, hundreds of methylated genes have been described in crc and adenoma. the correct genes to be analyzed should be accurately selected to improve the sensitivity and specificity of dna methylation tests. specific methylation events have been associated with different tumor stages and poor prognoses. as the first chemotherapeutic agent, 5-fluorouracil (5-fu) has been combined with folinic acid and has been used for crc chemotherapy. hence, newly available 5-fu - based oral formulations, such as capecitabine, offer maximum antitumor properties. cancer - specific dna methylation events may also be involved in different stages of colorectal carcinogenesis. unlike gene mutations the response and chemosensitivity of patients to chemotherapy may also be predicted by determining the status of dna methylation biomarkers in the stool of crc patients. recent advancements in engineered dna - binding molecules, such as transcription activator - like effector (tal or tale) proteins, clustered regularly interspaced short palindromic repeats (crispr), and crispr - associated proteins (cas) system, have been applied in genome editing in cells. these engineered dna - binding molecules can bind to a specific dna sequence and be applied to other purposes. engineered dna - binding molecule - mediated chromatin immunoprecipitation has been developed by utilizing a tal or crispr / cas system to target specific genomic regions and to investigate associated dna - binding interactions. the development of a sensitive stool qpcr dna methylation assay for crc and adenoma can provide a non - invasive, scalable, specific, safe, convenient, and widespread accessible screening tool, which is more acceptable to patients than current commonly used screening methods. this assay may help decrease the morbidity and mortality of crc. | colorectal carcinoma (crc) is a common cause of morbidity and mortality worldwide. two pathogenic pathways are involved in the development of adenoma to crc. the first pathway involvesapc/-catenin characterized by chromosomal instability resulting in the accumulation of mutations. the second pathway is characterized by lesions indna mismatch repair genes. aberrant dna methylation in selected gene promoters has emerged as a new epigenetic pathway in crc development. crc screening is the most efficient strategy to reduce death. specific dna methylation events occur in multistep carcinogenesis. epigenetic gene silencing is a causative factor of crc development. dna methylations have been extensively examined in stool from crc and precursor lesions. many methylated genes have been described in crc and adenoma, although no definite dna methylation biomarkers panel has been established. multiple dna methylation biomarkers, including secreted frizzled - related protein 2, secreted frizzled - related protein 1, tissue factor pathway inhibitor 2, vimentin, and methylguanine dna methyltransferase, have been further investigated, and observations have revealed that dna methylation biomarkers exhibit with high sensitivity and specificity. these markers may also be used to diagnose crc and adenoma in early stages. real time polymerase chain reaction (qpcr) is sensitive, scalable, specific, reliable, time saving, and cost effective. stool exfoliated markers provide advantages, including sensitivity and specificity. a stool qpcr methylation test may also be an enhanced tool for crc and adenoma screening. |
it has been described in patients with increased venous pressure and stasis caused by venous insufficiency, congenital / acquired arteriovenous anomalies, arteriovenous shunts and lower limb paralysis or amputation stumps. different names, like congenital dysplastic angiopathy, pseudo - kaposi sarcoma, and acral capillary angiomatosis, have been used. first type namely the mali type of acroangiodermatitis is related to chronic venous insuffiency and second the stewart - bluefarb type is associated with arteriovenous malformations. this lesion is usually encountered mostly on extensor surfaces of lower extremities, and clinically characterized by angiomatous red - violaceous, brown papules, plaques or nodules. it is seen more frequently in males and according to underlying causes may be presented in childhood or early adulthood. a 26-year - old male was admitted to our hospital with unilateral, multifocal irregularly contoured, purplish red colored, papular, plaque - shaped and nodular lesions on his right ankle. microscopically epidermis showed minimal achantosis with a melanin pigment increase in the basal cell layer. the lesion was located in dermis demonstrating a lobular architecture and was composed of small proliferating capillaries that are separating from each other with a slightly edematous matrix or forming nodular structures in which the luminal formations can hardly be identified. stroma contained minimal spindle cell proliferation around vessels, diffuse hemosiderin granules and extravasated erythrocytes. (h and e, 400) for differential diagnosis, immunohistochemical stains cd 34, cd 31 and factor 8 were used. positive immunostainings for cd 34, cd 31, and factor 8 were observed in endothelial cells figure 5. acroangiodermatitis is vasoproliferative disorder which is mostly related to vascular stasis and venous insufficiency, but rare cases without venous dysfunction are reported as in our case. whereas some authors classify acroangiodermatitis as a vascular lesion, it is a variant of stasis dermatitis and takes place in the group of eczematous diseases according to some authors. compared with other eczematous diseases it is more pigmented, and prone to develop stasis ulcers. histologically stasis dermatitis includes more dilated papillary dermal small blood vessels and more hemosiderin accumulation, shows more fibrosis or even sclerosing panniculitis in older lesions. in addition to these features, exuberant vascular proliferation is characteristic feature of acroangiodermatitis, which most importantly makes it resembling kaposi sarcoma both histologically and clinically. acroangiodermatitis has been commonly described in patients with increased venous pressure and stasis caused by mostly venous insufficiency, less commonly congenital / acquired arteriovenous anomalies, arteriovenous shunts and lower limb paralysis, particularly at lower distal extremities. although exact etiology is not clear, increased venous pressure and stasis cause chronic hypoxia which induces neovascularization and fibroblast proliferation. the role of angiogenetic factors, like pge1 and heparin, induced by several causes seems to be important in vascular proliferation. there are thick - walled, dilated capillaries showing reduplication may be indicating angiomatous appearance. some lesions may show nodular collections of vessels with narrow lumina. there may be mild perivascular fibroblastic proliferation. in addition to that, extravasated erythrocytes, horizontally arranged spindle cells, fibrosis, numerous hemosiderin pigment accumulation may be present. similar appearance, hypertrophic and tortuous venules can be observed in deep dermis but in kaposi sarcoma the vessels have more jagged outline and may show promontory sign which is characterized by protruding new formed small vessels into the larger vascular space. in acroangiodermatitis the angiomatous capillaries are separated by an edematous matrix. an important feature is that in acroangiodermatitis there is proliferation of the preexisting vasculature rather than new vascular formation seen in kaposi sarcoma. in kaposi sarcoma there is slit - like inconspicuous lumina, there are fascicles of spindle cells which are sometimes branching whereas in acroangiodermatitis vessels form nodular collections with narrow but more regular lumina. there may be mild perivascular fibroblastic proliferation around vessels in both lesions but these cells do not stain with cd 34 in acroangiodermatitis whereas they are positive with cd 34 in kaposi sarcoma. in kaposi sarcoma there is atypia in endothelial cells, small hyaline globules due to erytrophagocytosis and plasma cells can be observed in perivascular inflammatory infiltrate but in acroangiodermatitis there is no or minimal atypia in endothelial cells and other findings are not usual. there are other diseases like pigmented purpuric diseases, vasculitis, stasis dermatitis, vascular forms of fibrous histiyocytoma, and other hemangiomata in differential diagnosis of acroangiodermatitis. in stasis dermatitis there is more parakeratosis and spongiosis in epidermis, lesions are located deeper in dermis and there is more hemosiderin pigment deposition. in vasculitic lesions kaposi sarcoma versus acroangiodermatitis treatment of acroangiodermatitis is important to prevent further complications such as bone demineralization, soft tissue destruction, congestive heart failure and infection. treatment includes correction of any underlying congenital or acquired vascular disorder, conservative methods to reduce venous stasis, and local wound care. with all these clinical, histopathological, and immunohistochemical findings we diagnosed this lesion as acroangiodermatitis. here, it is discussed since no venous insufficiency or any reason for venous pressure increase and prominent stasis could be found. in addition, this lesion closely resembles kaposi sarcoma and differential diagnosis is important as the treatment of kaposi sarcoma involves skin grafting and radiotherapy. acroangiodermatitis needs to be evaluated carefully and distinguished from kaposi sarcoma.acroangiodermatitis can be seen without venous insufficiency or prominent venous stasis as in our case. acroangiodermatitis can be seen without venous insufficiency or prominent venous stasis as in our case. | acroangiodermatitis is a rare self - limited angioproliferative lesion which can be associated with congenital vascular malformations or acquired venous insufficiency. despite of its benign character, differential diagnosis of this lesion is very important because it closely resembles kaposi sarcoma. here we present a 26-year - old male patient with unilateral, purplish - red colored papules on his right ankle which diagnosed as acroangiodermatitis and discuss histopathological features, differential diagnosis and treatment of this unusual condition. |
there are three common types of protein glycosylation that modify large numbers of protein substrates in mammalian cells. proteins localized to the secretory pathway and the cell surface or secreted into the extracellular space can be modified by oligosaccharide structures, such as n - linked glycosylation (linked through asparagine) or mucin o - linked glycosylation (linked through serine and threonine). additionally, cytoplasmic, nuclear, and mitochondrial proteins can be substrates for the addition of the single monosaccharide n - acetyl - glucosamine, termed o - glcnac modification (o - glcnacylation, linked through serine and threonine). it is added to protein substrates by one of three isoforms of o - glcnac transferase (ogt) and removed by two isoforms of o - glcnacase (oga). the expression of these enzymes is also required for embryonic development in mice and drosophila.(68)o - glcnac modification displays significant crosstalk with other posttranslational modifications (ptms), most significantly phosphorylation and ubiquitination, setting up o - glcnacylation as a key regulator of cellular pathways. a wide variety of proteins have been shown to be o - glcnac modified, including regulators of transcription and translation, cytoskeletal proteins, signaling proteins, and metabolic enzymes. the specific consequences of most of these modifications are unknown ; however, limited biochemical analyses demonstrate that o - glcnac modification can change protein localization, stability, molecular interactions, and activity. critically, o - glcnacylation is also misregulated in alzheimer s disease and cancer. for example, in neurodegenerative disorders such as alzheimer s disease, o - glcnacylation levels are diminished directly leading to protein aggregation and cell death, and we have demonstrated that it likely plays a similar role in parkinson s disease. finally, higher levels of o - glcnac modification are a common feature of many cancers and are necessary for tumorigenesis and proliferation. to identify and characterize o - glcnac modifications, complementary chemical methods have been developed. in general, these technologies take advantage of bioorthogonal chemistries, such as the copper(i)-catalyzed azide alkyne cycloaddition (cuaac or this reaction relies upon small, abiotic chemical reporters (azides and alkynes) that can be selectively reacted with alkyne- and azido - probes, respectively, for the installation of visualization and affinity tags. one of these methods, initiated by the bertozzi laboratory, takes advantage of monosaccharide analogues that directly incorporate azides or alkynes into their structures. these analogues, termed metabolic chemical reporters (mcrs), are taken up by cells through carbohydrate salvage pathways and subsequently feed into the biosynthesis of nucleotide sugar - donors for use by glycosyltransferases. for example, the first o - glcnac - targeted mcr, n - azidoacetyl - glucosamine (glcnaz, figure 1b), has been used for the visualization and proteomic identification of labeled proteins. unlike other methods (e.g., western blotting), mcrs do not necessarily read - out on endogenous levels of o - glcnacylation, as they must compete with glcnac in the cell. however, because they must be metabolically transformed before their incorporation onto proteins, they not only report on o - glcnac modification but also on the integration of upstream metabolic pathways. additionally, they can be used much like radioactivity to isolate new modification events and subsequent rates of removal in pulse and pulse - chase labeling experiments. despite the clear utility of this technology, the previous iterations have limitations. until recently, glcnaz and other mcrs were presumed to label only one type of glycosylation (i.e., glcnaz treatment results in o - glcnacylation labeling), but several enzymatic pathways exist that can interconvert different monosaccharides, raising the possibility that mcrs are converted in the same manner. upon careful characterization, it was demonstrated that glcnaz can be readily transformed to n - azidoacetyl - galactosamine (galnaz, figure 1b) and vice versa, resulting in the labeling of both o - glcnacylated and mucin o - linked glycosylated proteins. furthermore, we showed that glcnaz treatment leads to labeling of n - linked glycosylation. this can be overcome using cellular fractionation ; however, since we have complete chemical control over the mcr, we predicted that structural alterations can limit this off - target labeling and produce an o - glcnacylation - specific reporter. indeed, we previously demonstrated that an alternative mcr, n - pentynyl - glucosamine (glcnalk), which contains a larger functional group at the n - acetyl position, is not converted to the galactosamine derivative and therefore could not label mucin o - linked glycoproteins. unfortunately, glcnalk was still incorporated into n - linked glycans, preventing its use as a completely selective o - glcnacylation reporter. we report here the development and application of 6-azido-6-deoxy - n - acetyl - glucosamine (6azglcnac, figure 1b and scheme s1 and figure s7 in supporting information (si)) as a mcr in living cells. cellular analysis of this mcr using cuaac and fluorescent probes demonstrated that, unlike previous reporters, it is highly selective for o - glcnacylated proteins, allowing for the robust visualization of o - glcnac modifications using in - gel fluorescence scanning. furthermore, comparative proteomics using 6azglcnac, glcnaz, and galnaz confirmed the specificity of 6azglcnac toward o - glcnac modifications. 6azglcnac - labeling resulted in the enrichment of zero proteins, out of 367, which are annotated to have exclusively extracellular or lumenal localization. in contrast, glcnaz and galnaz identified 9 and 72 such proteins, respectively. finally, we also demonstrate that 6azglcnac can bypass an assumed biosynthetic roadblock by being phosphorylated by the enzyme phosphoacetylglucosamine mutase. our previous data using mcrs demonstrated that even small alterations in chemical structure can have dramatic effects on the distribution of chemical reporters into different types of glycosylation. therefore, to find a specific mcr of o - glcnacylation, we synthesized a small panel of o - acetylated n - acetyl - glucosamine analogues bearing azides at different positions ; the acetate protecting - groups allow diffusion across the cell membrane and are subsequently removed by endogenous lipases / hydrolases. nih3t3 cells were treated with these compounds at 200 m concentrations for 16 h, followed by lysis, cuaac with an alkyne - containing rhodamine dye (alk - rho), and analysis by in - gel fluorescent scanning. one of these compounds, ac36azglcnac (figure 1b), gave a protein - labeling pattern that was subjectively similar in both intensity and pattern to ac4glcnaz (figure 2a). to further characterize this mcr, nih3t3 cells were treated with various concentrations of ac36azglcnac or ac4glcnaz for 16 h before reaction with alk - rho. in - gel fluorescence scanning revealed labeling of a wide - range of proteins in concentrations as low as 50 m and maximal labeling achieved at approximately 200 m (figure 2b), consistent with our other mcrs of glycosylation. to examine the toxicity of ac36azglcnac, the viability of nih3t3 cells was measured after treatment with 200 m ac36azglcnac for 16 or 72 h using a mts cell - proliferation assay. only minimal loss of cell growth / survival was seen even after 72 h of treatment (figure 2c). to determine if 6azglcnac could report on o - glcnac modifications, we treated nih3t3 cells with ac36azglcnac (200 m) for 16 h. the cells were then lysed and reacted with an alkyne - containing cleavable affinity tag (alk - azo - biotin, scheme s2 and figures s8s12 (si)) using cuaac. enriched proteins were then subjected to western blotting using antibodies against the known o - glcnac modified proteins nedd4, pyruvate kinase, and nucleoporin 62 (nup62). all three proteins were selectively enriched using 6azglcnac (figure 2d and figure s1 (si)), showing that the mcr does label known o - glcnacylated proteins. (a) nih3t3 cells were treated with ac4glcnaz (200 m), ac36azglcnac (200 m), or dmso vehicle for 16 h, followed by cuaac and analysis by in - gel fluorescence scanning. (b) nih3t3 cells were treated with varying concentrations of ac4glcnaz or ac36azglcnac for 16 h, followed by cuaac and analysis by in - gel fluorescence scanning. (c) nih3t3 cells were treated with ac36azglcnac (200 m), or dmso vehicle for the times indicated and were tested for toxicity using an mts assay. (d) proteins modified by 6azglcnac were enriched from nih3t3 cells treated with ac36azglcnac (200 m) or dmso vehicle using cuaac with alkyne - azo - biotin and analyzed by western blotting. mcrs are enzymatically transformed into their nucleotide sugar - donors by monosaccharide salvage pathways. previous o - glcnac mcrs are thought to largely utilize the glcnac salvage pathway (figure s2a (si)). the first step of this pathway is the phosphorylation of mcrs at the 6-position of the carbohydrate ring by n - acetylglucosamine kinase (gnk). this is followed by enzymatic mutation of the phosphate to the 1-position and conversion to the uridine - diphosphate (udp) sugar donor by n - acetylglucosamine - phosphate mutase (agm1) and uridine - diphosphate - n - acetylglucosamine pyrophosphorylase (agx1/2), respectively. although udp-6azglcnac is known to be accepted by ogt, 6azglcnac can not be phosphorylated at the 6-position, as we have replaced the 6-hydroxyl functionality with an azide. therefore, we first took a candidate - based approach to identify a kinase that could directly phosphorylated 6azglcnac at the 1-position and chose n - acetyl - galactosamine kinase (galk2), which performs this reaction on n - acetylgalactosamine (galnac) and poorly on glcnac. to test this possibility, nih3t3 cells were stably transformed with five different short - hairpin rna vectors targeting galk2 using retroviral infection and then treated with ac36azglcnac (200 m) for 16 h. subsequent cuaac with alk - rho and in - gel fluorescent scanning showed no loss of fluorescent signal, despite a clear reduction of galk2 mrna as measured by semiquantitative rt - pcr (figure s3 (si)), suggesting that galk2 is not the enzyme responsible for 6azglcnac metabolism. to confirm this result, we subjected 6azglcnac (scheme s3a and figures s13s15 (si) for details of synthesis and characterization) to in vitro phosphorylation by recombinant galk2. specifically, galk2 was incubated with 40 mm concentrations of galnac, glcnac, or 6azglcnac and [p]atp (5 mm). at these elevated substrate - concentrations, galk2 readily phosphorylated both galnac and glcnac but gave no detectable modification of 6azglcnac (figure 3a). next, we tested whether phosphoacetylglucosamine mutase (agm1) could directly generate 6azglcnac-1-phosphate. agm1 typically converts glcnac-6-phosphate to glcnac-1-phosphate during the biosynthesis of udp - glcnac. as part of its enzymatic cycle, agm1 removes the 6-phosphate from substrate sugars, resulting in a phosphoenzyme intermediate (figure 3b). therefore, once loaded, phosphorylated agm1 might be capable of phosphorylating 6azglcnac. to test this possibility, the enzyme was then incubated with 6azglcnac (2.25 mm) with or without different cofactors that could generate phosphorylated agm1, specifically glucose-6-phosphate or glucose-1,6-bisphosphate or glcnac-6-phosphate (all at 1 mm). to isolate any 6azglcnac-1-phosphate that had been produced, the enzymatic reactions were first subjected to copper - free click chemistry with a fluorescein - conjugated cyclooctyne tag. fluorescein - labeled compounds (i.e., 6azglcnac and 6azglcnac-1-phosphate) were then separated from the phosphorylated - cofactors by paper chromatography. finally, any fluorescent - spots were eluted and analyzed by mass spectrometry (lc ms, figure s4 (si)). incubation of agm1 with 6azglcnac alone, or with glucose-6-phosphate or glucose-1,6-bisphosphate, resulted in no detectable formation of 6azglcnac-1-phosphate. however, in the presence of glcnac-6-phosphate as a cofactor, the formation of 6azglcnac-1-phosphate was unambiguously detected. this demonstrates that direct phosphorylation of 6azglcnac by agm1 represents one pathway that circumvents the gnk biosynthetic - roadblock. however, because the conversion is very low (< 1% conversion to product based on ion - intensities in esi - ms), agm1 may not be the only enzyme that can produce 6azglcnac-1-phosphate in living cells. we next analyzed the final enzyme in the biosynthetic pathway, udp - n - acetylhexosamine pyrophosphorylase (agx1), by first synthesizing 6azglcnac-1-phosphate (scheme s3b and figures s16s30 (si) for synthetic details and characterization). recombinant agx1 was then incubated with different concentrations of glcnac-1-phosphate or 6azglcnac-1-phosphate and [h]utp. subsequent michaelis menten kinetic analysis demonstrated that 6azglcnac-1-phosphate is a substrate of agx1, although at a significantly lower efficiency than glcnac-1-phosphate (figure 3c). taken together, these data suggest that in living cells 6azglcnac can be directly phosphorylated by agm1 and enter the remainder of the glcnac salvage pathway to generate udp-6azglcnac (figure s2b (si)). (a) the indicated monosaccharides (40 mm concentration) were tested as substrates for purified galk2 in vitro. (b) proposed mechanism by which agm1 directly phosphorylates 6azglcnac in the presence of glcnac-6-phosphate. (c) kinetic constants for the enzymatic production of udp sugar donors from glcnac-1-phosphate and 6azglcnac-1-phosphate by the enzyme udp - n - acetylhexosamine pyrophosphorylase (agx1). next, to explore the generality of 6azglcnac as a mcr, we labeled a panel of different cell lines. specifically, cos-7, h1299, hek293, hela, mcf7, mouse embryonic fibroblasts (mefs), and nih3t3 cells were treated with ac36azglcnac (200 m) for 16 h. in - gel fluorescence scanning after cuaac with alk - rho showed labeling in all the cell lines examined and a diversity of the pattern and intensity of modified proteins (figure 4). to qualitatively compare 6azglcnac to previous mcrs of o - glcnacylation, the same panel of cell lines was treated with 200 m ac4glcnaz or ac4galnaz for 16 h (figure s5 (si)). in - gel fluorescence scanning showed incorporation of previously characterized mcrs in each cell line with varying intensities and patterns, which were more pronouncedly different for galnaz, when compared to 6azglcnac and glcnaz. indicated cell lines were treated with 200 m ac36azglcnac for 16 h before modified proteins were subjected to cuaac with alk - rho and analysis by in - gel fluorescence scanning. as stated above, mcrs only report on modifications that occur during the labeling time, raising the possibility that they can be used to isolate o - glcnacylation events in a short time frame via a pulse - labeling experiment. to determine the kinetics of protein labeling by 6azglcnac, nih3t3 cells were treated with ac36azglcnac (200 m) for different lengths of time. the cells were then lysed, reacted with alk - rho using cuaac, and analyzed by in - gel fluorescence scanning (figure 5a). modified proteins can be clearly visualized over background in 2 to 4 h, slightly slower than the kinetics of protein labeling by ac4glcnaz at 200 m (figure 5a). mcrs also have the ability to read - out on the turnover of protein modifications using a pulse - chase format. accordingly, we treated nih3t3 cells with either ac36azglcnac or ac4glcnaz at concentrations of 200 m. after 16 h, the cells were washed and fresh media containing ac4glcnac (200 m) was added. cells were collected after different lengths of time, lysed, and subjected to cuaac with alk - rho. in - gel fluorescence scanning showed a steady loss of protein labeling over the course of 48 h (figure 5b). o - glcnacase (oga) is responsible for the dynamic removal of o - glcnac from substrate proteins. to demonstrate that 6azglcnac is incorporated into o - glcnacylation and a substrate for oga, cells were first treated with ac36azglcnac (200 m) or dmso for 5 h. media was then exchanged for fresh media containing 200 m ac4glcnac with or without thiamet - g (10 m), a potent and highly selective oga inhibitor. after 12 h, cells were harvested and subjected to cuaac with alk - rho. in - gel fluorescence scanning showed that cells that were treated with thiamet - g maintained higher levels of 6azglcnac labeling compared to those without (figure 5c), demonstrating that 6azglcnac is incorporated into o - glcnac modifications that can be subsequently removed by oga. (a) nih3t3 cells were treated with 200 m ac36azglcnac or ac4glcnaz for the indicated times, followed by cuaac and analysis by in - gel fluorescence scanning. (b) nih3t3 cells were treated with 200 m ac36azglcnac or ac4glcnaz for 16 h, at which time media was exchanged for fresh media containing 200 m ac4glcnac. cells were harvested after the indicated lengths of time, subjected to cuaac, and analyzed by in - gel fluorescence scanning. (c) hela cells were treated with 200 m ac36azglcnac or ac4glcnaz for 5 h, at which time media was exchanged for fresh media containing 200 m ac4glcnac and 10 m of the oga inhibitor thiamet - g or dmso. cells were harvested at the times indicated and subjected to cuaac before being analyzed by in - gel fluorescence scanning. as noted above, previous mcrs of o - glcnacylation are not selective for o - glcnac modifications because they are also incorporated into either n - linked or mucin o - linked glycans or both. to determine if 6azglcnac specifically modifies o - glcnacylated proteins, we first took advantage of the chimeric, secreted protein glycam - igg that contains both an n - linked and multiple mucin o - linked glycosylation sites. nih3t3 cells that stably express glycam - igg via retroviral transformation were treated with ac36azglcnac, ac4glcnaz, or ac4glcnac at 200 m concentrations for 48 h. at this time, glycam - igg was immunoprecipitated from the media using protein - a - conjugated beads. in - gel fluorescence scanning, following cuaac with alk - rho, showed that while glcnaz robustly labels glycam - igg, as expected based on our previous results, 6azglcnac does not (figure 6a and figure s6a (si) for the full - gel image). this demonstrates that while glcnaz does label the major types of cell - surface glycosylation, 6azglcnac does not. next, to confirm that 6azglcnac labels o - glcnacylated proteins, we treated nih3t3 cells that were stably transfected with the flag - tagged transcription factor foxo1 with ac36azglcnac, ac4glcnaz, or ac4glcnac at 200 m concentrations for 24 h. in contrast to glycam - igg, in - gel fluorescence showed that both mcrs robustly labeled foxo1 (figure 6b and figure s6b (si) for the expanded - gel images of replicate experiments), demonstrating that 6azglcnac is a highly selective mcr of o - glcnac modifications. to rule out the possibility that 6azglcnac was excluded from glycam - igg but labeled other cell - surface glycoproteins, nih3t3 cells were treated with ac36azglcnac, ac4glcnaz, or ac4galnaz at 200 m for 16 h before being harvested and submitted to copper - free click chemistry using commercially available dbco - biotin. after subsequent incubation with fitc - conjugated avidin, cell - surface glycoprotein labeling by each chemical reporter was analyzed using flow cytometry. no labeling over background was observed with ac36azglcnac, while labeling was observed with ac4glcnaz and ac4galnaz (figure 6c). notably, this corroborates live - cell flow cytometry data from the bertozzi lab where they used the staudinger ligation to observe some cell - surface labeling with glcnaz and no labeling with 6azglcnac. to identify the proteins labeled by 6azglcnac and compare them to those enriched by the previous mcrs glcnaz and galnaz, nih3t3 cells were treated in triplicate with either ac36azglcnac, ac4glcnaz, ac4galnaz, or ac4glcnac as a control (all at 200 m) for 16 h. at this time cells were lysed using denaturing conditions (4% sds) and subjected to cuaac conditions with an alkyne - bearing biotin tag. equivalent amounts of the differentially labeled proteomes were then reduced, alkylated, and subjected to biotin - enrichment using streptavidin - conjugated beads. after extensive washing to remove unlabeled proteins, on - bead trypsinolysis afforded peptides that were analyzed using lc ms / ms, identified using proteome discoverer and mascot, and quantified by spectral counting. labeled proteins were identified as those that met the following threshold criteria : first, proteins must have been identified by at least 1 unique peptide in each of the three data sets and a total of 3 spectral counts in the sum of three replicate data sets. second, the sum of spectral counts of the mcr - treated samples must be 3-times greater than those in the glcnac labeled samples. finally, the number of spectral counts in the mcr treated sample compared to the control must be statistically significant (p < 0.05, t test). using these criteria, 366 proteins were identified as being labeled by 6azglcnac (table s1 (si)), including many known o - glcnacylated proteins, such as the three annotated in black in figure 6a (map4, nedd4, and hcf1). glcnaz and galnaz labeling identified 359 proteins (table s2 (si)) and 348 proteins (table s3 (si)), respectively. in contrast to 6azglcnac, these lists included both known o - glcnacylated proteins and proteins that are exclusively localized to the extracellular space or the lumen of the secretory pathway and lysosome, such as the three annotated in red in figure 7a (fibronectin, calumenin, and -glucosidase). comparison of the three proteomics lists showed that 6azglcnac has greater overlap with glcnaz than galnaz (figure 7b), consistent with with previous studies that show more efficient incorporation of galnaz versus glcnaz into cell - surface glycoproteins. importantly, many of the proteins that were identified by 6azglcnac have been previously identified in other o - glcnac proteomic studies (see tables s1, s2, and s3 (si) for references). nih3t3 cells stably expressing either glycam - igg (a) or flag - tagged foxo1 (b) were treated with the indicated mcrs or ac4glcnac, followed by immunoprecipitation, cuaac, and analysis by in - gel fluorescence scanning. (c) nih3t3 cells were treated with ac36azglcnac, ac4glcnaz, ac4galnaz, or ac4glcnac (all at 200 m) for 16 h, at which time cells were harvested and subjected to copper - free click chemistry with dbco - biotin. after incubation with fitc - avidin, live - cell surface labeling was analyzed by flow cytometry. we next annotated the proteins in our lists based on their characterized localizations (figure 7c). consistent with specific labeling of o - glcnacylated proteins, 6azglcnac treatment enriched 350 exclusively intracellular proteins (i.e., nuclear, cytosolic, and mitochondrial) and 9 proteins that can be localized to both the cytosol and extracellular space or lumenal compartments (e.g., transmembrane proteins). in contrast, 9 and 72 exclusively extracellular or lumenal proteins were found using glcnaz and galnaz treatment, respectively (figure 7c), reenforcing the data demonstrating the nonspecific labeling of multiple types of glycosylation by glcnaz and galnaz. the use of mcrs for the visualization and identification of protein glycosylation has expanded the ability to investigate these key posttranslational modifications. however, recent evidence from our lab and others has demonstrated that many mcrs of protein glycosylation lack specificity, as they are incorporated into multiple types of glycans. we previously showed that small changes to the chemical structure of mcrs can have a large impact on their distribution into different glycans. following this chemical - optimization theme further, we identified a mcr (6azglcnac) that robustly labeled a variety of proteins in living mammalian cells. using a fluorescent alkyne tag, we compared 6azglcnac to the previous mcr, glcnaz, and demonstrated that 6azglcnac is efficiently incorporated onto proteins allowing visualization in as little as 2 to 4 h after treatment (figure 5a). furthermore, 6azglcnac removal from proteins is dependent on the activity of oga, demonstrating that it is dynamically incorporated into o - glcnacylated proteins (figure 5c). using two reporter proteins, we next showed that while glcnaz labels both secreted glycoproteins and o - glcnacylated proteins, 6azglcnac is specific for o - glcnac modifications (figure 6a and b). this is consistent with our flow cytometry data (figure 6c) and previous reports that both showed essentially no cell - surface labeling by 6azglcnac and that chemically synthesized udp-6azglcnac is a substrate for recombinant o - glcnac transferase. unlike glcnaz, 6azglcnac can not be metabolized to the corresponding udp - sugar donor by the canonical glcnac salvage - pathway (figure s2 (si)), as the first step involves phosphorylation at the 6-hydroxyl of the monosaccharide. therefore, an alternative enzyme must directly phosphorylate 6azglcnac at the 1-hydroxyl to bypass this roadblock. taking a candidate - based approach, we tested galk2 and agm1 in vitro to determine if they could generate 6azglcnac-1-phosphate. we did not observe any product formation using galk2, and knockdown of galk2 in living cells using shrna did not result in reduced protein - labeling by 6azglcnac (figure s3 (si)). notably, however, we found that agm1 is capable of directly generating 6azglcnac-1-phosphate when its normal substrate, glcnac-6-phosphate, is added to the reaction mixture (figures 3b and s4 (si)). (a) nih3t3 cells were treated with ac36azglcnac, ac4glcnaz, ac4galnaz, or ac4glcnac (all at 200 m) for 16 h. at this time, the corresponding cell - lysates were subjected to cuaac with alkyne - biotin, enrichment with streptavidin - coated beads, and on - bead trypsinolysis. ms / ms are graphically presented as total number of positive minus total number of control spectral counts. three known o - glcnacylated proteins are annotated in black, and three known extracellular / lumenal proteins are annotated in red. (b) overlap between proteins identified using 6azglcnac, glcnaz and, galnaz. (c) graphical representation of enriched proteins based on whether their localization is exclusively intracellular (i.e., cytoplasmic, nuclear, or mitochondrial), exclusively extracellular or lumenal (i.e., er, golgi, lysosome), or have domains in both (e.g., transmembrane protein). on the basis of the enzymatic mechanism, we conclude that agm1 removes the phosphate from glcnac-6-phosphate to generate the known phosphoenzyme intermediate, followed by binding of 6azglcnac and phosphorylation of the 1-hydroxyl. this is consistent with the reversible nature of agm1 s activity, where the monosaccharide substrates can bind the active site with either the 1- or 6-hydroxyl groups oriented toward the catalytic serine. however, given the low levels of 6azglcnac turnover by agm1, it is reasonable to assume that additional enzymes may also phosphorylate 6azglcnac in living cells. additionally, we also showed that once 6azglcnac-1-phosphate is formed it can be enzymatically transformed to udp-6azglcnac by agx1 (figure 3c). we do not know if udp-6azglcnac can be epimerized to udp-6azgalnac in cells ; however, even if this metabolite is formed, previous studies by bertozzi and co - workers demonstrated that udp-6azgalnac is not a substrate for the polypeptide - n - acetyl - galactosamine transferases. together, these results suggest an unappreciated metabolic flexibility in mammalian cells. agm1 and potentially other, yet unidentified, small - molecule phosphotransferases may contribute to the salvaging of natural monosaccharides from the environment. furthermore, they have potentially important implications for the metabolism of bacterial or abiotic carbohydrates that would otherwise be assumed to not enter mammalian biosynthetic pathways. finally, our results challenge a dogma in mcr design, which relies on well - established metabolic pathways and directly resulted in the previous dismissal of 6azglcnac as a viable mcr in living cells. to further confirm the specificity of 6azglcnac and demonstrate any advantages over other mcrs previously used to study o - glcnacylated proteins, we performed a proteomics experiment using 6azglcnac, glcnaz, and galnaz in combination with alkyne - biotin and on - bead trypsinolysis (figure 7). we found that enrichment with 6azglcnac resulted in the identification of essentially only intracellular proteins that can not contain glycans (e.g., n - linked or mucin o - linked) that are added in the secretory pathway. this confirms the high degree of specificity of 6azglcnac for o - glcnacylated proteins. consistent with our fluorescence data, glcnaz was less selective, resulting in the enrichment of 28 transmembrane proteins and 9 exclusively extracellular or lumenal proteins. finally, galnaz was the least selective, since it enriched only 226 exclusively intracellular proteins and 72 proteins that are only extracellular or lumenal. we believe that this lack of selectivity is one reason why a recent study using galnaz required subcellular fractionation and two - dimensional electrophoresis to identify the potential o - glcnacylation of the voltage - dependent anion - selective channel protein 2 (vdac2), while the same protein was readily identified by 6azglcnac labeling without any biochemical manipulations (table s1 (si)). this specificity is an improvement over other mcrs that require biochemical manipulations (e.g., cell fractionation) to exclude cell - surface glycoproteins. previous direct comparisons of the selectivity of different glycoprotein mcrs are somewhat limited. the bertozzi lab reported that galnaz has superior o - glcnac labeling efficiency compared to glcnaz due to more efficient metabolic conversion of galnaz to udp - galnaz and subsequent epimerization to udp - glcnaz. our in - gel fluorescence data do not support these data, as glcnaz and galnaz resulted in qualitatively similar levels of protein labeling in a variety of cell lines (figure s5 (si)). interestingly, only a minority of cell lines show similar global - patterns of labeling between glcnaz and galnaz (e.g., mcf7), while most are significantly different. this also is true of 6azglcnac, which often shows different labeling patterns and intensities from both glcnaz and galnaz (figure 4 and figure s5 (si)). this supports our results that each of the mcrs is incorporated into different types of glycoproteins and utilizes independent metabolic enzymes for the generation of the corresponding udp donor sugars. notably, while 6azglcnac is the most selective reporter of o - glcnacylation, it requires longer labeling - times to achieve the same signal - to - noise as glcnaz (figure 5a), highlighting a potential trade - off between labeling efficiency and specificity. however, based on our results, we predict that any bottlenecks in the metabolism of 6azglcnac will not dramatically hamper the visualization and identification of o - glcnacylated proteins. furthermore, the extent of o - glcnacylation and identity of modified proteins has been shown to be dependent on the cellular concentration of udp - glcnac. therefore, it could be advantageous to have limited metabolic conversion of an mcr to minimize the chances of altering the endogenous repertoire of o - glcnacylated proteins, as long as the labeling is above the detection limit. we are currently exploring if different concentrations of mcr treatment change the overall levels of o - glcnacylation. despite the increased labeling efficiency of glcnaz and galnaz compared to 6azglcnac, approximately the same total number of spectral counts were found in our comparative proteomics experiment. we believe that this could be due to an excess of input that exceeded the capacity of the streptavidin beads, resulting in equal total levels of protein enrichment prior to trypsinolysis and identification. coupled with the ever - growing toolkit of commercially available and custom azide - reactive tags, including terminal alkynes, cyclooctynes, and phosphines, we predict that 6azglcnac will become the most powerful and readily used mcr for the study of o - glcnacylation. in particular, metabolic labeling strategies have the unique ability to isolate time - resolved protein modifications that only occur during cell labeling. furthermore, mcrs can be used in pulse - chase experiments to measure the dynamic removal of o - glcnac modifications in living cells. finally, the successful application of synthetic chemistry to identify a selective mcr of o - glcnacylation suggests that the same chemical strategy could be used to create reporters that are specific for other types of protein glycosylation. coupled with new bioorthogonal reactions (e.g., tetrazene clycoadditions), which enable more diverse functional groups to be incorporated into mcrs, we predict that a library of mcrs can be created to enable the specific visualization and identification of the several types of glycosylation in mammals and other organisms. all reagents used for chemical synthesis were purchased from sigma - aldrich, alfa aesar or emd millipore unless otherwise specified and used without further purification. analytical thin - layer chromatography (tlc) was conducted on emd silica gel 60 f254 plates with detection by ceric ammonium molybdate (cam), anisaldehyde or uv. for flash chromatography, h spectra were obtained at 400, 500, or 600 mhz on a varian spectrometers mercury 400, vnmrs-500, or -600. c spectra were obtained at 100, 125, or 150 mhz on the same instruments. cos-7, hek293, hela and mcf7 cells were cultured in dmem media (corning) enriched with 10% fetal bovine serum (atlanta biologicals). amphopack-293 retroviral packaging cells (clontech) were cultured in dmem media (corning) enriched with 10% fetal bovine serum (hyclone, thermoscientific). nih3t3 and mef cells were cultured in high - glucose dmem media (corning) enriched with 10% fetal calf serum (hyclone, thermoscientific). h1299 cells were cultured in rpmi media enriched with 10% fetal bovine serum (hyclone, thermoscientific). all cell lines were maintained in a humidified incubator at 37 c and 5.0% co2. to cells at 8085% confluency, media containing ac4glcnac, ac4glcnaz, ac4galnaz, ac36azglcnac (1000 stock in dmso), or dmso vehicle was added as indicated. for chase experiments, existing media was replaced with media supplemented with 200 m ac4glcnac (sigma) or 200 m ac4glcnac (sigma) plus 10 m thiamet - g (1000 x stock in dmso) as indicated. the cells were collected by trypsinization and pelleted by centrifugation at for 4 min at 2000 g, followed by washing 2 with pbs (1 ml). cell pellets were then resuspended in 100 l of 1% np-40 lysis buffer [1% np-40, 150 mm nacl, 50 mm triethanolamine (tea) ph 7.4 ] with complete, mini, edta - free protease inhibitor cocktail tablets (roche) for 20 min and then centrifuged for 10 min at 10 000 g at 4 c. the supernatant (soluble cell lysate) was collected and the protein concentration was determined by bca assay (pierce, thermoscientific). cell lysate (200 g) was diluted with cold 1% np-40 lysis buffer to obtain a desired concentration of 1 g l. newly made click chemistry cocktail (12 l) was added to each sample [alkynyl - rhodamine tag (100 m, 10 mm stock solution in dmso) ; tris(2-carboxyethyl)phosphine hydrochloride (tcep) (1 mm, 50 mm freshly prepared stock solution in water) ; tris[(1-benzyl-1-h-1,2,3-triazol-4-yl)methyl]amine (tbta) (100 m, 10 mm stock solution in dmso) ; cuso45h2o (1 mm, 50 mm freshly prepared stock solution in water) for a total reaction volume of 200 l. the reaction was gently vortexed and allowed to sit at room temperature for 1 h. upon completion, 1 ml of ice cold methanol was added to the reaction, and it was placed at 20 c for 2 h to precipitate proteins. the reactions were then centrifuged at 10 000 g for 10 min at 4 c. the supernatant was removed, the pellet was allowed to air - dry for 15 min, and then 50 l 4% sds buffer (4% sds, 150 mm nacl, 50 mm tea ph 7.4) was added to each sample. the mixture was sonicated in a bath sonicator to ensure complete dissolution, and 50 l of 2 sds - free loading buffer (20% glycerol, 0.2% bromophenol blue, 1.4% -mercaptoethanol, ph 6.8) was then added. the samples were boiled for 5 min at 97 c, and 40 g of protein was then loaded per lane for sds - page separation (any kd, criterion gel, bio - rad). following sds - page separation, gels were scanned on a typhoon 9400 variable mode imager (ge healthcare) using a 532 nm for excitation and 30 nm bandpass filter centered at 610 nm for detection. pcr was conducted in an eppendorf mastercycler thermocycler. to a 0.2 ml thermo - walled pcr tube was added 2 reaction mix (superscript one - step rt - pcr with platinum taq, invitrogen), template rna from nih3t3 cells (1000 ng), sense and antisense primers for galk2 (10 m), sense and antisense primers for gapdh (10 m), water, and taq enzyme (superscript one - step rt - pcr with platinum taq, invitrogen). the provided pcr cycle was used according to superscript one - step rt - pcr with platinum taq (invitrogen) with an extension time of 32 s (1 min / kbp). products were diluted with 6 sample loading dye (bio - rad) and analyzed by electrophoresis on a 5% agarose gel (500 mg of agarose in 1 tae buffer, tris / acetic acid / edta, bio - rad). the gel was subsequently visualized using a chemidoc xrs+ molecular imager (bio - rad). recombinant galk2 (8 g ml) was incubated in triplicate with galnac, glcnac or 6azglcnac (40 mm) in 25 l reaction buffer (10 mm mgcl2, 50 mm tris hcl ph 8.0) containing 1 mg / ml bsa and 5 mm [p]atp (1000 cpm / nmol) for 60 min at 37 c. after this time, reactions were terminated by the addition of water (0.75 ml) and applied to a dowex 1 8 (cl-) column (0.7 cm 3.0 cm). unreacted starting material was eluted by washing with 2 ml of 25 mm nh4hco3 before eluting the sugar-1-phosphates with 100 mm nh4hco3. the fractions (2 ml) were counted in a liquid scintillation counter (beta, perkinelmer). column profiles were compared to detect the presence of overlapping radioactive peaks corresponding to degradation products. if present, these peaks were subtracted from the assay chromatogram. homo sapiens phosphoacetylglucosamine mutase 3 (agm1/pgm3) cdna was obtained from biovalley (marne - la - valle, france), amplified by pcr, sequenced and cloned in ptrchis a (invitrogen). the 6his - tagged pgm3 protein was expressed in escherichia coli dh5 (invitrogen) cultured for 24 h at 18 c in 2ty medium supplemented with 1 mm iptg and 2 mm mgcl2. bacteria were lysed in y - per (thermoscientific) and the lysate diluted with 5 volumes of 50 mm phosphate buffer ph 8.0, 300 mm nacl, 10 mm imidazole, 0.1 mm pmsf and 0.1 mm tcep. after application of the lysate on a histrap ff 5 ml column (ge healthcare), agm1 was eluted with 250 mm imidazole in 25 mm phosphate buffer ph 8.0, 150 mm nacl, 0.1 mm tcep. agm1 activity was checked in a coupled assay by 2 h incubation at 37 c with glcnac-6-phosphate (2 mm), in 75 mm tris hcl ph 8.8, 5 mm mgcl2, containing 0.1 mg bsa and 2 l of the pgm3 enzyme solution, and coupling with agx1 (0.66.3 g ml, 2.222 mu ml) and yeast inorganic pyrophosphatase (1.6 g ml, 3 u ml) in the presence of [h]utp (perkinelmer, 2 mm, 260 cpm nmol). after agm1/agx1/yeast inorganic phosphatase heat denaturation, calf intestinal alkaline phosphatase (neb, 80 u ml) was added in order to hydrolyze all the utp and udp present, and the products were monitored as described below for agx1 enzymatic tests (separation on paper chromatography). finally, the production of udp - glcnac was estimated by scintillation counting. under these conditions, the recombinant agm1 activity was estimated to 20 nmol h g of the agm1 enzyme solution. 6azglcnac (2.25 mm final concentration) was incubated in 100 l of 75 mm tris hcl ph 8.8, 5 mm mgcl2, containing 0.1 mg bsa and 10 g of the pgm3 enzyme solution. incubations were run at 37 c for 1 h 30 min either without cofactor or in the presence of glc-6p, glc1,6-dip or glcnac-6p (1.00 mm final concentration). after thawing, the reaction mixtures were incubated for 1 h at 37 c with bicyclo[6.1.0]nonyne-(poe)3-nh - dye495 conjugate (synaffix, oss, netherlands). the reaction mixtures which contain the azido sugars coupled through their azido moiety to the bcn fluorescent dye495, were then laid onto a 46 57 cm sheet of whatman 3 mm paper (ge healthcare) and run for descending chromatography in ethyl acetate / formic acid / water (70:20:10) for 5 h. after drying, fluorescent spots (rf 0.8) were cut out and the products eluted from the paper in 50% methanol. (0.66.3 g ml, 2.222 mu ml) was incubated with glcnac-1p or 6azglcnac-1p in 25 l reaction buffer (1 mm mgcl2, 75 mm tris hcl ph 8.8) containing 1 mg ml bsa and 2 mm [h]utp (260 cpm nmol) for 10 min at 37 c. yeast inorganic pyrophosphatase (1.6 g ml, 3 mu ml) was also added to inhibit the reverse reaction. to hydrolyze excess utp and ump, calf intestinal alkaline phosphatase (new england biolabs, 80 u / ml) was added to the reaction mixture and incubated for 2 h at 37 c. the reaction was spotted onto whatman 3 mm chromatography paper and submitted to descending chromatography in ethyl acetate / formic acid / water (70:20:10) to remove [h]uridine (rf = 0.25). spots with [h]udp - sugars (rf = 0.01) were cut out of the chromatography paper and counted in a liquid scintillation counter. control samples without sugar-1p received the same treatment in order to deduct background radioactivity. km and kcat were calculated using the enzyme kinetic module 1.3 of sigmaplot 10, from plots obtained with different concentrations of sugar-1p and different amounts of agx1. nih3t3 cells were pretreated with 200 m ac36azglcnac or dmso for 72 h prior to plating. nih-3t3 cells (1 10 cells) were plated per well in a 96-well, white bottom dish 24 h before treatment with 200 m ac4glcnac or ac36azglcnac for 16 h in triplicate. celltiter 96 aqueous non - radioactive cell proliferation assay (promega, madison, wi) was used according to the provided protocol. absorbance at 490 nm was read using a biotek synergy h4multi - mode microplate reader. nih3t3 cells grown in 6-well plates at 8085% confluency were treated with 200 m ac4glcnac, ac4glcnaz, ac4galnaz or ac36azglcnac in triplicate for 16 h at which time media was removed and cells were gently washed with pbs before being detached from the plate with 1 mm edta in pbs. cells were collected by centrifugation (5 min, 300 g at 4 c) and were washed three times with pbs (5 min, 300 g at 4 c). cells were then resuspended in 200 l pbs containing dbco - biotin (click chemistry tools, 60 m) for 1 h, after which time they were washed three times with pbs (5 min, 300 g at 4 c) before being resuspended in ice - cold pbs containing fluorescein isothiocynate (fitc) conjugated avidin (sigma, 5 g / ml, 30 min at 4 c). cells were then washed three times in pbs (5 min, 300 g at 4 c) before being resuspended in 400 l pbs for flow - cytometry analysis. a total of 10 000 cells [dead cells were excluded by treatment with propidium iodide (2.5 g ml in water, 30 min) ] were analyzed on a bd sorp lsrii flow cytometer using the 488 nm argon laser. nih3t3 cells stably expressing flag - tagged foxo1 were treated with 200 m ac4glcnaz, ac36azglcnac (1000 x stock in dmso) or dmso and allowed to incubate overnight. cell pellets were resuspended in 100 l of 1% np-40 lysis buffer [1% np-40, 150 mm nacl, 50 mm triethanolamine (tea) ph 7.4 ] with complete mini, edta - free protease inhibitor cocktail tablets (thermo scientific) for 20 min and then centrifuged at 4 c for 10 min at 10 000 g. the supernatant was collected and the protein concentration was determined by bca assay (pierce, thermoscientific). total cell lysate (1.5 mg) was diluted as necessary to a final volume of 1 ml with 1% np-40 buffer with complete mini, edta - free protease inhibitor cocktail tablets (thermo scientific). ezview red anti - flag m2 affinity beads (30 l, sigma), prewashed with cold np-40 buffer 2 followed by cold pbs 2, were added to each sample. beads were collected by centrifugation at 2000 g for 2 min at 4 c, and the supernatant was carefully removed. beads were then washed with cold pbs by rotating for 5 min before centrifuging 2 min at 2000 g. the final pbs wash was carefully removed, and the beads were suspended in 40 l of 4% sds buffer and boiled for 5 min at 97 c. the appropriate amount of click chemistry cocktail was added, and the reaction was allowed to proceed for 1 h after which time 30 l of 2 loading buffer was added. protein samples (40 g) were then loaded per lane for sds - page separation (any kd criterion gel, bio - rad) and imaged by in - gel fluorescence scanning. nih3t3 cells stably expressing glycam - igg in 6-well dishes at 8085% confluency were treated in dmem with 10% fcs and 200 m ac4glcnaz, ac36azglcnac (1000 stock in dmso) or dmso for 24 h. the media from each sample was collected by centrifugation at 3000 g for 10 min at 4 c to remove cell debris. the supernatant (1 ml) was incubated with 50 l of recombinant protein g sepharose beads (invitrogen) in 100 mm tea ph 8 overnight. beads were collected by centrifugation at 2000 g for 2 min at 4 c. glycam - ig was eluted by addition of 50 l of 4% sds buffer (4% sds, 150 mm nacl, 50 mm tea ph 7.4) and boiling for 5 min at 97 c. final sds concentration was diluted to 0.5% by addition of 50 mm tea ph 7.4. the appropriate amount of click chemistry cocktail was added and the reaction was allowed to proceed for 1 h after which time 4 loading buffer (200 mm tris hcl, 4% sds, 40% glycerol, 0.4% bromophenol blue, 1.4% -mercaptoethanol, ph 6.8) was added. samples were boiled for 5 min at 97 c, and 50 g were loaded for sds - page separation (any kd criterion gel, bio - rad). proteins were separated by sds - page before being transferred to pvdf membrane (bio - rad) using standard western blotting procedures. all western blots were blocked in tbst (0.1% tween-20, 150 mm nacl, 10 mm tris ph 8.0) containing 5% nonfat milk for 1 h at rt. the blots were then incubated with the appropriate primary antibody in blocking buffer for 1 h at rt. the anti - flag antibody (thermo) and anti - mab414 antibody (covance) were used at a 1:5000 dilution and 1:1000 for detection of foxo1 and p62, respectively. the anti - nedd4 antibody (millipore) was used at a 1:10 000 dilution to detect nedd4 and the anti - pyruvate kinase antibody (abcam) was used at 1:1000. the blots were then washed three times in tbst for 10 min and incubated with the horseradish peroxidase (hrp)-conjugated secondary antibody for 1 h in blocking buffer at rt. hrp - conjugated antimouse, antirabbit, antigoat and antihuman antibodies (jackson immunoresearch) were used at 1:10 000 dilutions. after being washed three more times with tbst for 10 min, the blots were developed using ecl reagents (bio - rad) and the chemidoc xrs+ molecular imager (bio - rad). nih3t3 cell - pellets labeled with ac36azglcnac, ac3glcnaz, ac3galnaz or ac4glcnac for 16 h were resuspended in 200 l h2o, 60 l pmsf in h2o (250 mm), and 500 l of 0.05% sds buffer (0.05% sds, 10 mm tea ph 7.4, 150 mm nacl) with complete mini protease inhibitor cocktail (roche biosciences). to this was added 8 l benzonase (sigma), and the cells were incubated on ice for 30 min. then, 4% sds buffer (2000 l) was added, and the cells were briefly sonicated in a bath sonicator followed by centrifugation (20 000 g for 10 min at 15 c). soluble protein concentration was normalized by bca assay (pierce, thermoscientific) to 1 mg ml, and 10 mg of total protein was subjected to the appropriate amount of click chemistry cocktail containing alkyne - peg3-biotin (5 mm, click chemistry tools) for 1 h, after which time 10 volumes of ice - cold meoh were added. precipitated proteins were centrifuged at 5200 g for 30 min at 0 c and washed 3 times with 40 ml of ice - cold meoh, with resuspension of the pellet each time. the pellet was then air - dried for 1 h. to capture the biotinylated proteins by streptavidin beads, the air - dried protein pellet was resuspended in 2 ml of resuspension buffer (6 m urea, 2 m thiourea, 10 mm hepes ph 8.0) by bath sonication. to cap cysteine residues, 100 l of freshly made tcep (200 mm stock solution, thermo) was then added and the mixture incubated for 30 min, followed by 40 l of freshly prepared iodoacetamide (1 m stock solution, sigma) and incubation for a further 30 min in the dark. steptavadin beads (250 l of a 50% slurry per sample, thermo) were washed 2 with 1 ml pbs and 1 with 1 ml of resuspension buffer and resuspended in resuspension buffer (200 l). each sample was combined with streptavadin beads and incubated on a rotator for 2 h. these mixtures were then transferred to mini bio - spin columns (bio - rad) and placed on a vacuum manifold. captured proteins were then washed with agitation 5 with resuspension buffer (10 ml), 5 pbs (10 ml), 5 with 1% sds in pbs (10 ml), 30 with pbs (1 ml per wash, vacuum applied between each wash), and 5 2 m urea in pbs (1 ml per wash, vacuum applied between each wash). beads were then resuspended in 2 m urea in pbs (1 ml), transferred to screw - top tubes, and pelleted by centrifugation (2000 g for 2 min). at this time, 800 l of the supernatant was removed, leaving a volume of 200 l. to this bead - mixture was added 2 l of cacl2 (200 mm stock, 1 mm final concentration) and 2 l of 1 mg ml sequence grade trypsin (promega) and incubated at 37 c for 18 h. the resulting mixtures of tryptic peptides and beads were transferred to mini bio - spin columns (bio - rad) and the eluent was collected by centrifugation (1000 g for 2 min). any remaining peptides were eluted by addition of 100 l of 2 m urea in pbs followed by centrifugation as immediately above. the tryptic peptides were then applied to c18 spin columns (pierce) according to manufacturer s instructions, eluted with 70% acetonitrile in h2o, and concentrated to dryness on a speedvac. peptides were desalted on a trap column following separation on a 12 cm/75um reversed phase c18 column (nikkyo technos co., ltd. japan). a 3 h gradient increasing from 10% b to% 45% b in 3 h (a : 0.1% formic acid, b : acetonitrile/0.1% formic acid) was delivered at 150 nl min. the liquid chromatography setup (dionex, boston, ma, usa) was connected to an orbitrap xl (thermo, san jose, ca, usa) operated in top-5-mode. acquired tandem ms spectra (cid) were extracted using proteomediscoverer v. 1.3 (thermo, bremen, germany) and queried against the human uniprot protein database using mascot 2.3.02 (matrixscience, london, uk). all lc ms / ms analysis were carried out at the proteomics resource center at the rockefeller university, new york, ny, usa. excel files containing identified proteins will be made available upon request. the fluorescent detection tag alk - rho and the oga inhibitor thiamet - g were also synthesized according to published procedures. commercially available n - acetyl - glucosamine (1.00 g, 4.52 mmol) was dissolved in anhydrous pyridine under nitrogen and cooled to 20 c. p - toluenesulfonyl chloride (1.04 g, 5.43 mmol) was dissolved in anhydrous pyridine (3 ml), and the solution was added dropwise over 20 min to the above reaction mixture. upon completion of the addition, the reaction was warmed to rt and stirred for 18 h. the mixture was concentrated by vacuum and used without further purification. compound 1 was resuspended in n, n - dimethylformamide (20 ml) under a nitrogen atmosphere. sodium azide (1.47 g, 22.6 mmol) was added and the reaction was stirred for 3 d at 50 c. the reaction mixture was then concentrated by vacuum and resuspended in pyridine (30 ml). acetic anhydride (10.0 ml, 66.0 mmol) was added and the mixture was stirred for 16 h at rt. upon completion, solvent was removed under reduced pressure and the resulting mixture was redissolved in ch2cl2 (200 ml) and washed with 1 m hcl (2 100 ml), saturated aqueous sodium bicarbonate (2 100 ml) and water (2 100 ml). the resulting crude mixture was purified by column chromatography (65% ethyl acetate in hexanes) to afford 1.01 g of the product in 60% yield over three steps as an alpha - beta mixture : h nmr (400 mhz, cd3od) of pure alpha - anomer (ppm) 6.18 (d, j = 3.7 hz, 1h), 5.61 (d, j = 8.9 hz, 1h), 5.255.10 (m, 2h), 4.46 (ddd, j = 10.9, 9.0, 3.7 hz, 1h), 3.943.92 (m, 1h), 3.383.32 (m, 1h), 3.29 (dd, j = 13.5, 5.5 hz, 1h), 2.19 (s, 3h), 2.04 (d, j = 1.3 hz, 6h), 1.92 (s, 3h). hydroquinone (11.0 g, 0.910 mmol) and propargyl chloride (7.50 g, 0.101 mmol) were dissolved in ethanol (20 ml) under an argon atmosphere in a three - neck flask equipped with an addition funnel. koh (0.10 m in water) was added dropwise through the addition funnel. the mixture was then stirred for 20 h upon which time the reaction was cooled and solvent was removed by vacuum. the resulting crude mixture was dissolved in ch2cl2 and extracted with dilute, aqueous koh. the aqueous layer was then brought to a neutral ph by the addition of 1 m hcl and subsequently extracted with ch2cl2. the organic layer was washed with water and dried over sodium sulfate, filtered and concentrated. the crude mixture was purified by column chromatography (10% ethyl acetate : hexanes) to afford the pure product (4.07 g, 28%) : h nmr (400 mhz, cdcl3) (ppm) 6.85 (dd, j = 9.1, 1.1 hz, 2h), 6.78 (d, j = 9.0 hz, 2h), 4.61 (dd, j = 2.4, 1.0 hz, 2h), 2.50 (t, j = 2.4 hz, 1h). to a suspension of methyl-4-amino - benzoate in 6 m hcl was added sodium nitrite at 0 c. compound 3 (1.30 g, 18.9 mmol) was dissolved in water : thf (2:1) and cooled to 0 c. potassium carbonate (52.0 g, 376 mmol) was added and reaction let stir for 30 min upon which time 4-(methoxycarbonyl)benzenediazonium chloride was added dropwise. the reaction was allowed to warm to rt and was stirred for 18 h. the reaction was poured over water and extracted with ethyl acetate (3 200 ml). the organic layer was dried over sodium sulfate, filtered, and concentrated. the resulting crude mixture was purified by column chromatography by first starting at 10% ethyl acetate : hexanes and increasing to 20% ethyl acetate : hexanes to elute the product. concentration under decreased pressure affords the product as a yellow oil (2.00 g, 90%) : h nmr (400 mhz, cdcl3) (ppm) 8.20 (d, j = 8.5 hz, 2h), 7.92 (d, j = 8.6 hz, 2h), 7.56 (d, j = 3.1 hz, 1h), 7.10 (dd, j = 9.1, 3.1 hz, 1h), 7.00 (d, j = 9.1 hz, 1h), 4.75 (d, j = 2.3 hz, 2h), 3.97 (s, 3h), 2.56 (t, j = 2.4 hz, 1h) ; c nmr (125 mhz, cdcl3) (ppm) 166.25, 153.08, 150.83, 148.27, 137.01, 131.92, 130.80, 130.17, 128.36, 123.68, 122.02, 119.17, 111.60, 78.41, 75.86, 56.77, 52.38 ; maldi - ms calculated for c17h15n2o3 [m + h ] 295.1083, found 293.9045. compound 4 (0.124 g, 0.421 mmol) was dissolved in tetrahydrofuran (2 ml). naoh (0.758 mg, 1.90 mmol) dissolved in water was added and reaction let stir 18 h. upon completion, a color change from purple to orange is seen. the reaction was neutralized by the dropwise addition of acetic acid and subsequently concentrated under reduced pressure to remove solvent. the resulting crude mixture was dissolved in ch2cl2 and washed with water (2 50 ml). the crude mixture was column purified (8:1.5:0.5 ethyl acetate : methanol : water) to afford the pure product as a bright orange solid (0.825 g, 70%) : h nmr (600 mhz, cd3od) (ppm) 8.05 (d, j = 8.5 hz, 2h), 7.85 (d, j = 8.5 hz, 2h), 7.46 (d, j = 3.0 hz, 1h), 7.01 (dd, j = 9.2, 3.0 hz, 1h), 6.88 (d, j = 8.9 hz, 1h), 4.68 (d, j = 2.3 hz, 2h), 2.87 (t, j = 2.4 hz, 1h) ; c nmr (125 mhz, cd3od) (ppm) 216.29, 178.12, 162.96, 160.46, 160.22, 148.17, 146.80, 140.14, 132.53, 132.07, 129.05, 115.05, 89.05, 88.03, 65.94, 40.41 ; maldi - ms calculated for c16h12n2o3na [m + na ] 303.0740, found 302.9541. to a solution of 5 (0.180 g, 0.642 mmol) in thf under argon was added n - hydroxysuccinimide (0.177 g, 1.54 mmol) and n, n-dicyclohexylcarbodiimide (0.317 g, 1.54 mmol). the reaction was let stir for 18 h at rt at which time the reaction was concentrated by vacuum. the mixture was dissolved in ethyl acetate and filtered to remove solids. the flow - through was concentrated and the crude product was purified by column chromatography (1:10 ethyl acetate : ch2cl2) to afford the product as a dark red solid that was used in the subsequent reaction without further purification. compound 6 (0.040 g, 0.101 mmol) was dissolved in anhydrous n, n-dimethylformamide (1 ml) under argon. ez - link amine peg3-biotin (0.460 mg, 0.111 mmol) (thermo scientific) was added and reaction let stir for 18 h upon which time solvent was removed by vacuum. the resulting crude mixture was purified by rp - hplc over a c18 semipreparative column (the nest group) using a 5.544% b linear gradient over 10 min before switching to a 44100% b linear gradient over 40 min, tr = 18 min (buffer a : 0.1% tfa in water, buffer b : 0.1% tfa, 90% acn in water) and lyophilized to afford the pure product as an orange solid (0.022 g, 31%) : maldi - ms calculated for c34h40n6o8s (oxidized at the biotin cysteine) [m + na ] 719.2839, found 719.2656. commercially available 2-deoxy-2-n - acetyl - glucopyranose (2.50 g, 11.3 mmol) was coevaporated from toluene and dissolved in anhydrous pyridine (20 ml). p - toluenesulfonyl chloride (2.59 g, 13.6 mmol) was then dissolved is anhydrous pyridine (5 ml) and added dropwise to the stirring mixture. upon completion of addition, the reaction was allowed to warm to room temperature and stirred for 16 h under an argon atmosphere. to purify, the reaction was concentrated under reduced pressure and the crude mixture purified by column chromatography (7:1:0.5 ethyl acetate : methanol : water) to afford the product as a yellow oil (1.78 g) : h nmr (500 mhz, cd3od) -anomer 7.74 (d, j = 8.3 hz, 2h), 7.26 (d, j = 8.2 hz, 2h), 5.13 (d, j = 3.6 hz, 1h), 3.99 (m, 1h), 3.90 (dd, j = 2.2, 10.6 hz, 1h), 3.73 (m, 1h), 3.55 (dd, j = 3.2, 13.3 hz, 1h), 3.44 (dd, j = 5.4, 12.6 hz, 1h), 3.38 (m, 1h), 2.39 (s, 3h), 2.01 (s, 3h). the product was used in the subsequent reaction with no further characterization. compound 8 (1.78 g, 4.73 mmol) was coevaporated from toluene and dissolved in anhydrous n, n-dimethylformamide (20 ml). sodium azide (1.54 g, 23.7 mmol) was then added and the reaction warmed to 50 c. the reaction was stirred for 3 d after which time the reaction was cooled and concentrated under reduced pressure. the crude mixture was purified by silica gel chromatography (9:1:0.5 ethyl acetate : methanol : water) to afford the product as a white solid (402 mg, 14% yield over 2 steps). the sugar was further purified by rp - hplc over a c18 semipreparative column (the nest group) using a 515% b linear gradient over 10 min, tr = 2.5 min (buffer a : 0.1% tfa in water, buffer b : 0.1% tfa, 90% acn in water) : h nmr (500 mhz, (cd3)2so) -anomer 7.69 (d, j = 8.3 hz, 1h), 4.94 (app s, 1h), 3.78 (m, 1h), 3.62 (m, 1h), 3.50 (m, 2h), 3.37 (m, 1h), 3.10 (app t, j = 9.2 hz, 1h), 1.83 (s, 3h) ; c nmr (125 mhz,(cd3)2so) -anomer 169.39, 90.77, 71.85, 70.52, 70.17, 54.21, 51.60, 22.67. the procedure was adapted from literature. commercially available 2-deoxy-2-n - acetyl - glucopyranose (5.00 g, 22.6 mmol) was suspended in benzyl alcohol (50 ml) and concentrated hcl was added (1 ml). the solution was warmed to 75 c and stirred for 4 h after which time the reaction was cooled and poured into diethyl ether (400 ml) with vigorous stirring. a white precipitate was observed and the mixture left at 4 c for 16 h. the precipitate was then filtered and washed with diethyl ether (50 ml) to remove remaining benzyl alcohol. the filtrated was dried and recrystallized in a minimal amount of isopropanol to afford the product as white solid (2.48 g, 7.98 mmol, 35% yield) : h nmr (500 mhz, (cd3)2so) 7.82 (d, j = 8.2 hz, 1h), 7.387.28 (m, 5h), 4.71 (d, j = 3.5 hz, 1h), 4.68 (d, j = 12.5 hz, 1h), 4.31 (d, j = 12.5 hz, 1h), 3.80 (q, j = 6.1 hz, 1h), 3.703.64 (m, 2h), 3.553.47 (m, 2h), 3.18 (t, j = 9.02 hz, 1h), 1.83 (s, 3h). compound 10 (2.36 g, 7.58 mmol) was coevaporated from toluene and dissolved in anhydrous pyridine (20 ml) under an argon atmosphere. the mixture p - toluenesulfonyl chloride (1.74 g, 9.10 mmol), freshly rescrystallized from ch2cl2, was dissolved in pyridine (7 ml) and added dropwise over 20 min. the reaction was stirred at 20 c for 1 h and the dry ice bath replaced with an ice bath. the reaction was allowed to warm to room temperature over 16 h. upon completion, the mixture was concentrated to remove pyridine and purified over silica gel (9:1:0.5 etoac : methanol : water) to afford product (1.85 g, 3.97 mmol, 52% yield) : h nmr (500 mhz, cd3od) 7.85 (d, j = 10.4 hz, 2h), 7.46 (d, j = 1.1 hz, 2h), 7.36 (m, 5h), 4.76 (d, j = 4.5 hz, 1h), 4.65 (d, j = 15 hz, 1h), 4.45 (d, j = 14.8 hz, 1h), 4.36 (dd, j = 2.6, 13.6 hz, 1h), 4.27 (dd, j = 7.3, 13.6 hz, 1h), 3.88 (dd, j = 4.6, 13.5 hz, 1h), 3.813.78 (m, 1h), 3.713.66 (m, 1h), 3.353.31 (m, 1h), 2.46 (s, 3h), 1.97 (s, 3h). compound 11 (1.85 g, 3.97 mmol) was resuspended in pyridine (20 ml) and acetic anhydride (1.12 ml, 11.01 mmol). the reaction was stirred for 3 h at room temperature after which time the reaction mixture was concentrated and purified over silica gel (75% etoac in hexanes) to afford product in quantitative yield (2.18 g, 3.97 mmol) : h nmr (500 mhz, cdcl3) 7.79 (d, j = 10.3 hz, 2h), 7.377.29 (m, 7h), 5.63 (d, j = 11.9 hz, 1h), 5.20 (dd j = 11.7, 13.5 hz, 1h), 4.96 (t, j = 12.1 hz, 1h), 4.82 (d, j = 4.6 hz, 1h), 4.67 (d, j = 14.7 hz, 1h), 4.44 (d, j = 14.8 hz, 1h), 4.26 (td, j = 4.6, 12.6 hz, 1h), 4.07 (d, j = 5.0 hz, 2h), 4.044.00 (m, 1h), 2.44 (s, 3h), 1.98 (d, j = 2.6 hz, 6h), 1.86 (s, 3h). procedure adapted from published literature. pd(oh)2/c (10% pd) was added and a balloon of h2 was attached. the reaction was monitored by tlc (75% etoac in hexanes) and stirred for 48 h to completion. the mixture was then filtered over a pad of celite and the flow - through evaporated to yield the product (710 mg, 1.55 mmol) that was used in subsequent reactions with no further characterization. compound 13 (629 mg, 1.37 mmol) was coevaporated with toluene and resuspended in ch2cl2 (10 ml) under an argon atmosphere. 5-(ethylthio)-1h - tetrazole (1.07 g, 8.22 mmol) was added and the reaction stirred for 15 min. diallyl - n, n-diisopropylphosphoramidite (1.00 g, 4.11 mmol) was added dropwise, and the reaction stirred for 2 h until completed as determined by tlc (5% methanol in ch2cl2). at this time, the reaction was cooled to 78 c and freshly recrystallized m - chloroperoxybenzoic acid was added (1.18 g, 6.85 mmol). the reaction was allowed to proceed for 10 min after which time the dry ice bath was replaced with an ice bath, and the reaction was slowly warmed to room temperature over 1 h. upon completion, the reaction was diluted with ch2cl2 (50 ml) and washed 2 each with saturated sodium thiosulfate, saturated sodium bicarbonate, water and brine. the organic layer was then concentrated and purified over silica gel (35%45% acetone in hexanes) to afford the product (717 mg,74% yield over 2 steps) : h nmr (500 mhz, cdcl3) 7.70 (d, j = 8.4 hz, 2h), 7.29 (d, j = 7.8 hz, 2h), 6.06 (d, j = 9.4 hz, 1h), 5.935.82 (m, 2h), 5.54 (dd, j = 3.3, 6.3 hz, 1h), 5.32 (ddd, j = 17.1, 12.3, 1.4 hz, 2h), 5.23 (ddd, j = 10.6, 9.6, 1.2 hz, 1h), 5.12 (dd, j = 10.9, 9.4 hz, 1h), 4.96 (dd, j = 10.3, 9.5 hz, 1h), 4.544.49 (m, 3h), 4.254.21 (m, 1h), 4.194.15 (m, 1h), 4.04 (dd, j = 11.1, 2.6 hz, 1h), 3.98 (dd, j = 11.1, 5.1 hz, 1h), 2.39 (s, 3h), 1.94 (s, 3h), 1.93 (s, 3h), 1.86 (s, 3h) ; c nmr (125 mhz, cdcl3) 171.08, 170.31, 169.06, 145.21, 132.23, 132.12, 132.07, 131.91, 131.86, 129.86, 128.05, 119.06, 118.93, 95.65, 95.60, 69.73, 69.37, 68.79, 67.67, 66.99, 51.69, 51.63, 22.87, 21.63, 20.58, 20.45 ; p nmr (500 mhz, cdcl3) 2.77 ; apci - hrms calculated for c25h34no13psna [m + na ] 642.1488, found 642.1398 compound 14 (669 mg, 1.08 mmol) was resuspended is methanol (10 ml). the reaction was monitored by tlc (10% methanol in ch2cl2) and was determined complete after 1.5 h. upon completion, the reaction was quenched with acetic acid and concentrated to afford the crude. silica gel chromatography (7% methanol in ch2cl2) yielded the product (282 mg, 57% yield) : h nmr (500 mhz, cd3od) 7.79 (d, 2h, j = 8.3 hz), 7.44 (d, j = 8.5 hz, 2h), 6.025.92 (m, 2h), 5.59 (dd, j = 8.5, 8.5 hz, 1h), 5.425.37 (m, 2h), 5.295.26 (m, 2h), 4.604.55 (m, 4h), 4.32 (dd, j = 11.0, 1.9 hz, 1h), 4.21 (dd, j = 11.0, 5.7 hz, 1h), 3.933.89 (m, 1h), 3.863.82 (m, 1h), 3.64 (dd, j = 10.8, 8.8 hz, 1h), 3.36 (t, j = 8.7 hz, 1h), 2.46 (s, 3h), 1.98 (s, 3h) ; c nmr (125 mhz, cdcl3) 173.75, 146.59, 134.05, 133.63, 133.58, 133.57, 133.53, 131.02, 129.09, 118.89, 118.87, 97.39, 97.34, 73.35, 71.15, 71.12, 70.22, 69.89, 69.84, 69.79, 69.75, 55.08, 55.01, 22.51, 21.62 ; p nmr (500 mhz, cdcl3) 2.51 ; apci - hrms calculated for c21h30no11psna [m + na ] 558.1169, found 558.1154 compound 15 (282 mg, 0.527 mmol) was coevaporated from toluene and resuspended in n, n-dimethylformamide (20 ml) under an argon atmosphere. sodium azide (172 mg, 2.63 mmol) was added, and the reaction reaction warmed to 60 c. the reaction proceeded for 48 h after which time the reaction was concentrated and purified over silica gel (7:2:1 etoac : methanol : water) to afford the product (151 mg, 71% yield) : h nmr (500 mhz, cd3od) 6.075.73 (m, 2h), 5.40 (dd, j = 7.4, 3.3 hz, 1h), 5.275.20 (m, 2h), 5.065.01 (m, 2h), 4.344.31 (m, 2h), 4.274.24 (m, 2h), 3.893.81 (m, 2h), 3.59 (dd, j = 10.6, 8.9 hz, 1h), 3.49 (dd, j = 13.2, 2.5 hz, 1h), 3.363.31 (m, 2h), 3.223.21 (m, 1h), 1.91 (s, 3h) ; c nmr (125 mhz, cdcl3) 173.81, 135.99, 135.92, 116.18, 116.15, 95.59, 95.54, 73.63, 72.48, 72.37, 67.33, 67.29, 67.17, 67.13, 55.33, 55.27, 52.63, 22.85 ; p nmr (500 mhz, cdcl3) 0.66, 1.37. compound 16 (50 mg, 0.123 mmol) was resuspended in 4 ml of methanol : thf (1:1) under an argon atmosphere. p - toluenesulfinic acid sodium salt (44 mg, 0.246 mmol) and tetrakis(triphenylphosphine)-palladium(0) (11 mg, 0.095 mmol) were added. the the reaction was monitored by tlc (3:2:1 n - propanol : acetic acid : water) and determined complete. the reaction was then evaporated under reduced pressure and purified by silica gel chromatography (3:2:1 n - propanol : acetic acid : water). the sugar was further purified by rp - hplc over a c18 semipreparative column (the nest group) using a 0% b isocratic flush over 10 min followed by a 050% b linear gradient from 10 to 20 min and a second linear gradient 500% b 2030 min, tr = 2.54 min (buffer a : 0.1% tfa in water, buffer b : 0.1% tfa, 90% acn in water) : h nmr (500 mhz, d2o) 5.33 (dd, j = 7.3, 3.4 hz, 1h), 3.943.83 (m, 2h), 3.68 (dd, j = 10.5, 9.1 hz, 1h), 3.643.56 (m, 2h), 3.533.43 (m, 2h), 1.95 (s, 3h) ; c nmr (125 mhz, d2o) 174.63, 163.38, 163.10, 162.82, 162.53, 119.78, 117.46, 115.14, 112.82, 93.43, 93.38, 71.34, 70.42, 70.35, 58.59, 53.73, 53.66, 50.67, 33.71, 21.92 ; p nmr (500 mhz, d2o) 1.65 ; esi - ms calculated for c8h14n4o8p [m h ] 323.04, found 325.00. | metabolic chemical reporters (mcrs) of glycosylation are analogues of monosaccharides that contain bioorthogonal functionalities and enable the direct visualization and identification of glycoproteins from living cells. each mcr was initially thought to report on specific types of glycosylation. we and others have demonstrated that several mcrs are metabolically transformed and enter multiple glycosylation pathways. therefore, the development of selective mcrs remains a key unmet goal. we demonstrate here that 6-azido-6-deoxy - n - acetyl - glucosamine (6azglcnac) is a specific mcr for o - glcnacylated proteins. biochemical analysis and comparative proteomics with 6azglcnac, n - azidoacetyl - glucosamine (glcnaz), and n - azidoacetyl - galactosamine (galnaz) revealed that 6azglcnac exclusively labels intracellular proteins, while glcnaz and galnaz are incorporated into a combination of intracellular and extracellular / lumenal glycoproteins. notably, 6azglcnac can not be biosynthetically transformed into the corresponding udp sugar - donor by the canonical salvage - pathway that requires phosphorylation at the 6-hydroxyl. in vitro experiments showed that 6azglcnac can bypass this roadblock through direct phosphorylation of its 1-hydroxyl by the enzyme phosphoacetylglucosamine mutase (agm1). taken together, 6azglcnac enables the specific analysis of o - glcnacylated proteins, and these results suggest that specific mcrs for other types of glycosylation can be developed. additionally, our data demonstrate that cells are equipped with a somewhat unappreciated metabolic flexibility with important implications for the biosynthesis of natural and unnatural carbohydrates. |
regular physical activity (pa) has many physical and mental health benefits for older adults including lowering the risk of early death, improving bone health, increasing cardiorespiratory and muscular fitness, decreasing levels of body fat, and reducing anxiety and depression. to achieve these benefits, the 2008 physical activity guidelines for americans (pag) recommend that adults should complete 150 min a week of moderate intensity aerobic pa or 75 min a week of vigorous intensity aerobic pa (or a combination of both), as well as two days a week of muscle strengthening activities. pa participation progressively declines as people age, and currently only 17.1% and 15.9% of adults 5564 years and 65 years and older, respectively, meet these guidelines ; therefore, interventions to increase pa participation among older adults are warranted. meta - analytic evidence demonstrated that interventions are effective for increasing pa participation [4, 5 ], and specific characteristics of the intervention produced larger effects on behavior. for instance, in a review of 141 studies, dishman and buckworth found significantly larger effect sizes for interventions that used behavior modification strategies such as reinforcement, stimulus control, or behavioral contracts (r = 0.92 weighted ; r = 0.56 not weighted) and for those that were delivered using a mediated approach via indirect implementation through mailings or telecommunications (r = 0.91 weighted ; r = 0.41 not weighted). behavior modification techniques are based on the premise that the antecedents and consequences (including expected consequences) of the activity influence behavior. stimulus control involves manipulating environmental conditions, such as using prompts or reminders to decrease the problem behavior (physical inactivity) and increase the targeted behavior (pa participation) and this strategy has frequently been incorporated into health behavior interventions. in a systematic review of 19 weight loss, pa, and diet interventions that used periodic prompts, fry and neff found that 11 studies reported positive intervention effects. the type of prompt (i.e., messages, reminders, and feedback), delivery periodicity (i.e., delivered daily, weekly, or monthly), and method of administration (i.e., sent using e - mail, telephone, and mail) were examined to determine which prompt characteristics had the greatest impact on behavior change. of the 11 studies with positive results, 5 studies showed significant increases in pa when messages were delivered weekly by telephone and e - mail. overall, these findings demonstrated that prompts delivered periodically are effective for promoting behavior change, and specifically can increase pa participation. furthermore, fry and neff acknowledge that the use of mobile technology as an alternative method for prompt delivery may be another cost - effective way to promote behavior change that warrants future research. the use of cell phones, and specifically text messaging, to prompt pa participation is advantageous for promoting healthy behaviors because (a) there is a high penetration of mobile telephones across income and ethnic groups ; (b) mobile phones are popular, portable, and convenient ; and (c) information can be delivered quickly.. found that participants reported positive feedback and attitudes toward text messaging as a way to cultivate healthy behaviors. in a review of 14 health behavior change interventions that were delivered via mobile telephone short - message service (sms) text messages, fjeldsoe. observed significant positive behavioral changes in 8 studies, and an additional 5 studies demonstrated positive behavior trends using sms as a reminder to increase adherence to treatment programs. fanning. conducted a recent meta - analysis of 11 studies that used mobile devices to increase pa. specifically, interventions were delivered via sms (eight studies), mobile software (four studies), and a personal digital assistant (pda ; two studies). the results of the meta - analysis showed that interventions delivered via mobile devices produced significant moderate effects on pa behavior (g = 0.54, 95% ci = 0.17 to 0.91, and p = 0.01). moreover, a significant moderate effect was found for those interventions delivered with a mobile phone (g = 0.52, 95% ci = 0.11 to 0.94, and p = 0.01). however, of the 11 studies reviewed, only 2 reported samples with an average age of at least 60 years [11, 12 ]. king. compared an intervention group that received a programmed alert on their pda twice a day to a control group that received standard health educational written materials about pa. they found significantly larger increases in pa among older - aged adults when the intervention was delivered via a handheld computer (i.e., pda). nguyen. compared a mobile self - monitored group to a mobile coached group that sent daily text message updates on exercise and symptoms of copd. in return, both groups received a weekly thank - you standard text message. however, the mobile self - monitored group did not receive personalized feedback regarding exercise and symptoms of copd. although both groups increased pa, the mobile self - monitored group showed significant improvements in total steps per day compared to the mobile coached group. therefore, using cell phones as a way to merge communication technologies with intervention strategies to increase pa participation in adults warrants more research in general and specifically among older adults. to date, a limited number of research studies have examined the use of mobile technology to promote pa among adults aged 50 years and older [1315 ]. now that many older adults own and use a mobile phone, the purpose of this study was to determine if electronic prompts delivered via cell phones would increase min of aerobic pa among adults aged 50 years and older. it was hypothesized that participants would report significantly greater average weekly min of aerobic pa during the intervention condition than when they were in the control condition. participants were recruited from a certified personal training studio within the metro - atlanta area. study participants met the following inclusion criteria : (1) 50 years of age or older, (2) worked with a personal trainer for at least six consecutive months, (3) currently working with a personal trainer at least twice a week for strength training, but did not meet the pag for weekly aerobic pa, and (4) able to send and receive e - mail and/or text messages from a cell phone during a 4-week period. thirty volunteers signed the university irb approved informed consent form and were given information about the study. this study used an incomplete within - subjects crossover design with counterbalancing of conditions to control for carryover effects between the treatment and control conditions. at the beginning of the 4-week period, the principal investigator (pi ; the first author) met face to face with each volunteer for about 15 min. during the meeting, the pi explained and received a signature on the informed consent form. participants were then randomly assigned to the treatment condition (group 1) or the control condition (group 2). during the first two weeks of the study, group 1 (treatment condition) participants received a morning and evening text message to prompt aerobic pa three days a week. the morning prompt stated do n't forget to do cardio today and the evening prompt stated did you do your cardio today ? prompting aerobic pa three days a week was chosen to supplement the two days a week of strength training participants were completing with their personal trainers. although the participants were not currently meeting the pag of 150 min a week of aerobic pa, the objective of the research was to test the efficacy of the intervention for increasing weekly min of aerobic pa, not necessarily to achieve 150 min or more. participants in group 2 (control condition) received only the evening text message (i.e., did you do your cardio today ?) three days a week for two weeks. all participants completed the electronic pa participation form by cell phone e - mail or text message on the days the text messages were received. response to the evening message, they should report the type of aerobic pa, duration in min, and intensity (moderate or vigorous). with a no response to the evening message, participants were asked to report the reason for not performing aerobic pa (e.g., barriers). at the end of the first two weeks, participants crossed over to the other condition (i.e., group 1 completed the control condition and group 2 completed the treatment condition) and the procedures were executed exactly the same as described during the first two weeks. participants reported age, gender, marital status, race / ethnicity, education, and income. marital status was categorized as married and other (e.g., domestic partner, single, widowed, and divorced) ; race / ethnicity was categorized as white and other (e.g., hispanic or latino) ; education was categorized as high school or less, some college or associate 's degree, and bachelor 's degree or more ; and income was categorized as low (< $ 1306 per month), medium ($ 1307$1836 per month), high ($25,000 per year), and not reported. the electronic pa participation form was used to record the participants ' responses to the evening text message during the treatment and control conditions (i.e., did you do your cardio today ? if yes, what did you do and if no, why not ?). participants who reported yes to the completion of aerobic pa provided the type performed (walk, bike, swim, etc.), duration in min, and intensity (moderate or vigorous). participants who reported no to the completion of aerobic pa reported barriers that prevented them from engaging in aerobic pa (e.g., no time, work, bad weather, etc.). if outliers were identified and removed from the sample, anova and chi - square were used to compare group differences between the outliers and remaining sample across demographic variables (e.g., age, gender, marital status, race, education level, and income level). anova and chi - square were also used to examine group differences across demographic variables between the participants who began the study in group 1 (treatment condition) and those who began the study in group 2 (control condition). self - reported weekly min of aerobic pa and barriers to aerobic pa were summarized using frequencies. weekly min of aerobic pa were categorized as 029 min, 3059 min, 6089 min, 90119 min, 120149 min, and 150 min or more. finally, a 1-way within - subjects anova was used to determine significant differences in average weekly min of aerobic pa by condition. spss version 18.0 was used to perform all data analyses denoting a statistically significant value of alpha levels at p < 0.05. thirty older adults volunteered to participate in the study ; however, two were identified as multivariate outliers and removed from the analyses. there were no significant group differences between the outliers and the remaining sample across demographic characteristics except on income level. one of the participants removed as an outlier reported a significantly lower income level (e.g., $ 1306 or less monthly versus $ 25,000 or more annually) than the other study participants, (2, n = 30) = 14.63, p = 0.001 ; however, it should be noted this was the only volunteer in the sample who reported low income. the final sample included 28 male and female older adults (m age = 60 years, sd = 5.99, range = 5174 years ; see table 1). there were no significant group differences between the participants initially randomized into group 1 (treatment condition) and those who began the study in group 2 (control condition) across demographic characteristics. the weekly min of aerobic pa for group 1 and group 2 were summarized using frequencies (see table 2). the 1-way within - subjects anova showed significant differences between conditions on total min of aerobic pa, wilks ' lambda = 0.82, f(1,27) = 5.76, p = 0.024, p = 0.18, and observed power = 0.64. specifically, while participants were in the treatment condition they reported significantly greater average weekly min of aerobic pa (m = 96.88 min, sd = 62.90) compared to when they were in the control condition (m = 71.68 min, sd = 40.98 ; see figure 1). there were seven common barriers reported among participants that prevented them from engaging in aerobic pa (see figure 2). the most commonly reported barriers during the treatment condition were (a) did not make time (31%) and (b) work (31%) and the most commonly reported barriers to aerobic pa during the control condition were (a) did not make time (28%), (b) work (26%), and (c) not feeling well (e.g., sick / injury ; 18%). the purpose of this study was to determine if electronic prompts on cell phones would increase aerobic pa participation among adults aged 50 years and older. average weekly min of aerobic pa were significantly greater during the treatment condition than during the control condition. although future studies are warranted, current findings are consistent with previous research in that prompts effectively increase pa behavior and demonstrate the promise of using cell phone technology to deliver prompts to older adults. the clinical implications of these findings suggest that this is a feasible and effective intervention strategy for promoting aerobic pa among those 50 years and older who are members and regular users of fitness facilities because this intervention strategy was tested in a real - world setting. as hypothesized, participants reported significantly greater average weekly min of aerobic pa during the treatment condition when they received the electronic reminder in the morning than during the control condition when the morning reminder was not delivered, and this treatment effect (p = 0.024 ; p = 0.18) was found despite a small sample size and reduced statistical power (0.64). these results are consistent with previous research that demonstrated the effectiveness of prompt interventions with mediated delivery [5, 710 ]. a recent meta - analysis by fanning. found a significant moderate effect for physical activity interventions that were specifically delivered via mobile phones ; however, few of the studies reviewed included older adults. therefore, the findings from this study extend the literature by providing evidence that electronic prompts delivered via cell phones can also be a successful strategy for increasing pa levels among adults aged 50 years and older. in addition to examining the use of electronic messaging via cell phones to increase pa participation among older adults, common barriers to aerobic pa participation were recorded. the most common barriers during both conditions were did not make time and work, which are consistent with previous research. however, fewer barriers were reported while participants were in the treatment intervention (n = 32) than in the control (n = 39), suggesting that the electronic prompts may have assisted with barrier removal. these findings show promise for using electronic prompts delivered via cell phones to increase pa participation as well as to assist with barrier removal. although the results of this study suggest that use of electronic prompts delivered via cell phones to promote aerobic pa among older adults is effective, it is not without limitations. first, the generalizability of the findings is limited to a small sample of mostly white, wealthy, well - educated women with access to cell phones who were already physically active (e.g., working with a personal trainer for strength training) and relatively healthy ; however, it should be noted that the study sample was representative of the facility population from which volunteers were recruited. moreover, the study sample was similar to samples included in previous studies that used mobile devices to prompt pa among older adults [11, 12 ]. these studies also included small samples of mostly white women that held at least a bachelor 's degree and earned more than $ 50,000 a year with an average age of 60 years or more. second, within a crossover design, although participants were randomized into group 1 and group 2, contamination between the groups did occur in participants that partnered together during personal training sessions. specifically, a husband and wife pair began the study in opposite groups, and the husband in group 1 asked his wife in group 2 to walk with him. finally, the duration of the intervention and the frequency of the electronic prompt delivery may be considered inadequate despite the demonstration of positive results. however, this intervention should be viewed in the context of previous research that shares similar characteristics and also demonstrated the effectiveness of prompts for changing behavior. for instance, interventions that were less than six weeks were included in the fry and neff review (see [17, 18 ]), and the frequency of electronic prompt delivery in this study is within a range of frequencies (e.g., daily, once a week, and once a month) found in studies included in the fry and neff and fjeldsoe. reviews (see [11, 12, 17, 19, 20 ]). in addition, it should be noted that during the treatment condition participants were averaging about 32 min of aerobic pa per bout (6 bouts during 2-week condition) versus 24 min of aerobic pa during the control condition. these values suggest that if the treatment had been delivered 5 times per week, participants were on track to meet the 150 weekly min of aerobic activity. although longer interventions are necessary to determine the effectiveness of electronic prompts for the maintenance of aerobic pa in older adults, the evidence is promising for the effects of this strategy for promoting adoption and short - term aerobic pa. few studies have examined electronic prompts on cell phones to increase pa participation among older adults [1315 ], and few have been tested in real - world settings. the results of this study are consistent with previous research and indicate that electronic prompts can increase aerobic pa among older adults and may assist with barrier removal. future research interventions using mobile technology are needed to confirm the study findings using a randomized between - subjects design with a larger sample size of older adults across different income levels, educational backgrounds, ethnicities, and health status. future research interventions should also test the use of the video components (i.e., facetime and skype) of mobile technology for prompt delivery. in summary, the use of electronic prompts on cell phones may be a feasible, cost - effective, and convenient method to increase aerobic pa among older adults. physicians, physical therapists, and personal trainers may want to consider integrating mobile technology into their practice by using cell phones to deliver reminder, informational, and even instructional prompts to patients and clients. | the purpose of this study was to determine if electronic messaging would increase min of aerobic physical activity (pa) among older adults. participants were active older adults (n = 28 ; m age = 60 years, sd = 5.99, and range = 5174 years). using an incomplete within - subjects crossover design, participants were randomly assigned to begin the 4-week study receiving the treatment condition (a morning and evening text message) or the control condition (an evening text message). participants self - reported min of completed aerobic pa by cell phone text. the 1-way within - subjects anova showed significant group differences (p < 0.05). specifically, when participants were in the treatment condition, they reported significantly greater average weekly min of aerobic pa (m = 96.88 min, sd = 62.9) compared to when they completed the control condition (m = 71.68 min, sd = 40.98). electronic messaging delivered via cell phones was effective at increasing min of aerobic pa among older adults. |
in a number of clinical situations, concomitant use of two or more drugs is imperative. in particular in chronic disease treatment course, patients must take more than one drug for an extended period of time. in this course, many drug interactions have received a great deal of attention to avoid any side effects to the patients. the greater the number of drugs prescribed to a patient, the greater the risk of drug interactions. in an epidemiological study, conducted at a community hospital to investigate the clinical relevance of drug - drug interactions (ddis), it was reported that incidence of interactions raises up to 7% in those patients taking 610 drugs and 40% in those taking 1620 drugs a day. beside the off target effects, ddis can lead to termination of drug development in early stages, refusal of approval, very strong prescribing restrictions, and withdrawal of drugs from market. furthermore, frequent and severe side effects due to ddis in elderly patients because of the impaired physiological functions are reportedly increasing, necessitating the requirement of more information regarding the ddis, while giving any combination therapy. many of the major pharmacokinetic (pk) interactions between drugs are due to cytochrome 450 (cyp450) enzymes, whose genetic expressions are being affected (induction or inhibition) by previously or simultaneously administered drugs. in addition, such interactions may exist at the level of absorption, distribution, clearance, and transporters. such interactions are investigated in terms of the pk parameter changes of the concerned drug. these substantial changes in pk parameters may be used to indicate clinical importance of ddis, when substrate and interacting drugs are likely to be given simultaneously either for short periods or chronically for an extended periods of time during the combinational therapy. the present study aimed to evaluate the influences of coadministration of antiepileptic drugs (aeds) on an antimalarial candidate 99/411 pharmacokinetic (pk) profile. 99/411 is a novel 1, 2, 4 trioxane derivative, antimalarial drug candidate with peroxide scaffold essential for its pharmacological activity [4, 5 ]. this molecule has currently entered into phase i clinical trial. during the drug developmental stages, in vivo drug interaction studies are usually carried in experimental animals because of the difficulties to conduct these studies in humans at this stage [6, 7 ]. these studies are further helpful in predicting the drug interactions in human beings, although results obtained in the experimental animals do not ensures the existence of the same in humans, provided extrapolation of these findings is carefully done by considering physiochemical variables in higher species as an important function of the body weight across the species. in this study, our investigational drug 99/411 was considered as a substrate and the interacting agents chosen were fda approved antiepileptic drugs (aeds) including phenytoin (pht), carbamazepine (cbz), and gabapentin (gb). the rationale behind selecting aeds as interacting drugs is being strengthened by the fact that the seizures (characteristics of epilepsy) are one among the common feature of malaria regardless of its severity. seizures are found to occur in about 85% of the cases diagnosed of cerebral malaria [10, 11 ]. thus the coexistence of these two diseases leads to a combinational therapy involving simultaneous administration of aeds and antimalarials, making the importance of investigating ddis. pure (> 99%) reference standards of 99/411 and 97/63 (used as is) (figures 1(a) and 1(b)) were obtained from medicinal & process chemistry division, csir - central drug research institute (cdri), lucknow, india. acetonitrile, hplc grade, was purchased from thomas baker (chemicals) limited (mumbai, india). analytical grade ammonium acetate for buffer preparation was obtained from sd fine - chemicals limited (mumbai, india). drug free rat plasma was collected from healthy male and female sprague - dawley (sd) rats provided by national laboratory animal centre (nlac), cdri. healthy male and female sd rats obtained from nlac of cdri, india, were weighed 200250 g on the day of dosing. prior to the studies, animals were acclimatized for 4 days in proper ventilated polypropylene cases in standard laboratory conditions with regular 12 h light - dark cycle, temperature (22 2c), and relative humidity (55 5%). guidelines approved by the animal experimentation ethics committee and good laboratory practice (glp) were followed throughout the animal experimentation. the studies were single dose oral pk, designed to estimate the effect of concurrent administration of aeds on pk profile of 99/411. each study was carried out in two groups of experimental animals, every group comprising three animals (n = 3). studies were conducted separately on male and female sd rats to assess the intersex differences in the drug interaction pattern. subjects were given 12 mg / kg of 99/411 (control) and 99/411 followed by coadministration of aeds (42 mg / kg each) in separate sets of experimental animals. blood samples for pk analysis were collected before dosing and at the following time points 0.083, 0.33, 0.75, 1, 1.5, 2, 4, 6, 8, 12, 24, 36, 48, 60, 72, and 96 hours after dose. fresh oral formulations of 99/411 and each aeds were prepared in neutralized arachis oil (as a suspension) at 12 and 42 mg / kg dose, respectively. both the formulations were subjected to quality control (qc), stability, and homogeneity test to ensure the strength before dosing. blood samples collected for quantitative estimation of 99/411 were processed by centrifugation within 30 min of sample collection to obtain plasma and were stored at 70c till analysis. 10 l of is was spiked into each study samples followed by a double step liquid - liquid extraction procedure using in n - hexane to extract the drugs and is. plasma concentration was determined by using a fully validated lc - ms / ms method. mass spectrometric detection was performed on an api 4000 lc - ms / ms mass spectrometer (applied biosystems, mds sciex, usa) with analyst 1.4 software. product ion transitions (ammonium adducts of analyte and is), at m / z 412.3 to 185.1 and 418.2 to 119.1 were used for quantification of 99/411 and is respectively. the assay was linear over the range 1.56200 ng / ml with loq 1.56 ng / ml. coefficients of determination (r) were > 0.99 for standard curves generated. precision and accuracy of the method was determined by analyzing qcs at 1.50, 80 and 160 ng / ml. all accuracies were within 15% of the nominal concentrations with standard deviation of 0.05). the plasma concentration - time profiles (mean sd, n = 3) for 99/411 in male and female rats have been shown in figure 2. in male rats, mean values of t1/2, tmax, cmax, auc0, and mrt for 99/411 upon coadministration of 99/411 with pht were 2.10 0.30 h, 7.00 1.00 h, 489.00 166.4 ng / ml, 2521.93 619.89 ngh / ml, and 17.58 2.85 h, while for female rats values were 4.65 0.67 h, 4.00 1.18 h, 493.85 73.14 ng / ml, 2160.70 488.58 ngh / ml, and 12.04 1.00 h, respectively. pk profiles after oral coadministration of 99/411 with pht have been given in table 1. intersex statistical analysis of pk parameters for 99/411 upon coadministration with pht in male and female rats revealed that no significant difference existed between male and female pk profiles in terms of p values which were found > 0.05 for respective parameter. however, rb was found to be enhanced in male rats, while a decrease was seen in female rats (table 1). the plasma concentration - time profiles (mean sd, n = 3) for 99/411 upon pht coadministration in male and female rats have been shown in figure 3. mean values of t1/2, tmax, cmax, auc0, and mrt for 99/411 upon coadministration of 99/411 with cbz were 3.16 0.49 h, 6.50 0.50 h, 495.25 58.42 ng / ml, 2534.84 299.69 ngh / ml, and 13.84 1.56 h in male rats, while 3.49 1.09 h, 4.00 1.18 h, 484.74 60.50 ng / ml, 2095.20 298.73 ngh / ml, and 12.17 0.98 h for female rats, respectively (table 1). pk profiles after oral coadministration of 99/411 with cbz have been given in table 1. intersex statistical analysis of pk parameters for 99/411 upon coadministration with cbz in male and female rats revealed that no significant difference existed between male and female pk profiles in terms of p values. however, like pht coadministration, rb was found to be enhanced in male rats, while a decrease was seen in female rats (table 1). the plasma concentration - time profiles (mean sd, n = 3) for 99/411 upon cbz coadministration in male and female rats have been shown in figure 4. mean values of t1/2, tmax, cmax, auc0, and mrt for 99/411 upon coadministration of 99/411 with gb were 3.16 0.49 h, 6.50 0.50 h, 495.25 58.42 ng / ml, 2534.84 299.69 ngh / ml, and 13.84 1.56 h in male rats, while 5.02 1.09 h, 2.00 1.11 h, 449.64 77.95 ng / ml, 4560.86 1396.05 ngh / ml, and 14.05 1.56 h for female rats, respectively. pk profiles after oral coadministration of 99/411 with gb have been given in table 1. intersex statistical analysis of pk parameters for 99/411 upon coadministration of 99/411 with gb in male and female rats revealed that no significant difference existed between male and female pk profiles in terms of p values. however, rb was found to be decreased in male rats, while an increase was seen in female rats (table 1). the plasma concentration - time profiles (mean sd, n = 3) for 99/411 upon gb coadministration in male and female rats have been shown in figure 5. this study was conducted to evaluate the influence of concurrent administration of 99/411 with fda approved aeds. keeping in view, the effect of species and sex differences on the pk profile of concerned drugs, study was conducted in healthy male and female sd rats [12, 13 ]. first of all, the baseline pk profile was generated in male and female rats. due to fluctuating plasma concentration - time profile (figure 2) the use of noncompartmental analysis was preferred. therefore, pk parameters of 99/411 were obtained by noncompartmental analysis and are listed in table 1. pht, one of the frequently used aed, is well known to lower the plasma levels of a number of drugs, which reduces therapeutic efficacy of concurrently administered drugs. statistical comparison of pk parameters of 99/411 have shown no significance difference (in terms of p values > 0.05) from baseline pk profile, indicating that pht coadministration has little influence on pk parameters of 99/411. rb of 99/411 was observed to be enhanced by about 20% in male rats, while a decrease of about 13% was found in female rats. when pk profiles of male and female rats were statistically compared to evaluate intersex effect, it was observed that significance difference existed for t1/2 values, while for other pk parameters no significance difference existed (table 1). although individual differences in the expression of drug transporters along git and intersex hormonal differences may be responsible for the differences in the rb, but in context to this study, the alteration in rb values is due to individual variations rather than any realistic differences among male and female rats. however, such differences in pharmacokinetics and pharmacodynamics due to gender differences are well reported in animals and humans. gender is one among the influential variable that contributes significantly to differences in pharmacokinetics including absorption, distribution, metabolism, and excretion. its widespread and long term use with other medications enhance the possibilities of drug interactions. study was carried out to evaluate the influence of cbz on pk profile of 99/411. it was found that rb of 99/411 was enhanced by about 20% in male rats, while a decrease of about 15% was found in female rats, similar to that of 99/411 coadministration with pht, but statistically nonsignificant. no significant differences were observed too for other pk parameters of 99/411 in both the sexes. like pht and cbz, it does not bind to plasma proteins nor is metabolized and does not induce / inhibit liver enzymes, reducing the likelihood of drug interaction with other drugs. although this drug is rapidly absorbed in small intestine by carrier mediated transport system, which is saturable. this leads to the possibility of ddi in the absorption phase of 99/411. in an in situ single pass intestinal perfusion study, intestinal transporters have been reported to play a role in 99/411 absorption. study revealed that there was slight decrease in the systemic exposure (auc0) of 99/411 in male rats, while an increased auc0 was found for female rats. in terms of rb, rb of 99/411 was significantly increased by about 80% in female rats, while no effect was observed in male rats. thus, a significant difference was observed intersexually in the interaction pattern influencing the rbs. the rb was almost unaltered in male rats, while significantly enhanced in female rats. in male rats, there was a shift in tmax from 2 0.00 to 6.50 0.50 h, indicating that gb coadministration interacted at absorption level, which might have reduced absorption rate of 99/411 ; however, systemic exposure was unaltered. conversely, in female rats, tmax was shifted from 4.50 1.53 to 2.00 1.11 indicating fast absorption of 99/411 upon gb coadministration which might have resulted into enhanced systemic exposure of 99/411. overall, these studies explicitly indicated that coadministration of these aeds does not exert any significant effect on pk of 99/411, except for gb coadministration in female rats. a similarity was observed in the interaction pattern of pht and cbz, where an increase in the rb of 99/411 was reported in male rats, while a decrease in female rats, which was nonsignificant though. in contrast, opposite pattern was found for gb coadministration, where a significant increase of about 80% was reported in female rats, while no effect was reported in male rats. however, these studies were conducted on a randomized selection basis of animal group (n = 3) ; results represented herein do not negate the variations in the interaction pattern. these findings could not be directly utilized to estimate and predict existence of similar interactions in humans, unless predictions are not rationalized through allometric scaling approaches, keeping in view all the anatomical, physical, and chemical variations across species. | objective. the study aimed to evaluate the influences of coadministration of antiepileptic drugs (aeds) on an antimalarial candidate 99/411 pharmacokinetic (pk) profile. method. for this, single oral dose pk drug interaction studies were conducted between 99/411 and fda approved aeds, namely, phenytoin (pht), carbamazepine (cbz), and gabapentin (gb) in both male and female sd rats, to assess the coadministered and intersexual influences on 99/411 pk profile. results. studies revealed that there were no significant alterations in the pk profile of 99/411 upon pht and cbz coadministration in both male and female rats, while systemic exposure of 99/411 was significantly increased by about 80% in female rats upon gb coadministration. in terms of auc, there was an increase from 2471 586 to 4560 1396 ngh / ml. overall, it was concluded that simultaneous administration of aeds with 99/411 excludes the requirements for dose adjustment, additional therapeutic monitoring, contraindication to concomitant use, and/or other measures to mitigate risk, except for gb coadministration in females. these findings are further helpful to predict such interactions in humans, when potentially applied through proper allometric scaling to extrapolate the data. |
the neurovascular unit is comprised of the endothelial cells which make up the vessels as well as several other associated cell - types including astrocytes and perivascular cells such as pericytes and smooth muscle cells. pericytes wrap around vessels and are in direct contact with endothelial cells via gap junctions (figure 1b ; reviewed in bergers and song, 2005). these cells provide structural support for vessels and also participate in vasomotion (vaso - constriction and dilation) thereby affecting cerebral blood flow. pinocytosis and phagocytosis have been observed in pericytes, suggesting that these cells also play macrophagic roles. blood vessels in the brain are also surrounded by the endfeet of astrocytes (figure 1). astrocyte endfeet located on vessels interact directly with endothelial cells and are capable of up - take and/or release of a number of molecules (e.g. amino acids, growth factors ; reviewed in abbott, 2002 ; abbot., 2006). astrocytes are then able to release lactate into the extracellular milieu, providing neurons with the lactate necessary for energy production via glucose metabolism (reviewed in tsacopoulos and magistretti, 1996). there are a number of reasons why we have included instruction and demonstration of the cerebral vasculature and the neurovascular unit in undergraduate neuroscience lecture and lab - based courses. the first and most obvious is that the brain (neurons, glia, etc.) natural extensions of this fact include the neural and functional consequences of ischemia (e.g. stroke) or decreased oxygen content (e.g. due to high altitude). second, neuronal activity (action potential generation) comes at a high metabolic cost, requiring glucose metabolism. this fact relates to the hemodynamic correlates of neural activity which is measured by blood - oxygen - level dependent function magnetic resonance imaging (bold - fmri ; thompson. finally, changes in vascularity (e.g. vessel loss, angiogenesis) have been associated with disease such as brain tumors (jain., 2007), alzheimer s disease (iadecola, 2004 ; girouard and iadecola, 2006) and epilepsy (schwartz, 2007). our goal was to create a collection of histological material demonstrating cerebral vasculature and cell - vascular interactions for use in a laboratory - based class for undergraduate neuroscience majors. in the process, we identified a number of different methods / preparations which varied in time and resource investment as well as in the fine anatomical details that were demonstrated. a natural extension of this work was evaluating which methods were suitable for student participation with the goal of incorporating one or more of these methods into lab exercises. rat and mouse brains were used for all of the preparations described below. in some cases brains were removed following deep anesthesia and cardiac perfusion with phosphate - buffered saline (pbs) followed by 4% paraformaldehyde in pb. in other cases brain sections of varying thickness (40200m) were prepared on a vibratome or freezing - stage sliding microtome. we adapted methods described in zheng., (1991) for visualizing vessels in unstained sections. perfused and unperfused sections were mounted and coverslipped in 2% gelatin in order to prevent dehydration and preserve vessel structure. with the microscope condenser at its lowest position, providing sufficient contrast, vessels can be readily identified. figure 2 contains photomicrographs of unstained sections with visible blood vessels in neocortex (figure 2a) and hippocampus (figure 2b). an obvious advantage to using this method is that no additional reagents are required in order to demonstrate cerebral vasculature. students can mount and coverslip the tissue themselves and can view structures at relatively high magnification. cell somata are visible in addition to vessels making it possible to link the association of vascular networks embedded within the parenchyma. thus, this method is ideally suited for laboratory classes with access to rat / mouse brains but with limited budgets for additional reagents. this simple stain allows for visualization of cell somata with the ability to distinguish neurons from glia based on soma size and color. following nissl staining, dehydration, and coverslipping, visualization of vessels using the method described for unstained tissue is not possible. however, in addition to staining of neurons and glia, perivascular cells are stained, allowing for visualization of many vessels. in particular, vessels cut along the transverse axis are especially demonstrative since putative pericytes can be seen in close contact with vessels. figure 3 contains representative photomicrographs of nissl - stained sections where vessels found in the hippocampal fissure can be seen (arrowheads in a). an advantage of the above method is that demonstrations can be done on tissue that was already intended to be stained as part of the planned course exercise. additionally, this type of demonstration can be done on archival tissue which has previously been stained. given the minimal additional expense required to illustrate the relationship between pericytes and blood vessels (i.e. the cost of staining materials) this method is advantageous for use in courses with limited budgets. we adapted methods described by sherman and paull (1985) for use with unperfused tissue sections. sections from unperfused brains are placed in a solution of 1% dab (fluka) in pbs for 35 mins. next 30% h2o2 (fisher scientific) is added to the dab solution to a final concentration of 0.06% h2o2. within seconds of adding the h2o2 sections are left in this solution for 35 mins. and subsequently washed three times in pbs for 10 mins. sections are mounted on gelatin - coated slides in pbs and coverslipped after drying with permount (fisher scientific ; cat. staining with dab resulted in dark brown staining of rbcs found in blood vessels with little background staining. visualization of vessels with this technique varied depending on section thickness, with thicker sections (80200m) revealing greater detail of individual vessels and branches as well as vessels from the pial surface which penetrate into neocortex all the way to deep layers. some dab stained sections were also nissl counter - stained. this material provided visualization of stained vessels as well as stained somata of neurons and glia (figure 4c, e, f). high magnification of double - stained sections allowed for clear identification of labeled vessels with stained pericytes and nearby neurons (figure 4f). dab staining of unperfused sections is a simple method for fine visualization of cerebrovascular networks. when combined with nissl counter - staining, several components of the neurovascular unit can be visualized, making the additional reagents (and the cost of those reagents) and preparation time (only about 45 mins.. nevertheless, there are two important factors to consider when deciding to use dab stained sections in the teaching laboratory. first, all histochemical steps requiring dab must be done wearing gloves and safety goggles while under a fume hood, making this preparation useful only when a fume hood is available. second, dab waste including the tissue washes in pbs must be disposed of according to institutional guidelines for hazardous waste. these issues might prohibit student participation in the staining process ; however, once slides are stained and prepared they can be used repeatedly over many years. immunocytochemical (icc) methods constitute the most targeted method for labeling the cerebral vasculature as well as one or more components of the neurovascular unit. this approach is based on the principal that unique components of the neurovascular unit show molecular specificity and that there exist primary antibodies to those molecules. thus, antibodies that label molecules found only in endothelial cells will exclusively label cerebral blood vessels while antibodies against molecules found only in astrocytes will only label astrocytes. fortunately, such antibodies exist and are available for all components of the neurovascular unit. a list of commercially - available antibodies we have used in the past for research purposes can be found in croll., we used a commercial primary antibody against an unknown antigen found only in rat endothelial cells (rat endothelial cell antigen, reca ; serotec ; raised in mouse ; dilution 1:1000). immunocytochemistry performed with the anti - reca antibody resulted in the labeling of the cerebral vasculature with no background. figure 5 contains representative photomicrographs of stained sections containing the neocortex (a, b) and hippocampus (c, d). unlike dab staining of unperfused tissue, icc with anti - reca resulted in clear labeling of the vascular tube formed by endothelial cells. counterstaining with nissl revealed labeled endothelial cells as well as stained pericytes (figure 5f). we also used icc against the astrocyte - specific molecule glial fibrillary acidic protein (gfap ; dako ; raised in rabbit ; dilution 1:10,000). icc with a primary antibody against gfap resulted in excellent visualization of astrocytes and astrocytic processes (figure 6). blood vessels were evident due to the dense surrounding plexus formed by the labeled astrocytic processes. we next used double - icc with anti - reca and anti - gfap antibodies in order to determine whether greater visualization of these components of the neurovascular unit would be possible. examination of this tissue at high magnification revealed putative contacts made by astrocytes directly onto vessels (figure 7b, d). there are a number of advantages to using icc for demonstration of cerebral vascular networks and the neurovascular unit. first, discrete cellular elements of the neurovascular unit can be directly targeted with antibodies to cell - specific molecules. using this approach, we were able to specifically label endothelial cells (anti - reca) and astrocytes (anti - gfap). second, using double icc (or triple icc) multiple cellular elements can be revealed. using this approach first, primary and secondary antibodies come at a financial cost that can be prohibitive for use in many courses. second, icc is time consuming, and in our experience requires at least two days. it may be difficult to incorporate icc into student exercises in the teaching lab, as most courses generally meet only one day a week for several hours. therefore, in some cases, the financial expense and time requirements of icc might outweigh the increased resolution provided by icc. this might especially be true when comparing dab staining of unperfused tissue with the results obtained following icc for endothelial cells with anti - reca. both methods are valuable in demonstrating cerebral vasculature but the former can be performed with substantially less time and resources. third, because icc for conventional light microscopy uses dab as a chromagen, concerns related to access to a fume hood and hazardous waste disposal also apply as described above for dab staining of unperfused tissue. finally, single and especially double previously we demonstrated the versatility of the allen brain atlas (aba ; www.brain-map.org) for use in the teaching lab and lecture hall as a tool for demonstrating cerebral cytoarchitecture, cellular diversity, and area - specific gene expression (ramos., 2007). we extended this approach and made an extensive database search for genes with expression in components of the neurovascular unit. endothel, and angio results in an output of 5, 48, and 35 genes, respectively. we reviewed micrographs (> 200) from each of these genes but did not identify staining profiles which revealed the cerebral vasculature. note that for many genes, micrographs from more than one brain / case were available. for reasons that are not known, perhaps due to the methods used for in situ hybridization (lein., 2007) we next searched for other anatomical / genetic databases and identified the gensat database (http://gensat.org/index.html) as a useful tool for demonstrating cerebral vasculature and the neurovascular unit in silico (gong. the gensat database contains photomicrographic atlases of brain sections taken from green fluorescent protein (gfp) transgenic mice which have been stained using icc (anti - gfp antibody). moreover, histological data can be found from animals of various ages (embryonic day 15.5, postnatal day 7, adult). thus, micrographs found in this database reveal the expression profile in those cells / tissues where gfp expression is driven by transgene insertion. for example, the gensat database contains photomicrographs from transgenic mice where gfp is driven via insertion into the gfap gene. as expected, gfp expression is found exclusively in astrocytes, making these micrographs useful teaching tools for demonstrating the distribution and morphology of astrocytes in the brain. we used the search tools of the gensat database and searched for vascular which resulted in links to histological photomicrographs from 131 transgenic mice lines where gfp immunostaining is observed in the cerebral vasculature. we present photomicrographs taken from the gensat database for three such mouse lines where gfp expression is clearly visible in the cerebral vasculature in figure 8. an additional resource of the gensat database is the ability to zoom - in on photomicrographs and view different structures at higher magnification. figure 8 also contains higher magnification micrographs of vasculature in hippocampus, neocortex, and cerebellum (right panels in a we also performed a gensat database search for vascular neuron, vascular glial, and vascular neuron glial which resulted in links to photomicrographs from 88, 59, and 39 (respectively) transgenic mouse lines where gfp is found in these multiple cell - types. representative micrographs from the id3-gfp transgenic mouse line where gfp expression can be found in endothelial cells as well as astrocytes are found in figure 9. there are only advantages to using the gensat database for demonstrating the cellular components of the neurovascular unit. first, because the gensat database is publicly available, there is no financial commitment necessary, making its use possible at any institution. the option to use the gensat database is, therefore, ideally suited for use in laboratory classes with no budget available for the additional resources required for the histological demonstrations we have described above. moreover, histological material from the gensat database can be used in the lecture hall where it is becoming more common to have available internet access and associated lcd projectors. thus, demonstrating the cerebral vasculature and the cellular components of the neurovascular unit in the lecture hall requires only internet access and a video projector. the anatomy of the cerebral vasculature and the relationship between cells in the brain and blood vessels are very important topics in neuroscience. despite its importance in brain function recognizing this deficit, we evaluated several methods for use in the preparation of histological material detailing the cerebral vasculature and the neurovascular unit, which we have used in a laboratory - based course (part of our neuroscience curriculum). in the present report, we detail histological methods which reveal the cerebral vasculature and one or more cellular components of the neurovascular unit. based on these details, we believe that there exist one or more preparations which can be used in most laboratory - based courses. in instances where there is no budget for the resources required for the preparations described, we detail how the gensat database can be used. finally, identification of the gensat database as a means for demonstrating the cerebral vasculature has also introduced a novel teaching tool for use in the lecture hall. the present report describes our efforts to prepare histological material for students to examine with conventional compound microscopes. this material expands our collection of materials for demonstration and instruction of neuroanatomy, which also includes whole brains from various mammalian species, models of human brains, and computer software. an additional goal of assessing these various methods was to determine which could be incorporated into a lab exercise, where students participate in tissue preparation and staining. individual instructors and departments wishing to develop lab exercises for students using one of the methods described above will have to determine which preparation will be most suitable for their respective course. moreover, to what extent students participate in the histology should be carefully determined. mounting and visualizing unstained tissue as well as nissl staining are two preparations ideally suited for hands - on student participation. in contrast, dab - staining and icc are preparations requiring significant supervision and training. in addition to having students participate in the histology, there are exercises that can be implemented where students analyze several features of the neurovascular unit. tata and anderson (2002) provide both methods and examples of several important features of the neurovasculature that can be quantified. these measures include vessel diameter, capillary segment length, branch point number, and capillary tortuosity. in their report, tata and anderson (2002) use computer - assisted camera lucida where many measures are automatically calculated by the computer. equipped with microscopes with drawing tubes in our teaching lab (olympus bx41 ; 4x, 10x, 40x objectives), we wondered whether one or more of the measurements described by these authors could be determined using conventional camera lucida. figure 10, contains a representative camera - lucida drawing of a neocortical blood vessel. as can be seen, branches of multiple order (e.g. 2, 3, etc.) more sophisticated measurements such as vessel tortuosity and diameter prove difficult to accurately measure using this technique. however, drawings can be scanned with conventional flatbed scanners and digitally imported into the free image analysis software imagej which is distributed by the nih (http://rsb.info.nih.gov/ij/). using this software package, a number of measures can be obtained including total area, length, and volume of the drawn vessels. one challenge for neuroscience educators is to make as many aspects of neuroanatomy and neurophysiology accessible to students. we hope that the present description of methods for demonstrating cerebral vasculature and its relationship to glia and neurons will inspire greater discussion of the neurovascular unit and brain hemodynamics (moore and cao, 2008). although there are additional methods for revealing the cerebral vascular which are not described here (fonta and imbert, 2002 ; bovetti., 2007 ; chuquet., 2007), the methods described above represent realistic preparations that can be incorporated for use in laboratory courses. we adapted methods described in zheng., (1991) for visualizing vessels in unstained sections. perfused and unperfused sections were mounted and coverslipped in 2% gelatin in order to prevent dehydration and preserve vessel structure. with the microscope condenser at its lowest position, providing sufficient contrast, vessels can be readily identified. figure 2 contains photomicrographs of unstained sections with visible blood vessels in neocortex (figure 2a) and hippocampus (figure 2b). an obvious advantage to using this method is that no additional reagents are required in order to demonstrate cerebral vasculature. students can mount and coverslip the tissue themselves and can view structures at relatively high magnification. cell somata are visible in addition to vessels making it possible to link the association of vascular networks embedded within the parenchyma. thus, this method is ideally suited for laboratory classes with access to rat / mouse brains but with limited budgets for additional reagents. this simple stain allows for visualization of cell somata with the ability to distinguish neurons from glia based on soma size and color. following nissl staining, dehydration, and coverslipping, visualization of vessels using the method described for unstained tissue is not possible. however, in addition to staining of neurons and glia, perivascular cells are stained, allowing for visualization of many vessels. in particular, vessels cut along the transverse axis are especially demonstrative since putative pericytes can be seen in close contact with vessels. figure 3 contains representative photomicrographs of nissl - stained sections where vessels found in the hippocampal fissure can be seen (arrowheads in a). an advantage of the above method is that demonstrations can be done on tissue that was already intended to be stained as part of the planned course exercise. additionally, this type of demonstration can be done on archival tissue which has previously been stained. given the minimal additional expense required to illustrate the relationship between pericytes and blood vessels (i.e. the cost of staining materials) this method is advantageous for use in courses with limited budgets. we adapted methods described by sherman and paull (1985) for use with unperfused tissue sections. sections from unperfused brains are placed in a solution of 1% dab (fluka) in pbs for 35 mins. next 30% h2o2 (fisher scientific) is added to the dab solution to a final concentration of 0.06% h2o2. within seconds of adding the h2o2 sections are left in this solution for 35 mins. and subsequently washed three times in pbs for 10 mins. sections are mounted on gelatin - coated slides in pbs and coverslipped after drying with permount (fisher scientific ; cat. staining with dab resulted in dark brown staining of rbcs found in blood vessels with little background staining. visualization of vessels with this technique varied depending on section thickness, with thicker sections (80200m) revealing greater detail of individual vessels and branches as well as vessels from the pial surface which penetrate into neocortex all the way to deep layers. some dab stained sections were also nissl counter - stained. this material provided visualization of stained vessels as well as stained somata of neurons and glia (figure 4c, e, f). high magnification of double - stained sections allowed for clear identification of labeled vessels with stained pericytes and nearby neurons (figure 4f). dab staining of unperfused sections is a simple method for fine visualization of cerebrovascular networks. when combined with nissl counter - staining, several components of the neurovascular unit can be visualized, making the additional reagents (and the cost of those reagents) and preparation time (only about 45 mins.. nevertheless, there are two important factors to consider when deciding to use dab stained sections in the teaching laboratory. first, all histochemical steps requiring dab must be done wearing gloves and safety goggles while under a fume hood, making this preparation useful only when a fume hood is available. second, dab waste including the tissue washes in pbs must be disposed of according to institutional guidelines for hazardous waste. these issues might prohibit student participation in the staining process ; however, once slides are stained and prepared they can be used repeatedly over many years. immunocytochemical (icc) methods constitute the most targeted method for labeling the cerebral vasculature as well as one or more components of the neurovascular unit. this approach is based on the principal that unique components of the neurovascular unit show molecular specificity and that there exist primary antibodies to those molecules. thus, antibodies that label molecules found only in endothelial cells will exclusively label cerebral blood vessels while antibodies against molecules found only in astrocytes will only label astrocytes. fortunately, a list of commercially - available antibodies we have used in the past for research purposes can be found in croll. (2004 ; see also kasselman., 2007). with this in mind, we used a commercial primary antibody against an unknown antigen found only in rat endothelial cells (rat endothelial cell antigen, reca ; serotec ; raised in mouse ; dilution 1:1000). immunocytochemistry performed with the anti - reca antibody resulted in the labeling of the cerebral vasculature with no background. figure 5 contains representative photomicrographs of stained sections containing the neocortex (a, b) and hippocampus (c, d). unlike dab staining of unperfused tissue, icc with anti - reca resulted in clear labeling of the vascular tube formed by endothelial cells. counterstaining with nissl revealed labeled endothelial cells as well as stained pericytes (figure 5f). we also used icc against the astrocyte - specific molecule glial fibrillary acidic protein (gfap ; dako ; raised in rabbit ; dilution 1:10,000). icc with a primary antibody against gfap resulted in excellent visualization of astrocytes and astrocytic processes (figure 6). blood vessels were evident due to the dense surrounding plexus formed by the labeled astrocytic processes. we next used double - icc with anti - reca and anti - gfap antibodies in order to determine whether greater visualization of these components of the neurovascular unit would be possible. examination of this tissue at high magnification revealed putative contacts made by astrocytes directly onto vessels (figure 7b, d). there are a number of advantages to using icc for demonstration of cerebral vascular networks and the neurovascular unit. first, discrete cellular elements of the neurovascular unit can be directly targeted with antibodies to cell - specific molecules. using this approach, we were able to specifically label endothelial cells (anti - reca) and astrocytes (anti - gfap). second, using double icc (or triple icc) multiple cellular elements can be revealed. using this approach first, primary and secondary antibodies come at a financial cost that can be prohibitive for use in many courses. second, icc is time consuming, and in our experience requires at least two days. it may be difficult to incorporate icc into student exercises in the teaching lab, as most courses generally meet only one day a week for several hours. therefore, in some cases, the financial expense and time requirements of icc might outweigh the increased resolution provided by icc. this might especially be true when comparing dab staining of unperfused tissue with the results obtained following icc for endothelial cells with anti - reca. both methods are valuable in demonstrating cerebral vasculature but the former can be performed with substantially less time and resources. third, because icc for conventional light microscopy uses dab as a chromagen, concerns related to access to a fume hood and hazardous waste disposal also apply as described above for dab staining of unperfused tissue. previously we demonstrated the versatility of the allen brain atlas (aba ; www.brain-map.org) for use in the teaching lab and lecture hall as a tool for demonstrating cerebral cytoarchitecture, cellular diversity, and area - specific gene expression (ramos., 2007). we extended this approach and made an extensive database search for genes with expression in components of the neurovascular unit. endothel, and angio results in an output of 5, 48, and 35 genes, respectively. we reviewed micrographs (> 200) from each of these genes but did not identify staining profiles which revealed the cerebral vasculature. note that for many genes, micrographs from more than one brain / case were available. for reasons that are not known, perhaps due to the methods used for in situ hybridization (lein., 2007), the aba is not well - suited for demonstrating the cerebral vasculature. we next searched for other anatomical / genetic databases and identified the gensat database (http://gensat.org/index.html) as a useful tool for demonstrating cerebral vasculature and the neurovascular unit in silico (gong. the gensat database contains photomicrographic atlases of brain sections taken from green fluorescent protein (gfp) transgenic mice which have been stained using icc (anti - gfp antibody). moreover, histological data can be found from animals of various ages (embryonic day 15.5, postnatal day 7, adult). thus, micrographs found in this database reveal the expression profile in those cells / tissues where gfp expression is driven by transgene insertion. for example, the gensat database contains photomicrographs from transgenic mice where gfp is driven via insertion into the gfap gene. as expected, gfp expression is found exclusively in astrocytes, making these micrographs useful teaching tools for demonstrating the distribution and morphology of astrocytes in the brain. we used the search tools of the gensat database and searched for vascular which resulted in links to histological photomicrographs from 131 transgenic mice lines where gfp immunostaining is observed in the cerebral vasculature. we present photomicrographs taken from the gensat database for three such mouse lines where gfp expression is clearly visible in the cerebral vasculature in figure 8. an additional resource of the gensat database is the ability to zoom - in on photomicrographs and view different structures at higher magnification. figure 8 also contains higher magnification micrographs of vasculature in hippocampus, neocortex, and cerebellum (right panels in a c, respectively). we also performed a gensat database search for vascular neuron, vascular glial, and vascular neuron glial which resulted in links to photomicrographs from 88, 59, and 39 (respectively) transgenic mouse lines where gfp is found in these multiple cell - types. representative micrographs from the id3-gfp transgenic mouse line where gfp expression can be found in endothelial cells as well as astrocytes are found in figure 9. there are only advantages to using the gensat database for demonstrating the cellular components of the neurovascular unit. first, because the gensat database is publicly available, there is no financial commitment necessary, making its use possible at any institution. the option to use the gensat database is, therefore, ideally suited for use in laboratory classes with no budget available for the additional resources required for the histological demonstrations we have described above. moreover, histological material from the gensat database can be used in the lecture hall where it is becoming more common to have available internet access and associated lcd projectors. thus, demonstrating the cerebral vasculature and the cellular components of the neurovascular unit in the lecture hall requires only internet access and a video projector. the anatomy of the cerebral vasculature and the relationship between cells in the brain and blood vessels are very important topics in neuroscience. despite its importance in brain function, recognizing this deficit, we evaluated several methods for use in the preparation of histological material detailing the cerebral vasculature and the neurovascular unit, which we have used in a laboratory - based course (part of our neuroscience curriculum). in the present report, we detail histological methods which reveal the cerebral vasculature and one or more cellular components of the neurovascular unit. based on these details, we believe that there exist one or more preparations which can be used in most laboratory - based courses. in instances where there is no budget for the resources required for the preparations described, we detail how the gensat database can be used. finally, identification of the gensat database as a means for demonstrating the cerebral vasculature has also introduced a novel teaching tool for use in the lecture hall. the present report describes our efforts to prepare histological material for students to examine with conventional compound microscopes. this material expands our collection of materials for demonstration and instruction of neuroanatomy, which also includes whole brains from various mammalian species, models of human brains, and computer software. an additional goal of assessing these various methods was to determine which could be incorporated into a lab exercise, where students participate in tissue preparation and staining. individual instructors and departments wishing to develop lab exercises for students using one of the methods described above will have to determine which preparation will be most suitable for their respective course. moreover, to what extent students participate in the histology should be carefully determined. mounting and visualizing unstained tissue as well as nissl staining are two preparations ideally suited for hands - on student participation. in contrast, dab - staining and icc are preparations requiring significant supervision and training. in addition to having students participate in the histology, there are exercises that can be implemented where students analyze several features of the neurovascular unit. tata and anderson (2002) provide both methods and examples of several important features of the neurovasculature that can be quantified. these measures include vessel diameter, capillary segment length, branch point number, and capillary tortuosity. in their report, tata and anderson (2002) use computer - assisted camera lucida where many measures are automatically calculated by the computer. equipped with microscopes with drawing tubes in our teaching lab (olympus bx41 ; 4x, 10x, 40x objectives), we wondered whether one or more of the measurements described by these authors could be determined using conventional camera lucida. figure 10, contains a representative camera - lucida drawing of a neocortical blood vessel. as can be seen, branches of multiple order (e.g. 2, 3, etc.) more sophisticated measurements such as vessel tortuosity and diameter prove difficult to accurately measure using this technique. however, drawings can be scanned with conventional flatbed scanners and digitally imported into the free image analysis software imagej which is distributed by the nih (http://rsb.info.nih.gov/ij/). using this software package, a number of measures can be obtained including total area, length, and volume of the drawn vessels. one challenge for neuroscience educators is to make as many aspects of neuroanatomy and neurophysiology accessible to students. we hope that the present description of methods for demonstrating cerebral vasculature and its relationship to glia and neurons will inspire greater discussion of the neurovascular unit and brain hemodynamics (moore and cao, 2008). although there are additional methods for revealing the cerebral vascular which are not described here (fonta and imbert, 2002 ; bovetti., 2007), the methods described above represent realistic preparations that can be incorporated for use in laboratory courses. previously we demonstrated the versatility of the allen brain atlas (aba ; www.brain-map.org) for use in the teaching lab and lecture hall as a tool for demonstrating cerebral cytoarchitecture, cellular diversity, and area - specific gene expression (ramos., 2007). we extended this approach and made an extensive database search for genes with expression in components of the neurovascular unit. endothel, and angio results in an output of 5, 48, and 35 genes, respectively. we reviewed micrographs (> 200) from each of these genes but did not identify staining profiles which revealed the cerebral vasculature. note that for many genes, micrographs from more than one brain / case were available. for reasons that are not known, perhaps due to the methods used for in situ hybridization (lein., 2007) we next searched for other anatomical / genetic databases and identified the gensat database (http://gensat.org/index.html) as a useful tool for demonstrating cerebral vasculature and the neurovascular unit in silico (gong. the gensat database contains photomicrographic atlases of brain sections taken from green fluorescent protein (gfp) transgenic mice which have been stained using icc (anti - gfp antibody). moreover, histological data can be found from animals of various ages (embryonic day 15.5, postnatal day 7, adult). thus, micrographs found in this database reveal the expression profile in those cells / tissues where gfp expression is driven by transgene insertion. for example, the gensat database contains photomicrographs from transgenic mice where gfp is driven via insertion into the gfap gene. as expected, gfp expression is found exclusively in astrocytes, making these micrographs useful teaching tools for demonstrating the distribution and morphology of astrocytes in the brain. we used the search tools of the gensat database and searched for vascular which resulted in links to histological photomicrographs from 131 transgenic mice lines where gfp immunostaining is observed in the cerebral vasculature. we present photomicrographs taken from the gensat database for three such mouse lines where gfp expression is clearly visible in the cerebral vasculature in figure 8. an additional resource of the gensat database is the ability to zoom - in on photomicrographs and view different structures at higher magnification. figure 8 also contains higher magnification micrographs of vasculature in hippocampus, neocortex, and cerebellum (right panels in a we also performed a gensat database search for vascular neuron, vascular glial, and vascular neuron glial which resulted in links to photomicrographs from 88, 59, and 39 (respectively) transgenic mouse lines where gfp is found in these multiple cell - types. representative micrographs from the id3-gfp transgenic mouse line where gfp expression can be found in endothelial cells as well as astrocytes are found in figure 9. there are only advantages to using the gensat database for demonstrating the cellular components of the neurovascular unit. first, because the gensat database is publicly available, there is no financial commitment necessary, making its use possible at any institution. the option to use the gensat database is, therefore, ideally suited for use in laboratory classes with no budget available for the additional resources required for the histological demonstrations we have described above. moreover, histological material from the gensat database can be used in the lecture hall where it is becoming more common to have available internet access and associated lcd projectors. thus, demonstrating the cerebral vasculature and the cellular components of the neurovascular unit in the lecture hall requires only internet access and a video projector. the anatomy of the cerebral vasculature and the relationship between cells in the brain and blood vessels are very important topics in neuroscience. despite its importance in brain function recognizing this deficit, we evaluated several methods for use in the preparation of histological material detailing the cerebral vasculature and the neurovascular unit, which we have used in a laboratory - based course (part of our neuroscience curriculum). in the present report, we detail histological methods which reveal the cerebral vasculature and one or more cellular components of the neurovascular unit. moreover we have identified the strengths and limitations of each preparation. based on these details, we believe that there exist one or more preparations which can be used in most laboratory - based courses. in instances where there is no budget for the resources required for the preparations described, we detail how the gensat database can be used. finally, identification of the gensat database as a means for demonstrating the cerebral vasculature has also introduced a novel teaching tool for use in the lecture hall. the present report describes our efforts to prepare histological material for students to examine with conventional compound microscopes. this material expands our collection of materials for demonstration and instruction of neuroanatomy, which also includes whole brains from various mammalian species, models of human brains, and computer software. an additional goal of assessing these various methods was to determine which could be incorporated into a lab exercise, where students participate in tissue preparation and staining. individual instructors and departments wishing to develop lab exercises for students using one of the methods described above will have to determine which preparation will be most suitable for their respective course. mounting and visualizing unstained tissue as well as nissl staining are two preparations ideally suited for hands - on student participation. in contrast, dab - staining and icc are preparations requiring significant supervision and training. in addition to having students participate in the histology, there are exercises that can be implemented where students analyze several features of the neurovascular unit. tata and anderson (2002) provide both methods and examples of several important features of the neurovasculature that can be quantified. these measures include vessel diameter, capillary segment length, branch point number, and capillary tortuosity. in their report, tata and anderson (2002) use computer - assisted camera lucida where many measures are automatically calculated by the computer. equipped with microscopes with drawing tubes in our teaching lab (olympus bx41 ; 4x, 10x, 40x objectives), we wondered whether one or more of the measurements described by these authors could be determined using conventional camera lucida. figure 10, contains a representative camera - lucida drawing of a neocortical blood vessel. as can be seen, branches of multiple order (e.g. 2, 3, etc.) more sophisticated measurements such as vessel tortuosity and diameter prove difficult to accurately measure using this technique. however, drawings can be scanned with conventional flatbed scanners and digitally imported into the free image analysis software imagej which is distributed by the nih (http://rsb.info.nih.gov/ij/). using this software package, a number of measures can be obtained including total area, length, and volume of the drawn vessels. one challenge for neuroscience educators is to make as many aspects of neuroanatomy and neurophysiology accessible to students. we hope that the present description of methods for demonstrating cerebral vasculature and its relationship to glia and neurons will inspire greater discussion of the neurovascular unit and brain hemodynamics (moore and cao, 2008). although there are additional methods for revealing the cerebral vascular which are not described here (fonta and imbert, 2002 ; bovetti., 2007, the methods described above represent realistic preparations that can be incorporated for use in laboratory courses. | one challenge of neuroscience educators is to make accessible to students as many aspects of brain structure and function as possible. the anatomy and function of the cerebrovasculature is among many topics of neuroscience that are underrepresented in undergraduate neuroscience education. recognizing this deficit, we evaluated methods to produce archival tissue specimens of the cerebrovasculature and the neurovascular unit for instruction and demonstration in the teaching lab. an additional goal of this project was to identify the costs of each method as well as to determine which method(s) could be adapted into lab exercises, where students participate in the tissue preparation, staining, etc. in the present report, we detail several methods for demonstrating the cerebrovasculature and suggest that including this material can be a valuable addition to more traditional anatomy / physiology demonstrations and exercises. |
it is defined by the national institutes of health (nih) by having at least three of the following conditions : central obesity, elevated triglycerides, low high - density lipoprotein cholesterol, hypertension or elevated fasting plasma glucose. although it is widely accepted that lifestyle factors such as obesity, high caloric diet, and smoking contribute to the development of metabolic syndrome by virtue of their role in diabetes and cardiovascular disease, substantial research supports the role of early life exposures in the etiology of metabolic syndrome and related disorders including obesity and type 2 diabetes (t2d). historical epidemiologic observations have led to further study of the association between the intrauterine environment and subsequent disease. most notably, the dutch famine of 19441945 led to the epidemiologic observation that children born to mothers who were in the early stages of pregnancy during the famine were at significantly increased risk of cardiometabolic disorders in adulthood.1 hales and barker observed the relationship between low birth weight and increased risk for t2d in a british cohort, leading to the proposal of the thrifty phenotype hypothesis, which posited that malnutrition during pregnancy results in structural and functional changes in the developing fetus.2 since the proposal of the thrifty phenotype hypothesis in 1992, numerous studies have replicated the finding that low birth weight and other pregnancy complications confer increased risk for adult chronic disease in the offspring, including hypertension, t2d, and cardiovascular disease.36 this concept has evolved into the developmental origins of adult disease hypothesis, to encompass the interplay between an individual s genetic background and the intrauterine environment that results in permanent metabolic changes that impact the risk for later life chronic disease.7 changes occurring during critical periods of development, such as embryonic and fetal development, that promote survival of the fetus in an adverse intrauterine environment, such as maternal malnutrition, can also have lasting effects on the individual s metabolic health, increasing their risk of chronic disease later in life. these programmed changes or alterations, referred to here as developmental programming, can result in permanent structural changes of organs and tissues, altered responses to environmental stimuli, and epigenetic changes in gene expression. while the exact molecular mechanisms underlying developmental programming are largely unknown, there are likely multiple interrelated interactions between genetics and the intrauterine environment that when occurring during critical periods of fetal development lead to permanent metabolic and vascular changes impacting individual risk for later life chronic disease. at the structural level when combined, these developmental insults can result in increased risk for metabolic syndrome and other chronic diseases including obesity and t2d.8,9 although developmental programming is typically thought to refer only to responses to the intrauterine environment, it may also occur prior to conception by the programming of gametes. in particular, maternal metabolic syndrome can affect the quality of oocytes and embryos,10,11 which can program the resulting offspring to have an increased risk of developing metabolic syndrome. animal models of intrauterine exposures and pregnancy complications and the resulting changes in the offspring, including structural and epigenetic, have been particularly valuable for studying the developmental origins of chronic diseases from a developmental programming perspective.12 in particular, rodent models of maternal obesity and insulin resistance, nutrition intervention, intrauterine growth restriction (iugr), and early postnatal growth provide a rich source of evidence for the developmental programming of metabolic syndrome and other metabolic disorders. in this review, we describe human and animal studies that support the role of developmental programming in the etiology of metabolic syndrome, obesity, and t2d. specifically, we focus on how the developmental programming of metabolic disorders are influenced by epigenetic programming, maternal and postnatal diet, maternal obesity, and pregnancy complications. epigenetics refers to the changes in the biochemical structure of dna that alter gene expression. these changes include, but are not limited to, dna methylation, histone modification, and non - coding rna processes.13 the epigenetic state of an individual s dna is both inherited and modifiable, such that dna expression patterns can be passed from parent to offspring or they can be modified in response to environmental triggers.14 epigenetic changes have been observed in association with many disease states, and many are observed in metabolic syndrome and its encompassing conditions.15 thus, epigenetic changes offer biochemical evidence of the deleterious effects of adverse developmental conditions and subsequent disease. methylation of 5 cytosine residues at cytosine / guanine - rich regions of dna (also known as cpg islands) is a common epigenetic modification and hypermethylation of these regions is associated with transcriptional repression.16 this repression may be mediated by histone modifications, in which hypermethylated cpg islands promote the binding of mecp2, which recruit histone modifying complexes.16 the ensuing histone modification results in a chromatin structure that is inaccessible to transcription machinery. throughout this review, we describe epigenetic changes occurring as a consequence of maternal and postnatal diet, maternal obesity, and pregnancy complications. furthermore, we discuss how these epigenetic changes are involved in the offspring s risk for developing metabolic syndrome in adulthood. the relationship between the intrauterine environment and chronic disease in the offspring was first noted in response to maternal malnutrition. it is hypothesized that in the presence of maternal malnutrition the developing fetus metabolism is structurally and functionally altered in anticipation of harsh conditions after birth. this adaptation can have even greater detrimental effects on the offspring when the postnatal environment is nutrient - rich, rather than nutrient poor.17 manipulation of the maternal diet in mice and rats has illustrated the effects of in utero nutrition on the metabolic health of the offspring. ponzio has described the transgenerational effects of maternal nutrient restriction on hypertension and endothelial dysfunction in rats.18 female pregnant rats (f0) were exposed to 50% nutrient deprivation and cardiovascular factors were measured in their offspring (f1) and subsequent generations (f2 and f3) that were fed normal non - restrictive diets. high blood pressure and other metabolic perturbations were observed in all offspring born to nutrient restricted mothers compared to offspring of mothers who were not nutrient restricted. these results demonstrate the transmission of cardiovascular perturbations across multiple generations in response to a single incidence of maternal nutrient restriction.18 maternal over - nutrition has been shown to have equally detrimental effects on the future health of the offspring.19,20 as with maternal malnutrition, over - nutrition programs the developing fetus to anticipate excessive nutrient availability after birth. excess caloric intake during pregnancy is arguably more relevant to today s society, in which junk food is readily available in most developed and developing regions of the world.21 thus, it is critical to achieve greater understanding of the mechanisms of these effects as they may offer insights into the rising incidence of metabolic diseases, including obesity, t2d, and metabolic syndrome. many animal studies have investigated the effects of maternal over - nutrition on the metabolic health of the offspring. both high - fat and high - calorie diets have been shown to increase adiposity and inflammation in the offspring.22 endothelial dysfunction has been observed in response to maternal high - fat diet in nonhuman primates.23 female japanese macaques were exposed to either a control diet or high - fat diet for up to 5 years and their offspring were exposed to either a control or high - fat diet post - weaning. animals born to high - fat diet - fed mothers and who were fed a high - fat diet post - weaning (h / h) displayed the most perturbation. they demonstrated elevated fasting insulin levels, although fasting glucose was normal, indicating the early stages of insulin resistance. h / h animals also demonstrated impaired acetylcholine - induced vasodilation, an indicator of endothelial dysfunction. animals born to high - fat diet - fed mothers who were exposed to normal diet post - weaning demonstrated slight metabolic and endothelial perturbations compared to offspring born to control - fed mothers and fed a normal diet after birth.23 the results of this study indicate that the effects of maternal high - fat diet are most detrimental in the presence of a postnatal high - fat diet ; however, a healthy or normal postnatal diet can not completely reverse the metabolic effects caused by poor maternal nutrition.23 this is further supported by a study in rats in which females were fed a high - fat diet during pregnancy and offspring were fed a normal control diet post - weaning ; the offspring maintained an adverse metabolic profile and epigenetic changes through adulthood, suggesting that irreversible metabolic damage in the offspring can be caused by poor maternal nutrition during pregnancy.24 the biological mechanisms underlying the association between maternal nutrition and later life metabolic health in the offspring are unclear. leptin has been implicated as a possible mediator of increased risk for obesity in response to adverse intrauterine conditions.25 leptin is a hormone secreted by adipose tissue and is active during both fetal and postnatal life. in utero, leptin is supplied via maternal blood and acts as a neurotrophic factor to aid in development of the central nervous system.25 in postnatal life, leptin regulates appetite and energy expenditure to maintain energy balance.26 evidence from animal studies demonstrates that leptin sensitivity in offspring is affected by maternal diet,27 and these changes can have transgenerational effects.27,28 studies in rodents demonstrate the adverse effects of both maternal malnutrition and high - fat diet on leptin sensitivity. in the case of maternal malnutrition, the reduction in circulating maternal leptin results in decreased leptin sensitivity and obesity in the offspring.29 rat offspring exposed to a high - fat maternal diet demonstrated leptin resistance in adulthood regardless of post - weaning diet.30 in another study of rats exposed to maternal hyperglycemia, male offspring who were fed a high - fat diet demonstrated significantly increased leptin levels compared to male offspring not exposed to maternal hyperglycemia.31 female offspring exposed to maternal hyperglycemia and fed a high - fat diet demonstrated only moderate increase in leptin levels compared to female offspring not exposed to maternal hyperglycemia.31 this evidence supports the programming of leptin sensitivity in response to maternal diet, with potentially sex - specific effects. furthermore, this research suggests leptin as a mediator of the association between intrauterine exposures and metabolic disturbances in the offspring. in addition to the role of leptin, adiponectin (adipoq) has been implicated in metabolic syndrome.32 in mice exposed to maternal high - fat diet, serum adipoq-1 and adipoq receptor expression in skeletal muscle expression were significantly lower than controls. offspring of mothers fed high - fat diets grew to be significantly heavier and had significantly elevated fasting glucose levels compared to mice exposed to a normal maternal diet.33 given that adipoq helps to maintain insulin sensitivity and adipoq levels are inversely correlated with obesity, the results of this study suggest that metabolic disturbances in response to maternal high - fat diet may also be mediated by adipoq.33 maternal health prior to and at the time of conception can have detrimental effects on the pregnancy and the subsequent health of the child. in particular, obesity and insulin resistance during pregnancy have been consistently shown to negatively impact the metabolic health of the offspring. obesity and insulin resistance often co - exist and are common metabolic conditions of pregnancy with an estimated 33% of all pregnancies complicated by maternal obesity. the relationship between obesity and insulin resistance in pregnancy and the impact on obesity, t2d, and metabolic syndrome in the offspring may be due to permanent alterations in glucose - insulin metabolism in the offspring, causing reduced capacity for insulin secretion and insulin resistance.23 in fact, maternal obesity and insulin resistance have been shown to confer insulin resistance as early as the embryonic stage in animal models.10 maternal insulin resistance can negatively impact the developing embryo due to impaired glucose transport.34 in a study of the umbilical cords of lean pregnant women compared to obese pregnant women, maternal obesity was associated with significantly increased leptin and insulin levels in maternal plasma and cord plasma.35 these differences were accompanied by differential umbilical cord gene expression between lean and obese mothers. a study of 99 offspring of diabetic mothers evaluated cardiovascular risk factors in childhood and adolescence. they observed a significant increase in e - selectin, vascular cell adhesion molecule 1 (vcam1), and leptin levels in offspring of diabetic mothers compared to offspring of non - diabetic mothers, increased body mass index and waist circumference and decreased adipoq. e - selectin and vcam1 are markers of endothelial function and atherosclerosis and leptin and adipoq are regulators of hunger and metabolism.36 increased leptin and decreased adipoq levels are likely due to the increased body mass index and waist circumference.36 gestational diabetes mellitus (gdm) is characterized by novel hyperglycemia during pregnancy.37 in addition to increasing the maternal risk of t2d and metabolic syndrome, gdm is consistently shown to increase the risk of obesity, t2d, and metabolic syndrome in the offspring both in adolescence and adulthood.38 the increased risk for metabolic disturbances is thought to be mediated by oxidative stress. these substances are normally neutralized by antioxidants, but the antioxidant profiles of mothers with gdm and their offspring are altered.39 similarly, gdm is associated with hyperlipidemia in both mother and neonate, which is consistent with the observation of hyperlipidemia in t2d and metabolic syndrome.40 maternal obesity and diabetes are associated with epigenetic changes in the offspring, which mediate the metabolic disturbances seen in these offspring. in a mouse model of obesity and t2d, triglyceride and leptin levels were significantly elevated in offspring of obese / t2d mothers compared to offspring of mothers with normal metabolism.41 these changes were accompanied by reduced expression of two mitochondrial genes, atpase6 and cytb, and widespread changes in methylation patterns. these changes were exacerbated in offspring of obese mothers who were then fed a high - fat diet postnatally, compared to offspring fed a normal diet. the results of this study provide further evidence of the effect of the maternal metabolic state on the metabolic health of the offspring, and demonstrate the additionally detrimental effects of a high - fat postnatal diet following exposure to maternal obesity.41 gdm has been shown to trigger epigenetic modifications, including alterations in telomere length.42 in a study of offspring of women with gdm, telomere length was significantly shorter in fetuses of women with gdm compared to fetuses of women with uncomplicated pregnancy.42 in adulthood, shortened telomere length is associated with increased risk of cardiometabolic diseases. thus, the finding that telomere length is significantly shorter in developing fetuses exposed to gdm suggests a genetic mechanism for the increased risk of cardiometabolic disorders seen in these children that begins in utero. animal evidence of developmental programming suggests that sex differences exist in the susceptibility to the detrimental effects of intrauterine exposures.43,44 in mice exposed to pre - conceptional and gestational obesity, male but not female offspring developed obesity, insulin resistance, hyperleptinemia, and hepatic steatosis.43 differential expression of the lipogenic genes, srebf1, fasn, pparg1 and pparg2 was observed between male and female offspring, in which males exposed to pre - conceptional and gestational obesity demonstrated significantly different expression compared to control males, whereas no significant difference was observed between exposed females compared to control females.43 conversely, females showed significant increases in adipocyte size compared to control females, with no significant differences among males. these sex differences in adipocyte size were accompanied by differential expression of genes regulating lipid droplet size and lipogenesis, pnpla2 and bscl2 and a gene involved in apoptosis, bax, among exposed females compared to control females, but not in males.43 the results of this study demonstrate sex differences in the metabolic and epigenetic response to pre - conceptional and gestational obesity.43 in a study of the effects of maternal obesity, as triggered by a maternal high - fat diet, mice of both sexes that were exposed to maternal obesity developed hypercholesterolemia, hyperinsulinemia, and hyperleptinemia.44 however, exposed male offspring, as compared to exposed female offspring, had more severe hypercholesterolemia and hyperinsulinemia but a similar degree of hyperleptinemia. the results of this study provide further evidence of the detrimental effects of maternal obesity on cholesterol and insulin sensitivity in the offspring, which are manifested in a sex - specific manner.44 in a study of male mice exposed to maternal obesity, glucose tolerance was not impaired in maternal obesity offspring compared to control offspring, although fasting insulin levels were significantly elevated in obese offspring.45 interestingly, expression levels of insulin receptor substrate (irs-1) was markedly reduced in maternal obesity offspring, while levels of mir-126, a micro - rna known to inhibit translation of irs-1, were markedly increased. this suggests that hyperinsulinemia in response to maternal obesity is mediated by irs-1, which is under epigenetic regulation through a micro - rna, mir-126.45 taken together, the aforementioned evidence demonstrates the influence of maternal metabolic health on the metabolic health of the offspring. pregnancy complications and resulting perinatal outcomes are widely accepted to increase the risk of adult chronic disease in the offspring, including risk for cardiovascular disease, t2d, and metabolic syndrome.46 such complications include gestational hypertension, preeclampsia, and preterm birth. gestational hypertension and preeclampsia have been associated with development of chronic disease in the offspring including hypertension and cardiovascular disease.8,47,48 gestational hypertension is characterized by novel onset of hypertension during pregnancy while preeclampsia is characterized by novel onset of hypertension during pregnancy, in addition to proteinuria.48 the 1986 northern finland birth cohort study investigated the effect of gestational hypertension on the blood pressure of the offspring in adolescence.48 children of mothers with gestational hypertension had significantly elevated blood pressure compared to children of normotensive mothers. another study, using data from the avon longitudinal study of parents and children (alspac), investigated the effects of maternal gestational hypertension and preeclampsia on the blood pressure of the offspring in childhood.49 they found that gestational hypertension was associated with significantly increased blood pressure in the children, aged 912, while preeclampsia showed no association when adjusted for other factors. a study of women with preeclamptic pregnancies and their children demonstrated the deleterious effects of preeclampsia on the cardiovascular health of the child. women and children were screened for cardiovascular biomarkers 58 years postpartum compared to women and children of uncomplicated pregnancies.50 they observed significantly elevated total cholesterol in children exposed to preeclampsia compared to children exposed to uncomplicated pregnancies. preeclampsia has also been shown to induce epigenetic modifications in the offspring. in a study of the effects of preeclampsia and its effects on dna methylation, umbilical cord methylation at igf2 was significantly lower among infants exposed to preeclampsia compared to infants exposed to uncomplicated pregnancy. methylation of igf2 was inversely correlated with birth weight.51 given that igf2 is a regulator of fetal growth, this study suggests that low birth weight as a result of preeclampsia may be mediated by igf2. pregnancy complications can result in offspring born large for gestational age, often referred to as macrosomia, or offspring born small for gestational age. iugr manifests as low birth weight and is generally characterized by birth weight below the 10th percentile,12 and has repeatedly been shown to negatively impact health in adulthood. iugr can be the result of many conditions, including placental pathologies, intrauterine infections, preeclampsia or gestational hypertension, fetal syndromes, smoking, alcohol or substance abuse, severe malnutrition, maternal autoimmune diseases or severe maternal t2d.12 conversely, macrosomia, characterized by birth weight above the 90th percentile, can be equally as detrimental to future health. potential known causes of macrosomia include poorly managed maternal t2d, prolonged pregnancy, history of macrosomic pregnancy, or polyhydramnios.12 both iugr and macrosomia are associated with increased risk of metabolic syndrome.52,53 rat models of iugr, caused by a decrease in placental blood flow, have demonstrated metabolic and epigenetic changes in the offspring.54,55 a study demonstrated that iugr caused insulin resistance in a sex - specific manner, in which growth - restricted females had significantly higher fasting blood glucose levels than control females, whereas growth - restricted males showed no significant difference.56 growth restriction can also be the result of maternal malnutrition, and the postnatal environment following iugr can impact the metabolic profile in adulthood.57 sheep exposed to maternal caloric restriction to induce iugr followed by exposure to a low - activity, high calorie postnatal environment to induce rapid catch - up growth demonstrated obesity, insulin and leptin resistance, and elevated cortisol levels. in contrast, iugr offspring exposed to a normal postnatal environment to induce normal catch - up growth demonstrated significantly less severe outcomes, although their metabolic health was still somewhat impaired when compared to non - growth - restricted controls.57 the results of this study demonstrate the detrimental effects of iugr on the metabolic health of the offspring, as well as the differential effects of accelerated versus normal catch - up growth. one pathway shown to be involved in the role of pregnancy complications and the offspring s metabolic health later in life is endothelial dysfunction. the endothelium is responsible for the maintenance of proper vascularization of the placenta in pregnancy.58 thus, endothelial dysfunction can be both immediately threatening to the health of the fetus and can have lasting effects on the child s metabolic health. endothelial cells are responsible for the production of vasoactive substances to maintain vascular homeostasis.37 dysfunction occurs when vascular tissue has a diminished response to nitric oxide - mediated vasodilation, leading to a reduction in blood flow to the fetus.37 significant endothelial dysfunction is thought to be one of the causes of preeclampsia.59 although the pathogenesis of preeclampsia is not well understood, there is agreement that it is at least partially due to inadequate trophoblast invasion of the spiral arteries during placentation.60 this is thought to be the result of oxidative stress and inflammation, which trigger endothelial dysfunction in the developing fetus.46 another potential mechanism for the connection between pregnancy complications and offspring metabolic health is that low birth weight and small for gestational age infants often experience a significant period of catch - up growth in the postnatal period. these infants have been shown to experience significant changes in metabolism that are associated with an increased risk for obesity.61 given that many pregnancy complications can result in low birth weight or small for gestational age, these conditions represent a high risk population for metabolic syndrome. substantial evidence supports the role of the intrauterine environment in determining the metabolic health of the offspring by means of developmental programming. epidemiologic evidence consistently demonstrates the effects of maternal diet, maternal health, pregnancy complications, and epigenetic modifications on later life metabolic health in the offspring. these phenomena have been further characterized through the use of animal models of developmental programming. the interaction of intrauterine exposures and epigenetic changes results in a complex network of mechanisms that contribute to the development of metabolic syndrome and other metabolic disorders including obesity and t2d. in this review, we have presented evidence for the relationship between maternal and early postnatal diet, maternal obesity, insulin resistance and metabolic syndrome, pregnancy complications and epigenetic programming and subsequent risk of obesity, diabetes and metabolic syndrome in the offspring. it is clear that many of these factors overlap and may mutually confound these relationships.62 for example, maternal and early postnatal diet, along with the maternal metabolic state may confound the relationship between pregnancy complications and subsequent health of the child, which may also be mediated by epigenetic programming. this demonstrates the network of contributors to both developmental programming and the developmental origins of adult disease. it is also important to consider the potential role of confounders related to social determinants of health. in particular, socioeconomic factors such as access to medical care, income and education level, are related to both prenatal health and pregnancy outcomes.63 such factors present an opportunity to improve the pregnancy environment through public health awareness. the substantial evidence for the contribution of the intrauterine environment to the future metabolic health of the offspring demonstrates an opportunity for future investigation into the appropriate prenatal diet for optimal maternal and neonatal health. some studies have shown that adherence to a mediterranean diet is associated with more favorable metabolic health in both the mother and infant, including lower risk for gestational diabetes and low birth weight, as well as lower neonatal insulin, blood glucose, lipids and lipoprotein.6467 these studies demonstrate that a positive intrauterine environment can improve maternal and neonatal outcomes and should be considered for public health recommendations and translation into clinical practice. however, to date, research on modifying maternal diet during pregnancy has primarily been confined to studies using animal models. many such studies have shown sex differences in the metabolic response to adverse intrauterine conditions, a phenomenon which warrants further investigation. to replicate such findings in humans, observational cohorts should be established to assess the role of the prenatal environment on the future health of the mother and child through adolescence and adulthood. the growing body of evidence for the relationship between intrauterine environment and metabolic syndrome suggests the need for further investigation of the mechanisms by which prenatal exposures program biological systems to influence future health. through a better understanding of these mechanisms, we can improve prediction and prevention of pregnancy complications, ultimately improving the health outcomes of mothers and their offspring. | metabolic syndrome is a growing cause of morbidity and mortality worldwide. metabolic syndrome is characterized by the presence of a variety of metabolic disturbances including obesity, hyperlipidemia, hypertension, and elevated fasting blood sugar. although the risk for metabolic syndrome has largely been attributed to adult lifestyle factors such as poor nutrition, lack of exercise, and smoking, there is now strong evidence suggesting that predisposition to the development of metabolic syndrome begins in utero. first posited by hales and barker in 1992, the thrifty phenotype hypothesis proposes that susceptibility to adult chronic diseases can occur in response to exposures in the prenatal and perinatal periods. this hypothesis has been continually supported by epidemiologic studies and studies involving animal models. in this review, we describe the structural, metabolic and epigenetic changes that occur in response to adverse intrauterine environments including prenatal and postnatal diet, maternal obesity, and pregnancy complications. given the increasing prevalence of metabolic syndrome in both the developed and developing worlds, a greater understanding and appreciation for the role of the intrauterine environment in adult chronic disease etiology is imperative. |
brazil boasts the greatest plant diversity on the world (approximately 55,000 species of higher plants). brazilian plants represent a large source of potentially therapeutic compounds, a variety of which have been used in attempts to treat several infectious and/or inflammatory conditions. esenbeckia species, such as esenbeckia leiocarpa (rutaceae), are wide spread in several brazilian regions. the presence of various chemical constituents, primarily alkaloids, has already been demonstrated in this genus [2, 3 ]. in addition, coumarins, chalcones, as well as triterpenes and lignans have been shown to be, at least in part, responsible for different biological properties already attributed to this herb, including antimalarial, antiparasitic, antimicrobial, and anticholinesterasic effects. there are few studies investigating the anti - inflammatory effect of esenbeckia leiocarpa. however, previous reports have singled out alkaloids as playing a pivotal role in inflammatory conditions. for instance, jiao. showed that some alkaloids promote a potent inhibitory activity on the production of nitric oxide (no), tumor necrosis factor (tnf-), or interleukin 6 (il-6), in mouse macrophage raw264.7 cells stimulated by lipopolysaccharide (lps). others have demonstrated that the alkaloid 6-ethoxybuphanidrine was effective in inducing apoptosis in hl-60 and mda - mb-231 tumor cell lines. moreover, chalcones were effective in inducing early apoptosis in hl60 cells [10, 11 ]. recently, esenbeckia leiocarpa was found to possess interesting anti - inflammatory activity in vivo since it protected against carrageenan - induced inflammation. these cells are the first to arrive at inflammatory sites, where they secrete different cytokines / chemokines that attract either other pmns or other leukocytes [1315 ]. because the resolution of inflammation is known to occur by the elimination of apoptotic pmns by professional phagocytes, it is important to identify new agents that can induce or accelerate pmn apoptosis, since such agents could represent future potential therapeutic candidates [1418 ]. in order to investigate the potential anti - inflammatory properties of esenbeckia leiocarpa and to better understand the mode of action involved, we decided to determine whether or not a crude extract preparation of this plant could activate human pmns and if it can accelerate their ability to undergo spontaneous apoptosis (sa). we found that the crude hydroalcoholic extract (che) of esenbeckia leiocarpa bark can activate human pmns by inducing actin polymerization, cell signaling events, and cleavage of some cytoskeletal proteins. also, we demonstrate that che accelerates sa by a mechanism involving caspases but not p38 activation but also by a mechanism that does not increase vimentin cleavage and cd16 shedding. samples of bark from esenbeckia leiocarpa were collected in arenpolis, a town located in the state of mato grosso, brazil, collected in august 2007 and were identified by a biologist, professor dr. celice alexandre, of the state university of mato grosso, tangar da serra, mt, brazil, where a voucher specimen (38639) was deposited. esenbeckia leiocarpa barks were air - dried and protected from light at room temperature (25c) for one week. in addition, the dried barks (5400 g) were ground into particles (1.5 mm) using a knife mill (mill te-651, tecnal, piracicaba, sp, brazil). the ground material was extracted with 8 l of 96% ethanol (plant material : ethanol 1 : 8, w / v) at room temperature. after ten days, the extract obtained was filtered (using whatman paper no. 1), and the ethanol was removed by rotavapor (fisatom-802, so paulo, sp, brazil) at 55c under reduced pressure (460 mmhg ; vacuum q-355a2, quimis, diadema, sp, brazil). in order to obtain a final lyophilized powder, this procedure was repeated three times in a period of one month, with a resulting yield of 290 g to the crude hydroalcoholic extract (che). che was dissolved in the diluent composed of hbss-1% dimethyl sulfoxide (dmso) (sigma chemical company (st. the plant lectin viscum album agglutinin 1 (vaa - i) used as an inducer of pmn apoptosis, dimethyl sulfoxide (dmso), sb203580, a specific cell - permeable inhibitor of the map kinase homologues p38alpha, p38beta, and p38beta2, and pd98059, an inhibitor of mek1 and mek2, two enzymes leading to phosphorylation of erk-1/2 and n - formyl - methionyl - leucyl - phenylalanine (fmlp), were purchased from sigma chemical company (st. louis, mo, usa). the fitc - phalloidin conjugate was purchased from molecular probes (eugene, or, usa). fitc - annexin - v was purchased from biosource international (camarillo, ca, usa) and fitc - mouse anti - human cd16 mab was purchased from bd pharmingen (mississauga, ontario, canada). granulocyte macrophage colony - stimulating factor (gm - csf), a classical pmn agonist and antiapoptotic agent, was purchased from peprotech inc (rocky hill, nj, usa). the caspase-1, -3, -4, and -7 inhibitor n - benzyloxycarbonyl - v - a - d - o - methyl - fluoromethyl ketone (z - vad - fmk) was purchased from calbiochem (la jolla, ca). the caspase-3 inhibitor z - asp(ome)-gln - met - asp(ome)-fmk (z - dqmd - fmk), the irreversible caspase-6 inhibitor z - val - glu(ome)-ile - asp(ome)-fmk (z - veid - fmk), and the irreversible caspase-9 inhibitor z - leu - glu(ome)-his - asp(ome)-fmk (z - lehd - fmk) were purchased from calbiochem (la jolla, ca). the following mabs to human cytoskeletal proteins were purchased from sigma - aldrich (st. louis, mo) : anti - gelsolin (clone gs-2c4), anti - paxillin (clone pxc-10), and anti - vimentin (clone v9). cells were isolated from venous blood of healthy volunteers by dextran sedimentation followed by centrifugation over ficoll - hypaque (amersham pharmacia biotech inc., baie d'urf, qubec, canada), as described previously. blood donations were obtained from informed and consenting individuals according to our institutionally approved procedures. cell viability (> 98%) was monitored by trypan blue exclusion, and the purity (> 98%) was verified by cytology from cytocentrifuged preparations stained using the hema-3 stain set (biochemical sciences inc., freshly isolated human neutrophils (10 10 cells / ml suspended in rpmi-1640) were incubated for short periods of time (5, 15 or 30 min.) at 37c with buffer (dmso 1%) or che (500 g / ml) in a final volume of 100 l. synthetic peptide n - formyl - methionyl - leucyl - phenylalanine (fmlp) (a classical neutrophil activator) at the dose of 10 m was used as positive control. after incubation of pmns with buffer or che, digitonin and paraformaldehyde (pfa) were used for permeabilization and cell fixation, respectively. cells were washed and incubated with phalloidin - fitc (binds to filamentous of actin) for 20 min at 4c (light protected) prior to facs analysis. flow cytometric analysis (10,000 events) was performed using a facscan (bd biosciences, sao jose, ca, usa). neutrophils (10 10 cells / ml in rpmi-1640) were incubated for 0.5, 1, 5, 15, 30, 45, or 60 min at 37c with the diluent (hbss-1%dmso), gm - csf (65 ng / ml), or che (500 g / ml) in a final volume of 100 l. aliquots corresponding to 1 10 cells were loaded onto 10% sds - page and transferred from gel to nitrocellulose membranes (amersham pharmacia bio - tech inc., baie d'urf, qubec, canada). nonspecific sites were blocked with 3% bovine serum albumin (bsa) in tbs - tween (25 mm tris - hcl, ph 7.8, 190 mm nacl, 0.15% tween-20) for 1 h at room temperature. the monoclonal antiphosphotyrosine (clone 4g10 (1 : 1000)) was then incubated with membranes for 1 h at 37c followed by washes and incubated with a horseradish peroxidase - labelled goat anti - mouse igg (1 : 15,000, bio / can) for 1 h at room temperature in fresh blocking solution. membranes were washed three times with tbs - tween, and phosphotyrosine bands were revealed with the enhanced chemiluminescence (ecl) western blotting detection system (amersham pharmacia biotech baie d'urf, qubec, canada). protein loading was verified by staining the membranes with coomassie blue at the end of the experiments. neutrophils (10 10 cells / ml) were isolated and incubated as above at 37c with buffer (dmso 1%) or che (500 g / ml) in a final volume of 100 l. reactions were stopped by adding 35 l 4x laemmeli 's sample buffer, as described previously. samples corresponding to 1 10 cells were loaded onto 10% sds - page and transferred from gel to nitrocellulose membranes (amersham pharmacia bio - tech inc.). nonspecific sites were blocked with 3% bovine serum albumin (bsa) in tbs - tween (25 mm tris - hcl, ph 7.8, 190 mm nacl, 0.15% tween-20) and western blots were performed as described previously by pelletier., in 2002. monoclonal antiphospho - p38 (ptpy) antibody (1 : 1000 ; biosource, camarillo, ca, usa) and hrp - conjugated goat anti - mouse (1 : 15,000), or monoclonal anti - phosphospecific erk-1/2 mapk (clone 12d4) (upstate cell signalling, lake placid, ny, usa) and hrp - goat anti - rabbit (1 : 15,000), both diluted in 3% nonfat dry milk, were used. membranes were stripped for 30 min at 55c with stripping buffer (100 mm 2-me, 2% sds, 62.5 mm tris, ph 6.7), washed, and reprobed with an anti - p38 (clone c-20 : sc-535) (1 : 1000 ; santa cruz biotechnology, santa cruz, ca, usa), or polyclonal anti - erk-1/2 (millipore, billerica, ma, usa) antibodies followed by an hrp - conjugated goat anti - mouse igg + igm (1 : 20,000 ; jackson immunoresearch laboratories, inc.). pmns (100 l of a 10 10 cells / ml suspension in rpmi-1640 supplemented with 10% autologous serum) were incubated with or without che (500 g / ml) for indicated times in the presence or absence of caspase-1, -3, -4, and -7 inhibitor, n - benzyloxycarbonyl - v - a - d - o - methyl - fluoromethyl ketone (z - vad - fmk), caspase-3 inhibitor z - asp(ome)-gln - met - asp(ome)-fmk (z - dqmd - fmk), irreversible caspase-6 inhibitor z - val - glu(ome)-ile - asp(ome)-fmk (z - veid - fmk), or irreversible caspase-9 inhibitor z - leu - glu(ome)-his - asp(ome)-fmk (z - lehd - fmk), or appropriate controls, as indicated in the figure legends, and apoptosis was evaluated by cytology and/or flow cytometry. cytocentrifuge preparations of neutrophils were performed with a cyto - tek centrifuge (miles scientific) essentially as previously described and were stained with a diff - quick staining kit (baxter healthcare corporation, miami, fl, usa), according to the manufacturer 's instructions. cells were examined by light microscopy at 400x final magnification, and apoptotic neutrophils were defined as cells containing one or more characteristic darkly stained pyknotic nuclei. an ocular containing a 10 10-square grill was used to count at least five different fields (> 100 cells) for assessment of apoptotic cells. for the flow cytometric procedure, apoptosis was investigated using fluorescence labelling with annexin - v - fitc binding or anti - cd16-fitc as previously published. ten thousand cells were analyzed by facs calibur (becton - dickinson, san jose, ca) using cellquest program (bd biosciences, sao jose, ca, usa). the number of late apoptotic and necrotic cells was subtracted in order to evaluate the percentage of apoptotic cells. neutrophils (10 10 cells / ml in a 96-well plate) were incubated with or without 1000 ng / ml vaa - i or 500 g / ml che in its diluent (1% dmso) for the indicated time period and then harvested for the preparation of cell lysates in laemmli 's sample buffer (figure 5). aliquots corresponding to 500,000 cells were loaded onto 10% sds - page and transferred from gel to nitrocellulose membranes (amersham pharmacia bio - tech inc, baie d'urf, qc, canada). nonspecific sites were blocked with 3% bsa in tbs - t for 1 h at room temperature. membranes were incubated with monoclonal anti - human cytoskeletal abs (anti - gelsolin, anti - paxillin, anti - vimentin, and anti - vinculin) in the dilution of 1 : 1000 for 1 h at room temperature, followed by 3 washes, and incubated with an hrp - labelled goat anti - mouse igg (1/15,000 ; bio / can, montreal, canada) for 1 h at room temperature in fresh blocking solution. membranes were washed three times with tbs - t and bands were revealed with the ecl - western blotting detection system (pharmacia biotech). protein loading was verified by staining the membranes with coomassie blue at the end of the experiments. because this was the first time that che was tested in human pmns, we first determined its potential cytotoxicity. to do so, freshly isolated pmns were incubated in vitro with increasing concentrations of che (01000 g / ml) over time (024 h) and necrosis was assessed by a trypan blue exclusion assay. cell necrosis never exceeded 3% at concentrations 500 g / ml, and the number of cells initially seeded remained stable in plates observed 24 h later (data not shown). cell necrosis never exceeded 5% when cells were incubated with che at concentrations greater than 500 g / ml for shorter periods of time (less than 60 min), but up to 15% of cells displayed necrosis at the highest concentration tested (1000 g / ml) after 24 h of incubation (data not shown). based on these results, we selected the concentration of 500 g / ml for the remainder of this study, unless otherwise specified. next, we determined whether or not che could induce actin polymerization, a typical assay for evaluating pmn activation [24, 25 ]. as illustrated in figure 1, che increased actin polymerization, but this response required about 15 min to occur, as judged by the shift of fluorescence following phalloidin staining. we next evaluated the possibility that che activated phosphorylation events, since this cell signaling is important for modulating pmns functions. as illustrated in figure 2(a), che rapidly activated pmns, as judged by increased signal intensity of total phosphotyrosine proteins detected by western blot after 30 seconds, peaking at 1530 minutes and then declining after 45 min. because p38 and erk-1/2 mapks play significant roles in human pmn activity, we next determined whether or not che activated these kinases. che was found to activate p38 (figure 2(b)) but not erk-1/2 (figure 2(c)), despite the fact that, as expected, the cytokine gm - csf strongly induced phosphorylation of erk-1/2. several assays were used to evaluate the effect of che on pmn apoptosis. as assessed by cytology, che significantly induced apoptosis at a concentration of 500 g / ml, where 79.0 6.0% (mean sem, n = 5) of cells were typically in apoptosis (pyknotic nuclei) versus 50.3 2.6% for controls or sa (figure 3(a)). we then evaluated apoptosis by flow cytometry with fitc - annexin - v, known to be increased at the apoptotic cell surface. as expected, a greater number of pmns were annexin - v - positive when treated with 500 g / ml che versus sa (97.8% 0.9 versus 56.1% 5.6 for sa) (figure 3(b)). in contrast to annexin - v, cd16 is known to be shed from the cell surface of apoptotic pmns, leading to a decrease in expression. unexpectedly, we found that cd16 levels were not significantly decreased in che - induced pmns (data not shown). we then conducted a series of experiments in which apoptosis was evaluated in parallel using cytology and flow cytometry, to monitoring cd16 cell surface expression in apoptotic cells. as expected, vaa - i, a potent pro - apoptotic plant lectin, induced apoptosis as assessed by cytology (figure 4(a)) and decreased the cell surface expression of cd16 (figure 4(b)) as compared to sa, whereas che induced apoptosis as determined by cytology, but levels of cell surface expression of cd16 did not significantly decrease in pmns isolated from the same blood donors as compared to sa. since these latter results suggested that che induced atypical pmn apoptosis, we then investigated the degradation of cytoskeletal proteins, an event characteristic of apoptosis. as shown in figure 5, che induced the degradation of gelsolin as evidenced by the appearance of the 41 kda fragment and the degradation of the two main 60 and 48 kda paxillin polypeptides recognized by the antibody. unexpectedly, che did not induce the degradation of the intermediate filament protein vimentin, despite the fact that, as expected, the pro - apoptotic vaa - i molecule induced its cleavage. since che induced the cleavage of gelsolin and paxillin, an event requiring caspase activation [19, 27 ], we next decided to investigate whether or not che acted via caspases. che - induced pmns were incubated in the presence or absence of a pan - caspase inhibitor (z - vad - fmk) or a caspase-3 (z - dqmd - fmk), caspase-6 (z - veid - fmk), or caspase-9 (z - lehd - fmk)-specific inhibitor and apoptosis was evaluated by cytology. as expected, the tested inhibitors suppressed sa, but only the pan caspase inhibitor was able to reverse the pro - apoptotic activity of che when the apoptotic rate was 70% rather than close to 90% (grey zone in figure 6). we then decided to determine whether or not p38 was involved in che - induced neutrophil apoptosis, since this kinase is activated by che. however, as illustrated in figure 7, treatment with the p38-specific inhibitor (sb203580) did not reverse the pro - apoptotic activity of che, despite the fact that this inhibitor, as well as the mek-1/mek-2 inhibitor, was able to reverse the antiapoptotic activity of the cytokine gm - csf. during apoptosis, pmns are known to shrink and cytoskeleton breakdown occurs, as has been shown by the cleavage of several cytoskeletal proteins largely associated with caspase activity [19, 2729 ]. because of the importance of eliminating apoptotic pmns by professional phagocytes for the resolution of inflammation [13, 14, 16, 18, 30 ], it is critical to identify new agents that may act as neutrophil activators and, more specifically, that may act as regulators of pmn apoptosis, and to understand their modes of action. this is the first study to investigate the role of the che from esenbeckia leiocarpa bark in human neutrophil cell physiology, an extract that possesses interesting anti - inflammatory properties. clearly, che is a novel pmn activator, since it induced actin polymerization and cell signaling events, including p38 activation. furthermore, che induced cleavage of cytoskeletal proteins and pmn apoptosis. the fact that the pro - apoptotic activity of che was reversed by the z - vad - fmk pan - caspase inhibitor (known to inhibit the effector caspase-1, -3, -4, and -7) suggests that several caspases could be simultaneously or sequentially activated and also that several pathways of cell apoptosis may be involved. caspase-3 is known to be a central player in both classical extrinsic and intrinsic pathways of cell apoptosis. in addition, caspase-4 activation is known to be a major event occurring during the more recently identified pathway of cell apoptosis : the endoplasmic reticulum (er) stress - induced apoptosis. only recently have there been some evidences of the er stress - induced pathway in human pmns. in contrast to z - vad - fmk, the more specific inhibitors used in this study (those to caspase-3, -6, or -9) were not able to reverse the che pro - apoptotic activity. because che accelerated sa, and the three main pathways of cell apoptosis were activated during sa, it is plausible that inhibiting only one caspase with a more specific inhibitor than the pancaspase was not sufficient to reverse the effect of che. in addition, che is a crude extract composed of several hundred chemical compounds ; because of this, it is plausible that some compounds preferentially activate a given cell apoptotic pathway, while others activate several pathways leading to the inability of a particular caspase inhibitor to reverse the pro - apoptotic activity of che. however, the fact that treatment with the p38 inhibitor (sb203580) did not reverse the pro - apoptotic activity of che led us to conclude that che induced pmn apoptosis by a p38-independent mechanism, and that p38 is probably involved in other pmn functions, although this remains to be determined. several mapks, including p38 and erk-1/2, are known to be involved in the regulation of pmn apoptosis. erk-1/2 activation is normally implicated in pmn survival, while activation of p38 is observed in pmns in response to treatment with pro- or antiapoptotic agents. thus, the role of p38 in the regulation of pmn apoptosis is unclear and the present data support further our hypothesis that p38 is involved in functions other than apoptosis in human pmns. the mode of action of che for inducing apoptosis is not a conventional one. in general, pro - apoptotic agents increase cd16 shedding in human pmns, but che did not alter cd16 cell surface expression when compared to sa. however, che increased cell surface expression of annexin - v and induced typical morphological changes, as evidenced by the appearance of pyknotic nuclei. although the mechanism involved in cd16 shedding is not fully defined, it appears that a metalloproteinase is responsible for cd16 shedding [34, 35 ]. of note, it has been reported previously that cd16 shedding is not only inhibited by metalloproteinase inhibitors, but also by serine protease inhibitors indicating inhibited that this phenomenon is very complex [35, 36 ]. furthermore, a link between cytoskeleton rearrangement and the induction of cd16 shedding has been proposed, and actin polymerization has been found to induce shedding of cd16. this was determined with the use of jasplakinolide, an actin - polymerizing peptide, where enhanced actin polymerization was found to induce time- and concentration - dependent shedding of cd16. therefore, the fact that che did not increase cd16 shedding but induced actin polymerization is another criterion indicating that che induces atypical apoptosis in pmns. in addition, although che induced the degradation of the cytoskeletal proteins gelsolin and paxillin, as expected for pro - apoptotic molecules, it did not induce the degradation of vimentin that is normally increased by pro - apoptotic agents when compared to sa [23, 27 ]. in conclusion, the results of this study clearly establish that che is a novel pmn activator. although its mode of action has not yet been fully defined, we demonstrated that che induced tyrosine phosphorylation events, including p38 activation, and targeted the cytoskeleton, as evidenced by actin polymerization and degradation of cytoskeletal proteins. che induces apoptosis in pmns by a caspase - dependent and p38-independent mechanism but acted as an atypical pro - apoptotic agent, based on its inability to increase cd16 shedding and vimentin degradation. it is not without any precedent that a proapoptotic agent induces apoptotis in human pmns, since we have previously demonstrated that arsenic trioxide also activates p38, but not erk. we conclude that che possesses in vitro anti - inflammatory properties, based on its ability to induce pmn apoptosis, and this may be, at least in part, responsible for its previously reported in vivo anti - inflammatory activity. | despite the fact that esenbeckia leiocarpa, a brazilian plant, possesses potential anti - inflammatory properties, its effect in neutrophils, key players in inflammation, has never been investigated. in this study, a crude hydroalcoholic extract (che) was used to evaluate the potential toxic or agonistic effect of e. leiocarpa in human neutrophils. at a noncytotoxic concentration of 500 g / ml, che increased actin polymerization and cell signaling events, especially p38 mapk. its modulatory activity on neutrophil cell apoptosis was investigated by cytology and by flow cytometry and, although che increased the apoptotic rate (by cytology) and increased annexin - v binding, it did not, unexpectedly, increase cd16 shedding. che increased the degradation of the cytoskeletal proteins gelsolin and paxillin but, surprisingly, not of vimentin. the proapoptotic activity of che was reversed by a pan - caspase inhibitor but not by a p38 inhibitor. we conclude that che is a novel human neutrophil agonist that induces apoptosis by a caspase - dependent and p38-independent mechanism in an atypical fashion based on its lack of effect on cd16 shedding and vimentin degradation. since the resolution of inflammation occurs by elimination of apoptotic neutrophils, the ability of che to induce neutrophil apoptosis correlates well with its anti - inflammatory properties, as previously reported. |
acne vulgaris is a common inflammatory disease of the pilosebaceous unit, which affects up to 87% adolescence and 54% of adults with varying degrees of severity. left untreated or inadequately treated, acne vulgaris can lead to psychological and physical scarring. treatment improves the qol of patients with acne and can prevent scarring. according to severity of acne, there are various topical and systemic treatment modalities. in systemic therapy, the multiple modes of action of isotretinoin (13-cis - retinoic acid) makes this compound the major pharmacological breakthrough in acne therapeutics. over the time, oral isotretinoin has proven to be a wonder drug that is highly effective in the treatment of all forms and grades of acne vulgaris, even in lower dosages. oral isotretinoin in the standard regimen of 0.51.0 mg / kg / day for 1632 weeks causes many dose - dependent mucocutaneous and systemic adverse effects. various studies have reinforced the view that lower doses of isotretinoin are also effective in terms of response, adverse effects, and cost ; therefore, other regimens should be used instead of the daily standard regimen. there are few randomized comparative studies of low - dose regimens of oral isotretinoin in the indian literature. thus, the present study was undertaken to compare the efficacy and tolerability of two different fixed low - dose oral isotretinoin regimens in moderate to severe acne vulgaris with a lager sample size and a longer follow - up period. to assess and compare the efficacy and tolerability of two fixed low - dose (20 mg daily and alternate day) oral isotretinoin regimens in moderate to severe acne vulgaris. to assess and compare the efficacy and tolerability of two fixed low - dose (20 mg daily and alternate day) oral isotretinoin regimens in moderate to severe acne vulgaris. this prospective randomized comparative study included 240 patients with moderate to severe acne vulgaris attending the outpatient clinic in the dermatology department. patients with a personal or family history of hyperlipidemia or diabetes, and those having drug - induced acne were excluded. pregnant women, women desiring pregnancy, and women using temporary methods of contraception were also excluded. patients were finally graded into mild, moderate, and severe acne based on severity as described by pochi [table 1 ]. to enable analysis of improvement in lesion count, total acne load (tal) the patients were randomly assigned into two groups (a and b) ; each group consisted of 120 patients. groups a and b were treated with a fixed dose of 20 mg of oral isotretinoin daily and alternate days, respectively, for a total period of 24 weeks and followed up for 12 weeks post - therapy. patients were also advised to apply topical 1% clindamycin gel twice daily and white petroleum jelly on lips when required. all patients visited at an interval of two weeks for 24 weeks then six weekly interval for 12 weeks after completion of treatment. the adverse effects and response according to the number and types of lesions were recorded at every visit. complete blood cell counts, liver function tests, and serum lipid profile were done initially and repeated at four and eight weeks thereafter. emergence of near pretreatment severity of acne in the treated patient within 12 weeks of follow - up was considered as relapse. greater than twofold increase in baseline laboratory values of liver function tests and serum lipid profile was considered a criterion for discontinuation of therapy. treatment response was also evaluated according to response criteria, which is as follows : 1 + = poor response (90% reduction in the lesion counts). 1 + = poor response (90% reduction in the lesion counts). criteria for grading of acne vulgaris definition severity index statistical analyses were done using computer software (spss version 20 and primer). all the findings were analyzed by using chi - square test, student 's t - test and one - way analysis of variance (anova), mann whitney u - test, repeated anova, and wilcoxon - statistical test wherever required. the study protocol was approved by the research review board of the institution and had no financial support from any outside agency. in the present study, a total of 240 patients with a mean age of 18.88 2.46 years (range 1530 ; median 18.51) were selected prospectively and randomly assigned into two groups. out of 240 patients, six patients were lost to follow up during the study period. for final result analysis, there were 234 patients (group a, 118 and group b, 116). no statistically significant difference was observed in age, gender, and disease characteristics between the two groups [table 3 ]. a statistically significant difference was observed in the family history of acne among both groups. patient characteristics the initial mean tal in both groups was comparable as per mann whitney tests for independent samples (group a = 113.38 53.3 ; group b = 108.7 57.5 ; p value > 0.5). during follow - up, a statistically significant decrease in tal in both groups was observed as per wilcoxon paired two - tailed probability test (p value 0.05). in the era of smart phones with increasing popularity of social media and exchange of selfies between adolescents and young adults, the predominance of acne vulgaris in this psychologically labile age group coupled with its potentially lifelong sequelae makes it a matter of great financial and psychosocial concern. oral isotertinoin continues to be the mainstay of therapy for acne, because of its efficacy, ability to the four pathophysiologic factors, high rates of permanent remission, and prevention of permanent scarring in acne. multiple studies have addressed that the duration of remission after initial course of isotretinoin is variable and appear to correlate with several potential contributory factors, for example, age of patient, male gender, cumulative dose administered, endogenous androgen - excess (ie, polycystic ovary syndrome), presence / persistence of macrocomedones, presence of sinus tracts, and patient adherence. recurrence of acne after an initial course of isotretinoin is not always of the same severity as before isotretinoin treatment. although isotretinoin was approved by the fda for treatment of severe recalcitrant nodular acne, the appropriate use of isotretinoin also includes patients with moderate - to - severe acne or lesser degree of acne producing physical scarring or psychological distress and unresponsive to adequate conventional therapy. it has been suggested that isotretinoin should be initiated early in the management of acne, even lower - dose isotretinoin (0.250.5 mg / kg / day for 24 weeks) offering a good balance between efficacy and dose - related adverse effects. to decrease the incidence of adverse effects and to increase adherence of patients to therapy, the different low - dose isotretinoin regimens for different duration has been tried to treat acne in various studies (summarized in table 8). the doses of isotretinoin that were used in these studies varied from 0.14 to 0.75 mg / kg / day. the cumulative dosage varied from 21 mg / kg to as high as 180 mg / kg with a mean dose of 49.71 mg / kg. on comparison of these studies, the efficacy of low - dose isotretinoin in the treatment of acne varied from 69% to 99.8% and the relapse rate varied from 0% to 39%. comparison of different low - dose isotretinoin studies akman assessed the efficacy 0.5 mg / kg / day oral isotretinoin (10 days / month six months or each day in first month then 10 days / month five months or daily six months) in moderate - to - severe acne and reported 90% resolution and relapse in 15% of cases. studied the efficacy of low - fixed dose isotretinoin (0.150.28 mg / kg / d six months) plus topical 1% clindamycin gel in moderate grade of acne and observed clinically significant results in 87.54% of the patients, including 68.20% very good and 19.34% of good results. in a recent study by rao. (20 mg / d for a period of three months in moderate - to - severe acne), reported very good results in 90% of participants and relapse in 4% of participants. most of these studies have found that different low - dose regimens of isotretinoin are effective in moderate - to - severe acne with a low incidence and severity of adverse effects. in the present study, we have tried to compare the response of two different fixed low - dose regimens of oral isotretinoin in moderate to severe acne vulgaris. we have tried to correlate treatment response on the basis of various scales such as mean percentage decrease in tal, response criteria, and disease severity. a significant reduction in mean tal from the initial mean tal was observed in the both groups. the initial mean tal in groups a and b was 113.3 53.3 and 108.7 57.5, respectively, which at the end of therapy at 24 weeks decreased to 1.12 3.2 and 3.2 7.2, respectively. we observed that group a performed significantly better as compared with group b during the whole study period. the mean percentage decrease in tal in group a and group b at 24 weeks was 98.99% and 97.69%, respectively ((p value < 0.01), which decreased to 96.03% and 92.82%, respectively, at 36 weeks ((p value < 0.01). when both the groups were compared according to severity of acne, in the cases of severe acne significant difference was observed in terms of response between groups a and b until the end of 36 weeks. while in the cases of moderate acne, significant difference in the response between both groups was observed only up to 12 weeks. according to response criteria, at 24 weeks the excellent response in groups a and b was observed in 98.3% and 93.96% patients, respectively (p 0.166) which at 36 weeks decreased to 90.6% and 74.1% patients, respectively (p 0.004). although our study found that number of acne - free patients seen at the end of therapy was decreased at the end of follow up ; however, the patients developing acne recurrence had mild - grade acne. the doses of isotretinoin used in the present study were in the range of doses used in previous studies ; however, the degree of improvement observed during our study was higher than most of the previous similar low - dose isotretinoin studies, this may be due to either the use of topical 1% clindamycin phosphate gel as adjuvant or because of the longer treatment period in our study. in the present study, most common adverse effects noted in both groups were cheilitis (group a, 97.46% and group b, 95.69%) and dry skin (group a, -16.9% and group b, 10.3%). other less frequent adverse effects observed were pruritus, dry eyes, hair fall, urticaria, dry mouth, dry nose, facial redness on sun exposure, menstrual irregularities, head ache, myalgia, arthralgia, oral aphthous, moderately increased triglycerides level, abnormal liver function test, forgetfulness, dermographism, and pigmentation of face. all the adverse effects were managed successfully ; none of the patients required discontinuation of therapy because of adverse effects. various previous studies also showed that low - dose isotretinoin has lesser adverse effects as compared with the conventional high - dose regimen. reported that isotretinoin in the doses of < 0.2 mg / kg reduces the risk of acne flare upon initiation of therapy. various studies have reported many neuropsychiatric adverse effects. however, in our study one patient developed forgetfulness, which was reported in none of the previous low - dose studies. in 1983, in a series, 6/110 (5.5%) of isotretinoin - treated patients (12 mg / kg / day) developed symptoms of depressed mood, crying spells, malaise, and forgetfulness. in contrast to various previous studies of low - dose isotretinoin, none of the patients in our study showed relapse, which may be due to the short follow - up period of 12 weeks. we conclude that fixed low - dose regimen of oral isotretinoin should be encouraged because of excellent response in moderate - to - severe acne with the advantage of lesser adverse effects, patient compliance, and cost effectiveness. in moderate acne 20 mg alternate day regimen can be preferred, but for severe acne 20 mg daily regimen is a better choice in the terms of response. limitations of the current study were a small sample size and short follow - up period. prospective studies with larger sample sizes and longer durations of follow up are therefore required. the authors certify that they have obtained all appropriate patient consent forms. in the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal. the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity can not be guaranteed. the authors certify that they have obtained all appropriate patient consent forms. in the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal. the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity can not be guaranteed. | background : oral isotretinoin is highly effective in all forms and grades of acne, even in lower dosages (< 0.5 mg / kg / day). there is a paucity of comparative data on the various low - dose regimens of oral isotretinoin in the indian literature.objectives:to assess and compare the efficacy and tolerability of two low - dose oral isotretinoin treatment regimens (20 mg daily and 20 mg alternate days) in moderate to severe acne vulgaris.materials and methods : a total of 240 patients with moderate to severe acne vulgaris were selected and randomized into two groups and treated with a fixed dose of 20 mg of isotretinoin (group a - daily and group b - alternate days) for 24 weeks and followed up for 12 weeks post therapy.results:a total of 234 patients completed the study. at the end of therapy, decrease in the total acne loads up to 98.99% (group a) and 97.69% (group b) was achieved from the baseline (p < 0.01), excellent response was observed in 98.3% (group a) and 93.96% (group b) patients (p = 0.166). in the severe acne, group a performed significantly better than group b until the end of 36 weeks. while in the moderate acne, significant difference in the response between both groups was observed only up to 12 weeks. no serious side effect was observed.conclusion:both isotretinoin regimens were well tolerated and found to be an effective treatment for moderate to severe acne vulgaris. however, in moderate acne 20 mg alternate day regimen may be preferred. a 20 mg daily regimen is a better choice for severe acne in terms of response.limitation:small sample size and short follow - up period. |
choledochal cysts are congenitally malformed thin walled, dilated, intrahepatic or extrahepatic bile ducts. these cysts offer a major challenge for diagnosis and treatment during pregnancy because of the altered physiology associated with it. there has to be fine balance between the benefits as well as the risks associated with the treatment. it is secondary to raised intracystic pressure because of distal stricture or stones [4, 5 ]. spontaneous rupture of the choledochal cyst during immediate post partum has rarely been reported [7, 8 ]. here we describe a young female who presented to us with choledochal cyst with cholangitis during pregnancy. but unfortunately she presented in the immediate post partum with peritonitis secondary to spontaneous rupture of the cyst. the rarity of this presentation in post partum poses a diagnostic dilemma in the minds of treating clinician. this complication should be kept in mind while treating a known patient of choledochal cyst who presents to the emergency with peritonitis. a 27-year - old primigravida presented to surgical emergency with obstructive jaundice and grade ii cholangitis at 6 months of pregnancy. she was evaluated and was found to have a choledochal cyst on ultrasound and this was subsequently confirmed as type iv (fig. 1) on magnetic resonance cholangiopancreatography (mrcp). for these complaints, she underwent ercp and a biliary stent was placed so as to tide over the situation. an endobiliary stent could be placed and she was being managed conservatively but had pain abdomen, fever and vomiting 1 week after stenting. tachycardia (pr : 120/min) was present and there was generalized guarding and rigidity on abdominal examination. a contrast - enhanced ct scan was done that revealed the rupture of the suprapancreatic part of the choledochal cyst with free fluid in the abdominal cavity (fig. 2). after optimization, this patient underwent cyst excision with roux - en - y hepaticojejunostomy. histopathology of this excised cyst confirmed the choledochal cyst rupture without any evidence of dysplasia (fig. the patient did well in the postoperative period and was discharged on the 10th postoperative day. with recent advances in medical science, choledochal cyst is diagnosed 25% of the times during adulthood and rarely during pregnancy [9, 10 ]. it is associated with multiple complications during pregnancy like cholangitis, preterm labor, abortion and even rupture. the cumulative risk of spontaneous choledochal cyst rupture varies between 1.8% and 2.8% [11 - 13 ]. rupture is more common during childhood and rare during post partum period of the pregnancy. weakness of the dilated cyst wall with raised intracystic pressure because of stones / strictures, trauma due to multiple interventions, regurgitation of the amylase rich fluid in the bile duct and association of the anomalous pancreatobiliary junction are the commonly reported in literature [14 - 18 ]. multiple ercp and stent placement secondary to cholangitis causing the cbd weakness is the most probable cause of rupture in the present case. ercp is associated with increased risk of radiation exposure and subsequent malformations in the fetus. many studies have proved the efficacy of ercp during pregnancy particularly when the radiation dose to the fetus is calculated. ercp when indicated should be done with utmost care and in controlled conditions to prevent fetal damage.. however, pregnancy along with increased pressure during childbirth puts these patients at risk for cyst rupture and fetal loss. we tided over the complications of the cyst with minimally invasive techniques but repeated interventions for the same might have triggered the rupture. there is no consensus on the management of the ruptured choledochal cyst due to the rarity of the condition. friability of the cyst wall, hemodynamic instability, inflammation and edematous bowel mandate the drainage of the cbd either with a t - tube or percutaneous transhepatic drain [2, 3 ]. alternatively, single stage operation of cyst excision with bilioenteric drainage can be performed provided the intraoperative conditions are favorable. this patient had normal bowel with minimal inflammation of the bile duct so single stage operation was contemplated. cyst rupture should be kept as a differential diagnosis whenever a known patient harboring choledochal cyst presents with peritonitis. pregnancy with choledochal cyst rupture puts the maternal as well as fetal life at risk. cyst rupture should be kept as a differential diagnosis whenever a known patient harboring choledochal cyst presents with peritonitis. pregnancy with choledochal cyst rupture puts the maternal as well as fetal life at risk. ag, kc and lk were involved in writing, editing and approval of the manuscript. | with the advent of newer radiological investigations, choledochal cysts are being diagnosed more often in present era. these cysts are commonly diagnosed in early childhood and infancy, although some go undetected to be diagnosed in adulthood. these malformations are associated with multiple complications like cholangitis, jaundice, pancreatitis, rupture or even malignancy. here we describe a post partum female, who was diagnosed to have choledochal cyst during sixth month of pregnancy. she presented with obstructive jaundice in cholangitis and was subjected to endoscopic retrograde cholangiopancreatography (ercp) with stenting. this female delivered normally at term. she again had jaundice with cholangitis during early post partum period. endoscopic stenting could be performed. she had features of peritonitis after 1 week of stenting. investigations were performed and a diagnosis of spontaneous rupture of choledochal cyst was made. she underwent laparotomy and lavage with complete excision of the choledochal cyst and roux - en - y hepaticojejunostomy. |
the introduction of osseointegration and the use of endosseous implants provide alternative treatment options to clinicians for all indications of edentulism.1 implant - supported, fixed restorations are usually classified as screw- or cement - retained.2,3 the advantage of screw - retained restorations is the combination of a rigid connection between the restoration - abutment complex and its retrievability. however, these restorations are usually more expensive than cement - retained restorations because of the use of extra components and laboratory costs.4 cement - retained restorations were introduced to compensate for problems of screw loosening and the lack of esthetics of screw - retained restorations.4 the lack of fastening screws in cement - retained restorations reduces the possibility of preload stress and screw loosening.5 the major advantages of cement - retained restorations are the passive fit of frameworks, enhanced esthetics resulting from lack of screw access holes, and reduced complexity of laboratory procedures and chair - side time.6,7,8 the disadvantages of cement - retained restorations include the requirement for extra time for cementation, removal of residual excess cement, limited design possibilities for superstructure, and the reduced possibility for modifying treatment in case of periimplantitis.9 the existence of residual excess cement in peri - implant sulcus is a common complication of cement - retained implant prostheses.10,11 if there is excess cement located in the soft tissue deeper than 3 mm, it might be difficult to observe and remove. insufficient removal of excess cement may result in swelling, soreness, exudation or bleeding on probing, and can initiate a local inflammatory process, which is evidence of peri - implant disease and can ultimately lead to implant failure.12,13,14 moreover, removal of excess cement may cause scratching and gouging on the implant surfaces when plastic and metal scalers are used.15 several authors have reported on techniques regarding procedures used to assist in minimizing residual excess cement extrusion.16,17,18 this article describes a method of controlling cement flow, using stock or custom implant abutments, when cement - retained implant - supported restorations are utilized. the method can be used easily and quickly at chair - side by the use of daily restorative and laboratory materials. the use of die spacers results in a uniform space between the crown restoration and the implant abutment. check the marginal fit of the crown restoration to the implant analog on the dental model. 1a) according to the manufacturer 's recommendations (siladent die spacer 12 m gold, dr. bhme & schps gmbh, germany). repeat applying the die spacer until the desired cement film thickness is achieved (application of the die spacer 3 - 4 times forms a film thickness of approximately 45 - 50 m). completely fill the crown restoration with a bis - acrylic temporary restorative material (luxatemp plus, dmg chemisch - pharmazeutische fabrik gmbh, germany) and put a retention pin (bredent gmbh & co. kg, germany) with a smaller diameter tip into the uncured material to form a handle (fig. 1d) and secure the retention pin until the bis - acrylic material is cured. remove the crown restoration and check any discrepancies between the implant abutment and the bis - acrylic abutment. check that there are no voids on the duplicate abutment, and that the finish line has been duplicated accurately (fig. 1f). clean the intaglio surface of the crown restoration with air and check any residual die spacer. mix a desired luting agent (temp bond ne, kerrhawe s.a., switzerland) and apply to the intaglio surface of the crown restoration (fig. 2b) place the crown gently onto the bis - acrylic abutment and wipe off the excess cement with a cotton swab (fig. if there is a lack of cement layer, line the intaglio surface of the crown restoration with a thin layer of extra luting agent. this article presents a method of minimizing the excess cement around implant - retained restorations. the advantage of the technique is allowing the control of cement flow by using a custom - made duplicate abutment that can be fabricated quickly, easily, and economically at the time of implant abutment / crown insertion.16 the major benefit of extraoral cementation is to allow the indirect removal of excess cement around the margins. this clinical procedure is extremely important for avoiding the potential of peri - implant disease caused by residual cement left in the gingival sulcus. it is important not to form an oversized cement space when duplicating the implant abutment. the use of a die spacer provides a space of approximately 50 m, which represents the ideal cement space, and may be used for both custom and prefabricated abutments. the disadvantage of the technique is that it is a time - consuming procedure for routine clinical processes. dumbrigue.16 stated that when the extraoral cementation technique is preferred, the luting agent must have a longer working time. when a custom abutment is to be used, the dental laboratory may be instructed to make an abutment analog using an acrylic resin, but this is time consuming for the technician and involves additional laboratory costs.18 | the major drawback of cement - retained restorations is the extrusion of the excess cement into the peri - implant sulcus, with subsequent complications. insufficient removal of the excess cement may initiate a local inflammatory process, which may lead to implant failure. this article presents a method of controlling cement flow on implant abutments, minimizing the excess cement around implant - retained restorations. |
the cerebral abscess is a common central nervous system infection that can result from trauma, hematogenous spread, or spread from an adjacent infection such as otitis media or sinusitis. despite exhaustive searches, 15 to 30% of abscesses are termed cryptogenic when no source of infection is identified20). a distant infection focus that can cause brain abscesses is a cardiac right to left shunt, which is related to patent foramen ovale15), cyanotic cardiac disease15) or pulmonary arteriovenous malformation or fistula (avf). pulmonary avf is a rare congenital vascular malformation involving direct communication between the pulmonary artery and vein without an intervening capillary bed. approximately 8095% of pulmonary avfs are associated with hereditary hemorrhagic telangiectasia (hht), known as osler - weber - rendu syndrome5,8,9). the clinical triads of pulmonary avf is cyanosis, exertional dyspnea, and digital clubbing ; however, 56% of one large series were asymptomatic8). the most prominent central nervous system (cns) complications associated with pulmonary avfs are neurologic events, including transient ischemic attacks31), recurrent stroke1,6,18,27), brain abscesses, and seizures26).. we will focus on the cryptogenic brain abscess as developed by patients with idiopathic pulmonary avf, which may be detected only if we consider it may cause the brain abscess. a 65-year - old woman was admitted with a 1-month history of headache and cognitive impairment that had become aggravated 10 days prior. she showed impairment in orientation and judgment, but there were no lateralization signs of motor paralysis or cranial nerve deficits. there was no history of diabetes mellitus, hypertension, lung disease or heart disease. her blood pressure was 110/70 mmhg, pulse rate was 74/min, body temperature was 36.5c, and her respiration rate was 20 breaths / min. erythrocyte sedimentation rate was 54 mm / h and c - reactive protein (crp) was 0.22 mg / l. arterial blood gas analysis revealed a ph of 7.425, pco2 of 42.5 mmhg, po2 of 90.4 mmhg, and an hco3 of 22.2 mmol / l on room air. total cholesterol was 249 mg / dl and ldl - cholesterol was 172 mg / dl. brain computed tomography (ct) showed a mass with perilesional edema on the right frontal lobe. brain magnetic resonance (mr) imaging revealed a 43-cm ring enhanced mass in the right frontal lobe, which was associated with severe edema and midline shifting to the left side (fig. a chest x ray showed nodular infiltrations on the right mid - lung zone and the left upper and lower lung zones. 2) and antibiotics were maintained for 8 weeks. her past history gave no indication of exertional dyspnea or episodes of hemoptysis, melena, hematemesis, epistaxis or hematuria that might suggest underlying hht. a 45-year - old woman presented with a 7-day history of a progressive left hemiparesis. on admission, blood tests showed a hb of 13.4 g / dl, an hct of 39.6%, a white blood cell (wbc) count of 6290 cells/l, and a crp elevated to 2.62 mg / l. diffusion mr imaging showed a diffusion - restricted ovoid mass on the right motor and sensory cortex measuring 1.50.9 cm that was surrounded by diffuse vasogenic perilesional edema (fig. 3). mr imaging and mr spectroscopy revealed an enhancing lesion involving the right motor and sensory cortex and increased lactate / lipid complex, which was compatible with a brain abscess. a chest x ray did not suggest underlying lung disease. however, a chest ct revealed a pulmonary avf in the right upper lung (fig. the brain abscess progressed despite treatment with vancomycin and ceftriaxone, so it was removed via craniotomy and the pulmonary avf was embolized. a 65-year - old woman was admitted with a 1-month history of headache and cognitive impairment that had become aggravated 10 days prior. she showed impairment in orientation and judgment, but there were no lateralization signs of motor paralysis or cranial nerve deficits. there was no history of diabetes mellitus, hypertension, lung disease or heart disease. her blood pressure was 110/70 mmhg, pulse rate was 74/min, body temperature was 36.5c, and her respiration rate was 20 breaths / min. erythrocyte sedimentation rate was 54 mm / h and c - reactive protein (crp) was 0.22 mg / l. arterial blood gas analysis revealed a ph of 7.425, pco2 of 42.5 mmhg, po2 of 90.4 mmhg, and an hco3 of 22.2 mmol / l on room air. total cholesterol was 249 mg / dl and ldl - cholesterol was 172 mg / dl. brain computed tomography (ct) showed a mass with perilesional edema on the right frontal lobe. brain magnetic resonance (mr) imaging revealed a 43-cm ring enhanced mass in the right frontal lobe, which was associated with severe edema and midline shifting to the left side (fig. a chest x ray showed nodular infiltrations on the right mid - lung zone and the left upper and lower lung zones. 2) and antibiotics were maintained for 8 weeks. her past history gave no indication of exertional dyspnea or episodes of hemoptysis, melena, hematemesis, epistaxis or hematuria that might suggest underlying hht. a 45-year - old woman presented with a 7-day history of a progressive left hemiparesis., blood tests showed a hb of 13.4 g / dl, an hct of 39.6%, a white blood cell (wbc) count of 6290 cells/l, and a crp elevated to 2.62 mg / l. diffusion mr imaging showed a diffusion - restricted ovoid mass on the right motor and sensory cortex measuring 1.50.9 cm that was surrounded by diffuse vasogenic perilesional edema (fig. 3). mr imaging and mr spectroscopy revealed an enhancing lesion involving the right motor and sensory cortex and increased lactate / lipid complex, which was compatible with a brain abscess. however, a chest ct revealed a pulmonary avf in the right upper lung (fig. the brain abscess progressed despite treatment with vancomycin and ceftriaxone, so it was removed via craniotomy and the pulmonary avf was embolized. cryptogenic brain abscesses can occur due to rare diseases that are not addressed in routine clinical practice. congenital cyanotic heart disease3), patent foramen ovale12,15), thoracic infection19) or asymptomatic dental infections7) are commonly associated with cerebral abscesses. idiopathic asymptomatic pulmonary avfs are also a cause of brain abscess, especially recurrent brain abscess (table 1). the incidence of idiopathic pulmonary avf - related cns complications is between 19 and 59 % 11,25,29). associated neurological events included migraine, transient ischemic attack, stroke, abscess, and seizure17,26,30). the incidence of brain abscess in patients with a pulmonary avf is around 1 to 5%8). the most likely mechanism for these neurological events is a paradoxical embolism across the pulmonary avf or across a coexisting cerebral arteriovenous malformation in patients with hht17). the pulmonary capillary bed acts as a filter that removes small thrombi and bacteria as they enter the bloodstream, even during daily activities such as oral hygiene. in a pulmonary avf, the pulmonary capillary bed is bypassed, providing a direct right to left shunt that depends on the diameter of the feeding artery. as a consequence, patients may develop paradoxical emboli that present as a transient ischemic attack, stroke, or brain abscess5). the fundamental defect that we found was a right - to - left shunt from the pulmonary artery to the pulmonary vein, and the degree of shunting determines the clinical effects. if shunting is minimal, cyanotic symptoms are usually absent. if the right - to - left shunt is greater than 20% of the systemic cardiac output, or if there is reduction of hemoglobin by more than 50 g / l, the patient will have obvious cyanosis, clubbing, and polycythemia17). the characteristic findings of cyanosis, clubbing and an extra - cardiac murmur do not always accompany pulmonary avf, and diagnosis may be difficult. a review of the mayo clinic experience suggested a morbidity of 2633% and mortality of 816% in untreated patients with pulmonary avf26). the international guidelines for the management of pulmonary avf in hht recommends that treatments should be applied to all adults with avfs and children with symptomatic pulmonary avfs. the decision to treat in asymptomatic children (no dyspnea, no exercise intolerance, no growth delay, no cyanosis or clubbing, no previous complication) should be made on a case - by - case basis. the selection of pulmonary avfs for embolization is based on feeding artery diameter, generally 3 mm or greater10). a literature review (table 1) indicates that idiopathic pulmonary avfs can cause brain abscess in patients as young as 18 years old. based on these reported series, 10 of 13 patients did not have pulmonary avf - related symptoms until the brain abscess developed. idiopathic pulmonary avfs are more frequently solitary, around 80%, compared with that of hht (< 40%)30). it means idiopathic pulmonary avfs are less likely to be associated with large right - to - left shunt, this might in part explain why patients with idiopathic pavms might have a lower frequency of cyanosis and polycythemia. also, previous hht series have shown an association between number of pulmonary avfs and cerebral abscess risk22). this might explain why idiopathic pulmonary avfs are associated with a lower frequency of cerebral abscess than in hht. the organisms in the brain abscess were not consistent but most frequently isolated ones were streptococci genus. 6 cases out of 13 did not reveal an organism at all. if young adults without a premorbid history present with a brain abscess, pulmonary problems must be evaluated. this report highlights the need to consider pulmonary avf as an etiology of cerebral abscess when routine investigations fail to detect a source. | brain abscess commonly occurs secondary to an adjacent infection (mostly in the middle ear or paranasal sinuses) or due to hematogenous spread from a distant infection or trauma. pulmonary arteriovenous fistulas (avfs) are abnormal direct communications between the pulmonary artery and vein. we present two cases of brain abscess associated with asymptomatic pulmonary avf. a 65-year - old woman was admitted with a headache and cognitive impairment that aggravated 10 days prior. an magnetic resonance (mr) imaging revealed a brain abscess with severe edema in the right frontal lobe. we performed a craniotomy and abscess removal. bacteriological culture proved negative. her chest computed tomography (ct) showed multiple avfs. therapeutic embolization of multiple pulmonary avfs was performed and antibiotics were administered for 8 weeks. a 45-year - old woman presented with a 7-day history of progressive left hemiparesis. she had no remarkable past medical history or family history. on admission, blood examination showed a white blood cell count of 6290 cells / ul and a high sensitive c - reactive protein of 2.62 mg / l. ct and mr imaging with mr spectroscopy revealed an enhancing lesion involving the right motor and sensory cortex with marked perilesional edema that suggested a brain abscess. a chest ct revealed a pulmonary avf in the right upper lung. the pulmonary avf was obliterated with embolization. there needs to consider pulmonary avf as an etiology of cerebral abscess when routine investigations fail to detect a source. |
in the field of dentistry, gingival hypertrophy (gh) is a common presenting complaint, especially among patients belonging to pediatric age group. gingivitis is a commonly occurring phenomenon since the oral cavity is a potential site for active infection as it is constantly exposed to pathogenic microorganisms. the prevalence of gh among school going children is nearly 14%, inflammatory origin being the most common cause followed by chronic drug intake. hence, there is a tendency among us to consider gh as a mere inflammatory response to local infection rather than considering systemic illnesses ; this can eventually lead to delay in diagnosis and initiating appropriate treatment. gh due to acute myeloid leukemia (aml) in a child is extremely rare. here, we report a case of aml (subtype m5 of fab classification) in a 3-year - old male child wherein the disease primarily presented as gh. a 3-year - old male child presented to us with fever and body pain for 2 weeks, gum swelling for 1-month duration, initially presented to a pediatrician and a dentist, for which symptomatic treatment was given. the child was again reviewed with the pediatrician after 1 week with persisting symptoms. no history of halitosis or dental caries. on general examination, he had pallor ; there was no icterus, cyanosis, clubbing, pedal edema, or generalized lymphadenopathy. oral examination revealed the enlargement of maxillary and mandibular gingiva covering two - third of the crown structure in buccal, lingual, and palatal aspects. gingiva was reddish with the loss of stippling, soft, spongy, bleeding on touch but was nontender and not warm [figure 1 ]. on abdominal examination, the liver was palpable 2.5 cm below the right costal margin, and the spleen was palpable 2 cm beyond the left costal margin. g / l, total white blood cell count was 5.6 10/l with 90% blast cells and 10% lymphocytes, and platelet count was 0.9 10/l. his renal and liver function tests were within the normal range ; uric acid and lactate dehydrogenase levels were also normal. bone marrow aspirate smear showed blasts which are large with moderate amount of agranular to granular cytoplasm and round to irregular nucleus with fine chromatin and 13 nucleoli. few of the blasts showed auer rods [figure 2 ]. in flow cytometric analysis, the blasts were positive for cd33, cd117, human leukocyte antigen - dr, and cd13. parents were counseled about his condition, treatment, and outcome of the disease. due to long distance commuting issues, the parents opted for the child to receive treatment elsewhere ; the child was lost to follow - up. most common causes of gh in children are poor dental hygiene and chronic drug intakes such as phenytoin, cyclosporine, and calcium channel blockers. systemic illnesses such as wegener 's granulomatosis, sarcoidosis, crohn 's disease, infantile systemic hyalinosis, tuberculosis, and hereditary gingival hyperplasia should also be considered in the differential diagnosis. acute leukemia, which is the most common malignant disorder in children, is characterized by neoplastic proliferation of blast cells causing accumulation of > 20% blast cells in the bone marrow, interfering hematopoiesis resulting in fatigability, bleeding tendency, and infections. acute leukemia is subdivided into acute lymphoblastic leukemia and acute myeloid leukemia (aml), based on the phenotype of the blast. aml in a child generally presents with fatigue, pallor, abnormal bleeding and infections with or without splenomegaly and lymphadenopathy ; however rarely, it can present with infiltration of blasts cells in tissues such as skin, mucosa, and gums. literature review has shown only few studies that have reported cases of aml presenting with oral lesion as a primary manifestation. oral manifestations in leukemia are gh, oral ulcers, pale mucosa, herpes, and candida infections. gingival infiltration in aml is rare, usually associated with subtypes m4 and m5 (fab classification). it is due to infiltration of tissues with neoplastic precursors of myeloid cells or secondary to thrombocytopenia, neutropenia, or impaired granulocyte function. hence, gingival tissue, although unusual, is one of the sites that should be monitored for relapse. although confirmatory diagnosis and treatment of aml is primarily done by the pediatric hemato - oncologist, it is almost always a dentist or a pediatrician who first attend to cases of gh, and hence increasing awareness among them will aid in early detection and prompt referral and drastically improve the outcome of the disease. finally, any gh, particularly when associated with hepatosplenomegaly and abnormal blood counts should raise the suspicion of possible underlying hematological malignancy in the child. | acute leukemia is the most common malignant disorder of childhood. acute leukemia is characterized by marrow failure due to the replacement of marrow elements by leukemic blasts. gingival hypertrophy (gh) due to acute myeloid leukemia (aml) in a child is extremely rare. here, we report a case of aml (subtype m5 of fab classification) in a 3-year - old male child wherein the disease primarily presented as gh. |
interferon - alfa (ifn-) monotherapy has been found with normalization of alanine aminotransferase (alt) levels in a few patients diagnosed as non - a, non - b hepatitis even before hepatitis c virus (hcv) was identified as the chief etiologic agent in this diagnosis. in 1989, the first cases of successful treatment of documented chronic hepatitis c (chc) with ifn- monotherapy were reported, but relapse after the cessation of treatment was common [2, 3 ]. the introduction of combination therapy with ifn- and ribavirin has markedly improved treatment response. nevertheless, less than one - half of patients with chc were able to experience a favorable response to the combination therapy [46 ]. since 2000, the attachment of inert polyethylene glycol to conventional ifn-, pegylated ifn- (pegifn-), reduced degradation and clearance, prolonging the half - life of ifn and permitting less frequent, weekly dosing while maintaining higher sustained ifn levels (compared with 3 times weekly for conventional ifn). now, pegifn--ribavirin combination treatment has been recommended for all patients infected with hcv. for patients infected with hcv genotype 1 (hcv-1), the recommended treatment duration is 48 weeks, whereas for patients infected with hcv-2 or hcv-3, the recommended treatment duration is 24 weeks. there are two distinct but complementary mechanisms for the antiviral effects of ifn- : (a) induction of a non - virus - specific antiviral state in infected cells, resulting in direct inhibition of viral replication, and (b) immunomodulatory effects that enhance the host 's specific antiviral immune responses and may accelerate the death of infected cells. food and drug administration (fda) has approved 3 ifn preparations for treatment of hcv : (a) 3 million units (mus) ifn--2a 3 times weekly ; (b) 3 mus of ifn--2b 3 times weekly ; and (c) 9 gs of ifn alfacon-1 twice weekly, or 15 g 3 times weekly in nonresponders. pegifn is a product of pegylation to conventional ifn (the attachment of inert polyethylene glycol (peg) polymers to a therapeutic protein such as ifn). the larger molecular size of the compound results in a longer half - life due to reduced clearance, while retaining biological activity, and allows more convenient once - weekly dosing. two pegifns [11, 12 ] were studied : (a) pegifn--2a, a 40 kda branched molecule with a terminal half - life of 80 hours (range : 50140 hours) and a mean clearance of 22 ml / hrkg administered at a fixed 180 g per week and (b) pegifn--2b, a 12 kda linear molecule with a mean terminal half - life of 40 hours (range : 2260 hours) and a mean clearance of 94 ml / hr kg, administered on the basis of weight (1.5 g / kg / week). maximal serum concentrations (c max) occur between 15 and 44 hours post dose and are sustained for up to 4872 hours. these two pegifns much improved the rates of svr in comparison with their nonpegylated counterparts [11, 12 ]. ribavirin (1--d - ribofuranosyl-1,2,4-triazole-3-carboxamide) is an oral purine nucleoside analogue with broad activity against viral pathogens. the mechanism of action of ribavirin in chc remains controversial. among the suggested, but not proven, roles of ribavirin in the treatment of chc are an immunologic modulation through switching the t - cell phenotype from type 2 to type 1 ; inhibition of host inosine monophosphate dehydrogenase activity ; depletion of intracellular guanosine triphosphate pools ; induction of mutational catastrophe ; or a moderate, transient, early direct antiviral effect. ribavirin may lead to rapid and lethal mutation of virions or depletion of intracellular guanosine triphosphate, which is necessary for viral rna synthesis. additionally, ribavirin may act synergistically with ifn by upregulating the activity of double - stranded rna - activated protein kinase and enhances the action of interferon - alfa against hepatitis c virus. the most interesting clinical observation is that ribavirin monotherapy had a minimal effect on hcv viremia, despite the fact that serum alt levels were reduced significantly in a considerable proportion of patients with chronic hcv infection. however, the combination of ribavirin and ifn provides a clinically synergistic anti - hcv effect. hence it was proposed that ribavirin may exert its effect on the host immune response. several studies on virus - specific t - cell reactivity in association with ifn treatment have found increased numbers of patients with chc with demonstrable hcv - specific th responses either during treatment or after a sustained therapeutic response. these findings raise the possibility that enhancement of hcv - specific t - cell reactivity may be one mechanism for successful antiviral treatment. hcv - specific t - cell reactivity was uncommon at baseline but increased markedly during antiviral therapy, peaking around treatment weeks 48. the main difference in t - cell reactivity of patients treated with ifn - ribavirin was a significant decrease of the expression of ifn-, whereas inf- expression was similar to that in patients receiving ifn monotherapy. the greater efficacy of ribavirin may exert an anti - inflammatory effect and may help reducing ifn--driven t - cell activation and liver damage. in earlier studies, the primary end point for hcv therapies was a biochemical response, defined as the normalization of alt levels [2, 3 ]. the introduction of virologic assays to detect hcv rna further allows the assessment of a virologic response, defined as polymerase chain reaction- (pcr-) seronegative (50 iu / ml, or 100 copies / ml) for hcv rna. histological response has been assessed in some clinical studies, but there is little indication for posttreatment biopsy in clinical practice. four on - treatment and three patterns of off - treatment virological responses to antiviral therapy for hepatitis c have emerged over the past decade [2123 ]. they include the following : rapid virologic response (rvr) : pcr - seronegative of hcv rna at week 4 ; early virologic response (evr) : there are two kinds stratifications of evr : complete evr (cevr) : pcr - seronegative of hcv rna at week 12;partial evr (pevr) : decrease of hcv rna by > 2 log from baseline values at week 12 ; complete evr (cevr) : pcr - seronegative of hcv rna at week 12 ; partial evr (pevr) : decrease of hcv rna by > 2 log from baseline values at week 12 ; end - of - treatment virologic response (etvr) : pcr - seronegative of hcv rna at the end of therapy ; virologic breakthrough : hcv rna reappearance in serum while still on treatment ; sustained virologic response (svr) : pcr - seronegative of hcv rna 6 months after completing therapy ; virologic relapse : pcr - seronegative of hcv rna at the end of therapy, with return of circulating virus after completion of therapy ; nonresponders : persistently seropositive for hcv rna throughout treatment. more than 97% of patients with svr remain nonviremic by pcr for the subsequent 514 years [24, 25 ]. these patients are regarded as having a high probability of a durable biochemical, virologic, and histological response. until the 1990s, the only therapy of proven benefit for patients with chc was ifn-. initially, a 6-month course of 3 weekly injections of 3 mus of ifn- was approved for treatment of chc, and a biochemical response, defined as the normalization of alt levels, was assigned as the primary end point [2, 3 ]. ifn- monotherapy suppresses serum hcv rna to undetectable levels and normalizes the alt level in 25% to 40% of chc patients, usually within the first 2 - 3 months of treatment. however, these initial responses to ifn- monotherapy are usually transient, and sustained response is documented in only about 8% to 9% of patients. when virologic assays for detection of hcv rna became available, the virological response rates were observed to be lower than those reported with biochemical end points. in the meta - analysis of ifn- monotherapy, normalization of alt levels at the end of treatment and 6 months after stopping treatment was seen in 47% and 23% of treated patients, respectively. etvr and svr, however, were observed in only 29% and 8% of treated patients, respectively. improvement of efficacy on chc could be achieved with higher doses and/or a longer duration of ifn- monotherapy. a doubling of the duration of therapy to 12 months increased the frequency of svrs to approximately 20%. the best efficacy / risk ratio was in favor of 3 mus of ifn- 3 times weekly for at least 12 months in treatment - nave patients with chc. the introduction of ribavirin in combination with ifn- was a major breakthrough in the treatment of chc. even though ribavirin monotherapy was shown to be ineffective, the rate of svrs was 43% and 6% for the ifn--2a with and without ribavirin combination, respectively, and 36% and 18% for the ifn--2b with and without ribavirin combination. a meta - analysis in 1995 showed that the svr rate was significantly higher for ifn - ribavirin combination therapy than for ifn or ribavirin monotherapy (odds ratio [or ] : ifn - ribavirin versus ifn = 9.8 ; 95% confidence interval [ci ] = l.950). several landmark studies then followed and consistently demonstrated the dramatically improved responses to combination therapy, especially for hcv-2 or hcv-3 patients. in 1998, two multicenter randomized controlled trials (rcts) (one u.s. study and one international study) totaling 1,744 previously untreated patients with compensated chc compared 24- and 48-week drug regimens of ifn--2b monotherapy (3 mus 3 times weekly) with those of ifn--2b and ribavirin (1.000 mg / day or 1.200 mg / day for patients weighing 75 kg, resp.) combination therapy followed by 24 weeks of off - therapy followup [5, 6 ]. the overall svr rates for 24 and 48 weeks of therapy were 33% and 41%, respectively, for patients receiving ifn--2b - ribavirin, compared with svr rates of 6% at 24 weeks and 16% at 48 weeks ifn--2b monotherapy. in addition to definitively showing the benefit of combination therapy over ifn alone, these studies made several other important clinical points. second, the likelihood of response to treatment was related to pretreatment virus level and genotype. svrs to 48 or 24 weeks of combination therapy occurred in 29% and 17% of hcv-1 patients, respectively, and in 65% and 66% of hcv-2 or hcv-3 patients. the two studies reinforced the importance of longer duration therapy for 48 weeks in patients with hcv-1 infection. similarly, svrs to 48 or 24 weeks of combination therapy occurred in 38% and 27% of patients with pretreatment hcv rna levels of greater than 2 10 copies / ml, respectively, but the svr rates were no different for those with lower levels (45% and 43%, resp.). a systematic review in 2001 included data from 15 trials in which patients received ifn- monotherapy or ifn--ribavirin combination therapy. in comparison with ifn- monotherapy, combination therapy reduced the nonresponse rate (absence of svr) by 26% in treatment - nave patients (relative risk = 0.74 ; 95% ci = 0.700.78). morbidity and mortality showed a nonsignificant trend during treatment in favor of combination therapy. in 1998, the fda approved the combination of ifn- and ribavirin for patients with chronic hcv infection. in 1999, the easl international consensus conference on hepatitis c recommended that, for patients with chc who have not been previously treated, (a) standard therapy should consist of ifn- and ribavirin in combination for 24 weeks and that (b) treatment should be extended to 48 weeks in patients with both hcv-1 and hcv rna levels greater than 2 10 copies / ml. four rcts compared the efficacy and safety of once - weekly pegifn- monotherapy compared with ifn- monotherapy three times per week for the treatment of chronic hcv infection in treatment - nave patients [11, 12, 32, 33 ]. the recommended dose of pegifn--2a monotherapy, administered fixed at 180 g / week for 48 weeks, achieved higher svr rates compared with ifn--2a monotherapy (30% to 39% versus 8% to 19%) [12, 32, 33 ] ; the pegifn--2b monotherapy, administered according to body weight at 1.5 g / kg / week for 48 weeks, achieved an svr rate of 23%, compared to 12% with ifn--2b monotherapy. of note, conducted the first substantive prospective study confined to patients with compensated cirrhosis or advanced fibrosis. cirrhosis has been a poor predictor of responsiveness and is associated with a high risk of leucopenia and thrombocytopenia [5, 6 ]. this study, however, showed that pegifn monotherapy was both well tolerated and effective in cirrhotic chc patients, with an svr rate of 30%. pegifn monotherapy has been recommended for patients with contraindications to ribavirin, such as those with renal insufficiency, hemoglobinopathies, and ischemic cardiovascular disease. some clinical trials have been reported to date in these populations [34, 35 ]. for patients with contraindications to ribavirin but who have indications for antiviral therapy, pegifn represents the best option of treatment. the results of pegifn- monotherapy encouraged more clinical trials to go on and anticipation that combination therapy with pegifn- and ribavirin would be even more effective. the earlier two large rcts were applied with fixed durations of 48 weeks [36, 37 ]. in these trials, pegifn--2b was dosed by weight (1.5 g / kg was fda approved) and coupled with 800 mg of ribavirin ; pegifn--2a was given at a fixed dose of 180 g along with a weight - adjusted, higher dose of ribavirin (1.000 mg / day or 1.200 mg / day for patients weighing 75 kg, resp.). these trials demonstrated that higher svr rates could be achieved with the combination of pegifn- weekly plus oral ribavirin given twice daily than with the combination of ifn- given 3 times weekly plus ribavirin or than with pegifn- monotherapy. the issue of influence of ribavirin dose by body weight on the response rate was first addressed. in the pegifn--2b study, a post hoc analysis demonstrated that an svr of 61% was achieved in the subgroup whose daily dose of ribavirin exceeded 10.6 mg / kg. logistic regression analyses observed that the response rates generally increased as ribavirin dose increased up to about 13 mg / kg / day. some studies highlighted the potential importance of higher doses of ribavirin [38, 39 ]. the first 4 weeks of weight - based ribavirin exposure (> 13 mg / kg / day) have been associated with the achievement of an rvr. in non - rvr patients, one post hoc analysis showed that providing and maintaining optimal dose of ribavirin within 12 weeks of treatment was pivotal for the attainment of a cevr. patients with a cevr in this study received a ribavirin dose of 16.3 mg / kg / day. moreover, a higher weight - based dose of ribavirin (15.2 mg / kilogram / day) was associated with a lower relapse rate and higher svr rate. later, the optimal treatment duration and ribavirin dose were investigated in a multicenter rct in which all chc patients received pegifn--2a at a dose of 180 g, while patients in the four arms received either 24 or 48 weeks of ribavirin at a dose of 800 mg or at the higher, weight - based doses of 1.000 or 1.200 mg daily. in the subsequent registration trial, a high frequency of svrs occurred in patients with hcv-2 or hcv-3, regardless of the regimen (79% to 84%), but optimal frequencies of svrs in hcv-1 (52%) required longer duration and full - dose ribavirin, independent of the level of hcv rna. in patients with hcv-1 with a low viral load (2) compared to those without insulin resistance [69, 70 ]. kg / m are more likely to be insulin - resistant, to have more advanced hepatic steatosis or steatohepatitis and fibrosis, and to experience a reduced response to combination therapy [71, 72 ]. additionally, other possible mechanisms of the impact of obesity on the therapeutic response include the linear correlation of efficacy and body - weight - based doses of ribavirin (10.615 mg / kg / day). to encourage weight loss and exercise before treatment, which has been associated with a reduction in steatosis fibrosis scores, excessive alcohol use could reduce the likelihood of a response to therapy [74, 75 ]. to increase the efficacy of antiviral therapy, it has been suggested that abstinence be recommended before and during treatment for chc. racial differences in response to efficacy of ifn exist and have been one of the host factors. a lower response rate to ifn monotherapy was observed among african - american patients compared with white patients [17, 76 ]. a pool analysis of two clinical trials with ifn - ribavirin combination therapy demonstrated that svrs were highest among asians (61%), followed by whites (39%), hispanics (23%), and african - americans (14%). hispanics and african - americans were less likely to respond to pegifn--ribavirin compared to whites. in studies of taiwanese chc patients, the svr rate was 23.7%, 37.1%, and 63.6% for a 24-week treatment of 3 mus of ifn- 3 times weekly alone, 6 mus of 3 times weekly alone, and 3 mus of 3 times weekly plus ribavirin, respectively [65, 79 ]. the svr rate of hcv-1b patients to 24-week pegifn--ribavirin was 48.9% to 65.8% and could be as high as 80% with a 48-week regimen in taiwan [79, 80 ]. a relative lower body weight (6770 kg) in asian patients compared to u.s. patients (7881 kg) may also play an important role. the different ethnic response rates may reflect the important role of genetics. host genetic variations are probably involved in the efficacy of ifn - based therapies for chc. genetic polymorphisms of human leukocyte antigen, cc chemokine receptor 5, cytotoxic t lymphocyte antigen-4, interleukin-10, low molecular mass polypeptide 7, mxa, and transforming growth factor-1 have been reported to have significant associations with responsiveness [8289 ]. tnf--308 polymorphism was associated with svrs to ifn - ribavirin in patients with hcv-1b infection and a high viral load. these results reflect the important role of unique genetic predisposition, at least in part, in the response to ifn - based therapy for chc. recent advances in pharmacogenomics have demonstrated the potential applications of genetic single nucleotide polymorphism and expression patterns in determining treatment responsiveness in chc [91, 92 ]. a recent candidate gene study showed that genetic variation in the il28b gene, which encodes ifn-3, is associated with spontaneous hcv clearance. several genome - wide associated studies observed that il28b single nucleotide polymorphisms played an important role in the treatment outcome of pegifn - rbv for chc [9496 ]. a genome - wide association study in 2010 confirmed that il28b genetic variation was the strongest genetic predictor in both natural and treatment - induced control of hcv. the increasing evidence for the role of ifn-3 for both spontaneous and treatment - induced control of hcv infection opens new avenues for prognosis and treatment of hcv infection. individuals with hcv genotype 1 or 4 who carry the risk allele, particularly in homozygosis, will have a very low probability of natural or treatment - induced clearance. half of the ethnic differences in response to interferon and ribavirin combination therapy can be explained by genetic polymorphism of il28b. because of the presumably shared routes of transmission, approximately one - fourth to one - third of all persons infected with hiv are coinfected with hcv. patients with hiv - hcv coinfection have been shown to respond less favorably to antiviral therapy than patients infected with hcv alone [98, 99 ]. several rcts recommended 48 weeks of pegifn - ribavirin for hcv, regardless of hcv genotype, in hcv - hiv coinfected patients [100, 101 ]. dual infections of hcv and hepatitis b virus (hbv) are not uncommon and occur in up to 5% of the general population in hcv - endemic areas. combined chronic hepatitis b and c leads to more severe liver disease and an increased risk of hcv. although hbv - hcv dual infection was refractory to conventional ifn monotherapy, recent studies in taiwan have demonstrated that conventional ifn - ribavirin combination therapy was effective in hcv clearance among hcv - dominant, hbv / hcv dually infected patients [105, 106 ]. recently, a large, open - label, comparative, multicenter study confirmed the efficacy of pegifn - ribavirin for patients with chronic hcv - hbv dual infection in taiwan. nonresponders are more resistant to retreatment with subsequent ifn - based therapy, compared to relapsers (or = 3.912 ; 95% ci = 1.45910.49). retreatment with pegifn - ribavirin could achieve an svr rate of 47% to 60% for relapsers and 18% to 23% for nonresponders, hcv rna levels generally fall in a biphasic manner. the first rapid phase of viral suppression, from a few hours after the first ifn- injection to the end of the first day, is related to an inhibition of viral replication by a direct, nonspecific action of ifn-. this early initial decline in hcv rna levels correlates poorly with the eventual response to ifn - based therapy [74, 113 ]. the second, slower phase of viral suppression, beginning on day 2 and gradually leading to seroclearance of hcv rna, is possibly related to the gradual clearance of infected cells by the patient 's immune system, while hcv replication is efficiently inhibited. this phase, less influenced by the dosage of ifn and hcv genotype, exhibits a good response to pegifn and is an excellent marker of an svr to the treatment [36, 54, 74 ]. an rvr at week 4 could predict an svr to ifn - ribavirin with a high degree of accuracy in both hcv-1 and hcv-2 patients, with positive predictive values of 78% and 92%, respectively. recent studies have demonstrated that an rvr is the single best predictor of an svr to pegifn - ribavirin for hcv-1 [114, 115 ] and hcv-2 or hcv-3 patients [23, 55, 56, 116 ]. for hcv-1 or hcv-4 patients with lower baseline viral loads and an rvr, an abbreviated 24-week regimen could achieve a comparable svr rate with a standard 48-week regimen [115, 117, 118 ]. selected patients with rvr might have their treatment courses abbreviated to 16 weeks if they are infected with hcv-2 or hcv-3 [23, 56 ]. but, the shortening of therapy duration for genotype 2/3 with rvr is still controversial. abbreviated regimens may be considered in patients with a low baseline viral load who achieve an rvr [120, 121 ]. among patients with an evr, however, as a negative predictor, non - evr is even an more robust predictor. in cases without an evr, the non - evr is a significantly negative predictor in hcv-1 patients, but not in hcv-2 patients. thus it is recommended that hcv-1 patients who do not achieve an evr at week 12 should discontinue the therapy beyond 12 weeks [22, 78 ]. recently, stratification of early virological response (evr) into complete evr (cevr) and partial evr (pevr) has been possible to further improve the prediction of an svr and may allow for optimizing treatment duration in non - rvr patients. studies for hcv-1 non - rvr patients have demonstrated that the current recommended 48 weeks of treatment could achieve high svr rates in patients with a cevr but could lower rates of svr in patients with a pevr [124, 125 ]. the svr rates would be more than 90% if patients could reach a cevr with a standard regimen (48 weeks for hcv-1 or 24 weeks for hcv-2). for non - rvr patients, hcv viral loads < 10 iu / ml at week 4 provided an early and accurate prediction of who would or would not achieve a cevr and following svr. in hcv-1-infected patients with a pevr, the svr rates were 10% and 21% only and the relapse rates were up to 83% and 63% in the 24-week and 48-week groups, respectively. the treatment responses were inadequate, even with a standard 48-week regimen in these patients [124, 125 ]. based on these predictors associated with treatment efficacy, response - guided individualized therapy has become a major consideration for clinicians. it is desirable to expose chc patients to the lowest doses and shortest durations of treatment, to reduce the likelihood of adverse events and to minimize costs, without compromising treatment efficacy. on the other hand, some difficult - to - treat patients have to receive longer and/or higher dose therapy to achieve responses. to date, hcv genotype, baseline viral load as well as on - treatment virological responses will provide information for individualized therapy decisionmaking for chc patients in the near future [115, 126 ]. people who have an rvr may have a chance to abbreviate their treatment courses to avoid unnecessary costs and preventable drug side effects. in patients without an rvr treated with standard of care, the svr rate would be more than 90% if cevr could be accomplished. in patients with only a pevr, it has been suggested to extend the treatment course to 72 weeks [124, 125, 127 ] or adhere to high - dose peginterferon plus ribavirin combination therapy. in the future, additional therapy other than interferon - based treatment, such as protease inhibitors, might be anticipated in those difficult - to - treat patients. one would like to be able to evaluate whether a treatment response is likely as early as possible so that individualized strategies can be made or altered earlier before or during the treatment course. < 10 iu / ml at week 4 provided an accurate prediction of cevr and svr in non - rvr patients. medical adherence is an important factor associated with response to ifn - ribavirin, especially among patients with hcv-1 infection. in a retrospective analysis of data collected in the large registration trials of ifn - ribavirin, svrs have been reported to be more likely in patients who had taken at least 80% of all projected ifn injections and at least 80% of all projected ribavirin for at least 80% of the anticipated duration of treatment. recent development of direct - acting antiviral agents, also named specifically targeted antiviral therapy for hepatitis c (stat - c) compounds, to treat hcv has focused predominantly on inhibitors of the viral enzymes ns3/4a protease and the rna - dependent rna polymerase ns5b [129, 130 ]. the administration of hcv ns3/4a protease inhibitors to patients with chronic hcv infections has demonstrated that they have dramatic antiviral effects and that compounds acting via this mechanism are likely to form a key component of future anti - hcv therapy. newer data have demonstrated promise for 2 protease inhibitors, sch 503034 (boceprevir) and vx-950 (telaprevir), both of which appear to be able to improve sustained response while shortening duration of therapy. telaprevir (vx-950), the hcv protease inhibitor, is in the most advanced phase of clinical development. a first case of sustained virological response (svr) achieved in a patient with chronic hepatitis c by monotherapy with telaprevir without interferon therapy was reported. owing to a low genetic barrier, resistant variants emerge within a few days when used in monotherapy, thereby decreasing its efficacy. consequently, telaprevir has been combined with pegylated - interferon and ribavirin in clinical trials. this triple combination is more effective but has a higher rate of adverse events (notably rash) than the standard of care, despite the shorter duration of therapy. results of the milestone studies prove 1 and 2 indicate that 12 weeks of telaprevir - based triple therapy is too short because of the high rate of relapse after treatment completion. however, 24 to 48 weeks of total therapy including 12 weeks of triple therapy with telaprevir in addition to standard treatment greatly improved svr rates in treatment - nave genotype 1 patients compared with the standard of care. prove 3 has shown that telaprevir is also highly effective in the treatment of prior nonresponders or relapsers infected with hcv genotype 1 [130, 135 ]. | since 1986, interferon - alfa (ifn-) monotherapy has been administered for patients with chronic hepatitis c (chc). however, sustained response rate is only about 8% to 9%. subsequent introduction of ribavirin in combination with ifn- was a major breakthrough in the treatment of chc. sustained virological responses (svrs) rate is about 30% in hepatitis c virus genotype 1 (hcv-1) patients, and is about 65% in hcv-2 or -3 patients. after 2000, pegylated interferon (pegifn) much improved the rates of svr. presently, pegifn--ribavirin combination therapy has been current standard of care for patients infected with hcv. in patients with hcv-1, treatment for 48 weeks is optimal, but 24 weeks of treatment is sufficient in hcv-2 or -3 infected patients. clinical factors have been identified as predictors for the efficacy of the ifn - based therapy. the baseline factor most strongly predictive of an svr is the presence of hcv-2 or -3 infections. rapid virological response (rvr) is the single best predictor of an svr to pegifn - ribavirin therapy. if patients ca n't achieve a rvr but achieve a complete early virological response (cevr), treatment with current standard of care can provide more than 90% svr rate. hcv-1 patients who do not achieve an evr should discontinue the therapy. recent advances of protease inhibitor may contribute the development of a novel triple combination therapy. |
twelve adult beagle dogs, 110 years old and weighing 9.515.8 kg, were used in this study. dogs were divided into a conscious group (n=6) and a sedated group (n=6). all dogs were healthy based on physical examination and normal cbc and serum biochemistry including alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, gamma - glutamyltranspeptidase, ammonia, and fasting and post - prandial total bile acid levels. prior to the ceus study, b - mode us was performed on all the dogs, and no focal or diffuse hepatic abnormalities were noted. all b - mode us and ceus examinations were performed by the same sonographer (km) with 10 years of experience in performing liver ultrasound. an ultrasound scanner (aplio xg, toshiba medical systems, otawara, japan) with a 511 mhz broadband linear probe (plt-704 at, toshiba medical systems) suitable for pulse subtracting imaging was used for ceus. imaging was performed with a low mechanical index of 0.21 and a frame rate of 23 frames per sec. the contrast imaging gain was set at 80 db, and the focus was set at a depth of 4 cm. scanning in the sedated group was performed under anesthesia with propofol at an induction dosage of 6 mg / kg and a maintenance rate of 0.40.6 mg / kg / min. the dogs were positioned in left lateral recumbency, and the right hv was identified using an intercostal approach (fig. 1.color doppler and ceus images of the right hv obtained using a right intercostal approach. (a) right hv displayed in blue with color doppler flowed into the caudal vena cava (cvc). (b) at 8 sec, the hv, outlined by a dashed line, was not enhanced, although surrounding liver parenchyma was slightly enhanced. region of interest (roi) was manually placed in the hv (circle) to measure the tissue intensity. (c) hv reached its pi, which was similar in intensity to the liver parenchyma (shown here 23 sec after bolus injection of contrast agent). (d) at the end of the examination (120 sec), the contrast agent in the hv appeared washed - out and hypoechoic compared to the liver parenchyma.). the right hv was imaged to maintain clear visualization of the confluence with the caudal vena cava (cvc) as much as possible. perfusion of the hv was evaluated after intravenous bolus injection of microbubble contrast agent (sonazoid, daiichi sankyo, tokyo, japan). according to our previous report, we administered 0.01 ml / kg sonazoid through a 21 g butterfly catheter attached to a 22 g intravenous catheter placed in the cephalic vein, flushed by 2 ml of heparinized saline. immediately after bolus injection, continuous scanning of the right hv was performed for 2 min. the images were recorded in 40-sec cine - loops to a hard disk for further off - line analysis. ceus examinations were performed three times in each dog by using the same scanning plan, with a period of more than 48-hr between examinations. color doppler and ceus images of the right hv obtained using a right intercostal approach. (a) right hv displayed in blue with color doppler flowed into the caudal vena cava (cvc). (b) at 8 sec, the hv, outlined by a dashed line, was not enhanced, although surrounding liver parenchyma was slightly enhanced. region of interest (roi) was manually placed in the hv (circle) to measure the tissue intensity. (c) hv reached its pi, which was similar in intensity to the liver parenchyma (shown here 23 sec after bolus injection of contrast agent). (d) at the end of the examination (120 sec), the contrast agent in the hv appeared washed - out and hypoechoic compared to the liver parenchyma. two operators (km and ah) performed the quantitative analysis of the ceus images by using an off - line image analysis system (imagej, us national institutes of health, bethesda, md, u.s.a.). this system measures intensity using a gray - scale level ranging from 0 to 255 mean pixel value (mpv). one image per sec for the first 60 sec followed by 1 image at an interval of every 5 sec until 120 sec from the start of microbubble contrast agent infusion was analyzed. the region of interest (roi) was drawn in the right hv within a 1.5-cm distance from the confluence with the cvc as large as possible without including adjacent structures (fig. hepatic vein arrival time (hvat) was the time when the tic first reached 20% of peak intensity (pi). time to peak (ttp) and time to peak phase (ttpp) were defined as the time when tic reached to pi and to 90% pi, respectively. wash - out ratio (wr) indicated the attenuation rate from pi to the end of the study.). the hepatic vein arrival time (hvat) was the time from contrast agent injection to 20% of peak intensity (pi). time to peak (ttp) was the time taken from 20% of pi to pi. time to peak phase (ttpp) was the time taken from 20% to 90% of pi, which reflects the initial upslope of tic better than ttp. wash - out ratio (wr) was defined as the attenuation rate from pi to the intensity at the end of a ceus study. hepatic vein arrival time (hvat) was the time when the tic first reached 20% of peak intensity (pi). time to peak (ttp) and time to peak phase (ttpp) were defined as the time when tic reached to pi and to 90% pi, respectively. wash - out ratio (wr) indicated the attenuation rate from pi to the end of the study. all data were expressed as the median and range. statistical comparisons and calculations of coefficient of variation (cv) of each parameter when distribution approached normality, measured parameters from the conscious and sedated groups were compared using student s t - test. the examinations were successfully performed, and the tic of the hv could be measured clearly in both groups. no adverse events were noted during or after injection of the microbubble contrast agent. after contrast agent administration, the microbubbles first reached the ha and then the pv. the contrast effect of the hv developed more gradually than that of the pv ; it took over 10 sec to reach pi. during the pi phase, 1c) and was followed by a gradual wash - out of the contrast agent with gradual loss of enhancement (fig. the intensity of the contrast agent in the hv dropped to almost 20% of pi at the end of the examination, while the contrast agent in the pv retained its intensity. the tics derived from the median pixel intensity in the hv were similar in the two groups, but pi was higher in the conscious group (fig. the line graphs in the two groups are nearly identical, but the peak intensity was higher in the conscious group. and 3b). the line graphs in the two groups are nearly identical, but the peak intensity was higher in the conscious group. the measured parameters and cvs for each variable are summarized in table 1table 1.median values and cvs of the characteristic parameters of the time intensity curve in six healthy dogsconscious groupsedated groupp - valuemedianrangecv (%) medianrangecv (%) hvat (sec)13.5(922)25.312(817)11.80.242ttp (sec)12.5(624)29.712.5(917)14.80.854ttpp (sec)8(613)27.19(713)12.40.377wr (%) 78.0(60.791.7)7.684.1(63.094.4)12.30.689. cvs were 20% (range, 25.3 to 29.7%) and were higher than sedated group with the exception of wr (7.6%). our goal was to develop a new, non - invasive method that could assess intrahepatic hemodynamic changes related to underlying progressive hepatic disease. in this study, we characterized contrast - enhanced ultrasonography findings of the hv in normal dogs and evaluated the repeatability of this examination. we chose the right hv for analysis, because it can be imaged constantly while using an intercostal approach without compressing the upper abdomen which can affect the hepatic hemodynamics. there was a delay of several seconds between these two vessels, and the tic of the hv rose gradually. this delayed and gradual enhancement of the hv was similar to that observed in the previous human study [1, 10, 19 ]. because the ha carries a small amount of microbubbles, the hv is enhanced only after the microbubbles reach the sinusoid from the pv (which has more blood flow than the ha). since the sonazoid used in this study is phagocytosed by kupffer cells when it passes through the sinusoid, it takes longer for the hv to reach the pi, due to the escape of microbubbles via phagocytosis. after the pi, there is a gradual wash - out of the contrast agent in the hv, while the contrast effect in the pv is still present at the end of the examination. the number of microbubbles that re - enter the sinusoid through the general circulation decreases as time goes on due to phagocytosis by kupffer cells, which could contribute to the gradual loss of enhancement of the hv. we established reference values both in conscious and sedated dogs, and also evaluated the repeatability of this examination. although there was no statistically significant difference in each parameter between the two groups, median value of hvat was slightly longer in the conscious group. reported that the time to peak enhancement of the hepatic parenchyma, calculated from the time of injection, was significantly shorter in dogs anesthetized with propofol, as compared to that in non - anesthetized dogs. propofol has been found to increase hepatic arterial blood flow despite having no effect on portal venous flow, and the authors speculated that shortened time to peak enhancement was related to the effect of propofol on the vascular system. although this was observed in the hepatic parenchyma, it is possible that using propofol also affected the hvat results in the current study. however, statistical differences were not detected between the two groups, possibly because of the relatively low repeatability in the conscious group (cv ; 25.3%). obtaining stable images was slightly difficult in the conscious group compared with the sedated group, and this could have led to the low repeatability. in addition, changes in cardiac output and blood pressure related to the dog s excitation level may have affected the hepatic circulation. recent research demonstrated shortening of the hvat with the development of liver fibrosis in a ccl4-induced canine liver fibrosis model. however, the hvat was much shorter in the current study compared with that of the baseline value (18.22 0.82 sec) reported in the ccl4-induced canine liver fibrosis model. we speculate that the difference between our value and the previously reported value is due to differences in contrast agent, the volume of saline flush and/or how rapidly it was administered, and the method used for quantitative analysis. therefore, the reference values should be applied cautiously, and the methods used to obtain these values should be considered. ttp and ttpp, which also showed low repeatability in conscious dogs, were not different between the two groups. even if propofol increases arterial blood flow, the main blood supply associated with the initial upslope is presumably portal blood flow. in addition, because these parameters reflect only the intrahepatic circulation, they may be less vulnerable than the hvat to extra hepatic factors. although these parameters are not as common as hvat in human medicine, sugimoto. reported that the hv rising rates in cirrhotic patients were significantly higher than those in the control group and in non - cirrhotic patients. therefore, the ttp and ttpp, as a reflection of the hv rising rates, could be useful to assess the arterialization of the hv in dogs. in contrast to the hvat, ttp and ttpp, wr showed favorable repeatability in both groups. wr can be measured with only two values (the peak intensity and the intensity at the end of the examination), and this simple calculation could contribute to good repeatability. wr may also be less affected by systemic hemodynamic changes, because it is not a time - related parameter, which might have contributed to the lack of difference in this parameter between the two groups. to the author s knowledge, wr of the hv has never been measured in human studies. in our preliminary research, although multiple factors could affect wr, reduced kupffer cell phagocytic function may be one of the most conceivable reasons. it was reported that nonalcoholic steatohepatitis in a rat model showed reduced kupffer cell phagocytic function, with no changes in the numbers of kupffer cells. more recently, park. reported that elimination of sonazoid from the hepatic parenchyma became slower with progression of cirrhotic disease. the application of ceus to assess hemodynamic changes, as well as liver function, should be investigated in the future. quantitative assessment of portal pressure by using ceus was performed in a ccl4-induced canine liver fibrosis model. in that study, the roi was set on the hepatic parenchyma, and modified parameters based on the area under the curve of the tic were generated. compared with this previous report, the perfusion parameters utilized in the current study can be measured more simply. in addition, the ability of ceus of the hv to detect intrahepatic shunt flow that directly bypassed the sinusoid may be superior to that of ceus of the liver parenchyma. on the other hand, because a large roi can not be drawn on the hv, the repeatability of ceus of the hv might be inferior to that of parenchyma - targeted ceus analysis. this could be a major limitation of the current method, especially if adequate imaging of the hv can not be maintained. second, the dogs enrolled in this research were all beagles, and therefore, we did not evaluate the influence of body size on hepatic hemodynamics. the differences in body size may affect the repeatability of each measured parameter, because roi depends on the diameter of the hv, which is associated with the dog s size. finally, we used sonazoid, because it is the only second - generation contrast agent available in japan. however, other vascular - specific contrast agent might be better for assessing time - related parameters, because they would purely reflect hemodynamic changes related to liver disease. in conclusion, this research characterized image enhancement of the normal canine hv using sonazoid. established quantitative parameters may serve as a reference in the future assessment of liver function as related to hemodynamics. a further study into the application of this technique to evaluate intrahepatic hemodynamic changes associated with canine chronic hepatic disease is warranted. | contrast - enhanced ultrasonography (ceus) of the hepatic vein can assess intrahepatic hemodynamic changes and has been studied as a noninvasive method to assess the severity of portal hypertension and hepatic fibrosis in humans. however, few reports have described its usefulness in veterinary medicine. the purpose of this study was to characterize ceus findings of the hepatic vein in normal dogs and assess the repeatability of this method both in a conscious group (n=6) and a sedated group (n=6). sonazoid (0.01 ml / kg) was used as a contrast agent, and scanning of the hepatic vein was performed for 2 min. time - intensity curves were generated from regions of interest in the hepatic vein. four perfusion parameters were measured for quantitative analysis : hepatic vein arrival time (hvat), time to peak (ttp), time to peak phase (ttpp) and wash - out ratio (wr). ceus examinations were performed three times in each dog. the median (range) values of hvat, ttp, ttpp and wr in the conscious group were 13.5 sec (922 sec), 12.5 sec (624 sec), 8 sec (613 sec) and 78.0% (60.791.7%), respectively. median (range) values of hvat, ttp, ttpp and wr in the sedated group were 12 sec (817 sec), 12.5 sec (917 sec), 9 sec (713 sec) and 84.1% (63.094.4%), respectively. the coefficients of variation of these parameters in the conscious and sedated groups were 7.629.7% and 11.814.8%, respectively. |
in the century of spectacular medical therapies, there is still a lack of substance that may protect the brain cells against neurodegeneration. since the discovery of neurosteroids, scientists have made a great effort to evaluate their function, including possible neuroprotective properties. according to most commonly used definition neurosteroids cover both steroid hormones, which are synthesized de novo in neurons and glial cells, and their metabolites acting within the central nervous system (cns) (compagnone and mellon, 2000) (figure 1). hormones may regulate brain function in an autocrine and paracrine manner via membrane or nuclear receptors (baulieu, 1998 ; baulieu., 2001 ; plassart - schiess and baulieu, 2001 ; singh, 2006). regular neurosteroids act as positive or negative modulators of neurotransmitter receptors : gamma - amino butyric acid a (gabaa) receptor, n - methyl - d - aspartate (nmda) receptor, -amino-3-hydroxy-5-methylisoxazole propionate (ampa) receptor, sigma-1 (1), nicotinic, muscarinic, kainic, serotoninergic and glycine receptors, regulate gene expression, or signaling cascades (wojtal., 2006 ; borowicz., we review the main neurosteroids, including pregnenolone (preg) and pregnenolone sulfate (pregs), progesterone (prog), allopregnanolone (allo), dehydroepiandrosterone (dhea), dhea sulfate (dheas), deoxycorticosterone (doc), and tetrahydrodeoxycorticosterone (thdoc)., preg is a hormone precursor, prog, doc, and dhea represent hormones, while allo (a prog metabolite) and thdoc (a doc derivative) belong to neurosteroids, which are entirely devoid of hormonal action. synthetic neurosteroids have even longer half - time, and may be administered orally, in contrast to natural steroids (wojtal., 2006 ; borowicz., neuroprotection involves mechanisms protecting against neuronal injury or degeneration in the central and peripheral nervous system. all these processes may be a consequence of acute disorders (e.g., stroke or nervous system injury) or chronic neurodegenerative processes (e.g., in the course of alzheimer s, parkinson s, and huntington s disease). the overriding aim is, of course, to prevent the development of a disease, but it is equally important to limit neuronal dysfunction after the cns injury and maintain undisturbed neural function of the brain with the highest possible cellular integrity. at present, a wide range of neuroprotective products is available or under investigation. many of them can potentially be used in more than one disorder, because most of the underlying mechanisms of neurodegeneration (in both acute and chronic disorders) seems to be quite similar. until recently two mechanisms of cell death were known : the programmed cell death (apoptosis) and unregulated process of necrosis. necrosis and apoptosis differ with numerous morphological and biochemical features. in necrosis, extreme physiological conditions (e.g., hypoxia) lead to damage to the plasma membrane. the whole cell and intracellular organelles, particularly mitochondria, swell, and rapture. as a consequence of loss of membrane integrity, this process ends with cell lysis and is often associated with a vast tissue damage resulting from an intense inflammatory response (majno and joris, 1995 ; kanduc., 2002 ; van cruchten and van den broeck, 2002). nevertheless, it has been proved that non - apoptotic forms of programmed cell death may also exist. in fact, three main types of the programmed death has been distinguished : 1. autophagic cell death can be activated by ras genes, while type 3 (cytoplasmic) was shown to be triggered by stimulation of the insulin - like growth factor i receptor (igfir) or the binding of substance p to its neurokinin-1. this form, characterized by cytoplasmic vacuolization, lack of apoptotic morphology, and lack of caspase activation, was named paraptosis (sperandio., 2000, 2004, 2010 ; leist and jttel, 2001 ; yakovlev and faden, 2004 ; kroemer., 2009). however, accumulating evidences indicate that necrotic cell death can also be a regulated process. in 2005 the term necroptosis was introduced to describe a little known form of cell death the programmed necrosis (teng., 2005 ; vandenabeele., 2010) necroptosis is defined as a programmed but caspase - independent cell death that activates autophagy and morphologically resembles necrosis (degterev. whether this form of cell death should be equated with the programmed autophagic form remains uncertain. this process, in fact intermediate between necrosis and apoptosis, develops often as an answer to hypoxia, reperfusion, and excitotoxicity. these findings open a possibility to develop new therapeutic strategies that may extend the window for neuroprotection in such disorders as stroke, trauma and neurodegenerative diseases. interestingly, necrostatin-1 and 5, lately identified specific and potent small - molecule inhibitors of necroptosis, were shown to block a critical step of the cell death process (yuan., 2003 ; degterev., 2005 ; mehta., 2007 ; wang., in fact, research on neuronal death mechanisms may help to develop an effective neuroprotective treatment and contribute to a significant improvement in patient quality of life (charalampopoulos. pregnenolone, usually considered as a neurosteroid precursor, exhibited neuroprotective effects against glutamate- and amyloid protein - induced neurotoxicity in clonal mouse hippocampal cell line (ht-22 ; gursoy., 2001). enhanced its polymerization and activated neurite outgrowth in nerve growth factor - pretreated clonal rat pheochromocytoma cell line of neuronal crest origin, pc12 (fontaine - lenoir., 2006), improves myelination (koenig., 1995). (2008) preg reduced the staurosporine- and glutamate - induced ldh release and diminished the number of apoptotic cells in primary neuronal cortical cultures. additionally, preg exerted neuroprotective effects against kainate - induced cell death in the hippocampus of gonadectomized rats. the exact mechanism of preg action is not clear, however, it may be mediated by estradiol, the main product of aromatase action. fadrozole, an aromatase inhibitor, prevented the neuroprotective effects of both neurosteroids (veiga., 2003). in patients with alzheimer s disease, preg concentrations were reduced in the striatum and cerebellum. interestingly, the negative correlation was shown between preg and the level of cortical -amyloid (weill - engerer., 2002 ; luchetti., 2011). in rat hippocampal slices, preg inhibited, or enhanced nmda response. the former effect appeared in the presence of haloperidol and indicates an indirect receptor modulation. the latter one seems to be dependent on a direct nmda receptor response (monnet., 1995) preg, pregnenolone ; prog, progesterone ; allo, allopregnanolone ; dhea, dehydroepiandrosterone ; dheas, dehydroepiandrosterone sulfate ester ; doc, deoxycorticosterone ; thdoc, allotetrahydrodeoxycorticosterone. progesterone is produced primarily in females in the ovarian corpus luteum and placenta, while in males it is mostly found in testes and adrenal glands. however, this hormone may also be synthesized de novo within the nervous system. initially, it was observed that brain concentrations of prog maintained even in gonadectomized rats (corpchot., 1983). then, glial cell cultures were reported to synthesize prog and express prog receptors (jung - testas., 1989, 1999). the hormone and its derivatives are positive modulators of gabaa receptors (borowicz., 2008). prog is synthesized in human brain at the similar level in both sexes (stein and wright, 2010). identification of neuroprotective properties of this steroid began with the observation of a better recovery of female pseudopregnant rats after the traumatic brain injury (tbi ; roof., 1993). the authors observed the inverse correlation between serum prog concentration and degree of brain edema after injury (wright., 2001). in male and normal cycling female rats, administration of prog (in the 1st, 6th, 24th, and 48th h after tbi) significantly protected animals against the development of brain edema and cognitive impairment (roof. it could be concluded that the positive effect of prog treatment could be achieved when the steroid is administered within 24 h after injury, although the sooner onset of the treatment means the better outcome. the optimal dose of prog ranged from 8 to 16 mg / kg (roof. (2002) tested 3- and 5-days regimen of prog administration after tbi and observed a significant reduction size of injury - induced necrosis and diminished cell loss in the dorsomedial nucleus of the thalamus. prog, used at low physiological doses in ovariectomized female rats after tbi, reduced alterations in mitochondrial respiration and hippocampal cell loss (robertson., 2006). in another study, treatment with prog following tbi diminished production of inflammatory proteins in rats (pettus., 2005). this hormone administered after a tbi episode significantly lowered the brain concentration of isoprostaglandin, an established marker of lipid peroxidation. advantageous properties of prog were also observed in models of the spinal cord and peripheral nerve injury. the hormone administered for 3 days following the spinal cord injury improved myelination, increased the level of brain derived neurotrophic factor (bdnf) mrna and reduced chromatolysis (de nicola., 2006), whereas 5-day administration diminished the size of lesions and prevented secondary neuronal loss (thomas., 1999). according to labombarda. (2010) prog significantly enhanced bdnf neuronal expression, up - regulated growth - associated protein 43 (gap-43) necessary for axonal regeneration, prevented the injury - induced chromatolytic changes of spinal neurons and increased activity of enzymes crucial for normal neuronal metabolism and neurotransmission, and restored impaired expression of the na, k - atpase subunits and choline acetyltransferase. on the other hand, coughlan. administration of prog following acute spinal cord injury in rats attenuated the loss of microtubule - associated protein 2, a major component of the cytoskeleton (gonzlez., 2009). in addition, this steroid acts as a promyelinating factor by stimulating synthesis of myelin proteins and proliferation / differentiation of oligodendrocyte progenitors (gonzalez., 2005 ; labombarda., yu (1989) observed that prog treatment following motor neuron axotomy attenuated loss of neurons in rats. according to koenig. the same hormone increased expression of genes coding crucial myelin proteins in rat schwann cells (dsarnaud., 1998). in rat peripheral nerves prog increased glial cell growth and differentiation, induced synthesis of myelin - specific proteins in oligodendrocytes, and potentiated the formation of new myelin sheaths by schwann cells (jung - testas. progesterone administration following the cortical contusion injury protected against secondary neuronal loss and facilitated cognitive recovery in rats (roof., 1994 ; asbury., 1998). in the diffused tbi model, administration of physiological doses of prog reduced cell loss, axonal injury, decreased caspase-3 immunoreactivity, and facilitated the motor and cognitive performance recovery in male and ovariectomized female rats (oconnor., 2007). in the model of ischemic injury, treatment with prog reduced brain cell damage, improved neurological outcome in rats (jiang., 1996 ; chen., 1999 ; kumon., 2000), and increased survival rate in mice (gibson and murphy, 2004). in the study of jiang. (1996) the effects were comparable either when the hormone was given immediately before or 2 h after reperfusion. post - injury administration of prog in rats with the brain global ischemia resulted in a significant reduction of cortical shrinkage and cell loss in the ca1 and ca2 hippocampal subfields. additionally, the hormone prevented ventricular dilatation compared with control animals (moral., 2005). in another study, application of prog and allo after severe transient forebrain ischemia in rats resulted in better functional outcome and preserved dimensions of hippocampal formation despite pyramidal neurons loss (moral., 2011) similarly, in cats after acute global ischemia prog reduced cell loss, especially in the ca1/ca2 areas, and caudate nucleus regions (gonzlez - vidal., 1998 ; cervantes., 2002) this steroid diminished cortical and optionally subcortical infarct volumes (alkayed., 2000). both prog and allo improved behavioral outcome of animals (sayeed., 2007). recently, cai. (2008) found that acute neuroprotective effects of prog in ischemic brain injury may depend on its antagonistic action toward the 1 receptor and subsequent inhibition of the nmda - induced ca influx. it was observed that patients with acute tbi, treated with prog, had a lower 30-day mortality rate than control individuals (wright., 2006). similarly, lower mortality and better functional outcomes were found in the prog group of patients by xiao. at least two third - phase clinical trials are currently run to confirm neuroprotective properties of this hormone in patients after brain injury (stein and wright, 2010). wobbler mice receiving the hormon presented less pronounced neuropathology, reduced number of vacuolated cells, preserved mitochondrial ultrastructure (gonzalez deniselle., 2002), attenuated motoneuron degeneration and boosted myelination in schwann cells and oligodendrocytes in the cns (schumacher., 2004). (2003) prog and its derivatives : dihydroprogesterone (dhp) and tetrahydroprogesterone (thp) may control the expression of the glycoprotein po peripheral myelin and protein 22 (pmp22) via activation of the prog receptor or gabaa receptor, respectively. chronic (1 month lasting) treatment with these neurosteroids preserved the nerve conduction velocity, thermal threshold, intra - epidermal nerve fiber density, na(+)k(+)-atpase activity, and mrna levels of myelin proteins (leonelli., 2007). neuroprotective action of prog seem to be partially due to reduction of cerebral edema that may be achieved via different mechanisms : protecting or rebuilding the blood brain barrier (duvdevani., 1995 ; roof., 1997), modulating aquaporins (amiry - moghaddam., 2003), up - regulation of membrane prog binding protein 25-dx, which is co - expressed with vasopressin and regulates brain water homeostasis, and reduction of the cytotoxic phase of edema (guennoun., 2008 ; stein., 2008). other possible actions of prog include : down - regulation of the inflammatory cascade by decelerating cytokine (il-1 ; il-6 ; tnf)-induced reactions, slowing the immune cell activation, and migration (arvin. this neurosteroid limits cellular necrosis and apoptosis by : 1. lowering the concentration of nuclear factor and expression of its target genes such as il-1, c3, inos, cox2 (pettus., reducing excitotoxicity by inhibition of glutamate receptors, 3. boosting the effects of gabaa, 4 depression of spontaneous firing of neurons, a possible causative factor of posttraumatic seizures (bergeron. 2005 ; stein, 2008), 5. stimulation of schwann s cells via nuclear receptor to produce myelin, and reducing glial scarring in the cns (koenig., 1995 ; plassart - schiess and baulieu, 2001), 6. decreasing injury - induced lipid peroxidation and oxidative stress via inhibition of tnf- production or up - regulation of antioxidant enzymes (roof., 1997 ; stein, 2008 ; stein and wright, 2010). progesterone activates signaling pathways associated with neuroprotection like mitogen activated protein kinase, extracellular signal regulated kinase (mapk / erk), or serine / threonine protein kinase akt (brinton. nilsen and brinton (2002) showed that prog increased expression of the bcl-2 anti - apoptotic gene, which prevented cell death in rat hippocampal neuronal cultures. in the tbi model in rats, administration of prog increased mrna levels of the bcl-2 and bcl - x(l) anti - apoptotic genes, and their protein derivatives. on the contrary, the hormone reduced mrna levels of pro - apoptotic bax and bad genes, as well as their protein products (yao., 2005). additionally, the neurosteroid attenuates release of the proapoptotic cytochrome c (stein and wright, 2010). in cultured hippocampal neurons, prog attenuated lipid peroxidation induced by feso4 and amyloid -peptide, as well as lightened elevation of intracellular ca concentration following -amyloid- or glutamate - induced toxicity (goodman., 1996). in rats after tbi, administration of allo decreased apoptotic dna fragmentation and expression of caspase-3 and bax pro - apoptotic proteins. moreover, the neurosteroid improved behavioral outcome of animals similarly to prog (djebaili., 2004, 2005). both neurosteroids reduced production of pro - inflammatory cytokines (il-1, tnf- ; he., 2004) and enhanced production of the cd55 protein, a complement convertase inhibitor, which was reported to limit inflammatory processes after contusion of the cerebral cortex in rats (vanlandingham., 2007). in patients with alzheimer s disease, the level of allo in the temporal cortex was significantly lower than in controls, in contrast to preg and dhea which concentrations were increased. this may be explained by altered regulation of neurosteroid biosynthetic pathway, blocking allo formation (naylor., 2010). similarly, the allo level was found to be decreased in niemann - pick type. furthermore, allo enhanced myelination and reduced inflammatory processes in brains of npc1(/) mice, a genetic model of niemann - pick type c disease (griffin., 2004 ; ahmad., 2005 ; mellon., 2008 ; liao., (2001) revealed that prog protected dopaminergic neurons against mptp - induced degeneration in rats. moreover, in mptp mice, prog did not reverse the protective effect of estrogens on dopamine neurons. in methamphetamine model of parkinson s disease, prog used at low doses exerted protective action on striatal dopaminergic neurons in gonadectomized male mice, whereas much higher doses were needed to achieve a beneficial effect in ovariectomized mice (bourque., higher concentrations of prog, allo, and 5-dhp were found in the substantia nigra and nucleus caudate in comparison with other brain areas in female control patients. in patients with parkinson s disease, lower concentrations of these neurosteroids than in controls were found in the cerebrospinal fluid (csf ; luchetti., 2011). during further studies the authors observed reduced mrna expression of one enzyme synthesizing allo in the substantia nigra, and increased expression of another one in the caudate nucleus. it seems that disturbed synthesis of allo may result in a dysfunction of endogenous neuroprotective effects (luchetti., 2011). similarly, diminished allo concentration and reduced activity of enzymes synthesizing the neurosteroid were found in patients with multiple sclerosis (luchetti., 2011). such phenomenon as nmda - induced excitotoxicity in p-19 cell cultures (pluripotent embryonic cells differentiated into neurons) was attenuated by allo and dhea, while dheas remained less effective in this respect. allo prevented the release of cytochrome c to cytoplasm and bax protein translocation to mitochondria. all these processes are considered to be signs of apoptotic death. since both neurosteroids enhanced expression of gabaa receptor subunits, their neuroprotective action seems to be mediated by enhanced gaba - ergic neurotransmission (xilouri and papazafiri, 2006). reduced levels of this steroid were found in the patient plasma and prefrontal cortex. additionally, elevated concentrations of enzymes metabolizing pregnane steroids were found in brains from early stages of the disease (luchetti., 2011). in the mouse model of alzheimer s disease prog treatment improved cognitive functions and reduced hyperphosphorylation of tau protein. but on the other hand, prog antagonized beneficial effects of estrogens in reducing -amyloid deposits. it is possible that the sequential therapy with estrogen and prog may bring better results than the treatment with only one hormone (pike., 2009). allopregnanolone prevented apoptotic cell death in the human nt2 cell line culture in nmda - induced excitotoxicity (lockhart. progesterone is widely considered as a pleiotropic drug that can be markedly effective in the treatment of tbi. at present, more than 180 articles showed protective activity of prog in both experimental animals and humans. moreover, two independent phase ii clinical trials have revealed that prog group of patients had significantly better survival and functional outcomes than patients given placebo. nevertheless, in some studies prog was not effective or even worsen the prognosis of animals after tbi or ischemic injury (murphy., 2000 ; toung., 2004 ; ciriza., 2006 ; gilmer.,, medroxyprogesterone acetate, a prog synthetic derivative, may exhibit quite opposite properties in the cns than the parent compound. medroxyprogesterone did not bring better functional outcome after tbi, moreover, it blocked the expression of bcl-2 gene and estrogen - dependent neuroprotection, increased calcium - induced toxicity (stein, 2008). anticonvulsive and antiexcitotoxic properties of prog were widely examined in animal models and clinical studies. it seems that antiseizure action of this hormone is not mediated by steroid receptor since it occurs quickly (within minutes) and is not blocked by the respective receptor antagonist ru486. gabaa receptor activation induces neuronal membrane hyperpolarization and reduces its excitability. in kainic acid - induced seizures in rats the hormone significantly reduced seizures, mortality, and neuronal death in hippocampus (hoffman., 2003). in the same model in mice, allo protected against seizures and reduced neuronal loss in hippocampal fields, while other neurosteroids negative modulators of gabaa receptor (dheas, pregs) remained ineffective or even toxic (leskiewicz., 1997). holmes and weber (1984) tested prog in amygdala - kindled rats and observed kindling inhibition. secondary generalization of seizures was prevented in immature, but not adult animals. in the same model, prog and allo protected against secondarily generalized seizures, being ineffective or effective only at toxic doses against focal seizures. on the other hand, 5-dhp inhibited both components of seizures (lonsdale., 2006). growing evidence suggests that anticonvulsive and neuroprotective properties of prog are mediated by its metabolites 5-dhp and allo, positive modulators of gabaa receptors (reddy, 2004 ; ciriza., 2006 ; verrotti., 2010 ; stevens and harden, 2011). allo itself protected against picrotoxin - induced neuronal cell death (brinton, 1994). rhodes and frye (2005) showed that inhibition of 5-reductase enzyme (finasteride) attenuated antiseizure activity of prog and reduced concentration of allo. (2003) allo showed no significant anticonvulsive action against cocaine - induced kindling in mice, in contrast to isopregnanolon and a representative of negative gabaa modulators dheas. some other neurosteroids were reported to inhibit seizures. both prog derivatives : dhp and allo dose - dependently protected the kainate - induced loss of hilar neurons and the induction of vimentin expression in reactive astrocytes (a sign of neural damage) in ovariectomized rats (ciriza., 2004) (table 1). dehydroepiandrosterone and its sulfate ester (dheas) were reported to act as neurotropic or neuroprotective factors, defending neurons against many harmful events, including excitotoxicity. protective properties of dhea may be related to inhibition of the nmda - induced nitric oxide (no) production in hippocampal cells or modulation of the calcium / no signaling pathway. additionally, dheas was shown to attenuate the destructive action of glutamate and nmda on cerebellar granule cells in rats. protective effects of both dhea and dheas can be realized through preventing the mitochondria against intracellular ca overload (mao and barger, 1998). time- and dose - dependent neuroprotective action of dhea was documented in the in vivo model of global cerebral ischemia in rats. administration of dhea at the dose of 20 mg / kg during 348 h after ischemia reduced neuronal death in the hippocampal ca1 region and ameliorated ischemia - induced deficits in spatial learning. whereas, the treatment of dhea (20 mg / kg, 1 h before or after ischemia) may intensify the ischemia - induced neuronal damage and learning failure. kg (for 15 days before induction of ischemia) led to more pronounced neuroprotective effects and reduced hippocampal ca1 neuronal injury (li., 2001). these study may suggest that dhea, dependently on time of treatment, exhibits a dual action it may be either neurotoxic or neuroprotective, depending on the time of treatment initiation and duration (li., 2009). dhea sulfate significantly inhibited the amplitude of persistent sodium currents, and this result was canceled by the gi protein inhibitor, protein kinase c inhibitor, sigma-1 receptor blockers, but not by the protein kinase a inhibitor. these results suggest that dheas may protect neurons against ischemia by activation of sigma-1 receptor (cheng., 2008). the neurosteroid exhibited a preventive effect when it was administered 5 min, but not 30 min after ischemia. the beneficial effect of dhea was reversed by bicuculline, the gabaa antagonist, which indicates gaba - ergic mechanism of the neurosteroid action (lapchak., 2000). however, it should be remembered that dhea administered during ischemia may be also neurotoxic. according kimonides. (1998), dhea showed a dose - dependent neuroprotective effect against glutamate excitotoxicity mediated by nmda receptors (in vivo and in vitro) or evoked by ampa / ka receptor agonists (in vitro). for instance, the neurosteroid prevented hippocampal ca1/2 neurons against toxicity induced by nmda infusions. thus, decreased level of dhea in aging people may increase vulnerability of the brain to such a damage. age - related declines of neurosteroids have been postulated to play a role in the pathogenesis of neurodegenerative diseases (hillen., 2000 ; brown., 2003 ; naylor., 2008). interestingly, dhea - induced protection against ka - induced excitotoxicity in hippocampal hilar neurons was attenuated by letrozole, an aromatase inhibitor (veiga., 2003). taking this into consideration, neuroprotective effects of dhea in the hippocampus can be mediated by estradiol (azcoitia., 1998 ; it should be stressed that expression of aromatase in reactive glial cells is induced after brain injury (garcia - segura., 2003). some results suggest that dheas may be a negative modulator of gabaa receptors. in the study of czlonkowska. (2000), intracerebroventricularly administered dheas induced seizures in a dose - dependent manner. but on the other hand, dheas (25 mg / kg, i.p.) significantly increased the dose of nmda necessary to induce clonic convulsions in mice, indicating that the neurosteroids can protect mice against nmda - induced seizures and mortality (budziszewska., 1998). the antiseizure effect of dhea was also proved in the iron - induced model of posttraumatic epilepsy in rats. dhea at the dose of 30 mg / kg / day prevented epileptiform electrophysiological activity and attenuated cognitive defects produced by epileptic activity (mishra., 2010). this raises the possibility that exogenously administered neurosteroids or their synthetic analogs could be clinically effective as antiepileptogenic drugs, e.g., after tbi (biagini., 2006). possibly, these drugs may create a promising novel therapeutic avenue for the treatment of this dysfunction in humans. the neurosteroid accelerated axonal regeneration (ayhan., 2003) and increased the number of myelinated fibers and fiber diameters after sciatic nerve transection in rats (gudemez., 2002). according to frye and reed (1998), a 3-diol metabolite of another androgen testosterone moreover, the neurosteroid reduced hippocampal cell death and improved animal performance in the morris water maze. interestingly, this action was inhibited by gabaa receptor blockade, therefore it is not clear whether the action of 3-diol is due to enhanced gaba - ergic neurotransmission or to increased estrogen concentration (table 1). although there is no literature data on neuroprotective properties of deoxycorticosterone doc) and its derivative allotetrahydrodeoxycorticosterone (thdoc), the two neurosteroids exhibited anticonvulsive effects in some experimental studies. for instance, thdoc protected against convulsions induced by the gabaa receptor antagonists, like picrotoxin, pentylenetetrazole, or bicuculline, and the glutamate receptor agonists, such as kainic acid or nmda. the neurosteroid, administered at relatively high doses, showed also the anticonvulsive action in the rat model of amygdala kindling and the maximal electroshock test in mice. in human studies, decreased serum level of thdoc was found in women with catamenial epilepsy, which may indicate a role of this neurosteroid in the pathophysiology of perimenstrual seizures. the antiseizure effect of thdoc seems to depend on positive allosteric modulation of gabaa receptor (reddy, 2009) (table 1). therefore some modified derivatives were synthesized in order to select drugs, which are not so rapidly metabolized. neurosteroid analogs offered mainly a broad spectrum of anticonvulsive activity in different experimental seizure models. therefore, this group of neurosteroids are mostly considered as a novel class of antiepileptic agents. ganaxolone (gnx, 3-hydroxy-3-methyl-5-prengan-20-one) is the 3-methylated analog of allo. as the parent compound, gnx is a positive allosteric modulator of gabaa receptors and increases chloride channel permeability within the gabaa benzodiazepine receptor chloride ionophore complex (carter., 1997 ; the neurosteroid exhibited effectiveness in a broad range of animal models of epilepsy, including convulsions induced by pentylenetetrazole, bicuculline, fluorothyl, cocaine, aminophylline, as well as in pentylenetetrazole kindling, amygdala kindling, and 6 hz electrical stimulation (gasior., 2000 ; ungard., 2000 ; reddy and rogawski, 2000a, b ; kaminski., 2004). powerful antiseizure effects of gnx in the amygdala - kindled model in mice strongly support the utility of this substance in the treatment of temporal lobe epilepsy (reddy and rogawski, 2010). however, most data on this neurosteroid was obtained in preclinical models of catamenial epilepsy. according to reddy and rogawski (2009), gnx treatment (7 mg / kg, sc) significantly reduced the frequency of spontaneous seizures in rats. these results raise the possibility that gnx might provide a specific treatment for catamenial epilepsy in humans. on the other hand, this allo analog proved to be ineffective against nmda- and strychnine - induced seizures in mice (carter., 1997 ; gasior., 1997), gnx was shown to be well tolerated in adults and children. in early phase ii studies, gnx was found to be effective in adult patients with partial - onset seizures and in epileptic children with history of infantile spasms. currently, further investigations are conducted in infants with newly diagnosed infantile spasms, women with catamenial epilepsy, and adults with refractory partial - onset seizures (rogawski and reddy, 2004). it was recently reported that the pretreatment with a new synthesized analog of allo, 3-hydroxy-21,22-oxido-21-homo-5-pregnan-20-on (hohp), suppressed generalized tonic clonic seizures in pentylenetetrazol - induced seizures in mice, and efficacy of this analog resembled that of gnx (mare., 2010). two synthetic neurosteroids, minaxolone (2,3,5,11)-11-(dimethylamino)-2-(ethoxy-3-hydroxypregnan-20-one), and alfaxalone (5-pregnan-3-ol-11,20-dione) seem to be effective positive allosteric modulators of the 1 glycine receptor (maksay and biro, 2002 ; weir. alphaxalone showed, moreover, a moderate anticonvulsive activity in the rat model of kindling and maximal electroshock in mice (rogawski and reddy, 2004). another synthetic neurosteroid, co 2 - 1068 (3-(4acetylphenyl)ethynyl-3,21-dihydroxy-5-20-one-21-hemisuccinate) was re - ported to be effective against pentylenetetrazole-, nmda-, and cocaine - induced seizures in mice (gasior., 1997). so far, only fluasterone (dhef), a novel dhea analog, was considered as a candidate for a drug used in the treatment of tbi in humans. possible dhef mechanisms of action are still unclear and discussed. according to malik. (2003), this neurosteroid markedly inhibited synthesis of prostaglandin (pge2) and interleukin-1a - induced cyclooxygenase-2 (cox2) in cultures of rat mesangial, but not cortical or hippocampal cells (malik., 2003) (table 1). these natural and synthetic compounds attenuate the excitotoxicity, brain edema, inflammatory processes, oxidative stress, and neural degeneration. promising results of preclinical studies directed scientist attention toward possible profits of neurosteroid treatment in a wide range of diseases, especially the brain and spinal cord injury, stroke, parkinson s and alzheimer s diseases, or epilepsy. unfortunately, therapeutic application of natural neurosteroids was significantly limited by its rapid biotransformation. only synthetic analogs of these substances, particularly ganaxolone or 3-ol-5-pregnan-20-one, can be considered as potential anticonvulsive drugs. this gives a real hope that neurosteroids can be also used as effective neuroprotective drugs. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. | neurosteroids were initially defined as steroid hormones locally synthesized within the nervous tissue. subsequently, they were described as steroid hormone derivatives that devoid hormonal action but still affect neuronal excitability through modulation of ionotropic receptors. neurosteroids are further subdivided into natural (produced in the brain) and synthetic. some authors distinguish between hormonal and regular neurosteroids in the group of natural ones. the latter group, including hormone metabolites like allopregnanolone or tetrahydrodeoxycorticosterone, is devoid of hormonal activity. both hormones and their derivatives share, however, most of the physiological functions. it is usually very difficult to distinguish the effects of hormones and their metabolites. all these substances may influence seizure phenomena and exhibit neuroprotective effects. neuroprotection offered by steroid hormones may be realized in both genomic and non - genomic mechanisms and involve regulation of the pro- and anti - apoptotic factors expression, intracellular signaling pathways, neurotransmission, oxidative, and inflammatory processes. since regular neurosteroids show no affinity for steroid receptors, they may act only in a non - genomic mode. multiple studies have been conducted so far to show efficacy of neurosteroids in the treatment of the central and peripheral nervous system injury, ischemia, neurodegenerative diseases, or seizures. in this review we focused primarily on neurosteroid mechanisms of action and their role in the process of neurodegeneration. most of the data refers to results obtained in experimental studies. however, it should be realized that knowledge about neuroactive steroids remains still incomplete and requires confirmation in clinical conditions. |
streptococcus pneumoniae otherwise call pneumococcus has remained an extremely important human bacterial pathogen since its initial recognition in the late 1800s and remained an important public health concern throughout the world. globally it is the most common cause of community - acquired pneumonia (cap), sporadic bacterial meningitis and bacteraemia. while pneumococcal disease is a significant cause of morbidity and mortality worldwide, some groups bear a disproportionate share of the burden, such as the very young, the elderly, the economically disadvantaged, africans, and those with hiv / aids. from the beginning of the antibiotic era to the mid-1970s, pneumococcus remained uniformly susceptible to all classes of antibiotics that had been active against the organism, with the possible exception of tetracycline. however, in 1977 and 1978 an outbreaks of penicillin - resistance pneumococci (prp) were reported in durban and johannesburg, south africa. although they were originally called prp, these organisms appeared to have acquired genetic material that encoded resistance to both penicillin and other commonly used antibiotics. the major mechanism of resistance involves the introduction of mutations in genes encoding penicillin - binding proteins and selective pressure is thought to play an important role. high - level penicillin resistance, macrolide resistance and multidrug - resistance often complicate the management of pneumococcal infection and make choosing empiric antimicrobial therapy for suspected cases of meningitis and pneumonia increasingly difficult. an alarming increase in infections due to penicillin non - susceptible pneumococci (pnsp) has been documented in nearly all countries in the world. reported 30.4% of pneumococci as non - susceptible to penicillin in four african cities (abidjan, casablanca, dakar, tunisia). in kano, north - west nigeria, 93%, 92%, 84%, 53% and 21% of pneumococci were non - susceptible to penicillin, co - trimoxazole, tetracycline and ampicillin, respectively. penicillin non - susceptible rates of 18%, 29.72%, 11.76% and 67% were also reported by different workers from different regions in nigeria. the rapid emergence of antibiotic resistance is adding to the burden of pneumococcal disease by significantly contributing to the numbers of treatment failures and deaths from this disease. the previous studies in north - west nigeria used disc diffusion method which is inadequate in distinguishing intermediate resistance from absolute resistance among pneumococcal isolates. however, an e - test has been shown to be a good alternative for testing pneumococcal mic when compared with the standard agar dilution method. hence, the main objective of the present study was to determine the resistance pattern of pneumococcal isolates from patients with invasive pneumococcal disease (ipd) in north west nigeria using e - test strip. the study was a cross - sectional study among patients with community acquired pneumococcal pneumonia, meningitis or bacteraemia. the study was conducted in a tertiary referral centre in north west nigeria over the period june 2009 to january 2011. the hospital is among the major referral centers for north - west states of nigeria and neighboring countries like niger republic. it has 550 beds and offers specialist inpatient and outpatient care, across various specialties. all adult patients who were admitted with features compatible with case definition of community acquired pneumonia, meningitis and bacteraemia were recruited consecutively into the study. a sputum specimen was collected in a clean, sterile container from patients with clinical evidence of pneumonia. blood samples were collected from all the patients, and inoculated directly into each of brain heart infusion and thioglycolate culture media, with the use of standard aseptic procedures for aerobic and anaerobic cultures, respectively. a lumber puncture was conducted on all the patients presenting with clinical features suggestive of meningitis if there were no contraindication, the csf samples were collected in a clean, sterile container and was sent to the laboratories for microbiological analysis and for glucose and protein measurement. a blood sample was taken for random plasma glucose measurement just before the lumbar puncture was performed, for comparison with the csf glucose level. all samples were taken before administering antibiotic whenever feasible and transported to the laboratory immediately. the laboratory operates 24 hour per day and able to process csf specimen within 30 min of receipt. all the sputum specimen and csf sample inoculated plates were incubated in a candle jar so as to create a reduced oxygen tension (5 - 10% additional co2 tension). inoculated blood culture bottles were incubated in the laboratory at 37c and observed for bacterial growth within 24 to 72 hours and at day 7 if there was no bacterial growth. subcultures of inoculated media were done twice, on days 2 and 3 after incubation, and were inoculated onto blood agar plates and incubated as far csf and sputum. plates were examined after incubation for bacterial pathogens, by the use of standard procedures. samples of all typical pneumococcal colonies obtained from the plates were subjected to pneumococcal identification methods of -hemolysis, colony morphology and ethylhydrocupreine hydrochloride (optochin). microbial susceptibility tests was carried out on all confirmed pneumococcal isolate to penicillin g, amoxycillin, amoxycillin clvulanic acid, cefuroxime, ceftriaxone, tetracycline, trimethoprim / sulfamethoxazole (tpm / smx), azithromycin, ofloxacin and chloramphenicol using etest strips (manufactured by ab biodisk, sweden). minimum inhibitory concentrations (mics) were measured and strains were divided into resistant, intermediate or sensitive according to the clsi guidelines. pneumococcal pneumonia was defined based on clinical findings plus a chest radiograph consistent with pneumonia, in addition to gram positive diplococci on microscopy and positive culture of pneumococcus from an ideal sputum specimen defined as the presence of more than 25 white cells and less than 10 squamous epithelial cells per low power field. pneumococcal meningitis was defined as isolation of pneumococcus with or without appearance of gram positive diplococci on microscopy from csf or a csf pleocytosis (> 5 white blood cells / mm) plus a blood culture positive for pneumococcus in a patient with clinical evidence of meningitis. analysis was carried out using descriptive statistics with differences and relationships determined using student t - test, chi - squared and fisher 's exact tests as appropriate, with p < 0.05 regarded as significant. the ages of the patients ranged from 18 to 82 years, with a mean age of 42.7 years 18.74. there were 72 (54.5%) males and 60 (45.5%) females with a male to female ratio of 1:2. one hundred and seventeen (88.6%) were recovered from sputum, 7 (5.3%) from csf and 8 (6.1%) from blood. twenty - two (16.7%) of the pneumococcal isolates were fully sensitive to penicillin while 73 (55.3%) were intermediately resistant and 37 (28%) were fully resistant. only 5 (3.8%) of the isolates were sensitive to cotrimoxazole. the susceptibility profile of amoxicillin and amoxicillin / clavulanic acid was the same with 104 (78.8%) of the isolate been sensitive while 17 (12.9%) and 11 (8.5%) were intermediately resistant and fully resistant, respectively [table 1 ]. of the 132 isolates, 19 (14.4%) were resistant to only one class of antibiotic, 42 (31.8%) were resistant to two classes antibiotics while 71 (53.8%) were resistant to three or more antibiotics ; none of the isolate was susceptible to the entire antibiotic tested. penicillin - resistant pneumococcus is also resistant to more other antibiotics compared to penicillin susceptible pneumococcus [table 2 ]. the pattern of prescription of drugs by non - qualified personnel, under dosing, over prescription and outright fake drug racketeering has become profound in nigeria. these factors lead to development of resistance by bacteria to drugs that otherwise would have been helpful in treating infection. we demonstrated pneumococcal resistance to commonly used antibiotics in a tertiary referral center in north - west nigeria [table 1 ]. in this study 28% of the isolate were fully resistance to penicillin and 55.3% were of intermediate resistance. similarly, a previous study using disc diffusion method reported 95% of pneumococcal isolate to be non - susceptible to penicillin in kano, nigeria. in maiduguri north - east nigeria reported penicillin non - susceptible rate of 67% among pediatric pneumococcal isolates, while in north central nigeria akanbi., in ilorin reported resistance rate of 83%, which is similar to our report. furthermore, a recent multicenter study in two major cities in south west nigeria reported 100% of pneumococcal isolates to be resistant to penicillin, however, a decade earlier a resistance rate of 36% was reported from this region thus highlighting the rapid spread of prp in nigeria. a lower resistance rate of 29.7% and 11.76% were reported among non - invasive nasopharyngeal isolate in north central and south west nigeria, respectively. the high prevalence of prp in nigeria is not surprising as penicillin are the most widely used antibiotics. the greater the quantity and the longer the duration an antibiotic have been in use, the more likely resistant strains emerge to that particular antibiotic. the high prevalence of hiv infection and an attending prophylactic usage of tmp - smx in aids patients has been linked to the wide spread pneumococcal resistance to tmp - smx. this antibiotic had been recommended by who for the treatment of pneumococcal disease in hiv / aids patients. we found high prevalence of tmp - smx (96.2%) resistance which is comparable to report from different part of nigeria, even though some studies in nigeria reported a lower figure. amoxicillin and amoxicillin / clavulanic acid showed relatively good activity in this study with 78.8% of the isolates being sensitive while an excellent activity was seen with ceftriaxone, with only 5% being fully resistance. clavulinate, while akanbi. in a hospital - based study reported a resistance rate of 28.0% to ceftriaxone. this excellent activity seen with ceftriaxone might be related to the cost of the drug which is prohibiting in nigeria, therefore not usually abuse. the macrolides have long been important in treating cap, because of their excellent activity against pneumococci. this activity has been eroded in the past few years by the proliferation of macrolide - resistant strains. the prevalence of these resistance strains continues to increase in many parts of the world. in this. a higher resistance rate of 56.6% and 66.7% to erythromycin were reported by other workers in nigeria. reported 100% of invasive pneumococcal isolates from children to be sensitive to erythromycin which is also similar to findings by adeleye. chloramphenicol is an old antibiotic that has been so much abused in the past, as a first - line treatment for typhoid fever in most developing countries, however, with the appearance of cheaper generic forms of quinolones, and appearance of chloramphenicol - resistant salmonella typhi, prescribers have moved away from chloramphenicol and this relief of pressure on the drug, may be the reason for the good performance of chloramphenicol in this study with 80.3% being fully susceptible, with a reciprocal increase in ofloxacin non - susceptibility (41.7%). it has been reported that pneumococci resistant to penicillin are more likely to become resistant to other antibiotic than penicillin - susceptible strains. this is shown in this study where the resistance percentages among the cefuroxime, erythromycin, chloramphenicol, amoxicillin clavulanic acid and azithromycin were consistently higher among penicillin - resistant strains than among penicillin - susceptible isolates [table 2 ]. the heavy burden of community - acquired infectious diseases in most developing countries dictates a heavy requirement for antibiotics, often empirically. chloramphenicol and tpm / smx are commonly use as first - line drugs in the integrated management of childhood illness (imci) scheme. in addition to tpm / smx, penicillin and erythromycin are also widely use in sickle cell anemia and hiv / aids patient to prevent opportunistic infections. these coupled with wide spread antibiotic self - medication, may be promoting rapid emergence of antibiotic resistance in nigeria. in the first - line treatment of severe invasive pneumococcal infection in our environment we recommend the use of ceftriaxone ; however, in a resource - constrained settings chloramphenicol, amoxicillin or amoxicillin clavulanic acid may be an alternative. cefotaxime was not studied in this study however it is expected to have similar spectrum to ceftriaxone, hence may be considered were indicated. with high prevalence of penicillin resistance in this study the use of penicillin for empiric treatment of suspected pneumococcal infection is no longer recommended. the findings of our study even though limited by small sample size also underscored the need for a comprehensive action plan in nigeria to convert rapid spread of antimicrobial resistance among common bacteria pathogens such as pneumococcus and its associated morbidity and mortality. these should include promotion of rational use of antimicrobials, strengthening of antimicrobial resistance surveillance, and antimicrobial legislation among others. | background : an alarming increase in infections due to penicillin non - susceptible pneumococci (pnsp) has been documented in nearly all countries. increasingly, pnsp are also resistant to other antibiotics, and a growing number of clinical failures following the use of these agents have been reported.aims:to determine the resistance pattern of pneumococcal isolates from patients with invasive pneumococcal infection in north west nigeria.materials and methods : in a cross - sectional study clinical specimens were obtained from patients with community acquired pneumonia (cap), meningitis and bacteraemia over a 2 year period. pneumococcus strains were identified. isolates were tested against a panel of antibiotics using e - test strips, and interpreted according to the clsi criteria. 0.06 g / ml was used as break point for penicillin. analysis was carried out using descriptive statistics ; relationships determined using chi - squared or fisher 's exact tests, with p < 0.05 regarded as significant.results:total number of isolates was 132. twenty - two (16.7%) of the isolates were fully sensitive to penicillin while 73 (55.3%) and 37 (28.0%) were intermediately and fully resistant, respectively. one hundred and twenty - seven (96.2%) of the isolates were fully resistant to trimethoprim sulphamethoxazole. eleven (8.5%) were fully resistant to amoxicillin and 104 (78.8%) and 17 (12.9%) were intermediately resistant and fully susceptible. one hundred and six (80.3%) of the isolates were fully susceptible to chloramphenicol. resistance to penicillin was shown to infer resistance to other antibiotics.conclusions:pneumococcal resistance is common in north west nigeria. ceftriaxone retains excellent activity against most of the invasive isolate, while trimethoprim - sulphamethoxazole is almost uniformly resistant. |
during malignant transformation, cells undergo stages of gene expression reprogramming and mutagenesis that alter their metabolic phenotype(s) [15 ]. initial stimuli (not all known) dysregulate information signaling and activate oncogenes and/or cancer stem cells, resulting in a partial glycolytic warburg phenotype [15 ] in which pyruvate is diverted, at least to a certain extent, from oxidative phosphorylation (oxphos). high proliferation and impaired angiogenesis subsequently cause hypoxia in certain regions within a growing tumor, and then hypoxia - mediated metabolic reprogramming (such as that promoted by hypoxia - induced factor, hif [68 ]) further intensifies the glycolytic phenotype and may nearly completely divert pyruvate from pyruvate dehydrogenase (pdh), that is, from oxphos. the sustained high rate of cell proliferation, however, results in aglycemia, initiating the revival of oxphos in conjunction with the promotion of glutaminolysis [1, 2, 9, 10 ]. the overall glutaminolysis provides cytosolic pyruvate / lactate and also yields nadph via citrate export from mitochondria and subsequent atp - citrate lyase and malic enzyme reactions. this compensates for the reduced net energy production by the glycolytic pathway and pentose phosphate pathway (ppp). pyruvate imported into mitochondria is the precursor of not only acetyl - coa but also citrate, which is required for fatty acid synthesis and hence for phospholipid synthesis, so it is essential for cell growth [15 ]. the final established phenotype is exemplified by human glioblastoma cells, which, despite their low respiration, maintain a constant pyruvate flux through pdh and hence partial oxphos. for the purpose of this paper, we shall use the term glutaminolysis in a more general way than just the transformation of glutamine to 2-oxoglutarate (2og). if 2og resulting from glutamine acts in the forward krebs cycle (despite possible ongoing citrate extrusion and truncation of the cycle so that aconitase and classic nad - dependent isocitrate dehydrogenase (idh3) reactions are not required), we define the system of metabolic reactions involved as oxphos glutaminolysis. this term points out to its essential dependence on succinate dehydrogenase (complex ii) and hence on respiration and oxphos. in contrast, when the reductive carboxylation of 2og by isocitrate dehydrogenase 2 (idh2) (in the counter krebs cycle direction) consuming nadph follows glutaminolysis of glutamine to 2og and when the reverse aconitase reaction and citrate efflux are added, we define that system as reductive carboxylation glutaminolysis (rcg), also referred to as the latter term denotes the absolute independence of oxygen (respiration). in general although it acts frequently in broad cancer types, glutaminolysis is not universal for all cancers [35 ]. in cancer cells employing oxphos glutaminolysis, glutamine can fully compensate for the lack of glucose in terms of energy generation and syntheses of precursors for anabolic pathways [35 ]. thus, to survive under conditions of limited glucose, highly glycolytic cancer cells may adapt to glutaminolysis, which in its oxphos mode restores oxphos and may restore also at least partial pdh function [1, 3, 1214 ]. in normal cells, mitochondrial glutaminase catabolizes glutamine to produce ammonia and glutamate, which is further transaminated by glutamate dehydrogenase into 2og to feed the krebs cycle. in malignant tumors, negative allosteric effectors, such as gtp, inhibit glutamate dehydrogenase, resulting in a move toward glutaminolysis, where glutamate and pyruvate are reactants in a transamination reaction that produces, for example, alanine and 2og by alanine aminotransferase (transaminase). in cancer cells, 2og usually feeds the forward - running krebs cycle truncated after citrate synthase during citrate extrusion, so that aconitase and classic nad - dependent idh3 reactions are not required [1, 5 ]. this oxphos glutaminolytic mode is strictly dependent on oxaloacetate and acetyl - coa, that is, on the citrate synthase reaction ; hence, it proceeds only in cells in which oxaloacetate is provided by malate dehydrogenase fed by the krebs cycle as well as by malate import from the cytosol, where malate originates from atp - citrate lyase reaction. likewise incomplete inhibition of pdh restores acetyl - coa in mitochondria (the pyruvate pool is split between the pdh and transaminase reactions). also, the mitochondrial malic enzyme may contribute to this pool by producing pyruvate from malate. citrate is extruded from mitochondria and converted to oxaloacetate and acetyl - coa by atp citrate lyase. acetyl - coa is then used to produce fatty acids by fatty acid synthase and cholesterol for general lipid synthesis, which is essential for cancer cell proliferation [18, 19 ]. in glioblastoma, if there is excess nadh in the cytoplasm (produced by aerobic glycolysis), the cytosolic oxaloacetate is converted first to malate by malate dehydrogenase and then to pyruvate by the cytosolic malic enzyme, thus may also contribute to lactate production [9, 20 ]. moreover, alanine that is released by transaminase is used for cytosolic amino acid transformations and protein synthesis [1, 4, 5 ]. hypothetically, malignant tumors may survive on intermittent oxphos - independent rcg (also termed anoxic glutaminolysis) in parallel with intermittent glycolytic periods [1, 2 ]. rcg utilizes reductive carboxylation of 2og by the reverse reaction of mitochondrial idh2 at the expense of nadph, followed by the reverse aconitase reaction and citrate efflux from the matrix [13, 2123 ]. nadph is provided by the malic enzyme converting malate to pyruvate and might also be provided by the mitochondrial transhydrogenase. the oxphos independence of this mode means that it may proceed at any level of hypoxia and even at anoxia, thus increasing malignancy [1, 3 ]. the reductive carboxylation involves idh2, which converts 2og to isocitrate, from which the reverse aconitase reaction produces citrate, which is again exported from the mitochondrial matrix to the cytosol for fatty acid and lipid synthesis. note that acetyl - coa, and hence the pdh reaction, is not required in this mode. idh3 encodes a mitochondrial matrix nad - dependent octameric idh3 (422 subunits) that acts in the krebs cycle. idh3 is allosterically positively regulated by ca, adp, and citrate and negatively regulated by atp, nadh, and nadph. the two other idh genes, idh1 and idh2, encode cytosolic and mitochondrial matrix nadp - dependent (or nadph - dependent) idh1 and idh2, respectively, which are structurally and genetically unrelated to idh3 (table 1). idh3 irreversibly decarboxylates isocitrate to yield 2og while reducing nad to nadh, whereas idh1 and idh2 catalyze reversible reactions, either decarboxylating isocitrate to 2og while reducing nadp to nadph or acting in the reductive carboxylation reaction to convert 2og to isocitrate while oxidizing nadph to nadp. heterozygous mutations in idh2 at arg172 and at the analogous residue arg132 in idh1 are frequently found in grade 2 and 3 gliomas, secondary glioblastomas, and acute myeloid leukemia (aml), but they occur less frequently in primary glioblastomas and other cancers [2837 ]. no homozygous deletions of idh1 and idh2 have been found, as has been observed for classic tumor suppressors. nevertheless, mutated idh1 and idh2 exhibit a neomorphic enzyme activity, reducing 2og to d-2-hydroxyglutarate while converting nadph to nadp[23, 29, 36, 3840 ]. interestingly, the d-2-hydroxyglutarate thus formed further promotes neoplasia by competitive inhibition of histone demethylation and 5-methyl - cytosine hydroxylation, leading to genome - wide alternations in the methylation of histones and dna. it has also been reported that glioblastoma sf188 cells produce d-2-hydroxyglutarate, in spite of lacking the above - described mutations. moreover, idh2, like ~20% of other mitochondrial enzymes [42, 43 ], is acetylated at lysines, which inactivates the enzymatic activity. in turn, deacetylation of idh2 by the mitochondrial matrix deacetylase sirtuin 3 (sirt3) activates the enzyme to produce more nadph. in nonmalignant cells, the cytosolic idh1 is involved in lipid metabolism and glucose sensing. idh2 was traditionally considered to be involved in the regulation of oxphos and redox homeostasis (see section 4), and its involvement in reductive carboxylation has been recognized only recently (sections 2.4 and 3). nadp - dependent oxidative decarboxylation of isocitrate to 2og, as the major function of idh2 in nonmalignant cells, contributes substantially to the control of mitochondrial redox balance and the prevention of oxidative damage [45, 46 ]. idh2 contains an n - terminal mitochondrial addressing sequence and hence is imported to the mitochondrial matrix, although localization to nuclei has also been reported. idh2 expression in heart, skeletal muscle, and lymphocytes is quite substantial ; lower levels are found in liver, kidney, and lung [45, 47 ]. idh2 has also been found in cultured rat neurons, astrocytes, oligodendrocytes, and microglia. unlike idh1, the 94-kda idh2 (ec 1.1.1.42) is a homodimeric enzyme of two 413-amino acid subunits, each 47 kda [50, 51 ] (figure 1). idh2 function requires a divalent metal ion, and bound mn yields the maximum activity. the structure of the mn - isocitrate binding site was mapped from the solved crystal structure of porcine idh2. within the site, thr78, ser95, and asn97 (of the porcine sequence) donate a hydrogen bond to the c3 carboxyl, whereas asp252 and asp275 coordinate mn. the nadp binding site was originally predicted from the e. coli idh structures, positioning the 2-hydroxyl - bound phosphate to interact with his315 and lys374 of porcine idh2. porcine arg83 enhances nadp affinity by hydrogen bonding with the 3-oh of the nicotinamide ribose, and asn328 provides a hydrogen bond to the n1 of adenine. for efficient coenzyme site function, a hydroxyl group must be present at position 373 (thr373 of the porcine sequence), whereas asp375 and lys260 contribute to coenzyme affinity and catalysis [54, 55 ]. within the numbering of the human idh2 sequence, mutations in arg172 (an analog of frequently mutated arg132 of cytosolic idh1) are detected in gliomas [23, 36, 37 ], and mutations in arg172 and arg140 (which is adjacent in the active site to arg172) are found in aml. mutations are apparent after the transition from a normal cell to a clinically evident tumor. arg172 (as well as arg132 of idh1) provides hydrogen bonds to the and carboxyls of isocitrate and may be important in the transition from an open to closed state of the active site. the porcine arg residue mutated to asn in a position analogous to human arg172 displays a twofold reduction in specific activity and a km for isocitrate that is two orders of magnitude higher (table 1). likewise, in lysates of cells overexpressing idh2, activity is reduced when arg172 is substituted with gly, lys, or met. nevertheless, the existence of exclusively heterozygous idh2 (and idh1) mutations in gliomas and aml and the small possibility of dominant - negative mutations (minor mutant fractions existing could not exert this role) have led to the search for other consequences of idh1 and idh2 mutations. arg132 mutants of cytosolic idh1 (table 1) and arg172 mutants of mitochondrial idh2 [23, 36, 38, 39 ] possess the ability to reduce 2og to d-2-hydroxyglutarate while converting nadph to nadp. this is because the active closed state of the enzyme exhibits a higher affinity for nadph. mutant idh2 and idh1 are not supposed to allow the reductive carboxylation reaction of 2og to isocitrate. initially, the production of d-2-hydroxyglutarate in gliomas, secondary glioblastomas, and aml by mutant idh2 results in a decrease of 2og and hence depletion of succinate, fumarate, and malate from the rest of the krebs cycle [23, 36, 39 ]. interestingly, idh2 mutations also lead to increases in amino acid levels as would be expected for ongoing glutaminolysis. thus, the formed d-2-hydroxyglutarate strengthens the neoplastic phenotype by competitive inhibition of histone demethylation and 5-methyl - cytosine hydroxylation, leading to genome - wide alternations in histone and dna methylation. moreover, prolyl hydroxylase domain enzymes, which employ 2og as a cofactor for marking hypoxia - induced factor-1 (hif1) by proline hydroxylation, are inhibited by d-2-hydroxyglutarate as well as by the lack of 2og. as a result, hif1 is stabilized (if its inhibitor, aspartyl hydroxylase factor inhibiting hif, is not active) even at normoxia and thus can elicit the otherwise hypoxic reprogramming of gene expression. glutathionylation of proteins by the reversible glutaredoxin (thioltransferase) reaction serves to protect against irreversible oxidation of cysteines. such protection has been demonstrated for idh2 in that oxidized glutathione can inactivate idh2 by forming a mixed disulfide bond with cys269. the inactivated idh2 is reactivated by glutaredoxin 2 in the presence of reduced glutathione. also, idh2 in mouse heart may exist in complex with calcineurin, containing as well aconitase, malate dehydrogenase, and mnsod. posttranslational modifications of numerous mitochondrial proteins frequently occur via acetylation / deacetylation of lysine residues [42, 43, 60, 61 ]. among seven sirtuin family members, sirt3, sirt4, and sirt5 are enriched in mitochondria, such as exemplified and well described for sirt3 up to date [42, 43, 62 ]. caloric restriction prevents age - related hearing loss by reducing oxidative dna damage, but such is not the case for mice lacking sirt3. sirt3 directly deacetylates the idh2 lysines and thus activates idh2, which in its forward mode could result in increased nadph levels and thereby maintain reduced glutathione levels in mitochondria. indeed, overexpression of sirt3 and/or idh2 leads to increased nadph levels and is protective against oxidative stress - induced cell death. lys212, lys374, and lys260 (porcine sequence) may be the prime candidates for acetylation / inactivation. it remains to be shown that sirt3 can deacetylate these residues, however, and it should be investigated which reaction modes are active and possible before and after such activation, specifically, whether the reverse, nadph - dependent, reaction and rcg could be activated. as predicted in 1994 by sazanov and jackson (see also), the reductive carboxylation reaction by native idh2 converts 2og to isocitrate while oxidizing nadph to nadp. the arg172 and arg140 mutants of idh2 [23, 36, 38, 39 ] and glioblastoma sf188 cells under hypoxia convert 2og to d-2-hydroxy - glutarate in this reverse - reaction mode. this reductive carboxylation would proceed better in vivo when followed by the reverse aconitase reaction and subsequent citrate export from the mitochondrial matrix. reductive carboxylation was demonstrated for idh2 in 2002 and was indicated for cancer cells in transformed brown adipocytes, pediatric glioma sf188 cells [23, 41 ], and uok262 cells (derived from a renal tumor in a patient with hereditary leiomyomatosis, these cells are defective in respiration and devoid of fumarate hydratase activity). reductive carboxylation accompanied by citrate efflux has also been found in quiescent fibroblasts and is enhanced in contact - inhibited fibroblasts. idh2 silencing in sf188 cells results in diminished conversion of glutamine to citrate [23, 41 ]. recently, reductive carboxylation was detected in human osteosarcoma 143b cells in which the mitochondrial dna encoded a loss - of - function mutation in respiratory chain complex iii (cytb 143b cells). because only low - level reductive carboxylation was detected in wild - type 143b cells, the authors suggested that the impairment of oxphos, such as given by mutant mitochondrial dna, induces rcg. silencing of either idh1 or idh2 reduces the growth of both wild - type and cytb 143b cells. moreover, unlike in wild - type 143b cells, de novo fatty acid synthesis from glutamine as a precursor is prevalent in cytb 143b cells. reductive carboxylation in fumarate hydratase devoid uok262 cells, which are defective in respiration, has also been identified in parallel with oxphos glutaminolysis. interestingly, inhibition of respiration in mouse embryonic fibroblasts via administration of antimycin, rotenone, or metformin induces a switch towards rcg. thus, these data provide additional support for the authors ' hypothesis that rcg is a common cellular response to impaired mitochondrial metabolism. the reverse idh2 reaction was also considered such that idh2 acts together with the forward reaction of idh3 in a dissipative isocitrate/2og cycle (see section 4.2). the reductive carboxylation reaction and the overall rcg may indeed proceed together with the forward decarboxylation reaction [2, 22 ]. the best evidence was obtained by tracking the metabolites of c - labeled glutamine, such as the appearance of c - label in citrate [2, 22, 23, 41 ]. the first demonstrations of rcg in cancer cells [22, 23, 41 ] are consistent with the recent findings that mutant idh2 in gliomas and aml also produce d-2-hydroxyglutarate from 2og by alternate reduction. because these mutants are heterozygous, both rcg and the production of d-2-hydroxyglutarate might occur. the former reaction involves the nonmutant nadph - dependent idh2 reverse reaction followed by isocitrate conversion to citrate and by citrate export. the mutant idh2 (but maybe also wild - type idh2, see) acting in a reverse mode also produces d-2-hydroxyglutarate, which can not be transformed by aconitase ; however, it further enhances the malignant phenotype. the importance of this neomorphic idh2 activity for the cancer phenotype is valid even without consideration of d-2-hydroxyglutarate interference with epigenetics and the hif pathway, because idh2 depletes 2og from the krebs cycle. the consumption of nadph in the matrix is a consequence of the altered homeostasis of reactive oxygen species (ros) in cancer cells (see section 4.2) and is also possible due to nadph production by the mitochondrial malic enzyme [1, 5 ] and transhydrogenase [24, 63, 67 ]. it is not known whether sirt3-based activation also affects this reverse (nadph - dependent) idh2 reaction. although nadh, rather than nad, accumulates in the mitochondrial matrix of highly glycolytic cancer cells in which oxphos is dormant (figure 2(a)), nad might be produced by the inner membrane h transhydrogenase from nadh with the simultaneous formation of nadph from nadp in the matrix, thereby activating sirt3-mediated idh2 deacetylation. moreover, the usual acetylation of proteins may be retarded in highly glycolytic cancer cells ; hence, no sirt3-mediated deacetylation would be required. unlike glycolysis, rcg does not form atp. hence, either rcg coexistence with glycolysis or intermittent glycolysis is expected under hypoxic and deep hypoxic conditions ; that is, rcg may help cancer cells survive aglycemia and hypoxia in malignant cells. as clearly demonstrated by the examples of gliomas and aml with the oncogenic metabolite d-2-hydroxyglutarate, the establishment of rcg, even concomitantly with oxphos glutaminolysis (note that this mode does not require idh2 and aconitase reactions), helps to accelerate the malignant phenotype. recently, it has been demonstrated that hypoxia elevates rcg in sf188 cells in a hif - dependent manner. sf188 cells were able to proliferate at 0.5% o2 even if such hypoxic conditions substantially diminished glucose - dependent production of citrate, that is, oxphos and forward krebs cycle participation. a major function of idh2 in nonmalignant cells, when acting within the forward krebs cycle, is likely maintaining an adequate pool of reduced glutathione and peroxiredoxin by providing nadph. this function improves the mitochondrial redox balance and prevents oxidative damage [45, 46, 69 ], including heat - shock - induced oxidative damage and numerous consequent events of oxidative stress, such as ros - induced apoptosis [71, 72 ], apoptosis induced by ionizing radiation and cadmium, and staurosporine - induced cell death. the lack of idh2 or its activity elevates cytosolic ros, lipid peroxidation, and oxidative dna damage and shortens cell survival after oxidant exposure [69, 7173 ]. also, susceptibility to curcumin - induced apoptosis has been demonstrated upon idh2 silencing in hct116 cells. cardiac hypertrophy development is attributed to a decrease in idh2 activity owing to the lipoperoxidation product 4-hydroxynonenal and oxidative stress. idh2 is also protective for paraquat - mediated oxidative inactivation of aconitase in heart mitochondria. inactivation of idh2 activity by various ros insults is an important factor that has to be accounted for in any consideration of oxidative stress in cells. the forward krebs cycle activity of idh2 is inactivated by 4-hydroxynonenal, singlet oxygen, hypochlorous acid, aluminum, nitric oxide, and peroxynitrite. peroxynitrite forms s - nitrosothiol adducts on cys305 and cys387 of idh2 under nitrosative stress, such as that established in the liver of ethanol - fed rats. idh2 activity first increases and then decreases with age in fibroblasts and liver, kidney, and testes tissues of rats fed ad libitum but not of those fed a calorie - restricted diet. recently, caloric restriction has been proven to act via idh2 deacetylation through sirt3 and thus promote an antioxidant role for idh2-produced nadph. it is not known whether sirt3-mediated deacetylation also activates the nadph - dependent reverse reaction, that is, reductive carboxylation. the dissipative isocitrate/2og cycle has been suggested based on the reductive carboxylation reaction of idh2 (counter krebs cycle reaction direction, nadph dependent) in conjunction with the forward idh3 reaction in the canonical krebs cycle. the cycle may manifests itself in the absence of citrate export from mitochondria, as normally occurs in non - malignant cells, since cycling is impossible when reversed aconitase reaction depletes isocitrate. isocitrate formed by the reductive carboxylation reaction of idh2 is processed back to 2og by idh3. although in non - malignant cells complex i regenerates nadh to nad and nadp could be regenerated to nadph by, for example, mitochondrial malic enzyme, with increasing malignancy (more dormant state of mitochondria and hence decreasing respiration), the mitochondrial inner membrane h transhydrogenase [24, 63, 67 ] may alternatively transfer electrons from nadh and nadp to nadand nadph at the expense of the proton - motive force. however, it remains to be determined, whether this cycle is possible with d-2-hydroxyglutarate. if d-2-hydroxyglutarate was metabolized by idh3 in the canonical krebs cycle, then the cycle would be automatically induced by the appearance of d-2-hydroxyglutarate at simultaneously active h transhydrogenase. nevertheless oxphos can not be completely dormant, since proton - motive force would be required for this normal forward transhydrogenase reaction. consider the situation in highly malignant cells in which energy is derived primarily from glycolysis disconnected from oxphos (warburg phenotype) and high reductive carboxylation glutaminolysis takes place (figure 2(a)). presumably, oxphos impairment or deep hypoxia may set up this metabolic pattern. in this case, higher glucose-6-phosphate dehydrogenase activity (the first ppp enzyme) produces more nadph. it may be erroneously considered as antioxidant action ; however, because the constitutively expressed nadph oxidase isoform-4, nox4 [89, 90 ], can consume a major portion of the excess nadph and produce more superoxide and consequently release more h2o2 into the cytosol, the overall reaction scheme may be prooxidant (figure 2(a)). recently, nox4 was also suggested to have mitochondrial localization. probably, nox4 has km in the same order of magnitude as idh enzymes. the nox4 consumption of nadph leaves fewer redox equivalents for the reduction of cellular glutathione and other redox systems [9294 ]. the cytosolic oxidative stress is further intensified by the slow electron transport in low respiring (dormant) mitochondria of highly malignant cancer cells [15, 68 ], resulting in more superoxide release to the cytosol as well as the mitochondrial matrix from the respiratory chain. the ongoing maximum reductive carboxylation reaction further contributes to the oxidative stress by consuming nadph, thus leaving less nadph for maintenance of the reduced glutathione pool. moreover, as mentioned above, the accumulated nadh at slow respiration may lead to nad formation in the reversed h transhydrogenase reaction by concomitant nadph formation from nadp to further feed the nadph pool and hence reductive carboxylation. simultaneously, nad may lead to sirt3-mediated activation of idh2, at least of its forward mode, but it is not known whether reductive carboxylation is also activated by deacetylation of idh2. we next consider an intermediate warburg phenotype, characterized by the mixed use of sole glycolysis, that is, aerobic glycolysis producing lactate, and oxphos (figure 2(b)). the latter may be represented either by oxphos pyruvate metabolism and/or by oxphos glutaminolysis. under these conditions, considerable cytosolic oxidative stress is expected because of the elevated nox4 activity, as described above. however, a lower mitochondrial contribution to the cytosolic oxidative stress exists owing to an intermediate level of respiration and hence lower superoxide release from mitochondria to both the cytosolic and matrix compartments. there is also lower oxidative stress expected in the matrix owing to the possible ongoing dissipative isocitrate/2og cycle, which by decreasing the proton - motive force decreases mitochondrial superoxide formation. this can be considered, however, only when citrate efflux from mitochondria is not dominant or when d-2-hydroxyglutarate would be cycling instead of isocitrate/2og. if this is the case, nad rather than nadh would accumulate, further feeding the isocitrate/2og cycle by simultaneous action of the forward idh3 reaction and reverse (reductive carboxylation) reaction of idh2. the accumulated nad would also promote sirt3-mediated idh2 deacetylation, consequently accelerating the idh2 branch of the reaction cycle (figure 2(b)). finally, we consider the situation in non - malignant cells, in which oxphos predominates and the sole glycolysis and ppp activities are low (figure 2(c)). in this case, low oxidative stress in the cytosol is a consequence of the negligible nox4 activity and the low contribution of mitochondria to the cytosolic ros pool. under these normal conditions, we assume that the forward idh2 reaction generates nadph, which further improves the reduced state of the mitochondrial matrix glutathione and peroxiredoxin systems. indeed, ample evidence suggests that in cells with unattenuated oxphos, idh2 plays an important antioxidant role that is further strengthened by nad accumulation in highly respiring cells. nad then induces sirt3-mediated idh2 deacetylation, thus increasing its protective function in nadph formation for the maintenance of the reduced glutathione and peroxiredoxin systems and for self - maintenance by the reactivation of cystine - inactivated idh2 by glutaredoxin-2. (a) situation in cancer cells with a prevalent warburg phenotype and high reductive carboxylation. in the cytosol, higher glucose-6-phosphate dehydrogenase activity (g6pdh) produces higher nadph within the pentose phosphate pathway (ppp). nadph - oxidase isoform-4 (nox4) thus produces more superoxide and consequently contributes to high levels of reactive oxygen species (ros) in the cytosol. the cytosolic oxidative stress is further intensified by the slow electron transport in low - respiring (dormant) mitochondria, leading to higher superoxide release to the cytosol and matrix compartments. the ongoing maximum reductive carboxylation reaction further contributes to oxidative stress by consuming nadph, thus leaving less for maintenance of the reduced glutathione pool. the accumulated nadh at slow respiration may lead to nad formation in the reverse h transhydrogenase (th) reaction (due to low proton / motive force) with concomitant nadph formation from nadp to further feed the nadph pool and hence reductive carboxylation. hypothetically, nad may lead to sirtuin 3 (sirt3)-mediated deacetylation / activation (+) of idh2, but it is not known whether reductive carboxylation is also activated by deacetylation of idh2. (b) situation in cancer cells with an intermediate warburg phenotype and possible oxphos glutaminolysis. the major contribution to however, a lower mitochondrial contribution to cytosolic ros leads to intermediate oxidative stress under these conditions. indeed, an intermediate or high respiration leads to much lower superoxide production and release from the mitochondria to both the cytosolic and matrix compartments (dashed arrows). lower oxidative stress is also expected in the matrix owing to the ongoing dissipative isocitrate/2og cycle, which decreases further mitochondrial superoxide formation by decreasing the proton - motive force. oxphos glutaminolysis may predominate under these conditions ; hence, rcg might not be completed and the isocitrate/2og cycle with forward h transhydrogenase reaction may be initiated. aerobic glycolysis and ppp activity are low ; consequently, low oxidative stress in the cytosol also results from the negligible nox4 activity and the low contribution of mitochondria to the cytosolic ros. the forward idh2 reaction thus forms nadph, which further improves the reduced state in the mitochondrial matrix glutathione and peroxiredoxin systems. as in (b), the nad accumulation in highly respiring cells then induces sirt3-mediated deacetylation / activation of idh2. as briefly described above, mutant idh2 as well as idh1 [96100 ] produce d-2-hydroxy - glutarate, which can initiate an hif - mediated hypoxic type of gene reprogramming even at normoxia. nevertheless, detail investigations of d-2-hydroxyglutarate effects on hif signaling are required, since recently an opposite effect, diminishing hif levels by inhibition of egln prolyl 4-hydroxylases, has been reported. also, non - mutated idh2 acting in the 2og / isocitrate cycle together with h transhydrogenase could contribute to the modulation of the ros pool by initiating an impulse originating from complex iii to dissipate the proton - motive force, which reduces superoxide formation in the mitochondrial respiratory chain. in contrast to mutant idh2 activity, the ongoing dissipative 2og / isocitrate cycle in the absence of citrate efflux from mitochondria would retard hif signaling. the discovery of mutant idh2 and idh1 in certain gliomas and aml and their production of the oncogenic metabolite d-2-hydroxyglutarate have unraveled a fascinating story of cancer self - acceleration via intermittent episodes of genome instability and metabolic remodeling and namely via epigenomic alterations [98, 100 ]. however, there are additional aspects to be clarified. first, the exact role of d-2-hydroxy - glutarate must be further investigated to determine whether it promotes the reverse carboxylation mode of glutaminolysis and whether it acts in the dissipative 2og / isocitrate cycle, which would then become the 2og / d-2-hydroxyglutarate cycle, as we can now only speculate. also, conditions under which d-2-hydroxyglutarate might be formed in non - mutant idh2 should be defined. second, the role of sirt3 has to be established to determine whether it prevents or accelerates malignancy via idh2. finally, the role of idh2 in other cancer types distinct from aml, gliomas, and renal tumors of hereditary leiomyomatosis should be investigated. | isocitrate dehydrogenase 2 (idh2) is located in the mitochondrial matrix. idh2 acts in the forward krebs cycle as an nadp+-consuming enzyme, providing nadph for maintenance of the reduced glutathione and peroxiredoxin systems and for self - maintenance by reactivation of cystine - inactivated idh2 by glutaredoxin 2. in highly respiring cells, the resulting nad+ accumulation then induces sirtuin-3-mediated activating idh2 deacetylation, thus increasing its protective function. reductive carboxylation of 2-oxoglutarate by idh2 (in the reverse krebs cycle direction), which consumes nadph, may follow glutaminolysis of glutamine to 2-oxoglutarate in cancer cells. when the reverse aconitase reaction and citrate efflux are added, this overall anoxic glutaminolysis mode may help highly malignant tumors survive aglycemia during hypoxia. intermittent glycolysis would hypothetically be required to provide atp. when oxidative phosphorylation is dormant, this mode causes substantial oxidative stress. arg172 mutants of human idh2frequently found with similar mutants of cytosolic idh1 in grade 2 and 3 gliomas, secondary glioblastomas, and acute myeloid leukemia catalyze reductive carboxylation of 2-oxoglutarate and reduction to d-2-hydroxyglutarate, which strengthens the neoplastic phenotype by competitive inhibition of histone demethylation and 5-methylcytosine hydroxylation, leading to genome - wide histone and dna methylation alternations. d-2-hydroxyglutarate also interferes with proline hydroxylation and thus may stabilize hypoxia - induced factor. |
panel of samples - in this study, we included 34 samples from long - term residents of an endemic amazon rural community, colniza, state of mato grosso (mt) ; subclinical malaria infections were characterised in this area during a detailed descriptive epidemiology study carried out between 2003 - 2009 (maciel 2011). in that study, the parasitological and epidemiological data from seven consecutive years identified a small community, herein referred to as colniza, where 55.91% of all malaria cases were subclinical. consequently, malaria infection could not be excluded a priori in the individuals exposed to malaria in colniza. colniza is located inside the amazon forest in the northwest of mt, roughly 1,200 km from the capital cuiab ; colniza can be accessed by two paved roads, which connect mt to the states of amazonas (br-174) and rondnia (mt-206). the economic activities of this municipality are based mainly on wood extraction and livestock. malaria is transmitted year - round with an annual parasitological index (api) of 98.5 cases per 1,000 inhabitants (maciel 2011). samples were collected in this area in 2008 during a survey of asymptomatic patients in the area. the following eligibility criteria were included : (i) a minimum age of 15 years, (ii) the absence of pregnancy, (iii) a lifetime exposure to malaria in the colniza area, (iv) no self - reported symptoms suggestive of malaria, such as fever, myalgia, chills or headache and (v) negative blood parasites by direct examination of giemsa - stained thick blood smears. although all samples were negative by om, 14 out of 34 (41%) samples were positive according to a malaria - specific nested - pcr (snounou. consequently, all of the colniza samples were initially considered individuals who might have submicroscopic parasitaemia and may therefore be potential malaria carriers. as a positive control, we included 52 field samples from patients who sought care at a regional reference malaria laboratory (julio muller university hospital, federal university of mato grosso, cuiab) and whose thick blood smears were positive for malaria. based on the om results, the parasite densities of the positive controls ranged from high (> 1,000 parasites l / blood, n = 16), to medium (1,000 - 301 l / blood, n = 16) and low parasitaemia (100 - 300 parasites l / blood, n = 20). as a negative control, 20 blood samples from volunteers living outside of the endemic area were included ; these volunteers had never been infected or exposed to the malaria parasites. ethics - the ethical and methodological aspects of this study were approved by the ethical committee of research on human beings from the ren rachou research centre / oswaldo cruz foundation (reports 07/2006 and 01/2009), according to the resolution of the brazilian council on health 196/96. blood examination - the giemsa - stained thick blood smear technique was used for malaria diagnosis in all of the samples in the present study ; during this examination, long - term experienced microscopists were in charge of examining the equivalent of 0.2 l of blood (roughly 100 microscopy fields). for quality assurance, each slide was examined by two microscopists who had over 10 years of experience in reading malaria slides ; their proficiency was periodically evaluated by local / regional quality assurance programs of the brazilian ministry of health (ms). parasite density was estimated as the number of parasites per microlitre of blood, in accordance with the standards of the ms. whole blood samples and preparation of the dna template - at the time of the thick blood smear preparation, 5 ml of blood was drawn into sterile tubes containing ethylenediamine tetraacetic acid and aliquots (1 ml) of the whole blood were subsequently used to purify the templates for the pcr assays. genomic dna was extracted using a qiagen genomic dna purification kit (puregene) (gentra systems, minneapolis, mn, usa), according to the manufacturers recommendations. the dna was eluted in a 330-l volume (100 ng of dna /l) and stored at -20c until it was used. nested - pcr - samples were amplified using a nested - pcr protocol adapted from the original protocol described by snounou. (1993) ; the same primers described in the original study were used in this study. briefly, all pcr reactions were performed in 20 l volumes containing 250 m each oligonucleotide primer, 10 l of master mix (promega) (0.3 units of taq polymerase, 200 m each deoxyribonucleotide triphosphates and 1.5 mm mgcl 2) and 2 l of dna (6 l of whole blood). the pcr assays were performed using an automatic thermocycler (ptc-100 v.7.0) (mj research inc, usa) and the following cycling parameters were used : an initial denaturation at 95c for 5 min followed by 24 cycles of annealing at 58c for 2 min, extension at 72c for 2 min and denaturation at 94c for 1 min followed by a final annealing incubation at 58c for 2 min and extension at 72c for 2 min. the temperature was then reduced to 4c until the samples were taken. the cycling parameters for the second round of pcr were the same as the first reaction, but instead 30 cycles of amplification were used. the amplified products were detected by ethidium bromide staining following agarose 2% gel electrophoresis (invitrogen) and the species - specific fragment sizes were 205 bp for plasmodium falciparum, 120 bp for plasmodium vivax and 144 bp for plasmodium malariae. because human dna represents the majority of the dna in the samples, a gene present in the abo human system was amplified in the panel of samples to determine the quality control of the dna extraction, as previously described (olsson. rt - pcr - identification of the malaria parasite species was performed by rt - pcr amplification of the 18ssu rrna gene, as previously described (mangold. 2005) ; based on this protocol, a consensus pair of primers was used to amplify a species - specific region of the multicopy 18ssu rrna gene. briefly, each 20 l reaction mix contained 2 l of genomic dna (6 l of whole blood), 10 l of sybr green pcr master mix (applied biosystems), 2.5 mm mgso 4 (final concentration) and 0.5 m of each primer (biosynthesis). the pcr conditions consisted of an initial denaturation at 95c for 10 min followed by 40 cycles of 90c for 30 sec and 60c for 30 sec ; fluorescence acquisition was performed at the end of each extension step. after amplification, the melting curves were observed from the dissociation curves and those melting curve analyses, which were based on nucleotide variations within the amplicons, provided a basis for the accurate differentiation of the three plasmodia : p. falciparum, p. vivax and p. malariae. the amplification and fluorescence detection were performed using the abi prism 7000 sequence detection system (applied biosystems). the range of melting temperatures (t m) for each plasmodium was 74 - 76c for p. vivax, 71 - 73c for p. falciparum and 68 - 70c for p. malariae. reproducibility of the pcr reactions - initially, each dna sample from the individuals who might harbour submicroscopic parasitaemia (colniza ; potential malaria carriers) were submitted to three pcr reactions. we amplified the 18ssu rrna gene using nested - pcr, which is widely regarded as the gold standard for the pcr detection of malaria parasites (malera 2011). additionally, the samples were also submitted to a second pcr protocol (rt - pcr for the plasmodium 18ssu rrna gene). after this first round of pcr, the colniza samples were considered positive or negative if all of the pcr results were consistent. for the discordant results, the samples were submitted to a second round of pcr, which included a re - amplification using the gold - standard nested - pcr protocol and two additional replicates of the rt - pcr method ; this approach ensured that each discordant sample was retested at least three times by each pcr protocol. afterwards, the discordant samples were classified as doubtful for malaria infection. for samples from patients with microscopically detectable parasitaemia (positive controls), a consensus result per protocol was based on the agreement between at least three pcr results. statistical analysis - a chi - squared analysis was performed to compare the nested and rt - pcr protocols and to compare the single vs. multiple reactions. the agreement between the different assays was evaluated using mcnemar s chi - squared analysis and the kappa () coefficient of agreement. performance of the nested - pcr and rt - pcr protocols against a panel of reference samples - as an internal control, microscopically positive (n = 52) and negative (n = 20) control samples were evaluated using the nested and rt - pcr methods (table i). both pcr protocols were specific as no positive results were obtained from the blood samples of the 20 malaria nave volunteers. regardless of the pcr protocol, pcr accurately identified 98 - 100% of the microscopy - positive samples ; concerning the reproducibility of the pcr amplification, no significant differences were observed after retesting all 72 control samples (3 - 5 replicates per protocol). additionally, for the plasmodium species - specific identification, the results of both pcr protocols were highly reproducible and, in general, equivalent to those obtained by om (table ii). as expected, the pcr protocols detected a number of mixed infections (p. vivax plus p. falciparum) that could not be detected by microscopy (table ii). the reproducibility of the pcr methods was confirmed using statistics, which demonstrated that no difference was observed between the single and multiple pcr reactions or between the nested and rt - pcr protocols (-values of 0.70 - 0.91 ; mcnemar test, p > 0.05). table iperformance of polymerase chain reaction (pcr) protocols evaluated against a panel of reference samples with single or multiple assays realised per pcr protocolsamplesparasites/l(n) nested - pcr positive n (%) rt - pcr positive n (%) single multiplesinglemultiple positive > 100 (52)51 (98)52 (100)51 (98)51 (98)negative0 (20)0 (0)0 (0)0 (0)0 (0) a : parasitaemia as detected by optical microscopy ; b : single, the result of the first pcr reaction, and multiple, the results of three concordant pcr reactions. there were no statistical differences between results from single vs. multiple pcr assays or from nested vs. real - time (rt)-pcr for single vs. multiple reactions (p > 0.05). a : parasitaemia as detected by optical microscopy ; b : single, the result of the first pcr reaction, and multiple, the results of three concordant pcr reactions. there were no statistical differences between results from single vs. multiple pcr assays or from nested vs. real - time (rt)-pcr for single vs. multiple reactions (p > 0.05). table iipolymerase chain reaction (pcr) performance for the detection of plasmodium falciparum and/or plasmodium vivax at microscopically positive samples plasmodium speciesom positive samples n (%) nested - pcrrt - pcr single multiplesinglemultiple p. vivax 41 (79)40 (77)40 (77)40 (77)40 (77) p. falciparum 11 (21)9 (17)10 (19)10 (19)10 (19)mixed02 (4)2 (4)1 (2)1 (2)negative01 (2)0 (0)1 (2)1 (2) a : optical microscopy (om), which included 52 samples positive at parasite density > 100 parasites per l of blood ; b : nested - pcr and real - time (rt)-pcr were carried - out as described in subjects, materials and methods ; single, the first pcr reaction, and multiple, the results of three concordant pcr reactions. a : optical microscopy (om), which included 52 samples positive at parasite density > 100 parasites per l of blood ; b : nested - pcr and real - time (rt)-pcr were carried - out as described in subjects, materials and methods ; single, the first pcr reaction, and multiple, the results of three concordant pcr reactions. evaluation of pcr performance for detecting submicroscopic malaria infections - thirty - four samples from long - term residents of a rural amazon community with frequent subclinical malaria infections (potential malaria carriers) were assayed using both pcr - based protocols. at the time of the blood collection, all of these individuals had a negative malaria thick blood smear, but 14 out of 34 (41%) individuals were positive for malaria according to the nested - pcr assay, which was performed in parallel. to evaluate the reproducibility of the dna amplification by the pcr - based protocols, each sample was submitted to three additional pcr reactions (nested and rt - pcr) ; to reach a molecular consensus, the discordant samples were re - amplified by additional pcr assays (table iii). molecular consensus confirmed the submicroscopic malaria infection in seven (21%) individuals and excluded this possibility in 14 samples (41%). in 13 (38%) samples, the pcr replicates led to alternating positive or negative results and these discrepancies probably reflect the limitations of the molecular methods at low levels of parasitaemia. regarding the identification of the plasmodium species, only two samples (917 and 930) were discordant ; nested - pcr identified these samples as mixed infections, however these results were not confirmed by rt - pcr. on the other hand, no positive results were obtained from the blood samples from five malaria nave volunteers (data not shown). table iiireproducibility of polymerase chain reaction (pcr)-based protocols among 34 long - term residents of an amazon rural community who might harbour submicroscopic parasitaemia (potential malaria carriers) codenested - pcr rt - pcr consensus result n (%) firstsecondthirdfourth firstsecondthird 903negnegnegndnegndnd-906negnegnegndnegndnd-907negnegnegndnegndnd-909negnegnegndnegndnd-911negnegnegndnegndnd-912negnegnegndnegndnd-913negnegnegndnegndndnegative, 14 (41)918negnegnegndnegndnd-920negnegnegndnegndnd-922negnegnegndnegndnd-923negnegnegndnegndnd-934negnegnegndnegndnd-935negnegnegndnegndnd-936negnegnegndnegndnd- 902fvfvfvndfvndnd-904vvvndvndnd-916vvvndvndnd-921vvvndvndndpositive, 7 (21)924vvvndvndnd-925vvvndvndnd-929vvvndvndnd- 901mnegnegnegnegnegneg-908vnegnegnegvnegneg-915negnegvnegvvv-928negnegvnegnegnegneg-919negnegffnegnegneg-905fnegnegffnegnegdoubtful, 13 (38)910negvnegvvvv-917negfvfvfvvvv-930fvnegfvnegvvv-926vnegnegvnegnegneg-927negvvvnegnegneg-932vvvndnegnegv-933fnegnegnegnegnegf- a : initially, each sample was submitted to the first round of pcr [3 nested - pcr (gold - standard) and 1 real - time (rt)-pcr ]. samples with discordant results were resubmitted to a second round of pcr (1 nested - pcr and 2 rt - pcr). this approach allowed that discordant samples were classified as doubtful after being tested at least in triplicate by each pcr protocol. results were indicated as positive by plasmodium vivax (v), plasmodium falciparum (f), plasmodium malariae (m) and mixed infection by p. falciparum and p. vivax (fv). a : initially, each sample was submitted to the first round of pcr [3 nested - pcr (gold - standard) and 1 real - time (rt)-pcr ]. samples with discordant results were resubmitted to a second round of pcr (1 nested - pcr and 2 rt - pcr). this approach allowed that discordant samples were classified as doubtful after being tested at least in triplicate by each pcr protocol. results were indicated as positive by plasmodium vivax (v), plasmodium falciparum (f), plasmodium malariae (m) and mixed infection by p. falciparum and p. vivax (fv). nd : not done ; neg : pcr negative for plasmodium infection. of importance, the limitation of pcr amplification at low levels of parasitaemia was restricted to dna from field samples because titrations of dna templates obtained from the plasmodium reference isolates or species - specific plasmid constructions could be detected at concentrations of less than three parasites/l of blood. figs 1, 2 illustrate the end - point dna titrations of the rt - pcr method, in which the dna templates were obtained from cultured p. falciparum or from an artificially mixed infection obtained from highly - parasitaemic individuals infected with p. falciparum and p. vivax (10,000 parasites/l of blood). similar results were obtained using the nested - pcr protocol (data not shown). 1 : real - time polymerase chain reaction melting curve analysis obtained from dna template dilutions from plasmodium falciparum continuous erythrocyte culture. the p. falciparum parasite (bhz 26/86), a chloroquine - resistant isolate (carvalho. 1991), was maintained in culture by the candle jar method (jensen & trager 1977), with cultures maintained synchronised as described (jensen 1978). serial dilutions of samples included were 3,000, 300, 30, 3, 0.3 and 0 parasite/l of blood. the graph was generated by using the abi prism 7000 sequence detection system (applied biosystems). 2 : real - time polymerase chain reaction melting curve analysis obtained from dna template dilutions from and artificial plasmodium falciparum and plasmodium vivax infection. the graph was generated by using the abi prism 7000 sequence detection system (applied biosystems). serial dilutions of samples included were 3,000, 300, 30, 3, 0.3 and 0 parasite/l of blood. as part of the international effort to reduce the global incidence of malaria, it has been proposed that the treatment of asymptomatic carriers should be an essential tool for breaking the cycle of infection in some transmission settings (ogutu. however, improved diagnostic tests are needed to reach this goal in order to accurately detect submicroscopic malaria infections. although it has been claimed that pcr - based protocols are capable of detecting very low levels of parasitaemia, the reproducibility of these methods in malaria field samples has been largely underestimated. here, the main goal was to analyse the reproducibility of the pcr - based protocols in detecting submicroscopic malaria infections. therefore, field samples, not standard dna templates, were used in this analysis because some, if not all, of the field samples may contain inhibitors that are not present in the standard dna samples (andrews. 2010). in this context, we selected the colniza area due to the high frequency of subclinical malaria, which made it feasible to identify submicroscopic malaria infections. following this protocol, we demonstrated that the traditional pcr amplification protocols might not be able to accurately and reproducibly identify potential submicroscopic malaria carriers. in fact, the pcr results were inconsistent in 13 out of the 34 (~40%) individuals, even after seven replicates of each dna template (4 nested - pcr replicates and 3 rt - pcr replicates) were performed. these results were quite different from those obtained from the replicate samples of the microscopic positive patients, which could be confirmed with a high degree of reproducibility using both pcr - based protocols. as in the endemic areas where the cost of diagnostic tests becomes a limiting factor, we decided to use the simplest and most economical format of rt - pcr in this study, which relied on the detection of the fluorescent reporter sybr green i. while the sensitivity of sybr green is similar to other rt chemistries, the specificity of the reporter may be misleading in some few cases due to variations in the amount of template (parida 2008). in the present study, it was possible to rule out this potential limitation of the sybr - based protocols because rt - pcr was 100% specific, with no positive results from the negative controls (nave volunteers). additionally, similar results were obtained with both the nested - pcr and rt - pcr methods, suggesting the low variability between these two assay platforms based on the 18ssu rrna gene. it is important to emphasise that the reproducibility of the sybr green protocols could be due to variations in the t m that impact the melting curves, for example. however, this does not seem to be the case here, as the optimisation of the pcr reactions resulted in a very small variation in the tm values. additionally, based on our positive panel of samples, which included a wide - range of parasitaemia, finally, the low reproducibility for detecting submicroscopic parasitaemia was not exclusive to the sybr green protocol, but was also observed with the gold - standard nested - pcr. in conclusion, we agree with others that protocols based on sybr green are more cost efficient in endemic areas than the alternatives that use internal fluorogenic probes (moreira. concerning mixed - species infections, while the nested - pcr method identified five dual infections of p. falciparum and p. vivax, the rt method only identified two. because the rt - pcr protocol used here was based on single consensus primers, this result suggests that the mixed infection was misidentified ; however, this rt - pcr protocol has been used to amplify mixed - malaria infections (mangold. 2005). because a comparison between the pcr protocols was not the focus of this paper the results concerning the poor performance of the pcr methods for the identification of submicroscopic malaria infections corroborate previous observations of the irreproducibility of parasite detection in samples with very low levels of parasitaemia (singh. this result means that any pcr template diluted past a certain threshold copy number will experience large variations in amplification. the absence of amplification at very low levels of parasitaemia was not related to the dna extraction protocol because, as an internal control, a sequence of the abo human genome was amplified in all of the tested samples. although relevant, this internal control did not exhibit the specific amplification difficulties derived from field samples with low amounts of parasite dna. this inherent limitation of pcr amplification, previously described as the monte carlo effect (karrer. 1995), has been widely underestimated (stenman & orpana 2001, soong & ladnyi 2003). in fact, specific parasite pcr amplification at very low parasite densities may be hindered by several distinct factors, including the biological sample itself (guescini. 2007) and the pcr reagents, even when using premade master mixes from the same manufacturer (bustin 2002). regarding the scarcity of the template, it is clear that the likelihood of detecting parasites present at very low levels decreases as the volume of blood analysed decreases. thus, for the detection of submicroscopic infections, it has been proposed that the dna templates to be analysed by pcr should correspond to at least 5 l of the whole blood (proux. 2011). in the current paper, to avoid this potential limitation, both pcr protocols were performed with 2 l of template, which corresponded to approximately 6 l of the whole blood collected from the patient. because the use of templates isolated from substantially higher volumes of blood might encounter difficulties due to the high quantities of human dna, blood filtration methods for the removal of leukocytes have been proposed to increase the pcr sensitivity during malaria vaccine clinical trials (andrews. 2005, bejon. 2006). after performing a multistep protocol, during which 5 ml of blood was filtered to (2005) established a pcr cut - off point of 20 parasites / ml to follow the vaccinated volunteers in the phase ii trials. taken together, these results mean that the most commonly used pcr methods might not accurately detect subclinical malaria infections. these findings could be particularly relevant when studying malaria in low transmission settings, where a negative pcr result may indicate that the individual is truly negative or may be a consequence of insufficient sensitivity of the pcr tests. at this time, it is not possible to differentiate between these two possible outcomes as the validity of pcr has not been adequately assessed for asymptomatic or microparasitaemic individuals (stresman. although the results described here show a clear inconsistency of the pcr results in sub - patent malaria infections, the current results have limitations. the absence of similar studies performed with field samples makes it hard to compare our results with other researchers ; in fact, the consistency of the pcr results in the submicroscopic carriers has never been properly assessed, especially in field settings where sample collection and storage may not be optimal (stresman. 2012). additionally, the amplification of scarce dna templates by any pcr - based protocol requires a very high standard of laboratory practice. because we have well - trained and qualified personnel and we followed the requirements of the international organization for standardization/ international electrotechnical commission 17025, it was possible to minimise technical problems, such as those related to the adequate manipulation of the devices used in the pcr assays. consequently, at present, the application of pcr - based methods is restricted to well - equipped laboratories with specially trained technicians. to develop new strategies to manage the parasite - negative individuals, pcr capacity building programs are underway in several african countries with the help of the malaria clinical trials alliance (malera 2011). unfortunately, an initiative of this magnitude has not yet been initiated in latin america, where p. vivax is the predominant species. it is critical to achieve a sufficient sample size when studying areas with sub - patent malaria infections in order to have an adequately powered study. in this context, the size of our sample set could not be increased in the colniza area ; the geographical access and political conflicts, which often affect the gold - mining areas of the brazilian amazon, hampered the continuation of our study there. accordingly, the malera initiative stated that sufficiently powered studies are difficult to implement in settings with low malaria prevalence and this challenge could adversely impact malaria control (malera 2011). our data show that conventional pcr protocols based on the 18ssu rrna plasmodial gene do not allow for the accurate detection of submicroscopic malaria infections. consequently, pcr results require careful interpretation when the population of interest includes microparasitaemic individuals. currently, no pcr protocol is able to bypass the lack of pcr reproducibility at low levels of parasitaemia. although some new protocols have promise, such as loop - attenuated isothermal amplification, these protocols have not yet been adequately tested in community - based studies or in the detection of low - density parasitaemia (han 2013). thus, studies are required to decrease the current limit of detection in the pcr assays in low - transmission settings. furthermore, we agree with researchers that these protocols should be validated as a useful tool for the accurate detection of submicroscopic malaria infection, through comparative multicentre studies and this step is essential before these protocols are put into practice (proux | the polymerase chain reaction (pcr)-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. although a significant number of pcr protocols have been described, few studies have addressed the performance of pcr amplification in cases of field samples with submicroscopic malaria infection. here, the reproducibility of two well - established pcr protocols (nested - pcr and real - time pcr for the plasmodium 18 small subunit rrna gene) were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. regardless of the pcr protocol, a large variation between the pcr replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34) of the samples. these findings were quite different from those obtained from the microscopy - positive patients or the unexposed individuals ; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the pcr - based protocols. the limitation of pcr amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the dna templates were able to detect < 3 parasites/l in the blood. in conclusion, conventional pcr protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false - negative results can occur. |
tgf- is a multi - functional cytokine and its signaling pathway contributes to a wide range of immunological and biological effects on various cell types and several diseases. tgf- has regulatory functions in cell proliferation, differentiation, migration, and survival that affect multiple biological processes such as cell development, carcinogenesis, fibrosis, and wound healing, as well as immune responses (1). there is some controversy in the literature as to the precise functions of tgf- ; for example, in atherosclerosis, it is not clear whether tgf- is pro - atherogenic or anti - atherogenic. the inhibition of tgf-1 activity induces pro - atherogenic changes in the vessel wall of atherosclerotic animal models (2). furthermore, the neutralization of tgf-1 leads to an inflammatory response of the vessel wall and provokes plaque instability (3). after the engagement of tgf- type i & ii receptors, the smad - dependent pathways are activated. the biological effects that result depend on the types of smad complex involved in this signaling response (4). this process is modulated by other accessory receptors such as tgf- type iii receptor (5). although the expression of endoglin is increased in atherosclerotic lesions, the functional roles of endoglin in atherosclerosis have not been fully clarified. this review aims to suggest a hypothetical role for endoglin in atherosclerosis on the basis of previous reports. endoglin (cd105) is a homodimer composed of two identical 95 kda disulfide - linked subunits, and it is known as a hypoxia - inducible transmembrane glycoprotein (6). it consists of three domains : a large extracellular domain, a transmembrane domain, and a short intracellular domain. the extracellular domain contains an arg - gly - asp (rgd) tri - peptide, four n - linked glycosylation sites, and one o - linked glycosylation site (7). the intracellular domain includes several serine and threonine residues, some of which are phosphorylation sites (8). the human endoglin gene, which is located on chromosome 9, is composed of 15 exons. endoglin homologues have been identified in mice and pigs ; the amino acid sequences of these homologues each have more than 70% identity with human endoglin and more than 69% homology with -glycan, another type iii tgf- receptor (tgf-r) (10). two isoforms of endoglin were reported, long - form endoglin and short - form endoglin, which differ in the length of their intracellular domains and the degree of phosphorylation. long - form endoglin has 47 amino acids in its cytoplasmic tail, has a high degree of phosphorylation and is expressed predominantly in endothelial cells, whereas short - form endoglin has only 14 amino acids in its intracellular domain and has a low level of phosphorylation (6,11). a soluble form of endoglin has also been identified in the sera of both cancer patients and healthy persons. soluble forms are generated by the cleavage of the extracellular domain of endoglin by membrane - type metalloprotease-14 (mmp-14), which may serve as a naturally occurring antagonist for tgf- signaling (12). mmp-14 cleaves endoglin at position 586 to release a soluble fragment representing almost the entire endoglin extracellular domain (13). endoglin is expressed by various cells found in the blood vessel wall, including endothelial cells, monocytes / macrophages, fibroblasts and vascular smooth muscle cells (14). endoglin is upregulated during wound healing and tumor vascularization and in inflammatory tissues and developing embryos. endoglin expression in blood vessels is increased during hypoxia or following vascular injury. in hypoxic conditions, endoglin transcription is induced by the formation of a multiprotein complex with smad3/smad4, stimulating protein 1 (sp1), and hypoxia - inducible factor-1 (hif-1) (15). smad - dependent tgf- signaling also enhances endoglin expression whereas tnf- was reported to inhibit the expression of endoglin by endothelial cells (16,17). in contrast to these results, expression of the soluble form of endoglin was increased following treatment with tnf- and hydrogen peroxide, which are known as pro - atherogenic mediators (18). endoglin was originally identified as a non - signaling co - receptor for tgf- since it does not contain intrinsic kinase activity. the main function of endoglin is thought to be the regulation of tgf- signaling via interactions with several proteins within the tgf- signaling pathway. endoglin binds to both of the tgf-1 and tgf-3 isoforms, following which the cytosolic domain of endoglin can be targeted by serine and threonine kinases, leading to the formation of a functional receptor complex (19). indeed, endoglin is not a true receptor for tgf-, but it strongly modulates the phosphorylation levels of tgf-rii, activin receptor - like kinase (alk)-1, and alk-5 (20). the presence of endoglin can also modulate the downstream signaling by tgf-ri / tgf-rii complexes. recent studies have demonstrated that endoglin functions in an interplay between two signaling pathways involving alk-1 and alk-5, respectively, that have differential effects on target cells. endoglin / alk-1/smad1/5 signaling stimulates the migration, proliferation, and tube formation of endothelial cells, resulting in angiogenesis (21). in contrast, the endoglin / alk-5/smad2 pathway inhibits the activity of endothelial cells and angiogenesis by inhibiting the proliferation, tube formation, and migration of endothelial cells (22). in addition, endoglin has inhibitory effects on smad3-dependent tgf- signaling, resulting in effects on endothelial cells opposite to those that result from smad2-dependent signaling (23). mutations in endoglin have been reported in hereditary hemorrhagic telangiectasia, a disease characterized by malformations of vascular structure (24). the long - form and short - form endoglin isoforms are both able to bind to their ligands and interact with alk-1 and alk-5 ; however, the two membrane - bound endoglin isoforms differ in their affinity for each receptor, level of phosphorylation, and capacity to regulate tgf--dependent responses (25). long - form endoglin has pro - angiogenic effects through induction of endogenous nitric oxide synthase (enos) expression, whereas short - form endoglin has anti - angiogenic effects. signaling, is thought to be cleaved from the cell membrane and enter the systemic circulation, and may represent a useful candidate marker of endothelial injury, activation, inflammation, and senescence (12). endothelial dysfunction plays an important role in the development of atherosclerosis by inducing infiltration of inflammatory cells and a prothrombogenic state. in addition, the migration and proliferation of smooth muscle cells, which are processes that affect the plaque stability, are crucial in the progression of advanced atherosclerotic lesions. tgf- signaling results in inhibition of the proliferation and migration of smooth muscle cells, as well as endothelial cell regeneration (26). it was also reported that inhibition of tgf- signaling reduced collagen content and plaque stability in a mouse model of atherosclerosis (3). in this model, therefore, as an accessory receptor for tgf-, endoglin expressed by endothelial cells and smooth muscle cells may play an important role in modifying the development of atherosclerosis via the regulation of tgf--induced atheroprotective effects. although the expression of endoglin was very low in nonatherosclerotic aortas, the expression of endoglin by macrophages, smooth muscle cells and endothelial cells was increased in early atherosclerotic lesions (14). in advanced atherosclerotic plaques, smooth muscle cells expressed high levels of endoglin, a parameter that was independent of smooth muscle cell morphology and leukocyte infiltration. moreover, endoglin modulates the expression of genes that are known to be related to pro - angiogenic effects (vegf, angiopoietin-1, and angiopoeitin-2) or anti - angiogenic effects (notch signaling, notch-3, and dll4), respectively (27,28). several studies have also reported that the concentration of soluble endoglin increased in the blood of patients with hypercholesterolemia and atherosclerosis (29). increased soluble endoglin levels could be related to endothelial damage or dysfunction ; furthermore, soluble endoglin is an indicator of cardiovascular damage in hypertension and diabetes - associated vascular pathologies (30). the circulating concentration of soluble endoglin was reported to increase at early stages of atherosclerosis due to damage of endothelial cells and then decrease in later stages of atherosclerosis, which suggests a potential role of soluble endoglin in acute heart failure (31). as a decoy receptor the expression levels of endoglin and soluble endoglin were higher in atherogenic lesions than in healthy arteries. two isoforms of endoglin differentially transduce tgf- signaling by activation of different smad components, and thereby modulate the biological effects of tgf- signaling. long - form endoglin shows atheroprotective effect by induction of enos expression, while short - form endoglin and soluble endoglin forms enhance atherogenesis via downregulation of enos expression and inhibition of tgf- signaling. | endoglin (also known as cd105 or tgf- type iii receptor) is a co - receptor involved in tgf- signaling. in atherosclerosis, tgf- signaling is crucial in regulating disease progression owing to its anti - inflammatory effects as well as its inhibitory effects on smooth muscle cell proliferation and migration. endoglin is a regulator of tgf- signaling, but its role in atherosclerosis has yet to be defined. this review focuses on the roles of the various forms of endoglin in atherosclerosis. the expression of the two isoforms of endoglin (long - form and short - form) is increased in atherosclerotic lesions, and the expression of the soluble forms of endoglin is upregulated in sera of patients with hypercholesterolemia and atherosclerosis. interestingly, long - form endoglin shows an atheroprotective effect via the induction of enos expression, while short - form and soluble endoglin enhance atherogenesis by inhibiting enos expression and tgf- signaling. this review summarizes evidence suggesting that the different forms of endoglin have distinct roles in atherosclerosis. |
acute disseminated encephalomyelitis (adem) is an immune - mediated, demyelinating disease of the central nervous system. in 50 to 75% of all cases, the clinical onset of disease is preceded by viral or bacterial infections, mostly nonspecific upper respiratory tract infections. in children who are diagnosed with adem, a history of febrile event can be established in 50 to 75% of all cases1,2). vaccine - associated adem is frequently observed after measles, mumps or rubella vaccination1). to date, there are no reported large population studies or estimated incidence rates reporting an association between influenza vaccination and adem3). we report an uncommon case involving a previously healthy 34-month - old boy in whom adem developed following vaccination against novel influenza a (h1n1). a previously healthy 34-month - old boy visited emergency room on december 2009 with a clonic seizure affecting his left hand. he was administered a vaccination against novel influenza a (h1n1) five days ago and had no history of fever following this. he had received prior vaccination against 2008 influenza, japanese b encephalitis, diphtheria - pertussis - tetanus (dpt), poliomyelitis, measles and hepatitis b, without complications. on assessment, cranial nerve and sensory examination, deep tendon reflex and pathologic reflex did not show any abnormalities or pathologic findings. real - time reverse transcription - polymerase chain reaction (rt - pcr) for h1n1 influenza was negative. spinal tap revealed clear and colorless cerebrospinal fluid (csf) containing 58 white cells/l (100% lymphocytes). csf protein level was 32.1 mg / dl and glucose level was 57 mg / dl (serum glucose concentration 93 mg / dl). complete blood count, erythrocyte sedimentation rate, c - reactive protein, blood culture, liver and renal function test and sleep electroencephalogram were normal. magnetic resonance imaging (mri) revealed multiple patchy hyperintense lesions in the frontal and parietal subcortical white matter (fig., 1 mg / kg of dexamethasone was administered to the patient intravenously for five consecutive days. on the third day of treatment on the sixth day, he was able to walk normally without weakness on the left side and was discharged. one month later, follow - up mri showed resolution of the previous lesions (fig. adem is thought to be a neurologic complication following infection or vaccination, caused mainly by a t cell - mediated immune reaction to myelin components or oligodendrocytes4). adem may occur as a complication of vaccinations including japanese b encephalitis vaccine, live rubella vaccine, hepatitis b vaccine, diphtheria - tetanus - pertussis and influenza vaccine. for most vaccines, the association between the influenza vaccination and adem has only come to light in recent years, and hence there have been no large population studies or estimated incidence rates3). of the total 460 adverse events associated with intranasal influenza vaccine between 2003 and 2005 in the usa, 10 neurological events were reported that included two people with guillain - barre syndrome (gbs), one adem, and one febrile convulsion. nakayama and onoda found three cases of adem and nine of gbs among those who received 38.02 million doses of influenza vaccine administered between 1994 and 2004 by the kitasato institute, japan3). during the 2001 to 2002 influenza season, 9,842,601 doses of influenza vaccine were distributed to health care providers in canada, although the exact number of doses administered is unknown. health canada received 1,800 reports of people experiencing adverse events following the influenza vaccine, representing a rate of 183 reports per one million doses distributed. of these, the serious adverse events reported were gbs, convulsions, and meningitis and encephalopathy (1 per 3 million doses distributed)5). in the case presented here, there was no evidence of a febrile illness or infection in our patient before or after vaccination against novel influenza a (h1n1), and adem developed five days after vaccination. although it is difficult to establish a causal relationship between adem and vaccination, the close temporal association of the influenza vaccination with the neurologic symptoms further suggests a possible association with the vaccine6,7). the patient was treated with intravenous corticosteroid as first line therapy8), which produced a complete recovery without neurologic sequelae. follow up mri findings showed an improved state and no new lesion. from october 2009 to june 2010, koreans have received 14,762,293 doses of the vaccine against novel influenza a (h1n1) according to vaccine adverse events reporting system (vaers)9). the korea centers for disease control and prevention reported 88 cases of people who were diagnosed with adverse events following this vaccination. of these, the serious adverse events included gbs in ten people (two per three million vaccinated individuals), adem in two (0.4 per three million vaccinated individuals) and miller fisher syndrome, convulsion, cerebellitis and meningitis each in one case (adverse events of novel influenza a [h1n1 ] 2009 vaccination in south korea : vaers, unpublished data). in summary, post - vaccination adem has been already reported associated with several vaccines. however, there has been no previous report of adem associated with mass vaccination against novel influenza a (h1n1). although causal relationship can not be established, we report here a rare adverse event, a case of adem following vaccination against novel influenza a (h1n1). | acute disseminated encephalomyelitis (adem) is an inflammatory demyelinating disease of the central nervous system that typically follows an infection or vaccination and has a favorable long - term prognosis. we describe the first reported case of adem after vaccination against novel influenza a (h1n1). a previously healthy 34-month - old boy who developed adem presented with a seizure and left - sided weakness 5 days after vaccination against novel influenza a (h1n1). cerebrospinal fluid examination revealed elevated cell counts. t2-weighted images and fluid - attenuated inversion recovery images revealed multiple patchy hyperintense lesions in the frontal and parietal subcortical white matter and the left thalamus. after the administration of intravenous corticosteroid, the patient 's clinical symptoms improved and he recovered completely without neurologic sequelae. |
a 56-year - old caucasian male with polycythemia vera controlled with interferon alpha treatment for 2 years presented to our institution with decreased vision, greater on the right than left, scintillating scotomata, and floaters. intraocular pressures were 14 mmhg in the right eye (od) and 12 mmhg in the left eye (os). fundus examination on the right showed nerve fiber layer swelling at 12 and 6 oclock, a very distended and tortuous superior branch retinal vein, one flame - shaped peripapillary hemorrhage, and one preretinal hemorrhage alongside areas of ischemia at the inferior pole (figure 1). the left eye showed one peripapillary hemorrhage with a white center (roth spot) with slight retinal nerve fiber layer swelling at the optic disc margin superiorly and inferiorly, but much less venous distention (figure 2). fluorescein angiography confirmed impending retinal vein occlusion with delayed transit time (20 seconds for the right superior hemi vein), more in od than os, but no choroidal infarction. interferon was stopped immediately, and the patient started pentoxifylline 400 mg every day to treat polycythemia vera, and prednisone 40 mg every day to counter any interferon - induced inflammation. within 3 weeks, his vision became clear, the afferent papillary defect resolved, and fundus examination revealed complete resolution of the aforementioned vascular abnormalities. he was slowly tapered down to prednisone 7.5 mg every other day and maintained on pentoxifylline 400 mg three times a day. here we describe the course and likely pathophysiology of interferon alpha and polycythemia vera - associated impending aion, retinal vessel ischemia, and hemorrhage. our patient s bilateral optic disc edema did not have the supporting signs or symptoms of elevated intracranial pressure or malignant hypertension. in fact, our patient s optic disc edema was concentrated at the superior and inferior poles, corresponding to the locations of venous compromise. thus, considering the associated retinal venous distention and hemorrhage, we attributed the patient s optic disc edema to impending aion and his delayed filling on fluorescein angiogram to retinal vein occlusion. we attribute these fundus examination findings to axoplasmic stasis and retinal hemorrhage resulting from optic and retinal vascular occlusion and venous backflow,1 all likely secondary to complications of interferon and polycythemia vera. interferon has been documented to cause occlusion directly, possibly from inflammation.2 interferon may produce autoantibodies and incite inflammation in the vessels of the optic disc,2 contributing to an impending aion. this can cause optic nerve ischemia and fiber swelling,1 which can progress further to retinal vein occlusion and hemorrhage, as well as to aion with permanent losses of visual field and visual acuity.3 the preretinal hemorrhages and roth spots seen in our patient have been documented as complications with both interferon4 as well as myeloproliferative disorders.5 polycythemia vera poses additional risk factors for retinal vein occlusion, including higher whole blood viscosity, reduced red cell deformability,6 and abnormal red cell adhesion. diminished membrane fluidity of red blood cells plays a role in microvascular occlusion in patients with polycythemia vera.7 in addition, jak2 kinase mutation in patients with polycythemia vera causes abnormal phosphorylation of cd 239 on red blood cells, which allows its ligation with the laminin alpha5 chain on the apical surface of endothelial cells.8 this adhesion has been demonstrated to be strong enough to withstand sheer stresses of postcapillary venules.8 thus, polycythemia vera - associated red blood cell adhesion may be another strong factor in the pathophysiology of venous occlusion.6 considering that both polycythemia vera and interferon are possible influences on vascular occlusion and optic disc edema and the pathophysiology described, we immediately attempted to treat the polycythemia vera empirically with pentoxifylline to increase red blood cell fluidity and the interferon - associated inflammation with prednisone. our patient also had a history of hypotension to 95/65 mmhg, which was monitored, given that hypotension is a risk factor for aion.9 our patient experienced complete resolution of fundus abnormalities and return of normal vision, which may be attributed to successful treatment of both etiologies, though there remains the possibility of spontaneous resolution. thus, further study is warranted to elucidate the treatment of both polycythemia vera and interferon - induced impending aion. | we describe the course and likely pathophysiology of impending anterior ischemic optic neuropathy (aion) and retinal vein occlusion in a 56-year - old man with polycythemia vera managed with interferon alpha for 2 years. our patient presented with decreased vision, scintillating scotomata, and floaters. fundus examination findings and results of a fluorescein angiogram led to the diagnosis of impending aion and retinal vein occlusion. considering that both polycythemia vera and interferon have possible influences on vascular occlusion and optic disc edema, we stopped interferon treatment and immediately attempted to treat the polycythemia vera empirically with pentoxifylline and any interferon - associated inflammation with prednisone. our patient experienced complete resolution of fundus abnormalities and return of normal vision within 3 weeks, which may be attributed to our successful treatment of both etiologies. thus, further study is warranted to elucidate the treatment of both polycythemia vera and interferon - induced impending aion. |
acute bacterial meningitis (abm) is an important cause of childhood mortality and those who survive are at a higher risk of developing permanent neurological disability. worldwide meningitis was estimated to cause 1, 73, 000 deaths in 2002, most of them were children from the developing world (1). in the high - mortality countries of the eastern mediterranean region bacterial meningitis accounted for 23,000 (2.5%) of the 0.96 million deaths caused by infectious diseases in the region and contributed 13.3% of death due to meningitis worldwide (1). the annual incidence of bacterial meningitis in usa before the introduction of hib conjugate vaccines was between 30 - 70/100 000 (2). bacterial meningitis affects 35.000 europeans each year and has a mortality rate of about 20% (3). in 2011 in poland, it was recorded 2915 cases of meningitis and/or encephalitis. this included 1438 cases of viral etiology, 888 of bacterial etiology (4). a study conducted in europe and mediterranean region during 2007 found that neisseria meningitidis, streptococcus pneumoniae and haemophilus influenzae type b were most commonly associated with bacterial meningitis accounting for almost 90% of reported cases of acute bacterial meningitis in infants over 60 days of age and young children(5). in contrast, another study was carried out in eastern of mediterranean region during 2005 - 2010 found that the most commonly isolated pathogens were s. pneumoniae (27% of confirmed cases), n. meningitidis (22%), and h. influenzae (10%) (6). in the middle east region different studies have been carried out in order to estimate the rate of infection and to find out the etiological agents. accordingly n. meningitides, h. influenzae and s. pneumoniae were the predominant pathogens with different proportions (710). during the last two decades witnessed major advances in the understanding of the etiology and pathophysiology of bacterial meningitis ; however, the major breakthrough was in the prevention of meningitis with the introduction of the hib conjugate vaccine in the early 1980s. this resulted in a significant decrease in the incidence of bacterial meningitis in areas where routine vaccination of infants was instituted (1112). although diagnostic performance has recently improved by using new diagnostic methodologies (13, 14), the immediate management is usually decided upon treatment before a certain diagnosis is known and started considering only simple findings of cerebrospinal fluid (csf) examination. at this time, the emphasis is to firstly not miss a bacterial with antibiotics or inappropriately prescribe corticosteroids for an uncontrolled viral infection. this decision can be difficult to make since csf results often overlap between the two categories (15, 16). in order to help to distinguish bacterial and viral meningitis, academic algorithms (17, 18) and, few studies conducted to emphasis the etiologic agents of bacterial meningitis with the risk factors, therefore this study aimed to find out the different bacterial agents and the risk factors might be contributed in the development of such infection. from january to december 2009, active surveillance of acute bacterial meningitis among children admitted to gaza strip pediatrics hospitals was undertaken. north and middle geographic regions were selected to represent the population characteristics of the country. two hospitals, al nasser and al dora hospitals were selected to participate in the survey. approval was obtained from the ethical committees of the participating centers and ministry of health. in each hospital, suspected cases of acute bacterial meningitis were identified by using inclusion criteria used for of identification of bacterial meningitis cases, the presence of a clinical picture compatible with bacterial meningitis and cerebrospinal fluid (csf) neutrophilic pleocytosis of at least 100 neutrophil per cubic mm (presumptive) and then confirmed positive csf culture for bacterial agents (20). the clinical symptoms were diagnosed by a pediatrician based on the following criteria : any sign of meningitis : fever [axillaries measurement > 38c ], vomiting [> 3 episodes in 24 h ], headache, meningeal irritation signs [bulging fontanel, kernig or brudzinski signs, or neck stiffness ]) in children > 1 year of age fever without any documented source ; impaired consciousness (blantyre coma scale 9 months of age). for each suspected case, demographic data were recorded by using a standardized questionnaire approved by experts in pediatrics. demographic data collected included age and sex, house crowdness the residents in a house rooms with two categories a-3individual per room, mother education (elementary, secondary schools and university), malnutrition (anemia), family income (low, moderate and high according to local master of living). in the hospitals, sterile csf was placed in suitable transport or holding media (usually trypticase soy broth or thioglycollate broth), and rushed to the hospital laboratory that works 24 hr a day. a total count of csf cells and differential count were done using a haemocytometer and standard methods. the csf samples were subjected to centrifugation, the resultant smear was gram stained and examined microscopically. the procedure used for microbiological analysis was sediment from a centrifuged csf specimen cultured on specific culture media, the isolated pathogens were identified by specific biochemical tests, api system and specific antisera. the biochemical tests used for detection of bacterial meningitis in csf were glucose level and protein level.. the csf - total - blood glucose and protein were computed. the chi square and odds ratio tests were applied to examine any significant association that may exists between each of the demographical, clinical development of bacterial infection. also anova test was used to find out the impact of the three main pathogens on development of anemia and leukocytosis. demographic data collected included age and sex, house crowdness the residents in a house rooms with two categories a-3individual per room, mother education (elementary, secondary schools and university), malnutrition (anemia), family income (low, moderate and high according to local master of living). in the hospitals, sterile csf was placed in suitable transport or holding media (usually trypticase soy broth or thioglycollate broth), and rushed to the hospital laboratory that works 24 hr a day. a total count of csf cells and differential count were done using a haemocytometer and standard methods. the csf samples were subjected to centrifugation, the resultant smear was gram stained and examined microscopically. the procedure used for microbiological analysis was sediment from a centrifuged csf specimen cultured on specific culture media, the isolated pathogens were identified by specific biochemical tests, api system and specific antisera. the biochemical tests used for detection of bacterial meningitis in csf were glucose level and protein level.. the csf - total - blood glucose and protein were computed. the chi square and odds ratio tests were applied to examine any significant association that may exists between each of the demographical, clinical development of bacterial infection. also anova test was used to find out the impact of the three main pathogens on development of anemia and leukocytosis. out of the 1853 suspected cases bacterial meningitis based on inclusion criteria with presence of cells > 100 in csf and were confirmed by culture in 73(3.9%) patients. male to female ratio was 1.6:1.0, 42% of the cases were male less than 2 years while 80% of the cases were male less than 4 years. at the same time, 46% of the cases were female less than 2 years while 82% were female less than 4 years of age. distribution of bacterial meningitis cases by age group and gender table 2 illustrates the causative organisms n. meningitides (47.9%), s. pneumoniae (15.1%), h. influenzae (13.7%), e. coli (11.0%), enterobacter sp. the isolated species from the clinical samples table 3 illustrates the socio - demographic factors that might be contributed in developing of bacterial meningitis. the statically significance associated with developing of infection was obtained with malnutrition (low hemoglobin level) p - value 1.0), malnutrition showed a risk factor for developing of bacterial meningitis odds ratio 2.7 followed by house crowdness odds ratio 1.7 and low family income odds ratio 1.6 (table 3). the demographic characteristics and the risk factors associated with developing of bacterial meningitis table 4 illustrates the direct effect of the isolated pathogens on the development of anemia while table 5 shows the effect of the same pathogens on development of leucocytosis in infected patients ; both analyses demonstrated clearly that s. pneumonia was the significant factor in development of these pathological effects. pairwise comparison among differences of three pathogens in anemic patients pairwise comparison among differences of three pathogens in relation to leukocytosis in csf table 6 illustrates the symptoms accompanied the meningitis cases, the fever was the most frequent symptom followed by neck stiffness and vomiting, other minor symptoms were poor feeding and irritability. an accurate laboratory confirmation of the etiology in acute bacterial meningitis (abm) is essential to provide optimal patient therapy, appropriate case contact management, and reasoned public health actions, it also provides information upon which to base decisions regarding immunization programs, especially for countries without routine vaccination against the main acute bacterial meningitis pathogens (21, 22). the present cross sectional study showed the pattern of bacterial meningitis in children younger than twelve years of age and reported the pattern of the disease in district hospitals which may reflects the pattern of the disease in the central and north catchment areas of gaza strip. in our study, only 73 (4%) cases proved to contain viable bacterial pathogens out of 1853 confirmed cases by cells in according of inclusion criteria of probable abm cases. the infection rate recorded is low in comparison to big number of suspected specimens by cells. reasons as reviewed in other studies for low csf culture yield are low bacterial load, use of antimicrobial agents prior to csf collection, poor culture media (23), poor culture facility such as non - availability of special media, stored in unsatisfactory conditions, samples refrigerated before plating, delayed and faulty inoculation, lack of transport media and inadequacy in processing of csf specimens (24), lack of 24 hours facility for processing csf samples (25). in our study, the probable cause was the use of antibiotics prior hospitalization. it is well known that meningitis developed as a complication for initial infection like pneumonia, sepsis, and otitis. more infection was in the age group of 1-month - two years with frequency (44%), and 81% of confirmed bacterial meningitis belonged to age group 1-month-4 years, these age groups for the children have considered as development age and they are more susceptible to infection than elder one (28). in diagnosis of acute bacterial meningitis, usually blood culture was carried out in parallel with csf analysis which can be used as tool of diagnosis the bacteria has three steps to reach to the meninges, the second step is the invasion of the blood. fifty seven percent of meningitis cases showed blood positive in our trial, also gram stain was carried out in parallel of cells excluding 12 cases which were positive only on gram - stain and not by culture. similar results were obtained when a comparison was carried out between pcr, gram and culture in which gram and pcr are not affected by antibiotics (29). the main symptoms accompanied the meningitis cases were the fever followed by neck stiffness and vomiting. it was noted that some cases have no fever which reflects the asymptomatic cases and this was recorded in some reports (3335). the latex agglutination test (lat) was used in comparison with culture and with some csf negative culture which contain cells > 100 cells. the results showed that out of 120 cases with negative csf culture examined 18% were positive by lat. some studies demonstrated that lat was more sensitive compared to conventional gram stain and culture technique in identifying the fastidious organisms like h. influenzae, s. pneumoniae and group b streptococcus (36). tzanakaki &, mastrantonio (2007) reported that the etiology of bacterial meningitis in europe and in the mediterranean region n. meningitidis, s. pneumoniae and h. influenzae type b were most commonly associated with bacterial meningitis accounting for almost 90% of reported cases of acute bacterial meningitis in infants and young children (5). mani. reported that s. pneumoniae was the predominant pathogen accounting for 238 (61.8%) cases. haemophilus influenzae and n. meningitidis accounted for 7 (1.8%) and 4 (1%) cases respectively in india (24). this difference in the frequencies of the causative agents may be attributed to the applying of vaccination regimen and other socioeconomically factors associated with target group of the study area. the introduction of vaccination regimen of h. influenzae and s. pneumonia and n. meningitidis in different countries induced great reduction of these pathogens from the community (37). the risk factors associated with developing such an infection using chi square test with p - value of 1.0 showed that there was statically significant association with the malnutrition (low hemoglobin level). these factors showed clearly that the anemic patients were highly susceptible to serious infection, and it is well known that the developing countries and gaza strip are highly endemic with anemia with different causative agents (38, 39). simultaneously, house crowdness encouraged the development of meningitis due to most of the detected pathogens are air transmission and the smoking in these houses played an important role in diminishing the capacity of epithelial cells covering the respiratory tract for prevention of acquiring infection in addition to the prevalence of healthy carriers of pathogens (40, 41). the anova test demonstrated that the impact effect of the presence of the three main pathogens in the blood and csf of the children, the test proved clearly that the presence of s. pneumonia caused hemolysis of the blood causing anemia and induced the development of leukocytosis in the blood of patients. first, this is a cross sectional study analyzing only notified cases of meningitis ; thus the true incidence of disease in the community may have been under - reported. second, detailed information before presentation of meningitis was missing, and cases of presumed viral meningitis could have represented cases of partially treated bacterial meningitis, thus affecting the results. a final limitation of our study is our inability to follow up and record the complications including the neurological ones in the survivor of acute bacterial meningitis. the bacterial meningitis is still predominant among the children and n. meningitides is the dominant causative agent and needs vaccination. ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors. | abstractbackgroundbacterial meningitis is still the leading cause of high morbidity and mortality among the children. the present study was conducted to determine the epidemiology, clinical characteristics of bacterial meningitis and to evaluate the risk factors associated with developing the infection.methodsthis cross sectional study was conducted in three hospitals of gaza strip -palestine during the period 2009. all the children with clinical diagnosis of meningitis /meningoencephalitis admitted to these hospitals were included in the study. they were subjected to clinical examination as well as csf bacteriological and serological investigations.resultsduring the period (2009), 1853 patients were admitted to the hospitals with suspect of meningitis by pediatricians, 73 (3.9%) proved by culture to be acute bacterial meningitis, of these patients 62% were males and 38% were females. the common isolated pathogens were neisseria meningitides (47.9%), streptococcus pneumonia (15.1%), haemophilus influenza (13.7%), e. coli (11.0%), enterobacter spp. (6.8%), citrobacter spp. (2.7%), providencia spp. (1.4%), and pseudomonas aeruginosa (1.4%). the common recorded symptoms were fever (78%), neck stiffness (47%), vomiting (37%), poor feeding (19%), and irritability (16%). statistical analysis showed that there was statistical significance associated developing of infection with malnutrition (low hemoglobin level), high house crowdness and irritability (p - value < 0.05). the anova statistical analysis showed that s. pneumonia has an impact on developing low hemoglobin level and leukocytosis.conclusionn. meningitides is still dominant and needs vaccination. the risk factors should be taken into consideration in any future plan. |
crohn 's disease (cd) and ulcerative colitis (uc) are two types of inflammatory bowel disease (ibd) of unknown aetiology that result in significant morbidity and health expenditure. recent data suggests that the prevalence of ibd in general practice in the uk has exponentially increased to around 400 per 100,000. the incidence rate of juvenile onset ibd has risen by nearly 30% in scotland over the last twenty years with a concerning decline in age at presentation. purest form of disease without many extraneous influences of adult behaviour e.g. smoking or disease comorbidity. studying the aetiological factors of this form of the disease is perhaps more likely to further our understanding of the initiating events of these debilitating conditions. the current paradigm of ibd pathogenesis suggests an exaggerated immune response against the luminal microbiota in genetically susceptible individuals. the risk - associated genes are critical in the innate immune system that recognises and distinguishes pathogens from commensal microorganisms, are involved in the clearance of pathogens or pertain to the regulation of adaptive immunity. crucially, a significant proportion of individuals with ibd do not have any evidence of heritable genetic susceptibility indicating that environmental triggers play an important role in the pathogenesis of ibd. the gastrointestinal microbiota has come to the fore in efforts to explain this pathogenesis gap. the normal gastrointestinal tract harbours a complex community of commensal microbes that are critical to normal physiological functioning. in fact, the microbial gene set within the gut lumen is 150 times larger than the entire human gene complement. traditional culture methods have been unsuccessful in characterising the entire microbiota with many microbes going undetected. newer molecular methods and next generation sequence analysis in particular have vastly enhanced the yield of bacteria and fungi that can be identified within the gut [810 ]. in contrast to luminal bacteria, the exact role of colonising fungi and their pathogenic potential has not been fully explored. from metagenomic studies it has been established that 99.1% of the genetic catalogues from the lumen are of bacterial origin whereas fungal dna accounts for around 0.02% of the entire mucosa - associated microbiota. it is difficult to ascertain if changes to this component have an impact on the final genesis of inflammation. however, other aspects of the immune response may also explain changes that occur in the fungal microbiome. anti - saccharomyces cerevisiae antibodies (asca) have been found to have a role in diagnosis, disease phenotype and prognosis, more commonly found in cd patients compared to uc patients and healthy controls. it has now been shown that cd patients with pattern recognition receptor and autophagy gene variants, but not those with genetic variants of il-23 signalling, were more likely to develop asca antibodies. several questions still remain unanswered in the aetiopathogenesis of ibd, especially the role of intestinal fungi in initiating / driving the abnormal inflammation that is characteristic of ibd. fungi have received scant attention in the literature of ibd microbiology to date and warrant specific and targeted consideration. the 25 children with ibd selected for this study were part of a cohort of children who had been recruited to the bacteria in scottish children undergoing investigation before treatment (biscuit) study. the inclusion and exclusion criteria and the modality of assessment of these patients have been reported previously. in short, these children were stringently evaluated, and only those with documented new onset ibd who had not received and ibd treatment at any time or systemic antibiotics in the 3 months prior to their colonoscopy. the comparator groups comprised of 12 control paediatric subjects from the same study, two adult patients with a normal colonoscopy and two adult patients with ulcerative colitis (uc), who were also part of a previously reported study. biopsies were taken from a single site, from the distal colon (rectum / sigmoid), and in the case of ibd subjects macroscopic inflammation had to be present at the site. 2 - 3 biopsies were collected using standard endoscopic forceps into a sterile 1.5 ml eppendorf container and placed immediately onto ice before transfer to 80 c storage. dna extraction of mucosal biopsies was performed using the commercially available qiagen qiaamp mini kit (qiagen, crawley, uk) with minor modifications. ethical approval was granted by north of scotland research ethics service on behalf of all participating centres and written informed consent was obtained from the adult subjects and from the parents of the paediatric patients. informed assent was also obtained from older children who were deemed capable of understanding the nature of the study. the biscuit study is publically registered on the united kingdom clinical research network portfolio (9633). initial pcr amplification was undertaken with faststart high fidelity pcr reagents (roche, penzberg, germany) utilising a per - reaction mix containing 50 ng dna template. hence the 540 bp pcr product was flanked by a 40 bp fusion primer / multiplex identifier sequence at the forward end and a 30 bp fusion primer at the reverse end (table 1). after confirmation of successful pcr amplification, products were purified as per the recommended agencourt ampure (beckman coulter, beverly, ma, usa) purification method for 454 sequencing and sequenced on roche 454 titanium (454 life sciences, branford, ct, usa) by newgene (newcastle, uk). data analysis of the 454 sequence data was performed using qiime version 1.3.0 workflow for 18s data using the qiime compatible version of the silva-104 release (downloaded from http://www.arb-silva.de/download/archive/qiime/) for template based alignment and taxonomic assignment : sequences were binned according to sample - specific barcode, denoised (fast denoiser) and clustered with uclust into de - novo operational taxonomic units (otus) at 97% sequence similarity. representative sequences were picked for each otu and aligned with pynast using the silva template alignment core_silva_aligned.fasta and chimera check was performed with chimeraslayer for removal of potential chimeric sequences. taxonomy assignment of each otu was performed by blasting against the taxonomic mapping file silva_taxa_mapping_104set_97_otus.txt followed by construction of otu tables at different taxonomic levels. otu tables were rarefied at 3000 and results were plotted at phylum and genus level. all novel sequence data was deposited at ncbi 's sequence read archive under accession number prjeb7438. quantitative pcr was done to estimate the amount of fungal rdna present in all seven paediatric biopsy samples (6 ibd and 1 control) and three adult biopsy control samples. the 18s region was amplified from 50 ng of sample dna using methods described previously. standard curve was generated from 10-fold serial dilutions of amplified fungal 18s rrna genes from candida albicans strain. fungal dna was amplifiable from 8 patient samples, 6 children with a diagnosis of ibd 4 with crohn 's disease, 2 children with ulcerative colitis and 2 children without ibd. fungal diversity was assessed in all paediatric samples alongside four adult samples to act as a further comparison. the adult samples comprised 2 patients with ulcerative colitis and 2 patients with negative colonoscopy findings. fungal dna could be amplified in one of the adult patients with de - novo uc and both the adult controls. pyrosequencing generated 90,000 individual sequencing reads in total with a mean yield of 5245 reads per sample after bioinformatic processing but before rarefaction. the minimum read score was biscuit 27 with 3385 reads therefore rarefaction analysis was performed at a threshold of 3000 reads to allow subject - to - subject comparison. two patient samples (biscuit 64 and 1uc15) were discarded from further analysis as sequence data was confirmed to be eukaryotic but could not subsequently be matched to fungi. banisveld eukaryote (72%), identified from banisveld water and thought to relate to a distinct phylum. comparisons were made at both phylum and genus levels (figs. 1 and 2). phylum level analysis indicated that fungal sequences almost exclusively belonged to the ascomycota and basidiomycota phyla (fig. 1). the most abundant phylum was basidiomycota which was responsible for 100% of detectable fungal sequences in 5 of the 6 paediatric ibd patient samples (3/4 cd and 2/2 uc). in comparison the phylum data from the three adult samples showed that the two healthy control samples comprised > 80% ascomycota sequences whilst the uc patient contained exclusively basidiomycota sequences. genus level analysis was undertaken to compare the basidiomycota sequences between the paediatric ibd patient samples (biscuit 31, 62, 89, 33, 104 ; fig. 2). the number of genera detected in paediatric samples varied from 3 to 8 genera and showed that both uc patients and one of the cd patient samples were predominated by corticiales sequences (fig. 2). the corticiales are one of the most ecologically diverse groups of basidiomycota containing saprobes, plant and fungal pathogens, and lichens. the other 2 cd patients were predominated by an uncultured basidiomycota sequence (biscuit 31) and an auriculariales sequence (biscuit 62). the remaining two paediatric patient samples (biscuit 1 (cd) and biscuit 27 (control)) were heavily represented by dothideomyceta species, although the cd patient also contained some unclassified ascomycota sequences (24%). when genus level analysis was explored within the adult samples, there was representation from more genera than in the paediatric samples. there was no similarity between individual diversity profiles ; the control patients overlapped in containing dothideomyceta species with adult gh4 also containing unidentified ascomyceta, saccharomycetales, agaricales and oxyporus. patient 2uc21 (adult de - novo uc) contained agaricales, auriculariales, oxyporus, trametes and uncultured environmental basidiomycota species. quantitative pcr to document relative fungal load was performed on all fungal positive biopsy samples and the results are summarised in supplementary table 2. five out of the seven paediatric samples showed much lower fungal load as compared to the adult samples. the two samples which showed comparable results were both from patients with cd (biscuit1 and biscuit89). this study elucidates the fungal microbiome or mycobiome in de - novo paediatric ibd patients. it is quite interesting to note that an amplified fungal pcr product was available for only 8 of the 37 paediatric subjects. this could potentially be due to the dna extraction method, which was optimised for bacterial dna extraction. the extraction protocol did not subject biopsy samples to mechanical disruption, which is recommended for some fungal species. this cohort has been subject to an extensive (and successful) bacterial diversity analysis by next - generation sequencing which has been reported elsewhere, and the relative paucity of fungi in this cohort is indeed a novel finding. it is possible that aspects of fungal diversity have therefore been under - reported within this study due to these limitations, however biopsy samples from both the paediatric and adult cohorts were processed in the same way therefore comparisons made between the various study groups reflects genuine differences. it is also possible that the low fungal diversity reported in this study is a confounder of bowel preparation prior to colonoscopy, which all recruits were subjected to. whilst this may well be the case, it has not impacted to a similar degree on reported bacterial diversity in the same cohort. it would also be difficult to ethically justify accessing the colonic mucosa for research sampling in children without adequate bowel preparation, hence these children were undergoing colonoscopy for diagnostic purposes and bowel preparation was therefore essential. the evolution of the fungal microbiome from childhood to adulthood is not known, but it can be surmised that with increased and varied dietary exposure, adults might have a greater quantity and diversity of fungi in their lumen. this is clearly demonstrated with all adults in this study showing higher fungal loads than the majority of children. the single paediatric cd recruit with an ascomycota predominance was clinically reviewed in relation to the other ibd recruits in this study with respect to any critical differences that might explain this finding. all the cd biopsies amplified in this study were taken from macroscopically and microscopically inflamed sites and from recruits with granulomatous changes somewhere in their gastrointestinal tract, though not necessarily at the same site as sampled. perhaps intriguingly, biscuits 31, 62 and 89 (basidiomycota - predominant) had endoscopic evidence of aphthous ulceration at the site sampled for microbial analysis whereas biscuit 1 had inflamed mucosa with erythema and mucosal breaks but no ulcers, though granulomata and chronic inflammation were evident on histology. bacterial diversity assessment from biscuit 1 was not dissimilar at phylum - level to the other cd recruits. clearly the small number of cases represented in this study, and single incidence of an absence of aphthous ulceration and coincidental ascomycota predominance prevent any firm conclusion being drawn, but the association of microbial / fungal changes with endoscopic / microscopic disease should be a direction for further research. the current paradigm in the pathogenesis of ibd suggests a perturbation in the relationship of the host innate immunity and the resident luminal gut microbiota. this study has shown a distinct dichotomy in the fungal microbiota between control patients and patients with ibd with a predominance of ascomycota sequences (> 80% of sequences in all patients) in the former group whilst a majority of ibd patients (6/7) contained exclusively members from the basidiomycota phylum nevertheless, it is acknowledged that this is a small study and further studies are needed to validate these findings. the biopsy samples from these patients were assiduously collected prior to the institution of immunosuppressive treatment and without the co - administration of antibiotics and probably therefore represents the native condition as accurately as ethically permissible in both cases and controls. this stringency in case selection is critical in the assessment of the fungal microbiome. one of the key members of ascomycetes, candida is a normal commensal in the gut, which has been documented to overgrow in patients treated with antibiotics. therefore this shift from the ascomycota - predominant microbiota in normal subjects to a distinctly different fungal spectrum with predominance of basidomycetes in patients with de - novo ibd without the conflicting influence of immunosuppression or antibiotics might have pathogenic relevance. fungal dna accounts for around 0.02% of the entire mucosa - associated microbiota as assessed from quantitative analyses from mucosal biopsies. the fact that only 8 out of the paediatric cohort of 37 patients that were included in the previously published bacterial diversity study were positive for fungal pcr and could therefore be included in this study, supports the challenge of assessing fungal diversity within mucosal samples. the finding of distinctly lower mucosal fungal load in the paediatric cohort could partly explain this difficulty. a recent fungal mycobiome analysis of healthy subject faecal samples demonstrated positivity in all subject samples tested (around 100 subjects) finding 66 genera, with generally mutually exclusive presence of either the phyla ascomycota or basiodiomycota. the difference in methodology of this study, which targeted the its region and our study and that by ott that utilised amplification of the 18s rrna needs to be acknowledged. despite this, the findings reflects the data from our study in terms of phylum diversity on an individual basis. it also potentially highlights the fact that most fungal species within the gut are not associated with the mucosa, remaining predominantly within the luminal contents and most likely having limited interaction with the host. we maintain that in terms of clinical relevance, assessing diversity within fungal species that are associated with mucosal tissues, especially when assessing diversity in relation to ibd, a mucosal disease, is the most appropriate sample choice. it is difficult to ascertain if changes to the fungal component have an impact on the final genesis of inflammation. other aspects of the immune response may however explain changes that occur in the fungal microbiome. there has been plenty of interest in the role of one of the key members of the phylum ascomycota, namely s. cerevisiae. cerevisiae antibodies (asca) has been found to be an important phenotypic determinant, especially in cd patients. these antibodies may be as a result of loss of tolerance against this fungus or another member of the phylum ascomycota, perhaps c. albicans. if the loss of tolerance hypothesis can be extended to the ascomycota phylum it may explain why there is less representation in ibd patients and a relative shift towards basidomycetes. our study does not have the strength of numbers to definitely prove this hypothesis but it indicates that a radical shift occurs in the fungal microbiota of patients with ibd as opposed to controls, however with the caveat that fungal dna amplification and diversity assessment appears more limited than conventional bacterial approaches. the initiating event in ibd is still a matter of debate and it is tantalising to suggest that this may in some cases be an inappropriate response to a fungus. | inflammatory bowel disease (ibd) is characterised by an inappropriate chronic immune response against resident gut microbes. this may be on account of distinct changes in the gut microbiota termed as dysbiosis. the role of fungi in this altered luminal environment has been scarcely reported. we studied the fungal microbiome in de - novo paediatric ibd patients utilising next generation sequencing and compared with adult disease and normal controls. we report a distinct difference in fungal species with ascomycota predominating in control subjects compared to basidiomycota dominance in children with ibd, which could be as a result of altered tolerance in these patients. |
the piriformis muscle (pm) is located posterior to the hip joint and passes out of the pelvis through the greater sciatic foramen, dividing it into two topographic areas of utmost clinical importance : suprapiriform and infra - piriform foramina. due to the fact that a large number of invasive medical procedures are performed in the gluteal region, knowledge of the typical and variant anatomical relationships between the pm and sciatic nerve (sn) may be crucial to ensure the best outcome. the pm may be also associated with etiopathogenesis of pain syndrome whose symptoms resemble sciatica and which is called piriformis syndrome. the traditional approach describes piriformis syndrome as a neuromuscular disorder classified as compression neuropathy, caused by compression on the sn at the level of the pm [25 ]. however, there are some patients with abdominal pain of uncertain etiology (e.g., some anatomical variants of vasculature of the abdomen) that may lead to unnecessary investigation and intervention. piriformis syndrome poses a considerable diagnostic problem, and data on its etiopathogenesis, especially with regard to its anatomical conditions, are still scarce. upon detailed literature review, the authors of the present work have found no anatomy research in which morphometric differences between a group with a typical pm morphology and a typical sn course in the infra - piriform foramen and a group with anatomical variations of both these structures would be statistically analyzed. the article aims at : 1) studying the incidence of anatomical variations in the sn course in relation to the piriformis ; 2) taking precise anthropometric measurements of selected pm and sn parameters ; and 3) comparing the measurement results of the group with a typical sn course and the group with variations of the sn, as well as comparing the results found in male and female limbs. thirty randomized, formalin - fixed human lower limbs of adults of both sexes were studied. the specimens were 14 limbs of women and 16 limbs of men, 13 of which were right limbs and 17 left ones. the bioethics commission of the medical university of lodz issued a consent for the study (consent no. deep dissection was performed in the gluteal region. upon visualization of the structures located deep to the gluteus maximus muscle special attention was paid to the sn course in the infra - piriform foramen and its relation to pm. the next stage has consisted in precise morphometric measurements of pm parameters (width wpm, length of the upper edge luepm, length of the lower edge llepm) and sn location from palpable bony landmarks (distance between the lateral edge of the sn and the greater trochanter lesn - gt, distance between the medial edge of the sn and the apex of the ischial tuberosity mesn - it). when determining the landmarks for measurements, the methodology applied by gvener. has been used, with modifications necessary for the purposes of this study. to complete the data, the following parameters were measured and statistically analyzed : length of the lower extremity (lle) from the greater trochanter to the lower edge of the lateral malleolus, thigh length (tl) from the greater trochanter to the knee - joint fissure, distance between the posterior superior iliac spine and the greater trochanter (psis - gt), distance between the posterior superior iliac spine and the apex of the ischial tuberosity (psis - it), distance between the apex of the ischial tuberosity and the greater trochanter (it - gt) as well as length at which the sn crosses the lower edge of pm (lsn - lepm). the measurements have been taken along straight lines, with stanley powerlock tape rule (stanley tools product group, new britain, the united states) and digimatic caliper (mitutoyo corporation, kawasaki - shi, kanagawa, japan). each measurement was taken twice, accurate to within 1 mm (with the exception of the sn measurements, which were accurate to within 0.1 mm) ; the average of both measurements was accepted as the final result. individual parameters have been assessed in the anthropometric study and their designations are presented in table 1. for the purposes of the analysis, the specimens have been divided into two groups : the first one with a typical pm morphology and a typical sn course in the infra - piriform foramen and the second one with variations in the area. distribution normality of the variables has been assessed with the shapiro - wilk test. despite the small size of the sample, deviation from distribution normality has been noted only for the llepm variable (for both groups), and for wpm in the group with a typical pm and psis - gt morphology and in the group with anatomical variations. this has made it possible to use parametric methods for assessment of significance of differences between the groups (in the case at hand student s t - test) for the majority of variables. for variables with deviations from the normal distribution the next stage has consisted in assessment of correlations between the variables with a specific correlation coefficient : spearman s rho. upon analysis of the pm morphology after it passes out of the pelvis, three variations of the muscle have been observed. variation i includes the cases with a typical pm morphology, where the muscle is pear - shaped (figure 1). this pm morphological type has been observed in 21 specimens (70%), more specifically in 11 male limbs and in 10 female limbs. variation ii covers the cases where pm is divided into two parts with the common peroneal nerve running between them (figure 2). this variation has been found in six specimens (20%), three of which are male and three female. one of the cases classified as variation ii has presented a distinct fusion of a tendon of one of the pm parts with the inferior gemellus muscle (figure 2). variation iii encompasses the limbs in which there is a fusion of pm with the gluteus medius muscle (figure 3). the variation has been found in three cases (10%), more specifically in two male limbs and in one female limb. due to the fusion of pm and the gluteus medius, the superior gluteal nerve and superior gluteal vessels run between fibres of the fused muscles. in the study material, a typical course of the sn (a single trunk in the infra - piriform foramen) has been observed in 20 limbs (66.7%), 11 of which are male and nine female (figure 1). 17 out of the limbs (56,6%) have displayed a typical pm morphology, whereas three of the limbs (10%) have pm fused with the gluteus medius (figure 3). the variation in which the common peroneal nerve runs through pm (figure 2) was found in six limbs (20%) three male and three female. this variation covered the cases where pm was divided into two parts with the common peroneal nerve running between them. three limbs (10%), on the other hand, have displayed a variation in which two sn roots merge below the pm inferior edge into one trunk. this morphology has been found in one male limb and two female limbs, with pm displaying a typical morphology. a rare variation with common peroneal nerve running within suprapiriform foramen and tibial nerve running within infra - piriform foramen (figure 4) was found in one male limb (3.3%). for the purposes of statistical analysis, the study material has been divided into two groups depending on sn relationships to the piriformis. specimens with a typical course of the sn have been classified in the first group. specimens displaying atypical course of the sn in the greater sciatic foramen have been classified in the second group. analysis of the statistical data (table 2) indicates that the groups do not significantly differ in the median, although slightly higher levels have been recorded for the group with the anatomical variations. variations group displayed greater diversity of results (figure 5). comparing the two populations using an adequate test does not, however, confirm significance of the differences between them from the perspective of the variables at hand. the conducted analysis allows for drawing a conclusion that there is a significant positive correlation between selected piriformis parameters on the one hand, and certain anthropometric measurements on the other, in the typical pm morphology group. the higher (on average) psis - it, psis - gt and it - gt, the bigger wpm. analogical, and at the same time stronger, relationships have been observed for llepm, whereas lesn - gt is significantly and positively correlated with psis - it and psis - gt. another significant positive correlation has been observed between lsn - lepm and lle. in the second group these regularities are weaker and not statistically significant. generally, in the group with a typical pm morphology, there has been observed a distinct regularity that a higher level of one parameter corresponds to a higher level of the other. assessment of the relationships between particular pm parameters (luepm, llepm, wpm) and selected sn parameters (lesn - gt, mesn - it) has revealed slightly different configurations of relationships in the group with a typical course of the sn and the group with atypical course of the sn. only the relationships between lesn - gt on the one hand, and luepm and llepm on the other, as well as between lsn - lepm and wpm can be deemed statistically significant in the group with a typical sn course. in the second group none of the relationships table 3 contains basic descriptive statistics for the analyzed variables in the male specimens group and in the female specimens group. sex - oriented statistical analysis of the gathered material revealed significant statistical differences in sn diameter measured along the lower edge of pm (the lsn - lepm dimension) the parameter has been higher to a statistically significant extent in the male limbs. psis - it is another parameter found to be higher to a statistically significant extent in the male group. in the male limbs, there has been a statistically significant positive correlation found between the length of the lower edge of pm (the llepm dimension) and the parameters psis - gt, it - gt, lesn - gt, mesn - it and lsn - lepm. in the female limbs only the lesn - gt dimension has correlated to a statistically significant extent with the llepm parameter. in the male limbs group there has been a statistically significant correlation observed between the length of the lower limb (lle) and the distance from the lateral edge of the sn to the greater trochanter (lesn - gt). in this group also the lsn - lepm parameter has been found to be positively correlated to a statistically significant extent with the it - gt parameter. in the female limbs group there has been a statistically significant positive correlation observed between the length of the lower limb (lle), as well as the thigh length (lt), and the distance from the sn to the apex of the ischial tuberosity (the mesn - it parameter). a comparison of dispersion of the selected variables in the male limbs group and in the female limbs group has been illustrated in figure 6. upon analysis of the pm morphology after it passes out of the pelvis, three variations of the muscle have been observed. variation i includes the cases with a typical pm morphology, where the muscle is pear - shaped (figure 1). this pm morphological type has been observed in 21 specimens (70%), more specifically in 11 male limbs and in 10 female limbs. variation ii covers the cases where pm is divided into two parts with the common peroneal nerve running between them (figure 2). this variation has been found in six specimens (20%), three of which are male and three female. one of the cases classified as variation ii has presented a distinct fusion of a tendon of one of the pm parts with the inferior gemellus muscle (figure 2). variation iii encompasses the limbs in which there is a fusion of pm with the gluteus medius muscle (figure 3). the variation has been found in three cases (10%), more specifically in two male limbs and in one female limb. due to the fusion of pm and the gluteus medius, the superior gluteal nerve and superior gluteal vessels run between fibres of the fused muscles. in the study material, a typical course of the sn (a single trunk in the infra - piriform foramen) has been observed in 20 limbs (66.7%), 11 of which are male and nine female (figure 1). 17 out of the limbs (56,6%) have displayed a typical pm morphology, whereas three of the limbs (10%) have pm fused with the gluteus medius (figure 3). the variation in which the common peroneal nerve runs through pm (figure 2) was found in six limbs (20%) three male and three female. this variation covered the cases where pm was divided into two parts with the common peroneal nerve running between them. three limbs (10%), on the other hand, have displayed a variation in which two sn roots merge below the pm inferior edge into one trunk. this morphology has been found in one male limb and two female limbs, with pm displaying a typical morphology. a rare variation with common peroneal nerve running within suprapiriform foramen and tibial nerve running within infra - piriform foramen (figure 4) was found in one male limb (3.3%). for the purposes of statistical analysis, the study material has been divided into two groups depending on sn relationships to the piriformis. specimens with a typical course of the sn have been classified in the first group. specimens displaying atypical course of the sn in the greater sciatic foramen have been classified in the second group. analysis of the statistical data (table 2) indicates that the groups do not significantly differ in the median, although slightly higher levels have been recorded for the group with the anatomical variations. variations group displayed greater diversity of results (figure 5). comparing the two populations using an adequate test does not, however, confirm significance of the differences between them from the perspective of the variables at hand. the conducted analysis allows for drawing a conclusion that there is a significant positive correlation between selected piriformis parameters on the one hand, and certain anthropometric measurements on the other, in the typical pm morphology group. the higher (on average) psis - it, psis - gt and it - gt, the bigger wpm. analogical, and at the same time stronger, relationships have been observed for llepm, whereas lesn - gt is significantly and positively correlated with psis - it and psis - gt. another significant positive correlation has been observed between lsn - lepm and lle. in the second group generally, in the group with a typical pm morphology, there has been observed a distinct regularity that a higher level of one parameter corresponds to a higher level of the other. assessment of the relationships between particular pm parameters (luepm, llepm, wpm) and selected sn parameters (lesn - gt, mesn - it) has revealed slightly different configurations of relationships in the group with a typical course of the sn and the group with atypical course of the sn. only the relationships between lesn - gt on the one hand, and luepm and llepm on the other, as well as between lsn - lepm and wpm can be deemed statistically significant in the group with a typical sn course. in the second group none of the relationships table 3 contains basic descriptive statistics for the analyzed variables in the male specimens group and in the female specimens group. sex - oriented statistical analysis of the gathered material revealed significant statistical differences in sn diameter measured along the lower edge of pm (the lsn - lepm dimension) the parameter has been higher to a statistically significant extent in the male limbs. psis - it is another parameter found to be higher to a statistically significant extent in the male group. in the male limbs, there has been a statistically significant positive correlation found between the length of the lower edge of pm (the llepm dimension) and the parameters psis - gt, it - gt, lesn - gt, mesn - it and lsn - lepm. in the female limbs only the lesn - gt dimension has correlated to a statistically significant extent with the llepm parameter. in the male limbs group there has been a statistically significant correlation observed between the length of the lower limb (lle) and the distance from the lateral edge of the sn to the greater trochanter (lesn - gt). in this group also the lsn - lepm parameter has been found to be positively correlated to a statistically significant extent with the it - gt parameter. in the female limbs group there has been a statistically significant positive correlation observed between the length of the lower limb (lle), as well as the thigh length (lt), and the distance from the sn to the apex of the ischial tuberosity (the mesn - it parameter). a comparison of dispersion of the selected variables in the male limbs group and in the female limbs group has been illustrated in figure 6. in 1937 beaton and anson introduced a modern detailed classification of sn course in relation to pm. this variation is related to high division of the sn, with the peroneal portion of the nerve emerging between the two parts of pm. in the present study, this variation has been observed in 20% of the limbs ; however, in the literature the incidence of this variation varies. the authors point out that during a surgical procedure aiming at complete decompression of the sciatic nerve, the surgeon should take into account a possibility that another tendon may be located inferior or deep to the first one. okraszewska. recorded the variation in two out of 36 studied limbs of the polish population (6%), whereas pokorn., in a study conducted on 91 cadavers in the czech population, observed a variation in which pm is perforated by one branch of the sn in 14.3% of the cases. studied 25 male cadavers and found this anatomical relation in six cadavers (in one case it was bilateral and in five it was unilateral). ogengo, in his research on variations of the sciatic nerve in the black kenyan population, found that the tibial nerve passed always under pm (within the infra - piriform foramen), whereas the common peroneal nerve pierced the pm in 7.9% of cases. in a study on 514 limbs chiba found a variation with the common peroneal nerve passing through the pm in as many as 38% of cases, which is the highest rate reported in literature. an atypical course of the sn in which two roots of the sn merge into one trunk below the inferior edge of the pm was observed by ogengo. in 4.9% of cases, while okraszewska. found it in three out of 36 examined limbs (8% of cases). this arrangement has been recorded in the present study in 10% of cases. moreover, in literature there are case reports of the sn branches wrapping around the pm in specimens with high division of the sn, so that the tibial nerve runs downwards (within the infra - piriform foramen), and the common peroneal nerve upwards from the pm (through the suprapiriform foramen). this type incidence according to different authors is : 1.5% of the examined cadavers (ugrenovic.), 2.4% (ogengo.), 6% of the examined specimens (okraszewska.), while gvener. found it in four out of 25 cadavers (in two of them it was unilateral and in two it occurred bilaterally). a rare case in which three roots of the sn merged into one common trunk only after exiting of the greater sciatic foramen (with the upper trunk running above and two trunks running below the pm) was described by nayak.. bergman describes a possible fusion of the pm with other muscles, including the gluteus medius, the superior gemellus muscle and in rare cases with the obturator internus. a fusion of the pm with the gluteus medius has been found in three limbs in our specimens, which accounts for 10% of the study material. the matter of differences in the incidence of particular variations of the sn course in relation to the pm between the sexes remains to be settled. okraszewska. have recorded no such differences, which is in line with our observations. taking into consideration the clinical problems, it seems probable that occurrence of anatomical differences in the sn course in relation to the pm may, according to some authors, contribute to piriformis syndrome, especially if accompanied by other etiological factors [5,1719 ]. chapman and bakkum described a case of a male patient with low back pain and piriformis syndrome symptoms, whose mri revealed an anomaly of the pm accessory superior bundles of the right piriformis. conservative treatment resulted in improvement, even though the structural cause of the ailment remained. chen, on the other hand, described a case of a 28-year - old female patient with a only recreation of normal relations of the sn to the pm by dissection of the lower head of the piriformis resolved the sciatica symptoms. accessory piriformis muscle as a cause of piriformis syndrome, easily diagnosable with mri, was described by sen and rajesh. a few authors took into consideration anthropometric measurements of the pm in reference to different types of build and sex. gvener. presented in 2008 morphometric data on the relationships between the sciatic nerve on the one hand, and the pm and selected bony landmarks in both neutral and test positions on the other hand ; however, the study was conducted solely on male limbs. although it is true that this research was conducted in static conditions due to the specificity of the examined specimens, to the best of our knowledge it is the first work that attempts to present a morphometric analysis of the anatomical relations between the pm and sn with reference to anatomical variations of both these structures. so, in specimens with typical anatomical relations between the pm and the sn, certain regularities have been observed, but in the group of specimens with variations in the pm, on the contrary, the data are more diverse and the correlations between them much weaker. in view of the above, a possibility of considerable deviations from the expected topographic relations should be taken into account when interpreting sciatic neuropathy, but also during any invasive medical procedures in the gluteal region. the research material has also revealed subtle differences in reference to sex. for a majority of parameters there were several differences between the male and female pelvis (e.g., the female pelvis is more shallow and the sciatic notches are wider, and the male pelvis is taller and narrower with the acetabulum oriented more laterally. so, slightly different correlations between particular anthropometric parameters in both sexes may result from differences in the structure of the pelvis. results of the conducted research, as well as the scientific literature review, point to the conclusion that there are several anatomical variations of the pm morphology and sn course within the deep gluteal region. there are also statistically significant correlations between some anthropometric measurements in groups of male and female limbs. for a majority of parameters, however, in this study there were no statistically significant differences revealed taking into consideration the location of sn in reference to selected bony landmarks between limbs with a typical sn course and limbs with sn anatomical variations. | backgroundthe aim of this study was to determine relationships between piriformis muscle (pm) and sciatic nerve (sn) with reference to sex and anatomical variations.material/methodsdeep dissection of the gluteal region was performed on 30 randomized, formalin - fixed human lower limbs of adults of both sexes of the polish population. anthropometric measurements were taken and then statistically analyzed.resultsthe conducted research revealed that, apart from the typical structure of the piriformis muscle, the most common variation was division of the piriformis muscle into two heads, with the common peroneal nerve running between them (20%). the group with anatomical variations of the sciatic nerve course displayed greater diversity of morphometric measurement results. there was a statistically significant correlation between the lower limb length and the distance from the sciatic nerve to the greater trochanter in the male specimens. on the other hand, in the female specimens, a statistically significant correlation was observed between the lower limb length and the distance from the sciatic nerve to the ischial tuberosity. the shortest distance from the sciatic nerve to the greater trochanter measured at the level of the inferior edge of the piriformis was 21 mm, while the shortest distance to the ischial tuberosity was 63 mm. such correlations should be taken into account during invasive medical procedures performed in the gluteal region.conclusionsit is possible to distinguish several anatomical variations of the sciatic nerve course within the deep gluteal region. the statistically significant correlations between some anthropometric measurements were only present within particular groups of male and female limbs. |
a 60-year - old male was referred to the asan medical center for a nodule in the left lower lobe (lll). the nodule was incidentally detected during the preoperative evaluation of gallstone, for which he underwent laparoscopic cholecystectomy at an outside hospital three months prior to his presentation to us. on his visit, he did not have any respiratory complaints such as productive cough or dyspnea. further, the patient had been a non - smoker for 10 years although he used to smoke half a pack a day for 30 years before quitting. we found that the patient 's physical examination was unremarkable except decreased breath sounds over the left lower lung field. chest x - ray and computed tomography scan revealed a mass having the following dimensions : 20105 mm. the mass obstructed the secondary bronchus entering into the lll, which resulted in a total collapse of lll (fig. 1). a flexible bronchoscopy showed an endobronchial mass filling the basal segments of the lll (fig. the patient underwent a left lower lobectomy via left posterolateral thoracotomy through the 5th intercostal space. we divided the lll bronchus at the level of the left upper lobe spur and performed a left lower lobectomy. the medial side of the left main bronchus was repaired using an interrupted anastomosis of 3 - 0 vicryl. the resection margin of the bronchial stump was clear from the tumor on the frozen section. immunohistochemical staining demonstrated the positivity for s-100 protein, and the ki-67 labeling index was low (1%), supporting the current diagnosis. granular cell tumor (gct), a rare benign neoplasm that most commonly occurs in the tongue, skin, subcutaneous tissue, and breast, was first described by abrikossoff in 1926. pulmonary gct, known to comprise 6% to 10% of all gtcs, was first reported by kramer in 1938, and since then, less than 80 cases of gct arising in the lung have been reported in the english - language literature. in korea, seo. it was traditionally termed ' granular cell myoblastoma ' until the late 1980s after abrikossoff suggested that gct had a myogenic origin. now, it is believed that gct has a neural cell origin, thus establishing the current nomenclature. although it has been known that most pulmonary gcts behave in a benign fashion, our review of the literature suggests that they have no unique clinical features. pulmonary gcts can be associated with synchronous extrapulmonary gcts occurring in various organs, such as the tongue, kidney, or esophagus. pulmonary gcts may occur metachronously in a single lung and thus, can be multicentric in 10% to 20% of the patients, although a majority of the gcts tend to be solitary. pulmonary gcts can be associated with other malignancies or infectious diseases such as tuberculosis or human immunodeficiency virus. pulmonary gcts can be diagnosed at any age, but most cases of pulmonary gct present in the third or the fourth decade. previous clinical series showed that there is no gender predilection, and gcts are equally distributed over both lungs with a predilection for the upper lobe. however, another study found a slight predilection toward the left lung with a preference for the lower lobe, as presented in our case. there are no commonly agreed risk factors, although the association of smoking with pulmonary gcts was hypothesized in some studies. more than half of the gct patients are asymptomatic at the time of diagnosis, and respiratory symptoms such as cough, dyspnea, hemoptysis, and wheezing present as tumor erosion and bronchial obstruction progress due to the growth of the endobronchial mass. with the onset of the symptoms, the bronchial obstruction causes the suppuration and destruction of the lung parenchyma distal to the obstruction ; in this case, surgical resection is clearly indicated. advocated bronchoscopic resection in asymptomatic patients with a tumor having a diameter of less than 8 mm, and van der maten. suggested that endobronchial therapy be the primary treatment however, bronchoscopic removal can not be a safe treatment option as it does not guarantee complete removal when gcts infiltrate through the entire bronchial wall, which is evidenced by the fact that the incidence of recurrence was as high as 54% after bronchoscopic removal. in addition, although extremely rare, it is possible that pulmonary gcts can be malignant ; the first case of malignant pulmonary gct was reported in 2003. being relatively young at the time of diagnosis can be a factor that favors complete surgical resection. in this regard, we believe that adequate surgical removal should be the preferred treatment option for all patients among whom gcts are amenable to surgical resection. based on the size, location, and number of masses, a surgical option, including either segmentectomy, lobectomy with or without sleeve resection, or rarely pneumonectomy, can be chosen with a lower incidence of recurrence and long disease - free survival. | we report a rare case of granular cell tumor arising in the left lower lobe (lll) bronchus with secondary obstructive change in a 60-year - old male. the patient was found to have a nodule in the lll on a computed tomography scan, three months prior to his presentation to the asan medical center. bronchoscopic biopsies revealed a granular cell tumor. after undergoing lll lobectomy with bronchoplasty, the patient has not experienced any tumor recurrence. |
w klinice, w ktrej pracuj autorzy, rdoperacyjne badanie ultrasonograficzne jest wykonywane w codziennej praktyce. badania rdoperacyjne przeprowadzane byy przez chirurga, ktry dokonywa oceny przed zabiegiem, co pozwolio na weryfikacj rozpozna. przytoczony materia dotyczy 145 procedur ious wykonywanych podczas laparotomii z powodu zmian chorobowych trzustki, w tym 57 zastosowanych w przypadku procesu zapalnego. ious jest wiarygodnym badaniem w ocenie ostrych zmian zapalnych w trzustce, gwnie w trakcie operacji przewlekego, objawowego zapalenia tego narzdu. badanie rnicuje zmiany torbielowate, guzy o torbielowatym charakterze, okrela prawidowy sposb drenau lub weryfikuje wskazania do wycicia zmiany chorobowej. ocenia miejsce i zakres operacji drenaowych w przypadku nadcinienia w drogach trzustkowych spowodowanego zwapnieniami miszu lub kamic przewodow w przebiegu przewlekego zapalenia trzustki. w raku trzustki weryfikuje stan miejscowego zaawansowania zmian guzowatych, pozwala na ocen zajcia naczy okootrzustkowych, wzw chonnych oraz wykazuje obecno przerzutw miejscowych the ii department of general and gastrointestinal surgery and surgical oncology of the alimentary tract has been performing ultrasound examinations since 1996. during this period, approximately 500 such procedures have been carried out, mainly necessitated by the various diseases of the liver and the pancreas. since 2007, pro focus system, and the 5 - 12 mhz linear array probe with oblong i previously, the examination was performer using a 12 mhz linear probe and a hitachi eub 410 12 ultrasound. in the last 10 years, over 280 procedures of intraoperative ultrasonography were performed, including 145 cases of laparotomy due to various pancreatic diseases. in this group of patients, percutaneous ultrasound, including doppler, was used prior to surgery, with multislice ct, 33 mri or pet performer in the case of 113 patients. in patients with underlying disease of the pancreas, in most cases the reason for uous examination were nodular changes, both already confirmed by previous imaging and fine needle aspiration biopsy targeting (bacc) as cancerous, with and without an explicit result with regard to the nature of the tumor or inflammation, i.e. cases classified for differential diagnosis. the procedure was performed on 88 patients with tumors of the pancreas, including 41 with confirmed (through bacc) or suspected cancer of malignant transformation. the remaining group of patients required intraoperative verification of pancreatic tumor. in 57 patients ious was performed due to other, non - oncological diseases of that organ mainly chronic pancreatitis in order to verify the changes occurring in the enlarged pancreatic duct, identifying plaques and cysts. less often, the examination was carried with the aim of providing intraoperative assessment of the changes in the course of acute pancreatitis, mainly to provide images of the abscesses and fluid reservoirs. ious examination in patients operated due to lesions of the pancreas (years 20042014) before each examination, an intraoperative probe (bk pro focus) was sterilized using appropriate antiseptic agents. over the last 5 years, disposable covers also used in laparoscopy which mask the entire section of the cable were used. for over a year now, special disposable covers for ultrasound heads are also in use. apart from not requiring prior sterilization, covers of this type protect the front of the scanner head, and are filled with gel. during the examination, the entire pancreas was evaluated, starting from head imaging, through the duodenum, and the direct application of the probe to the organ, after the incision of lesser sac and the release of all adhesions, starting from the stomach curvature and proceeding through to the root of the transverse colon mesentery. this was followed by the examination of the body of the organ 's, the tail of the pancreas, and the spleen cavity. attention was paid to the lobular parenchyma construction, its dimensions, and adjacent vessels ; this included flow evaluation by doppler scanning. arteries and veins were scanned, both using color and power doppler, and in some cases pulsed doppler as well. the assessment included any abnormalities in the pancreas itself, lesions present in its surroundings, and vascular infiltrations. in cases of neoplastic lesions, lymphatic involvement was evaluated, including the assessment of potential metastases, mainly in the liver and subsequent lymph nodes. in cases where the surgery was performed due to causes other than cancer, examination was conducted for the extent and type of secondary degenerative lesions, and the changes in the organ 's structure. the size, location, and number of fluid reservoirs was determined, as well as the gastrointestinal tract and other nearby organs and vessels of the upper section of the abdominal cavity. in differential diagnostics, in cases of suspected malignant changes of hard - to - determine nature, ious was accompanied by biopsy using fine- or more often core needle. for a long time, the authors have been using the sonocan (b braun), which provides cylindrical tissue samples. an important aid in biopsy the setup is equipped with a 10 mm aspiration syringe and needles with a diameter of 7 to 12 mm. in the case of changes which are adjacent to the duodenum, it is possible to use needles of larger diameter, including sets for biopsy of cylindrical tissue samples (1216 mm tru - cut needles). in such cases, the surgeon always waited for the result delivered by a pathologist directly to the operating room. in the last 10 years, ious examination was carried out in a group of 145 patients operated for pancreatic diseases identified in previous imaging and laboratory tests. among these, in 41 cases the presence of a malignancy was confirmed prior to surgery, both in cytology, in fine - needle biopsy, and in number of imaging tests, defining the nature of malignancy using the markers ca 19 - 9, and less frequently ca 125 or cea. in these cases, the aim of ious was to determine the severity of the malignancy and the feasibility of safe resection, or deciding on a palliative bypass. in another group of 47 patients who underwent laparotomy without a definitive diagnosis, ious examination was conducted in order to perform a differential diagnosis of nodular changes. the largest group, containing 23 cases, was related to the confirmation of the presence of cancer, mainly by ious - guided biopsy with an immediate assessment provided by the pathologist, as well as the determination of the expansion of the tumor to the surrounding structures, and lymph node imaging, with the possibility to collect samples during intraoperative examination. intraoperative biopsy was performed using tissue needles (tru - cut) of a larger diameter than needles used for cytological biopsy. in cases where the lesions occurred in the head of the pancreas, perforation was performed mostly via the duodenum, in order to prevent the formation of a fistula or bleeding. ious examination in patients undergoing laparotomy for a differential diagnosis (years 20042014) ious examination confirmed the presence of seven lithium - cystic changes with the characteristics of cystic tumors of the pancreas. in these patients, bacc including aspiration was performed. only in two patients content analysis (cytology, marker levels, mucus) gave a positive result ; in the case of the remaining group the results were inconclusive. during surgery, in six of the cases, resection of the tumor was conducted, together with a corresponding portion of the pancreas. in one patient, the presence of malignant tumor infiltrating the surrounding area together with the liver was confirmed. ious proved to be an effective method of intraoperative assessment with regard to determining the structure of liquid tumors, evaluating the boundary of the resection, and in the latter case imaging of small metastases occurring in the liver. within the studied sample group of 145 patients who underwent intraoperative ultrasound examination, in 64 cases (41 confirmed preoperatively and 23 during surgery) the presence of pancreatic cancer has been confirmed. in these patients, the size of the tumor was analyzed, as well as its location in relation to the portal - mesenteric confluence and other venous and arterial vessels. echogenicity and the structure of the tumor was carefully examined, together with the presence of enlarged regional and farther - located lymph nodes. the evaluation also included the width of the bile and wirsung 's duct. in all cases, the liver parenchyma was investigated in search of metastatic lesions. in another 11 of the studied patients, a high probability of a non - cancerous tumor ultrasound was used to scan small degenerative changes such as fibrosis, calcification, local and extended changes in the structure, which may correspond to the presence of a proinflammatory tumor, most often due to chronic pancreatitis, imitating metabolic changes typical of cancer. in all these cases, intraoperative biopsy, mainly tissue, confirmed the absence of cancer. among the remaining 57 patients ious was conducted during laparotomy, due to non - malignant changes in the pancreas. the largest group, consisting of 37 patients, included cases of chronic pancreatitis (cp). the course and the content of the pancreatic (wirsung 's) duct were evaluated during the removal of deposits as a preliminary procedure to puestow anastomosis. in this group, there were also patients with choledocholitiasis combined with the presence of cysts or complicated cases of cystic lesions, qualified for surgical treatment of chronic pancreatitis. the remaining group of 16 patients underwent laparotomy as a part of the treatment for acute pancreatitis complications and proinflammatory lesions, mostly cystic and thus not qualified for endoscopic drainage. the aim of ious was to evaluate the intensity of tissue damage, the viability and location for drainage, including necroses and complicated cysts (determination of the anastomosis). in four cases, ious assessment was carried out for pancreatic cancer metastasis resulting from other cancerous changes in other organs, mainly in cancer of the stomach ; the aim of the examination in such cases was to determine the scope of the planned operation. the last six studied cases included pronounced changes in the pancreas leading to its remodeling, including the infiltration of neighboring structures, without the possibility of a final verification using ious and a resection. table 3 presents a complete ious evaluation of the sample group with lesions of the pancreas. final verification of the group of patients operated due to lesions of the pancreas and examinied using ious (years 20072014) the most important advantage of ious examination is the ability to apply the scanner head directly to the organ during abdominal surgery. the basic task of intraoperative ultrasonography is the staging of tumors, their operability, as well as identifying possible metastases. ious is a useful method that helps solve problems in pancreatic surgery, during liver resection, and in a variety of therapeutic and diagnostic procedures in laparotomy. along with lus, ious is now the most widely used method in intraoperative assessment of the liver, gallbladder, and the evaluation of pathology and the biliary tract construction. other purposes of ious is the determination of the nature of focal liver lesions and the extent of resection of liver cancer in terms of criteria, as well as the control of ablation procedures in the case of metastatic tumors. an important element of the examination is also evaluating the changes in the levels of the lymphatic system, both in the peritoneal and retroperitoneal cavity. surgical procedures in pancreatic diseases are classified as the most difficult among all abdominal surgery. in many cases, intraoperative ultrasound is the major factor in the decision on the type of planned surgery, or even its cancelation. the use of ious may change the initial plans for surgery formulated with the use of preoperative imaging even in 3849% of the cases. ious is frequently used in the differentiation of pancreatic lesions, mainly pancreatic intraductal cancer and inflammatory lesions, or cystic and neuroendocrine tumors. at present, the recommended method enabling the surgeon to identify these is to extend the examination using doppler imaging, including color, power, and pulse doppler, and even elastography based on tissue doppler. the examination concerns the evaluation of visceral vessels, both arteries and veins, and the determination of their path in relation to the changes under investigation. color doppler is useful in differentiating pancreatic pseudoaneurysms, which affects the course of surgical procedure. despite ongoing developments in diagnostic imaging, it is still problematic to differentiate tumor - like lesions of the pancreas, and the changes which become clearly distinguishable only during laparotomy. intraoperative ultrasound is the method of choice in such situations, where no alternative diagnostic approaches are viable. high resolution imaging used in intraoperative scanning probes allows for a correct visualization of almost the entire pancreas. ious enables the determination of the criteria indicating the presence and location of the tumor mass, its echostructure and homogeneity, the imaging of its borders, and the presence of changes occurring beyond the pancreas itself (lymph nodes, infiltration of adipose tissue, vascular walls of the gastrointestinal tract, metastases in other organs). the primary objective of the examination is to provide images of the tumors, distinguish it from other commonly - inflammatory or proinflammatory changes in solid tumors, and to classify it, leading to establishing a concrete treatment strategy. in the last 10 years, the authors have used intraoperative study in 145 patients with pancreatic diseases. in most cases, the reasons for ious examination are nodular changes, with confirmed malignancy, and the lack of an explicit result with regard to the nature of the tumor or inflammation, or qualification for differential diagnosis (fig. tumor in the head of the pancreas with uneven surface and heterogeneous echostructure in some of the cases, the examination procedure can be further improved by directly placing the scanner head to a particular segment of the pancreas. conditions of the examination can be enhanced by cutting the gastro - colonic ligament and mobilizing the duodenum (kocher 's maneuver) (fig. ious. large pancreatic tumor (diameter : 5 cm). direct application of the probe in the tumor after duodenum mobilization in the case of lesions in the uncinate process, the alignment of the superior mesenteric artery and vein should be monitored (fig. if there is a change in the head of the pancreas, this requires a careful evaluation of the superior mesenteric vein, portal - mesenteric confluence, portal vein, gastro - duodenal vein and hepatic arteries. the evaluation of the vessels, including their movement, infiltration, changes in the diameter, and changes in blood flow, substantially affect the choice of surgical procedure to be adopted. imaging the distal body and tail of the pancreas, and the entire length of the splenic vessels should be evaluated. in this case, the area of spleen cavity, the structure of left kidney, large vessels in this area, and the entire adjacent retroperitoneal area should be scanned and evaluated. superior mesenteric vein, tup tumor of the uncinate process of the pancreas biopsy performed during surgery is an important part of the differential diagnosis, especially in scenarios where there is no preoperative confirmation on the nature of focal changes in the pancreas. the combination of ious and fine or core needle biopsy leads to increased diagnostic accuracy, with both : sensitivity and specificity reaching 90100%. in this study, the authors aim at performing intraoperative bacc, guiding the needle through the duodenum for changes located in the head of the pancreas. in such cases, this prevents the risk of pancreatic fistula, and in many cases, also of bleeding in the diagnosed area. when performing a biopsy within the body or tail of the organ, a narrower set is used, with the procedure supervised using doppler, thus avoiding penetration to the surrounding vascular structures (fig. an important aspect of intraoperative ultrasound is the assessment of peripancreatic vascular infiltration, portal vein flow, superior mesenteric artery, and the celiac trunk. in one of the first comprehensive studies, machi. demonstrated a significant advantage of sensitivity, specificity and accuracy of ious in diagnosing malignant invasion to the portal vein flow, as compared to pre - operative examination ious accuracy was determined at 89.7%, as compared to the average of 64.1%, for other imaging procedures. modern multidetector computer tomography (mdct) allows for a better assessment of tumor severity with the ability to assess peripancreatic lymphadenopathy. these are particularly difficult to distinguish, especially in cases of an existing inflammatory reaction, extensive infiltration of surrounding structures, or abundant adipose tissue. peripancreatic lymph nodes (marked by an arrow) another important issue is the assessment of cystic changes. most often, these include pseudocysts, formed as a complication due to acute and chronic pancreatitis. it should be noted, however, that the changes may sometimes also include cysts and cystic tumors. according to current studies, 25% of the cystic lesions of the pancreas designate cancer and cystic tumors, and that these constitute up to 10% of all tumors of the pancreas. a characteristic feature of serous adenocarcinomas cystoma are numerous small cysts, sometimes with internal calcification forming polycyclic structures. the presence of intraductal papillary mucinous neoplasia (ipmn) of the pancreas (ipmn) is indicated by the image of the cystic enlargement of the pancreatic duct, and the presence of non - uniformly thickened wall mucinous cystic tumor and internal cystic lesions, and a cystic tumor followed by changes of the non - uniformly thickened wall, with often additional partitions, solid intramural nodules and peripheral calcification. depending on the type of tumor, these may include benign or malignant forms, structure infiltration and metastases, including lymph nodes and the liver. ious examination is essential in the surgical treatment of cystic tumors, as it allows for accurate positioning of the changes and determining the condition of the adjacent vessels. it is important to note that these may be multiple tumors, unrecognized prior to the surgery. this is confirmed by our material, wherein the cystic tumor was recorded both in the body as well as in the tail of the pancreas (fig. secomd serous cystadenocarcinoma ; slightly smaller tumor located in the tail of the pancreas ious is an important study in surgery of pancreatic endocrine tumors. the most commonly imaged types include insulinomals, usually single lesions with reduced echogenicity, homogeneous, and well isolated. in some cases, hormonally active tumors may be isoechogenic, as a results of which they are difficult to distinguish from the rest of the pancreatic parenchyma making the initial diagnostic imaging harder, particularly in percutaneous ultrasound. the use of a contrast agent (ceus) and ultrasound heads with high - resolution of harmonic imaging has a significant impact on the proper imaging of the internal vascularity of the tumor, reducing the risk for potential diagnostic errors. the increased cell flow is observed in pancreatic insulinomals, and partially in neuroendocrine tumors. the presence of multiple of neuroendocrine tumor foci should also be kept in mind, as well as their non - pancreatic location. the less frequently diagnosed neuroendocrine tumors include glucagonoma, gastrinoma, vipoma, somastatinoma, and carcinoid. these tumors give hypo- or izoechogenic ultrasound image, and like the insulinoma, they are usually well disconnected from the pancreatic parenchyma. more often, however, they present a malignancy, as exemplified by the vipoma tumor, located in the tail of the pancreas, in the hilar region of the spleen (fig. 8). hypoechoic, well - demarcated malicious vipoma tumor located in the tail of the pancreas (arrows) in the hilar region of the spleen. small internal calcification the echogenicity of the pancreas is correlated with the patient 's age, the amount of adipose tissue and fibrous elements. it is usually slightly larger in relation to the liver, and may be increased in the case of adipose tissue infiltration, and the changes occurring in chronic pancreatitis. the inflammatory processes lead to local and extended destruction of the organ, causing changes in the internal echostructure and significant obstruction in determining the outer boundary as a result of infiltration of surrounding retroperitoneal space, which typically takes place due to acute pancreatitis. surgical treatment for acute pancreatitis due to extensive infected necrosis, abscesses and pancreas abscesses, peripancreatic tissue, retroperitoneal space and concomitant intraperitoneal lesions, require the use of proper surgical technique. preoperative imaging studies (ultrasound, ct) determine only generally the extent of lesion formation, which, due to extensive tissue damage, the exact location and nature, can only be assessed after, often complicated, laparotomy or opening of the retroperitoneal space. in such cases, ious allows for proper access to the affected area, determines the surgical planes, places the outbreak or outbreaks of largest disintegration lesions of necrosis that should be reached, removed and drained (fig. 9). this enables the surgeon to avoid damaging vital life structures, including the main vascular branches, infiltrated parts of the gastrointestinal tract, the structure of the bile duct and the main pancreatic duct. in such situations, it is important to evaluate doppler images, which allows to distinguish space with no vital vessels, mainly tanks and fluid spaces and structures that may indicate major blood vessels. evaluation of blood around during planned access to the lesions in order to place a drain local complications in acute pancreatitis in the form of abscess or pseudocyst require careful differentiation, including intraoperative, due to considerable differences in surgical strategies. it is important to evaluate the fluid reservoirs, distinguishing acute phase reservoirs, pseudocysts and inflammatory fluid in the abdomen, often limited by inflammatory or post - operative adhesions. good interpretation influences the choice of appropriate treatment, choice of the type of drainage, thus helping to avoid many postoperative complications. the characteristic echogenicity in the structure of the vessel may indicate the presence of dense fluid and gas, which is characteristic of an abscess. a similarly characteristic echo image may suggest the present of hematoma or retroperitoneal phlegmon. both the pancreatic pseudocyst and reservoir of the lesser sac may contain necrotic elements, necrosis of the pancreas and nectrotic adipose tissue fragments (fig. intraoperative examination enables the surgeon to correctly determine the indications for their removal, particularly in cases where the elements are separated from the retroperitoneal space and are not vascularized. intraoperative evaluation can also provide information about the concomitant gallbladder disease, cholelithiasis or choledocholithiasis. cyst with visible abscess, located to the rear of the stomach treatment of pancreatic abscesses depends on its location, the experience of the diagnostic and therapeutic personnel, and the assessment of the pancreatitis, including the condition of the pancreas, peripancreatic changes, and the general condition of the patient. in cases where there is no immediate indication for surgery currently, percutaneous image - guided drainage is carried out, as well as internal drainage using endoscopic techniques and laparoscopy include the use of lus (fig. 11). external drainage conducted when the pouch (reservoir) is located the organs, in order to prevent any damage to the bowel and adjacent organs. in cases of pancreatic abscesses, it is recommended to use large diameter tubing from 14f to 24f, and in some cases even 30f this is associated with high contents of abscesses fragments and the presence of necrotic tissue resulting from the decay of peripancreatic vessels and the pancreas itself. cystogastrostomy prosthesis during implanting ious is a useful procedure in evaluating the position of pseudocysts in relation to certain parts of the gastrointestinal tract, primarily the stomach and duodenum. adhesion to the stomach cyst may suggest the use of jurasz method, i.e. cystogastrostomy. in the absence of connection with the stomach or the duodenum, or in cases where despite correct position anastomotic adhesion treatment is not possible due to technical reasons, attaching the duct to a loop of the small intestine is recommended (roux - en - y anastomosis). furthermore, in the case where jurasz method was used, doppler ious allows for the selection of a suitable location for anastomosis, in which no major blood vessels are present, and consequently, where cutting the walls of the gastrointestinal tract will not cause major bleeding (fig. ooperational cystogastrostomy ; ious with doppler allows the selection of a suitable linking spot distant from larger vessels chronic pancreatitis can be correctly diagnosed using imaging examination. in some cases, however, examination may be inconclusive, especially when dealing with tumors. if the structure of the tumor can be seen as a degeneration of cysts, focal fibrosis and calcification, the presence of tumor inflammation can be suspected. if, however, the changes are ambiguous in nature, with a dominant solid structure, and degenerative features are poorly marked, a more detailed examination is necessary. these methods allow for a thorough definition of the border of both normal and pathological changes of the organ. the offer highly accurate image of the abnormal structure of the inflamed pancreas, seen as small pseudocysts, bands and hiperechogenic fibrosis. they enable a correct evaluation of the extension of pancreatic ducts and their course, localized calcification in the main ducts and branches, and the surrounding parenchyma. they can also contribute to the proper differentiation of inflammatory and malignant tumors of the pancreas, including aspiration biopsy. tumors in the head of the pancreas due to chronic inflammation are accompanied by numerous factors of degenerative nature. with the right adjustment of the intraoperative probe, the surgeon can determine the tortuous, extended course of the pancreatic duct and the presence of numerous calcifications inside the duct and the perenchyma (fig. when performing drainage, mainly using puestow 's method, it is possible to determine the point of incision into the enlarged pancreatic duct, which makes the identification and removal of pancreas duct stones. ious provides a correct imaging of the differences in the structure of cystic changes, litho - cystic and solid tumors in the pancreas itself and in the retroperitoneal space. tortuous, expanded pancreatic duct with calcification present. preparing for the puestow procedure, creating an incision along the pancreatic duct, draining, and attaching the duct to a loop of the small intestine (roux - en - y anastomosis) at first glance it enables a thorough assessment of the changes occurring in the pancreas and the surrounding area is crucial, without extensive tissue preparation. the final interpretation of the results is not dependent on other medical staff, and can be carried out during surgery itself. in some of the cases, ious examination leads to the decision to change the scope of the operation or to use additional therapeutic procedures. this is mainly due to the complicated nature of the cases, both due to acute and chronic pancreatitis. the procedure has no major restrictions, except in cases of significant adiposity around the pancreas, or pancreatic infiltration, which impede direct assessment of the organ. pancreas treatments performed in referral centers due to the advanced stage of the changes, often require sophisticated diagnostic and surgery techniques. iuos is now becoming a compulsory technology, allowing for proper classification and proper conduct of complex surgical procedures. it is one of the basic tools of the surgeon, and thus only the surgeon involved in pancreas surgery will benefit from the use of this method. ious examination is mainly used for the determination of the level and extent of pancreatic cancer, the assessment of liver for the existence of metastases, and the imaging of small neuroendocrine tumors.ious also plays an important role in the differentiation of cystic tumors of the pancreas and pseudocysts, differentiation and non - malignant tumors, mainly arising in the course of inflammation of the pancreas.in cases of acute pancreatitis, ious enables a supervised surgery, the removal of necrotic tissues, abscesses and phlegmon in complicated cases.ious is a useful procedure in the diagnosis and localization of pseudocysts, allowing for the selection of the appropriate corrective surgery.ious is also very useful in monitoring of drainage procedures, treatment in complicated cases of chronic pancreatitis, cystic changes, and overpressure of the pancreatic system and choledocholithiasis. ious examination is mainly used for the determination of the level and extent of pancreatic cancer, the assessment of liver for the existence of metastases, and the imaging of small neuroendocrine tumors. ious also plays an important role in the differentiation of cystic tumors of the pancreas and pseudocysts, differentiation and non - malignant tumors, mainly arising in the course of inflammation of the pancreas. in cases of acute pancreatitis, ious enables a supervised surgery, the removal of necrotic tissues, abscesses and phlegmon in complicated cases. ious is a useful procedure in the diagnosis and localization of pseudocysts, allowing for the selection of the appropriate corrective surgery. ious is also very useful in monitoring of drainage procedures, treatment in complicated cases of chronic pancreatitis, cystic changes, and overpressure of the pancreatic system and choledocholithiasis. the authors of this paper do not claim any financial or personal relationships with other individuals or organizations which could adversely affect the content of this publication, and/or claim any rights to this publication. | both acute and chronic inflammation of the pancreas often lead to complications that nowadays can be resolved using endoscopic and surgical procedures. in many cases, intraoperative ultrasound examination (ious) enables correct assessment of the extent of the lesion, and allows for safe surgery, while also shortening its length.aim of the researchat the authors clinic, intraoperative ultrasound is performed in daily practice. in this paper, we try to share our experiences in the application of this particular imaging technique.research sample and methodologyintraoperative examination conducted by a surgeon who has assessed the patient prior to surgery, which enabled the surgeon to verify the initial diagnosis. the material presented in this paper includes 145 ious procedures performed during laparotomy due to lesions of the pancreas, 57 of which were carried out in cases of inflammatory process.results and conclusionsious is a reliable examination tool in the evaluation of acute inflammatory lesions in the pancreas, especially during the surgery of chronic, symptomatic inflammation of the organ. the procedure allows for a correct determination of the necessary scope of the planned surgery. the examination allows for the differentiation between cystic lesions and tumors of cystic nature, dictates the correct strategy for draining, as well as validates the indications for the lesion 's surgical removal. ious also allows the estimation of place and scope of drainage procedures in cases of overpressure in the pancreatic ducts caused by calcification of the parenchyma or choledocholitiasis in chronic pancreatitis. in pancreatic cancer, ious provides a verification of the local extent of tumor - like lesions, allowing for the assessment of pancreatic and lymph nodes metastasis, and indicating the presence of distant and local metastases, including the liver. ious significantly improves the effectiveness of intraoperative bac aspiration or drainage of fluid reservoirs. |
this process requires insulin, a peptide hormone that lowers glycemia by triggering the uptake of glucose into cells. as the exclusive source of insulin, pancreatic cells play an essential role in glucose homeostasis. they are responsible for the production, storage and release of insulin in a manner that is strictly coupled to demand. what is clear is that glucosestimulated insulin secretion (gsis) is a complex and tightly regulated process, the disruption of which has severe consequences. evidence of this can be seen in diabetes, a widespread metabolic disease resulting from the failure of cells to meet the physiological requirements for insulin. in type 1 diabetes, this is caused by the autoimmunemediated destruction of cells. in type 2 diabetes, cells fail to adequately compensate for the insulin resistance often ensuing in conditions such as obesity. early cell dysfunction, characterized by impaired gsis, is considered fundamental in this process. the deficits in gsis observed in type 2 diabetes have been attributed to numerous factors. cholesterol is an essential constituent of mammalian cell membranes, which influences their fluidity, permeability and curvature. it is also a major component of membrane rafts dynamic nanoscale assemblies of sterols, sphingolipids and proteins that can be stabilized to coalesce into platforms that facilitate various cellular processes. these domains are now widely considered to participate in the regulation of gsis, a conclusion based primarily on two observations. first, numerous proteins involved in either gsis or the biogenesis of secretory granules (sgs), the intracellular storage organelles from which insulin is secreted, have been shown to partition with detergentresistant membranes (drms) in the light fractions of sucrose density gradients after solubilization at 4c with triton x100 or other nonionic detergents. second, perturbation of membrane cholesterol often induced a repartitioning of these proteins that corresponded with alterations in their function, as well as in insulin secretion. these results have prompted speculation that changes in membrane rafts, triggered by altered cellular cholesterol homeostasis, contribute to the impaired gsis in type 2 diabetes. here we provide a brief overview of the work linking membrane rafts and gsis, and the insight it provides into cell dysfunction. recent studies in mice have emphasized the importance of cell cholesterol homeostasis for insulin secretion. disruption of cholesterol efflux through knockout of the cholesterol transporter adenosine triphosphate (atp)binding cassette transporter a1 (abca1) selectively in cells resulted in the accumulation of islet cholesterol, as well as glucose intolerance and impaired gsis. this was in agreement with the previous observation that knockout of liver x receptor (lxr), a nuclear hormone receptor that upregulates abca1 expression in response to cholesterol, caused cell dysfunction. mice lacking the cholesterol acceptor apolipoprotein e (apoe) also showed elevated islet cholesterol levels and reduced insulin secretion. unlike abca1 mice, however, circulating cholesterol levels in apoe mice were elevated, suggesting a correlation between hypercholesterolemia and cell dysfunction. knockout of the low density lipoprotein receptor (ldlr), which facilitates cholesterol uptake, also triggered hypercholesterolemia, although its impact on cell function was inconsistent. one group observed elevated islet cholesterol levels, impaired glucose tolerance and reduced gsis in these mice, whereas another reported no significant alterations in islet cholesterol or cell function. despite this discrepancy, the trend emerging from these and other studies is that cholesterol accumulation in cells impairs insulin secretion. work investigating the role of membrane rafts in gsis has identified numerous stages at which this might occur. glycemia is normally maintained at concentrations of 5 mmol / l, and increases above this value trigger glucose uptake in cells. in rodents, this is facilitated primarily by glucose transporter (glut)2, whereas in humans glut1 is the predominant glucose transporter. although there is little direct evidence for the association of these transporters with membrane rafts in cells, glut1 partitioned with drms in various other cell types. in addition, cholesterol depletion of liverderived clone 9 cells with methylcyclodextrin (mcd), which extracts cholesterol from the plasma membrane, disrupted the raft partitioning of glut1 and enhanced glucose transport. interestingly, ldlr islets with elevated cholesterol showed reduced glucose uptake, as did cholesterolloaded primary cells. however, the possibility that this represented a membrane raftdependent effect on glucose transporter activity was not investigated. this critical ratelimiting step in glucose metabolism is catalyzed by glucokinase (gck), the primary glucose sensor of cells. a pool of gck associates with sgs, and glucose induces its dissociation and activation. this association is mediated by an interaction with neuronal nitric oxide synthase (nnos), and recent work suggests a role for membrane rafts in this process. have reported that mcd reduced nnos dimerization, promoted the translocation and activation of gck, and enhanced gsis. nnos has been previously shown to interact with islet cell autoantigen 512 (ica512), a transmembrane sg protein also known as insulinomaassociated protein 2 (ia2) or protein tyrosine phosphatase, receptor type, n (ptprn). hao. speculated that ica512 associates with membrane rafts, and this facilitates nnos dimerization and the retention of gck on sgs (figure 1a). both ica512 and nnos partition with drms in insulinoma cells (dirkx r and solimena m, unpublished data, 20072009), and recent structural studies have indicated that the luminal / extracellular domain of ica512 dimerizes. however, it is not yet clear if membrane rafts influence ica512 dimerization or its interaction with nnos. therefore, additional work is required, especially in light of reports that gck does not translocate from granules in response to glucose and that nnitrolarginine methyl ester (lname), an inhibitor of nnos that enhanced its dimerization, amplified insulin secretion. apart from gck activity, cholesterol overloading of cells directly disrupted mitochondrial metabolism, and this together with reduced glucose uptake likely accounted for the near complete inability of glucose to elicit increases in cellular atp levels in these cells. this initiates ca influx, leading to soluble nethylmaleimidesensitive factor attachment protein receptor (snare)mediated secretory granule (sg) fusion and insulin secretion. sphingolipid and cholesterolenriched membrane rafts (highlighted in red) have been proposed to regulate various aspects of glucosestimulated insulin secretion including (a) glucose metabolism, and the secretiondependent translocation and activation of a sgassociated pool of glucokinase (gck) ; (b) katp, cav and kv channel activity, snaremediated sg fusion and its spatial coupling to ca entry, fusion pore formation, and the syntaxinmediated regulation of channel gating ; and (c) targeting and retention of prohormones, their processing enzymes, and granins in the cholesterolenriched membranes of newly forming sg. cav, voltagegated ca ; cga, chromogranin a ; cpe, carboxypeptidase e ; glut, glucose transporter ; katp, adenosine triphosphatesensitive k ; kir, inwardly rectifying k ; kv, voltagegated k ; sur, sulphonylurea receptor ; nnos, neuronal nitric oxide synthase ; ia2, insulinomaassociated protein 2 ; ia2, insulinomaassociated protein 2 ; ica512, islet cell autoantigen 512 ; pc1/3, prohormone convertase 1/3 ; pc2, prohormone convertase 2 ; ptprn, protein tyrosine phosphatase, receptor type, n ; ptprn2, protein tyrosine phosphatase, receptor type, n polypeptide 2 ; sgiii, secretogranin iii ; snap25, synaptosomalassociated protein 25 ; vamp2, vesicleassociated membrane protein 2. the enhanced intracellular atp levels resulting from glucose metabolism inactivate atpsensitive k (katp) channels, causing membrane depolarization. this triggers ca influx through voltagegated ca (cav) channels and subsequent soluble nethylmaleimidesensitive factor attachment protein receptor (snare)mediated fusion of sgs. depolarization also activates voltagegated k (kv) channels, which act to reestablish the resting membrane potential and thus suppress insulin secretion. the inwardly rectifying k (kir) channel 6.2 and its associated sulphonylurea receptor (sur)1 constitute the main katp channel responsible for glucoseinduced depolarization of cells. while kir6.2 associated with membrane rafts in cardiomyocytes, kir6.2 and sur1 however, kv2.1 and cav1.2, and the snare proteins syntaxin 1a, synaptosomalassociated protein 25 (snap25) and vesicleassociated membrane protein 2 (vamp2) were all partially associated with membrane rafts (figure 1b). mcd, which caused their redistribution out of raft fractions, increased gsis, a result which capacitance measurements indicated was due, in part, to enhanced refilling of the readily releasable sg pool. kv channel current amplitude was reduced in depleted cells, suggesting that membrane raft disruption promoted insulin secretion by hindering repolarization. in this context, it is noteworthy that snare proteins, in addition to their fundamental role in granule fusion, have also been reported to regulate katp, kv and cav channels. thus, membrane rafts appear to contribute to the modulation of cell excitability, either by directly regulating channel activity or by spatially coordinating snarecoupled channel gating. upregulated gsis and enhanced depolarization were also observed in mcdtreated ins1 cells, as was increased cortical factin remodeling. these results were attributed to altered membrane phosphatidylinositol 4,5bisphosphate (pip2) levels, as mcd increased pip2 hydrolysis whereas cholesterol loading appeared to enhance membrane pip2 levels and disrupt glucosedependent hydrolysis. its accumulation impaired insulin secretion by reducing the sensitivity of katp channels to atp and stabilizing the cortical factin cytoskeleton. this work suggests that the effects of cholesterol accumulation on gsis are coupled in part through pip2. possibly, as triton x100 insoluble raft fractions were reportedly enriched in pip2. however, it is still unclear how this might influence glucosedependent pip2 hydrolysis or the regulation of katp channels comprised of kir6.2 and sur1, both of which appear to be excluded from membrane rafts in cells. in contrast to the observations that cholesterol depletion enhances gsis, further work by xia. indicated that the inhibition of cholesterol biosynthesis in min6 insulinoma cells, which also disrupted the raft partitioning of cav1.2, kv2.1 and snare proteins, impaired gsis. in this case, cav, kv and katp channel activity similar results were reported in cells after cholesterol overloading, suggesting that these channels are sensitive to any deviations from optimal cholesterol levels, regardless of direction. as reducing kv and katp channel activity promotes secretion, the component of impaired gsis resulting from altered channel function was attributed in these studies to the observed deficit in cav channel activity. alterations of the membrane lipid environment also disrupted insulin secretion by dispersing ca influx independent of changes in channel activity or sg release competence. this spatial uncoupling of ca influx and sgs has been proposed to hinder fusion pore formation, thus reducing the frequency of full fusion events and the efficiency of insulin release. in addition, reduced sg exocytosis, detected in the absence of altered channel function, was a primary deficit in the cells of abca1islets. the core snare fusion complex is comprised of the target (t)snares syntaxin 1a, and snap25 on the plasma membrane and the vesicle (v)snare vamp2 on vesicles. as previously described in neurons, cholesterolsensitive syntaxin 1 and snap25 clusters define sites where sgs preferentially dock and fuse. in insulinoma cells, mcd dispersed syntaxin 1 and induced a redistribution of snap25 to the cytosol, both of which were accompanied by reductions in the number of docked sgs and gsis. interestingly, diffusion of syntaxin 1a from granule docking sites and reduced gsis were also observed in ins1 cells cultured in high glucose, a condition that downregulated cholesterol biosynthesis and disrupted syntaxin 1acontaining membrane rafts. however, studies demonstrating cholesteroldependent tsnare clustering did not always detect snare proteins in membrane raft fractions. in addition, syntaxin 1a clustering was detected in proteoliposomes that did not support the formation of raftlike liquid ordered (lo) domains. when cell snare proteins did partition with drms, a substantial pool was also detected in soluble fractions. in neuroendocrine cells, more recently, these proteins have been shown to form two conformationally distinct and spatially segregated tsnare dimer intermediates, only one of which supports fusion. in addition, crosslinked complexes containing syntaxin 1a and the sec1/munc18like (sm) protein mammalian uncoordinated 18 (munc18), an accessory protein essential for secretion that participates in multiple stages of snare assembly and fusion, were restricted to nonraft fractions. although these observations suggest that snare assembly and fusion might proceed in nonraft membrane regions, more work is required to understand the role of membrane rafts in the multiple, and often spatially and temporally distinct, stages of snare assembly and function. proper sg biogenesis is an obvious prerequisite for secretion, and cholesterol, which is highly enriched in the granule membrane, is critical for their formation and integrity. in neuroendocrine cells, disruption of cholesterol biosynthesis with lovastatin, a 3hydroxy3methylglutarylcoenzyme a (hmgcoa) reductase inhibitor, blocked the formation of granules from the transgolgi network (tgn) and caused swelling of the tgn cisterna. in min6 cells, lovastatin decreased sg numbers while increasing their average size, and this corresponded with reduced insulin content and impaired regulated secretory response. disruption of either lanthosterol5desaturase (sc5d) or 7dehydrocholesterol reductase (dhcr7), the enzymes responsible for the last two steps in cholesterol synthesis, decreased pancreatic exocrine and endocrine sg numbers, and increased granule size. studies in model membranes demonstrated that lanthosterol enhanced membrane flexibility while reducing intrinsic membrane curvature relative to cholesterol, suggesting that the altered sg biogenesis in sc5d mice resulted from the accumulation of lanthosterol in granule membranes. cholesterol accumulation in abca1 islets was also suggested to disrupt sg biogenesis, a conclusion based on observations that cell golgi ultrastructure was altered and circulating proinsulin levels were enhanced. however, although the insulin sgs of these mice were described to be heterogeneous with respect to mean diameter compared with controls, no significant changes in sg numbers, size or distribution were observed. enlarged sgs and impaired gsis downstream of depolarization were also observed in islets and insulinoma cells lacking the cholesterol transporter atpbinding cassette transporter g1 (abcg1). in cells, abcg1 was reportedly expressed on sgs, and its loss led to reductions in sg cholesterol levels without altering total cellular or circulating cholesterol levels. therefore, abcg1 has been proposed to maintain sg integrity by facilitating the retention of cholesterol within the granule inner membrane leaflet, thus counteracting the carriermediated diffusion of cholesterol from the sg outer membrane leaflet. in addition to reducing sg membrane integrity, the dispersal of this pool could alter raftdependent processes elsewhere a possibility supported by the observation that mcd extracted more cholesterol from cells lacking abcg1. this apparent redistribution of cholesterol to the plasma membrane might explain the latestage deficit in secretion (i.e. downstream of ca influx) detected in these islets, although it is tempting to speculate that a corresponding reduction of sg membrane cholesterol might have also perturbed raftassociated sg proteins, such as vamp2. whatever the case, this work suggests a unique mechanism of cell dysfunction that could be of particular interest given the observation that abcg1 expression is reduced in diabetic mice. although the mechanisms governing this process are still debated, membrane rafts appear to play a role (figure 1c). prohormone convertase 1/3 (pc1/3) and 2 (pc2), two cargo endoproteases responsible for the conversion of proinsulin to insulin during sg maturation, both partitioned with drms in neuroendocrine cells. in addition, pc1/3 associated with the luminal leaflet of sgs in a cholesterolsensitive manner, and deletion of its membranebinding domain led to missorting of pc1/3 and its constitutive release. the membrane raft association of pc2, in contrast, appeared to be sphingolipiddependent. inhibition of sphingolipid synthesis with fumonisin blocked its targeting to sgs, as did truncation of its cterminal raftbinding domain. the insulin processing enzyme carboxypeptidase e (cpe) was also reported to associate with membrane rafts in sg membranes purified from pituitary. cholesterol depletion dissociated cpe from sg membranes, and its sorting to sgs was disrupted in lovastatintreated att20 pituitary cells. a similar missorting was observed in neuroendocrine cells when the cterminus of cpe, which mediated its partitioning with drms, was removed. it should be noted, however, that cpe did not partition with raft fractions in min6 cells. cholesterol appears essential for targeting the granin protein, secretogranin iii (sgiii), to immature granules, as it bound to sglike liposomes and isolated sg membranes in a cholesteroldependent manner, and deletion of its nterminal membranebinding domain caused its constitutive secretion. in ins1 cells, sgiii binds cpe, and its interaction with chromogranin a (cga), another granin that promotes prohormone aggregation in the acidic luminal milieu of sgs, targeted cga to insulin sg membranes. therefore, sgiii has been described as a multifunctional adaptor that facilitates the retention of prohormone aggregates in the cholesterolenriched membranes of nascent sgs, thus promoting their processing and maturation by raftassociated convertases. this does not appear to be the case, as it was soluble in triton x100 and several other detergents typically used to designate raft association. the transmembrane sg protein phogrin, additionally referred to as insulinomaassociated protein 2 (ia2) or protein tyrosine phosphatase, receptor type, n polypeptide 2 (ptprn2), was also shown to interact with cpe, and this facilitated the targeting of both proteins to granules. phogrin and its paralog, ica512, like sgiii were also primarily soluble in triton x100. however, ica512 partitioned to a greater extent with drms after solubilization in lubrol (dirkx r and solimena m, unpublished data, 2007), a finding similar to that reported previously for vamp2. these results suggest that sg membranes, although highly enriched in cholesterol and sphingolipids, still appear to be organized in heterogeneous functional membrane raft domains with distinct protein profiles. cholesterol is essential for proper cell function, and despite discrepancies regarding the effect of cholesterol depletion on some aspects of gsis, there now appears to be a clear consensus that accumulation of cellular cholesterol impairs insulin secretion (figure 2). in the end, however, the question remains do membrane rafts regulate gsis ? conceivably yes, as compelling evidence indicates that numerous proteins essential for granule biogenesis and insulin secretion associate with these domains in a cholesteroldepletion sensitive fashion. however, at this time there is little evidence that physiological stimuli that trigger or augment insulin secretion (e.g. glucose, glucagonlike peptide 1 etc.) do so by altering the partitioning of these proteins in or out of membrane rafts. in addition, although a recent study suggested that hyperglycemiainduced reductions in cholesterol might impair gsis in part by disrupting membrane rafts, it has not been clearly demonstrated that physiopathological conditions that induce cholesterol accumulation also alter membrane rafts. for these reasons, it is difficult to assess at this time if membrane raft perturbation is a key factor contributing to cell dysfunction in type 2 diabetes. thus, while it remains an appealing possibility, the hypothesis that impaired cellular cholesterol homeostasis disrupts insulin secretion by altering cell membrane rafts remains to be proven. a summary of the reported effects of cholesterol perturbation in pancreatic islets, cells or insulinoma cells. arrows indicate increase () or decrease () in the described effect. those effects associated with enhanced or reduced gsis are listed in green or red, respectively. as noted below, exocytosis is listed only when observed directly (i.e. changes in cadependent exocytotic response monitored by capacitance measurements taken independent of voltagegated ca [cav ] channeldependent ca influx). the deficit in regulated secretion associated with the sc5dmice was reported from exocrine cells. although no net change in cholesterol was reported in abcg1 islets, secretory granule (sg) cholesterol levels were reduced, whereas plasma membrane levels appeared to be elevated. although not measured directly, impaired exocytosis likely accounted in part for the secretory deficit in abcg1 islets, as glucoseinduced ca influx was unchanged compared with controls. abca1, atpbinding cassette transporter a1 ; abcg1, adenosine triphosphatebinding cassette transporter g1 ; drm, detergent resistant membrane ; gck, glucokinase ; hmgcoa, 3hydroxy3methylglutarylcoenzyme a ; katp, adenosine triphosphatesensitive k channel ; kv, voltagegated k channel ; ldlr, low density lipoprotein receptor ; mcd, methylcyclodextrin ; pip2, phosphatidylinositol 4,5bisphosphate ; sc5d, lanthosterol5desaturase ; snap25, synaptosomalassociated protein 25 ; vamp2, vesicleassociated membrane protein 2. | abstractthe failure of pancreatic cells to supply insulin in quantities sufficient to maintain euglycemia is a hallmark of type 2 diabetes. perturbation of cell cholesterol homeostasis, culminating in elevated intracellular cholesterol levels, impairs insulin secretion and has therefore been proposed as a mechanism contributing to cell dysfunction. the manner in which this occurs, however, is unclear. cholesterol is an essential lipid, as well as a major component of membrane rafts, and numerous proteins critical for the regulation of insulin secretion have been reported to associate with these domains. although this suggests that alterations in membrane rafts could partially account for the reduction in insulin secretion observed when cell cholesterol accumulates, this has not yet been demonstrated. in this review, we provide a brief overview of recent work implicating membrane rafts in some of the basic molecular mechanisms of insulin secretion, and discuss the insight it provides into the cell dysfunction characteristic of type 2 diabetes. (j diabetes invest, doi : 10.1111/j.20401124.2012.00200.x, 2012) |
chronic otitis media is characterized by a defect to the tympanic membrane, conductive hearing loss (or mixed hearing loss where the concurrent sensorineural component is involved), and permanent or periodical discharge from the ear. depending on the character of lesions to the middle ear mucous, different types of this abnormality are distinguished : simple chronic otitis media, chronic cholesteatoma otitis media, chronic granulomatous otitis media, and chronic otitis media associated with specific diseases. particularly notable is the occurrence of cholesteatoma and granulation tissue, which are characterized by a tendency to damage the bone tissue, implying the risk of otogenic intracranial and intratemporal complications (figure 1) [13 ]. the treatment of choice is surgery aimed at the elimination of abnormalities from the middle ear, the generation of dry and duly aired postoperative cavity, and hearing improvement. an important component of the methodology of surgical treatment consists in the preservation of the upper posterior wall of the external auditory meatus in order to protect the region of the middle ear from contacting the external environment. in the case of canal wall - down tympanoplasty, a search for methods enabling the reconstruction of the upper posterior wall of the external auditory meatus has been underway. the aim of non - invasive treatment in the course of chronic otitis media is to ensure supplementary treatment in the form of individually selected pharmacotherapy in order to obtain the so - called dry ear during the preoperative period or to eliminate the discharge from the ear occurring periodically in the aftermath of canal wall - down tympanoplasty. hearing improvement after otosurgery is measured by the degree of closure of the air - bone gap (the shift in air conduction threshold level compared to bone conduction threshold level) in pure tone audiometry (pta). attention is also paid to the shift in bone conduction threshold level after middle ear surgery. the above interrelationship is exemplified by the occurrence of the carhart sign in the patients operated on due to otosclerosis. that regularity is claimed to be due to the impact of the conductive mechanism of the middle ear on the function of the inner ear. the aim of the research is to define the determinants of hearing improvement in the patients with chronic otitis media in terms of abg (air - bone gap) closure and a change in bone conduction after surgery. the research consisted in a prospective analysis of the patients operated on due to the diseases of the middle ear during the period of 20092012. patients operated on for the first time due to chronic otitis media were considered for inclusion. a questionnaire was devised that described the conditions reported by the patient during the preoperative stage, the abnormalities observed in the middle ear during the surgery, the method applied to reconstruct the sound - conducting system in the middle ear, and the observations made during follow - up examinations. we distinguished between patients in whom the treatment had involved only myringoplasty and those in whom the reconstruction of the ossicular chain had also been required. the patients classified into the above groups were further divided into subgroups according to inner ear mucous abnormalities observed during surgery (table 1). hearing test was carried out immediately before surgery and at 6 and 12 months after otosurgery. the analysis pertained to the changes to abg and bone conduction thresholds expressed as the average values for the frequency of speech (500, 1000, 2000hz) for each group of patients with myringoplasty and ossiculoplasty. all the experiments reported in this manuscript were conducted in accordance with the recommendations of iasp and the nih guide for the care and use of laboratory animals and were reviewed and accepted by the local bioethics committee. in 20092012, 457 patients underwent otosurgery at the otolaryngology teaching hospital of collegium medicum, jagiellonian university. the youngest patient in, 293 patients were operated on due to chronic otitis media for the first time. there were 151 successive patients with myringoplasty and 142 patients in whom ossiculoplasty had been performed who met the inclusion criteria. the perichondrium was the most common material used for the reconstruction of the tympanic membrane. the perichondrium was strengthened with cartilage extracted from the tragus (figure 2.). distant results of the surgery were analyzed from the aspect of the change of the average bone conduction values between the groups. the assessment was made prior to the commencement of the treatment (time 0) and after 6 and 12 months of follow - up. the analysis of variance of the obtained results in relation to the passing of time was carried out with a view to determining whether the observed change of the average value of abg within each of the groups after 6 and 12 months of follow - up was statistically significant. the observation was concerned with the behavior of the average value of cochlear reserve within the particular groups (tables 2, 3). stands for the number of the analyzed group (110) sd gr. stands for the number of the analyzed group (110) within the control group (group 1), statistically significant changes of the average abg were not observed. the group had the fewest abnormalities of the middle ear, which resulted in the lack of any significant variations of the average value of cochlear reserves tested during the follow - up examinations. the follow - up after 6 and 12 months from otosurgery in group 2 revealed some statistically significant changes of the average value of abg (p=0.05). the average value of abg observed after 12 months was significantly lower than the average value of abg measured before the surgery and statistically equal to the average value of abg tested after 6 months from the surgery. the average value of abg after 6 months was significantly lower than the average value of abg prior to the commencement of the treatment. the patients in that group did not report discharge from the ear during preoperative examination ; however, due to the occurrence of other lesions within the region of the middle ear, the surgical treatment and its accompanying elimination of abnormalities to the middle ear mucous brought about significant hearing improvement, which was observed at 6- and 12-month follow - ups. in group 3, in which discharge from the ear reported during the preoperative period was the predominant symptom, the change of the average value of abg was statistically significant. an improvement (ie, a decrease in the average value of abg) was observed after 6 months, and that improved condition was retained after 12 months. the average value of abg measured after 6 months was statistically equal to the average value of abg after 12 months. the removal of adhesions from the tympanic cavity with undamaged ossicular chain in the patients from group 4 also yielded some statistically significant differences between the average values of abg observed during the successive follow - up examinations. the average value of abg measured after 6 months was statistically equal to the average value of abg after 12 months. the decrease in the average value of abg observed after 6 and 12 months testifies to the effectiveness of the treatment and the retention of improved hearing over a long follow - up period. in the patients without ossiculoplasty and with granulation tissue (group 5), statistically significant changes of the average value of abg were not observed during follow - up examinations. the above observation points to the fact that granulomatous lesions are likely to impede hearing improvement in the future, even if the continuity of the ossicular chain is preserved. statistically significant lesions testifying to the effectiveness of the treatment were observed within group 6. the average value of abg after 12 months was smaller than the average value of abg at the beginning of the treatment and statistically equal to the average value of abg after 6 months, while the average value of abg after 6 months was significantly smaller than the average value of abg at the beginning of the treatment. in accordance with the philosophy behind ossiculoplasty, the removal of cholesteatoma lesions and successive type 2 tympanoplasty yielded satisfactory results in the form of hearing improvement. in group 7, significant changes (i.e., the closure of the average value of abg) were not observed with the passing of time. the group comprised the patients with damage to the ossicular chain in whom abnormalities other than cholesteatoma occurred in the middle ear. in spite of reconstruction similar to the one performed in the patients with cholesteatoma (group 5), significant hearing improvement was not observed. in the patients classified as group 8, statistically significant changes of the average value of abg were not observed during follow - up examinations carried out after 6 and 12 months from the surgery. in group 9, significant change of the average value of abg was not observed, showing that hearing quality did not improve by 6 and 12 months after surgery. the results observed in the patients classified as groups 8 and 9 confirm unambiguously that a significant damage to the ossicular chain, with only the stapes (particularly the base) being preserved often implies that hearing quality does not improve after middle ear surgery. in these patients the priority for surgical treatment is in the radical elimination of lesions and obtaining dry ear. the use of a ventilation tube (group 10) to restore the continuity of the ossicular chain brought about a statistically significant change of the average value of abg (p=0.046) by 6 months after otosurgery, showing the utility of using that material as a porp in selected cases. a comparison of the results obtained 6 and 12 months after otosurgery did not reveal any significant changes, showing that the obtained degree of hearing improvement was retained at follow - up examinations. on the successive stage of hearing quality tests in patients who had undergone otosurgery, which consisted in an analysis of variance of the obtained results in reference to the passage of time, the question was whether the observed change of the average value of bone conduction within each of the groups after 6 and 12 months of follow - up was statistically significant. the observation was concerned with the behavior of the average value of bone conduction within each group (tables 4, 5). stands for the number of the analyzed group (110) sd gr. stands for the number of the analyzed group (110) within the control group (group 1), statistically significant changes of the average bone conduction were observed. the average value of bone conduction observed after 12 months was significantly lower than the average value of bone conduction measured before the surgery and statistically equal to the average value of bone conduction tested after 6 months from the surgery. the average value of bone conduction after 6 months was significantly lower than the average value of bone conduction prior to the commencement of the treatment. the follow - up at 6 and 12 months after otosurgery in group 2 did not reveal any statistically significant changes of the average value of bone conduction. the elimination of proliferative lesions from the middle ear mucous and the subsequent myringoplasty did not bring about significant changes of the average values of bone conduction tested at follow - up examinations. in group 3, in which discharge from the ear reported during the preoperative period was the predominant symptom, the change of the average value of bone conduction was statistically significant. an improvement (i.e., a decrease in the average value of bone conduction) was observed after 6 months, and that improved condition was retained after 12 months. the average value of bone conduction measured after 6 months was statistically equal to the average value of bone conduction after 12 months. the removal of adhesions from the tympanic cavity with undamaged ossicular chain in the patients from group 4 did not yield any statistically significant differences between the average values of bone conduction observed during the successive follow - up examinations. in the patients without ossiculoplasty and with granulation tissue (group 5), a statistically significant change of the average values of bone conduction was observed. in the groups in which damage to the ossicular chain occurred (groups 610), regardless of the method used to reconstruct the sound - conducting system in the middle ear, statistically significant changes to the value of bone conduction within the range of the frequency of speech the basic aim of the surgical treatment of conditions of the middle ear is to eliminate abnormalities from the mucous of the middle ear, which is followed by ensuring the function of the auditory tube, while the final stage is the reconstruction of the sound - conducting system in the middle ear. the above principles are fulfilled parallel to the attempts to preserve the upper posterior wall of the external auditory meatus to protect the region of the middle ear from direct contact with the external environment. the preservation of all the ossicles after the coexistent abnormalities of the tympanic membrane have been eliminated offers the optimum conditions for hearing improvement. this observation is in line with the reports from reference literature from across the world that a significant hearing improvement was observed in the majority of patients with the average abg closure below 20 db who underwent type 1 tympanoplasty. the observation of the behavior of the average values of abg in each of the groups confirmed that hearing quality had improved significantly in the patients from the groups without ossiculoplasty (including the control group), but also in the patients in whom it had been feasible to perform type ii tympanoplasty (the placing of the modelled incus on the normal stapes), and in those from group 10, where the ossicular chain had been reconstructed with the use of a porp (partial ossicular replacement prosthesis placed on the head of the stapes) [911 ]. according to information contained in reference literature, obtaining normal suprastructure of the stapes after abnormalities were removed, and the reconstruction of the ossicular chain by placing the patient s own modelled ossicle on the head of the stapes, results in hearing improvement in nearly a half of cases. the hearing improvement in the analyzed patients was significantly better in the group with cholesteatoma than in the cases of similar damage to the ossicular chain and the co - occurrence of other lesions on the mucous of the middle ear. this observation corresponds with the reports by other authors, especially in terms of the unfavorable effect of cholesteatoma - related lesions in the middle ear on the improvement of hearing quality. the tests carried out by vartiainen. showed that in the group of 181 patients who had undergone surgery due to chronic otitis media, the value of bone conduction did not change after the surgical treatment in 92%, while an improvement was observed in 5%, and deterioration in 3%. significant observations have been made with regard to patients with lesions on the mucous of the middle ear (advanced cholesteatoma) or damage to the ossicles. by affecting the mechanics of the ossicular chain, the above factors seem to have an indirect effect on the function of the inner ear. the veracity of that statement is shown by the case of bone conduction disorder in response to the ankylosis of the stapes in the course of otosclerosis described by carhart in 1958. attempts have also been made to explain bone conduction disorder as resulting from the toxic effect of mediators of inflammation in the middle ear on the function of the inner ear. it has been emphasized that biochemical changes to perilymph and endolymph are likely to result from the impact of the substances penetrating from the middle ear through the round window. a significant improvement of bone conduction was observed in patients from the group with dry perforation (group 1), without other lesions in the region of the middle ear. the scope of treatment applied to this group resulted in restoring most physiological relationships between the mechanics of the middle ear and the function of the inner ear. in the patients with permanent discharge from the ear in the preoperative period (group 3), the appropriate pharmacological treatment that preceded the reconstruction of the tympanic membrane and resulted in obtaining the dry ear brought about the same postoperative results in terms of bone conduction improvement as in group 1. it has also been reported that the lesions in the region of the round window have an adverse effect on bone conduction. an analysis of patients operated on at the otolaryngology teaching hospital of jagiellonian university s collegium medicum confirms that observation. in the group of patients with the occurrence of adhesions in the tympanic cavity, statistically significant improvement of bone conduction after otosurgery was not observed. the reason for the above observation may be a tendency to restrict the mobility of the ossicular chain as a consequence of even partial recurrence of adhesions after surgery. the highest risk of decreasing the value of bone conduction is observed in the case of adhesions in the niche of the round window. the elimination of granulation lesions was a positive factor for the future improvement of inner ear function. in such cases the surgery eliminated mucous abnormalities and the toxic effect of mediators of inflammation on inner ear function. however, hearing improvement manifesting itself in a change of the abg was not observed in this group, since hearing improvement assessed by postoperative tests was statistically insignificant. in analyzing factors that affect hearing improvement in patients who underwent myringoplasty, significantly better results were not observed only in the cases where granulation tissue was present in the tympanic cavity and the ossicular chain was not damaged. in the remaining groups without ossiculoplasty (without discharge, with discharge, and with adhesions), the observed hearing improvement (manifesting itself in abg closure) was statistically significant. the observations above are coincident with reports encountered in reference literature from across the world. the presence of granuloma - related lesions in the middle ear spaces is likely to impede the improvement of both air conduction and bone conduction. damage to the ossicular chain rules out the possibility of bone conduction improvement after surgery. the prognosis on tube - related simple chronic otitis media after myringoplasty, with the preserved continuity of the ossicular chain, consists of abg closure and leads to significant improvement in bone conduction. | backgroundmiddle ear surgery aims to eliminate pathology from the middle ear, improve drainage and ventilation of the postoperative cavity, and reconstruct the tympanic membrane and ossicles.the aim of this work is to define the factors that affect abg (air - bone gap) and bone conduction in the patients operated on due to chronic otitis media.material/methodsa prospective analysis of patients operated on due to diseases of the middle ear during 20092012 was carried out. the cases of patients operated on for the first time due to chronic otitis media were analyzed.the analysis encompassed patients who had undergone middle ear surgery. the patients were divided into several groups taking into account the abnormalities of the middle ear mucous and damage of the ossicular chain observed during otosurgery.resultsa significant hearing improvement was observed in patients with type 2 tympanoplasty in the course of chronic cholesteatoma otitis media and in patients with simple chronic inflammatory process in whom a porp was used in the reconstruction. granulation tissue was an unfavorable factor of hearing improvement following tympanoplasty.a significant improvement of bone conduction was observed in the patients with dry perforation without other lesions in the middle ear.the elimination of granulation lesions was a positive factor for the future improvement of the function of the inner ear.conclusionsthe presence of granuloma - related lesions in the middle ear spaces is likely to impede hearing improvement.damage to the ossicular chain rules out the possibility of bone conduction improvement after surgery.the prognosis on tube - related simple chronic otitis media after myringoplasty, with the preserved continuity of the ossicular chain, consists of closing the abg and leads to significant improvement of bone conduction. |
hypertension is associated with increased peripheral resistance, resulting predominantly from functional, structural, and mechanical alterations at the level of small - resistance arteries. functional alterations, which include an impaired endothelial function, are mainly assessed as an impaired acetylcholine - induced, endothelium - dependent relaxation. vascular structural changes include vascular remodeling, secondary to an increased cell growth, cell migration, and low - grade vascular inflammation [1, 2 ]. in particular, an increased media - to - lumen ratio (m / l) may result from a reduced outer diameter that narrows the lumen without net growth (eutrophic remodeling) or from a thicker media encroaching on the lumen (hypertrophic remodeling) [1, 2 ]. another hallmark of hypertension - induced structural abnormalities is represented by changes in the mechanical properties of arteries, with particular regard for increased stiffness. vascular fibrosis is critically important in the determinism of vascular structural modifications, and it involves changes in extracellular matrix (ecm) components, including collagen type i and iii, elastin, and fibronectin. an increase in collagen and fibronectin and a decrease in elastin contents have been shown in the media of small arteries from hypertensive animals [35 ]. it is widely accepted that angiotensin (ang) ii, traditionally involved in modulating blood pressure and electrolyte homeostasis, is also greatly implicated in the pathogenesis of endothelial dysfunction and vascular remodeling [68 ]. this concept is strengthened by the evidence that chronic at1 receptor blockade is able to correct the altered structure and endothelial dysfunction of subcutaneous resistance small vessels from patients with essential hypertension whereas the -receptor blockade has no effect, despite similar blood pressure lowering effect. major mechanisms whereby ang ii exerts vascular damage include generation of reactive oxygen species (ros) and stimulation of redox - dependent signalling pathways [6, 10, 11 ]. the present review will focus on major ang ii - induced vascular ros generation and on recent development of signalling pathways whereby ang ii - driven vascular ros induce and accelerate functional and structural vascular injury. ros are ubiquitous reactive derivatives of o2 metabolism found in the environment and in all biological systems. ros are implicated in many intracellular signaling pathways leading to changes in gene transcription and protein synthesis and consequently in cell function. within the cardiovascular system, ros play a crucial physiological role in maintaining cardiac and vascular integrity and a pathophysiological role in cardiovascular dysfunction associated with several clinical conditions, including hypertension [12, 13 ]. the most important ros detectable within the vasculature include the superoxide anion (o2), hydrogen peroxide (h2o2), hydroxyl radical (oh), and the reactive nitrogen species peroxynitrite (onoo), which have been regarded as a nasty, life - threatening, and destructive oxygen - derived toxicant. in healthy conditions, ros are produced in a controlled manner at low concentrations and function as signaling molecules regulating vascular contraction - relaxation and cell growth. physiologically, ros generation is tightly regulated by endogenous cellular antioxidants, which include superoxide dismutase (sod), catalase, thioredoxin, glutathione, and antioxidant vitamins. in physiological conditions, in contrast, under pathological conditions, such as hypertension, ros are produced in concentrations that can not be controlled by the usual protective antioxidant mechanisms employed by the cells, leading to a state of oxidative stress. indeed, when produced in excess, o2 reacts with nitric oxide (no) to produce a dramatic concentration of the toxic onoo which promotes a variety of negative effects on cellular function. these include alteration of transcription factors, kinases, protein synthesis, and redox - sensitive genes, which in turn influence endothelial function, increase vascular contractility, vascular smooth muscle cell growth and apoptosis, monocyte migration, lipid peroxidation, inflammation, and increased deposition of ecm proteins, all major processes deeply involved in the pathogenesis and progression of vascular damage in cardiovascular disease [15, 16 ]. vascular ros may be produced at the level of endothelial, as well as smooth muscle and adventitial cells, and can be generated by several enzymes. as concerns hypertension - related vascular disease, major sources of ros are xanthine oxidase, uncoupled endothelial no synthase, nad(p)h oxidase, and cyclooxygenase (cox). the role of cox in the ang ii - mediated oxidant excess will be described later. the xanthine oxidase system, detectable in the vascular endothelium, catalyses the oxidation of hypoxanthine and xanthine to form o2. major demonstrations of the role of xanthine oxidase - system concern the setting of ischemia - reperfusion injury and heart failure. nevertheless, some experimental reports also indicate an involvement of such complex in hypertension. in mesenteric small vessels from spontaneously hypertensive rats (shr), an enhanced activity of xanthine oxidase was documented. beyond its effect within the vascular wall, an active role of xanthine oxidase has been also documented in the kidney from shr or dahl salt - sensitive rats. usually, the xanthine oxidase enzymatic system is inhibited by allopurinol. of note, chronic allopurinol administration in shr, while abrogating the renal xanthine oxidase - related ros generation, failed to reduce blood pressure values, suggesting that, at least in such animal model of disease, the increased renal ros production is a mere consequence of hypertension rather than a pathogenetic factor. this concept is supported by the findings that in these animals chronic allopurinol intake is also associated with an amelioration of cardiac hypertrophy. endothelial nitric oxide synthase (enos), the enzymatic system constitutively delegated to produce no, can also generate ros in those conditions characterized by deficiency of the substrate arginine or the cofactor tetrahydrobiopterin (bh4). this process, which has been called nos uncoupling, implies that the physiological activity of the enzyme for no production is decreased and switched to the nos - dependent o2 generation. enos uncoupling has been documented in several pathological conditions, including diabetes, hyperhomocysteinemia, and hypertension. enos uncoupling has been demonstrated in doca salt - induced hypertensive mice. in this animal model, the critical step in this uncoupling seems to be oxidation of bh4 by onoo, reducing the bioavailability of this critical cofactor. the activity of enos uncoupling as ros source in hypertension is strengthened by human evidence in diabetic and hypertensive patients, where endothelial oxidant excess was dramatically reduced by administration of the precursor of bh4 [24, 25 ]. a large body of evidence indicated that nad(p)h oxidase represents the major source of ros in the vascular wall. the activation of such enzymatic system, which utilises nadh / nadph as electron donor to reduce molecular oxygen and generate o2, requires the assembly of cytosolic (p47phox, p67phox) and membrane - bound (gp91phox / nox1/nox4 and p22phox) subunits to form a functional enzyme complex. in the vasculature the nad(p)h oxidase complex is at least partly preassembled, as a significant proportion of nad(p)h oxidase subunits are colocalized intracellularly in endothelial cells. it is widely recognized that nad(p)h oxidase is the primary source of o2 in the vasculature, and it is functionally active either in the endothelium or in the media and adventitia as well. within the vascular wall, all the nad(p)h oxidase subunits are expressed, to varying degrees [15, 17 ]. a large body of evidence supports a crucial role for ros production, particularly from nad(p)h oxidase, in vascular injury which characterizes the hypertensive disease. ang ii represents one of the major vasoactive peptides, together with cytokines and growth factors, involved in the regulation and activation of nad(p)h oxidase. ang ii stimulates activation of nad(p)h oxidase, increases expression of nad(p)h oxidase subunits, and induces ros generation in vascular smooth muscle cells, endothelial cells, adventitial fibroblasts, and intact arteries as well [15, 26 ]. experimental reports documented that ang ii may exert such effects via at1 receptors. of note, ros may regulate at1 receptor gene expression, which in turn modulates ros generation, thus perpetuating a vicious circle. molecular mechanisms and signaling pathways whereby ang ii - derived nad(p)h oxidase activation leads to vascular cell oxidation are beyond the scope of this report and, therefore, the reader is directed to many excellent reviews focusing on these aspects [6, 17 ]. the strict crosstalk between ang ii and nad(p)h oxidase is confirmed by in vivo studies. thus, in ang ii - infused hypertensive rats, nad(p)h oxidase subunit expression and activity are increased, and administration of an nad(p)h oxidase inhibitor reduces vascular o2 generation [28, 29 ]. more recently, it was demonstrated that chronic administration of apocynin, a selective inhibitor of nad(p)h oxidase, prevents the increase in media - to - lumen ratio, an index of vascular remodeling, as well as endothelial dysfunction and collagen deposition at the level of mesenteric resistance arteries from ang ii - infused mice. these data suggest that activation of vascular nad(p)h oxidase plays an important role in vascular functional and structural changes that accompany development of hypertension in ang ii - infused mice. of note, in this study, apocynin, which, abolishing the ang ii - induced increase of vascular nad(p)h oxidase activity, was able to attenuate the systolic blood pressure rise induced by ang ii. these findings demonstrate that nad(p)h oxidase inhibition leads to blood pressure reduction in an ang ii - dependent hypertensive murine model and support the concept that nad(p)h oxidase - derived o2 plays a role in the ang ii - induced blood pressure elevation. it is worth noting that in this experimental condition, apocynin, while only partially reducing blood pressure, totally abolished the ang ii - mediated nad(p)h oxidase increased activity, thus suggesting that, at least in mice, redox - independent pathways also underlie ang ii - induced blood pressure elevation. these findings, obtained by pharmacological doses of exogenous ang ii, are supported by other reports assessing the role for the endogenous renin - angiotensin system in increasing ros production during hypertension. in the 2-kidney 1-clip model of renovascular hypertension (a model characterized by a high activation of the renin - angiotensin system), endothelial dysfunction was associated with an nad(p)h oxidase - derived increased o2 production, a condition which in part participates in blood pressure elevation in blood pressure. in salt - sensitive dahl rats, another animal model of hypertension characterized by activation of the local renin - angiotensin system, chronic administration with an ang ii receptor blocker dramatically reduced vascular o2 production. of note, in animal model of salt - sensitive hypertension, treatment with a gp91phox - containing nad(p)h oxidase inhibitor also prevented the increased vascular o2 production together with the expression of proinflammatory molecules, thus supporting the concept of a linkage between renin - angiotensin system, nad(p)h oxidase activity, and vascular inflammation. importantly, the deleterious effect by ang ii - derived nad(p)h oxidase activity on vasculature is not dependent on blood pressure elevation. indeed, it was documented that in an animal model of ang ii - hypertension, production of h2o2, while essential for ang ii - mediated vascular changes, had no significant impact on blood pressure. there is also evidence for ros involvement in the hypertension - related vascular disease independent of ang ii actions. indeed, it has been suggested that endothelin-1 (et-1) is implicated in the development of vascular changes through the ros generation via nad(p)h oxidase activation. interestingly, the et-1-mediated enhanced ros production can affect vascular structure and function independently of blood pressure modifications. direct infusion of et-1 can increase nad(p)h oxidase - dependent o2 production, which is not significantly related to the development of hypertension. recently, an animal model of transgenic mice overexpressing human preproet-1 gene specifically in blood vessel endothelium was generated. this is an useful model to investigate the role of endothelium - generated et-1 on the endothelial function and vascular structure of small resistance arteries. these animals exhibited 3-fold higher vascular tissue et-1 mrna and 7-fold higher et-1 plasma levels than did wild - type mice but no significant elevation in blood pressure. despite the absence of significant blood pressure elevation, transgenic mice exhibited marked hypertrophic remodeling and oxidant excess - dependent endothelial dysfunction of resistance vessels, altered et-1 and et-3 vascular responses, and significant increases in etb expression compared with wild - type littermates. moreover, transgenic mice generated significantly higher oxidative stress, possibly through increased activity and expression of vascular nad(p)h oxidase. using a transgenic approach, these findings represent the demonstration that endothelium - secreted human et-1 induces vascular remodeling and endothelial dysfunction in the absence of significant increases in blood pressure, as also evidenced above for ang ii actions. in conclusions, these data unambiguously underscore the concept that ang ii exerts several pleiotropic deleterious vascular effects, including functional and structural changes, through nad(p)h oxidase - derived ros generation, an effect which does not necessarily occur as a consequence of blood pressure elevation. in the last decade, a growing literature provided evidence that a major pathway involved in vascular disease is cyclooxygenase (cox) activity. indeed, cox metabolizes arachidonic acid from membrane - bound phospholipids into the unstable intermediate pgh2, which, in turn, is converted by an array of downstream enzymes to form a variety of bioactive prostaglandins (pgs) and thromboxane (tx) a2, collectively termed prostanoids. these have been considered autacoids mediating a variety of responses in the cardiovascular system, including modulation of vascular tone and structure and inflammatory responses. under physiological conditions, prostacyclin (pgi2) is the major prostanoid identified and released by endothelial cells mediating several protective effects on the vascular wall, including relaxation and inhibition of platelet aggregation and adhesion. the predominant opponent of pgi2 is txa2, specifically acting on thromboxane - prostanoid (tp) receptors mainly located on smooth muscle cells where it causes vasoconstriction. under pathological conditions, such as inflammation or atherosclerosis, the pgi2 production decreases, and cox - derived vasoconstrictor substance release, including txa2, although cox-1 is constitutively expressed to produce physiologically relevant prostanoids, cox-2 is regarded as an inducible isoform, which can be rapidly upregulated by a number of stimuli, a direct interaction between ang ii and the cox pathway has been described. thus, a direct interaction between ang ii and cox-2 pathway was documented in in vitro studies, either in vascular smooth muscles (vsmcs) or endothelial cells. ohnaka. observed that ang ii dose - dependently increased the expression of cox-2 mrna in cultured rat vsmcs. this effect was totally abolished by the at1 receptor antagonist losartan, by the mitogen - activated protein kinase (mapk) kinase-1 inhibitor, and by the p38 mapk inhibitor. a similar possibility was hypothesized by young., who documented that a cox-2-derived prostanoid, possibly txa2, may contribute to vsmc hyperplasia in rat aortic injury or pathophysiological conditions associated with elevated levels of tnf- or ang ii. in this study, the activation of map kinase was confirmed to be implicated as a signaling pathway for cox-2 gene transcription and proliferative response of vsmcs to ang ii. an increased cox-2 expression secondary to ang ii incubation these in vitro animal and human reports provide evidence that ang ii - mediated activation of at1 receptors plays a crucial role in triggering multiple biological responses in vsmcs, including cell growth and proliferation, via increased cox-2 expression. the relationship between ang ii and cox-2 ii - induced hypertension, it was demonstrated that ang ii - mediated vascular lesions were associated with increased expression of cox-2 in the media of coronary arteries. however, these findings were not confirmed when the interaction between ang ii and cox-2 were investigated in mren2 rats, a transgenic animal model of hypertension characterized by ang ii - induced vascular and tissue injury. in such animals, the authors explored whether cox - derived prostanoids were involved in the pathogenesis of ang ii - induced vascular injury, in myocardium and kidney. the main finding of this report was that neither nonselective cox inhibitor nor the cox-2 selective blocker was able to prevent ang ii - induced vascular and tissue damage. therefore, these results seem to exclude, at least in this particular transgenic animal model, a central role by cox in the pathogenesis of ang ii - induced vascular or end - organ damage. of note, the interpretation of these findings deserve caution if we consider that this particular transgenic animal model does not reproduce physiological conditions. nevertheless, when ang ii and cox interaction is investigated in resistance arteries, in more physiological conditions, a pivotal role of cox-1 on ang ii - mediated vascular changes, instead of cox-2, emerged. thus, we documented that in mesenteric small vessels from ang ii - infused mice, cox-1 inhibition as well as tp receptor antagonist similarly improved the blunted endothelium - dependent relaxation to acetylcholine while cox-2 inhibition was ineffective. in addition, a cox-2 downregulation and a simultaneous induction of cox-1 expression and staining in ang ii - vessels were detected. concomitantly, the nad(p)h oxidase apocynin, while normalizing endothelial function, failed to modify the cox-2 downregulation and cox-1 upregulation. overall, these results demonstrate the participation of cox-1 isoenzyme in the development of functional alterations of resistance arteries from ang ii - infused mice. as summarized in figure 1, it was proposed that ang ii is associated to cox-1 overexpression and cox-2 downregulation while ang ii - mediated ros production stimulates cox-1 activity, but not overexpression, to produce a contracting prostanoid, acting as an agonist on tp receptors. of note, in this report cox-1 blockade improved only in part the ang ii - induced endothelial dysfunction, thus confirming the presence of a residual direct and specific cox-1-independent effect of ang ii on the vascular wall. ang ii plays also a crucial role in inducing mechanical changes of arteries, with particular regard for increased stiffness, and in determining changes in ecm components within the vascular wall [35, 47 ]. indeed, an increased collagen and fibronectin depositions, together with a decreased elastin content, have been described in the media of small arteries from ang ii - infused animals [4, 5, 47 ]. in this context, experimental observations strongly suggest a predominant role of cox-1-derived activators of tp receptors in the development / progression of vascular atherosclerosis. therefore, a direct interaction between ang ii and cox-1 pathway can be hypothesized as one of the mechanisms whereby ang ii induces vascular structural changes. in a very recent report, this possibility has been investigated in our laboratory, by utilizing two different experimental methodologies, such as the employment of selective cox isoforms inhibitors, chronically administered to ang ii - treated mice, and the utilization of homozygous mice carrying a targeted disruption of cox-1 gene. in murine mesenteric small vessels, we documented that ang ii - induced hypertrophic remodeling and arterial stiffness were partly reduced by chronic administration of cox-1 selective inhibitor sc-560, or by the tp receptor blockade, while not being affected by the cox-2 inhibitor dfu, thus indicating that cox-1, but not cox-2, contributes to the pathogenesis of vascular structural and mechanical changes elicited by ang ii. these findings, obtained by a pharmacological approach, were strongly substantiated by results from cox-1-ko mice, in which ang ii failed to elicit vascular remodeling or mechanical changes. in the same context, a significant role of the cox-1 pathway in ang ii - induced vascular ecm changes emerged. indeed, the enhanced deposition of collagen and fibronectin was reduced by sc-560 and, to a similar extent, by the tp receptor antagonist, while not affected by dfu. in parallel, the vascular content of elastin was completely restored by cox-1 and tp receptor blockade, while not being ameliorated by cox-2 inhibition. in vessels from cox-1 mice, collagen, fibronectin, and elastin contents did not differ from wild type, and they were not modified by ang ii. overall, these findings unequivocally support a relevant role of cox-1-dependent tp receptor activation in the development of ang ii - induced hypertrophic vascular remodeling, changes in mechanics and ecm components, leading to vascular fibrosis. in conclusions, although a strict interaction between ang ii and the cox pathway in the pathogenesis of vascular injury is well established, the pivotal role of cox-1 or cox-2 isoforms may differ and predominate according to the experimental settings and the vascular districts considered. there is also the possibility that in several vascular beds a cox-1/cox-2 compensatory phenomenon occurs as a consequence of ang ii stimulation, leading to different patterns of prostanoid formation. of course, the heterogeneous experimental models, including both the variety of cells stimulated and the different conditions in which ang ii is applied, contribute to complicate the picture. for these reasons, further experimental and clinical studies examining the interaction between the renin - angiotensin system and cox pathway are warranted. ros, including superoxide, hydrogen peroxide, and hydroxyl anion, and reactive nitrogen species, are the most important o2 derivates, which play an active role in vascular biology. ros are generated within the vascular wall, at the level of endothelial and vascular smooth muscle cells, as well as by adventitial fibroblasts. in healthy conditions, ros are produced in a controlled manner at low concentrations and function as signaling molecules regulating vascular contraction - relaxation and cell growth. physiologically, the rate of ros generation is counterbalanced by the rate of elimination. under pathological conditions, the ros generation excess can not be controlled by the usual protective antioxidant mechanisms, leading to a state of oxidative stress. a large body of evidence supports a crucial role for ros production, particularly from nad(p)h oxidase, in vascular injury which characterizes the hypertensive disease. ang ii represents one of the major vasoactive peptides involved in the regulation and activation of nad(p)h oxidase. ang ii stimulates activation of nad(p)h oxidase, increases expression of nad(p)h oxidase subunits, and induces ros generation in vascular smooth muscle cells, endothelial cells, and adventitial fibroblasts. a large body of evidence from experimental and clinical studies unequivocally demonstrated that ang ii exerts several pleiotropic deleterious vascular effects, including functional and structural changes, through nad(p)h oxidase - derived ros generation. more recently, it was proposed that at the level of peripheral resistance arteries, ang ii - mediated ros production stimulates cox-1 activity, to produce contracting prostanoids(s), acting as agonists on tp receptors. such mechanism likely contributes to the endothelial dysfunction and vascular atherosclerotic damage elicited by ang ii. | reactive oxygen species are oxygen derivates and play an active role in vascular biology. these compounds are generated within the vascular wall, at the level of endothelial and vascular smooth muscle cells, as well as by adventitial fibroblasts. in healthy conditions, ros are produced in a controlled manner at low concentrations and function as signaling molecules regulating vascular contraction - relaxation and cell growth. physiologically, the rate of ros generation is counterbalanced by the rate of elimination. in hypertension, an enhanced ros generation occurs, which is not counterbalanced by the endogenous antioxidant mechanisms, leading to a state of oxidative stress. in the present paper, major angiotensin ii - induced vascular ros generation within the vasculature, and relative sources, will be discussed. recent development of signalling pathways whereby angiotensin ii - driven vascular ros induce and accelerate functional and structural vascular injury will be also considered. |
the income, prestige, and authority of doctors in most western countries reflects their omnipotence amongst health care professionals and their power within our society. however, concurrent with the increasing number of women entering medicine, there has been a recent decrease in that power. for example, a significant proportion of female family physicians reports being sexually harassed by male patients. sexual harassment is an abusive behaviour perpetrated by those with power on the more vulnerable. the victimization of female doctors could only occur if the offending male patients saw their physicians as vulnerable women rather than powerful professionals, that is, if gender rather than professional role was the primary determinant of power in the relationship. if female physicians are " women first " in the eyes of some male patients, do their overwhelmingly female nurse colleagues also view them through a gender lens ? how will the increasing percentage of women in medicine change professional relationships between doctors and nurses ? this study examines whether the traditional authority of doctors over nurses is eroded when that authority arises solely from profession and not from gender. historically both the gendered role of nursing and the sex of nurses was almost exclusively female. the profession primarily attracted working class or immigrant women whose background fostered unquestioning obedience to authority. the " doctor nurse " game described by stein (1967) indicated that despite the passage of time, roles had not changed substantially. by showing initiative and making important recommendations, while appearing to defer passively to the doctor 's authority stein revisited the nurse - doctor game in 1990 and argued that nurses had unilaterally decided to stop playing. the change was, in part, attributed to an increasing number of female physicians and male nurses, both of whom were unable to play. nurses ' recent overt refusal to be dominated by physicians is also a reflection of the decrease in power differentials between men and women in western society at large. in contrast to nursing, the gender role and the practitioners of medicine one hundred years ago were male. many nurses and physicians still overtly and covertly resist the equalization of power that true teamwork requires. salvage and smith argue that while assertive nurses resent being put down by doctors, physicians resent being challenged by nurses. obstacles to collaboration include gendered thinking, different styles of learning, models of working, regulatory mechanisms, role ambiguity, and incongruent expectations. nurses generally experience greater satisfaction when communicating with female rather than male physicians and prefer a female managerial style. nurses doubt that physicians ' sex affects their behaviour, although some admit anger or disappointment when female physicians do not exceed the standards nurses set for male physicians. they deny any sexual chemistry that favours male physicians, despite the female doctors ' impression to the contrary. some female nurses describe female doctors in stereotypic terms such as " demanding ", " domineering ", and " bitchy ". female physicians, on the other hand, resent both having to make extra efforts to be nice to nurses, and devising conscious strategies to cultivate egalitarianism and friendship. more than 80% feel that at some time in their careers they have experienced unequal treatment, more intense scrutiny, or a lack of respect from nurses because they (the doctors) were female. a recent norwegian study examined the physician 's perspective on what happens to the doctor - nurse relationship when both are women. both male and female physicians thought the relationship was influenced by the doctor 's gender. female doctors perceived that they received less respect or help than did their male colleagues. the physicians interpreted this in two ways, thinking that either nurses ' wishes to reduce status differences between nurses and physicians affect female doctors more than male, or that there is an " erotic game " taking place between male doctors and female nurses. hypothesizing that the sex of the physician could affect nurses ' behaviour, we examined differences in the interaction between female nurses and female and male physicians. a self selected population of nurses working in an urban, university based hospital was asked to complete one of two forms of a three page questionnaire in jan. 2000. the questionnaire included four clinical vignettes reflecting some previously identified areas of strain in the doctor nurse relationship. in form 1 of the questionnaire the physicians described were female, male, female, and male. in form 2 participants were asked five point likert type questions about nurse physician interactions, their expectations, probable actions, and feelings about the physicians. the questionnaire was pre - tested amongst a small group of hospital nurses to assess face and content validity. letters explaining that the accompanying study 's aim was to examine teamwork in a hospital setting, that participation was voluntary, and that responses would be confidential were left at all patient care planning areas (nursing desks) of the hospital. all surveys left at a specific patient care planning area were of the same form. nurses were asked to return questionnaires, whether completed or not, to an identified collection envelope, and to complete only one questionnaire. following the final collection date, letters explaining that responses to the two forms of the questionnaire would be compared to identify differences in interactions between nurses and physicians based on the doctor 's sex, and describing the " nurse - doctor game " were distributed. the analysis compared the responses to each question based on the sex of the physician in the particular vignette (ie responses to form 1 and form 2 of the questionnaire). pearson chi - square analysis was used to test for statistical significance (p < 0.05). of the three hundred surveys printed, 265 were taken, 197 were returned completed, 2 were returned with no responses, and 66 were not returned. the overall response was 74% (199 of 265 taken) and included approximately 22% of the 900 nurses employed by the hospital. the inpatient nursing specialties were broadly represented amongst the 95% (n = 177) who indicated they were female, the 5% (n = 9) who were male, and the 11 respondents who did not specify. based on the overall sex ratio of respondents these 11 were assumed to be female and included in the analysis.. responses from men were excluded, leaving 188 surveys for inclusion (95 surveys of form 1 and 93 of form 2). in the first vignette a physician leaves a suture tray with needles at the bedside, despite a department policy assigning cleanup responsibility to the user of any " sharps ". female nurses expected physicians of either sex, to dispose of the needles (85.3% female physician, 86.0% male physician, p = 0.97) but were significantly less likely to remove the needles for female physicians (p < 0.05). nurses expectations of, and conflicts with physicians varied by sex. those surveyed were more likely to feel indifferent about a male physician, and negative about a female physician when the nurse ultimately removed the needles herself (p < 0.01). in vignette two, the nurse was interrupted while checking a patient 's vital signs and asked to do the same check on the doctor 's patient. nurses were equally unlikely to immediately stop and help a female or male physician (p = 0.69). however assertive requests by physicians were more likely to be acted upon if the physician were male (p < 0.03) despite near universal resentment of this aggression (80% toward females, and 77% toward males, p = 0.89). when physician requests for help were polite, nurses felt positive toward both male and female physicians (68.5% toward females, and 65.1% toward males, p = 0.33) but, as in vignette 1, were less likely to help the female physician (p = 0.17). the nurse wonders if the physician remembers that the mother received meperidine (a medication that could depress the baby 's breathing and that could be reversed by giving the baby naloxone) two hours previously. nurses were more likely to suggest to the physician that the newborn needed naloxone, (99% were likely or very likely to suggest to female physicians and 97.8% for male physicians, p = 0.24), than they were to tell the physician that the newborn needed naloxone (31.8% were likely or very likely to tell a female physician and 26.1% for a male physician, p = 0.21). again, though not statistically significant in this case, there was a trend for nurses to be more forward with female doctors. they were less likely to wait for a female doctor to make her own decision about giving naloxone (p = 0.15), and more likely to suggest (p = 0.21) or tell (p = 0.20) the female doctor to give the medication. nurses also expected female doctors would respond more positively to their suggestions (p < 0.04). in the final vignette a doctor on call has just gone to sleep in her / his call room. nurses were asked if they would call the physician for an acetaminophen (an analgesic) order. there was, however, a consistent and contrary trend to that observed in the other scenarios. nurses were less likely to call a female physician than a male, regardless of whether the physician had given the nurse a complement earlier in the day (p = 0.24), or had been rude earlier on (p = 0.63). nurses were more likely to feel that a male physician 's anger was inappropriate (p = 0.39). they were less comfortable approaching a female doctor to discuss her anger (p = 0.38). in this vignette our findings suggest, however, that the process of, and feelings around nurse physician interactions are informed by gender stereotypes. in addition to professional hierarchy, gender appears to account for physicians ' perceived power over nurses. although physicians may well reinforce these same stereotypes this study did not examine their beliefs. overall, nurses ' behaviour was influenced by the sex of the physician. in vignette 1, those surveyed expected both male and female physicians to remove needles left on a suture tray. they were, however, more willing to clean up after male physicians, and to do so with indifference rather than with the hostility they directed toward female doctors. findings that nurses are statistically less likely to remove needles for female doctors, and to feel somewhat more resentful toward female doctors for whom they have cleaned up, speaks to the primacy of sex over hierarchy in defining the doctor nurse relationship. perhaps nurses feel role confusion because female physicians do not fit into their learned male stereotypes, and instead better fit into traditionally female roles such as " cleaner ". these results corroborate pringle 's subjective findings that nurses do more for male physicians and expect more of female physicians. that nurses were unlikely to drop everything to assist either a male or female physician take a blood pressure is consistent with the increasing autonomy of the nursing profession. assertive physician requests met with resistance from these increasingly confident nurses who commented, " many times doctors feel they have the right to interrupt with little to no consideration for the rns. they feel their job is more important ! " and, " she is perfectly capable of doing vital signs. " pleasant requests for nursing help were more effective. again, however, sex role stereotypes appeared to enter the relationship as nurses accepted aggressive male behaviour and acquiesced more readily to male requests for help. responses to the third scenario suggest that the ' doctor - nurse game ' is alive and well. nurses deferred to the physicians ' status despite knowing what was medically necessary, and would suggest, but not dictate, treatment for the unresponsive baby. as one respondent wrote, " i would be more likely to phrase it in a way that would make him feel in control. " nevertheless, there was again more deference to the authority of male doctors. in the final vignette, respondents showed a non - significant trend toward a more kindly association with female than male physicians. at first this this vignette, however was the only one of the four requiring a nurse to initiate, rather than respond to an action. perhaps nurses are hostile and reactive to female physicians in situations where their expectations (often based on sex stereotypes) are not met, such as when women fail to clean up after themselves. however, when the nurse is in control, her less hierarchical relationship with another female, despite the power differential of profession, may foster collegiality. when doctors and nurses are both female, elimination of the power differential of gender diminishes nurses ' perceptions of professional power inequalities. as a result, female nurses appear more comfortable approaching and communicating with female doctors, but are also more hostile toward female physicians ' use of medical authority. these paradoxical behaviours will confuse female physicians if they view themselves as doctors first, rather than as women, and expect nurses to interact with all physicians equally. as females these same physicians may anticipate appreciation for their increased collaboration and egalitarianism, and not understand the nurses ' confusion at the lack of traditional professional hierarchy. perhaps the perception that female physicians are more caring and compassionate than their male counterparts creates conflicts with nurses, who define caring as their function, and may feel their role in health care delivery is threatened by women physicians. in general, the nurses surveyed said they would resist being controlled by physicians. this decrease in the power of medicine over nursing is concurrent with an increase in the number of women physicians in north america. although the feminization of medicine could diminish the power and prestige of all physicians within the health care system, our findings suggest that nurses are more resistant to domination by female, rather than male doctors. changes in power differentials between medicine and nursing appear to be shaped by gender, suggesting that the traditional omnipotence of physicians in the health care hierarchy arose from gender roles, and not solely from profession. written responses may define socially desirable values rather than actual behaviours in clinical situations, however the hostility toward physicians expressed in many of the nurses ' written comments (not reported here) mitigates against this concern. because the study was limited to hospital nurses and the scenarios were hospital based as with any study in which participants are self - selected rather than randomly surveyed, selection bias is possible. our relatively high response rate (74%) minimizes, but does not preclude this limitation. written responses may define socially desirable values rather than actual behaviours in clinical situations, however the hostility toward physicians expressed in many of the nurses ' written comments (not reported here) mitigates against this concern. because the study was limited to hospital nurses and the scenarios were hospital based as with any study in which participants are self - selected rather than randomly surveyed, selection bias is possible. our relatively high response rate (74%) minimizes, but does not preclude this limitation. historically, the power held by a predominantly male medical profession may have arisen primarily from gender rather than from hierarchical position. current relationships between doctors and nurses appear to be shaped by gender as well as by profession. when nurses and doctors are female the traditional power imbalance between the two diminishes. the effects of this change on the authority of the medical profession, the role of nurses, and on patient care remain undefined. | backgroundthe nurse - doctor relationship is historically one of female nurse deference to male physician authority. we investigated the effects of physicians ' sex on female nurses ' behaviour.methodsnurses at an urban, university based hospital completed one of two forms of a vignette - based survey in january, 2000. each survey included four clinical scenarios. in form 1 of the questionnaire the physicians described were female, male, female, and male. in form 2, vignettes were identical but the physician sex was changed to male, female, male, and female. differences in responses to questions based on the sex of the physician in each vignette were studiedresults199 self - selected nurses completed the survey. the responses of 177 female respondents and 11 respondents who did not specifiy their sex, and were assumed to be female based on the overall sex ratio of respondents, were analysed. persistent sex - role stereotypes influenced the relationship between female nurses and physicians. nurses were more willing to serve and defer to male physicians. they approached female physicians on a more egalitarian basis, were more comfortable communicating with them, yet more hostile toward them.conclusionwhen nurses and doctors are female, traditional power imbalances in their relationship diminish, suggesting that these imbalances are based as much on gender as on professional hierarchy. the effects of this change on the authority of the medical profession, the role of nurses, and on patient care merit further exploration. |
the data sources for this study include the u.s. census bureau (6) and the search study (2,3,711). population by ages (0, 1, 2,,19 years), race / ethnicity (nhw, non - hispanic black [nhb ], hispanic, asian and pacific islander [api ], american indian / alaska native [aian ]), and sex, as well as projection estimates of births, deaths, and net migration by the same dimensions for the years 20022050. for each of these components of population change fertility, mortality and net migration we used the series using the middle assumption for each of these components, also designated as the middle series. search data include diabetes prevalence in 2001 and incidence from 2002 to 2007 collected from geographically defined populations in ohio, colorado, south carolina, and washington, as well as indian health service beneficiaries from four american indian populations, and enrollees in managed health care plans in california and hawaii. search is a multicenter study that began in 2001 and is conducting population - based ascertainment of youth aged 9%) than nhw youth (31). minority youth with t1 dm are also more likely to live in households with low income and parental education (711). this in turn may affect their access to and quality of health care (32,33). because of the changing demographics of the youth population with t1 dm, health care policies and delivery systems need to assure that less advantaged youth receive appropriate care. our projections indicate a serious picture of the future national diabetes burden in youth. even if the incidence remains at 2002 levels, because of the population growth projected by the u.s. census the future numbers of youth with diabetes is projected to increase, resulting in increased health care needs and costs. future planning should include strategies for implementing childhood obesity prevention programs and primary prevention programs for youth at risk for developing t2 dm. likewise, to prevent future human suffering and health care costs, effective interventions for the prevention of diabetes - related complications should be available to all youth with diabetes (34). at the same time, it is crucial to continuously monitor diabetes trends at the population level, as well as complications and quality of care among youth. | objectiveto forecast the number of u.s. individuals aged < 20 years with type 1 diabetes mellitus (t1 dm) or type 2 diabetes mellitus (t2 dm) through 2050, accounting for changing demography and diabetes incidence.research design and methodswe used markov modeling framework to generate yearly forecasts of the number of individuals in each of three states (diabetes, no diabetes, and death). we used 2001 prevalence and 2002 incidence of t1 dm and t2 dm from the search for diabetes in youth study and u.s. census bureau population demographic projections. two scenarios were considered for t1 dm and t2 dm incidence : 1) constant incidence over time ; 2) for t1 dm yearly percentage increases of 3.5, 2.2, 1.8, and 2.1% by age - groups 04 years, 59 years, 1014 years, and 1519 years, respectively, and for t2 dm a yearly 2.3% increase across all ages.resultsunder scenario 1, the projected number of youth with t1 dm rises from 166,018 to 203,382 and with t2 dm from 20,203 to 30,111, respectively, in 2010 and 2050. under scenario 2, the number of youth with t1 dm nearly triples from 179,388 in 2010 to 587,488 in 2050 (prevalence 2.13/1,000 and 5.20/1,000 [+ 144% increase ]), with the greatest increase in youth of minority racial / ethnic groups. the number of youth with t2 dm almost quadruples from 22,820 in 2010 to 84,131 in 2050 ; prevalence increases from 0.27/1,000 to 0.75/1,000 (+ 178% increase).conclusionsa linear increase in diabetes incidence could result in a substantial increase in the number of youth with t1 dm and t2 dm over the next 40 years, especially those of minority race / ethnicity. |
myelodysplastic syndromes (mds) describe a heterogeneous group of malignant hematopoietic stem cell disorders which characterized by dysplastic and ineffective blood cell production and a variable risk of transformation to acute leukemia. because of a variable reduction in production of normal blood cells, a variety of systemic consequences including anemia, bleeding, and an increased risk of infection may occur. there are some case reports and series indicating the association of mds with inflammatory arthritis or vasculitis syndromes. in some cases, patients with inflammatory arthritis and cytopenia are often diagnosed with sle, ra (felty 's syndrome) or sarcoidosis, but clinician should remember that it may be a combination of inflammatory arthritis and mds. from jan 2013 to may 2014, eighty consecutive patients with mds were referred by a hematologist to the rheumatology clinic in sari, northern iran. the diagnosis of mds and its subtypes was confirmed by study of peripheral blood smear (pbs) and bone marrow aspiration. all patients with unexplained cytopenia including monocytopenia, bicytopenia or pancytopenia in initial evaluation underwent bone marrow aspiration ; biopsy and iron staining for ringed sideroblasts. patients with unexplained morphologic features of dysplasia in blood and marrow were included in the study. the subtypes of mds are refractory cytopenia with unilinage dysplasia refractory anemia with ring sideroblasts(rars), refractory cytopenia with multilinage dysplasia (rcmd), refractory anemia with excess blast (raeb), mds with isolated del(5q) and mds unclassified. patients ' information including age, gender, and history of systemic disorders, disease duration and subtype of mds were recorded. a rheumatologist evaluated the patients by history (for joint symptoms, skin rashes, and family and drug history) and physical examination for inflammatory rheumatic diseases including rheumatoid arthritis (ra), systemic lupus erythematosus (sle) and vasculitis syndromes. patients who had any signs or symptoms for inflammatory arthritis were evaluated by laboratory tests. patients with and without inflammatory rheumatic disorders were compared for their hematologic and basic characteristics by t - test and chi - square test with spss v (20) package. this cross sectional study surveyed the characteristics of inflammatory arthritis in patients with mds in hematology and rheumatology clinics in sari, iran. thirty - six (45%) of 80 patients enrolled in the study were females. systemic or metabolic disorders included diabetes mellitus, hyperlipidemia, hypothyroidism, renal failure in 10(12.5%), 16(20%), 16(20%), 10(12.5%) of participants, respectively. the subtypes of mds included rc in 28 (35%), rars in 1(1.3%), rcmd in 47(58.8%), raeb1 in 3 (3.8%) and raeb2 in 1(1.3%). the subtypes of mds in these patients included rc in 4(44.4%), rcmd in 4(44.4%) and raeb1 in 1(11.1%). no significant difference was found in hematologic parameters including white blood cell count (wbc), hemoglobin (hg), red blood cell count (rbc) and platelet count between the two groups (p>0.05). various types of inflammatory rheumatologic disorders may be associated with mds (table 1). characteristics of mds patients with inflammatory rheumatologic disorder rcmd : refractory cytopenia with multilinage dysplasia, rc : refractory cytopenia, raeb 1 : refractory anemia with excess blast 1. demographic data and underling disease in mds patients with and without rheumatologic disorders the co - existence of mds and rheumatologic disorders was shown in 11.3% of patients. several reports showed that about 10% of mds patients have clinical autoimmune disorders such as skin vasculitis and rheumatic disease or autoimmune hemolytic anemia. george., and mendez., reported the association of mds with inflammatory arthritis in 8 of 28(28.5%) patients and 3 of 55 patients(5.4%), respectively. but in a recent study conducted by mekinian, 22 patients with mds were evaluated for inflammatory arthritis and polyarthritis was diagnosed in 17(77%) cases. inflammatory arthritis was recorded between 5.4 and 77% in patients with mds. there are some kinds of immunological abnormalities in patients with mds, including defective b- and t - cell function, hyper or hypogammaglobulinemia and monoclonal gammopathy. positive antinuclear antibody and positive direct coombs test or inverted cd4/8 ratios were found in 1865% of patients with mds (12, 13). considering the unavailability of cytogenetic study in our center, we suggest future surveys on the association of rheumatologic disorders in mds patients with different kinds of cytogenetic anomalies. the findings of this study indicate that rheumatologic manifestations may be present in mds patients. | abstractbackgroundthe aim of this study was to determine the prevalence and characteristics of rheumatologic manifestations associated with mds.methods:eighty patients with mds were evaluated by history and physical examination for inflammatory rheumatologic disorders from jan 2013 to may 2014. patients who had any signs or symptoms of rheumatologic disorders underwent evaluation by laboratory tests. patients with and without inflammatory rheumatic disorders were compared for their characteristics.results:of 80 participants with mds, 9 (11.3%) patients were diagnosed as having rheumatic disorders. mds patients with or without rheumatologic disorder were similar in demographic and hematologic parameters, except age which was lower in patients with rheumatologic disorders. (p=0.016). in younger patients, refractory cytopenia and refractory cytopenia with multilinage dysplasia were more prevalent.conclusion:the findings of this study indicate that rheumatologic manifestations may be present in mds patients. younger patients are more prone to the occurrence of mds and rheumatic disorders. |
a 4-year - old neutered male labrador retriever presented to the washington state university veterinary teaching hospital neurology service following an acute worsening of thoracolumbar pain. the dog had previously been diagnosed with diskospondylitis via radiography by a referring veterinarian and had not responded to a course of enrofloxacin, carprofen, and tramadol. thoracic, abdominal, pelvic, and stifle radiographs performed by the referring veterinarian showed no obvious lesions other than diskospondylitis. the dog also developed a mild right - sided head tilt 4 months prior to the presentation. neurologic examination revealed severe pain on spinal palpation in the thoracolumbar area along with severe epaxial muscle atrophy. the dog had a short, stiff - strided gait in the pelvic limbs and a root signature sign in the left pelvic limb. neuroanatomic localization was in two separate areas : thoracolumbar spine due to pain and right peripheral vestibular. a complete blood count, chemistry panel, urinalysis, urine culture, and blood culture were performed. biochemical abnormalities noted were a mildly increased total protein level (reference range) at 7.8 g / dl (5.67.6 g / dl) and an increased globulin level at 4.8 g / dl (2.73.8 g / dl). the blood fungal culture isolated an organism that was initially identified as a penicillium species, but was furthered characterized as geosmithia argillacea using dna sequencing. no susceptibility testing was performed at this time due to cost concerns of the client. spinal digital radiography was performed using a digital radiography system (canon cxdi-50 g digital radiography system ; canon usa, irvine, ca). left lateral and ventrodorsal views of the thoracolumbar spinal region were obtained. destruction of the adjacent end plates along the central portions of the intervertebral disks at t6t7, t9t11, t1213, l1l2, l3l4, and l6l7 forming concave radiolucent defects were present with variable collapse of the intervertebral disk space and deeper sclerosis surrounding the osteolysis, consistent with diskospondylitis (fig.1a). the dog was placed on a regimen of carprofen 2.5 mg / kg po q12 h, gabapentin 9.8 mg / kg po q8 h, codeine 2.9 mg / kg po q8 h, fluconazole 3.26 mg / kg po q12 h, enrofloxacin 8.9 mg / kg po q24 h, and cephalexin 32.7 mg / kg po q12 h. the dog was discharged following 4 days of these medications and cage rest with instructions to keep the dog cage confined for 4 weeks. following the results of the positive fungal culture, 2 weeks after presentation, the owner was instructed to discontinue the enrofloxacin and cephalexin. a left lateral thoracolumbar spine radiograph of the affected dog on presentation (a) showing typical signs of diskopondylitis including the destruction of adjacent vertebral end plates (white arrows) present at t9t11, t1213, l12, l3l4, and l6l7. on postmortem examination 11 months later (b), the end - plate destruction has progressed and is now present in the majority of vertebral end plates. lysis of the sternal end plates along with a generalized osteopenic appearance of the sternebrae is present (white arrowheads) (c). on recheck 40 days after initial presentation, the dog 's pain was significantly improved, with none elicited on spinal palpation. severe muscle atrophy of the pelvic limb and thoracolumbar epaxial muscles was still present, as was the right - sided head tilt. the recommendation was made to continue fluconazole for a minimum of 12 months until the clinical signs resolved and then to use carprofen as needed for pain. the dog was discharged, and contact via email with the owner was maintained over the following months revealing no relapse of any clinical signs. approximately 10 months following the previous discharge (11 months from initial presentation) the dog presented with severe acute neurologic signs including circling to the left, right hemiparesis, and neck pain. the dog was euthanized at the owner 's request and additional imaging of the cadaver was performed. magnetic resonance (mr) imaging of the brain and cervical spinal column was performed immediately following euthanasia using a 1.0 t mr imaging system (philips nt10 gyroscan intera ; philips medical systems, andover, ma). t1-weighted (t1-w), t2-weighted (t2-w), and fluid attenuated inversion recovery (flair) images (4 mm slices) in sagittal, coronal, and axial planes were reviewed. a marked dilation of the left lateral ventricle causing compression of the left thalamus and a midline shift of the falx to the right was noted. the fluid within the lateral ventricle was hyperintense on t2-w images and hypointense on the t1-w and flair images, consistent with cerebrospinal fluid (csf) (fig.2a and b). a hyperintense rim surrounded the left lateral ventricle on the flair images. a single 0.3 cm 0.7 cm ill - defined, curvilinear, t2-w, and flair hyperintensity was present in the left dorsorostral cerebrum, although this could not be differentiated from the edema related to the enlarged left lateral ventricle due to the lack of a contrast study. the intervertebral disk spaces of c2c5 were narrowed with irregular contours and t2-w hyperintense end plates suggestive of diskospondyitis. fluid attenuated inversion recovery (a), t2-weighted (b) axial images and postmortem section (c) of the brain at the level of thalamus. the left lateral ventricle is enlarged (), containing t2 hyperintense and flair hypointense fluid, consistent with cerebrospinal fluid. this is causing compression on the thalamus and midline deviation of the falx to the right. the flair image also shows a small rim of periventricular hyperintensity surrounding the left lateral ventricle (white arrow). left lateral and ventrodorsal radiographs of the spine and thorax the previously noted lysis and irregularity of vertebral end plates was still present, with new irregularities involving the end plates of the majority of the cervical, thoracic, and lumbar vertebrae (fig.1b). the vertebral bodies of t5t7 and t11 were heterogeneous and osteopenic compared to neighboring vertebrae. lysis of the sternal end plates along with a generalized osteopenic appearance of the sternebrae was noted (fig.1c). postmortem analysis of the body confirmed severe and diffuse diskospondylitis at c2c5, t3t5, t9t13, and l1l5, multifocal sternal osteomyelitis, and severe dilation of left lateral ventricle of the brain (fig.2c). histopathology showed an inflammatory infiltrate containing fungal hyphae within the meninges, brain, spinal cord, liver, pancreas, spleen, kidneys, lungs, heart, adrenal glands, lymph nodes, mesentery, peritoneum, vertebrae, sternebrae, and bone marrow. fungal culture and dna sequencing confirmed the fungal organism to be the previously diagnosed geosmithia argillacea. susceptibility testing on csf collected postmortem showed that the organism was strongly resistant to fluconazole, voriconazole, caspofungin, and amphotericin b and minimally resistant to itraconzaole and posaconzaole. geosmithia argillacea is an opportunistic fungus phenotypically similar to the penicillium species that has been isolated in humans suffering from genetic immunodeficiency illnesses such as cystic fibrosis and chronic granulomatous disease 14. it has been assumed that these patients acquire the agent through inhalation, though the exact environmental source has not been identified 2. there have been rare reports in humans where the fungus has become aggressive and disseminated, with involvement of the pulmonary parenchyma, chest wall, contiguous rib bones, and presumed cerebral infection 5,6. this is of particular concern in individuals that are or may become immunocompromised 2,6. the fungi involved with the human infections typically has low susceptibility to itraconazole, voriconazole, and fluconazole, variable susceptibility to amphotericin b and posaconazole, and in one study was susceptible to echinocandins, such as micafungin or caspofungin 3,5,6. in contrast to previous human isolates, the isolate in this case had a high susceptibility to itraconazole and a low susceptibility to caspofungin. due to its similar phenotypic and microscopic characteristics to both penicillium and paecilomyces species, a molecular approach for identification has been recommended to enable accurate identification of geosmithia argillacea 4,5. both organisms, however, demonstrate different susceptibility profiles to geosmithia : penicillium marneffei, responsible for the majority of human disseminated mycotic cases, displays little to no susceptibility to fluconazole, intermediate susceptibility to amphotericin b, and high sensitivity to itraconazole, voriconazole, ketoconazole, and miconazole ; most paecilomyces are typically resistant to fluconazole, moderately resistant to amphotericin b, variably resistant to itraconazole and voraconazole, and susceptible to select triazoles such as pozaconazole and ravuconazole 7,8. the recommended treatment in humans for both penicillium and paecilomyces infections is a combination of amphotericin b and itraconazole or voriconazole 810. fluconazole was chosen in this case primarily due to its ability to cross the blood brain barrier and reach concentrations in the csf that is roughly equal to that in serum, as well as cost concerns of the client 11. while it seemed to be initially successful at treating the fungus, based on the patient 's clinical improvement, postmortem susceptibility testing showed this particular strain of geosmithia argillacea ultimately became resistant to fluconazole. the use of amphotericin b and itraconazole has been reported in dogs with systemic mycosis 12,13. however, these treatments were prohibitively expensive for a dog of this size. based on their limited success in humans, this organism 's susceptibility to itraconazole on postmortem testing, and the near universal resistance of the most common disseminated mycotic infections to fluconazole, this combination treatment may have been more effective than the fluconazole used in this case. infection with the fungus geosmithia argillacea has been reported only once as a case report in the veterinary literature 14. while that case originally presented for acute onset of glaucoma in the right eye, further tests revealed osseous proliferation and a concurrent lysis of the vertebral end plates of t4t6 and sternabrae, similar to the current case 14. this reported case was never treated and a diagnosis of geosmithia argillacea was made via necropsy. in the previous case, as with the current case, initially the fungus was incorrectly identified as a penicillium species. as noted previously, the genus geosmithia currently contains numerous species formerly classified as penicillium. it is possible that geosmithia argillacea may be isolated more commonly than has been realized up to now and overlooked given its morphological similarities to penicillium and paecilomyces species 2. differentiation using dna pcr assays is important to correctly identify the fungus in order to start appropriate treatment. diskospondylititis is one of the many infections of the vertebral spinal column including vertebral physitis, spondylitis, and diskitis, and refers to a primary infection of the cartilaginous vertebral end plates with secondary involvement of the intervertebral disk 15,16. it is a relatively uncommon disease with nonspecific clinical signs that include malaise, neurologic deficits, and vertebral hyperesthesia or pain 15,17. classic radiographic findings associated with diskospondylitis include loss of definition of end - plate margins, narrowing of the ivd space, lytic bony changes of the vertebrae adjacent to the ivd space, and sclerosis at the margins of bone lysis 18,19. the primary source of infection in small animal patients with bacterial diskopondylitis alone is infrequently determined, although urogenital infections, abscesses, open wounds, and respiratory tract and oral cavity infections are frequently implicated 20. while these areas are often responsible for inoculation of a fungal infection, the primary means of entry often remain unknown, as it the current case 21. in one study, staphylococcus species, streptococcus species, and escherichia coli were isolated most often from cases of bacterial diskospondylitis 18. in this case, urogenital infection and external or oral cavity wounds were ruled out based on the negative urine culture and physical examination. while thoracic and abdominal radiographs performed by the referring veterinarian were not noted to have any abnormalities, it is possible a nydus of mycotic infection was not visible radiographically. similarly, disseminated opportunistic mycoses are infrequently reported in dogs, with the most common etiologic agents identified as species of aspergillus 2224. other isolates have included penicillium, paecilomyces, sagenomella, westerdykella, as well as one case report of geosmithia 14,21,2527. clinical signs associated with these disseminated infections are often vague and can include spinal hyperesthesia, neurologic deficits, weight loss, anorexia, uveitis, head tilt, nystagmus, renal failure, and urinary incontinence 17,23. interestingly, in one recent study just over half of dogs with systemic aspergillosis infection showed radiographic signs of diskospondylitis 23. treatment in these cases is often not successful due to fungal resistance to the available medications, as well as the questionable ability of antifungal drugs to penetrate all of the affected tissues 14. the breed most affected by disseminated mycotic infections has been the german shepherd dog, with this breed having an odds ratio of 43 for contracting one of the more common mycotic infections, systemic aspergillosis, relative to a background hospital population 23. female german shepherd dogs were also overrepresented, comprising 77% of the german shepherd dog group 23. numerous reports of a wide variety of fungal infections have been reported in german shepherd dogs 21,22,27,28. it has been hypothesized that german shepherd dogs have a breed - related immunodeficiency that increases their risk of contracting mycotic infections, though a specific defect has not been identified 29. similarly, an immunodeficiency was suspected, but not proven, to be a contributing factor in this dog 's systemic mycotic infection. in contrast, bacterial diskopondylitis has been reported to be more common in a variety of breeds, including labrador retrievers and great danes, though pure bred dogs as a group were more likely to be affected than mixed - breed dogs 17,18,30. mr imaging has been used to describe diskospondylitis previously in both humans and dogs 15. this dog displayed the typical findings previously described, with hypointense vertebral bodies and mixed signal vertebral end plates on t2-w images 15. due to the postmortem nature of the patient in this case report, contrast was not utilized, though contrast enhancement of vertebral bodies and paravertebral tissues has been previously reported in diskospondylitis cases 15. mr imaging has been previously used to examine the brains of dogs infected with other intracranial mycoses including cryptococcus and blastomyces 31,32. in these cases these areas were hypointense on t1-w images and enhanced minimally with gadolinium. in the present case, a similar t2-w hyperintensity was also found but instead within the dorsorostral cerebrum. this hyperintensity, in addition to multiple other sites within the brain, was confirmed on histopathology to be fungal of origin, showing the wide - spread dissemination of this organism. periventricular changes associated with the lateral ventricles were also found in both the current and previously reported cases. the enlarged left lateral ventricle in this case is thought to have arisen from the inflammation caused by the fungus, leading to lack of csf outflow from the ventricles. a flair sequence was used to differentiate csf within the ventricle from other inflammatory or hemorrhagic fluid, as both can appear hyperintense on t2-w images. the cryptococcus case also showed gadolinium - enhanced t1-w images showing focal, contrast - enhancing areas in the frontal cortex with diffuse meningeal enhancement. these lesions were noted to have improved, but were still present after 5 months of therapy. in conclusion, this case report is the first to demonstrate the dissemination of geosmithia argillacea fungal infection in the nervous system of a dog using radiography and mr imaging. additionally, this is the first treated case of disseminated geosmithia argiliacea reported in dogs. more treated cases are needed to determine the long - term prognosis and the best form of therapy for this disseminated mycosis. due to similar clinical, imaging, and histopathologic characteristics to disseminated aspergillus and penicillium species, geosmithia argillacea should be considered to be a potential differential if similar lesions are encountered by practitioners in the future. | key clinical messagea 4-year - old male castrated labrador retriever presented for severe spinal pain. radiographs and magnetic resonance imaging showed evidence of diskospondylitis and meningoencephalomyelitis. blood culture revealed a geosmithia argillacea fungal infection after dna sequencing, initially misdiagnosed as penicillium species. geosmithia argillacea should be considered as a differential for disseminated fungal diskospondylitis. |
salivary gland tumors occurring in the sublingual gland are rare as compared to other locations, such as the parotid and submandibular glands. among malignant salivary gland tumors, the most frequent type is adenoid cystic carcinoma, followed by adenocarcinoma and carcinoma ex pleomorphic adenoma. the malignant component is frequently a poorly differentiated carcinoma, high - grade adenocarcinoma or salivary duct carcinoma. however, most other types of salivary gland carcinomas have been described in carcinoma ex pleomorphic adenoma, and some cases show diverse differentiation with several distinct types within the tumor mass. according to the world health organization histological classification published in 2005, malignat changes in the pleomorphic adenoma include three different types : carcinoma ex pleomorphic adenoma, carcinosarcoma and metastasizing pleomorphic adenoma. the macroscopic features that suggest malignant transformation in pleomorphic adenoma include poorly defined and/or infiltrative tumor margins, the presence of foci of hemorrhage, and necrosis. also the coexistent benign and malignant elements are considered as well. herein, we report a case of carcinoma ex pleomorphic adenoma that occurred in the sublingual gland, and presented histological findings of microinvasion beyond the original capsule and abundant myoepithelial cells. a 70-year - old japanese man was referred to our clinic for further evaluation of a mass located in the left floor of the mouth. there were no subjective symptoms, including pain and tenderness, and the patient had not noticed it until his dentist pointed it out. extraoral examination results were unremarkable and no abnormal mass in the face or lymphadenopathy in the bilateral neck was seen. an intraoral examination revealed a painless, non - tender, elastic hard, smooth mass measuring 1.5 cm1.5 cm. the mass was covered by intact oral mucosa and it was not fixed to the surrounding structures, including the mandible (figure 1). a reduced secretion of saliva from the left orifice of wharton 's duct was found. in a magnetic resonance (mr) examination, a space occupying mass lesion, which showed homogeneous low signal intensity on t1-weighted images and homogeneous intermediate signal intensity on t2-weighted images, was delineated (figure 2). on dynamic mr images, tumor located in sublingual space was gradually enhanced as compared to that of surrounding sublingual glands (figure 3). the mass was located in the sublingual space and a clear interface with the sublingual gland was evident. we made a clinical diagnosis of a benign salivary gland tumor originating from the sublingual salivary gland. since tumors arising from the sublingual gland have a high chance of being malignant, excision of the mass with the sublingual salivary gland in an en bloc fashion via an intraoral approach was performed under general anesthesia. during the operation, the tumor mass was found located deep within the sublingual gland and above the mylohyoid muscle, and a sharp and blunt dissection from the mandible, extrinsic tongue musculature, and mylohyoid muscle was performed. the postoperative course was uneventful, and there was no recurrence or metastasis for 5 years and 10 months postsurgically. the macroscopic appearance of the resected specimen was solid in nature and it was completely encapsulated. the cut surface showed a grayish white, homogeneous, solid mass with no bleeding foci or necrotic areas (figure 4). histopathological examination revealed that the tumor was composed of a pleomorphic adenoma consisting of myxoid, chondroid and mucoid materials, as well as duct - like structures and cell - rich mesenchymal tissues (figure 5a). although it was well encapsulated, there was a rupture of the fibrous capsule and tumor cells had slightly invaded the surrounding fat tissues (figure 5b). diffuse cell - rich sheets composed of myoepithelial cells with round nuclei were also seen, among which there were mitotic figures and atypical cells (figure 5c and 5d). immunohistochemical examinations, including smooth muscle actin, s-100 protein and glial fibrillary acidic protein (gfap), cytokeratin were performed. in the parenchyma, staining for cytokeratin highlighted the ductal cells, whereas stromal cells that had differentiated into myxoid, chondroid and mucoid cells were not stained. the cells that composed of cell - rich sheets were positive to smooth muscle actin (figure 6). postoperative ultrasound examination of the neck and f - fluorodeoxyglucose positron emission tomography study revealed no metastatic deposits. based on these findings, a final diagnosis of myoepithelial carcinoma ex pleomorphic adenoma (pt1n0m0) was made. additional treatments including neck dissection and adjuvant radiation were not performed, because there were no evidences of recurrence and metastasis, and patient adapted a wait - and - see ' approach. salivary gland tumors are rarely found located in the sublingual gland, though such masses have been shown to be malignant in 80%90% of the reported cases. nagler and laufer reported that they did not observe any benign tumors occurring in the sublingual glands. clinically, an asymptomatic swelling in the floor of the mouth is the most common complaint associated with malignant sublingual gland tumors, though one case was incidentally discovered by a dentist, which was the same as with the present patient, who did not notice the mass until pointed out by his dentist. tumors of the sublingual salivary gland are generally not recognized until they reach an advanced stage, mainly because of minimal symptomatology. in order to detect a sublingual malignant neoplasm in the early stage, in addition, it is important to rule out malignancy when a sublingual mass is presented. a diagnosis of malignant salivary neoplasm must be considered for every patient who has a swelling in the area of the major salivary glands or a submucosal mass in the oral cavity or pharynx, even if the swelling has been present for years. in the present case, there were no apparent features that indicated a malignant tumor in the results of our physical examination or in diagnostic images. clinically, we routinely use magnetic resonance imaging (mri) as a diagnostic tool for mass lesions located in soft tissues. reported mr findings for an adenoid cystic carcinoma originating from the sublingual gland and a gingival squamous cell carcinoma that had invaded the sublingual gland, which both demonstrated destruction of the gland. in the present case, reported that dynamic mri was useful in differentiating malignant from benign tumors, as well as for detecting the extent of invasion of a sublingual carcinoma. according to the marginal appearance and enhancement timing of the present mass lesion, we considered that it was benign rather than malignant in nature. further, since a large part of the tumor margin was encapsulated, we thought it was difficult to diagnose the present case as malignant in nature, because of the marginal features on diagnostic images, including those obtained with mri. in the world health organization classification of salivary gland tumors, the histological proportion of benign versus malignant components can be quite variable. occasionally, extensive sampling is necessary to find the benign component and in rare case, a benign remnant might not be found. as for infiltrative growth, three subtypes can be distinguished : non - invasive, minimally invasive and invasive. in the present case, our final diagnosis was minimally invasive carcinoma ex pleomorphic adenoma, as there was microinvasion beyond the capsule. reported a histopathologic subclassification for 37 cases of carcinomas ex pleomorphic adenoma, which yielded 13 cductal, 10 undifferentiated, 9 terminal duct and 3 myoepithelial types, with two cases that could not be classified because of the small csize of the surgical specimen. in the present case, because cells showing myoepithelial differentiation were abundant, it could be subclassified as a myoepithelial type. tortoledo. also reported two variables, measured invasion in millimeters and histological subclassification cof the malignant neoplasm, as valuable guides for prognosis and biologic behavior. however, they found no definite association between gross dimensions of the tumor and incidence of recurrence or metastasis. when recurrence and distant metastasis occur, survival is so low ; therefore, early and adequate removal of that carcinoma ex pleomorphic adenoma is extremely critical. although metastasis to the lung is rare, patients treated for carcinoma ex pleomorphic adenoma should be investigated for distant metastasis, such as to the lungs and bone, thus long term follow - up examinations for local recurrence and systemic metastasis of our patient are essential. | we report a case of carcinoma ex pleomorphic adenoma of a sublingual gland in a 70-year - old man. under a clinical diagnosis of benign salivary gland tumor, excision of the mass with the sublingual salivary gland in an en bloc fashion via an intraoral approach was performed. histopathologically, there was a rupture of the fibrous capsule and diffuse cell - rich sheets composed of myoepithelial cells with round nuclei were also seen. immunohistochemically, the cells that composed of cell rich sheets were positive to smooth muscle actin. final diagnosis of myoepithelial carcinoma ex pleomorphic adenoma was made. |
the dpp enrolled 3,234 participants with igt and fasting hyperglycemia who were at least 25 years of age and had bmi of 24 kg / m or higher (22 kg / m in asian americans) (3). mean age was 51 years of age and mean bmi was 34.0 kg / m (3). sixty - eight percent were women, and forty - five percent were members of minority groups (3). the goals for participants randomized to lifestyle were to achieve and maintain a weight reduction of at least 7% of initial body weight through diet and physical activity of moderate intensity, such as brisk walking, for at least 150-min per week. a 16-session core curriculum (given approximately weekly in individual participant sessions) and subsequent individual sessions (usually monthly) and group sessions with case managers were designed to reinforce the behavioral changes. the medication interventions (metformin and placebo) were initiated at a dose of 850 mg taken orally once a day. at 1 month, the dose was increased to 850-mg twice daily. standard lifestyle recommendations were provided to all groups through written information and an annual 20- to 30-min individual session that emphasized the importance of a healthy lifestyle. mean follow - up at the end of the dpp was 3.2 years. for the purposes of this analysis, we assumed that all subjects were enrolled in the dpp for exactly 3 years. at the end of the dpp in july 2001, masked treatment was discontinued and each participant had a 1-h debriefing and closure visit during which he or she was informed of the main dpp results. in light of the proven benefits of lifestyle, all participants were offered a group - implemented 16-session lifestyle intervention between january and july 2002. forty percent of lifestyle, fifty - eight percent of metformin, and fifty - seven percent of placebo participants attended at least one session (11). the original lifestyle group was offered additional lifestyle support and was not encouraged to take metformin. the original metformin group was encouraged to continue metformin and to participate in the group lifestyle intervention. those randomized to placebo stopped placebo and were encouraged to participate in the group lifestyle intervention. for the purposes of this analysis, we assumed that year 4 represented the dpp / dppos bridge. all active participants were eligible for continued follow - up, and 2,766 of 3,150 (88%) enrolled (4). these included 910 from lifestyle, 924 from metformin, and 932 from placebo. during the dppos, the group lifestyle intervention was implemented as the healthy lifestyle program (help) for all participants. help reinforced the original weight loss and physical activity goals and focused on current topics in nutrition, physical activity, stress management, and diabetes prevention. all participants received a reminder for help sessions. although all participants were invited to attend all help sessions, many chose to attend fewer. the dpp participants initially randomized to lifestyle were also eligible to receive two additional sessions, referred to as boost sessions, per year to reinvigorate their self - management behaviors for weight loss. the sessions were more intensive than help sessions and reinforced specific behavioral self - management activities (e.g., self - monitoring of fat, calories, and/or physical activity, as well as weight checks) important for weight loss and physical activity adherence and/or maintenance. in addition, the sessions promoted home - based behavioral self - management of weight and physical activity through the use of motivational campaigns., metformin participants taking study - provided metformin received an annual complete blood count and serum creatinine for drug safety monitoring. only metformin participants were encouraged to take metformin, and only 1% of nondiabetic participants in lifestyle and 3% of nondiabetic participants in placebo took metformin prescribed outside the study (4). for the purposes of this analysis, we assumed that years 510 represented dppos follow - up. participants identified with glucose levels diagnostic of diabetes at their 6-monthly visits were seen within 6 weeks for glucose testing to confirm the diagnosis. participants with confirmed newly diagnosed diabetes received 1 h of individual counseling focused on self - monitoring of blood glucose, were provided with meters and test strips and encouraged to monitor their glucose levels once daily, and were maintained in their randomized intervention groups. treatment for diabetes and surveillance for complications and comorbidities were performed by the participants own health care providers. medications used by the dpp participants for management of diabetes were recorded every 6 months on a drug summary form. we calculated the total direct medical costs associated with the dpp / dppos interventions over each of the 10 years after randomization (supplementary table 1). direct medical costs of the interventions were estimated from the resources used and unit costs adjusted to 2010 u.s., we estimated what the cost of lifestyle might have been during the dpp if it had been administered in a group format rather than individually (dpp group lifestyle intervention). we recalculated the costs of lifestyle assuming that the core curriculum and monthly follow - up visits with the lifestyle case managers, which were conducted individually during the 3 years of the dpp, were conducted as group sessions with 10 participants. studies have shown that group intervention programs can be as effective as individual programs (12,13). although metformin was implemented with brand name metformin (glucophage), we assumed that it was implemented with generically priced metformin throughout the 10 years of the dpp / dppos. as previously described, we also estimated the direct medical cost of care outside the study (5). the direct medical cost of care outside the study included the costs of hospital, emergency room, urgent care, outpatient services, and telephone calls to health care providers. this was estimated from the number of prescription medications that participants reported taking at semiannual visits and the mean average wholesale price of a prescription medication dispensed by a large u.s. direct nonmedical costs were assessed twice, once during the dpp and once during the dppos, and costs were annualized. in estimating the direct nonmedical costs of the interventions, we considered the costs of food, food preparation items (blenders, cookbooks, food scales, freezers, microwave ovens, mixers, popcorn poppers, steamers, and woks), exercise classes, gym memberships, personal trainers, and exercise equipment (bicycles, exercise videos, free weights, golf clubs, home gyms, shoes, stationary bicycles, steps and treadmills) (5). we also considered the costs of transportation to study visits and to medical visits (5). the value of the time that participants spent shopping, cooking, exercising, and traveling to and attending appointments was also assessed (5). the costs of exercise were valued according to whether participants disliked, were neutral, or liked although direct nonmedical costs are not usually paid by private insurers or government health programs, we included them in our cost calculations from a societal perspective. qalys measure length of life adjusted for quality of life as assessed by the health utility score. by convention, health utility scores are placed on a continuum where perfect health is assigned a value of 1.0 and health judged equivalent to death is assigned a value of 0.0. we assessed health utilities annually using the self - administered quality of well - being index (qwb - sa) (6). the qwb - sa is a widely used, validated, multiattribute utility model that combines preference - weighted values for symptoms and functioning to provide a health utility score. the numerical value assigned by the qwb - sa to quality of life reflects the public 's judgment of the desirability of the health state. mathematically, qalys are calculated as the sum of the product of the number of years of life and the quality of life, measured in health utilities, in each of those years. for the base - case analysis, we followed the recommendations of the panel on cost - effectiveness in health in medicine (15) and took the perspective of a health system. we included direct nonmedical costs excluding participant time in a sensitivity analysis from a modified societal perspective and direct nonmedical costs including participant time in a sensitivity analysis from a full societal perspective. these sensitivity analyses assessed the impact of covering the cost of the behavioral interventions implemented by the study participants on society as a whole. the analyses of lifestyle, metformin, and placebo were based on the design, cost, and clinical effectiveness of the interventions as implemented in the 3 years of the dpp and the 7 years of the dppos. for the dpp group lifestyle sensitivity analysis, we estimated what the costs of lifestyle would have been during the 3 years of dpp if the 16-session core curriculum and monthly follow - up visits with the case managers had been conducted as group sessions with 10 participants. we excluded from the analyses the costs of the research component of the dpp / dppos. subsequently, both cost and health outcomes were converted to net present value using a 3% discount rate, and incremental cost - effectiveness ratios were calculated using the discounted costs and qalys. the dpp enrolled 3,234 participants with igt and fasting hyperglycemia who were at least 25 years of age and had bmi of 24 kg / m or higher (22 kg / m in asian americans) (3). mean age was 51 years of age and mean bmi was 34.0 kg / m (3). sixty - eight percent were women, and forty - five percent were members of minority groups (3). the goals for participants randomized to lifestyle were to achieve and maintain a weight reduction of at least 7% of initial body weight through diet and physical activity of moderate intensity, such as brisk walking, for at least 150-min per week. a 16-session core curriculum (given approximately weekly in individual participant sessions) and subsequent individual sessions (usually monthly) and group sessions with case managers were designed to reinforce the behavioral changes. the medication interventions (metformin and placebo) were initiated at a dose of 850 mg taken orally once a day. at 1 month, the dose was increased to 850-mg twice daily. standard lifestyle recommendations were provided to all groups through written information and an annual 20- to 30-min individual session that emphasized the importance of a healthy lifestyle. mean follow - up at the end of the dpp was 3.2 years. for the purposes of this analysis, we assumed that all subjects were enrolled in the dpp for exactly 3 years. at the end of the dpp in july 2001, masked treatment was discontinued and each participant had a 1-h debriefing and closure visit during which he or she was informed of the main dpp results. in light of the proven benefits of lifestyle, all participants were offered a group - implemented 16-session lifestyle intervention between january and july 2002. forty percent of lifestyle, fifty - eight percent of metformin, and fifty - seven percent of placebo participants attended at least one session (11). the original lifestyle group was offered additional lifestyle support and was not encouraged to take metformin. the original metformin group was encouraged to continue metformin and to participate in the group lifestyle intervention. those randomized to placebo stopped placebo and were encouraged to participate in the group lifestyle intervention. for the purposes of this analysis, we assumed that year 4 represented the dpp / dppos bridge. all active participants were eligible for continued follow - up, and 2,766 of 3,150 (88%) enrolled (4). these included 910 from lifestyle, 924 from metformin, and 932 from placebo. during the dppos, the group lifestyle intervention was implemented as the healthy lifestyle program (help) for all participants. help reinforced the original weight loss and physical activity goals and focused on current topics in nutrition, physical activity, stress management, and diabetes prevention. all participants received a reminder for help sessions. although all participants were invited to attend all help sessions, many chose to attend fewer. the dpp participants initially randomized to lifestyle were also eligible to receive two additional sessions, referred to as boost sessions, per year to reinvigorate their self - management behaviors for weight loss. the sessions were more intensive than help sessions and reinforced specific behavioral self - management activities (e.g., self - monitoring of fat, calories, and/or physical activity, as well as weight checks) important for weight loss and physical activity adherence and/or maintenance. in addition, the sessions promoted home - based behavioral self - management of weight and physical activity through the use of motivational campaigns., metformin participants taking study - provided metformin received an annual complete blood count and serum creatinine for drug safety monitoring. only metformin participants were encouraged to take metformin, and only 1% of nondiabetic participants in lifestyle and 3% of nondiabetic participants in placebo took metformin prescribed outside the study (4). for the purposes of this analysis, we assumed that years 510 represented dppos follow - up. participants identified with glucose levels diagnostic of diabetes at their 6-monthly visits were seen within 6 weeks for glucose testing to confirm the diagnosis. participants with confirmed newly diagnosed diabetes received 1 h of individual counseling focused on self - monitoring of blood glucose, were provided with meters and test strips and encouraged to monitor their glucose levels once daily, and were maintained in their randomized intervention groups. treatment for diabetes and surveillance for complications and comorbidities were performed by the participants own health care providers. medications used by the dpp participants for management of diabetes were recorded every 6 months on a drug summary form. the dpp enrolled 3,234 participants with igt and fasting hyperglycemia who were at least 25 years of age and had bmi of 24 kg / m or higher (22 kg / m in asian americans) (3). mean age was 51 years of age and mean bmi was 34.0 kg / m (3). sixty - eight percent were women, and forty - five percent were members of minority groups (3). the goals for participants randomized to lifestyle were to achieve and maintain a weight reduction of at least 7% of initial body weight through diet and physical activity of moderate intensity, such as brisk walking, for at least 150-min per week. a 16-session core curriculum (given approximately weekly in individual participant sessions) and subsequent individual sessions (usually monthly) and group sessions with case managers were designed to reinforce the behavioral changes. the medication interventions (metformin and placebo) were initiated at a dose of 850 mg taken orally once a day. at 1 month, the dose was increased to 850-mg twice daily. standard lifestyle recommendations were provided to all groups through written information and an annual 20- to 30-min individual session that emphasized the importance of a healthy lifestyle. mean follow - up at the end of the dpp was 3.2 years. for the purposes of this analysis, we assumed that all subjects were enrolled in the dpp for exactly 3 years. at the end of the dpp in july 2001, masked treatment was discontinued and each participant had a 1-h debriefing and closure visit during which he or she was informed of the main dpp results. in light of the proven benefits of lifestyle, all participants were offered a group - implemented 16-session lifestyle intervention between january and july 2002. forty percent of lifestyle, fifty - eight percent of metformin, and fifty - seven percent of placebo participants attended at least one session (11). the original lifestyle group was offered additional lifestyle support and was not encouraged to take metformin. the original metformin group was encouraged to continue metformin and to participate in the group lifestyle intervention. those randomized to placebo stopped placebo and were encouraged to participate in the group lifestyle intervention. for the purposes of this analysis, we assumed that year 4 represented the dpp / dppos bridge. all active participants were eligible for continued follow - up, and 2,766 of 3,150 (88%) enrolled (4). these included 910 from lifestyle, 924 from metformin, and 932 from placebo. during the dppos, the group lifestyle intervention was implemented as the healthy lifestyle program (help) for all participants. help reinforced the original weight loss and physical activity goals and focused on current topics in nutrition, physical activity, stress management, and diabetes prevention. all participants received a reminder for help sessions. although all participants were invited to attend all help sessions, many chose to attend fewer. the dpp participants initially randomized to lifestyle were also eligible to receive two additional sessions, referred to as boost sessions, per year to reinvigorate their self - management behaviors for weight loss. the sessions were more intensive than help sessions and reinforced specific behavioral self - management activities (e.g., self - monitoring of fat, calories, and/or physical activity, as well as weight checks) important for weight loss and physical activity adherence and/or maintenance. in addition, the sessions promoted home - based behavioral self - management of weight and physical activity through the use of motivational campaigns., metformin participants taking study - provided metformin received an annual complete blood count and serum creatinine for drug safety monitoring. only metformin participants were encouraged to take metformin, and only 1% of nondiabetic participants in lifestyle and 3% of nondiabetic participants in placebo took metformin prescribed outside the study (4). for the purposes of this analysis, we assumed that years 510 represented dppos follow - up. participants identified with glucose levels diagnostic of diabetes at their 6-monthly visits were seen within 6 weeks for glucose testing to confirm the diagnosis. participants with confirmed newly diagnosed diabetes received 1 h of individual counseling focused on self - monitoring of blood glucose, were provided with meters and test strips and encouraged to monitor their glucose levels once daily, and were maintained in their randomized intervention groups. treatment for diabetes and surveillance for complications and comorbidities were performed by the participants own health care providers. medications used by the dpp participants for management of diabetes were recorded every 6 months on a drug summary form. we calculated the total direct medical costs associated with the dpp / dppos interventions over each of the 10 years after randomization (supplementary table 1). direct medical costs of the interventions were estimated from the resources used and unit costs adjusted to 2010 u.s., we estimated what the cost of lifestyle might have been during the dpp if it had been administered in a group format rather than individually (dpp group lifestyle intervention). we recalculated the costs of lifestyle assuming that the core curriculum and monthly follow - up visits with the lifestyle case managers, which were conducted individually during the 3 years of the dpp, were conducted as group sessions with 10 participants. studies have shown that group intervention programs can be as effective as individual programs (12,13). although metformin was implemented with brand name metformin (glucophage), we assumed that it was implemented with generically priced metformin throughout the 10 years of the dpp / dppos. as previously described, we also estimated the direct medical cost of care outside the study (5). the direct medical cost of care outside the study included the costs of hospital, emergency room, urgent care, outpatient services, and telephone calls to health care providers. this was estimated from the number of prescription medications that participants reported taking at semiannual visits and the mean average wholesale price of a prescription medication dispensed by a large u.s. direct nonmedical costs were assessed twice, once during the dpp and once during the dppos, and costs were annualized. in estimating the direct nonmedical costs of the interventions, we considered the costs of food, food preparation items (blenders, cookbooks, food scales, freezers, microwave ovens, mixers, popcorn poppers, steamers, and woks), exercise classes, gym memberships, personal trainers, and exercise equipment (bicycles, exercise videos, free weights, golf clubs, home gyms, shoes, stationary bicycles, steps and treadmills) (5). we also considered the costs of transportation to study visits and to medical visits (5). the value of the time that participants spent shopping, cooking, exercising, and traveling to and attending appointments was also assessed (5). the costs of exercise were valued according to whether participants disliked, were neutral, or liked although direct nonmedical costs are not usually paid by private insurers or government health programs, we included them in our cost calculations from a societal perspective. qalys measure length of life adjusted for quality of life as assessed by the health utility score. by convention, health utility scores are placed on a continuum where perfect health is assigned a value of 1.0 and health judged equivalent to death is assigned a value of 0.0. we assessed health utilities annually using the self - administered quality of well - being index (qwb - sa) (6). the qwb - sa is a widely used, validated, multiattribute utility model that combines preference - weighted values for symptoms and functioning to provide a health utility score. the numerical value assigned by the qwb - sa to quality of life reflects the public 's judgment of the desirability of the health state. mathematically, qalys are calculated as the sum of the product of the number of years of life and the quality of life, measured in health utilities, in each of those years. for the base - case analysis, we followed the recommendations of the panel on cost - effectiveness in health in medicine (15) and took the perspective of a health system. we included direct nonmedical costs excluding participant time in a sensitivity analysis from a modified societal perspective and direct nonmedical costs including participant time in a sensitivity analysis from a full societal perspective. these sensitivity analyses assessed the impact of covering the cost of the behavioral interventions implemented by the study participants on society as a whole. the analyses of lifestyle, metformin, and placebo were based on the design, cost, and clinical effectiveness of the interventions as implemented in the 3 years of the dpp and the 7 years of the dppos. for the dpp group lifestyle sensitivity analysis, we estimated what the costs of lifestyle would have been during the 3 years of dpp if the 16-session core curriculum and monthly follow - up visits with the case managers had been conducted as group sessions with 10 participants. we excluded from the analyses the costs of the research component of the dpp / dppos. subsequently, both cost and health outcomes were converted to net present value using a 3% discount rate, and incremental cost - effectiveness ratios were calculated using the discounted costs and qalys. the annual undiscounted, per capita, direct medical costs of lifestyle, metformin, and placebo over 10 years are summarized in table 1 as are the costs of the dpp group lifestyle sensitivity analysis. the cumulative, undiscounted per participant cost of the lifestyle intervention as implemented in the dpp ($ 4,601) was substantially greater than the metformin intervention ($ 2,300) or the placebo intervention ($ 769). the estimated cost of the dpp group lifestyle intervention ($ 3,023) was approximately one - third less than that of the lifestyle intervention. the costs of lifestyle were substantially less during the dppos than during the dpp because of the change from an individual- to a group - implemented intervention and because fewer visits took place. the costs of placebo were higher during the dppos than during the dpp because placebo participants engaged in the group lifestyle intervention. during the dppos, lifestyle and metformin each cost approximately $ 140 per participant per year. the costs of the interventions during the dpp differ somewhat from those reported previously as we have added the costs of fasting glucose and glucose tolerance testing and incorporated generic pricing for metformin (5). undiscounted, per capita, direct medical costs of the dpp / dppos interventions by intervention group and study year ($) a : cumulative, undiscounted, per participant, direct medical costs of the dpp / dppos interventions by intervention group and study year. b : cumulative, undiscounted, per participant, direct medical costs of medical care received outside the dpp / dppos by intervention group and study year. c : cumulative, undiscounted, per participant, total direct medical costs of the dpp / dppos interventions and medical care received outside the dpp / dppos by intervention group and study year. d : cumulative, undiscounted, per participant, total quality of well - being index by intervention group and year. the cumulative, undiscounted per capita direct medical costs of nonintervention - related medical care by intervention group and year following randomization are shown in table 2 and fig. the direct medical costs of nonintervention - related medical care were substantially greater than the costs of the interventions, and within 3 years, the cumulative costs of nonintervention - related medical care exceeded the 10-year cumulative direct medical costs of the interventions. the cumulative per - participant direct medical costs of nonintervention - related medical care increased substantially over time. from the outset of the dpp, the greater cost of nonintervention - related medical care for placebo was largely driven by greater use of outpatient and inpatient services, prescription medications, and by the greater rate of conversion to diabetes with the attendant costs of self - monitoring and laboratory tests (table 2). across treatment groups, the direct medical costs of nonintervention - related medical care were 3444% higher among diabetic participants compared with nondiabetic participants (supplementary table 3). over 10 years, cumulative, per capita nonintervention - related direct medical costs were greater by $ 1,853 and $ 2,905 for placebo compared with metformin and lifestyle, respectively. undiscounted, per capita, direct medical costs of care outside the dpp / dppos by intervention group and study year, and distribution of undiscounted, per capita, 10-year, direct medical costs of care outside the dpp / dppos by intervention group and type ($) over 10 years, the cumulative, undiscounted, per capita direct medical costs of the interventions were greater for participants randomized to lifestyle ($ 4,601) and metformin ($ 2,300) compared with placebo ($ 769). in contrast, the cumulative, undiscounted, per capita direct medical costs of nonintervention - related medical care (medical care received outside the dpp / dppos) were greater for placebo ($ 27,468) than for metformin ($ 25,615) or lifestyle ($ 24,563). by year 10, the cumulative, undiscounted, per capita, total direct medical costs of the interventions and nonintervention - related medical care were higher for lifestyle than for placebo but were lower for metformin than for placebo (fig. supplementary table 4 summarizes the undiscounted, per capita, cumulative, 10-year direct nonmedical costs by intervention group and type defined as diet - related costs, physical activity related costs, transportation - related costs, and participant time - related costs. transportation - related costs were also substantially higher for lifestyle and metformin due to the greater number of study visits. total diet-, physical activity-, and transportation - related costs were greatest for lifestyle but similar for metformin and placebo. participant time related to the interventions (time spent traveling to study visits, at study visits, and for intervention - related calls) was greater for lifestyle and metformin than for placebo. participant time related to medical care outside of the interventions was generally greater for placebo than for metformin or lifestyle. time spent shopping and cooking was the largest component of participant time but differed little across intervention groups. although lifestyle subjects spent more time exercising, the adjusted value of the time they spent exercising was less than for either metformin or placebo because of their greater enjoyment of leisure time physical activity and the lower opportunity cost. the total, per capita, 10-year, direct nonmedical costs including the costs of participant time were lowest for metformin ($ 144,143) and similar for placebo and lifestyle ($ 147,043 and $ 147,493, respectively). every year after randomization, quality of life was better for lifestyle than for metformin or placebo (supplementary table 3). across treatment groups, quality of life was worse among participants who developed diabetes (supplementary table 3). since more placebo participants developed diabetes, the cumulative, undiscounted, per participant quality of well - being score gained over 10 years was greatest for lifestyle (6.81), intermediate for metformin (6.69), and least for placebo (6.67) (fig.. table 3 summarizes the differences in total costs and qalys among the treatment groups and the incremental cost - effectiveness ratios of lifestyle and metformin versus placebo, and lifestyle versus metformin. the incremental cost - effectiveness ratio is also shown for the dpp - group lifestyle versus placebo. from the health system perspective, from the modified societal perspective, and from the societal perspective, lifestyle cost more than placebo but was also more effective as assessed by the qalys that were gained. from a health system perspective, with both costs and health outcomes discounted at 3% per year, the cost of lifestyle compared with placebo was approximately $ 10,000 per qaly gained ; however, metformin had slightly lower costs and nearly the same outcome (as assessed by qalys) as placebo. compared with metformin, lifestyle cost more but produced better health outcomes. from a health system perspective, with both costs and health outcomes discounted at 3% per year, the cost of lifestyle compared with metformin was approximately $ 13,400 per qaly gained. dpp - group lifestyle, like metformin, was generally less expensive and more effective than placebo. differences in costs and qalys and incremental cost - effectiveness ratios for lifestyle and metformin versus placebo and lifestyle versus metformin over 10 years from three alternative perspectives the annual undiscounted, per capita, direct medical costs of lifestyle, metformin, and placebo over 10 years are summarized in table 1 as are the costs of the dpp group lifestyle sensitivity analysis. the cumulative, undiscounted per participant cost of the lifestyle intervention as implemented in the dpp ($ 4,601) was substantially greater than the metformin intervention ($ 2,300) or the placebo intervention ($ 769). the estimated cost of the dpp group lifestyle intervention ($ 3,023) was approximately one - third less than that of the lifestyle intervention. the costs of lifestyle were substantially less during the dppos than during the dpp because of the change from an individual- to a group - implemented intervention and because fewer visits took place. the costs of placebo were higher during the dppos than during the dpp because placebo participants engaged in the group lifestyle intervention. during the dppos, lifestyle and metformin each cost approximately $ 140 per participant per year. the costs of the interventions during the dpp differ somewhat from those reported previously as we have added the costs of fasting glucose and glucose tolerance testing and incorporated generic pricing for metformin (5). undiscounted, per capita, direct medical costs of the dpp / dppos interventions by intervention group and study year ($) a : cumulative, undiscounted, per participant, direct medical costs of the dpp / dppos interventions by intervention group and study year. b : cumulative, undiscounted, per participant, direct medical costs of medical care received outside the dpp / dppos by intervention group and study year. c : cumulative, undiscounted, per participant, total direct medical costs of the dpp / dppos interventions and medical care received outside the dpp / dppos by intervention group and study year. d : cumulative, undiscounted, per participant, total quality of well - being index by intervention group and year. the cumulative, undiscounted per capita direct medical costs of nonintervention - related medical care by intervention group and year following randomization are shown in table 2 and fig. the direct medical costs of nonintervention - related medical care were substantially greater than the costs of the interventions, and within 3 years, the cumulative costs of nonintervention - related medical care exceeded the 10-year cumulative direct medical costs of the interventions. the cumulative per - participant direct medical costs of nonintervention - related medical care increased substantially over time. from the outset of the dpp, the greater cost of nonintervention - related medical care for placebo was largely driven by greater use of outpatient and inpatient services, prescription medications, and by the greater rate of conversion to diabetes with the attendant costs of self - monitoring and laboratory tests (table 2). across treatment groups, the direct medical costs of nonintervention - related medical care were 3444% higher among diabetic participants compared with nondiabetic participants (supplementary table 3). over 10 years, cumulative, per capita nonintervention - related direct medical costs were greater by $ 1,853 and $ 2,905 for placebo compared with metformin and lifestyle, respectively. undiscounted, per capita, direct medical costs of care outside the dpp / dppos by intervention group and study year, and distribution of undiscounted, per capita, 10-year, direct medical costs of care outside the dpp / dppos by intervention group and type ($) over 10 years, the cumulative, undiscounted, per capita direct medical costs of the interventions were greater for participants randomized to lifestyle ($ 4,601) and metformin ($ 2,300) compared with placebo ($ 769). in contrast, the cumulative, undiscounted, per capita direct medical costs of nonintervention - related medical care (medical care received outside the dpp / dppos) were greater for placebo ($ 27,468) than for metformin ($ 25,615) or lifestyle ($ 24,563). by year 10, the cumulative, undiscounted, per capita, total direct medical costs of the interventions and nonintervention - related medical care were higher for lifestyle than for placebo but were lower for metformin than for placebo (fig. supplementary table 4 summarizes the undiscounted, per capita, cumulative, 10-year direct nonmedical costs by intervention group and type defined as diet - related costs, physical activity related costs, transportation - related costs, and participant time - related costs. transportation - related costs were also substantially higher for lifestyle and metformin due to the greater number of study visits. total diet-, physical activity-, and transportation - related costs were greatest for lifestyle but similar for metformin and placebo. participant time related to the interventions (time spent traveling to study visits, at study visits, and for intervention - related calls) was greater for lifestyle and metformin than for placebo. participant time related to medical care outside of the interventions was generally greater for placebo than for metformin or lifestyle. time spent shopping and cooking was the largest component of participant time but differed little across intervention groups. although lifestyle subjects spent more time exercising, the adjusted value of the time they spent exercising was less than for either metformin or placebo because of their greater enjoyment of leisure time physical activity and the lower opportunity cost. the total, per capita, 10-year, direct nonmedical costs including the costs of participant time were lowest for metformin ($ 144,143) and similar for placebo and lifestyle ($ 147,043 and $ 147,493, respectively). every year after randomization, quality of life was better for lifestyle than for metformin or placebo (supplementary table 3). across treatment groups, quality of life was worse among participants who developed diabetes (supplementary table 3). since more placebo participants developed diabetes, the cumulative, undiscounted, per participant quality of well - being score gained over 10 years was greatest for lifestyle (6.81), intermediate for metformin (6.69), and least for placebo (6.67) (fig. table 3 summarizes the differences in total costs and qalys among the treatment groups and the incremental cost - effectiveness ratios of lifestyle and metformin versus placebo, and lifestyle versus metformin. the incremental cost - effectiveness ratio is also shown for the dpp - group lifestyle versus placebo. from the health system perspective, from the modified societal perspective, and from the societal perspective, lifestyle cost more than placebo but was also more effective as assessed by the qalys that were gained. from a health system perspective, with both costs and health outcomes discounted at 3% per year, the cost of lifestyle compared with placebo was approximately $ 10,000 per qaly gained ; however, metformin had slightly lower costs and nearly the same outcome (as assessed by qalys) as placebo. compared with metformin, lifestyle cost more but produced better health outcomes. from a health system perspective, with both costs and health outcomes discounted at 3% per year, the cost of lifestyle compared with metformin was approximately $ 13,400 per qaly gained. dpp - group lifestyle, like metformin, was generally less expensive and more effective than placebo. differences in costs and qalys and incremental cost - effectiveness ratios for lifestyle and metformin versus placebo and lifestyle versus metformin over 10 years from three alternative perspectives using 3 years of dpp data and computer simulation modeling, we and others suggested that screening for glucose intolerance in the overweight and obese population and implementing lifestyle and metformin interventions would have favorable cost - effectiveness ratios (79,16). however, one analysis suggested that lifestyle might be too expensive for health plans or a national program to implement (10). the current study, a 10-year, within - trial, intention - to - treat analysis of the dpp / dppos demonstrates that lifestyle is indeed cost - effective, and metformin is marginally cost - saving or at least cost - neutral compared with placebo. even when the direct nonmedical costs of the interventions are considered, the interventions are cost - effective. health and social policies should support the funding of intensive lifestyle and metformin interventions for diabetes prevention in high - risk adults. when a new treatment is more effective and less costly than usual care, it should be widely adopted and used. unfortunately, fewer than 1 in 5 new interventions in health and medicine are cost - saving compared with usual care (17). published cost - effectiveness ratios that is the cost in dollars per qaly gained for prevention and treatment range from less than $ 10,000 per qaly to greater than $ 1 million per qaly with most falling between $ 10,000 and $ 50,000 per qaly. while influenza immunization has been demonstrated to be cost - saving in the medicare population, interventions such as mammography, antihypertensive treatment, and cholesterol treatment for secondary prevention of cardiovascular disease have been estimated to cost between $ 10,000 and $ 60,000 per qaly (18). widely implemented interventions such as dialysis for end - stage renal disease ($ 50,000 to $ 100,000 per qaly) and left ventricular assist devices ($ 500,000 to $ 1.4 million per qaly) are substantially more expensive. from the perspective of a health system or society, what is the value of delaying or preventing the development of type 2 diabetes ? from a health system perspective, it delays or prevents the direct medical costs of diabetes including the costs of diabetes education and nutritional counseling, glucose monitoring, antihyperglycemic treatments, and surveillance and treatment of complications (1921). from a societal perspective, diabetes prevention also reduces health care related costs to the individual not reimbursed by the health system and time lost from work and usual activities (19). the american diabetes association has estimated that total per capita health care expenditures for people with diabetes are $ 11,744 per year, of which $ 6,649 is attributed to diabetes (19). this estimate likely overstates the costs of diabetes in dpp participants, since dpp participants who developed diabetes were screen - detected very early in their clinical course and had few complications. the costs of diabetes increase with duration of diabetes and with the presence of complications and comorbidities and would be expected to be lower for persons with short durations of diabetes and for those without complications (22). patients with new clinically diagnosed diabetes have been reported to have costs 2.1 times those of individuals without diabetes, and the incremental cost of diabetes is apparent from the time of diagnosis (20). in 2000, using data from a single managed - care health plan, we estimated that the median, annual, direct medical cost of care for a man with diet - controlled type 2 diabetes with no microvascular, neuropathic, or cardiovascular risk factors or complications was approximately $ 1,700 (23). more recently, using data from approximately 7,100 type 2 diabetic patients enrolled in eight managed - care health plans participating in translating research into action for diabetes (triad), we demonstrated that median, annual, per capita, direct medical costs of care were approximately $ 2,500 for a man with recent - onset diabetes without complications or comorbidities (r. li, personal communication). these costs of recent - onset type 2 diabetes are quite consistent with those observed during the dpp / dppos. compared with the substantial costs of diabetes, it is now clear that the use of a 3-year time horizon in our previous within - trial economic analysis resulted in a higher cost per qaly gained than the current analysis, which used a 10-year time horizon (6). with a 3-year time horizon, treatment costs were higher, and the benefits of lifestyle and metformin in terms of averted diabetes were less. the costs of both lifestyle and metformin were greatest in year 1, decreased substantially in years 2 and 3, and decreased further during years 4 through 10. in contrast, much of the benefit of both lifestyle and metformin, as assessed by both cumulative, nonintervention - related direct medical costs and quality of life, occurred after 3 years of follow - up. first, the dppos was an observational follow - up of the dpp, a randomized controlled clinical trial. it is likely that during the dppos, when 57% of placebo participants also attended at least one group lifestyle intervention (help) session, placebo was more effective than the usual care that nonstudy participants might receive (11). thus, if real - world usual care was used for comparison, the difference between lifestyle and placebo might have been greater. the fact that 58% of metformin participants also attended at least one help session may also have made metformin appear more effective and cost - effective compared with lifestyle (11). second, the costs of medical care outside the interventions appear low compared with those reported in the literature for people with diabetes (19). this likely reflects the fact that trial participants were earlier in the natural history of diabetes and were healthier than patients with diabetes in the general population. it is important to note that resource utilization and cost were assessed in an identical fashion across intervention groups so the differences among groups, which determine the incremental cost - effectiveness ratios, should be reasonably accurate. third, in our analysis of the dpp group lifestyle intervention, we assumed that lifestyle could be implemented in a group rather than in an individual format at one - third lower cost and achieve the same outcomes. although group - implemented lifestyle interventions have been shown to be at least as effective as individual programs for weight loss, there has not been a direct comparison of individual and group lifestyle interventions for diabetes prevention (12,13). finally, we recognize that in assessing the direct nonmedical costs of the interventions, we have overestimated diet - related costs. clearly, people need to eat whether or not they participate in a randomized controlled clinical trial. we did not have a good method for distinguishing study - related and nonstudy - related food consumption. nevertheless, the data are instructive in that they indicate that there were not substantial differences in diet - related costs across intervention groups. this 10-year, within trial, intention - to - treat economic analysis of the dpp / dppos demonstrates that lifestyle, when compared with placebo, is cost - effective, and metformin is marginally cost - saving from a health system and societal perspective. if a dpp group lifestyle intervention could be delivered at one - third lower cost than the dpp lifestyle intervention and achieve the same outcomes, it would also be cost - saving or cost - effective compared with placebo. even when compared with metformin, lifestyle was cost - effective from both a health system and societal perspective. these analyses should assist health plans and policy makers in comparing the benefit of diabetes prevention to other preventive and palliative interventions. the adoption of diabetes prevention programs by health plans and society will result in important health benefits over 10 years and represents a good value for the money spent. | objectivethe diabetes prevention program (dpp) and its outcomes study (dppos) demonstrated that either intensive lifestyle intervention or metformin could prevent type 2 diabetes in high - risk adults for at least 10 years after randomization. we report the 10-year within - trial cost - effectiveness of the interventions.research design and methodsdata on resource utilization, cost, and quality of life were collected prospectively. economic analyses were performed from health system and societal perspectives.resultsover 10 years, the cumulative, undiscounted per capita direct medical costs of the interventions, as implemented during the dpp, were greater for lifestyle ($ 4,601) than metformin ($ 2,300) or placebo ($ 769). the cumulative direct medical costs of care outside the dpp / dppos were least for lifestyle ($ 24,563 lifestyle vs. $ 25,616 metformin vs. $ 27,468 placebo). the cumulative, combined total direct medical costs were greatest for lifestyle and least for metformin ($ 29,164 lifestyle vs. $ 27,915 metformin vs. $ 28,236 placebo). the cumulative quality - adjusted life - years (qalys) accrued over 10 years were greater for lifestyle (6.81) than metformin (6.69) or placebo (6.67). when costs and outcomes were discounted at 3%, lifestyle cost $ 10,037 per qaly, and metformin had slightly lower costs and nearly the same qalys as placebo.conclusionsover 10 years, from a payer perspective, lifestyle was cost - effective and metformin was marginally cost - saving compared with placebo. investment in lifestyle and metformin interventions for diabetes prevention in high - risk adults provides good value for the money spent. |
the authors have designed a dual - sided electrosurgery handpiece where a cylindrical electrode used for cutting and a spherical electrode used for coagulation are combined at the opposite ends of the same handpiece allowing alternative use of the two electrodes with a simple handpiece flip. the device could be a simple and safe alternative to the traditional electrosurgery pencil allowing the simultaneous use of two electrodes without the hassle of frequent electrode replacement. direct heating of tissues as a therapeutic tool has been used for thousands of years ; however, it was not until 1900 and only by chance that joseph rivere accidentally proved darsonval s theorem that electric energy could be transformed into heat energy which can be used to coagulate tissues.13 more than 2 decades later, the american plant physiologist william t bovie introduced his electrosurgical unit (esu) to dr harvey cushing, a neurosurgeon from boston, massachusetts, who used the instrument in 1926 to remove a highly vascular brain myeloma, and the era of electrosurgery was officially born.1,3 the two fundamental tissue effects of electrosurgery, ie, cutting and coagulation, involve joule heating of the conductive tissue by high - frequency electric current that leads either to vaporization and ionization of the water content in tissues (cutting), which is achieved with a sinusoidal wave that results in extreme spikes of temperature rise, or thermal denaturation without tissue vaporization (coagulation), which is achieved with a series of discontinuous wave packets where periods of quiescence interrupt the sinusoidal wave cycles and allow the tissues to relatively cool down a little creating a coagulum (figure 1).3,4 electrode geometry is a major factor influencing the final impact that an esu has on tissues. electrodes come in a variety of shapes and designs, each built for a specific purpose, but changing the electrodes during surgery every time the situation demands may be time - consuming ; therefore, we designed a double - sided handpiece to accommodate two electrodes simultaneously where a spherical electrode used for coagulation could be attached to one end of the handpiece, while a cylindrical electrode used for cutting could be simultaneously attached to the other end obviating the need for frequent change of electrode tips. this study was conducted with the approval of the ain shams university ethics committee, and the study protocol was also approved by the university animal ethics committee. our handpiece design conform to the association of surgical technologists recommended standards of practice for use of electrosurgery.5 fifteen wistar albino white rats of similar age and size were maintained and used in accordance with the association for research in vision and ophthalmology statement for the use of animals in ophthalmic and visual research. in addition, our handpiece design fully conformed to the association of surgical technologists recommended standards of practice for use of electrosurgery.5 we designed a prototype dual - sided electrosurgery handpiece allowing automatic switching between two electrodes with a simple handpiece flip. the device was assembled locally in our hospital laboratory by making minor conceptual changes to the traditional design of the two - button electrosurgery pencil that is widely available in every operating theater. instead of the electric current reaching one side of the pencil with the active electrode attached to the other end, and the rest of the probe sealed or coated, the entire shaft was covered with a fire and waterproof electrical insulator leaving only two uncoated ends with empty sockets for electrode placement, thus making both of them simultaneously active. open for electrode fitting, while the other end is prefitted with a ball electrode for coagulation. figures 2 and 3 show the outline of the handpiece in various stages of assemblage and its final design. the design is relatively simple, could be constructed inexpensively, and the handpiece is autoclavable. the animals were bought and kept in the medical research center in ain shams university. they were kept in separate cages in rooms with controlled light and temperature, and were fed standard chow and water ad libitum. intraoperatively, the animals were anesthetized by an intraperitoneal injection of 10 mg / kg xylazine (rompun vet ; bayer ab, solna, sweden) and 40 mg / kg ketamine hydrochloride (ketalar ; pfizer, inc., new york, ny, usa) 5 minutes before the procedure, and monitored by a veterinary technician. rats were positioned on a thermistor - controlled heating pad in the prone position and a rectal probe was inserted. the handpiece was connected to an mc-9 electrosurgery unit (macan, milton, de, usa), at a minimal power setting of 0.5 u in coagulation mode. the cutting tip was used first to create a linear full - thickness incision followed by the coagulation tip which was used with no change of settings on the electrosurgery unit to create two circular coagulation scars (figure 4 a and b). the rats were divided into three sets. in each set of five animals, a specific length of the electrosurgery handpiece was used : set 1 : a 12 cm shaft was used.set 2 : a 16 cm shaft was used.set 3 : a 20 cm shaft was used set 3 : a 20 cm shaft was used. in the early postoperative period, the rats routinely received 3 ml of saline intraperitoneally to compensate for the blood loss during the surgical procedure which was minimal because of the use of cautery. the rats were kept in ventilated cages and maintained on normal diet and water for 2 weeks, and the wounds were dressed daily by 10% povidone - iodine. after 2 weeks, the wounds were evaluated and documented photographically ; then the animals were sacrificed and the visible scars were excised and submitted for histopathological examination. this study was conducted with the approval of the ain shams university ethics committee, and the study protocol was also approved by the university animal ethics committee. our handpiece design conform to the association of surgical technologists recommended standards of practice for use of electrosurgery.5 fifteen wistar albino white rats of similar age and size were maintained and used in accordance with the association for research in vision and ophthalmology statement for the use of animals in ophthalmic and visual research. in addition, our handpiece design fully conformed to the association of surgical technologists recommended standards of practice for use of electrosurgery.5 we designed a prototype dual - sided electrosurgery handpiece allowing automatic switching between two electrodes with a simple handpiece flip. the device was assembled locally in our hospital laboratory by making minor conceptual changes to the traditional design of the two - button electrosurgery pencil that is widely available in every operating theater. instead of the electric current reaching one side of the pencil with the active electrode attached to the other end, and the rest of the probe sealed or coated, the entire shaft was covered with a fire and waterproof electrical insulator leaving only two uncoated ends with empty sockets for electrode placement, thus making both of them simultaneously active. open for electrode fitting, while the other end is prefitted with a ball electrode for coagulation. figures 2 and 3 show the outline of the handpiece in various stages of assemblage and its final design. the design is relatively simple, could be constructed inexpensively, and the handpiece is autoclavable. the animals were bought and kept in the medical research center in ain shams university. they were kept in separate cages in rooms with controlled light and temperature, and were fed standard chow and water ad libitum. intraoperatively, the animals were anesthetized by an intraperitoneal injection of 10 mg / kg xylazine (rompun vet ; bayer ab, solna, sweden) and 40 mg / kg ketamine hydrochloride (ketalar ; pfizer, inc., new york, ny, usa) 5 minutes before the procedure, and monitored by a veterinary technician. rats were positioned on a thermistor - controlled heating pad in the prone position and a rectal probe was inserted. the handpiece was connected to an mc-9 electrosurgery unit (macan, milton, de, usa), at a minimal power setting of 0.5 u in coagulation mode. the cutting tip was used first to create a linear full - thickness incision followed by the coagulation tip which was used with no change of settings on the electrosurgery unit to create two circular coagulation scars (figure 4 a and b). the rats were divided into three sets. in each set of five animals, a specific length of the electrosurgery handpiece was used : set 1 : a 12 cm shaft was used.set 2 : a 16 cm shaft was used.set 3 : a 20 cm shaft was used. set 2 : a 16 cm shaft was used. set 3 : a 20 cm shaft was used. in the early postoperative period, the rats routinely received 3 ml of saline intraperitoneally to compensate for the blood loss during the surgical procedure which was minimal because of the use of cautery. the rats were kept in ventilated cages and maintained on normal diet and water for 2 weeks, and the wounds were dressed daily by 10% povidone - iodine. after 2 weeks, the wounds were evaluated and documented photographically ; then the animals were sacrificed and the visible scars were excised and submitted for histopathological examination. a normal healing process including epithelialization and wound contraction was observed in most animals at 2 weeks, and no evidence of ischemia, ulceration, or infection was noted in any of the wounds ; however, one of the animals from set 1 and another from set 2 had partial dehiscence of the linear wound. set 1 : we did not encounter direct or capacitive coupling in any animal (unintended tissue injury through the spread of electric current from the unused electrode to an adjacent metallic surgical instrument either directly or indirectly through insulators), dielectric burns (unintended injury to the surgical team through breakdown of nonconductive material like rubber gloves), operating theater fires, or animal / surgical team burns. sets 2 and 3 : results were similar to set 1, but we did, however, find out that we had to use extreme caution when using these extraordinary long shafts. personal injury or injury to the nursing staff is possible with the unused end of an unusually long shaft. sections examined from the skin of the rats in all three sets revealed an intact covering of stratified squamous epithelium, with no ulceration or erosions. there was no evidence of excessive fibrosis or inflammation in the dermis (figure 4). sections examined from the skin of the rats in all three sets revealed an intact covering of stratified squamous epithelium, with no ulceration or erosions. there was no evidence of excessive fibrosis or inflammation in the dermis (figure 4). conventional electrosurgery has been available in operating theaters for almost a century and although the shape and design of esus have changed dramatically, the fundamental principles of electrosurgery have not changed much, and with the exception of the introduction of adaptive generators, innovations have been limited.1 basically, electrosurgery is the process where a high - frequency electrical current is applied to biologic tissues to achieve specific thermal effects like cutting or coagulation. one electrode delivers the current to the tissues while the other electrode returns the current to the machine. the human body acts as the source of electrical resistance (impedance) and completes the circuit.6 to help explain our design in precise electrical terms, we have to understand that it is analogous to connecting an electrical circuit in parallel. in parallel circuits voltage the total current is the sum of currents flowing though all branches (figure 4), and the current in each branch in a parallel circuit is totally independent of the other branch and is calculated by ohm s law as follows : i = vr in layman s terms, in parallel circuits each component behaves as if it is connected alone to the electric source and current flow is dependent mainly on the resistor in individual components so the total current could simply be calculated as follows : i = vra+vrbwhere i is the total current across the circuit, v is the voltage which in parallel circuits is the same in all branches, ra is the impedance of the active electrode, and rb is the impedance of the inactive electrode (figure 5). there will be little resistance in the inactive branch which is only due to the resistance of the electrode material itself which is very low. current will flow in both branches, with considerably more flowing in the inactive electrode because according to ohm s law, current flows in the path of least resistance. although we could infer from the previously mentioned formula that for a given energy output on the esu, the final effect on tissues would be less than when using a traditional electrosurgical pencil ; in fact, that this is of little clinical relevance because the final effect of electrosurgery on tissues depends on several variables, which include, in addition to the current, the tissue resistance, the speed of motion through tissues, the pressure applied by the surgeon s electrosurgical instrument on tissues, the type of waveform (ie, continuous or intermittent), and finally electrode design and geometry.1,79 the effect of all these factors could be summarized by joule s first law : t = j2rtwhere t denotes the local rise in temperature, j is the current density (current / cross - sectional area), t is the time or duration of application of the current, and r is tissue resistance.1,4,10,11 it is clear from the equation mentioned earlier that the square of current density is positively correlated with the final rise in temperature ; therefore, electrode size or shape has a direct bearing on the final tissue effect, as the heat produced is inversely proportional to the surface area of the electrode. the smaller the electrode, the more localized is the current concentration, which ultimately creates more intense heating at tissue level.1,12 electrodes could be broadly classified into two categories : spherical or ball electrodes for coagulation and cylindrical electrodes for cutting.4 the cutting mode works by sending electric sparks that produce intense localized heat at the surgical site high enough to vaporize tissues ahead of the active electrode, thus behaving like a traditional scalpel blade ; however, it is inconceivable that blunt, usually rounded ball, electrodes can cut through any tissue at all even if the esu is in the cutting mode. conversely, ultrathin cutting electrodes with their markedly localized tissue heating effect would not provide the ideal desiccation tool.12 theoretical bases aside, both electrode categories claim special usage in everyday oculoplastic practice. the merits of using ultrathin microdissection needles for precise soft tissue dissections, and the safety of using ball electrodes while applying desiccation in the vicinity of the globe has led some authors to claim that electrode geometry is the most important factor controlling the quality of hemostasis or the finesse of a cut.13 surgeons handle hemostasis differently. certainly, a case could be made for the simultaneous use of a bipolar and a monopolar handpiece ; the monopolar handpiece for cutting and the bipolar forceps for coagulation, but both having cords in juxtaposition in the surgical field could induce capacitative or direct leakage of electrical current from the monopolar to the bipolar cord, or inadvertent activation of the either tool, and subsequent burns.1,14 besides, a single handpiece that does both jobs simplifies matters and relieves the operating room staff from the complexity of having too many tools in the operative field. alternatively, other surgeons use a monopolar handpiece alone. a meticulous surgeon would regularly change electrodes, and alter the mode dial on the esu or pencil every time the situation demands it, which may be quite cumbersome. some simply change the mode dial on the machine, or on the pencil while using a single universal needle or blade electrode as a trade - off, while others use the electrode tip for cutting, and then maneuver the handpiece and use the side of the same electrode for coagulation. manipulating the handpiece again our design enables simultaneous cutting or coagulation with the proper electrodes at the discretion of the surgeon without wasting time locating, attaching, or removing several electrodes, but it is not without drawbacks. with the exception of handpiece insulation failure which still lingers as one of the few remaining dangers of modern electrosurgery,7 electrosurgical injuries in the operating theater have been practically eliminated;15 therefore, it may be counterintuitive to create an artificial insulation failure environment by having two electrodes that are simultaneously active at the same time, with one of them hanging uninsulated in the air. given our understanding that electricity always flows along the path of least resistance,16 we would expect current flow through the unused electrode to be extremely high and therefore any accidental contact with this low impedance electrode could in theory subject the recipient to stray radiofrequency current and extremely high temperatures.2,5 however, as we mentioned earlier, we did not encounter a single case of capacitative failure or dielectric breakdown or any accidental burn to the surgical team or our animals. technically, none of these idiosyncrasies traditionally linked to the use of esus could be encountered because the unused electrode is always well away from the surgical field or any metal instrument, so capacitative or direct coupling or unintended burns are not physically possible (figure 3). more importantly, we have found that reducing the length of the handpiece down to 12 cm (set 1) would allow it to rest comfortably in the operator s hand without being too long or too short to further minimize the risk of any potential burn to the scrubbed nurse or the surgeon, respectively (figure 3). alternatively, an autoclavable plastic cap could be used as a temporary cover for the unused electrode. in fact, we could counter argue that by creating a controlled defect in the insulation, our design merely exploits in a precise and exact manner the insulation failure issue which still haunts modern electrosurgery.14 a further improvement that would possibly safeguard against any potential hazard could be the addition of a single - pole double - throw switch to act as a safety valve against accidental injury by the unused electrode ; however, our limited technical staff and our low resources prevented us from developing such a switch. besides, we believe that the addition of a switch defies our notion of design simplicity. in conclusion, although our design offers the clear advantage of using two different electrodes simultaneously, this comes at the price of a theoretical burn risk which we acknowledge was never encountered so far. it would be rather rash to assume that the design in question is superior to the traditional bipolar / monopolar combination frequently used by many surgeons around the world, or the gold standard electrosurgery pencil with the typical cutting / coagulation buttons near the tip.17 there may be advantages and disadvantages inherent in each design. as with all surgical disciplines, different surgeons may employ or favor a slightly dissimilar surgical approach for the management of the same disease, and while we may proceed at length to offer spirited debates about the advantages of our design, we acknowledge that all prior well - established designs yield an equally decent job, and they are all a testament to the success of electrosurgery and a tribute to all those innovators at the turn of the previous century who made it possible. | objectiveto introduce and evaluate the safety of a novel dual - sided electrosurgery handpiece design for simultaneous tissue cutting and coagulation.methodswe designed a prototype double - sided handpiece allowing automatic switching between two electrodes with a simple handpiece flip. the concept of the system as a surgical instrument was assessed by an animal experiment.resultsthe skin of 15 wistar albino white rats could be successfully incised and coagulated using both ends of the handpiece, thereby confirming the prospects and clinical applications of the system.conclusionthe dual - sided electrosurgery handpiece is a simple and safe alternative to the traditional electrosurgery pencil, allowing the simultaneous use of two electrodes without the hassle of frequent electrode replacement. |
chronic complications are the major outcome of type 2 dm (t2 dm) progress, which reduces the quality of life of patients, incurs heavy burdens to the healthcare system, and increases diabetic mortality. after adjusting for age, the death rate of people with t2 dm is about twice as high as their non - diabetic peers. about 50 - 80% of all individuals with diabetes die of cardiovascular and cerebrovascular diseases. the fall of glomerular filtration rate (gfr) in case of diabetic nephropathy is usually rapid and appears to be linear with time. hyperlipidemia has received attention as one of the factors incriminated in this process by participation in the progression of glomerular injury. more rapid decline of renal function has been observed in diabetic nephropathy patients with hyperlipidemia than in those without it. prospective studies suggested that an adverse lipid profile might cause nephropathy in both type 1 and type 2 diabetic patients through possible mechanisms, including mesengial cell proliferation, recruitment of macrophages, altered cytokine responses, and increased matrix deposition. low density lipoprotein (ldl) consists of a heterogeneous spectrum of particles with highly variable atherogenic potential. small dense ldl (sdldl) particles are believed to be particularly atherogenic due to increased susceptibility to oxidation, high endothelia permeability, decreased ldl receptor affinity, and an increased interaction with matrix components. on the other hand, ldl size seems to be an important predictor of cardiovascular events and progression of coronary artery disease, and a predominance of sdldl has been accepted as an emerging cardiovascular risk factor by the national cholesterol education program adult. a number of studies have demonstrated a high prevalence of sdldl particles in t2 dm patients with nephropathy as compared with that in t2 dm without nephropathy or in non - diabetic controls. the high prevalence of small - sized ldl may in part explain the high incidence of coronary heart disease in diabetes with nephropathy. in view of all these considerations, this study aims to assess sdldl as a potential risk factor and a possible predictor for diabetic nephropathy in t2 dm. the study was conducted on diabetic attendants of outpatient diabetes and general medicine clinics of suez canal university hospital from january 2011 to june 2012. after exclusion of those at risk of developing sdldl in blood or urinary albumin excretion (e.g., with positive suggestive history or criteria of type 1 diabetes, hypertension, obesity, high - fat intake or on lipid - regulating agents, beta blockers or ace inhibitors therapy, chronic liver disease, heart failure, and post - streptococcal glomerulonephritis), 20 consecutive adults with t2 dm and persistent microalbuminuria were enrolled for the study (group a). another 20 adults with t2 dm who were free of microalbuminuria and age and gender matched were included in group b. patients of both the groups underwent a detailed history taking, physical examination, and the following laboratory investigations : 24-h urine collection for microalbuminuria, glycated hemoglobin (hba1c), fasting blood sugar (fbs), serum creatinine, blood urea, triglyceride, total cholesterol, hdl - c, and small dense ldl - c. the analyses were done by standard protocols at the department of clinical pathology in suez canal university hospitals. samples were collected from each individual at a single time point and kept at 70c until analysis. all abnormal tests were confirmed in two out of three samples collected over a 3 - 6-month period. tests were not performed in the presence of conditions that could increase microalbuminuria, such as hematuria, urinary tract infection, acute febrile illness, short - term obvious hyperglycemia, and vigorous exercise. according to modified diet in renal disease (mdrd), which estimates gfr, diabetic patients were categorized into other three subgroups : patients with normal gfr (gfr > 90 ml / min/1.73 m)patients with mild decrease in gfr (gfr of 60 - 89 ml / min/1.73 m)patients with moderate decrease in gfr (gfr of 30 - 59 ml / min/1.73 m). the recommended equation by the national kidney foundation is that of the mdrd (modified diet in renal disease) : patients with normal gfr (gfr > 90 ml / min/1.73 m) patients with mild decrease in gfr (gfr of 60 - 89 ml / min/1.73 m) patients with moderate decrease in gfr (gfr of 30 - 59 ml / min/1.73 m). the recommended equation by the national kidney foundation is that of the mdrd (modified diet in renal disease) : gfr (ml min 1.73 m) = 186 [serum creatinine (mg / dl) age (years) (0.742 if female) (1.210 if african american) ] informed consent was obtained from the patients. the study was approved by the ethics committee of faculty of medicine, suez canal university. student 's t - test, correlation coefficient, and chi - square test were used to evaluate the results presented through tables and diagrams. the sensitivity, specificity, and positive and negative predictive values were calculated according to the standard formulae. statistical significance was considered at p 0.05). however, statistically significant correlation between sdldl and albuminuria in all patients in the study - if considered as a one group- was found (p 55.14 mg / dl regarding albuminuria. on the other hand, the sensitivity and specificity of sdldl were 88.24% and 73.91% respectively, with cutoff values of sdldl > 41.89 mg / dl based on the decreased gfr [table 1 ]. sdldl serum level was slightly higher in type 2 diabetic patients with microalbuminuria than in type 2 diabetic patients without microalbuminuria, with significant correlation with the microalbuminuria values. this is in accordance with findings observed by hirano., who found that ldl particle diameter was significantly smaller in type 2 diabetic patients with nephropathy as compared with in those without nephropathy. in addition, the current data are in agreement with those in previous studies that documented that all multiple lipoprotein abnormalities described in diabetic patients with nephropathy become more accentuated with increasing urinary albumin excretion. in addition to highly significant inverse correlation between microalbuminuria and estimated gfr, statistically highly significant inverse correlation between sdldl and estimated gfr were observed in this study in all patients. this is in agreement with chowta., who found that creatinine clearance negatively correlated with microalbuminuria. in contrary, another study suggested that the high prevalence of sdldl in t2 dm with nephropathy is not directly associated with kidney damage. serum creatinine and urea were significantly higher in the microalbuminuria positive group than in the microalbuminuria negative group. although there was no statistically significant correlation between urea and sdldl in each group, the correlation between serum creatinine and sdldl was statistically significant. this is in accordance with other different studies that revealed that all multiple lipoprotein abnormalities described in diabetic patients with nephropathy become more accentuated with decreasing renal functions. statistically significant positive correlation between degree of diabetes control as presented by either fbg or hb a1c and sdldl is shown in all patients. on the other hand, fbg and hba1c were insignificantly higher in the microalbuminuria positive group than in the microalbuminuria negative group. moreover, no statistically significant correlation was found between duration of diabetes and either sdldl or microalbuminuria ; this does not agree with the findings of chowta., who found that average fbs was significantly higher in microalbuminuria patients than in normo - albuminuric patients and suggested significant relationship between both severity and duration of diabetes and microalbuminuria. the conflict between both the studies may be explained by the variations of the sample size and duration of diabetes. in addition, those with short - term pronounced hyperglycemia at the time of sampling were excluded from the study. this is in agreement with american diabetes association, which state that the gender difference of small dense ldl - c disappears after adjustment for tg, which is a significant determinant of small dense ldl - c. this was in contrast with the findings of hirano., who found that small dense ldl - c was higher in males than in females. cholesterol, triglycerides, and ldl - c are higher in the microalbuminuria positive group than in the microalbuminuria negative group, although high - density lipoprotein cholesterol (hdl) was lower ; this was in accordance with other studies. observations recorded by other studies state that this becomes more apparent when diabetic nephropathy is present. on the other hand, statistically highly significant correlation between sdldl and cholesterol, triglycerides, and ldl had a highly significant inverse correlation between sdldl and hdl. this is agree with american diabetes association, which report that sdldl levels are positively correlated with serum triglyceride and ldl - c and that these levels were inversely correlated with hdl - c values. the sensitivity of sdldl in the diagnosis of diabetic nephropathy based on estimated gfr was higher than its specificity in nephropathy diagnosis based on microalbuminuria. sdldl cutoff values > 55.14 mg% and > 41.89% may be considered as a predictor values for nephropathy based on microalbuminuria or on gfr, respectively. sdldl is suggested to be the diagnostic biomarker used in conjunction with other biochemical markers for early diagnosis, assessment, and follow - up of diabetic nephropathy among t2 dm. to investigate this hypothesis, further studies should be undertaken to evaluate sdldl levels in correlation to kidney histopathological profile in a relatively larger number of patients with diabetic nephropathy. sdldl levels in the microalbuminuria positive group was insignificantly higher than those in the microalbuminuria negative group, but it was significantly higher in patients with either mild or moderate decrease in estimated gfr than in patients with normal estimated gfr. there was a significant correlation between sdldl and albuminuria, and a highly significant inverse correlation between sdldl and estimated gfr. from all of the previously mentioned data, we can suggest that sdldl can be considered as a potential risk factor for diabetic nephropathy and subsequent changes in the renal function. given that sdldl positively correlated with microalbuminuria and negatively with gfr, ldl can be considered as a diagnostic biomarker and predictor in conjunction with other parameters for early diagnosis and follow - up of diabetic nephropathy among type 2 diabetic patients. | background : the risk for diabetic nephropathy in type 2 diabetes is about 30 - 40%, and it is considered the leading cause of end - stage renal disease. small dense low - density lipoprotein (sdldl) particles are believed to be atherogenic, and its predominance has been accepted as an emerging cardiovascular risk factor. this study aimed to assess small dense ldl as a potential risk factor and a possible predictor for diabetic nephropathy in type 2 diabetic patients.patients and methods : according to microalbuminuria test, 40 diabetic patients were categorized into two groups : diabetic patients without nephropathy (microalbuminuria negative group) and diabetic patients with nephropathy (microalbuminuria positive group), each group consists of 20 patients and all were non - obese and normotensive. the patients were re - classified into three sub - groups depending on the glomerular filtration rate (gfr).results : the mean of small dense ldl level in the microalbuminuria positive group was higher than that in the microalbuminuria negative group, but without statistical significance. it was significantly higher in patients with either mild or moderate decrease in estimated gfr than in patients with normal estimated gfr. there was statistically significant correlation between small dense ldl and albuminuria and significant inverse correlation between small dense ldl and estimated gfr in all patients in the study. based on microalbuminuria, the sensitivity and specificity of small dense ldl in the diagnosis of diabetic nephropathy was 40% and 80%, respectively, with cutoff values of small dense ldl > 55.14 mg / dl. on the other hand, based on gfr, the sensitivity and specificity were 88.24% and 73.91% respectively, with cutoff values of small dense ldl > 41.89 mg / dl.conclusion : small dense ldl is correlated with the incidence and severity of diabetic nephropathy in type 2 diabetic patients. it should be considered as a potential risk factor and as a diagnostic biomarker to be used in conjunction with other biochemical markers for early diagnosis, assessment, and follow - up of diabetic nephropathy. |
heart failure (hf) is a common medical problem, in which the heart fails to meet the peripheral tissue demands at a normal filling pressure. the global prevalence of hf is estimated to be 2.33.9% per annum.[24 ] around 25 million people around the world are suffering from hf, and each year 2 million new cases of hf are diagnosed. it has a high mortality and morbidity rates and an enormous impact on health care system and public health.[510 ] the incidence and prevalence of hf continue to increase likely due to therapeutic improvement in the treatment of acute myocardial infarction and hypertension and also due to increase in the aging population. evidence from the literature showed that gender discrepancies in hf management may exist.[1116 ] elderly women make up a greater proportion of hf patients in those over 75 years of age. earlier studies such as framingham reported better survival among female patients with hf compared to males. other recent trials with accurate assessment of left ventricular function showed contradicting results where female patients with hf had a higher mortality rate. although gender bias in ischemic heart disease (ihd) management is well studied,[1829 ] the evidence of gender bias in hf management is scarce. the aseer region (population of 1,200,000) is located in the southwest of saudi arabia covering an area of more than 80,000 km. the region extends from the high mountains of sarawat (with an altitude of 3200 m above sea level) to the red sea. health service delivery in the aseer region is provided by a network of 244 primary health care centers, 16 referral hospitals and one tertiary hospital, aseer central hospital (ach). ach, with 500 beds, is run by the ministry of health and the college of medicine of king khalid university (kku), abha. this study was designed to investigate whether gender difference exists in the management of hf patients admitted to ach, aseer region / saudi arabia. a retrospective cohort of all consecutive patients admitted to ach with the diagnosis of hf during the period from june 2007 to may 2009 were studied. these data including the clinical profile of hf (demographic data, etiologic factors for hf, associated risk factors for hf such as : diabetes, hypertension, atrial fibrillation, and renal failure), and echocardiographic features. frequency, percentage, mean, standard deviation, and median were used to present the data. chi square and the student t were used as tests of significance at the 5% level. a total of 206 male patients (68.7%) and 94 female patients (31.3%) with the diagnosis of hf were included. male patients were significantly older than female patients (68.83 13.5 vs. 64.33 13.5, respectively, p < 0.008). gender differences in clinical profile of heart failure patients as an etiology for heart failure ischemic heart disease and dilated cardiomyopathy were significantly higher in male patients than female patients (42.7 vs. 28.7%, p < 0.021) and (13.1 vs. 3.2%, p < 0.008), respectively, the prevalence of other etiologies were the same in both genders. regarding the associated risk factors for hf, smoking was significantly higher in male patients (11.7 vs. 0%, respectively, p < 0.001), whereas atrial fibrillation and renal dysfunction were significantly higher in female patients (20.2 vs. 10.2%, p < 0.018) and (20.2 vs. 5.3%, p < 0.001), respectively. echocardiography was performed for the vast majority of male and female patients equally (99% and 97.9%, respectively, p = 0.42). however, ejection fraction was significantly higher in female patients compared to male patients (38.2% 16.9 vs. 30.4% 16.6, respectively, p < 0.001). male patients with hf were prescribed ace inhibitors and digoxin less significantly than female patients (64.1 vs. 75.5%. p < 0.049) and (24.8 vs. 36.2%, p < 0.042), respectively. whereas female patients with hf were prescribed beta - blockers and nitrate therapies less significantly than male patients (36.2 vs. 57.8%, p < 0.001) and (13.8 vs. 35.4%, p < 0.001) respectively. in addition, aspirin and lipid lowering therapies were prescribed significantly less for female patients with hf compared to male patients (64.9 vs. 84.5%, p < 0.001) and (22.3 vs. 48.5%, p < 0.001), respectively. the rest of therapeutic agents used in treatment of hf were prescribed for both sexes without a significant difference. male patients were significantly older than female patients (68.83 13.5 vs. 64.33 13.5, respectively, p < 0.008). gender differences in clinical profile of heart failure patients as an etiology for heart failure ischemic heart disease and dilated cardiomyopathy were significantly higher in male patients than female patients (42.7 vs. 28.7%, p < 0.021) and (13.1 vs. 3.2%, p < 0.008), respectively, the prevalence of other etiologies were the same in both genders. regarding the associated risk factors for hf, smoking was significantly higher in male patients (11.7 vs. 0%, respectively, p < 0.001), whereas atrial fibrillation and renal dysfunction were significantly higher in female patients (20.2 vs. 10.2%, p < 0.018) and (20.2 vs. 5.3%, p < 0.001), respectively. echocardiography was performed for the vast majority of male and female patients equally (99% and 97.9%, respectively, p = 0.42). however, ejection fraction was significantly higher in female patients compared to male patients (38.2% 16.9 vs. 30.4% 16.6, respectively, p < 0.001). male patients with hf were prescribed ace inhibitors and digoxin less significantly than female patients (64.1 vs. 75.5%. p < 0.049) and (24.8 vs. 36.2%, p < 0.042), respectively. whereas female patients with hf were prescribed beta - blockers and nitrate therapies less significantly than male patients (36.2 vs. 57.8%, p < 0.001) and (13.8 vs. 35.4%, p < 0.001) respectively. in addition, aspirin and lipid lowering therapies were prescribed significantly less for female patients with hf compared to male patients (64.9 vs. 84.5%, p < 0.001) and (22.3 vs. 48.5%, p < 0.001), respectively. the rest of therapeutic agents used in treatment of hf were prescribed for both sexes without a significant difference. the primary finding of this study relates to the presence of sex differences in both clinical presentation as well as management of hf patients admitted to ach. some of these differences are related to biologic differences between both genders, but others could be due to true gender bias in management of hf patients. in our series ischemic etiology of hf was found more significantly in male patients compared to female patients. this sex difference was reported in other studies.[113032 ] it is a well known fact that the male gender is a risk factor for ihd. hf due to ihd carries a worse prognosis than hf due to nonischemic causes, thus this finding of less prevalence of ihd in female patients with hf may reflect on better outcomes compared to male patients. smoking was significantly less in female patients compared to male patients, which was likely due to the local saudi conservative sociocultural environment. renal failure and atrial fibrillation are known risk factors for hf which make prognosis worse when they are associate with hf. in our study, both risk factors were significantly more in female patients with hf compared to male patients. echocardiography is the mainstay investigational tool for the assessment of left ventricular function in hf patients, our series showed that echocardiography was performed on the vast majority of patients with hf, and there was no evidence of gender difference in utilizing this important investigation. other reports showed evidence of sex - linked differences in investigating hf patients with less utilization of echocardiography in female patients with hf. ejection fraction is a practical and useful tool for assessing left ventricular function in hf patients and implicates a prognostication value. female patients in our series had a better ejection fraction values compared to male patients, a similar finding detected in other studies. this might reflect on a better survival in female patients with hf compared to male patients. certain therapeutic agents have shown survival benefit and improve morbidity when prescribed to hf patients (beta - blockers, ace inhibitors, k - sparing diuretics, and digoxin).[3646 ]. in our series female patients with hf were significantly prescribed less beta - blockers than male patients with hf. male patients with hf were prescribed significantly less ace inhibitors and digoxin compared to female patients with hf. the underutilization of beta - blockers in female patients with hf could be due to true gender bias or to lower incidence of ischemic etiology for hf in female patients, in which beta - blockers are indicated for ischemic indication. while underutilization of ace inhibitors and digoxin in male patients with hf compared to female patients with hf was an unexpected finding, this could be a true paradoxical gender bias (i.e. this time against male patients). there is no logical explanation for under - prescribing both therapies to male patients with hf. interestingly a similar earlier finding was reported regarding under - prescription of digoxin to male compared to female patients. in conclusion, several baseline clinical and echocardiographic features were found in our series to differ significantly between women and men. some characteristics are expected to confer a better prognosis, namely having a higher prevalence of nonischemic etiology, higher left ventricular ejection fraction. some other features, however, have been related to worse outcome including higher prevalence of atrial fibrillation and renal dysfunction. female patients were prescribed less beta - blockers while male patients were prescribed less ace inhibitors and digoxin. the presence of this gender difference in the management of hf should be avoided by better adherence to evidence - based medicine regardless of a patient 's gender. | background : heart failure (hf) is a common medical problem with a high impact on public health. evidence of gender difference in management of hf is scarce. we conducted a retrospective study to evaluate the presence of gender difference in management of hf patients admitted to the tertiary care hospital in the aseer region / saudi arabia.patients and methods : a chart review was conducted at aseer central hospital (ach) on consecutive patients admitted with the primary diagnosis of hf between jun 2007 and may 2009. data were collected on clinical and management profiles and analyzed for the presence of gender difference in hf management.results:a total of 206 male patients and 94 female patients with hf were reviewed. ischemic and dilated cardiomyopathy etiologies were significantly higher in male patients (42.7 vs. 28.7%, p < 0.021) and (13.1% vs. 3.2%, p < 0.008), respectively. renal failure and atrial fibrillation were significantly higher in female patients with hf (20.2 vs., 5.3% p < 0.001) and (20.2 vs. 10.2%, p < 0.018), respectively. smoking was significantly higher in male patients (11.7 vs. 0%, p < 0.001). echocardiography was performed equally for both genders and ejection fraction was significantly higher in female patients (38.2 16.9% vs. 30.4 16.6%, p < 0.001). beta - blockers were prescribed significantly less to female patients (36.2 vs. 57.8%, p < 0.001), while ace inhibitors and digoxin were prescribed significantly less to male patients (64.1 vs.75.5%, p < 0.049) and (24.8 vs. 36.2%, p < 0.042), respectively.conclusion:gender differences were detected in clinical presentation and management of hf. female patients with hf had less ischemic etiology and smoking, but more atrial fibrillation and renal dysfunction. female patients were under - treated by beta - blockers while male patients were under - treated by ace inhibitors and digoxin. both genders were investigated equally, and female patients had a better ejection fraction. |
natural orifice translumenal endoscopic surgery (notes) is on the forefront of surgical technique and is pushing the perceptions and boundaries of abdominal surgery, as laparoscopy did when first introduced. however, in spite of enthusiasm on behalf of researchers for the technical aspects of notes, what will truly lead to its wider implementation will be improved patient outcomes and acceptance. while better patient outcomes (less postoperative pain, fewer if any scars, and decreased length of hospital stay) are touted to be the main goal of this technique however, patient acceptance of the procedure and its risks can be assessed through surveys in advance of outcomes data. though multiple studies have addressed attitudes towards this developing technique, the ability to interpret these variable study results is challenging. secondly, the larger scale studies have come mainly from europe, thus making direct inferences to a north american population potentially incorrect. finally, these surveys have emphasized gender and age as variables in assessing interest in notes but have not assessed whether previous surgery affects patients perceptions of scars and postsurgical pain. it is known that obese patients are at higher risk for developing postoperative hernias and wound infections [14 ] and thus may be a group that could derive significant benefit from notes. in this paper, we surveyed a large number of patients at a canadian centre to assess opinions regarding scarless surgical procedures and whether increased risks would affect their choices. a large sample also allowed for subgroup analyses based on gender, age, and body mass index. the survey instrument was developed by a team of general surgeons, gastroenterologists, and a statistician. approval for the study was obtained from the queen 's university health sciences & affiliated teaching hospitals research ethics board. a pilot study was performed with 10 people and feedback incorporated into the survey tool. the final survey was comprised of demographic data (age, gender, self - reported height and weight), as well as questions regarding previous surgery and presence and location of scars. patients were then asked about the importance of scars, bother from scars, interest in scarless surgery, interest in scarless surgery if there were increased complications, acceptable complication rate (from 0% to 20%), importance of research into the field, and importance of shorter recovery from surgery. these were all graded on a five - point scale (see the appendix). all patients attending general surgery outpatient clinics (excluding breast clinics) at hotel dieu hospital an ambulatory based hospital providing secondary and tertiary care to residents of kingston, ontario, and the surrounding area were invited to fill out a short questionnaire regarding notes over a 6-month period in 2008 - 2009. surveys were distributed and collected by study hospital staff and deposited in a collection box, which was emptied on a weekly basis to avoid any chance of patient identification. the actual response rate could not be calculated, as the surveys were anonymous and clinic staff did not track the number of patients who were uninterested in responding. however, anecdotal evidence suggests that the patients were generally happy to complete the short survey while they waited. in the event that several appointments were scheduled, patients were asked to complete the survey only once. data were entered into an excel spreadsheet designed for the study and entered into spss (version 17.0 for windows, 2009, chicago, il) for statistical analysis. body mass index (bmi) was calculated according to the standard formula of weight (kg) divided by height (metres) squared. bmi was then classified using the standard cutpoints of 18.524.9 (healthy weight), 2529.9 (overweight), 3034.9 (obese i), 3539.9 (obese ii), and 35 (obese iii). two who were just below the 18.5 threshold were included with the healthy weight group. data were initially assessed descriptively (mean, standard deviation and range for continuous and ordinal data, frequency and percent for categorical data) and graphed to assess the underlying distribution. responses to the 5-level likert scales (1 = no importance, bother, or interest and 5 = extremely important, bothered, or interested) were quantified so that means and standard deviations could be generated. although the data are ordinal in nature and the use of inferential statistics is not optimal in this situation, they were used for several reasons. first, this was considered preferable to a large volume of chi - square tests. a comparison of medians was also considered but while groups often had similar median values, subtle differences emerged when means were used. finally, the sample size for the majority of the comparisons was sufficiently substantial to allow the use of inferential statistics in this situation. the associations of age and body mass index with the seven questions were assessed by means of the nonparametric spearman 's correlation. the association of gender and presence of a previous surgical scar (abdominal or nonabdominal) with the seven questions was assessed by means of the mann - whitney u test, while the association for the three levels of age and bmi were assessed by means of the kruskal - wallis test. in order to provide an adequate sample to allow for subgroup analysis, for all analyses, the significance level was set at p < 0.05 (two - sided), although results that fell short of statistical significance were noted if they were deemed to be of clinical interest. nine percent were 29 years of age, 26% were 3049 years, and 64% were 50 years ; for bmi, 29.9% were at a healthy weight, 34.9% were overweight, and 29.6% were obese (6% were missing height and/or weight). as this was a voluntary, anonymous survey, there were very few missing data (see table 2). for the few items that were missing, analyses were completed on the subset without missing data, as the type of detailed information typically required for imputation was not collected. younger respondents (< 50 years of age), females, and those of a healthy weight indicated that cosmetic issues such as scars were more important, as compared to older, male, and heavier respondents (p 0.001 for all three comparisons) (table 3). amongst of these, 58% indicated that it did not bother them at all, but 9.9% indicated that they were bothered quite a bit or extremely by their scar(s). women placed significantly greater importance on abdominal scars than men and were more greatly impacted by them ; fifty - six percent of women were bothered by some degree by their current scars as compared with 23% of men (p < 0.001). age (as a continuous variable) was negatively correlated with the importance and impact of abdominal scars ; in other words, as age increased, the importance and impact of abdominal scars decreased (p < 0.001, see figure 1 for importance). similarly, as bmi increased, the importance of abdominal scars significantly decreased (p < 0.001, figure 2.) the majority (83%) had at least some interest in a surgery that would leave no scars. the two younger groups were more interested than those over 50 years (p = 0.001), with those between 30 and 49 years remaining the most interested in the face of increased risk (p = 0.036). the two younger groups were comfortable with a risk up to 10%, while the older group was more conservative and was more comfortable with a risk close to 5% (p = 0.003). there were also gender differences in the level of interest, with women expressing more interest than men (p = 0.021). this difference disappeared when the question of risk was added (p = 0.192), although the women tended to accept an increased risk of close to 10%, while the men were closer to 5% (p = 0.059). level of interest in notes was not significantly related to bmi, nor was acceptance of increased rate of complication, or the amount of acceptable risk. however, for all three questions, those at a healthy weight had the highest scores, suggesting more interest and less concern about risk. those without previous abdominal scars were more interested in notes than those with scars (p = 0.049), but both groups lost interest when presented with increased risk. the presence of other scars had little association with the responses to the three questions. over 80% of respondents felt that research into scarless surgery was of some importance, with 30.4% rating it as quite or extremely important. with age as a continuous variable, the spearman correlation suggested a negative but significant association (rho =.205, p < 0.001) ; using the categorical variable, those in the age group of 3049 years rated research as more important than the younger or older groups (p = 0.040). bmi was also negatively and significantly associated with importance when using the continuous variable (rho =.149, p = 0.009), but fell just short of significance when using the categorical variable (p = 0.066), although it was the healthy weight group that was more likely to rate it as important. women rated it as more important than men, although it fell short of significance (p = 0.084). one of the key proposed benefits of notes is a decreased length of stay in the hospital. very few (only 5.1%) indicated that a shorter hospital stay was not important, with 64.8% indicating that it was quite or extremely important. there was a weak, negative association with age using the spearman correlation (rho =.109, p = 0.049), but this was no longer significant when using the categorical data (p = 0.537). sex, bmi, and presence of scars also had little association with the importance of shorter in - hospital recovery time. here, we captured the opinions of 335 north american patients to obtain their views on this developing technique. several patient surveys have attempted to characterize those who would be most interested in this new method. studies published to date have variable results, perhaps related to the population surveyed and questions asked. some surveys have shown that patients prefer notes to laparoscopic surgery due to its improved cosmetic result with the potential for decreased pain also holding appeal in some studies [710 ]. however, patients consistently had decreased interest as the potential rate of complication increased [7, 9 ]. single port surgery (sps) is a minimally invasive form of laparoscopic surgery and a large - scale british study (n = 750) comparing patient views on it and notes showed that sps was significantly preferred over open surgery and notes. although experts often point to women as being a target group who would be interested in notes, studies looking at the effect of gender on opinions of notes have led to conflicting results. varadarajulu. did not find a significant preference by women for notes compared to men. further to this, surveys targeted at women in the context of transvaginal notes have had variable results. sixty - eight percent of women were interested in notes in a study by peterson. however, in an australian study, three quarters of surveyed women were neutral or unhappy about transvaginal notes compared with standard laparoscopic surgery. in keeping with the results of previous surveys, women were significantly more concerned with the cosmetic results of surgery and were more bothered by current scars. in addition, female patients are anatomically more versatile candidates for notes, with the potential for a transvaginal approach. our study did support the theory that women would be more interested in notes than men, but this association was lost when additional risk was factored into the equation. those under 50 years of age rated a scarless method as being more important and expressed more interest, even in the face of increased risk. although there was a high interest in the concept of notes (83% showed at least slight interest), this dropped to 38% when an increased complication risk was proposed compared to traditional techniques. however, this remains a significant proportion of the surveyed population, and provides impetus to further research and development in this field to make it a safe alternative to laparoscopic and open surgery. this is borne out in our data where 81% of patients felt that research into notes held some level of importance. one of the groups in the position to benefit the most from notes is obese patients, though our data show that level of interest in the technique is significantly and negatively associated with bmi, such that those of healthy weight expressed greater interest. obese patients are especially at risk for hernias after transabdominal surgery [46 ] and notes could mitigate this risk. the lack of abdominal wall incisions could also lead to earlier postoperative mobilization, better lung ventilation, decreased wound infections, all of which would lead to decreased length of hospital stay. furthermore, notes - assisted bariatric surgery has now been successfully attempted and in the authors ' opinion is one of the prime areas for notes development. hence, further objective data and education will be necessary to garner the interest and support of this population in this new technique. though the capital investment required for the development and adoption of any new technique is significant, the potential for cost savings in projected shorter hospital stays could offset the cost. ninety - five percent of patients indicated that a shorter in - hospital stay was important to them, adding to the attractiveness of this aspect of notes. the reasons behind patient interest in shorter length of hospital stay were not explored further but could include less time away from home and increased awareness of hospital acquired infections. third party payers (insurance companies and governments) would certainly also be interested in a technique that reduces hospital stay. in addition, it has been proposed that once further developed notes would not require a traditional operating room, thus altering hospital utilization further. the current study has some limitations. by dint of the survey population being from surgical clinics, while the self - administered survey prevented any bias that might have stemmed from a personal interview, patients were unable to ask for any more detail regarding the technique and complications than was included in the survey. for example, when presented with potential complications such as dyspareunia and infertility, women may in fact be less interested in the transvaginal approach of notes. this could also be extended to multiple centres to capture regional differences in opinion as the present study was performed in a single centre. the technique is still in its early stage of acceptance, but our data lend support to this endeavour. clearly, once techniques are further refined, hard data including complication rates, length of stay, and post - operative pain will be necessary to assess its utility and give patients adequate information for an informed choice. survey of opinions regarding a new surgical technique age : yearssex : male () female () height : (in feet and inches) or (in centimetres)weight : (in pounds) or (in kilograms)do you have an abdominal scar from a previous surgery ? yes () no () do you have any other major scars ? yes () no () if yes, where ? age : yearssex : male () female () height : (in feet and inches) or (in centimetres)weight : (in pounds) or (in kilograms)do you have an abdominal scar from a previous surgery ? yes () no () do you have any other major scars ? yes () no () if yes, where ? male () female () height : (in feet and inches) or (in centimetres) weight : (in pounds) or (in kilograms) if yes, where ? for the following questions, please place a check mark in the box that corresponds best with what you think how important are cosmetic issues, like scars, to you in abdominal surgery ? not at all important () slightly important () moderately important () quite important () extremely important () how do you feel about the scars you have ? not applicable, no scars () do not bother me at all () bother me slightly () bother me moderately () bother me quite a bit () extremely bothered () would you be interested in a surgery that would leave no scars ? not interested () slightly interested () moderately interested () quite interested () extremely interested () would you be interested in a surgery that would leave no scars even if there was an increased risk of complications such as infection inside your abdomen ? not interested () slightly interested () moderately interested () quite interested () extremely interested () how much increased risk would you be comfortable with if the surgery would leave no scar ? for example, if you pick 5%, you are indicating that you 'd be comfortable with a 5 in 100 chance of having a complication such as infection just to have a scarless surgery. none, would not have scarless surgery () 5% () 10% () 15% () 20% or more () how would you rate the importance of further research and investment into scarless surgery ? not important at all () slightly important () moderately important () quite important () extremely important () how important is a shorter recovery time (time spent in hospital recuperating from surgery) to you ? not important at all () slightly important () moderately important () quite important () extremely important () how important are cosmetic issues, like scars, to you in abdominal surgery ? not at all important () slightly important () moderately important () quite important () extremely important () not at all important () slightly important () moderately important () extremely important () how do you feel about the scars you have ? not applicable, no scars () do not bother me at all () bother me slightly () bother me moderately () bother me quite a bit () extremely bothered () not applicable, no scars () do not bother me at all () bother me slightly () bother me moderately () bother me quite a bit () extremely bothered () would you be interested in a surgery that would leave no scars ? not interested () slightly interested () moderately interested () quite interested () extremely interested () slightly interested () moderately interested () quite interested () extremely interested () would you be interested in a surgery that would leave no scars even if there was an increased risk of complications such as infection inside your abdomen ? not interested () slightly interested () moderately interested () quite interested () extremely interested () slightly interested () moderately interested () quite interested () extremely interested () how much increased risk would you be comfortable with if the surgery would leave no scar ? for example, if you pick 5%, you are indicating that you 'd be comfortable with a 5 in 100 chance of having a complication such as infection just to have a scarless surgery. none, would not have scarless surgery () 5% () 10% () 15% () 20% or more () none, would not have scarless surgery () how would you rate the importance of further research and investment into scarless surgery ? not important at all () slightly important () moderately important () quite important () extremely important () not important at all () slightly important () moderately important () extremely important () how important is a shorter recovery time (time spent in hospital recuperating from surgery) to you ? not important at all () slightly important () moderately important () quite important () extremely important () not important at all () slightly important () moderately important () extremely important () | natural orifice translumenal endoscopic surgery (notes) is on the forefront of surgical technique, but existing research has produced mixed results regarding factors associated with interest in the procedure. our objective was to ascertain patient opinions at a canadian centre regarding scarless surgery. a survey comprising demographic data (gender, age, body mass index [bmi ]), interest in notes, impact of increased risk, as well as importance of further research and shorter recovery time was administered to volunteer patients at outpatient general surgery clinics. nonparametric tests were utilized to examine difference in response by age, sex, bmi, and preexisting scars. of the 335 participants (57% female, mean age of 54.5 15.9 years, mean bmi of 28.7 6.9), the majority (83%) showed some interest, but this dropped to 38% when additional risk was factored in. generally, women, those under 50 years of age and those of healthy weight, were more interested than male, older, and/or heavier patients. most felt that research into notes and reduced length of inpatient stay were important (80% and 95%, respectively). further investigation into objective notes outcomes are needed to provide patients adequate data to make an informed choice regarding surgical route. |
the supraspinatus is one of the rotator cuff muscles ; it is positioned at the supraspinous fossa and under the trapezius and it abducts the shoulder joints to rotate externally1, 2. the rotator cuff muscles are highly important for dynamic stability of the shoulders, but it is the supraspinatus that plays an important role in dynamic stability during shoulder abduction. the supraspinatus is also the most frequently injured area when the rotator cuff muscles are injured3. thus, strengthening the supraspinatus is essential to prevent damage to the rotator cuff. generally, the full can and empty can positions are recommended as exercises that strengthen the supraspinatus4, 5. boettcher.6 indicated that there was no distinctive difference in muscle activity between the full can and empty can positions. however, few studies have been conducted to determine changes in the cross - sectional areas of the supraspinatus according to abduction angles, suggesting no definite answers concerning which posture and abduct angles are the best for strengthening the supraspinatus. jobe and moyne7 suggested an abduction angle of approximately 90 for the supraspinatus strengthening exercise, while escamilla.8 suggested that muscle activity of the supraspinatus was highest at an abduction angle of 60. however, in clinical practice, no recommendation for the abduction angle has been made for the supraspinatus strengthening exercise, so various angles have been applied by physiotherapists. it would be much easier for physiotherapists to determine the criteria for strengthening exercises if they knew which abduction angle of the shoulders incurs the largest cross - sectional area of the supraspinatus. therefore, the objective of this study was to determine by ultrasonography the changes in the supraspinatus cross - sectional areas according to shoulder abduction angles. forty subjects at d college participated in the present study (20 males and 20 females). the average ages, heights, and weights of the subjects were 21.32.3 years, 165.24.2 cm, and 57.64.8 kg, respectively. we excluded individuals who had shoulder pain ; had cervical, shoulder, or elbow operations ; had experienced sprains or strains ; or had neurological problems or blood vessel disorders. all included patients understood the purpose of this study and provided written informed consent prior to participation in the study in accordance with the ethical standards of the declaration of helsinki. in order to measure the thickness of the supraspinatus muscle during shoulder abduction, we seated the subjects in chairs without elbow and back rests, and all subjects wore clothes that exposed the right shoulder and scapula. while subjects were sitting comfortably, their waists and backs remained straight, their eyes faced the horizontal plane in front of them, and their foreheads and chins were positioned vertically. shoulder abduction was conducted in the frontal plane, the elbows of the subjects were extended, and the palms faced the front with the thumbs up. during abduction, we set four abduction angle levels level i (0 to 30), level ii (30 to 60), level iii (60 to 90), and level iv (90 to 120)to measure the thickness of the supraspinatus muscle with a newly manufactured angle plate (100 cm width100 cm length) designed for that purpose. the center point of the angle plate was positioned at the axis of the movement of the shoulder joint. in order for the subject to be able to position their abduction at five different angles, one research assistant adjusted the arm of the subject so that it was positioned at the appropriate angle, and the subject maintained the position while the other research assistant monitored the subject s response. in each abduction step, subjects maintained positions for 10 seconds to permit the recording of ultrasonography images and took a rest for 10 seconds between steps. all subjects practiced three times before the measurement. while the subjects conducted each level exercise, an ultrasound imaging system (mysono, seoul, south korea) and a 7.5-mhz transducer were used to measure muscle thickness. two experienced researchers with ultrasonography experience participated in the experiment to measure the ultrasonographic image. before ultrasonography, the shoulder areas of all subjects were wiped with alcohol gauze, and gels were applied to the supraspinatus region. one researcher positioned the transducer to give the optimized image of the supraspinatus, while the other researcher operated the computer to capture the optimized supraspinatus image. a line was drawn between the acromioclavicular joint and the superior angle to move the transducer in the longitudinal direction, and the transducer was positioned to see the starting point at the left side of the image. the right side of the supraspinatus muscle of all subjects was measured two times for each level, and the best quality image was selected. during measurement, the mysono u6 was positioned behind the back of the subject so that the subject could not see the ultrasonographic image. the images obtained from ultrasonography were used to measure the supraspinatus muscle thickness by using the national institutes of health image j software (version 1.44 for windows). for measurement of supraspinatus muscle thickness, a reference line was drawn at the starting point of the muscle at the left side of the image, while vertical lines were drawn 0.5 cm, 1 cm, and 1.5 cm from the reference line. the distance from the boundary between the trapezius and the supraspinatus muscle and between the supraspinatus muscle and the scapular fossa were measured. average values of the measured muscle thickness were used, and the change rate of muscle thickness was calculated by the formula (muscle thickness at the time of contraction muscle thickness at the time of rest)/muscle thickness at the time of rest. all measurements were conducted three times, and averages were used as the final result values9. based on this protocol, a test retest reliability study was conducted to determine the degree of reliability between the pre- and post - tests of ultrasound measurements of supraspinatus muscle size in normal young adults. intra - class correlation coefficient (icc) statistical analysis revealed good to excellent iccs ranging from 0.74 to 0.93. the data collected from this study were analyzed using spss 17.0, and the average and standard deviation are presented. in addition, repeated measures of analysis of variance was conducted to determine the rate of change in the thickness of the muscle according to abduction angle. using ultrasonography, the changes in the cross - sectional area of the supraspinatus according to the shoulder abduction angles were measured. the average rate of change in the thickness of the supraspinatus showed that level iii (60 to 90) exhibited the most statistically significant change (p<0.05) (table 1table 1.comparison of changes in supraspinatus thickness according to abduction angle (unit : cm)level ilevel iilevel iiilevel ivmeansd0.360.320.670.410.850.500.650.39p < 0.05. the shoulder joints consist of ball and socket joints with insufficient stability but very high mobility. because of their wide movement range, it is important for the shoulder joints to ensure stability and mobility between many ligaments and muscles. the rotator cuff muscle is important for maintaining stability within the range of most movements of the shoulder joint10. in addition, the rotator cuff muscle always moves with movement of the shoulder joints, thus playing the role of a dynamic ligament. because of this, it frequently experiences damage and is one of the main causes of shoulder pain11. the supraspinatus is the most frequent area of damage in the rotator cuff muscle3 ; thus, the supraspinatus strengthening exercise is highly important for the dynamic stability of this muscle. the full can and empty can positions are both recommended as examination methods for the supraspinatus4, but we conducted abduction based on the suggestion that the full can position should be used to avoid conflicts in the subacromial space12. while different recommended positions and angles have been reported for the supraspinatus strengthening exercises, the most commonly used angle is 90 abduction and 30 horizontal adduction. abduction at 90 is reported to result in the highest muscle activity of the supraspinatus7 ; however, escamilla.8 suggested that 60 of abduction result in the highest muscle activity in the supraspinatus. furthemore forbush.13 reported that both the full can and empty can positions at 60 of abduction result in a significant increase in cross - sectional area compared with that at the time of stabilization. another study recommended less than 60 of abduction for the empty can position to avoid conflict in the subacromial space, but it also recommended consideration of the full can position11. the measurement results in this study comparing abduction angles of 0, 30, 60, 90, and 120 showed that the largest cross - sectional area of the supraspinatus was found between 60 and 90. this result is consistent with previous results showing that the muscle activity and cross - sectional area of the supraspinatus were greatest at a 60 abduction angle12. we suggest the reason for our results is that the movement of the shoulder joint is minimized at abduction angles between 60 and 90, so abduction under the stable condition creates stronger torque in the supraspinatus. therefore, performance of abduction exercises that strengthen the supraspinatus, which is essential to improve the functions of the rotator cuff muscle, is suggested at abduction angles between 60 and 90. while previous studies have suggested only one angle for abduction, we set a range of angles instead of a single angle to suggest an effective range of movement. | [purpose ] the purpose of this study was to determine the changes in the supraspinatus cross - sectional areas according to shoulder abduction angles, using ultrasonography. [subjects and methods ] the subjects consisted of 40 individuals (20 males and 20 females). the cross - sectional areas of the supraspinatus of all subjects were measured with ultrasonography at abduction angle of 0, 30, 60, 90, and 120. we set four abduction angle levels (i, ii, iii, and iv), 0 to 30, 30 to 60, 60 to 90, and 90 to 120, respectively, when determining the largest change in cross - sectional area. [results ] the results revealed that cross - sectional areas of the supraspinatus increased at all levels, but the abduction angle level with the largest increase in cross - sectional area of the supraspinatus was level iii. [conclusion ] the above results indicate that performing exercises at an abduction angle between 60 and 90 will be the most effective for supraspinatus strengthening in clinical practice. |
caspases coordinate, in a proteolytic cascade and with the help of other proteases, the rapid and efficient elimination of a cell by apoptosis. they are classified into monomeric initiator caspases (caspase-8 and -9) with long prodomains (death effector domain [ded ], and caspase recruitment domain [card ]), which are activated by recruitment to and dimerization on protein platforms, and already dimerized effector caspases (caspase-3, -6 and -7), which require for their activation the cleavage (e.g., by initiator caspases) of an intersubunit linker that binds to the dimer interface. in the extrinsic signaling pathway, the recruitment platform is the death - inducing signaling complex (disc) consisting of the activated death receptor, the adapter fadd (fas - associated protein with death domain) and initiator caspase-8 and -10. in the intrinsic mitochondrial pathway, the platform is the apoptosome, a complex of the adapter apaf-1 (apoptotic protease activating factor 1), mitochondrially - released cytochrome c and initiator caspase-9. in both cases, the main role of caspase-8 and -9 is to cleave and activate effector caspase-3 and -7. caspase-6 is an effector caspase with a limited substrate specificity whose exact role in apoptosis remains ill - defined. caspase-2 is recruited to another platform, the piddosome (pidd is the p53-induced protein with death domain), which is involved in translating a danger signal, such as dna damage, into either a repair or death response depending on the cellular or environmental context. similarly, caspases-1, -4 and -5 in humans and caspase-11 in mice are part of inflammasome platforms that assemble in response to external, pathogenic stimuli and guide the production and secretion of pro - inflammatory cytokines such as interleukin (il)-1 and il-18. under certain circumstances, such as salmonella - infected macrophages, the antimicrobial, inflammatory response may result in a caspase-1-mediated form of programmed cell death, called pyroptosis. caspase-12 is an inhibitor of caspase-1, and caspase-14 is probably the only truly non - apoptotic human caspase mediating keratinocyte differentiation. in the caspase field, are non - caspase proteases important to support or even replace caspase - mediated signaling ? and why is effector caspase activation and apoptosis not synchronized, even in a clonal cell population ? two recent papers reported on the caspase substrate repertoire in apoptotic cells. in one case, the proteomes from control and apoptosis - stimulated systems were separated on one - dimensional sds - page (sodium dodecyl sulfate polyacrylamide gel electrophoresis) and analyzed by liquid chromatography coupled with tandem mass spectrometry (lc - ms / ms) after gel elution. in the other approach a gel - free technology was used by selectively biotinylating free protein amino termini that are generated in apoptotic cells upon caspase - mediated cleavages to enrich for lc - ms / ms. both groups identified hundreds of new substrates and support the concept that most of them are cleaved into domain - containing fragments that may either gain or lose function. the cleaved substrates are often stable, suggesting that dismantling the apoptotic cell is more like folding a tent after careful removal of pegs than disposing debris after an explosion. they found that caspase-3 was more promiscuous than caspase-7 because 12 out of 20 substrates were preferentially cleaved by caspase-3 whereas only one was more susceptible to processing by caspase-7. thus, caspase-3 and -7 may, in part, be functionally distinct, explaining why caspase-3 and caspase-7 null mice show distinct phenotypes on some genetic backgrounds. in this regard, a recent study published for the first time a non - redundant role of caspase-7 in mediating lipopolysaccharide - induced lymphocyte apoptosis and mortality in mice. this might be due to the fact that caspase-7, unlike caspase-3, can be processed and activated by caspase-1. thus, under certain conditions caspase-7 may be crucial for inflammatory events triggered by the caspase-1 inflammasome. caspase-3 can also process other caspases, such as caspase-6 and -2. in turn, caspase-6 processes caspase-8 and -10. using a specific inhibitor of caspase-3, and small interfering rna - mediated ablation of specific caspases, inoue. recently validated this caspase ordering pathway not only for caspase-3 but also for caspase-7. caspase-2 was previously suggested to function as an initiator caspase for dna damage and heat - shock - induced apoptosis upstream of mitochondria. it seems that caspase-2 may amplify apoptotic responses by being activated downstream of caspase-9/-3 or, alternatively, to drive a dna damage response that bypasses p53, b - cell lymphoma protein-2 (bcl-2) and caspase-3. moreover, a non - apoptotic role of caspase-2 was proposed in the context of dna damage - associated cell cycle arrest through the recruitment and activation on a cytosolic and a nuclear piddosome platform because caspase-2 deficient cells failed to show g2/m arrest, leading to more mitotic cells whose dna was not repaired. in accordance with such a mechanism, ho. since the number of therapies associated with increased or decreased apoptosis continue to grow, it is crucial to directly visualize and quantify apoptosis in vivo. developed fluorescently - labeled activity - based probes (abps) against caspases that provided direct readouts of kinetics of apoptosis in thymi and tumors in live mice. in contrast to the already - used polymer - based quenched fluorescent substrates that are cleaved in multiple locations to produce fluorescent products, the abps are retained at the site of proteolysis by forming a covalent bond with the active - site cysteine of caspases. thus, the fluorescent abps show more rapid and selective uptake into tumors and brighter signals compared to substrate probes. human diseases characterized by high apoptosis resistance, such as cancer, may be treated in the future with small - molecule drugs that can activate effector caspase proenzymes. wolan. used high - throughput screening to identify a compound that promoted selective autoproteolytic activation of pro - caspase-3 at physiological concentrations by stabilizing the on - state conformation of the proenzyme. moreover, walters. recently reported on a caspase-3 mutation that prevented the intersubunit linker from binding in the dimer interface, allowing the active site to form in the procaspase in the absence of proteolysis. this pseudoactivated caspase-3 was not inhibited by xiap (x - linked inhibitor of apoptosis protein) and rapidly killed cells at low concentrations. in mammalian cells this form of cell death seems to be mediated by other proteases, such as calpains, serine proteases or lysosomal proteases, which act in parallel with caspases to amplify apoptosis signaling or induce other forms of cell death such as necrosis. calpains mainly play a pro - death role when calcium signaling is involved. in 2005, nicotera s group showed that the plasma membrane na / ca exchanger is cleaved by calpain in the ischemic brain and in cerebellar granule neurons exposed to glutamate leading to a ca - mediated neuronal demise. moreover, calpains were recently shown to redistribute to the nuclear envelope, where they degraded nuclear pore complexes and increased nuclear leakiness in response to a ca overload. furthermore, calpain-1 was found to be activated in spontaneous and fas - mediated apoptosis of neutrophils by a caspase - induced cleavage of its inhibitor calpastatin. this resulted in the truncation of pro - apoptotic bax (bcl-2-associated x protein) and the autophagy - related 5 (atg5) protein, which both enhanced cytochrome c release and most likely deviated the cells from autophagy to apoptosis. masson and tschopp identified a family of serine proteases, the granzymes (gzms), present in cytotoxic t cells and natural killer cells, which were capable of eliminating virally infected and malignant cells in cooperation with the fasl - fas signaling system. meanwhile, it has become clear that gzmb mediates caspase - dependent apoptosis by either cleaving bid (bh3-interacting domain death agonist) and activating bax / bak - dependent cytochrome c release or directly processing caspase-3. by contrast, metkar. recently reported that gzma contributes to anti - viral immunity, not via its pro - apoptotic action, but by triggering the processing of pro - il-1 to mature il-1, thereby stimulating a pro - inflammatory response. thus, gzms resemble caspases in their capacity to influence both apoptosis and inflammation depending on the isoform. in this respect, the orphan human gzmm and gzmk may similarly act as pro - inflammatory proteases, explaining the observed ongoing anti - viral defence in gzmaxb-/- mice. moreover, it is conceivable that other cell types may also exploit a serine protease - based mechanism to regulate apoptosis. a few candidate serine proteases have so far been proposed, such as htra2 (high - temperature - regulated a2), ap24 (24 kda apoptotic protease) and serine proteases implicated in endoplasmatic reticulum stress - induced apoptosis. cathepsins encompass three classes of lysosomal proteases, the serine proteases cathepsin a and cathepsin g, the aspartic proteases cathepsin d and cathepsin e and the 11 so far known human cysteine proteases, cathepsins b, c, f, h, k, l, o, s, v, w and x / z. they have been implicated in apoptosis regulation because of their cytoplasmic release due to increased lysosomal membrane permeabilization (lmp). although they depend on acidic ph for optimal activity, they seem to retain some of their catalytic activity at physiological ph. therefore, upon their release into the cytoplasm they can directly cleave caspases or, as recently reported, pro- and anti - apoptotic members of the bcl-2 family or xiap. unfortunately, in most studies, lmp was artificially induced by lysosomotropic agents such as leu - leu - ome (l - leucyl - l - leucine methyl ester), and it has therefore remained unclear if cathepsin release indeed plays an initiating role in apoptosis signaling. report that cells deficient in bax / bak, apoptosomal components or caspase-3/-7 are resistant to lmp in response to various apoptotic stimuli, indicating that cathepsin release and action occurs downstream of mitochondria. moreover, since some cathepsin knock - out cells (b, l but not d) exhibited delayed but not blocked apoptosis, this lysosomal signaling pathway seems to amplify rather than initiate apoptosis. this process could nevertheless be physiologically relevant because a lack of this amplifcation loop would lead to delayed cell death and/or inefficent removal of apoptotic bodies and may be the underlying cause of a lack of resolution of inflammation due to neutrophil accumulation in cathepsin d knock - outs, reduced keratinocyte apoptosis resulting in periodic hair loss in cathepsin l - deficient mice and diminished liver damage upon tumor necrosis factor (tnf)-alpha challenge in mice deficient of cathepsin b. more recently, kirkegaard. offered a possibility to stabilize lysosomes by delivering hsp70 (heat - shock protein 70) via the endocytotic pathway. through its interaction with an endolysosomal phospholipid this could be exploited to correct niemann - pick disease - associated pathology (in which acid spingomyelinase is defective). conversely, as tumor cells express high levels of lysosomal hsp70, a reduction of this protein may sensitize these cells to lmp and cathepsin - mediated cell death. it has remained enigmatic why cells, even in clonal populations, undergo apoptosis at different rates despite simultaneous addition of an apoptotic stimulus. although caspase-3 activation occurs within minutes after cytochrome c release, the duration of events preceding cytochrome c release can vary from 1 to 24 hours. a number of factors could contribute to this population variability, including differences in cell cycle stages, metabolic rates, the local environment of single cells or stochasticity in biochemical reactions triggered by apoptotic stimuli. now, two recent papers reveal that the cell - cell variability of apoptosis times is due to the divergence of the molecular composition of the cells. using a novel single fluorophore reporter to measure caspase-3/-7 activities inside cells, bhola. report that the onset of proteolytic activity is tightly synchronized amongst the most related sister cells and lost over successive generations. similiarly, spencer. found that variability in the apoptotic phenotype arises from cell - to - cell differences in protein levels of caspases, caspase inhibitors, bcl-2 family members, and so on, that exist before trail (tnf - related apoptosis - inducing ligand) exposure. a particular protein state of a single cell is then transmitted to the daughter cells, giving rise to transient non - genetic heritability in cell fate. due to ongoing protein synthesis, the protein content of sister cells rapidly diverges so that soon these cells are no more similar to each other than pairs of cells chosen at random. two recent papers reported on the caspase substrate repertoire in apoptotic cells. in one case, the proteomes from control and apoptosis - stimulated systems were separated on one - dimensional sds - page (sodium dodecyl sulfate polyacrylamide gel electrophoresis) and analyzed by liquid chromatography coupled with tandem mass spectrometry (lc - ms / ms) after gel elution. in the other approach a gel - free technology was used by selectively biotinylating free protein amino termini that are generated in apoptotic cells upon caspase - mediated cleavages to enrich for lc - ms / ms. both groups identified hundreds of new substrates and support the concept that most of them are cleaved into domain - containing fragments that may either gain or lose function. the cleaved substrates are often stable, suggesting that dismantling the apoptotic cell is more like folding a tent after careful removal of pegs than disposing debris after an explosion. they found that caspase-3 was more promiscuous than caspase-7 because 12 out of 20 substrates were preferentially cleaved by caspase-3 whereas only one was more susceptible to processing by caspase-7. thus, caspase-3 and -7 may, in part, be functionally distinct, explaining why caspase-3 and caspase-7 null mice show distinct phenotypes on some genetic backgrounds. in this regard, a recent study published for the first time a non - redundant role of caspase-7 in mediating lipopolysaccharide - induced lymphocyte apoptosis and mortality in mice. this might be due to the fact that caspase-7, unlike caspase-3, can be processed and activated by caspase-1. thus, under certain conditions caspase-7 may be crucial for inflammatory events triggered by the caspase-1 inflammasome. caspase-3 can also process other caspases, such as caspase-6 and -2. in turn, caspase-6 processes caspase-8 and -10. using a specific inhibitor of caspase-3, and small interfering rna - mediated ablation of specific caspases, inoue. recently validated this caspase ordering pathway not only for caspase-3 but also for caspase-7. caspase-2 was previously suggested to function as an initiator caspase for dna damage and heat - shock - induced apoptosis upstream of mitochondria. it seems that caspase-2 may amplify apoptotic responses by being activated downstream of caspase-9/-3 or, alternatively, to drive a dna damage response that bypasses p53, b - cell lymphoma protein-2 (bcl-2) and caspase-3. moreover, a non - apoptotic role of caspase-2 was proposed in the context of dna damage - associated cell cycle arrest through the recruitment and activation on a cytosolic and a nuclear piddosome platform because caspase-2 deficient cells failed to show g2/m arrest, leading to more mitotic cells whose dna was not repaired. in accordance with such a mechanism, ho. since the number of therapies associated with increased or decreased apoptosis continue to grow, it is crucial to directly visualize and quantify apoptosis in vivo. developed fluorescently - labeled activity - based probes (abps) against caspases that provided direct readouts of kinetics of apoptosis in thymi and tumors in live mice. in contrast to the already - used polymer - based quenched fluorescent substrates that are cleaved in multiple locations to produce fluorescent products, the abps are retained at the site of proteolysis by forming a covalent bond with the active - site cysteine of caspases. thus, the fluorescent abps show more rapid and selective uptake into tumors and brighter signals compared to substrate probes. human diseases characterized by high apoptosis resistance, such as cancer, may be treated in the future with small - molecule drugs that can activate effector caspase proenzymes. wolan. used high - throughput screening to identify a compound that promoted selective autoproteolytic activation of pro - caspase-3 at physiological concentrations by stabilizing the on - state conformation of the proenzyme. moreover, walters. recently reported on a caspase-3 mutation that prevented the intersubunit linker from binding in the dimer interface, allowing the active site to form in the procaspase in the absence of proteolysis. this pseudoactivated caspase-3 was not inhibited by xiap (x - linked inhibitor of apoptosis protein) and rapidly killed cells at low concentrations. this form of cell death seems to be mediated by other proteases, such as calpains, serine proteases or lysosomal proteases, which act in parallel with caspases to amplify apoptosis signaling or induce other forms of cell death such as necrosis. calpains mainly play a pro - death role when calcium signaling is involved. in 2005, nicotera s group showed that the plasma membrane na / ca exchanger is cleaved by calpain in the ischemic brain and in cerebellar granule neurons exposed to glutamate leading to a ca - mediated neuronal demise. moreover, calpains were recently shown to redistribute to the nuclear envelope, where they degraded nuclear pore complexes and increased nuclear leakiness in response to a ca overload. furthermore, calpain-1 was found to be activated in spontaneous and fas - mediated apoptosis of neutrophils by a caspase - induced cleavage of its inhibitor calpastatin. this resulted in the truncation of pro - apoptotic bax (bcl-2-associated x protein) and the autophagy - related 5 (atg5) protein, which both enhanced cytochrome c release and most likely deviated the cells from autophagy to apoptosis. masson and tschopp identified a family of serine proteases, the granzymes (gzms), present in cytotoxic t cells and natural killer cells, which were capable of eliminating virally infected and malignant cells in cooperation with the fasl - fas signaling system. meanwhile, it has become clear that gzmb mediates caspase - dependent apoptosis by either cleaving bid (bh3-interacting domain death agonist) and activating bax / bak - dependent cytochrome c release or directly processing caspase-3. by contrast, metkar. recently reported that gzma contributes to anti - viral immunity, not via its pro - apoptotic action, but by triggering the processing of pro - il-1 to mature il-1, thereby stimulating a pro - inflammatory response. thus, gzms resemble caspases in their capacity to influence both apoptosis and inflammation depending on the isoform. in this respect, the orphan human gzmm and gzmk may similarly act as pro - inflammatory proteases, explaining the observed ongoing anti - viral defence in gzmaxb-/- mice. moreover, it is conceivable that other cell types may also exploit a serine protease - based mechanism to regulate apoptosis. a few candidate serine proteases have so far been proposed, such as htra2 (high - temperature - regulated a2), ap24 (24 kda apoptotic protease) and serine proteases implicated in endoplasmatic reticulum stress - induced apoptosis. cathepsins encompass three classes of lysosomal proteases, the serine proteases cathepsin a and cathepsin g, the aspartic proteases cathepsin d and cathepsin e and the 11 so far known human cysteine proteases, cathepsins b, c, f, h, k, l, o, s, v, w and x / z. they have been implicated in apoptosis regulation because of their cytoplasmic release due to increased lysosomal membrane permeabilization (lmp). although they depend on acidic ph for optimal activity, they seem to retain some of their catalytic activity at physiological ph. therefore, upon their release into the cytoplasm they can directly cleave caspases or, as recently reported, pro- and anti - apoptotic members of the bcl-2 family or xiap. unfortunately, in most studies, lmp was artificially induced by lysosomotropic agents such as leu - leu - ome (l - leucyl - l - leucine methyl ester), and it has therefore remained unclear if cathepsin release indeed plays an initiating role in apoptosis signaling. report that cells deficient in bax / bak, apoptosomal components or caspase-3/-7 are resistant to lmp in response to various apoptotic stimuli, indicating that cathepsin release and action occurs downstream of mitochondria. moreover, since some cathepsin knock - out cells (b, l but not d) exhibited delayed but not blocked apoptosis, this lysosomal signaling pathway seems to amplify rather than initiate apoptosis. this process could nevertheless be physiologically relevant because a lack of this amplifcation loop would lead to delayed cell death and/or inefficent removal of apoptotic bodies and may be the underlying cause of a lack of resolution of inflammation due to neutrophil accumulation in cathepsin d knock - outs, reduced keratinocyte apoptosis resulting in periodic hair loss in cathepsin l - deficient mice and diminished liver damage upon tumor necrosis factor (tnf)-alpha challenge in mice deficient of cathepsin b. offered a possibility to stabilize lysosomes by delivering hsp70 (heat - shock protein 70) via the endocytotic pathway. through its interaction with an endolysosomal phospholipid this could be exploited to correct niemann - pick disease - associated pathology (in which acid spingomyelinase is defective). conversely, as tumor cells express high levels of lysosomal hsp70, a reduction of this protein may sensitize these cells to lmp and cathepsin - mediated cell death. it has remained enigmatic why cells, even in clonal populations, undergo apoptosis at different rates despite simultaneous addition of an apoptotic stimulus. although caspase-3 activation occurs within minutes after cytochrome c release, the duration of events preceding cytochrome c release can vary from 1 to 24 hours. a number of factors could contribute to this population variability, including differences in cell cycle stages, metabolic rates, the local environment of single cells or stochasticity in biochemical reactions triggered by apoptotic stimuli. now, two recent papers reveal that the cell - cell variability of apoptosis times is due to the divergence of the molecular composition of the cells. using a novel single fluorophore reporter to measure caspase-3/-7 activities inside cells, bhola. report that the onset of proteolytic activity is tightly synchronized amongst the most related sister cells and lost over successive generations. similiarly, spencer. found that variability in the apoptotic phenotype arises from cell - to - cell differences in protein levels of caspases, caspase inhibitors, bcl-2 family members, and so on, that exist before trail (tnf - related apoptosis - inducing ligand) exposure. a particular protein state of a single cell is then transmitted to the daughter cells, giving rise to transient non - genetic heritability in cell fate. due to ongoing protein synthesis, the protein content of sister cells rapidly diverges so that soon these cells are no more similar to each other than pairs of cells chosen at random. although we have learned much about the regulation of mammalian caspases, their ordering within signaling cascades and their specific roles in particular cell death regimens in vitro and in vivo, we do not know yet the full scope of action of the two effector caspases-7 and -6. is caspase-6 only an amplifier caspase or does it play a discrete role under particular stress responses ? what about the large number of caspase substrates that have recently been identified by mass spectrometry ? can they be validated in vivo (i.e., at physiologically relevant caspase concentrations of 1 nm in dying cells) and which of them, if any, exert a functional significance in mediating the execution of apoptosis ? another major task will be to determine if caspase-2 is only a checkpoint controller, or also an apoptotic caspase at specific cell cycle stages, for example, leading to mitotic catastrophe, a form of apoptosis that may depend on the molecular profile of the cell. in this respect it will be exciting to continue the recent work on determining how the protein content of apoptosis signaling molecules sets the threshold for death induction in single cells, preferentially supported by systems biology approaches as shown by spencer.. this will have major implications for future anti - cancer therapies as resistance to chemotherapy is most likely due to such cell - to - cell variability within a given tumor cell population. another crucial aspect will certainly be the better detection of apoptotic cells in diseased tissues using specific fluorescent probes and the development of more drugs that activate the caspase-3 proenzyme. in particular, a drug mimicking the caspase-3 mutant described by walters. holds great promise to activate caspase-3 without proteolytic processing and eventually to kill even tumor cells expressing high xiap levels. finally, we desperately need to understand the exact role of non - caspase proteases in cell death regulation. the implication of calpains, serine proteases, cathepsins and other proteases in this process seems to be a relatively recent evolutionary response to the complexity of biological processes in humans. thus, these enzymes will be promising targets for future therapeutic intervention - for example, to save neurons or immune cells from degeneration - irrespective of whether these proteases amplify caspase - dependent signaling or trigger alternative caspase - independent processes. our future work will include the identification and molecular characterization of more apoptotic and pro - inflammatory serine proteases and the discovery of the signaling pathway leading from caspases to lmp and cathepsin release from lysosomes. | undoubtedly, caspases are the major driving force for apoptosis execution and mechanisms of their activation and inhibition have been largely unveiled. recent progress has been made with regard to the exact intracellular ordering of caspases, monitoring their activities in vivo and unveiling their substrate degradomes. moreover, non - caspase proteases seem to assist caspases in the completion of the death execution program. here we will consider some very recent data dealing with these aspects. we will also provide novel insights into the mechanisms that dictate apoptotic variability within a cell population. |
the world health organization estimated that worldwide, 10 million people were diagnosed with cancer in 2000, and that the cancer incidence rate would increase by 50% to 15 million by 2020. furthermore, as treatment outcomes improve and cancer patients have an increased survival21), the incidence and prevalence of spinal metastases, which are known to occur in 30 - 50% of cancer patients22,27,41), are also set to rise. the majority of these patients will undergo palliative radiation therapy, and the role of radiation therapy for the treatment of metastatic tumors of the spine is well established7,23,37). conventional radiation therapy (rt) is defined as radiation delivered using 1 to 2 beams without high precision or highly conformal treatment. therefore, the effectiveness of conventional radiation therapy has been limited by the poor radiation tolerance of the spinal cord, which is highly susceptible to radiation. in recent years, advances in imaging technology and computed treatment planning have allowed the safe delivery of high - dose radiation to spinal metastases, even when in close proximity to the spinal cord. these treatments are administered in 1 to 5 fractions of high - dose radiation (to ensure safety), which limit the dose delivered to the spinal cord12). the emerging technique of stereotactic radiosurgery (srs) for spine metastases represents a logical extension of the current state - of - the - art of radiation therapy. stereotactic radiosurgery has emerged as a new treatment option for the multidisciplinary management of metastases located within or adjacent to vertebral bodies and the spinal cord. the goals of stereotactic radiosurgery parallel those of brain radiosurgery, that is, to improve local control over conventional fractionated radiation therapy and to be effective for the treatment of previously irradiated lesions with an acceptable safety profile. herein, we present a systematic review regarding the value of spinal stereotactic radiosurgery in the management of spinal metastasis. case reports or papers describing less than 10 spine metastatic patients and studies that used intensity modulated radiotherapy involving more than 5 fractionations were excluded. grades of recommendation, assessment, development, and education (grade) working group criteria as described by guyatt and coworkers35) was used to critically evaluate the quality of each dataset (table 1), which was assigned high, moderate, low, or very low qualities based on the grade approach35). twenty - three studies were classified as ' low ' and 8 as ' very low '. the number of studies using cyberknife (accuracy inc., sunny vale, ca, usa) was 21. the number of studies using novalis (brain lab inc. the number of studies using linac, synergy s linac (elekta synergy s 6-mv linac) and helical tomotherapy was 1 each. the indication for spinal stereotactic radiosurgery in spine metastasis has evolved over time and will continue to evolve as clinical experience increases. however, surgery is usually reserved for spinal instability and significant neurologic deficits from direct tumor conprogression rather than stereotactic radiosurgery. the current indications for the use of stereotactic radiosurgery as a treatment modality for metastatic spine disease include pain related to a specific involved vertebral body, radiographic tumor progression as a primary treatment modality for progressive neurologic deficits, and adjuvant therapy after open surgical intervention. these indications were grouped into four general categories, as described by sahgal.34) : unirradiated patients : spinal metastases in a previously unirradiated volume treated by srs. reirradiated patients : spinal metastases in a previously irradiated volume now containing new, recurrent, or progressive metastatic disease treated by srs. postoperative patients : spinal metastases treated with srs after open surgical intervention, with or without spinal stabilization. pain is the most frequent indication for the treatment of spinal metastases, and radiation is well known to be effective as a treatment for pain associated with spinal malignancies. furthermore, stereotactic radiosurgery has been reported to be highly effective at reducing pain associated with symptomatic spinal metastasis5,29), regardless of prior treatment by conventional fractionated radiotherapy, and to have an overall improvement rate of approximately 85 - 100%. pain is reported to decrease usually within weeks after srs and occasionally within days5,19,29,33). ryu.31) reported an overall pain control rate of 84% at 1 year after treatment in a series of 49 patients. gerszten.11) reported on a mixed population that achieved an overall pain improvement rate of 86% (290 of 336 cases) depending on primary histopathology. durable pain improvement was demonstrated in 96% of women with breast cancer, in 96% of melanoma cases, in 94% of cases with renal cell carcinoma, and in 93% of lung - cancer cases. gibbs.16) reported that 84% of symptomatic patients experienced improvement or resolution of symptoms after treatment. in addition, excellent pain - control and quality - of - life results after spinal stereotactic radiosurgery have been reported by the georgetown university hospital6,8,9), and haley.18) reported no statistically significant difference in pain between srs and rt groups. degen.6) demonstrated a 95% local control rate for 58 lesions in a mean follow - up of 350 days, and chang.3) reported a 1-year 84% progression free incidence in 74 lesions. overall long - term radiographic tumor control for progressive spinal disease in a series of 500 cases was 88 - 90% during the median 21-month follow - up11). radiographic tumor control rates were found to be dependent on primary pathology : breast (100%), lung (100%), renal cell (87%), and melanoma (75%)11). spine srs is frequently used to treat radiographic tumor progression after conventional rt or after prior surgery. however, currently, spine stereotactic radiosurgery is often being used as a " salvage " technique for those cases in which further conventional irradiation or open surgery are not appropriate. choi.4) recently reported 6 and 12 month local control rates of 87% and 81%, respectively, in previously irradiated patients, and gerszten.11) reported an 88% radiographic control rate in patients, 69% of whom had previously received radiotherapy. chang.3) reported a 1-year actuarial tumor progression - free incidence of 84% for fractionated srs treatment ; 56% of their patients received srs as a retreatment. as greater experience is gained, stereotactic radiosurgery will probably evolve into an initial upfront treatment for spinal metastasis in certain cases, especially for cases of oligometastasis. this is similar to the evolution that occurred over the past decade for the treatment of intracranial metastases by radiosurgery. additional asymptomatic lesions may be treated by srs to avoid further irradiation to neural elements and further bone - marrow suppression and to permit subsequent systemic therapy. gagnon.8) reported a matched - pair analysis in which 18 patients with breast - cancer spinal metastases treated by srs were compared to 18 matched patients that received conventional external beam radiation therapy (ebrt) upfront. this study concluded that salvage srs is as efficacious as initial fractionated rt without added toxicity. haley.18) recently reported that in terms of pain relief, srs as a primary treatment modality in spinal metastasis was not different from ebrt. when used as a primary treatment modality, long term radiographic tumor control was demonstrated in 90% of cases of breast, lung, and renal cell carcinoma metastases and in 75% of melanoma metastases11). sheehan.36) reported a 100% tumor control rate in lesions that had not previously undergone irradiation, and ryu.31) reported the results of a dose - escalation trial in which a series of 49 patients with lesions that had not previously undergone fractionated rt demonstrated good clinical outcomes. the spine can be instrumented if necessary, residual tumor can be safely treated later by srs, and thus, the adjunctive srs can reduce the chance of repeated surgery and possible morbidities from the second surgery. furthermore, anterior corpectomy with reconstruction procedures in certain cases can be avoided successfully by posterior decompression and instrumentation alone followed by srs to the remaining anterior lesion. given the ability to perform spinal srs effectively, the current surgical approach to these lesions might be changed. as srs has the stiff falloff gradient of the target dose with negligible skin dose20), such treatments can be given soon after surgery instead of after the usual significant delay before standard external beam rt is permitted2,25,39). open surgery for spinal metastases will likely evolve in a similar manner, whereby intracranial brain tumors are debulked in such a way as to avoid neurologic deficits and minimize surgical morbidity12). rock.28,31) specifically evaluated the combination of open surgery followed by adjuvant srs in a series of 18 patients and achieved a local control rate of 94%, whereas gerszten.10) reported a series of 26 patients treated by srs after vertebral body cement augmentation and achieved a local control rate of 92%. the prescribed radiation dose to the tumor is determined based on tumor histology, spinal cord, or cauda equina tolerance and previous radiation dosage to normal tissue, especially to the spinal cord. no large - scale study has yet developed an optimal dose for spinal srs, and no appropriate dose or fractionation schedule for metastatic tumors have been firmly established. however, spinal srs has been found to be safe at doses comparable to those used for intracranial radiosurgery without the occurrence of radiation - induced neural injury. single - fraction srs doses range from 8 to 24 gy, while hypofractionated regimens consist of 4 gy5 fractions, 6 gy5 fractions, 8 gy3 fractions, or 9 gy3 fractions9). in one recent large series9), 26.4 gy in 3 fractions was prescribed to the 75% isodose surface for radiation nave lesions. previously irradiated lesions were treated with a mean maximum dose of 20 gy (range 12.5 - 25 gy)11), a median dose 35 gy (range 20 - 50.4 gy)3), a median dose of 20 gy in 5 fractions (range 20 - 30 gy)43), and a median dose 20 gy (range 10 - 30 gy) in 1 - 5 fractions (median 2). one concern that has been raised regarding srs for spinal metastases is whether adjacent levels are included in the radiation field. in the report of university of pittsburgh medical center, no cases of tumor progression were encountered at immediate adjacent levels, thus justifying the treatment of the involved spine only11,33). although they reported failures in 3 out of 49 patients treated for solitary metastases, no failure was identified in adjacent untreated vertebrae33). the implication of these findings is that progression in adjacent vertebral bodies is rare, and thus, they support srs treatment of involved spinal levels only3,34). based on these findings, sahgal concluded that it was possible that : 1) failure in the epidural space may have been be due to underdosing of the tumor because of strict spinal cord constraints, 2) uninvolved adjacent posterior elements should have been included in the target volume, and 3) encompassing one vertebral body above and below diseased vertebrae was unnecessary34). the minor and limited toxicities reported for spine radiosurgery include esophagitis18,19), dysphagia6), diarrhea3,6), cenparesthesia6), transient laryngitis1), compression fracture9), and transient radiculitis1). radiation induced spinal cord injury is exceedingly rare, and only a small number of cases have been reported. an early series by benzil.1) contained no radiation - induced spinal cord toxicity, and gerszten.11) found no spinal cord toxicity after a follow - up of over 60 months. ryu.30) specifically addressed the partial volume tolerance of the spinal cord and complications of single - dose srs. they reported a single case of radiation - induced cord injury 13 months after srs and concluded that, whereas the maximum spinal cord tolerance to single - dose radiation is unknown, partial volume tolerance of the human spinal cord is at least 10 gy to 10% of the spinal cord volume, defined as 6 mm above and below the srs target. in a recent multicenter study of 1075 cases17), only 6 patients developed delayed radiation - induced myelopathy at a mean of 6.4 months (range, 2 - 9 months) after spinal srs. recently, haley.18) reported that rt had higher acute toxicity rates than srs but encountered no late complications after either treatment modality. pain is the most frequent indication for the treatment of spinal metastases, and radiation is well known to be effective as a treatment for pain associated with spinal malignancies. furthermore, stereotactic radiosurgery has been reported to be highly effective at reducing pain associated with symptomatic spinal metastasis5,29), regardless of prior treatment by conventional fractionated radiotherapy, and to have an overall improvement rate of approximately 85 - 100%. pain is reported to decrease usually within weeks after srs and occasionally within days5,19,29,33). ryu.31) reported an overall pain control rate of 84% at 1 year after treatment in a series of 49 patients. gerszten.11) reported on a mixed population that achieved an overall pain improvement rate of 86% (290 of 336 cases) depending on primary histopathology. durable pain improvement was demonstrated in 96% of women with breast cancer, in 96% of melanoma cases, in 94% of cases with renal cell carcinoma, and in 93% of lung - cancer cases. gibbs.16) reported that 84% of symptomatic patients experienced improvement or resolution of symptoms after treatment. in addition, excellent pain - control and quality - of - life results after spinal stereotactic radiosurgery have been reported by the georgetown university hospital6,8,9), and haley.18) reported no statistically significant difference in pain between srs and rt groups. degen.6) demonstrated a 95% local control rate for 58 lesions in a mean follow - up of 350 days, and chang.3) reported a 1-year 84% progression free incidence in 74 lesions. overall long - term radiographic tumor control for progressive spinal disease in a series of 500 cases was 88 - 90% during the median 21-month follow - up11). radiographic tumor control rates were found to be dependent on primary pathology : breast (100%), lung (100%), renal cell (87%), and melanoma (75%)11). spine srs is frequently used to treat radiographic tumor progression after conventional rt or after prior surgery. however, currently, spine stereotactic radiosurgery is often being used as a " salvage " technique for those cases in which further conventional irradiation or open surgery are not appropriate. choi.4) recently reported 6 and 12 month local control rates of 87% and 81%, respectively, in previously irradiated patients, and gerszten.11) reported an 88% radiographic control rate in patients, 69% of whom had previously received radiotherapy. chang.3) reported a 1-year actuarial tumor progression - free incidence of 84% for fractionated srs treatment ; 56% of their patients received srs as a retreatment. as greater experience is gained, stereotactic radiosurgery will probably evolve into an initial upfront treatment for spinal metastasis in certain cases, especially for cases of oligometastasis. this is similar to the evolution that occurred over the past decade for the treatment of intracranial metastases by radiosurgery. additional asymptomatic lesions may be treated by srs to avoid further irradiation to neural elements and further bone - marrow suppression and to permit subsequent systemic therapy. gagnon.8) reported a matched - pair analysis in which 18 patients with breast - cancer spinal metastases treated by srs were compared to 18 matched patients that received conventional external beam radiation therapy (ebrt) upfront. this study concluded that salvage srs is as efficacious as initial fractionated rt without added toxicity. haley.18) recently reported that in terms of pain relief, srs as a primary treatment modality in spinal metastasis was not different from ebrt. when used as a primary treatment modality, long term radiographic tumor control was demonstrated in 90% of cases of breast, lung, and renal cell carcinoma metastases and in 75% of melanoma metastases11). sheehan.36) reported a 100% tumor control rate in lesions that had not previously undergone irradiation, and ryu.31) reported the results of a dose - escalation trial in which a series of 49 patients with lesions that had not previously undergone fractionated rt demonstrated good clinical outcomes. the spine can be instrumented if necessary, residual tumor can be safely treated later by srs, and thus, the adjunctive srs can reduce the chance of repeated surgery and possible morbidities from the second surgery. furthermore, anterior corpectomy with reconstruction procedures in certain cases can be avoided successfully by posterior decompression and instrumentation alone followed by srs to the remaining anterior lesion. given the ability to perform spinal srs effectively, the current surgical approach to these lesions might be changed. as srs has the stiff falloff gradient of the target dose with negligible skin dose20), such treatments can be given soon after surgery instead of after the usual significant delay before standard external beam rt is permitted2,25,39). open surgery for spinal metastases will likely evolve in a similar manner, whereby intracranial brain tumors are debulked in such a way as to avoid neurologic deficits and minimize surgical morbidity12). rock.28,31) specifically evaluated the combination of open surgery followed by adjuvant srs in a series of 18 patients and achieved a local control rate of 94%, whereas gerszten.10) reported a series of 26 patients treated by srs after vertebral body cement augmentation and achieved a local control rate of 92%. the prescribed radiation dose to the tumor is determined based on tumor histology, spinal cord, or cauda equina tolerance and previous radiation dosage to normal tissue, especially to the spinal cord. no large - scale study has yet developed an optimal dose for spinal srs, and no appropriate dose or fractionation schedule for metastatic tumors have been firmly established. however, spinal srs has been found to be safe at doses comparable to those used for intracranial radiosurgery without the occurrence of radiation - induced neural injury. single - fraction srs doses range from 8 to 24 gy, while hypofractionated regimens consist of 4 gy5 fractions, 6 gy5 fractions, 8 gy3 fractions, or 9 gy3 fractions9). currently, there is no evidence to support one regimen over another34). in one recent large series9), 26.4 gy in 3 fractions was prescribed to the 75% isodose surface for radiation nave lesions. previously irradiated lesions were treated with a mean maximum dose of 20 gy (range 12.5 - 25 gy)11), a median dose 35 gy (range 20 - 50.4 gy)3), a median dose of 20 gy in 5 fractions (range 20 - 30 gy)43), and a median dose 20 gy (range 10 - 30 gy) in 1 - 5 fractions (median 2). one concern that has been raised regarding srs for spinal metastases is whether adjacent levels are included in the radiation field. in the report of university of pittsburgh medical center, no cases of tumor progression were encountered at immediate adjacent levels, thus justifying the treatment of the involved spine only11,33). although they reported failures in 3 out of 49 patients treated for solitary metastases, no failure was identified in adjacent untreated vertebrae33). the implication of these findings is that progression in adjacent vertebral bodies is rare, and thus, they support srs treatment of involved spinal levels only3,34). based on these findings, sahgal concluded that it was possible that : 1) failure in the epidural space may have been be due to underdosing of the tumor because of strict spinal cord constraints, 2) uninvolved adjacent posterior elements should have been included in the target volume, and 3) encompassing one vertebral body above and below diseased vertebrae was unnecessary34). the minor and limited toxicities reported for spine radiosurgery include esophagitis18,19), dysphagia6), diarrhea3,6), cenparesthesia6), transient laryngitis1), compression fracture9), and transient radiculitis1). radiation induced spinal cord injury is exceedingly rare, and only a small number of cases have been reported. an early series by benzil.1) contained no radiation - induced spinal cord toxicity, and gerszten.11) found no spinal cord toxicity after a follow - up of over 60 months. ryu.30) specifically addressed the partial volume tolerance of the spinal cord and complications of single - dose srs. they reported a single case of radiation - induced cord injury 13 months after srs and concluded that, whereas the maximum spinal cord tolerance to single - dose radiation is unknown, partial volume tolerance of the human spinal cord is at least 10 gy to 10% of the spinal cord volume, defined as 6 mm above and below the srs target. in a recent multicenter study of 1075 cases17), only 6 patients developed delayed radiation - induced myelopathy at a mean of 6.4 months (range, 2 - 9 months) after spinal srs. recently, haley.18) reported that rt had higher acute toxicity rates than srs but encountered no late complications after either treatment modality. from a historical viewpoint, modern linac is equipped for a wide variety of treatment modalities, including intensity - modulated radiation therapy, stereotactic treatment, and image - guided radiation therapy. these advances allow more precise target definition and conformality, which makes hypofractionation more feasible, and provide a potential means of reducing the toxicities often observed after administering large fraction sizes18). the development of gamma knife srs and linac - based radiosurgery allow the delivery of highly conformal doses of radiation in a single fraction. the first cyberknife (accuray) prototypes were used in the 1990s, and in 2001 the fda granted clearance for treatment of extracranial lesions15). the metastatic disease population is an inherently difficult group of patients to study, and patients typically have multiple disease sites, poor health, and quality of life. with limited follow - up and survival and other probable confounders such as high dose steroid use, retrospective datasets generally report better outcomes than reported by randomized trials. this systemic literature review reveals the relative safety and efficacy of spinal srs. despite the significant clinical experience and widespread utilization of conventional rt for spinal metastases, early treatment of these lesions before a patient becomes symptomatic and the stability of the spine is threatened is obvious advantageous5). furthermore, conformal srs avoids the need to irradiate large segments of the spinal cord. in addition, the early srs treatment of spinal lesions may obviate the need for extensive spinal surgery for decompression and fixation in these already debilitated patients and may also avoid the need to irradiate large segments of the spinal column, which is known to have a deleterious effect on bone marrow reserve in these patients. the avoidance of open surgery and the preservation of bone - marrow function facilitate continuous chemotherapy in this patient population. furthermore, improved local control, such as that demonstrated for intracranial radiosurgery, could translate into more effective palliation and potentially longer survival. one advantage to patients offered by single - fraction srs is that treatment can be completed in a single day rather than over the course of several weeks, which is not inconsequential for those with a limited life expectancy. furthermore, the technique may be useful for capitalizing on the possible advantages of radiosensitizers12). in addition, cancer patients may have difficulty with access to a radiation - treatment facility for prolonged, daily fractionated therapy. also, for certain tumors such as sarcomas, melanomas, and renal cell metastases, a large single fraction of irradiation may be radiobiologically advantageous compared to prolonged fractionated rt. as opposed to responses to conventional ebrt, responses to high - dose single - fraction radiation or srs have been demonstrated to be histology independent, and excellent responses have been observed for radioresistant tumors. clinical responses such as pain or neurologic deficit improvement might also be more rapid after srs12). first, the quality of literature on spinal srs is poor ; no randomized controlled study has been conducted. second, srs is more expensive than conventional rt ; according to the us medicare system, the cost of rt is about 80% that of srs18). in the south korea system, when cyberknife stereotactic radiosurgery was done in 3 fractions and rt was done in 10 fractions, stereotactic radiosurgery is two times more expensive than 2d rt and similar to 3d rt. although specific costs are likely to differ in other countries, a cost benefit study is required before the widespread adoption of srs. therefore, we suggest that srs be initially used to treat spinal metastasis and chemo resistant tumors. nonetheless, we believe that the usage of srs will progress in the same manner as brain radiosurgery and that eventually it will be routinely used to treat spinal metastasis. however, further randomized controlled studies are required to compare spine srs to conventional rt for the treatment of spinal metastasis. in the management of spinal metastasis, stereotactic radiosurgery appears to provide high rates of tumor control, may be less affected by histology, and can be used in previously irradiated patients. however, the quality of available literature on spine srs for metastasis is low or very low. | objectivethe incidence and prevalence of spinal metastases are increasing, and although the role of radiation therapy in the treatment of metastatic tumors of the spine has been well established, the same can not be said about the role of stereotactic radiosurgery. herein, the authors present a systematic review regarding the value of spinal stereotactic radiosurgery in the management of spinal metastasis.methodsa systematic literature search for stereotactic radiosurgery of spinal metastases was undertaken. grades of recommendation, assessment, development, and education (grade) working group criteria was used to evaluate the qualities of study datasets.resultsthirty-one studies met the study inclusion criteria. twenty - three studies were of low quality, and 8 were of very low quality according to the grade criteria. stereotactic radiosurgery was reported to be highly effective in reducing pain, regardless of prior treatment. the overall local control rate was approximately 90%. additional asymptomatic lesions may be treated by stereotactic radiosurgery to avoid further irradiation of neural elements and further bone - marrow suppression. stereotactic radiosurgery may be preferred in previously irradiated patients when considering the radiation tolerance of the spinal cord. furthermore, residual tumors after surgery can be safely treated by stereotactic radiosurgery, which decreases the likelihood of repeat surgery and accompanying surgical morbidities. encompassing one vertebral body above and below the involved vertebrae is unnecessary. complications associated with stereotactic radiosurgery are generally self - limited and mild.conclusionin the management of spinal metastasis, stereotactic radiosurgery appears to provide high rates of tumor control, regardless of histologic diagnosis, and can be used in previously irradiated patients. however, the quality of literature available on the subject is not sufficient. |
despite existing initiatives to integrate health services in the americas health care fragmentation remains a significant challenge. excessive fragmentation leads to difficulties in access to services, delivery of services of poor technical quality, inefficient use of resources, increases in production costs, and low user satisfaction. to address this problem, the pan american health organization (paho) has launched the integrated health services delivery networks (ihsdn) initiative to support the development of more accessible, equitable and efficient health care models in the region. ihsdn are defined as a network of organizations that provides, or makes arrangements to provide, equitable, comprehensive, and integrated health services to a defined population and is willing to be held accountable for its clinical and economic outcomes and the health status of the population served. ihsdn require 14 essential attributes for their adequate operation grouped according to four principal domains : model of care, governance and strategy, organization and management, and financial allocation and incentives. an extensive literature review, expert meetings and country consultations (national, subregional and regional) in the americas resulted in a set of consensus - based essential attributes and policy options for implementing ihsdn. the research and evidence on health services integration remains limited ; however, several studies suggest that ihsdn could improve health systems performance. principal lessons learned include : i) integration processes are difficult, complex and long term ; ii) integration requires extensive systemic changes and a commitment by health workers, health service managers and policymakers ; and iii) multiple modalities and degrees of integration can coexist within a single system. the public policy objective is to propose a design that meets each system s specific organizational needs. | introductiondespite existing initiatives to integrate health services in the americas health care fragmentation remains a significant challenge. excessive fragmentation leads to difficulties in access to services, delivery of services of poor technical quality, inefficient use of resources, increases in production costs, and low user satisfaction. to address this problem, the pan american health organization (paho) has launched the integrated health services delivery networks (ihsdn) initiative to support the development of more accessible, equitable and efficient health care models in the region [1].theory / conceptual frameworkihsdn are defined as a network of organizations that provides, or makes arrangements to provide, equitable, comprehensive, and integrated health services to a defined population and is willing to be held accountable for its clinical and economic outcomes and the health status of the population served. ihsdn require 14 essential attributes for their adequate operation grouped according to four principal domains : model of care, governance and strategy, organization and management, and financial allocation and incentives [1].methodsan extensive literature review, expert meetings and country consultations (national, subregional and regional) in the americas resulted in a set of consensus - based essential attributes and policy options for implementing ihsdn.results and conclusionsthe research and evidence on health services integration remains limited ; however, several studies suggest that ihsdn could improve health systems performance. principal lessons learned include : i) integration processes are difficult, complex and long term ; ii) integration requires extensive systemic changes and a commitment by health workers, health service managers and policymakers ; and iii) multiple modalities and degrees of integration can coexist within a single system. the public policy objective is to propose a design that meets each system s specific organizational needs [1 ]. |
crohn s disease is a chronic granulomatous inflammatory disease that may involve any part of the alimentary tract, although the ileum is the most frequent location. the presenting symptoms are variable and include abdominal pain, growth failure, and, less commonly, diarrhea. in the early stages, crohn s disease causes small erosions on the inner surface of the bowel (aphthous ulcers). with time, the erosions become deeper and larger, causing scarring and stiffness of the bowel. histologically, the active mucosal lesion shows a mixed infiltrate of lymphocytes, plasma cells, and neutrophils. non - necrotizing granulomas are found in about 50% of resection specimens and may be located in any portion of the bowel wall. crohn s disease was shown to be a predisposing factor for ileoileal intussusception (1). intussusception occurs when a proximal segment of bowel telescopes into an adjacent distal segment. unlike in children we describe an unusual case of acute intestinal obstruction due to ileoileal intussusception as an initial manifestation of crohn s disease. we speculate that intussusception was secondary to inflammatory edema and spasm, which led to impaired contraction of the bowel and allowed unbalanced peristaltic forces to rotate the intestinal wall inwards and initiate the invagination. hence, crohn s disease should be taken into consideration in young patients with intestinal intussusception if no other cause is found. a 20-year - old patient presented to emergency with complaints of central abdominal pain, vomitting, and bloody stool for the previous 2 days. the abdomen was distended and examination revealed mild central abdominal tenderness with diminished bowel sounds. routine investigations showed a raised white cell count of 21,200/mm, and a mild metabolic acidosis (ph of 7.34, serum level of bicarbonate of 18.12 an abdominal x - ray showed grossly distended loops of small intestine with absent colonic shadows, suggestive of mid - bowel obstruction (figure 1). conservative treatment with nasogastric tube and endovenous fluids was initially instaured for at least 36 hours but ultrasound was later considered because there was no improvement. ultrasonography showed a moderate amount of free fluid in the peritoneal cavity with distended bowel loops and enlarged lymph nodes in the mesentery. contrast enhanced ct - scan (figure 2) revealed a hypodense mass lesion in the pelvis, representing a thickened segment of bowel (enteroenteric intussusception). laparotomy revealed a moderate amount of serous free fluid, grossly distended proximal small bowel loops, and distal ileum intussusception. enlarged lymph nodes were noted at the site of the intussusception. the intussusceptum segment (60 cm - long ileum) finally, a 70 cm - long resection with side to side isoperistaltic anastomosis was carried out. postoperative period was uneventful for the patient and he was discharged on the fifth day after surgery. gross examination of the specimen showed extensive (60 cm - long) bowel infarction. the rest of the bowel (10 cm - long) was hemorrhagic and presented small longitudinal ulcerations with irregular borders in the mucosa (figure 3). transmural inflammation, deep ulcerations, and non - necrotizing epithelioid cell granuloma (sarcoid like - granulomas) were demonstrated (figure 4). a final diagnosis of inflammatory crohn s disease affecting the ileum was made. at 6 months follow up, the patient was doing well and was receiving mesalazine 2 g orally for the treatment of crohn s disease. one of the most common complications leading to surgery is chronic intestinal obstruction secondary to chronic inflammation with fibrous scar, which is rarely complete but is high grade (2). cases of intestinal obstruction secondary to small bowel intussusception by a segment of active crohn s ileitis have been rarely reported (1,3). symptoms are usually the same as for other types of intestinal obstruction. the classic triad of abdominal mass, pain, tenderness, and bloody stool is rarely found. the aetiology of intussusception in the small bowel and the colon are different. in two thirds of cases, intussusception arises in the small bowel and is more common in the proximal bowel due to increased peristaltic activity. about 10% of intussusceptions in adults are primary and 8090% are secondary to an underlying pathology. of the latter, approximately 65% are secondary to a benign lesion or malignant tumor, and 1520% of cases are due to processes other than tumor growth. with the widespread use of ct, the diagnosis is nowadays most often made by the radiologist since the ct features of intussusception are virtually pathognomonic (5,6). optimal management between reduction and primary resection in treatment of adult intussusception has caused some controversy. some authors have established the principle of resection without reduction whenever possible based on a high incidence of underlying malignancy that could not be confirmed either preoperatively or intraoperatively (7). the problems against reduction include : risk of intraluminal seeding or venous embolization, possible perforation during manipulation, and subjection of the patient to increased risk of anastomotic leakage due to edematous bowel. in favor of reduction nowadays, it is recommended to use a selective approach to resection that takes into consideration the site of intussusception that tends to influence the type of pathology (8). we advocate individualized treatment, depending on medical history and findings during intervention, as some cases of transient and acute intussusception have been observed on small bowel barium studies in patients with crohn s disease, adult coeliac disease, and many other benign conditions. transient intussusception has been observed occasionally on small bowel barium studies in patients with crohn s and adult coeliac disease. the leading point to the intussusception in crohn s disease is probably the dysrhythmic contractions secondary to the on - going inflammatory process of a thickened, inflamed segment of bowel wall (9). both patients underwent exploratory laparotomy, and no intraluminal mass was detected (10). the risk of developing short bowel syndrome in patients with crohn s disease is approximately 5% to 10% in reported series. as far as we know, this is the first case reported of small bowel intussusception as an initial manifestation of crohn s disease, for which long surgical resection was necessary and thus worsened the prognosis of the disease. the incidence of short bowel syndrome (sbs) varies depending on the underlying disease process and its medical and surgical management. aggressive resectional therapy, surgical complications, and errors in initial diagnosis contribute to development of sbs in these patients (11). we conclude that small bowel intussusception might be the first manifestation of crohn s disease. intussusception might be secondary to impaired contraction of the bowel associated with inflammation, edema and spasm. management of small bowel intussusception in young patients should be individualized depending on the patient s medical history and intraoperative findings. in these cases, early exploration and reduction of the intussusception (thus avoiding intestinal necrosis) may prevent the onset of short bowel syndrome in the future. we recommend urgent ct - scan in patients with a known history of crohn s disease and a sudden onset of abdominal pain to rule out intussusception and its potential complications. in these cases, | intussusception is usually considered a childhood condition, but it may also be present in adults, where it is more often associated with an underlying pathology. there is no agreement upon the correct treatment of adult intussusception, although surgical intervention is considered necessary. resection without prior reduction has been the traditional treatment of choice due to the significant risk for malignancy found in most series. we describe an unusual case of intestinal necrosis secondary to ileoileal intussusception caused by crohn s disease. a long intestinal resection was necessary and the patient was discharged without major complications. based on the details of this case, the authors emphasize the potential importance of considering individualized treatment of adult intussusception. the practical benefit for reduction of viable bowel in crohns patients is the preservation of bowel length. |
preterm birth, as one of the pregnancy problems, is the leading cause of neonatal mortality and the second cause of child deaths under the age of 5. it is defined as birth before 37 weeks of gestation, which affects 518% of the pregnancies. for the families and health - care systems, short- and long - term morbidity and financial implications of preterm birth primary symptoms of preterm labor (ptl) are often mild, and the associated symptoms occur too late, so, it is difficult to diagnose early. some methods are used to predict preterm delivery (ptd) by clinical symptoms and epidemiological risk factors such as obstetric history, but these are neither sensitive nor specific. the presence of a method, enabling to a rapid and accurate diagnosis of actual ptl in pregnancy, could be useful to lower treatment costs and unnecessary interventions. nitric oxide (no), as one of the pivotal metabolic factors, has been implicated in a variety of biological and reproductive processes including oocyte maturation, fertilization, and embryonic progression. no has a short half - life time and promptly oxidized by nitrite oxide which is changed to nitrite oxide metabolites (nox), contained to no3 (nitrates) and no2 (nitrites). assessment of no metabolite can be measured easily from plasma, urine, and vaginal secretions. even though the effects of tocolytics on neonatal outcomes improvement have been not shown, they are the important interventions in obstetrics to delay ptd. the aim of tocolytic therapy is to delay ptd long enough for antenatal corticosteroids to be administered or transporting the mother to a tertiary care center, thereby reducing neonatal morbidity and mortality. the use of tocolytic agents in contemporary obstetric practice should be customized based on the available evidences of efficacy and fetomaternal safety, gestational age, maternal conditions, and drugs potential complications. magnesium sulfate is one of the tocolytic agents which is commonly used for tocolytic therapy, and despite maternal side effects, its usage in women at risk of preterm birth helps to protect the child 's brain, to reduce the rates of cerebral palsy, and to improve long - term neonatal outcomes. hence, the present study was aimed to estimate the plasma level of no metabolites in pregnant women with symptoms of ptl compared to the women with normal pregnancy. however, as the strength of the survey, it was tried to reduce the risk of ptl with magnesium sulfate therapy in two factors of no and cl comparison and to estimate the diagnostic value of each of the two factors. this was a case control study, and according to the cochran sample size calculation formula to compare the mean values at the confidence level of 95% and power of 80%, a standard deviation of cl was estimated as 1.55 and the least significant difference between the two groups was considered as 0.8 ; approximately, sixty women assigned in each normal and ptd groups with simple random sampling method. samples were selected based on the acceptable criteria among the pregnant women admitted to the delivery section of shahid beheshti hospital in isfahan (iran) from february to december 2014. in painful uterian contractions, documented, despite hydration, for 1 h on an external tocodynamometer or regular contractions resulting cervical changes in dilatation and effacement was defined as ptl in case group. cases with any clinical signs of infection or any other maternal or fetal complications were not selected. inclusion criteria were age range of 1835 years, singleton pregnancy, gestational age of 2434 completed weeks, nulliparous pregnancies with intact membranes, no history of type 1 or 2 diabetes mellitus, hypertension, cardiovascular disease, and infectious diseases. women with ptl were excluded from the study if they had contraindication by using tocolytic drugs, fetus or amniotic fluid anomaly, uterine or cervical abnormality, multiparity, and emerging with some undesirable conditions during parturition such as pre - eclampsia and abruption. women with unreliable gestational age for any reason, whom with multiple pregnancy or problems such as premature rupture of membranes, gestational diabetes, high blood pressure, eclampsia or pre - eclampsia, incompetent cervix, uterus anomaly, use of prescription drugs such as corticosteroids before sampling or during hospitalization, and evidence of chorioamnionitis or other infections were excluded from the study. those who have contraindications to medications such as tocolysis (fetal asphyxia, fetal growth restriction, and placental problems, such as a placenta previa or abruption) were also excluded from the study (ten females have been excluded from the study because of some problems). in addition, the study was approved by the isfahan university of medical sciences ethical committee with the code of 392348. cl was measured by an experienced sonographer, using a transvaginal ultrasound (siemens, sonoline g40 model, ev9 - 4 mhz probe) placed in the anterior fornix of the vagina while the patient 's bladder was empty. cl is defined as the distance between the internal to external along the end cervical canal. baseline data were collected to assess comparability of the study groups, and in all women, blood samples were collected by venipuncture to measure the plasma level of no. after that, the women in case group were received standard tocolysis, ampicillin and corticosteroid for fetal lung maturity. the methods used for tocolysis treatment were in this way ; use of magnesium sulfate as follows : first, injection of 4 g magnesium sulfate 20% and then 2 g / h continued, after that, they were followed till delivery time to assess the treatment response. no concentration was measured spectrophotometrically using the griess reaction with a commercial kit (madison, wisconsin, usa, promega co.). chicago, il, usa), using independent t - test, pearson 's correlation, and logistic regression to compare the two groups, as well as in case of the two subgroups with preterm labor and and preterm delivery regarding the data normal distribution approved by kolmogorov in addition, to compare the diagnostic value of no with the cl, receiver operating characteristic (roc) analysis and mcnemar test were performed using medcalc for windows, version 15.1 (medcalc software, ostend, belgium). in the current study, the mean age of the women with preterm birth risk (n = 50) was 23.84 3.94 years, whereas in women with normal status (n = 60), it was 24.50 4.42 years. the mean gestational age in the group with preterm birth was 30.58 2.48 weeks, whereas it was 29.91 2.60 weeks in normal group. no significant difference was found between the two groups, and they were similar regarding maternal and gestational age (p > 0.05). furthermore, the level of no in the normal group, with the mean of 39.05 10.17 clinical characteristics of pregnant women on the other hand, among the pregnant women with ptl after magnesium sulfate treatment, ten participants (20%) had ptd (in 26.13 3.24 h after treatment) and forty cases (80%) had term pregnancy (in 17 2.47 h after treatment), indicating the level of no in the term pregnancy women, with the mean of 37.78 7.09 mol / l ; this has been significantly higher than ptd women (25.38 4.21 mol / l) (p < 0.0001), and the length of cervix in the treated women with the mean of 27.30 1.71 mm has been significantly more than ptd women with the mean of 19.90 2.96 mm (p < 0.0001). in addition, in the case group, there was a direct and significant correlation between the length of cervix and the level of no so that the length of cervix increased with no level (correlation ptd = 0.795 and correlation ptl = 0.624) [table 2 ]. clinical characteristics of women with preterm labor in two groups : term and preterm the results of logistic regression to determine the risk of influential factors in preterm birth among the pregnant women at risk of ptd indicated that the level of no, with impact factor of 0.494 and odds ratio of 0.610 (0.4400.846%), and also the length of cervix with impact factor of 31.099 and odds ratio of 3.119 (1.2327.03%), have been influential in the occurrence of preterm birth (p < 0.05) [table 3 ]. multivariate analysis of prognostic factors for preterm delivery in women with preterm labor finally, roc analysis indicated that discriminative value of no level and the length of cervix in relation to preterm birth in tocolytic therapy group (ptl and delivery term) were lower or equal with 31 mol / l, with a sensitivity of 99.70 (69.0100%) and a specificity of 82.50 (67.292.6%), and in the cervix length, it was lower than or equal to 22 mm with a sensitivity of 80 (44.496.9%) and a specificity of 99.90 (91.1100%). in other words, sensitivity and features of these factors had a high capability in the discriminative evaluation of preterm birth. the npv was high in the two methods (npv in nox = 98.8 and cl = 95.2), while positive predictive value (ppv) was lower than the length of cervix in measuring the no level (ppv in nox = 58.8 and cl = 99.9), and also, the level under the curve was more than 0.70 in both the groups. therefore, it seems that these two factors can be considered as good prognostic criteria for preterm birth (p = 0.0001) [table 4 ]. comparison between cervical length and nitric oxide diagnostic methods in women with preterm labor on the other hand, comparative analysis of roc, using the mcnamar test in two discriminative criteria of no level and length of cervix, indicated that the area under curve of no level (area under receiver operating characteristic curve [auc ] = 0.952) had no significant difference with cl (auc = 1.00) (difference between areas = 0.047, standard error = 0.028, and 95% confidence interval = 0.0080.103 ; p = 0.095). in other words, the accuracy and value of both no and cl have been assessed similarly. therefore, both of them can be appropriate discriminative criteria regarding the preterm birth [figure 1 ] ptl, as one of the most common problems in perinatology, may lead to many neonatal disorders such as morbidity and mortality and variety of physical diseases and imposes us the unwanted heavy costs for hospital administration and caretaking of preterm infants. to prevent ptl, many investigations have been done to specify the possible reasons through which we can identify the susceptible pregnant women. in the current study previous studies have revealed that because nox is involved in cervical ripening, it is a good marker for ptd. likewise, in a study done by zhou., they found the similar result for the level of nox in their both groups. it has been shown that no normally generates in the uterus and inhibits the uterine contractility. the changes in no and its effects were consistent with the theory that no plays a role in uterine quiescence during pregnancy. hence, a change in this system at term or preterm could play a role in the inhibition of labor and delivery. besides, the lower level of nox was observed in preterm compared with delivery term in ptl women. likewise, visnen - tommiska. in their comprehensive investigation found the same result. in addition, sladek. found that no level in preterm was lower than term group. it is supposed that reducing the level of no during the last stage of pregnancy triggers the initiation of labor consequently and stimulates the contraction of uterine. on the other hand, some studies have reported the elevated nox level in ptl women. on the other hand, the cl and nox levels in women with ptl indicated that ptl risk factors have a significant effect on the sample of our study. our evaluation revealed that no level and cl were prognostic factors for ptd in pdt women. despite finding a positive correlation between nox level and cl in ptl, the survey performed by duckitt and thornton demonstrated that using magnesium sulfate, which causes an elevated level of no, had no significant effect of ptl. have revealed that nox donor treatment tended to decrease the risk of birth compared to placebo group. however, cl reports are fluctuating, and still, there is no global standard for it ; so, we could only implicitly compare between our findings with others. in many studies, it has been demonstrated that both cl and nox factors have a noticeable impact on ptl. in addition, it has been shown that no has a short half - life time and promptly oxidase to nox, which contains no3 (nitrates) and no2 (nitrites). in fact, nox is the marker of no activity, which is the main biomedical mediators promoting cervical ripening and maintenance of pregnancy. in other studies, there was variable cutoff. in comparison with our assessment (nox 31 [mol / l ]), some studies have reported the higher amount of no (nox 123 [mol / l ]), while other probations have stated the lower no level compared with our findings. we believe that the fluctuation of nox level might be related to our different population nature or small sample size, and we encounter with limiting external validation of the result, and more investigations are needed to evaluate the level of no in bigger population. for cl cutoff, our result revealed that those with equal or lower cl than 22 mm might highly encounter with ptd. in addition, no was an appropriate discriminative criterion to determine the preterm birth so that cutoff in the level of no is lower than or equal to 31 mol / l, and the length of the cervix is 22 mm. whether or not considering the variety of reports regarding no efficacy, more number of evaluations should be performed to find the exact effect of biochemical materials such as no on ptl. apart from the effect of no on ptl, it should be kept in mind that using magnesium sulfate has side effects such as nausea and vomiting, and patients taking magnesium sulfate should be tracked for complications such as cardiac arrest or respiratory depression. all in all, due to small sample size and no recruitment of race variable in our study, we can not have a meticulous report ; therefore, in the future study, these limitations should be considered. according to the previous investigations, we are standing on this claim that no might be a reliable marker for predicting the ptl, and administration of no synthesis could be a candidate for the future therapeutic target. our findings shown that nitric oxide was appropriate discriminative criteria to determine the preterm birth so that cut off in the level of nitric oxide is lower than or equals to 31 mol / l and the length of cervix is less than or equals to 22 mm. zsh contributed in the conception, design, and definition of intellectual content of the work, conducting the study, approval of the final version of the manuscript, and agreed for all aspects of the work. mn contributed in the concepts, literature search, clinical studies, experimental studies, data acquisition of the work, preparation, and editing of the manuscript. fej contributed in the literature search, experimental studies, data analysis, statistical analysis of the work, and agreed for all aspects of the work. | background : preterm labor (ptl) is the main challenge in prenatal health care, leads to high rate of mortality and increases cost of health services. to evaluate the preterm delivery (ptd)-related risk factors, we decided to measure nitrite oxide metabolites and cervical length (cl) as the diagnostic and predictive tools for ptd in women and response to tocolytic therapy.materials and methods : in this case control study, sixty women of 1835 years with first pregnancy during the 2434 gestational weeks with ptl in case group admitted to the delivery section of beheshti hospital, isfahan, iran were included. sixty women in control group have the same specifications. no and cl level were assessed, and the collected data were analyzed by spss software, version 20 and medcalc software, version 15.1.results:the two groups were similar regarding maternal and gestational age (p > 0.05). lower level of no was observed in ptl women with a mean of 35.30 8.27 mol / l compared to the normal gestation group with a mean of 39.05 10.17 mol / l (p = 0.035). in addition, the diagnostic accuracy of both ptl - predicting factors was determined (no 31, sensitivity 99.7%, specificity 82.5% and cl 22, sensitivity 80%, specificity 99.9%).conclusion : as the previous investigations stated, it can be claimed that no might be the reliable marker for predicting the ptl, and administration of no synthesis could be a candidate for the future therapeutic target. |
interventional radiology is a clinically - oriented specialty that employs image guidance in order to perform minimally invasive diagnostic and therapeutic procedures.1 technological developments of imaging equipment coupled with the advanced engineering of pinhole therapeutic applicators and minuscule endovascular instruments have fuelled worldwide adoption of transcatheter and percutaneous techniques in the treatment of various vascular and solid organ pathologies with increased efficacy and reduced rates of morbidity and mortality.2 elderly patients may be poor anesthetic candidates and are usually denied surgical treatments because of underlying comorbidities. in addition, elderly patients are in a higher risk of developing peri- and post - operative complications and usually require a longer and more cost - consuming recovery and rehabilitation period. moreover, there is decreased pain sensitivity and perception with aging, which may further complicate therapy and management of the geriatric population. elderly cancer patients, in particular, may suffer from increased drug toxicity and peri - operative morbidity and mortality because of age - related physiological decline and reduced functional reserve capacity.36 front - line minimally invasive therapeutic procedures that are alternatives or may serve as adjuncts to traditional surgical treatments are becoming all the more important in the curative or palliative management of elderly frail patients with multiple comorbid conditions. the present report provides a concise review of several interventional radiological - guided procedures with a special focus on the treatment of the primary debilitating pathologies of the elderly population. in particular, the authors elaborate on thermoablation of solid organ malignancies, palliative stent placement for gastrointestinal tract cancer, endovascular management of aortic and peripheral arterial vascular disease, and cement stabilization of osteoporotic vertebral fractures (figure 1). however, interventional radiological procedures in the elderly further include and are not limited to hepatobiliary interventions in malignancy, percutaneous urinary tract procedures in obstructive nephropathy, carotid stenting of atherosclerotic extracranial carotid disease, interventional therapy of deep venous thrombosis and pulmonary embolism and various interventions for chronic pain relief. amassed evidence is generally limited to uncontrolled observational series and prospective studies, because the associated comorbidities and low performance status of the geriatric population usually prohibits properly conducted head - to - head randomized controlled trials. all procedures described in the present review paper are performed by appropriately trained interventional specialists, who are capable to carry out a successful intervention and take on responsibility and management of any procedure - related complications within a wide multidisciplinary team of clinical specialties that may include interventional radiologists, interventional cardiologists, vascular surgeons, thoracic surgeons, general surgeons, orthopedic surgeons and oncologists. cancer remains the second leading cause of death with a well - recognized increasing burden of cancer in the elderly population. the risk of cancer development increases exponentially with age above 60 years and almost two thirds of all new cancers afflict people older than 65 years.7,8 solid organ oncological interventions have a rapidly expanding role within interventional radiology. a wide range of radiological locoregional ablative techniques is available, which induce tumorous cell death primarily through coagulative necrosis or ischemia. they may be broadly categorized into thermal ablation, mainly encompassing radiofrequency ablation, microwave ablation and cryoablation, chemical ablation by alcohol or acetic acid and transcatheter embolization with or without additional targeted chemotherapy. at the moment, radiofrequency ablation (rfa), which was first applied in the early 1990s for the treatment of hepatic tumors,9 is by far the most widely adopted and commonly employed technique for percutaneous thermocoagulation of solid organ malignancies.1,2 rfa applicators with straight or expandable electrodes are introduced percutaneously under computed tomographic or ultrasonographic guidance into the center of the target tumor. then, a high - frequency alternating current (460500 khz) is delivered through the lesion, which causes agitation of the tissue ionic molecules, which in turn produces frictional heat. ablation treatment must include a 0.51 cm margin of healthy tissue around the target lesion in order to obliterate any microscopic satellite foci and avoid early local recurrence.2,10 the efficacy of rfa may be limited by adjacent high - flow vascular structures, which act as a cooling circuitry (widely known as the heat - sink phenomenon) and increased tissue impedance in case of tissue boiling and/or charring.10 microwave thermocoagulation is an emerging technology, which depends on the application of an electromagnetic wave (around 900 mhz) through an electrode - antenna. electromagnetic microwaves travelling through tissue evoke agitation of ionic molecules and production of frictional heat, which results in tissue coagulative necrosis. of note, microwave ablation technologies have certain inherent advantages over rfa, since they operate independent of any electrical current convection and are less influenced by tissue impedance variabilities and heat sink phenomena. microwave tumor ablation is gradually gaining place as a more versatile and efficient method of tissue thermocoagulation, because it can achieve higher intratumorous temperatures and larger ablation zones more quickly than rfa.2,10,11 primary hepatocellular carcinoma and metastatic liver disease (where local control can often improve life expectancy) have both been treated with rfa and a survival benefit has been demonstrated.12 a magnitude of prospective cohort studies in patients unfit for surgery for various reasons have provided the first evidence base for more widespread application of liver radiofrequency ablation.13,14 referred patients most commonly have inoperable disease or are unfit for liver surgical resection. rfa is best suited for localized primary hepatic tumors (one lesion less than 5 cm or three lesions less than 3 cm each).10 in a single - center rfa study of primary hepatocellular carcinoma in 206 cirrhotic patients, considered ineligible for transplantation or surgical resection, survival rates at 1, 3 and 5 years were 97%, 67%, and 41% on an intention - to - treat basis, respectively, after a median follow - up period of 2 years.15 unlike surgery, rfa tumor ablation can be performed as a day case procedure under conscious sedation and has less morbidity and mortality.10 rfa may be repeated for new or recurrent disease and has a lower complication rate due to its minimally invasive nature.16 reported mortality is 0.5% and associated complication rates range from 8% to 35%, mostly encompassing minor cutaneous burns, abscess formation and self - limiting post - ablation syndrome. benign post - ablation biliary strictures and tumor seeding along the electrode tract remain rare.2,10 in parallel, there are reports of a survival benefit in patients with hepatic colorectal metastases unfit for surgical metastasectomy and treated with rfa.12,17 reported 5-year survival rates compare very favorably with operable candidates who have undergone resection (30% with rfa vs 39% with surgery).16 rfa also has the added benefit of preserving bigger volumes of functioning liver tissue and thereby allowing for repeat sessions in the future, even in cases of multiple dispersed liver metastases.10 however, despite widespread adoption and incorporation of liver rfa into modern multidisciplinary management of liver cancer, more rigorous controlled trials are warranted to further elucidate its role in prolonging patient survival.13,14 there is also a growing body of evidence regarding thermocoagulation of renal cell carcinoma.10,11,18 rfa of renal cell carcinoma is an appealing curative treatment for small and exophytic tumors or when patients are too old and frail to undergo partial or complete nephrectomy (figure 2).11,19 however, large or central hilar tumors are more difficult to ablate completely due to heat - sink effect from high blood flow at the renal hilum and increased risk of complications from the collecting system ; mainly benign post - ablation strictures and urinoma formation.1,11 lung cancer remains the leading cause of cancer death in men and women and is biologically characterized by an extended time period between exposure to carcinogenic chemicals and tumor development.20 unfortunately, elderly people, in particular octogenarians, are less likely to be offered surgical resection as a first - line curative treatment option owing to either coexisting comorbid conditions or advanced disease at the time of diagnosis.20 poor heat conductivity of the surrounding air makes lung lesions particularly suitable to rfa ablation, as heat remains localized into the lesion. elderly surgically unfit patients with early (stage 1) nonsmall cell lung cancer (nsclc) and those with limited metastases can be typically offered the treatment.10 however, published evidence of radiofrequency ablation of lung tumors is still limited to observational studies and case series that have demonstrated favorable safety profile and low recurrence rates around 11%.21 a systematic literature review of lung rfa showed that the median progression - free interval ranged from 15 to 27 months (median = 21 months), and 1-, 2- and 3-year survival rates were 63%85%, 55%65%, and 15%46%, respectively.21 in view of growing evidence regarding lung stereotactic radiation therapy that also shows promising local control rates, randomized controlled trials between the two types of treatment are warranted.22 finally, application of rfa is particularly appealling for pain management of intractable metastatic bone disease. up to 85% of patients presenting with breast, prostate and lung cancer have evidence of bone metastases at the time of death.23 relief of pain from these deposits is an important aspect of palliative care. radiation therapy can take weeks to take effect and fails to relieve pain in up to 30% of patients.24 there are several ablative techniques that have been used to treat bone metastases. severe pain from bone metastases may be treated by this method when conventional therapies such as opiate analgesia, chemotherapy and radiotherapy are ineffective, too slow acting or cause unacceptable side effects.25,26 rfa is particularly suited to bone metastases that are unsuitable for alcohol ablation due to their proximity to nerves or when intra - articular leak of alcohol may occur.26 a multicenter trial of patients with painful bone metastases in whom other therapies including radiotherapy and chemotherapy had failed found sustained pain relief in 95% of patients.27 of interest, cryoablation is an alternative technique that freezes lesions to form an similar results to rfa have been achieved in providing pain relief for bone metastases.28 although the procedure takes more time than rfa, the extent of the cryoablation zone is more easily appreciated and monitored with conventional computed tomography, which allows the lesion to be more extensively treated without posing risks to surrounding structures.24 complications of bone deposit ablation include damage to surrounding structures such as nerve roots, bowel and bladder symptoms, formation of tumor - cutaneous fistulae, and pathological fractures.24,27 if a pathological fracture is anticipated, then cementoplasty (deposition of cement inside the ablation area based on the same principles of vertebroplasty (see dedicated section of the present overview below) may be performed to stabilize the treated bone, usually the vertebrae or the acetabulum.10,25 a further field of tumor ablative therapy includes arterial intervention. selective endovascular catheterization of tumors is performed with the aim of embolization or delivering regional chemotherapy. embolization may be used to reduce tumor size or blood loss prior to surgery or to palliate patents that are poor surgical candidates and require symptom relief. any hypervascular tumor such as metastastic renal cell or the majority of esophageal, gastric, pancreatic and colorectal cancers are detected in elderly people ; ie, older than 65 years.30 moreover, commonly applied treatments of surgery, chemotherapy, radiation or combinations thereof can be associated with significant complications and morbidity or may be intolerable in the setting of advanced age and underlying comorbidities. unfortunately, more than 50% of esophageal and gastroduodenal cancer cases present with advanced disease and are not eligible for curative resection at the time of diagnosis.31,32 minimally invasive radiological stent placement is a palliative treatment option that is routinely offered nowadays to patients with unresectable tumorous obstructive disease of the gastrointestinal tract. stenting is actually an established form of treatment in a wide range of pathological conditions. biliary and ureteric stenting are either used to palliate malignant obstruction or as a temporary measure in stone disease. gastrointestinal (gi) stenting is used in upper gi ; oesophageal and gastroduodenal ; and lower gi ; colonic ; malignant obstructive pathology. stents are designed to maintain patency, avoid re - obstruction and minimize the risk of migration. stents may be balloon - expandable or self - expanding and are manufactured from stainless steel or other alloys. nitinol (an alloy of nickel and titanium) self - expanding stents assume a predictable shape at body temperature when deployed and are generally preferred in the gastrointestinal tract. stents may be covered (usually with silicone and polyethylene covers) or uncovered, consisting of a nitinol mesh only.3134 covered stents usually resist tumor ingrowth and therefore prevent re - obstruction but are less stable and more rigid, requiring larger delivery systems and are more prone to migration. uncovered stents are more flexible and easier to deliver and deploy but are subject to tumor ingrowth. many stents are also designed to prevent migration by having flared ends. for the purposes of this review the following is a discussion of the principles, advantages and complications of esophageal, gastroduodenal and colonic stent insertion. this technique exemplifies the benefits stenting can have over more traditional forms of treatment, particularly in an elderly population. palliative therapy in case of advanced esophageal carcinoma aims to maintain oral food intake and relieve pain, while avoiding aspiration, reflux and regurgitation.31 over the last decade, self - expanding metal stents have become the endoluminal treatment of choice for rapid relief of dysphagia in patients with advanced stage esophageal carcinoma.33,34 indications for esophageal stenting generally include tumorous esophageal obstruction or extrinsic compression, malignant esophageal perforation and tracheoesophageal fistula, as well as refractory benign strictures.31,34 esophageal stent insertion is usually performed after completion of chemotherapy and radiotherapy to avoid tumor shrinkage, which predisposes to stent migration. esophageal stents are typically inserted transorally under conscious sedation.31 the technical success rate of radiological esophageal stent insertion is almost 100% with impressive and rapid relief of dysphagia.34 early procedure - related complications of esophageal stenting include lung aspiration, hemorrhage and esophageal perforation, which may occur in 10%20% of the cases.31,35 hemorrhage is usually self - limited, perforation is uncommon and procedure - related mortality is very low, ranging from 0% to 1.4%.35,36 late recurrent dysphagia as a result of tumor overgrowth at the stent edges or ingrowth through the mesh of uncovered stents may be as high as 60%, and is usually treated with repeat co - axial placement of another stent.34,35 other delayed complications are mostly device - related and may include stent migration, stent torsion, stent fracture or tracheoesophageal fistulation.35,37 of note, percutaneous gastrostomy or gastrojejunostomy may be particularly helpful in patients with inoperable and unstentable carcinoma of the upper gastrointestinal tract that require prolonged enteral feeding. disruption of normal swallowing in the elderly because of stroke or degenerative neurological conditions is another indication of the procedure.38,39 with a combination of ultrasound and x - ray guided gastropexy various types of gastrostomy or gastrojejunostomy tubes may be inserted. operators have to be extremely careful of liver laceration, perforation of the transverse colon and tube misplacement.39 stenting can also be applied to alleviate malignant gastroduodenal and colonic obstruction. patients with malignant gastric outlet or duodenal obstruction exhibit gastric distension, intractable vomiting and complete food intolerance leading to severely impaired quality of life.32 they typically suffer from dehydration and electrolyte imbalances and are at increased risk of aspiration pneumonia.40,41 large - diameter, self - expanding enteral stents can be inserted to relieve gastroduodenal obstruction and re - establish oral intake in patients with poor general condition. nowadays, gastroduodenal self - expanding stenting has become the treatment of choice for rapid palliation of gastric outlet and duodenal obstruction in pre - terminal patients with advanced upper gastrointestinal malignant disease (figure 3).32 indications for gastroduodenal stenting include inoperable extrinsic or intrinsic malignant strictures due to stomach, duodenal, pancreatic and cholangiocarcinoma, lymphadenopathy and post - surgery anastomotic recurrent disease.32 gastrointestinal perforation with symptoms of peritonitis, peritoneal carcinomatosis, distal small bowel obstruction and uncorrectable coagulopathy are typical contra - indications for the procedure. the procedure is performed transorally under conscious sedation and fluoroscopic guidance.32 although large - diameter uncovered stents are routinely deployed, covered stents may be helpful to exclude malignant fistulae to adjacent organs. the technical success of gastroduodenal stent insertion approaches 100%, but clinical success to relieve symptoms and restore oral feeding is nearer 90% because of either progressive distal disease or lack of functional stomach peristalsis (chronically obstructed stomach or tumor infiltration of coeliac axis neural plexus).42 the procedure is generally safe and well tolerated with a reported 0% mortality and less than 1% major complications including perforation and hemorrhage. of note, early intraprocedural perforation or late perforation by erosion of the stent ends through the intestinal wall may be a surgical emergency.42 similarly to esophageal stenting, stent migration occurs less frequently with uncovered stents, whereas reobstruction because of tumor ingrowth is treated with repeat co - axial stenting.32,41 large bowel obstruction due to malignant colorectal cancer is also a common, major surgical emergency. presenting patients are typically elderly with multiple co - morbidites including metabolic and electrolyte disturbances, intestinal ischaemia and sepsis. emergency surgery has mortality up to 20%43 and hartmanns procedures (resection and terminal colostomy) are suboptimal in elderly patients due to stoma care issues and many cases not being reversed. colonic stenting has a number of advantages related to emergency surgery being avoided in favor of elective surgery. this allows optimization of the patient, preoperative radiological staging, multidisciplinary team discussion, neoadjuvant therapy and primary anastomosis to avoid a two - stage procedure. a recent analysis paper comparing colonic stenting as a bridge to surgery versus surgery alone for emergent left colonic obstruction found it to be more effective with reduced peri - procedural mortality and less likely to require a permanent colostomy.44 the benefits were greatest among those who were at highest risk of surgery. stenting can also be used as a palliative measure in those patients that are unsuitable for surgery. most patients have a computed tomography (ct) scan and water - soluble enema to confirm the diagnosis, exclude perforation and assess the position and degree of stenosis. most left sided colonic lesions can be crossed with fluoroscopic guidance using a combination of wires and catheters. the only absolute contraindications are perforation, distal rectal lesions (where a healthy landing zone above the anal sphincter mechanism can not be obtained) and obstruction involving multiple sites, (most commonly found with pelvic cancers, serosal metastases and lymphadenopathy).45 a pooled safety and efficacy analysis of prospective colonic stenting studies encompassing around 1, 200 patients demonstrated median technical and clinical success rates of 94% and 91%, respectively, with a stent - related mortality of 0.58%.43 the clinical success of colonic stenting as a bridge to surgery was 71.7%.43 stenting is also more cost effective than traditional surgical options and palliative stenting has been shown to improve quality of life when compared with surgery.46 shorter hospital stay and a cost reduction between approximately 20%30% have also been observed.47 colonic stenting is a relatively low - risk procedure with a mortality rate around 1%. when the stent is placed very near the anorectal canal tenesmus and transient incontinence can occur. self - limiting haemorrhage is a minor complication, which is most likely related to the disease process itself. of note, performing physicians must be particularly vigilant of colonic perforation, which has an overall incidence of 4% and carries a 10% mortality rate.48,49 the risk increases with balloon dilatation of the diseased segment before stent deployment and excessive manipulation of guidewires (especially in the presence of diverticular disease).45 it can also occur as a late complication due to stent erosion, radiotherapy or chemotherapy.50 migration of colonic stents has been reported in 12% of cases.43 most stents migrate distally and pass through the anus, while symptomatic stents may be removed endoscopically. finally, stent re - obstruction, which occurs in approximately 10% of the cases because of tumor ingrowth or overgrowth, can be treated by co - axial deployment of a second.48,51 airway stenting may be applied to alleviate malignant or benign strictures of the tracheobronchial tree with impending asphyxia and death (figure 4). the procedure may be either palliative for inoperable primary or secondary lung or neck neoplasms encroaching or compressing the airway, or temporary for benign disease like inflammatory and anastomotic strictures, post - intubation stenosis and tracheobronchomalacia.5255 patients with advanced malignant obstructions may present with hemoptysis and chest pain, severe dyspnea and stridor, being on the verge of suffocation. given the limited life expectancy and poor performance status of these patients, urgent airway stenting is a sufficient and effective palliative therapy.53,54 the procedure generally involves mutidisciplinary evaluation and execution from a team of oncologists, surgeons and interventional radiologists. a combination of rigid or flexible endoscopy and plain fluoroscopy under general anesthesia is the safest approach for accurate stent deployment with minimal complications.52,53 dedicated airway stents are typically self - expanding and may be uncovered or covered ; composed either from plastic or metal alloys. technical success rates are very high (98%100%), but clinical success rates are somewhat lower, at the level of 88%100% for benign conditions and 82%92% for malignant disease.54 similar to applications in other hollow organs, uncovered stents mostly suffer from neoplastic tissue ingrowth and covered ones from migration. stent - related complications are more frequently encountered in the long - term treament of patients with benign airway stenoses and include decreased mucociliary clearance and sputum impaction, development of granulation tissue at the stent edges, stent migration and fracture.54,55 further studies are necessary to identify specific patient groups who may have the most benefit from stenting, as well as which type of stent is more suitable for the airways.56 abdominal aortic aneurysm (aaa) is an age - related disease.57 aaa patients over 80 years old are often denied open surgical repair because of underlying comorbidities.57,58 advanced age on its own has also been identified as an independent strong predictor of increased peri - operative death and post - operative adverse events following surgery of the thoracic or abdominal aorta.57,59 endovascular aneurysm repair (evar) is now commonly used to treat elderly patients with amenable anatomy (figure 5). parodi and colleagues reported the first successful clinical application of an appropriately engineered endograft for aaa exclusion in 1991.60 ever since, the introduction of new devices with lower profile and higher flexibility and conformability allow continuous expansion of anatomical inclusion criteria and today more elderly patients may qualify for the procedure. new generation endograft devices are smaller, more durable and far easier to advance through tortuous iliac arteries and deploy across angulated aaa necks.1,58 most importantly, evidence from of large multicenter randomized trials has demonstrated decreased peri - procedural mortality and morbidity of evar compared to open surgical repair series, although both procedure- and aneurysm - related mortality remain notably higher in older than in younger patients.57,61 moreover, evar is related to significantly less hospital stay and earlier patient ambulation and return to preoperative levels of activity.1 according to a meta - analysis, which included 1534 patients treated surgically and 1045 patients treated endovascularly for aaa, pooled mortality and morbidity was 7.5% and 31% after open repair compared to 4.6% and 11.5% following evar.57 nonetheless, long - term survival seems to be comparable for both techniques and device - related re - interventions are more common with evar.1,57 thus, the actual benefit of evar in terms of life years gained for elderly patients, especially for those over 80-years - old, remains questionable to date.58 overall, however, the current status of evar continues to be exceptionally robust and promising. recently, fenestrated and branched customized endografts have been successfully applied for the endovascular exclusion of complex suprarenal and juxtarenal thoracoabdominal aortic aneurysms in surgically unfit patients.62 in parallel, there has been tremendous progress in endovascular minimally invasive treatment of thoracic aortic disease.58 following the early clinical enthusiasm with endograft exclusion of aaas, dake and colleagues pioneered the same endovascular technique in the management of descending thoracic aortic aneurysms in 1994.63 ever since, a rapidly growing number of applications have been reported for a wide spectrum of thoracic aortic syndromes. these include and are not limited to acute and chronic aortic dissection, penetrating atherosclerotic ulcer, traumatic aortic transection, mycotic aneurysm, and rupture.64,65 although high - level clinical evidence from randomized controlled trials is still missing, elderly and frail patients are probably the ones to enjoy the most clinical benefit in this new era of endovascular treatment of thoracic aortic diseases.66 critical limb ischemia (cli) refers to limb - threatening peripheral atherosclerosis, and is typically characterized by multilevel, infrainguinal and infrapopliteal arterial occlusive disease.6769 cli has an estimated incidence of 5001000 per million per year and primarily afflicts elderly patients with diabetes mellitus.70 almost 170 million people suffer from diabetes worldwide with a projection to double by 2030.71 diabetic foot ulcers affect approximately 15% of all diabetics and are identified in 84% of diabetes - related lower extremities amputations owing usually to a combination of neuropathy and cli symptoms.71,72 deficiencies in more than 100 physiologic factors implicated in the cascades of angiogenesis, tissue regeneration and normal wound healing have been identified in diabetic ischemic feet.71 the presence of diabetes mellitus accentuates the risk of cli by four times and diabetic patients with cli are ten times more prone to amputation than normoglycemic patients.73 if cli is left untreated, it has a dispiriting natural course with an estimated 25% major amputation and 25% cardiovascular mortality rate at 1 year.70 in the interest of preventing limb loss or minimizing the extent of pre - planned amputation, cli patients must undergo urgent percutaneous or surgical recanalization of the peripheral arteries. although bypass surgery remains the cornerstone of cli treatment, the majority of the patients are rendered ineligible because of diffuse infrapopliteal arterial occlusions, absence of suitable vein grafts and multiple underlying comorbidities.72,73 on the other hand, modern developments in endovascular instruments and the growing skills of vascular interventional radiologists have driven a paradigm shift in cli treatment towards percutaneous transfemoral infrapopliteal angioplasty and stenting.69,73 compared to surgery, angioplasty is a minimally invasive procedure with a clear benefit of reduced complications and peri - procedural adverse events, especially in the frail patient cohort of elderly octogenarians.69,74 in addition, it may be repeated as necessary and more than one occluded vessels to the foot may be recanalized. amassed evidence regarding the overall effectiveness and safety of infrapopliteal angioplasty supports its application as first - line treatment option for infrapopliteal obstructive arterial disease for cli treatment.67,69,72 the primary goal of infrapopliteal angioplasty is to restore at least one straight line of blood vessel to the distal foot (figure 6). the secondary objective is to preserve the patency of the treated lesion for as long as possible to avoid recurrence of cli. in the majority of the cases infrapopliteal angioplasty occasionally, it may be applied in tight distal anastomotic lesions of bypass grafts to avoid early graft failure and thrombosis. reported complications rates range from 3% to 11% and include puncture site hematomas, vessel perforation, dissection and distal embolism or thrombosis, which may be successfully managed by endovascular means. the 30-day peri - procedural mortality rate is less than 1.7%.69 a random effects meta - regression analysis of 18 studies published between 1984 and 1997 and including 1280 patients treated with infrapopliteal balloon angioplasty reported overall limb salvage rates of 79% at 1 year and 74% after 2 years.75 a more recent meta - analysis of 30 studies published between 1990 and 2006 reported 3-year limb salvage and patient survival probabilities of 82.4% and 68.4%, respectively.76 in comparison the 5-year limb salvage rates using autogenous veins for infrapopliteal bypasses range from 73% to 81%.77 unfortunately, short - term angiographic vascular restenosis is high, and infrapopliteal occlusion reportedly recurs in as many as 50% of the cases by 1 year resulting in a high frequency of repeat procedures.72,73,78 although infrapopliteal application of bare metal stents is safe and feasible, it is associated with significant neointimal hyperplasia and early restenosis.6769,79 motivated by the success of drug - eluting stents in the coronary arteries, researchers have applied them in the infrapopliteal arteries to forestall vascular restenosis and prolong amputation- and reintervention - free survival of cli patients. recently published data about application of drug - eluting stents (des) show favorable clinical results at 6 and 12 months with significantly higher angiographic patency and less clinically driven re - interventions when compared to bare metal stents.72,78,80,81 osteoporotic vertebral fractures are a cause of severe back pain and immobility in elderly patients. consequences include loss of independence and increased risk of deep venous thrombotic and respiratory complications. fractures can occur after minor trauma and may involve acute collapse or micro fractures without a compressive component. it is believed that pain is related to compressive loads causing movement of fracture fragments. this results in inflammatory changes and irritation of pain receptors.82 pathological fractures secondary to vertebral body metastases and multiple myeloma are also important causes for severe back pain in elderly patients. rapidly relieving pain to restore function and quality of life they often fail traditional medical therapy, are susceptible to the adverse effects of opiates, require more rapid relief than chemotherapy and radiotherapy can offer (and which can also be poorly tolerated) and are frequently surgically unfit. the role of both vertebroplasty and kyphoplasty lies in the management of those in whom medical management including opiate analgesia, bed rest and bracing have proved unsatisfactory or inadequate. vertebroplasty is a minimally invasive technique, which can be performed under conscious sedation as a day case procedure. it is used to treat pain related to vertebral body fractures or malignant infiltration. in patients with neurological symptoms it may also be used as an adjunct to surgery to provide vertebral stabilization prior to spinal decompression.83 fluoroscopy (in some centres used in conjunction with computed tomography) is used to guide a needle through the posterior aspect of the vertebral body, using most commonly a transpedicular approach. cement is injected under careful fluoroscopic guidance and uni- or bipedicular injections can be applied depending on operator preference, positioning of the needles and success of cement injection (figure 7). most operators will inject up to three levels at a single sitting. during the procedure bone biopsies kyphoplasty is an alternative technique, which is similar to vertebroplasty but includes the additional step of introducing a high - pressure balloon into the vertebral body to form a cavity into which cement is injected. this technique produces a small but measurable restoration of the body height of the collapsed vertebrae.84 it also reduces the risk of cement leakage seen with vertebroplasty due to the formation of a cavity allowing low - pressure cement injection.82 several large scale nonrandomized controlled trials and observational studies of vertebroplasty and/or kyphoplasty against best medical therapy have demonstrated their relative safety and superior effectiveness in treating painful osteoporotic vertebral fractures.85,86 as with any interventional procedure patients should be assessed clinically to confirm their suitability. the vertebral fracture should be confirmed as the likeliest cause for the patients pain and other causes such as degenerative changes and radiculopathy should be considered and excluded. diffuse pain is unlikely to settle with vertebroplasty or kyphoplasty and symptoms should also correlate with the radiological findings. patients may initially be diagnosed on plain film findings, however magnetic resonance imaging (mri) is also normally undertaken to confirm edema within the fracture site (a good indicator that vertebroplasty will be effective) and assess for spinal cord involvement. ct and technetium 99m - pertechnetate bone scintigraphy have also been used.87 contraindications include fractures which are asymptomatic or improving on medical therapy, as a prophylactic measure for osteoporosis, infection, myelopathy related to retropulsed fragments and uncorrected coagulopathy.88 complications are more common in the treatment of metastatic compared to osteoporotic disease. the incidence of serious complications has been reported at 0.9% including severe cement leakage or neurological symptoms requiring surgery.83 cement leakage is in fact a common phenomenon (41%) and sometimes a small amount may indicate that optimal filling of the vertebral body has been achieved. the incidence of cement embolism is thought to be very low (0.1%) and symptomatic cases are confined to case reports.89 the risk of fracture to adjacent vertebral bodies following vertebroplasty is also recognized. although the absolute risk is unclear the increased risk may be as high as 5-fold.90 kyphoplasty, which reduces the degree of deformity, may help to reduce this risk. pneumothorax and paraspinal haematoma are further risks when the procedure is performed in the thoracic spine.87 these procedures are characterized by an immediate analgesic effect91 with the large majority experiencing pain relief within hours of the procedure.82 despite this, the cause for pain relief is poorly understood. bone cement (polymethylmethylacrylate [pmma ]), which achieves 90% of its ultimate strength within one hour of injection,92 may immobilize fracture fragments and have a heat effect on nerve endings.83 however no correlation has been found between the amount of cement injected or indeed the degree of vertebral body height restored and pain relief.93 many studies now support the use of these techniques although long - term studies and head - to - head randomized clinical trials are still lacking.94 short- to mid - term follow up has shown a 90% improvement in pain levels 18 months following vertebroplasty for osteoporotic fractures.92 a study of 173 patients with osteoporotic vertebral compression fractures found significant pain reduction immediately following the procedure and 82% reported marked to complete resolution of original symptoms at 2 years independent of whether single or multiple levels were treated.95 a study of 112 patients with up to 3 years follow up found significantly less analgesia used and a high rate of patient satisfaction.96 of particular relevance to the elderly, one study has demonstrated 69% of nonambulatory patients becoming ambulatory following vertebroplasty due to significant pain relief.91 a review of the literature on the treatment of metastases and debilitating pain has demonstrated pain relief in 50%97% of patients following vertebroplasty. this outcome is similar to the ones reported for surgical treatment.87,97 a pooled analysis of 19 studies has demonstrated a 67.9% reduction in reported pain using a visual analogue scale following vertebroplasty for all causes.83 a systematic comparative review of vertebroplasty and kyphoplasty suggests that both provide similar pain relief although kyphoplasty may have benefits in functionality and quality of life with lower rates of cement leakage, and less neurologic and pulmonary complications.85 minimally invasive interventional radiological procedures may be applied for the curative or palliative treament of a variety of disorders in the elderly population. in comparison to surgery, they are related with significantly less mortality and morbidity, while being equally effective. this is of extreme importance in the setting of elderly patients suffering from multiple comorbidities and associated risk factors. physicians actively involved in the care of elderly patients, especially octogenarians, need to be aware of the range of image - guided percutaneous treatment options including their indications, efficacy, results and potential complications. | interventional radiological percutaneous procedures are becoming all the more important in the curative or palliative management of elderly frail patients with multiple underlying comorbidities. they may serve either as alternative primary minimally invasive therapies or adjuncts to traditional surgical treatments. the present report provides a concise review of the most important interventional radiological procedures with a special focus on the treatment of the primary debilitating pathologies of the elderly population. the authors elaborate on the scientific evidence and latest developments of thermoablation of solid organ malignancies, palliative stent placement for gastrointestinal tract cancer, airway stenting for tracheobronchial strictures, endovascular management of aortic and peripheral arterial vascular disease, and cement stabilization of osteoporotic vertebral fractures. the added benefits of high technical and clinical success coupled with lower procedural mortality and morbidity are highlighted. |
this cross - sectional study was carried out in a university hospital in shiraz, iran. this hospital was selected because of the availability and the subsequent enthusiasm of its nursing managers. this hospital admits patients from southern iran, and nurses who work in this hospital play a vital role in providing health care for people living in this area. a census sampling was used. the sample comprised of all nurses (n=330) and head nurses (n=19) working in this hospital, and all inpatient wards including medical, surgical, pediatrics, emergency, criteria for selecting the samples included1 graduation in the bsc nursing program2 and working full - time in university hospital as a nurse. in the beginning of the study, an explanatory session was held for the head nurses and nurses to introduce the whole plan, its objectives and its method. then, prepared envelops each containing two similar competence questionnaires, one for the nurses and the other for the head nurses, along with an informed consent form and a manual of the instructions of filling the questionnaire were distributed among the head nurses. they had the responsibility of handing the envelops to the nurses of their respective wards. in the manual, the nurses were asked if they agreed to participate in the study, they filled the questionnaire independently and handed the head nurse the second questionnaire to be filled in. the two questionnaires were completely identical in their content and structure. after completing the questionnaires, data collection process lasted for one month. to maintain the privacy of the participants, all closed envelops were delivered to the main investigator. the instrument used in this research was nurse competence scale (ncs) which assesses 73 skills in 7 different categories. these categories were as follows : helping role (7 skills), teaching coaching (16 skills), diagnostic functions (7 skills), managing situations (8 skills), therapeutic interventions (10 skills), ensuring quality (6 skills) and work role (19 skills). (2004) based on benner 's framework and its validity and reliability have been confirmed.418 in this study, each nurse was asked to identify the level of competence on a visual analogue scale (vas) (0 - 100) with values 0 - 25, 26 - 50, 51 - 75, and 76 - 100 that were respectively weak, moderate, good and excellent levels of competence. the mean individual scores in each item was the indicator of clinical competence in that item. the total mean of items in each category was the indicator of competence of nurses in that category and the total mean of categories was indicator of the total clinical competence of nurses. therefore, in addition to identifying the level of nurse 's clinical competence in each skill, the competence level in each seven category and finally, the overall nurse competence were identified. moreover, every evaluator was asked to determine the level of performance of skills in the ward where the nurse was working at that time period. this was done by using likert 's four point scale in which 0 means not applicable ; 1, rarely used ; 2, occasionally used ; and 3, frequently used. the logic behind this was based on the disparity of possessing the competence and its actual use in clinical practice. demographic data such as age, gender, work experience in the current ward and total work experience were also collected through this questionnaire. in order to yield a correct translation based on the recommended way of world health organization, the instrument used for assessing clinical competence of nurses was first translated into persian language by a researcher and then, translated back into english. finally, two english language specialists approved the accuracy of the translation. then, validity of the instrument was approved by consulting specialists and experts of clinical nursing education and experienced nurses from different universities of the country. the reliability of the instrument was assessed by doing a pilot study and cronbach 's coefficients in 7 categories ranged between 0.75 - 0.89, indicating the favorable internal consistency and high reliability of the instrument.18 completed questionnaires were received from 205 staff nurses (response rate of 62%) and from all 19 head nurses (response rate of 100%). all participants were given a letter containing information about the study 's aims and procedures. the voluntary nature of participation and anonymity had been emphasized in the informed consent form. data analysis was done by the statistical package for social sciences version 11.5 (spss, chicago, il, usa). anova was used for comparing the means and chi - square for comparing the frequency of using skills. this cross - sectional study was carried out in a university hospital in shiraz, iran. this hospital was selected because of the availability and the subsequent enthusiasm of its nursing managers. this hospital admits patients from southern iran, and nurses who work in this hospital play a vital role in providing health care for people living in this area. a census sampling was used. the sample comprised of all nurses (n=330) and head nurses (n=19) working in this hospital, and all inpatient wards including medical, surgical, pediatrics, emergency, criteria for selecting the samples included1 graduation in the bsc nursing program2 and working full - time in university hospital as a nurse. in the beginning of the study, an explanatory session was held for the head nurses and nurses to introduce the whole plan, its objectives and its method. then, prepared envelops each containing two similar competence questionnaires, one for the nurses and the other for the head nurses, along with an informed consent form and a manual of the instructions of filling the questionnaire were distributed among the head nurses. they had the responsibility of handing the envelops to the nurses of their respective wards. in the manual, the nurses were asked if they agreed to participate in the study, they filled the questionnaire independently and handed the head nurse the second questionnaire to be filled in. the two questionnaires were completely identical in their content and structure. after completing the questionnaires, data collection process lasted for one month. to maintain the privacy of the participants, all closed envelops were delivered to the main investigator. the instrument used in this research was nurse competence scale (ncs) which assesses 73 skills in 7 different categories. these categories were as follows : helping role (7 skills), teaching coaching (16 skills), diagnostic functions (7 skills), managing situations (8 skills), therapeutic interventions (10 skills), ensuring quality (6 skills) and work role (19 skills). (2004) based on benner 's framework and its validity and reliability have been confirmed.418 in this study, each nurse was asked to identify the level of competence on a visual analogue scale (vas) (0 - 100) with values 0 - 25, 26 - 50, 51 - 75, and 76 - 100 that were respectively weak, moderate, good and excellent levels of competence. the mean individual scores in each item was the indicator of clinical competence in that item. the total mean of items in each category was the indicator of competence of nurses in that category and the total mean of categories was indicator of the total clinical competence of nurses. therefore, in addition to identifying the level of nurse 's clinical competence in each skill, the competence level in each seven category and finally, the overall nurse competence were identified. moreover, every evaluator was asked to determine the level of performance of skills in the ward where the nurse was working at that time period. this was done by using likert 's four point scale in which 0 means not applicable ; 1, rarely used ; 2, occasionally used ; and 3, frequently used. the logic behind this was based on the disparity of possessing the competence and its actual use in clinical practice. demographic data such as age, gender, work experience in the current ward and total work experience were also collected through this questionnaire. in order to yield a correct translation based on the recommended way of world health organization, the instrument used for assessing clinical competence of nurses was first translated into persian language by a researcher and then, translated back into english. then, validity of the instrument was approved by consulting specialists and experts of clinical nursing education and experienced nurses from different universities of the country. the reliability of the instrument was assessed by doing a pilot study and cronbach 's coefficients in 7 categories ranged between 0.75 - 0.89, indicating the favorable internal consistency and high reliability of the instrument.18 completed questionnaires were received from 205 staff nurses (response rate of 62%) and from all 19 head nurses (response rate of 100%). the study was approved by the ethics committee of the university. approval for data collection all participants were given a letter containing information about the study 's aims and procedures. the voluntary nature of participation and anonymity had been emphasized in the informed consent form. data analysis was done by the statistical package for social sciences version 11.5 (spss, chicago, il, usa). anova was used for comparing the means and chi - square for comparing the frequency of using skills. almost 24% (n=46) of nurses had less than 2 years work experience and all the nurses had a bachelor 's degree. the other demographic data of 19 head nurses and 190 practicing nurses are presented in table 1. demographic characteristics of head nurses (n=19) and practicing nurses (n=190) the overall mean competence (87.03 10.03) obtained in self - assessment was significantly greater than that calculated by head nurse assessment (80.15 15.54) (p < 0.05). the difference between the results of these two types of assessment was also perfectly significant in seven categories of competence scale (anova) (table 2). comparison of self - assessment and assessment made by head nurses of level of clinical competence (anova) the nurses considered themselves more competent in the categories of managing situations and teaching coaching while the head nurses considered them to be more competent in the categories of diagnostic functions and managing situations. the least level of competence in both types of assessment was identified in the category of ensuring quality the greatest level of difference between nurses and head nurses results was reflected in the categories of managing situations and teaching coaching and the least level of difference was observed in the categories of helping roles and diagnostic functions (table 2). the level of using the skills in clinical practice in the current ward (occasionally or frequently) determined the minimum of 76 percent and maximum of 88 percent in self - assessment and 82 percent and 88 percent in the head nurse assessment, respectively, and there was no significant difference between the results in this regard (chi -square) (figure 1). the difference of self - assessment and head nurse assessment of using skills in different categories of clinical competence this study aimed to compare the results of nurse competence assessment by two methods of self - assessment and head nurse assessment. although the overall competence level was recognized as favorable by both methods, the head nurses recognized the nurses as less competent than in self - assessment. in fact, the competence assessment showed that, regardless of the type of assessment, nurses competence was judged as favorable. (2010) concerning competence assessment of nursing graduates of jordanian universities.22 on the other hand, demographic data showed that practicing nurses were younger than the head nurses. the results of some studies declared that new and young nurses generally overestimate their clinical competence level that can explain the reason of difference between self - assessment of practicing nurses and that done by their head nurses. (2001) found that younger assessors have the tendency to assess nurse competence as higher than older assessors.1923 this significant difference reflects a rather severe disagreement between the nurses and the head nurses in assessing the clinical competence. this has been previously reported in certain researches. in a research carried out in hospitals in isfahan / iran about the performance of freshly graduated nurses by themselves and their head nurses, the results indicated that there was a significant difference between the two assessment types.21 considering the results of that study, the nurses understood themselves as more competent than did their head nurses, so the results were congruent with the present research. a possible explanation for these differences could be related to higher expectations of the nurses from the managers. in contrast, some researches have had different results ; i.e., the head nurses have rated the nurses as more competent than the nurses themselves.19 these dissimilarities make further investigations necessary to explore influential factors on assessment results. however, the present research indicated a significant difference between the two methods of assessment. it should be noticed that by point to point comparing of the results in categories of nurse competence, there was a relatively similar pattern of assessment, so the higher and the lower competence levels of nurses belonged to categories of managing situations and ensuring quality, respectively. in studies carried out previously, some similarities can be seen such as studies of bahraini. in bushehr (2008), meretoja. in finland (2003) and salonen. in finland (2007).181924 a similar pattern of assessment results obtained in comparing a university hospital in a developed country like finland, a university hospital of shiraz and a university hospital of bushehr demonstrated that nurses have common weak and strong points regardless of the work environment. it is essential to pay adequate attention to these points to improve the strengths and eliminate weaknesses. these common points reflect the high capability of nurses in managing complicated clinical situations as a strong point and their low competence in ensuring quality skills like care giving based on evidence and utilizing research findings in clinical practice as a weak point. it seems that the weak points should be noticed more than ever not only in iran also in other parts of the world. despite significant differences between self - assessment of nurses competence and head nurses assessment, they had common viewpoints in terms of assessment of actual use of skills in clinical practice. this agreement was seen in the comparison of the frequency of using the skills in seven categories and in overall frequency of using the skills. perhaps, the high level of agreement of assessment results in terms of performance is because of the visible nature of performance that can lead to a decrease on the subjectivity. in fact, the lack of a clear definition of competence has been implied in many studies.25 there have been some limitations in performing this research. anyway, the entity of evaluation is such that it can be affected by individual evaluator characteristics. furthermore, the behavior of nurses can be changed because of knowing that they will be assessed by their managers. it must be remembered that no direct observation has been done to assess the nurse performance in order to remove any direct effect on the nurses behavior. despite reasonable number of samples, since the sample had been chosen from a university hospital in shiraz, the cultural and environmental factors of research area can be influential, so this is noteworthy in generalizing the results. the results of this study indicated that although head nurses agreed with nurses about the frequency of using the skills, there was profound disagreement between these two groups in assessing the level of nurses competence. in fact, comparison of the results in different categories indicated that the nurses considered themselves more competent than what head nurses reported. this study also indicated that for assessment of competence more than one method should be used. assessment made by head nurses led nurses to recognize categories that need to be improved and by self assessment, the nurses could achieve self - awareness in terms of their weak and strong points. therefore, a multi - method approach to the assessment of nurse competence is advisable. since this study has focused on the importance of nurse clinical competence assessment and enhancement of its precision by utilizing different resources, more research is needed to assess competencies in different environments and to compare the perceptions of nurse managers, nurses and peers. moreover, the nurses and head nurses points of view about clinical competence assessment and methods of assessment are to be investigated by qualitative and mixed studies. | background : nurses play a crucial role in patient - care. therefore, assessing nurses clinical competence is essential to achieve qualified and safe care. the aim of this study was to determine and compare the competence assessments made by head nurses and practicing nurses in a university hospital in iran in 2009.methods:a cross - sectional survey was conducted to make comparisons of both self - assessment of nurse competence as well as assessment made by their respective head nurses working in a university hospital setting in iran. the instrument employed for data collection was nurse competence scale (ncs), whose reliability and validity have been previously confirmed. the clinical competence of the nurses in 73 skills under 7 categories was determined based on a visual analogue scale (vas) (0 to 100). they were also asked to indicate the extent to which their competence was actually used in clinical practice on a four - point scale of likert. the data was analyzed through descriptive and inferential statistics.results:comparison of self - assessment (87.03 10.03) and the assessment done by head nurses (80.15 15.54) showed a significant difference but no precise differences were found between the assessment methods for the frequency of using these competencies.conclusions:the results of this study indicated no consensus between the nurses owns assessment and their head nurse assessment. therefore, it is necessary to use a combination of nurses competence assessment methods in order to reach a more valid and precise conclusion. |
a great number of patients with major injuries [13 ] suffer from accidental hypothermia ranging from 12 to 66% [4, 5 ]. in the current literature, an increase of mortality has been demonstrated below a core temperature of 34c in patients with multiple injuries, this temperature threshold seems to be critical in trauma patients and therefore a modified definition is reasonable. thereby, the extent of hypothermia correlates with the overall injury severity and is increased by pelvic or abdominal surgery ; furthermore, hypothermic polytrauma patients suffer from an increased incidence of posttraumatic complications [2, 4, 810 ] as well as a an increased mortality [2, 8, 11 ]. depending on its origin, endogenous hypothermia results from a metabolic dysfunction with a decreased heat production (e.g., hypothyreodism, hypoglycaemia, hypoadrenalism) or a disturbed thermoregulation (e.g., intracranial tumor, degenerative neurologic disorders). accidental hypothermia is characterized by an unintentional decrease of the core temperature due to exposure to a cold environment without a thermoregulative dysfunction. the infusion of cold fluids as, for example, 2 l of crystalloids (18) decreases core temperatures about 0.6c. in addition, a reduced oxygen supply with an anaerobic state decreases the amount of adenosine trisphosphate (atp) and subsequent heat production. furthermore, the application of anaesthetics and skeletal muscle relaxants prevents shivering and vasoconstriction and therefore advances heat loss. while the first two entities do not play a major role after trauma, accidental hypothermia is common in trauma patients as well as patients undergoing major surgery [4, 5 ]. in contrast to accidental hypothermia that needs to be addressed in the treatment of severely injured patients due to its detrimental effects, induced hypothermia is commonly used, that is, in elective cardiac surgery. in addition there exists a strong recommendation for the induction of hypothermia after cardiopulmonary reanimation, and there exists a growing body of evidence that suggests the application of hypothermia after blunt brain injury. some articles were published regarding the influence of hypothermia in context of elective surgery but also on the posttraumatic immune response in animal models. however, an overview about the influence of hypothermia on the humeral and cellular immune response with special focus on apoptosis is missing. this paper outlines the molecular mechanisms by which hypothermia influences apoptosis as well as the immune response following severe trauma and major surgery. in general, cell death following hemorrhage and ischemia occurs either as necrosis of affected cells or as a complex process of programmed cell death called apoptosis. in contrast, necrosis represents the premature death of cells caused by external factors, that is, trauma, infections, or exposure to toxins. apoptosis is associated with a cascade of enzymatic reactions in which proteolytic caspase enzymes play a major role. apoptosis could be initiated either in an extrinsic or intrinsic way. the extrinsic way is characterized by the interaction of ligands (e.g., tnf-) with death receptors on the cell surface (e.g., cd95) activating the enzymatic cascade by caspase-8. the intrinsic activation of apoptosis is triggered by tumor suppressing factors (e.g., p53) resulting in an increased expression of proapoptotic factors of the bcl-2 family (e.g., bax, bad) and an increased mitochondrial release of cytochrome - c. binding apaf-1 (apoptotic protease activating factor) cytochrome - c activates the apoptotic cascade via caspase-9 [63, 64 ]. besides the proteins of the bcl-2 family (antiapoptotic bcl-2 ; proapoptotic bax and bad), the apoptotic process is regulated by mitogen - activated protein kinases (map - kinases) like extracellular - signal - regulated kinase 1/2 (erk 1/2), cjun n - terminal protein kinase 1/2 (jnk 1/2), and p38 map - kinase. additionally, other pathways involving phosphatidylinositol-3 kinases (pi3k) generating phosphatidylinositol-3,4,5-trisphosphate (pi-3,4,5-p(3)) and other phospholipids interacting with akt are known to play an important role in regulating cell survival. furthermore, besides kinases the transcription factor nf - kappab regulates cellular apoptotic programs. in various studies, hypothermia was shown to prevent additional tissue injury by interrupting both, the intrinsic, and extrinsic apoptotic pathway [15, 6770 ]. interestingly, hypothermia seems to affect the very early steps in the apoptotic process including inhibition of activation of caspase enzymes, preserving mitochondrial function and decreased overload of excitatory transmitters. in contrast, apoptosis occurs relatively late following tissue challenge but it was shown that the process continues for up to 3 days [7072 ]. due to the delay of the apoptotic process, modulation of the apoptotic cascade could serve as a therapeutic target in early stages of polytrauma management after the initial resuscitation process in which the patient is stabilized with the aim to prevent additional damage. in this context, it is of special importance that the rate of apoptosis in neutrophils is dramatically decreased in multiple trauma patients. cultured hepatocytes showed suppressed fas - mediated apoptosis detected by a decreased mitochondrial damage following moderate hypothermia. besides an attenuated cytochrome - c release, hypothermia suppressed the activation of caspase-7 and -9. this data suggests potential organ protective effects of hypothermia regarding apoptosis, which were confirmed in various animal models. on the other hand, murine neutrophils revealed a reduced spontaneous and tnf-induced apoptosis under mild hypothermia of 35c. this fact could result in a prolonged exposure to activated neutrophils after trauma resulting in secondary organ damage. profound hypothermia was not only shown to preserve akt in cardiomyocytes and inhibit caspase-3 activation but also activate antiapoptotic proteins such as bcl-2 in an experimental model of hemorrhagic shock and ischemic insult. in ischemia / reperfusion injury, hypothermia reversed activation of apoptosis stimulating fragment (fas)/caspase-8, the increase of bax (an proapoptotic protein), and decrease of bcl-2 in endothelial cells. following ischemia and reperfusion, isolated cardiomyocytes showed increased phospho - akt levels associated with attenuation of reactive oxygen species production, which was blocked by akt but not cgmp inhibition. additionally, hypothermia was associated with downregulation of the tnf receptor (tnfr)1 and its proapoptotic ligand fas in rat cerebral cortices following a moderate fluid percussion model of traumatic brain injury. most of the clinical studies regarding the influence of hypothermia on apoptosis are limited to ischemic injuries following cardiac arrest or brain ischemia [78, 79 ]. in summary, there is clear evidence that hypothermia reduces ischemic neuronal apoptosis in global cerebral ischemia as a result of attenuated p53 expression and increased bcl-2 release. immune response following major surgery or trauma consists of a complex set of pro- and anti - inflammatory reactions in order to restore homeostasis. the balance or imbalance of the pro- and anti - inflammatory immune response in part influences the clinical course. whereas predominance of the pro - inflammatory response leads to the systemic inflammatory response syndrome (sirs), the anti - inflammatory reaction also named as compensatory anti - inflammatory response syndrome (cars) might result in immune suppression with an enhanced risk of infectious complications. sirs as well as immune suppression plays a decisive role in the development of sepsis and the multiple organ dysfunction syndrome (mods) after trauma. cytokines, released from various cell types including immunocompetent and intrinsic cells, regulate the specific and unspecific immune response. these mediators are detectable in the peripheral blood and several compartments like the lung and the liver. they serve not only as a marker of injury severity or outcome predictors but also as a tool for decision - making regarding timing of elective surgery during the clinical course [80, 81 ]. the most important cytokines in this regard include tnf-, il-1, il-6, il-8, and il-10 (table 2). as another essential step of the systemic immune response, chemotactic cytokines, so - called chemokines (il-8, mcp-1, mip-1, or mip-1) mediate neutrophil infiltration into the affected tissue. the initial neutrophil - endothelial interaction, so - called rolling, is mediated by members of the selectin family of adhesion molecules. integrins (cd11/cd18) and immunoglobulin superfamily receptors (icam-1, vcam-1, elam-1) are important for the following firm adhesion and cell diapedesis [84, 85 ]. in various experimental as well as clinical studies, an effect of hypothermia on the inflammatory response by altering the expression of pro- and anti - inflammatory cytokines, chemokines and adhesion molecules has been shown [38, 8688 ]. in brain injury there is profound evidence that an inadequate or disproportionate posttraumatic immune response not only increases the risk for brain cell injury but also the extent of damage [8995 ]. in this process elevated levels of il-1 as well as an increased expression of il-1 mrna were detected following experimental brain injury in rodents, respectively [96100 ]. while il-1 does not cause brain damage itself, injection of il-1 increased cell death following various brain damage models [101103 ]. the hypothesis that il-1 increases brain damage is supported by experiments in which an il-1 antagonist prevented cell death in experimental brain injury [102105 ]. similar results were observed following treatment with an il-1 converting enzyme (ice) inhibitor in cerebral ischemia. thus, modulation of cytokine release by hypothermia may serve as a therapeutic approach following major injury. peripheral blood mononuclear cells stimulated with lipopolysaccharide (lps) from healthy volunteers showed decreased tnf- release, while release of il-1 and il-6 was delayed when incubated at 33c as compared to incubation at 37c. in a similar study with human macrophages, early secretion of tnf- and il-6 additionally, a shift towards anti - inflammatory cytokines was detected in microglia cells following lps treatment. in contrast, hypothermia of 33c raised the levels of il-1, il-6, and tnf- produced by monocytes from healthy volunteers stimulated with lps. this controversial findings suggest diverse effects of hypothermia on different cell types. in a rat model of acute hemorrhage, gundersen. evaluated the effect of hypothermia on immune response and corresponding organ damage. moderate hypothermia had an organ protective effect in liver and kidney, which was associated with a decreased release of il-6 as well as a reduction of reactive oxygen species. in contrast, mild hypothermia did not affect systemic levels of il-1, il-6, and il-10, while serum tnf- levels were even increased following hemorrhagic shock suggesting different responses of cytokines or their respective sources. in a study using a swine model of uncontrolled lethal hemorrhage, the authors were able to detect a decreased pro - inflammatory (il-6) and an increased anti - inflammatory (il-10) immune response following profound hypothermia. furthermore, the potentially protective chaperone heat shock protein-70 (hsp 70) was preserved. the authors, therefore, concluded a beneficial modulation of the immune system due to hypothermia in this hemorrhage model. only a few publications investigated the anti - inflammatory effects of hypothermia in a combined trauma - hemorrhage setting. in a two - hit model consisting of a femoral fracture and hemorrhage, systemic il-10 levels were elevated following mild hypothermia confirming results from other experimental studies [35, 112, 113 ]. the increased anti - inflammatory response induced by hypothermia was also associated with a conversion from th-1 to th-2 cytokine pattern. in a nonbacterial - driven sepsis model using intraperitoneal lipopolysaccharide injection, hypothermia also induced elevated plasma il-10 levels. the effects of hypothermia on the release of inflammatory cytokines are presented in table 3. experimental studies of traumatic brain injury, in which hypothermia decreased systemic cytokine levels, were confirmed by a clinical study showing a suppression in cytokine release associated with an improved outcome [38, 88 ]. in cerebral trauma patients, hypothermia of 32 - 33c suppressed systemic il-6 levels, which was associated with an increased glasgow outcome scale 6 months postinjury as compared to patients treated under normothermic conditions. the effects of hypothermia on chemokine levels and the expression of adhesion molecules were investigated in experimental as well as clinical studies (tables 4 and 5). in vitro studies of human umbilical vein endothelial cells showed decreased mcp-1 as well as il-8 levels under hypothermic conditions. in contrast, no effect of hypothermia on icam-1 expression in human cerebral endothelial cells was shown under stress conditions. in cultured human umbilical vein cells, hypothermia inhibited the transcription and expression but not the induction of e - selectin. in a model of cerebral ischemia and reperfusion, mild hypothermia reduced local expression of mcp-1. the same finding could be confirmed in a murine multiple trauma model. in another cerebral ischemia model, intraischemic as well as delayed hypothermia decreased icam-1 expression as well as intracerebral neutrophil infiltration. in pediatric cardiopulmonary bypass (cpb) surgery, hypothermia reduced systemic levels of the chemokine regulated on activation normal t cell expressed and secreted (rantes) and mcp-1. in contrast, no effect of hypothermia on mcp-1 levels was detected in a model of cardiac arrest in rats. in transient focal cerebral ischemia, mild hypothermia reduced icam-1 expression, which was associated with reduced neutrophil and monocyte infiltration. in contrast to experimental studies, circulating adhesion molecules were not altered by hypothermia in aortocoronary artery bypass grafting., there is evidence that induced hypothermia decreases pro - inflammatory cytokines as well as chemokines and adhesion molecules. besides this, an increased anti - inflammatory cytokine response hypothermia influences the cellular immune response, which was especially studied following brain injury. in various animal models, neutrophil and macrophage function was attenuated leading to a decreased extent of secondary brain injury and infarction size. furthermore, posttraumatic hypothermia decreased early and prolonged accumulation of neutrophils and myeloperoxidase activity suggesting hypothermia as a potential mechanism to modulate outcome. these findings confirmed an earlier study of toyoda. showing a decreased neutrophil infiltration following intraischemic hypothermia in a focal ischemia reperfusion injury, which was also shown after delayed hypothermia in another cerebral ischemia model. additionally, posttraumatic hypothermia reduced neutrophil accumulation on the injury site at 24 h in a model of spinal cord injury. although most studies were conducted in traumatic brain injury, similar findings were shown in other organs. already in the 1980s, it was shown that hypothermia reduced local neutrophil infiltration in an experimental pleuritis model, while the number of circulating neutrophils was not affected. other studies suggest a hypothermia - induced decrease of circulating neutrophils after soft - tissue injury in piglets, supporting an older study with prolonged hypothermia of 29c in pigs. the reduced infiltration can be explained by a decrease of adhesion molecules due to hypothermia. however, phagocytosis of opsonised bacteria is even increased at a lower temperature suggesting a temperature - dependent activation of neutrophils. following major injuries, infiltrated neutrophils release proteolytic enzymes as well as free radicals causing tissue damage which may subsequently lead to organ dysfunction and failure. in contrast, hypothermia did not affect the formation of free radicals in a rat model of hemorrhagic shock [120122 ]. the reduced number of free radicals is of great benefit since the capacity of antioxidative mechanisms is limited. most of free radicals following brain injury are synthesized by nitric oxide synthase and by deregulated mitochondrial electron transporters [124127 ]. thus, it was speculated that the prevention of release or synthesis of free radicals may be induced by preserved mitochondrial function. interestingly, mitochondrial function plays also a pivotal role in the development of apoptosis through inhibition of the caspase cascade activation. the essential role of the nitric oxide synthase was supported by another experiment, in which attenuation of acute lung injury by induced hypothermia following hemorrhagic shock was associated with less myeloperoxidase activity and decreased gene expression of inos. furthermore, gene expression of heat shock protein (hsp-72), a molecular chaperone known to exert protective effects in ischemia - reperfusion injury, was detected in hypothermic but not in normothermic rats. in contrast to these results, another study using a model of pressure - controlled hemorrhagic shock revealed no differences in serum - free 8-isoprostane (a marker of lipid peroxidation by free radicals) between the two groups at either baseline or resuscitation time 1 hr. in a forebrain ischemia and recirculation model, postischemic leukotriene production a well as edema development was reduced 2 h but not 10 min following reperfusion. controlled mild hypothermia had no effect on the number of circulating t lymphocytes in patients with severe brain injury. a clinical study including infants and children with severe traumatic brain injury showed a preserved antioxidant reserve in cerebrospinal fluid, suggesting an attenuation of oxidative stress following hypothermia in severe brain injury. less neuron damage was detected at a temperature of 34c following brain ischemia confirming another study of thoracic aortic ischemia - reperfusion injury in which hypothermia prevented and delayed paralysis by preserving cells of the central nervous system. in another study, a beneficial long - term effect of mild (35c) and moderate (32c) hypothermia was detected after spinal cord ischemia and reperfusion until 28 days following the injury. in a rat model of ischemia / reperfusion of the lower extremity, local hypothermia protected skeletal muscle from capillary leakage, which was prevented after treatment with heme oxygenase and nitric oxide synthase inhibitors. hypothermia not only prevents damage on site of injury but also distant organ damage. in mesenteric ischemia - reperfusion injury, remote lung injury was prevented as measured by leukocyte trafficking, alveolar hemorrhage, and increased bal protein and wet / dry ratios. these results confirmed another study using a hepatic model of ischemia / reperfusion injury, in which hypothermia reduced the associated lung injury. in a rat hemorrhagic shock model, mild hypothermia (34c) improved survival associated with modulation of the immune response. clinical studies are mainly focused on patients with traumatic brain injury. in general, there is a gap between experimental studies and clinical experience. in a multicenter study of 392 patients with severe head injuries, hypothermia of 33c did not influence outcome. in 5 meta - analyses, conflicting results regarding outcome were shown [138142 ]. only 2 of them [141, 142 ] described a marginal benefit regarding mortality and neurological outcome. patients with elevated intracranial pressure seem to be the cohort with the most benefit of hypothermia. regarding these controversial results, in current guidelines hypothermia is recommended as a level iii treatment option. hypothermia at time of occlusion decreased infarct size in a myocardial ischemia - reperfusion injury supporting the results showing an increased cellular tolerance to ischemia under hypothermic conditions. these results suggest starting hypothermia as soon as the hemodynamic and hemostaseological parameters were stabilized. in contrast, there is consistent evidence that rapid rewarming reverses the beneficial effects of induced hypothermia in traumatic brain injury. furthermore, gradual rewarming improved survival and attenuated remote acute lung injury after intestinal ischemia and reperfusion injury as compared to speed rewarming. considering the current literature, it seems likely that abrogation of the beneficial effects is associated with atp depletion, energy failure, and consecutive mitochondrial dysfunction. to date, detailed knowledge about exact mechanisms in different rewarming strategies is lacking. the european resuscitation council recommends early hypothermia (3234c) for 1224 hours following cardiac arrest and a slow rewarming procedure with 0.250.5c per hour avoiding hyperthermia. in a clinical study in 57 hypothermic patients, continuous arteriovenous rewarming resulted in less fluid requirement and less mortality as compared to standard rewarming procedures. in summary, there is only minor understanding of the rewarming process but slow rewarming is recommended based on mostly experimental studies. before induced hypothermia can be introduced in the clinical management of patients several limitations of the presented studies need to be considered. a potential limitation of all studies in which hypothermia is induced by a cardiopulmonary bypass machine is the fact that increase of cytokines may be due to the bypass procedure itself. while numerous experimental as well as clinical studies regarding cardiac surgery, brain injury, or cardiac arrest are available information regarding hypothermia following major injuries is spare. since there are still divergent results in experimental studies that are mostly limited to traumatic brain injury, the mechanisms by which hypothermia influences the posttraumatic immune response after multiple trauma need to be elucidated. | numerous multiple trauma and surgical patients suffer from accidental hypothermia. while induced hypothermia is commonly used in elective cardiac surgery due to its protective effects, accidental hypothermia is associated with increased posttraumatic complications and even mortality in severely injured patients. this paper focuses on protective molecular mechanisms of hypothermia on apoptosis and the posttraumatic immune response. although information regarding severe trauma is limited, there is evidence that induced hypothermia may have beneficial effects on the posttraumatic immune response as well as apoptosis in animal studies and certain clinical situations. however, more profound knowledge of mechanisms is necessary before randomized clinical trials in trauma patients can be initiated. |
after birth, the neonate must transition to the gastrointestinal system as the primary source of nutrition. in premature newborns, the gastrointestinal system and other organ systems in the body are underdeveloped. this is a challenge because the neonatologist must assess the function of the intestine for management of enteral feeding. much of the knowledge about the physiology of the intestines in neonates is derived and subsequently inferred from experimental animal models. clinical methods to assess intestinal function include abdominal distension, aspiration of gastric residuals (gr), bowel auscultation, and abdominal x - ray. however, recently two noninvasive technologies have demonstrated potential to assess intestinal function in the neonatal intensive care unit (nicu) : transabdominal ultrasonography (us) and near - infrared spectroscopy (nirs). different modalities of transabdominal us have been utilized by some investigators for assessment of necrotizing enterocolitis (nec) [813 ]. for example, studies have found that us is more sensitive than x - rays in detecting intramural gas, portal venous gas, free peritoneal gas and free peritoneal fluid [1317 ]. color doppler us of the abdominal wall is more accurate than clinical examination and x - ray in detecting bowel necrosis. in principle, transabdominal us allows the visualization of peristaltic movements. the bowel walls are visible as multiple white echoic lines in a darker hypoechoic background of peritoneum. peristaltic contractions appear as wormlike movements of the bowel wall. in a recent publication, richburg and kim duodenojejunal manometry, another measure of small intestinal motility, has previously been found to be a sensitive predictor of feeding intolerance in preterm infants. however, this method is more invasive than transabdominal ultrasonography, and requires more specialized equipment and operator training. near - infrared spectroscopy (nirs) is a noninvasive technology available to obtain in vivo, real time, portable, and continuous measurement of tissue oxygen saturation of hemoglobin (sto2). nirs exploits the different absorptive properties of deoxyhemoglobin, oxyhemoglobin, and underlying tissue to measure sto2. physiologically, sto2 is a measure of a combination of oxygen saturation in venous, arterial, and capillary blood. thus, sto2 is dependent on the regional delivery and consumption of oxygen in the tissues. while us may be operator dependent and assesses function at the time of the intervention, it remains the current gold standard to directly visualize motility. the advantage of nirs is that it can be used without an operator over relatively long time intervals. our group recently studied continuous cerebral sto2 over 24 h to determine the hemodynamic effects of umbilical cord milking in preterm neonates. although blood flow through the superior mesenteric artery (sma), was found to correlate with sto2 measurements, no study to date has validated splanchnic nirs measurements with a local imaging method that measures intestinal function. correlating a method of continuous nirs monitoring with a validated functional imaging technique the objective of our study is to explore the relationship between us derived assessment of motility and levels of sto2 derived from nirs instrumentation. this pilot study was conducted in the level iii neonatal intensive care unit (nicu) at sharp mary birch hospital for women and newborns in san diego, california between december 2013 and may 2014. the data was collected as part of the validation study of the fore - sight ii nirs tissue oximeter monitor for splanchnic sto2. the study was approved by the sharp healthcare institutional review board and registered on clinical trials.gov (nct02017652). inclusion criteria were as follows : (i) gestational age greater than 32 weeks ; (ii) weight of less than 5000 g ; and (iii) umbilical venous catheterization to obtain a venous partial pressure of oxygen for device calibration as part of a multicenter trial (currently ongoing). a gestational age of 32 weeks was chosen to enroll those that would be large and well enough to have nirs monitoring but also require a nicu admission. no infants who required any significant respiratory support (mechanical ventilation or nasal ventilation), or cardiac inotropes were included. a venous blood sample from the umbilical venous catheter was drawn for the validation study of the nirs technology. exclusion criteria were perinatal asphyxia events, intraventricular hemorrhage, vascular or coagulation disorders, congenital anomalies, or a history of nec. upon enrollment, bowel ultrasound scans were performed using a vivid e9 (ge healthcare, wauwatosa, wisconsin) system and an 11 mhz linear probe. the transducer was placed on the left, middle and right abdomen (figure 1a), and the peristaltic movements of the intestine were observed for 10 s at each location. immediately after the ultrasound scan, a nirs infrared probe (casmed, fore - sight ii, branford, ct, usa) was placed on the left lower quadrant of the abdomen (figure 1b). splanchnic sto2 data was recorded into a laptop every 2 s for 24 h. the blinded ultrasonographer (da) classified the babies into the respective motility levels, based on the observed peristaltic activity. image features of a peristaltic movement of the bowel wall included rotational movement, displacement or sudden disappearance / reappearance of the echogenic bowel over 30 s (3 consecutive 10-s clips). to be considered a peristaltic activity, the movement must be localized to a small section of the image. (i.e. no, low, normal, hyperactive), were reduced to two distinct categories of visible levels of motility. the lower level categories (i.e. no, low) were merged into a single no / low level, while the upper two categories (i.e. normal, hyperactive) were merged into a normal / hyperactive category. the no / low category was assigned to subjects with minimal or no motility (02 peristaltic movements) observed in any 10-s image. an alternative normal / hyperactive category was assigned to a subject with multiple peristaltic movements (3 peristaltic movements) in any 10-s image. movement of echogenic lines that are not localized to a small region of the image, are considered artifacts due to movement of the baby, movement of the us probe, or displacement of the abdominal contents (for example due to breathing). doppler ultrasonography of the superior mesenteric artery was performed using an 8 mhz phased array transducer to measure the peak systolic velocity (vsystole) and end diastolic velocity (vdiastole). the arterial resistivity index was determined by using the following relation : for analysis of the recorded nirs measurements, the data was initially smoothed with a moving - window of 20 s. for each 24-h dataset, a representative distribution of measurements was generated from a uniform random sampling of multiple overlapping 4-min intervals, such that the average difference between the centers of the intervals was 1 min. figure 1c illustrates an 8-min interval of sto2 samples with two 4-min linear fits highlighted in red. a linear fit was performed for each of the randomly selected 4-min intervals. for visualizing the distributional properties of the representative measurements, the average sto2 (i.e. bias values of the linear fits) of all selected 4-min intervals over the 24 h were summarized into a single box plot. this was repeated for all cases, for a total of 19 boxplots. to measure the variability of the 4-min linear trends, the residual errors are deviations from the line - of - best fit for each 4-min interval. the averages of the residual errors for each 4-min interval over the 24 h were summarized into box plots. for further analysis, the distributions of average sto2 and respective residual errors were normalized to zero mean and unit standard deviation. a multivariate linear regression model was created using the following factors as training and test inputs : means, residual errors, and pairwise products. a nonlinear variant (3-node single hidden - layer neural network) of the regression model two sets of box plots were created for the global linear and non - linear regression models. as this was a pilot study without prior data comparing nirs to us, a convenience sample size of 19 subjects was obtained. for initial exploratory analysis purposes, the differences between the sto2 distributions for the no / low versus normal / hyperactive motility assignments were assessed using multivariate analysis of variance (manova) techniques. for the results reported herein, the lm () and anova () commands in r (; 2015 - 06 - 18), were utilized for generating the linear fits and comparison of the means and medians of the respective distributions. the nnet () command in r (nnet package) was utilized for generating the nonlinear variant of the linear regression model. the nutritional intake was recorded at the bedside over the course of 24 h and additional data relevant to the study (maternal and infant characteristics) were collected from the patient s electronic medical record and managed using redcap database application (redcap software v5.7.1 2014 vanderbilt university). mann - whitney u, chi - squared, or t tests were used for data analysis where appropriate. four patients were excluded from the study, 2 because of inability to obtain a venous blood gas from the uvc lines, and 2 due to insufficient data. after undergoing abdominal ultrasound imaging, 8 subjects had negligible peristaltic movements visible on bowel ultrasonography and were classified into the no / low group. differences in gestational age and day of life at enrollment were not significant between the 2 categories. birthweight was higher in the normal / hyperactive group and the mean magnesium levels were higher in the no / low group ; however, these results were not statistically significant (p=0.11 and p=0.09, respectively). the no / low group had a higher incidence of abdominal distention (2 vs. 0 ; p = na), gastric residuals (7 vs. 4 ; p=0.03), and gastric residual volume (2.03 ml vs. 0.87 ml ; p=0.06). the no / low group had a lower volume of enteral nutrition during the duration of the study (13 ml vs. 98 ml ; p=0.02). table 3 summarizes the data obtained from the ultrasonography measurements. on all three 10-s ultrasound images, the no / low category had an average of 1.91.3 peristaltic movements and the normal / hyperactive group had an average of 9.22.2 peristaltic movements. the peak systolic velocity through the superior mesenteric artery was higher in the normal / hyperactive (77.26.3 cm / s vs. 58.58.1 cm / s ; p=0.04). neonates who were classified as having normal / hyperactive motility had on average higher sto2 over 24 h (figure 3a) than those classified as having no / low motility (72.34.4 vs. 65.57.9, p=0.03, f=5.65). on average, no / low motility neonates also had higher variability, or deviations (i.e., residual errors) from the 4-min linear fits as shown in figure 3b. as a univariate factor, the difference in the residual error (goodness - of - fit) was not considered statistically significant (1.480.26 vs. 1.730.58, p=0.213, f=1.67). the global linear regression models showed a higher level of separation between the groups (0.470.26 vs. 0.240.33, p=0.0001, f=27.4), as illustrated in figure 3c. the non - linear variant of the regression model showed the highest level of separation between the 2 groups (0.680.24 vs. 0.490.53, p=0.0001, f=41.9), as illustrated in figure 3d. emerging noninvasive continuous monitoring techniques, such as cerebral nirs (cerebral sto2) and electrocardiography (cardiac output, stroke volume), have been utilized by our group to augment continuous recording of more common vital signs, such as heart rate, blood pressure, mean arterial pressure, and arterial oxygen saturation (spo2). previous studies by other groups developed nirs - based methods for describing splanchnic sto2 characteristics in relation to : cerebral sto2, superior mesenteric artery flow, blood transfusions, hyperemia after feeds, apneic episodes, feeding intolerance, patent ductus arteriosus and necrotizing enterocolitis. the methods of nirs data recording, statistical analysis, and instrumentation vary widely among these studies. to date, no other study has validated splanchnic nirs with a functional medical imaging technique which measures intestinal function, such as the one described by richburg.. in this pilot study, we were successful in describing a relationship between this method of medical imaging and nirs. this study found that higher motility levels correspond to higher average splanchnic sto2 over a 24-h period. we attribute this finding to increased delivery of oxygenated arterial blood in the normal / hyperactive group, as observed by doppler us of the sma (insert results). although peristaltic contractions of the smooth muscle cells result in increased oxygen consumption (which would decrease sto2), some metabolic products of peristaltic activity (such as adenosine) are powerful vasodilators that increase arterial blood flow by as much as a factor of 4. however, motility and blood flow are dependent on many other factors : gestational age, postnatal age, time after administration of feeds (fed / unfed state), and overall maturation. the gestational age and postnatal age did not differ significantly between the 2 comparison groups. the total volume of feeds over the 24 h of monitoring was significantly higher in the normal / hyperactive group (results), which suggests that infants in the normal / hyperactive group had better overall intestinal function. to identify normal and abnormal intestinal function and development, larger stratified studies are needed to further describe the gestational postnatal age and postprandial evolution of motility and circulation. multivariate regression models using a combination of sto2 and goodness - of - fit, displayed the highest degree of separation between the 2 groups. in the normal / hyperactive group, 2-s measurements more consistently increased (positive slope), decreased (negative slope), or stayed the same value (zero slope) throughout 4-min sample intervals. overall, the regression models indicate that at higher sto2 levels, the 4-min trends tend to be more linear and less random. we attribute the less random nature to more functional auto - regulatory mechanisms in the intestinal microcirculation. one of the future applications of this study lies in the decision to advance or delay enteral feeds in preterm neonates. feeding protocols are generally based on the gestational age (ga) and birthweight of neonates and subsequent trial and error of tolerance [37 ]. one method available to estimate tolerance of feeds is the collection of gastric residual (gr) aspirates. in the present study, however, even the presence of grs is often not a sufficient reason to decrease or interrupt enteral feeds, as maintaining feeding may improve gastrointestinal maturation and feeding tolerance. clinicians consider gastric residuals suspect if they are > 3050% of the previous feed or bilious - stained. our findings that multivariate linear regression models of continuous sto2 measurements correlate closely with us motility measurements suggest that nirs may be also used for gauging feeding readiness. another future application of our results is in the early detection of neonates at high risk of nec, which often occurs unpredictably, with subsequent high morbidity and mortality. patel. found that infants with nec have a higher variability of sto2. the variability of sto2 measurements suggests an impairment of auto - regulation of blood flow. this is consistent with our finding that infants with higher intestinal function tend to adhere to a more linear trend of 4-min measurement intervals. this is also consistent with the study by downard., which described a discontinuous stop - and - go pattern of flow in venules of rats with induced nec. in this context, our study suggests an alternative analysis of sto2 data that is potentially useful for future nec studies. the sample included relatively mature preterm babies of gestational age > 32 weeks, and the timing of the scans were not predefined. this was an exploratory study to describe the general correspondence between 2 techniques which are not currently used in our nicu. more work is needed to apply our results to neonates who may benefit the most from this type of noninvasive monitoring. movement of the baby, movement of abdominal contents due to contraction of the diaphragm during breathing, movement of the ultrasound probe, and presence of small amounts of air can create artifacts that affect the quality of the images. nirs instrumentation is also subject to motion artifacts and light interference which limit the accuracy of nirs measurements. this is the first study to demonstrate an association between nirs - based sto2 measurements and peristaltic activity visualized by ultrasound imaging. in addition to continuously monitoring splanchnic sto2 level, nirs may offer a continuous, noninvasive method to indirectly assess intestinal motility and function. future research will focus on the applicability of the methods and results demonstrated in this study for predicting tolerance to feeds, advancing or withholding enteral feeding, and early detection of necrotizing enterocolitis. | backgroundnear - infrared spectroscopy (nirs) has the potential to continuously and noninvasively monitor intestinal function. this technology may be valuable because among neonates, intestinal maturity is highly variable and difficult to assess based solely on clinical signs. the aim of this study was to determine if there is an association between nirs - based sto2 measurements and peristaltic activity assessed by transabdominal ultrasonography (us).material / methodsnineteen neonates of gestational age > 32 weeks were categorized according to no / low versus normal / hyperactive motility levels, based on blinded us scan results. sto2 was recorded every 2 s for 24 h, following the ultrasound recording. differences between the resulting estimates of average sto2 (bias of fits) and goodness - of - fit (residuals) were evaluated.resultsnewborns with normal / hyperactive motility had higher mean sto2 than newborns with no / low motility (72.34.4 vs. 65.57.9, p<0.05, f=5.65). residual errors were not significantly different between the 2 groups (p=0.213, f=0.213). a multivariate linear regression model using the means, residuals, and pairwise products of both, demonstrated more significant separation (0.470.26 vs. 0.240.33, p<0.01, f=27.4). a non - linear variant of the multivariate linear regression model demonstrated greatest separation (0.680.24 vs. 0.490.53, p<0.01, f=41.9).conclusionsthis is the first study to demonstrate an association between nirs - based sto2 measurements and peristaltic activity visualized by ultrasound imaging. nirs may offer a continuous, noninvasive method to assess motility. this may have significant implications in premature infants at risk for feeding intolerance or necrotizing enterocolitis. |
spigelian hernia (sh) is a ventral hernia that occurs through slit - like defects in the anterior abdominal wall adjacent to the semilunar line. adriaan van der spiegel is credited as the first to describe the semilunar line in 1645. however, in 1764 klinkosch1 described a spontaneous lateral ventral hernia specifically located in the semilunar line. in 1935, scopinaro2 was the first to report a lateral ventral hernia in a pediatric patient. only 37 cases have been reported in the pediatric age group in a review of the literature from 1935 to 2000.3 in children, shs range is from newborn to 17 years of age (average, 4.52 years), they are more frequent in males than females (ratio, 3.7:1), and they are more commonly left - sided and may occur bilaterally in 15% of cases.4 5 6 in adults, they most occur on the right side, between fourth to seventh decade of life, they are more frequent in women (ratio, 4:3) and are rarely bilateral.4 7 8 although adult hernias are considered to be acquired because of trauma or increased intra - abdominal pressure, the pediatric cases are suspected to be congenital.4 it is difficult to establish the correct clinical diagnosis because there are no characteristic symptoms9 and sh may be interparietal with no signs on inspection or palpation.8 10 generally, patients present a localized pain that in time becomes diffuse and aggravating. in doubtful cases, ultrasonography (us), computed tomography (ct), and magnetic resonance imaging (mri) can help to establish the correct diagnosis. we report a case of sh in a 14-year - old girl presented with recurrent abdominal pain. in a review of literature from 2000 to 2013, we collected only 24 cases of sh in children younger than the age of 14 years, for a total of 25 cases including our case. we had considered the following parameters : age, sex, side, associated risk factors, associated anomalies, and content of hernia sac. a tall, thin 14-year - old girl without other comorbid conditions or previous abdominal wall trauma, was admitted to our outpatient surgical with 1 year history of recurrent abdominal pain associated to swelling usually appeared on the right lower abdominal quadrant after strain and spontaneously resolved. physical examination revealed only tenderness and discomfort to palpation of the abdomen, especially in the right lower quadrant. us of the right midabdomen, using a 7.5 mhz linear transducer, noted a fascial plane defect. with the suspected diagnosis of sh, the girl underwent open surgery under general anesthesia. a median incision presented a hernia lipoma sticking out from the lateral margin of the abdominal rectus. the orifice diameter was approximately 1.5 cm ; it was as a ring like through the fibers of transversus and internal oblique muscles. the hernia sac contained a small part of the greater omentum, which was reduced. a medline database search (20002013) revealed 17 articles for a total of 24 cases of pediatric sh (25 including our case)3 4 5 11 12 13 14 15 16 17 18 19 20 21 22 23 24 (table 1). there were 22 (88%) males and 3 (12%) females, ratio 7:1. the hernia was situated on the right side in 11 (44%), the left side in 10 (40%), and was bilateral in 4 (16%) cases. in two cases, the hernia was caused by trauma19 24 ; in another case, there was imperforate anus.13 two children presented with a strangulated sh.14 17 twelve patients had anomalies associated to them : 16 (72.72%) undescended testis (13 ipsilateral and 3 bilateral), 2 (9.09%) inguinal hernia, 1 (4.54%) umbilical hernia, 1 (4.54%) glandular hypospadias, and 2 patients presented other anomalies. the contents of the hernia sac was in most cases the testis, 16 (42.10%) ; followed by small intestine, 11 (28.94%) ; omentum, 5 (13.15%) ; vas deferens, 2 (5.26%) ; cord structures, 1 (2.63%) ; fat and vessel, 1 (2.63%) ; spermatic vessel, 1 (2.63%) ; and sigmoid colon, 1 (2.63%). sh protrudes through a congenital or usually acquired defect of the spigelian fascia, which is the aponeurotic layer between the rectus abdominis muscle medially and the semilunar line laterally.8 the term spigelian hernia is usually referred to hernias located cranially to the inferior epigastric vessels. those that cross the strip of spigelian at the triangle of hasselbach, caudally and medially to the vessels, are called low and are a rare entity in pediatric surgery often misdiagnosed as an inguinal hernia.10 24 in 90% of cases, these hernias lies in the so - called sh belt, which is a transverse belt lying 6 cm cranial to the interspinal plane.25 one of the weakest points is the insertion between the semilunar and semicircular line of douglas. this line marks the caudal end of the posterior lamina of the aponeurotic rectus sheath in the infraumbilical area. in classic sh, the external oblique fascia remains generally intact and the hernial sac is located between the internal oblique muscle and aponeurosis of the transversus muscle (fig. the etiology in children is still unclear : a congenital abnormality in the development of the abdominal wall secondary to a structural change of the internal oblique and transversus abdominis muscles, neurovascular openings in the fascia, infiltration of muscles layers with fat and muscle palsy has been hypothesized.11 18 most shs reported in the pediatric age group are spontaneous and idiopathic, although posttraumatic and postoperative sh have been reported.5 11 19 24 on the basis of the musculoaponeurotic defect etiology, diverse factors that increase intra - abdominal pressure or deteriorate the abdominal wall are considered predisposing factors such as collagen disorders, changes in body weight, aging, chronic pulmonary disease, trauma, previous abdominal surgery, previous or concomitant hernias, and imperforate anus.6 13 16 an association of cryptorchidism, umbilical hernia, inguinal hernia, gastroschisis, omphalocoele, meningomyelocele, congenital diaphragmatic hernia, and bladder or cloacal exstrophy have been reported for sh.3 4 5 12 13 15 16 18 21 22 23 anatomy of abdominal wall : (1) linea semilunaris ; (2) spigelian fascia ; (3) semicircular line ; (4) inferior epigastric vessels. among male infants with shs, 75% presented are associated with cryptorchidism and in most of these the undescended testis was found in the hernia sac.4 7 21 22 23 there have been many hypotheses on the mechanism of this congenital association. some authors4 5 21 report that sh is the primary defect and the undescended testis takes the path of least resistance in the abdominal wall. raveenthiran26 instead hypothesized that the ectopic location of the testis is the primary abnormality and leads to the formation of a sh by dragging a peritoneal sac along with it. for all these authors, therefore, sh and undescended testis are in a sequence. because of the high rate of coexistence of this two anomalies, bilici suggest for a congenital spigelian cryptorchidism syndrome, defined by defects in the spigelian fascia, hernia sac containing the testis and absence of both the gubernaculum and the inguinal canal ; on the other side, mirilas27 states that this association can be simply accidental : the discussion in literature is still open. the submission of pediatric shs is quite uncommon, therefore this often means a delayed diagnosis. they may be asymptomatic or present with no specific clinical symptoms and signs, ranging from pain, swelling, intermittent abdominal pain to an acute abdomen ; in addition 20% of shs in children present with strangulation.4 5 21 pain is usually limited to the area where the hernia has occurred ; it varies in type, severity and location, and depends upon contents of hernia28 ; the contraction of the abdominal muscles or other maneuvers that increase intra - abdominal pressure, causing or exacerbating the pain, can help toward the correct diagnosis. the presence of an intermittent palpable mass along the spigelian aponeurosis that appears after physical exertion and spontaneously resolves, as reported in our case,29 makes the diagnosis apparent.28 in doubtful cases us, ct, and mri should be considered.11 a carefully performed us examination with a high - resolution linear transducer may demonstrate the fascial defect, the hernia sac, and its contents5 ; the test can also be conducted in association with valsalva maneuver to help identify the hernia orifice and evaluate parietal muscle contractility. differential diagnosis of sh in children includes the following : appendicitis and appendiceal abscess, ventral or inguinal hernia, tumor of the abdominal wall, and spontaneous hematoma of the rectus sheath.30 shs are usually small and the risk of strangulation is high, so it should be repaired.8 10 31 in adults, the validity of laparoscopic treatment is widely confirmed.29 recent studies support the possible role of laparoscopy in the diagnosis and treatment of sh also in children, suggesting that it may represent an acceptable therapeutic alternative.32 the open surgery is still considered the technique of choice in children. in case of palpable hernia, transverse incision is recommended over the protrusion. external oblique aponeurosis is incised in the direction of its fibers to expose the peritoneal sac. median or paramedian incision is indicated if there is not any palpable hernia or hernia orifice.10 28 in pediatric age, recurrent rates following such repairs have been reported to be very low.7 8 the hernial sac contains commonly testis, preperitoneal fat, small intestine, colon, omentum, although herniation of a meckel diverticulum, gallbladder, stomach, urinary bladder, and ovary have been rarely reported in children.3 4 5 11 12 13 14 15 16 17 18 19 20 21 after the hernia content reduction, the sac is excised and the fascia defect is closed with suture in layers. when the defect is larger and with coexisting recurrent risk factors, prosthetic mesh, in the preperitoneal space or above the fascia, may be required to reinforce the suture and supports the laxity of spigelian band7 21 (table 2). congenital or acquired defect of spigelian fascia, located between the rectus abdominis muscle medially and the semilunar line laterally. the hernia sac is located between the internal oblique muscle and aponeurosis of the transversus muscle and contains mostly preperitoneal fat, small intestine, colon, and omentum. sh can be associated with cryptorchidism ; in most of these cases, the undescended testis is located in the hernia sac. often asymptomatic ; symptoms and signs ranging from pain, swelling, intermittent abdominal pain to acute abdomen. differential diagnosis with appendiceal abscess, ventral or inguinal hernia, tumor of the abdominal wall, spontaneous hematoma of the rectus sheath. sh in children is small and has to be repaired because of a high risk of incarceration : open surgery is the technique of choice | spigelian hernia (sh) is a surgical rarity in children, which occurs through slit - like defects in the anterior abdominal wall adjacent to the semilunar line, the convexity lateral line which joins the nine ribs to the pubic tubercle and signs the limit between the muscular and aponeurotic portion of transversus abdominis muscle. as there are no specific symptoms and signs, the diagnosis is difficult, especially in children. we report a case of sh that comes to our observation : a 14-year - old girl presented recurrent abdominal pain associated to intermittent palpable mass in the paraumbilical region. starting from our case report, we review the literature of pediatric sh from 2000 to 2013 and we describe the anatomy, etiology, clinical presentation, instrumental diagnosis, and surgical technique of pediatric sh. |
studies on asthmatic patients and animal models of allergy have demonstrated that th2 cells produce cytokines il-4, il-5, and il-13 and thus contribute to development of asthma characterized by airway inflammation, mucus hypersecretion, and airway hyperresponsiveness. however, the mechanisms through which nave t cells differentiate to th2 cells in response to allergens remain unclear. dcs are a group of cells which possess the ability in dictating nave cd4 + t cells differentiation to either th1 or th2 cells depending on ambient microenvironment [1, 2 ]. it is still an enigma how antigen - specific th2 cells get skewed polarization and how they maintain a dominant status in allergy. recent studies have showed that dcs express t cell immunoglobulin mucin domain (tim)4 that ligates tim1 on th2 cells to promote th2 cells development. tim is a new family of cell surface proteins that are potentially involved in the regulation of effector t cell responses. accumulated data suggest that several tim molecules play critical roles in the regulation of th1 and th2 immune responses. among them, dc - derived tim4 has been found to be able to drive cd4 + t cells into th2 cells [4, 5 ]. it has also been observed that the expression of tim4 on dcs could be up - regulated dramatically upon activation [6, 7 ]. however, little is known about the actions of allergens in tim4 upregulation on dcs. cockroaches have been identified to induce allergy in different regions of the world [811 ]. the most common cockroach species, which are frequently found in homes, are b. germanica and periplaneta americana (p. americana) [12, 13 ]. over the past decade, seven allergens of b. germanica (bla g 1, bla g 2, bla g 4, bla g 5, bla g 6, bla g 7, and bla g 8) have been cloned [1417 ]. among them, bla g 7 is a tropomyosin and has a highly cross - reactive pan - allergen to serum ige. since the structure of bla g 7 is very similar to per a 7 (a tropomyosin from p. americana), which has been previously reported to be able to activate the secretion of th2 cytokine, il-4, and il-13, from p815 mast cell line [18, 19 ], we anticipated that bla g 7 may also stimulate th2 cytokine release from other immune cells. as dcs are the most powerful antigen presenting cells, which could induce th2 polarization and intestinal allergy, the initiation factors through which dcs trigger cd4 + t cell differentiation remain unknown. therefore, in this study, we hypothesized that bla g 7 might affect dcs by promoting tim4 expression in dcs and evoke cd4 + t cells to differentiate into th2 cells subsequently. exscript rt reagent kit and sybr premix ex taq (perfect real time) were obtained from takara (dalian, china). pe - conjugated mouse antihuman il-4, cd80, cd86, and fitc - conjugated mouse antihuman ifn- antibodies were obtained from ebioscience (los angeles, ca, usa). antihuman i-b, phospho - i-b, nf-b, and phospho - nf-b antibodies were purchased from cell signaling technology inc. anti - tim4 antibody was purchased from r&d systems (san diego, usa). gm - csf, and il-4 was purchased from peprotech (rocky hill, usa). rbla g 7 and its monoclonal antibody were prepared in our laboratory as shown previously. most of other reagents such as salt and buffer components were of analytical grade and obtained from sigma - aldrich (st. peripheral blood mononuclear cells (pbmcs) from 6 healthy volunteers were isolated by ficoll centrifugation. cd14 + monocytes were then purified by cd14 + magnetic microbeads (miltenyi biotec, germany) according to the manufacturer 's instruction. they were cultured in rpmi-1640 supplemented with 10% fetal bovine serum, antibiotics, gm - csf (10 ng / ml), and il-4 (5 ng / ml). the further addition of the cytokines was carried out every other day. after 5 days of culture, immature dcs were harvested for use. for challenge experiments, cells were exposed to various concentrations (101000 ng / ml) of rbla g 7 with or without anti - tim4 antibody (10 ng / ml), or 100 ng / ml of lps (as positive control). at 48 h following incubation, the culture plates were centrifuged at 450 g for 10 min at 25c. after the supernatants being collected and stored at 80c, the cell pellet containing approximately 5 10 matured dcs was collected for western - blot, flow cytometry, and real - time pcr analyses. some dcs were pulsed with 100 ng / ml lps and 1 g / ml rbla g 7 for 24 h, washed, and then cultured with cd4 + t cells for 2 days. in order to investigate the influence of cd80 and cd86 molecules on rbla g 7-activated dcs induced polarization of cd4 + t cells, rbla g 7-activated dcs were preincubated with cd80 and cd86 blocking antibodies respectively, for 30 min at 37c before being cocultured with cd4 + t cells. cd4 + t cells were purified from the pbmc (donated by 6 healthy volunteers) with cd4 + magnetic microbeads according to the manufacturer 's instruction. isolated cd4 + t cells were then mixed with rbla g 7-activated dcs at a ratio of 10 : 1 with or without tim4 blocking antibody (10 ng / ml). the cocultured two types of cells were maintained in rpmi-1640 culture medium supplemented with 10% fbs and antibiotics for 48 h at 37c. following centrifugation, the supernatant was collected, and levels of ifn- and il-13 in the supernatant were measured by elisa. the cell pellet was resuspended, and intracellular expression levels of ifn- and il-4 were measured by flow cytometry analysis. after being challenged with 10, 100 and 1000 ng / ml rbla g 7 or medium alone for 48 h and challenged with 1000 ng / ml rbla g 7 (or medium alone) for 20 min, 40 min, and 60 min, the purified dcs were lysed as previously described. densitometry analysis of immunoblots was carried out by using quantity one software (bio - rad, usa). the relative level of phosphor - i-b and nf-b was expressed as the ratio to i-b and nf-b, and tim4 was expressed as the ratio to gapdh, an internal control. the cdna was prepared by exscript rt reagent kit according to the manufacturer 's instruction and then was amplified by pcr with specific primers. briefly, real - time pcr was performed by using sybr premix ex taq on a sequence detection system (eppendorf, germany). the thermal cycling conditions included an initial denaturation step at 95c for 30 s, followed by 40 cycles of 5 s at 95c and 30 s at 60c. primer sequences for human tim4, il-12, and il-13 and gapdh are summarized in table 1. dcs were pelleted by centrifugation at 450 g for 5 min and then fixed and permeabilized by using a cell fixation / permeabilization kit (bd pharmingen). briefly, thoroughly resuspended cells were added in 100 l of bd cytofix / cytoperm solution and incubated for 30 min at 4c. dcs were then incubated with pe - conjugated cd80, and cd86 and cd4 + t cells were incubated with fitc - conjugated ifn- and pe - conjugated il-4 monoclonal antibody or isotope control, respectively (at a final concentration 4 g / ml), at 4c for 30 min. after washing, cells were analyzed on a fluorescence - activated cell sorting (facs) arial flow cytometer with flowjo software (treestar, san carlos, ca, usa). levels of il-13 and il-12p70 (excell china) in the culture supernatant of dcs or il-13 and ifn- in the culture supernatant of t cells were measured by elisa kits according to manufacturer 's instructions. data are expressed as mean sem for the indicated number of independently performed duplicated experiments. statistical significance between means previous reports indicated that dcs express tim4 that plays a critical role in inducing peripheral th2 polarization [4, 21 ]. however, the factors in upregulating tim4 expression in dcs remain unknown. as shown in western blot, the expression of tim4 in dcs was significantly increased in response to rbla g 7 in a dose - dependent manner (figures 1(a) and 1(b)). similarly, tim4 mrna expression in human dcs was enhanced by up to approximately 28.2-fold assessed by realtime pcr analysis when the cells were cultured with various concentrations of rbla g 7 (figure 1(c)). once being added at the same time with rbla g 7, anti - bla g 7 antibody was able to diminish rbla g 7 induced tim4 protein and mrna expression though it itself induced modest tim4 expression in dcs (figure 1). cd80 and cd86 mediate the necessary costimulatory signals to t cells, which results in th1/th2 cell polarization. it has also been reported that enhanced expression of cd80 and cd86 was observed on human monocyte - derived dendritic cell 's (modcs) during maturation, and we therefore investigated expression of cd80 and cd86 on dcs in the present study. rbla g 7 induced approximately 2.4- and-2.2 fold upregulated expression of cd80 and cd86 on immature dcs, indicating the maturation of these immature dcs. the phenotypic changes induced by rbla g 7 were comparable to those elicited by lps (100 ng / ml), suggesting that rbla g 7 is a potent stimulus of dc maturation and activation. once being added at the same time with rbla g 7, anti - bla g 7 antibody was able to diminish rbla g 7 induced cd80 and cd86 expression (figure 2). il-13 is a well - known th2 cytokine, which contribute 's greatly to the development of allergic inflammation. it has been shown that il-13 is not only secreted from th2 cells, but also released from basophils and epithelial cells. however, little is known about the influence of allergen on il-13 secretion from dcs. in the present study, rbla g 7 induced a dose - dependent secretion of il-13 from dcs, which was partially inhibited by tim4 blocking antibody (figure 3(c)), and cd80 and cd86 blocking antibodies (figure 3(e)). rbla g 7 also up - regulated the expression of il-13 mrna in dcs (figure 3(d)). in the parallel experiments, rbla g 7 at the doses tested failed to show any effect on il-12 protein (figure 3(a)) or mrna expression (figure 3(b)) in dcs. therefore, we examined i-b and nf-b activation in dcs in the presence of rbla g 7. the results revealed that rbla g 7 triggered phosphorylation of i-b and nf-b in dcs initiated at 20 min following incubation and lasted for 40 and 60 min, respectively (figure 4). induction of th2 polarization is one of the crucial steps of sensitization process in allergy. we found that coculture of rbla g 7-activated dcs with isolated cd4 + t cells induced th2 polarization of helper t - cells as shown by enhanced ratio of il-4 + cells versus ifn-+ cells (14.23 0.82), which was approximately 7-fold higher than the ratio for immature dcs (2.082 0.46) (figures 5(a) and 5(b)). moreover, coculture of rbla g 7-activated dcs with isolated cd4 + t cells resulted in the elevated level of il-13 in the culture supernatant (figure 5(c)). since dc - derived tim4 has been reported to drive cd4 + t cells into th2 cells [4, 5 ], it may mediate rbla g 7-induced th2 polarization. indeed, tim4 antibody reduced rbla g 7-activated dcs induced il-4 expression of cd4 + t cells by approximately 48% (figure 6(a)), significantly diminished the ratio of il-4 + versus ifn-+ cells (figure 6(b)), and decreased the il-13 level in the culture supernatant of cocultured rbla g 7-activated dcs and isolated cd4 + t cells (figure 6(c)). in addition, cd80 and cd86 antibodies also inhibited rbla g 7-induced th2 polarization when they were added to rbla g 7-activated dcs for 30 min before co - culturing with isolated cd4 + t cells (figure 6). although bla g 1 and bla g 2 were employed as markers of b. germanica, little is known about the profile of bla g 7 in proinflammatory actions. in the present study, we found for the first time that bla g 7 could potently induce tim4 expression on dcs. since activated dcs highly express tim4 which plays a critical role in t cell proliferation and th2 cell development, and dcs are mainly localized at the interface between epithelium and environment, and we believe that inhalant allergen bla g 7 might initiate the sensitization process of allergy by activating dcs [30, 31 ]. on the other hand, bla g 7 could also induce dcs maturation assessed by the levels of cd80 and cd86. as cd80 and cd86 have been found to mediate the necessary costimulatory signals to evoke th2 polarization involved in allergy, cd80 and cd86 upregulation induced by rbla g 7 in dcs may contribute to the subsequent allergic responses. a recent study demonstrated that a p. americana allergen per a 10 induced significant cd86 upregulation on dcs, and provoked significantly low il-12 but high il-4 and il-5 release from dcs. another report also confirmed that cd11c+ mhcii+ dcs within mediastinal lymph nodes expressed maturation markers such as cd80 and cd86, which supports our observation. however, unlike per a 10 and fungal allergens, rbla g 7 was found to only downregulate the level of il-12 mrna, but not il-12 secretion from dcs. since il-13 serves as a foremost cytokine and provides a first and crucial signal for class switching of b cells to produce ige, our finding implicates that rbla g 7 may induce b cell to produce ige without activating th2 cells. the previous studies have demonstrated that grass pollen and birch pollen were able to induce il-13 production from human dcs, and that diesel - enriched particulate enhanced il-13 secretion from human dcs may support our view above. moreover, our findings that antibodies against tim4 and cd86, but not cd80 blocked rbla g 7-induced il-13 production in dcs, indicated that the effects of rbla g 7 are via a tim4 and cd86 dependent mechanism. although high levels of cd80 and cd86 represent the dcs maturity, expression of cd80 and cd86 under the same stimulation respond differently as shown in the present study. similar observation was reported previously that reduced expression of cd80 and cd86 was observed in the majority of dcs in vitro while a significantly increased cd86 expression was found in a subpopulation of dcs exposed to maxadilan. induction of phosphorylation of i-b followed by nf-b activation by rbla g 7 indicates that nf-b translocation into nucleus may also be involved in maturation of dcs and il-13 release from dcs. the previous report that nf-b1 expression within dcs is required to promote optimal th2 responses following exposure to eggs may support our observation above. although dcs from allergic individuals preferentially induce a th2-type response, the mechanism underlying by which nave cd4 + t cells develop to th2 cells and how this process is out of control is a critical point to elucidate the mechanism of allergy. using the current experiment model, we demonstrated for the first time that cockroach allergen bla g 7 preferably induces nave cd4 + t cells to become th2 cells via dcs. since antibodies against tim4, cd80, and cd86 blocked rbla g 7-activated - dcs induced il-13 release from cd4 + t cells, the actions of rbla g 7 on il-13 secretion from cd4 + t cells are likely via tim4, cd80, and cd86 dependent signaling pathways in dcs. however, the antibodies against tim4, but not cd80 and cd86, blocked rbla g 7-activated - dcs induced il-4 upregulation in cd4 + t cells indicates that the actions of rbla g 7 on il-4 upregulation are likely via a tim4, but not cd80 and cd86 pathway in dcs. obviously, the involvement of different signaling pathways of dcs in the induction of il-13 and il-4 upregulation is still required to be further studied. in conclusion, we demonstrated in this study that cockroach allergen rbla g 7 induces dc - dictated th2 polarization of cd4 + t cells through tim4, cd80, and cd86 dependent mechanisms. since th2 cells are pivotal factors in allergy, bla g 7 seems likely to play an important role in the development of cockroach allergy. | as one of the most common sources of indoor aeroallergens worldwide, cockroach is important in causing rhinitis and asthma while the mechanisms underlying remain obscure. since t helper (th) type 2 polarization plays an important role in the pathogenesis of allergic diseases, we investigated the effect of bla g 7, a pan - allergen from blattella germanica (b. germanica), on th polarization which is controlled by monocyte - derived dendritic cells (dcs). challenged by recombinant bla g 7 (rbla g 7), immature dcs obtained from human exhibited upregulated levels of tim4, cd80, and cd86 and increased il-13 secretion. cocultured with cd4 + t cells, challenged dcs increased the ratio of il-4 + versus ifn-+ of cd4 + t cells, suggesting a balance shift from th1 to th2. moreover, antibodies against tim4, cd80, and cd86 reversed the enhancement of il-4+/ifn-+ ratio and alleviated the il-13 release induced by rbla g 7, indicating that the th2 polarization provoked by rbla g 7 challenged dcs is via tim4-, cd80-, and cd86-dependent mechanisms. in conclusion, the present findings implied a crucial role of bla g 7 in the development of cockroach allergy and highlighted an involvement of dcs - induced th2 polarization in cockroach allergy. |
this study compared travel histories of c. gattii infected case - patients with travel patterns of the general public to validate and refine these risk areas on vi. we also examined spatial progression of these areas over time to assess whether c. gattii spread from a single focal point since its emergence in 1999. c. gattii infected case - patients were defined as bc residents with culture - confirmed c. gattii infection or hiv - negative residents of bc with cryptococcus sp. analysis included all cases diagnosed from january 1999 through december 2006 in which the patient had documented travel history on vi. case - patients were interviewed by using a standard questionnaire and asked about travel to any city outside their city of residence in the 12 months before symptom onset or diagnosis (8). tourism bc (www.hellobc.com/en-ca/default.htm) provided aggregated monthly visitor volume to 14 visitor centers in major tourist destinations (figure) on vi during 20002006. only visitors classified as bc residents were included in these analyses ; additional personal attributes of visitors were not collected (c. jenkins, pers. proportion of visits to each visitor center city was defined as number of visits to a visitor center city divided by total number of visits to all visitor center cities. for case - patients, the proportion was similarly defined. in both instances, visits to multiple cities by the same person were counted multiple times. differences between proportion of case - patient visits and tourism bc visits were evaluated by fisher exact test and statxact software (cytel inc., cambridge, ma, usa). analysis was conducted for all years combined and in 2 four - year increments (19992002 and 20032006) to assess potential spread of c. gattii on vi over time. because tourism bc visitor data were unavailable for 1999, case data for 19992002 were compared with aggregated tourism bc visitor data from 2000 through 2002. analysis was also conducted for a subset of case - patients who resided on the mainland because they represented travel exposures uncontaminated by potential exposure in place of residence. the value for significance was adjusted to account for testing multiple visitor center cities (p = 0.05/14 visitor center cities = 0.0036). maps were created by using arcmap version 8.2 (environmental systems research institute inc., redlands, ca, usa). travel history data were available for 104 (60.1%) case - patients. eighty - two (78.8%) had traveled to > 1 visitor center city. of these, 62 (75.6%) resided on vi and 20 (24.4%) lived on the bc mainland. a significantly greater proportion of visits to parksville (18.7% vs 7.2% ; p<0.0001) and nanaimo (21.4% vs 7.4% ; p<0.0001) were reported for patients than for tourism bc visitors (table). similar results were obtained when analysis was restricted to earlier (19992002) and later (20032006) periods (table). significant differences after adjustment for multiple comparisons according to fisher exact test (p<0.0036). when analysis was restricted to data concerning mainland residents (patients with travel - associated exposure but no residential exposure to the fungus), a greater proportion of mainland case - patients visited courtenay (19.4% vs 7.6% ; p = 0.017), parksville (30.6% vs 8.3% ; p = 0.0001), nanaimo (11.1% vs 6.9% ; p = 0.313), and qualicum beach (8.3% vs 4.7% ; p = 0.239) than did tourism bc visitors during 19992006 because of the small number of patients who resided on the mainland (n = 20), we could not further restrict this subset analysis to earlier (19992002) and later (20032006) periods. residents of vi may be exposed in their place of residence, in addition to their travel destination. however, we could not accurately weight patient exposure in the home environment to exposure at the travel destination. minor differences in results obtained for all case - patients compared with only mainland patients may be caused by this limitation or by differences in travel preferences between these groups. although travel history data were unavailable for 39.9% of the case - patients, they were not significantly different in terms of mean age (p = 0.303, by f test) or sex (p = 0.574, by test). however, travel patterns of central vi residents did not differ from travel patterns of other vi residents (data not shown). our analysis assumes that travel patterns of tourism bc visitors represent those of the general bc public. however, characteristics and activities of persons who use tourism bc visitor centers may differ from those of persons who do not. our interpretation is limited by its inability to account for duration of time spent in each visitor center city and specific activities of persons while there, factors that may contribute to exposure risk. our findings suggest that the opportunity for c. gattii exposure in the areas studied has existed since the beginning of its emergence and that minimal spatial progression of risk areas has occurred over time. areas of higher risk near parksville and nanaimo are consistent with distribution of environmental samples, which shows a high number of c. gattii positive samples in these areas (3). results are also consistent with annual incidence rates for c. gattii infection based on place of residence, which are highest along the central eastern coast (figure) (9). the refinement of geographic risk from our analysis may in part be the result of a reporting bias that produced larger than expected risk differences for certain areas. bc residents may be more likely to visit or travel through nanaimo, a commercial center on vi and transportation gateway to the rest of the island (10), than shown in tourism bc data. case - patients may be more likely to report traveling to parksville, a popular tourist destination, because it was often mentioned in media reports of the initial c. gattii outbreak. alternatively, results may indicate a true increase in travel - associated risk in areas near parksville and nanaimo. some case - patients who resided in areas with high incidence rates may have acquired their infections by travel to these 2 areas. although parksville and nanaimo may represent areas of higher risk, environmental sampling suggests fungal colonization in southern and central eastern vi, and travelers can be exposed to c. gattii in these regions (3). to determine travel - related risk for malaria (11) and gastrointestinal illness (1214), travel patterns of case - patients use of visitor center information and tourism surveys is a cost - effective solution to derive comparison data during a retrospective investigation. this approach shows promise in assessing risk for environmental pathogens where location of exposure is unclear. | we compared travel histories of case - patients with cryptococcus gattii infection during 19992006 to travel destinations of the general public on vancouver island, british columbia, canada. findings validated and refined estimates of risk on the basis of place of residence and showed no spatial progression of risk areas on this island over time. |
cutaneous manifestations of crohn s disease (cd) typically present as lesions that are contiguous with the gastrointestinal tract, such as peri - oral and peri - anal lesions [1, 2 ]. vulval involvement, mostly due to distant spread of granulomata (metastatic cd), is rare, especially in children [2, 3 ]. here, a 10-year - old girl presented to the dermatology department at york hospital with a 12-month history of asymptomatic erythema and swelling of the vulva. the patient was a healthy - looking girl with normal height and weight for her age. peau dorange appearance, with a large skin tag in the anterior peri - anal area (fig. 1). examination of the oral mucosa, rectum, and the rest of the skin was unremarkable. the patient was treated with tacrolimus ointment 0.03% which resulted in good control of the disease. a year after the initial presentation 1vulval swelling noted in patient 1 vulval swelling noted in patient 1 a 13-year - old girl presented with a 9-month history of asymptomatic vulval swelling. the patient was diagnosed with cd at the age of 5 years and had been well - controlled on methotrexate. examination of the peri - anal skin showed fissures and skin tags (fig. 2). examination of the rest of the skin, oral mucosa, and other systems was unremarkable. biopsy of the affected vulval area showed typical features of non - caseating granulomata with negative stains and culture for organisms. the patient was treated with intralesional triamcinolone and oral metronidazole, which resulted in a clear improvement in terms of swelling after 3 months.fig. 2unilateral vulval swelling with erythema noted in patient 2 unilateral vulval swelling with erythema noted in patient 2 a 10-year - old girl presented to the dermatology department at york hospital with a 12-month history of asymptomatic erythema and swelling of the vulva. the patient was a healthy - looking girl with normal height and weight for her age. peau dorange appearance, with a large skin tag in the anterior peri - anal area (fig. 1). examination of the oral mucosa, rectum, and the rest of the skin was unremarkable. the patient was treated with tacrolimus ointment 0.03% which resulted in good control of the disease. a year after the initial presentation a 13-year - old girl presented with a 9-month history of asymptomatic vulval swelling. the patient was diagnosed with cd at the age of 5 years and had been well - controlled on methotrexate. examination of the peri - anal skin showed fissures and skin tags (fig. 2). examination of the rest of the skin, oral mucosa, and other systems was unremarkable. biopsy of the affected vulval area showed typical features of non - caseating granulomata with negative stains and culture for organisms. the patient was treated with intralesional triamcinolone and oral metronidazole, which resulted in a clear improvement in terms of swelling after 3 months.fig. 2unilateral vulval swelling with erythema noted in patient 2 unilateral vulval swelling with erythema noted in patient 2 metastatic cd in children is rare, and most present prior to the diagnosis of cd [1, 2 ]. parks. there have only been 16 cases of vulval metastatic cd in children reported in the literature. vulval cd may present as the first and only manifestation of cd, as seen in patient 1, or after development of the disease, even if well - controlled otherwise, as in patient 2. the clinical presentation of vulval cd is variable and may simply manifest as diffuse edema with infiltration or ulceration. the absence of gastrointestinal symptoms often makes diagnosis difficult in children ; however, the presence of peri - anal fissures and skin tags should raise suspicion for vulval cd. the differential diagnoses for vulval swelling should include sarcoidosis, infections (e.g. tuberculosis, cellulitis, lymphogranuloma venereum, actinomycosis, pyogenic infections, hidradenitis suppurativa, intertrigo, syphilitic lesions), foreign body reactions, contact dermatitis, acquired lymphangiectasia, vascular malformations, and sexual abuse [46 ]. biopsy of the lesion is often necessary to reach a definitive diagnosis, revealing the typical appearance of a non - caseating granulomatous inflammation as seen in cd. as there is little correlation between the activity and/or severity of skin lesions and bowel disease, treatment of the underlying cd may not be effective against cutaneous cd, as was seen in patient 2. currently, metronidazole alone and/or topical / oral steroids seem to be the most effective treatment for metastatic cd. other beneficial therapies include dapsone, tetracycline, azathioprine, 6-mercaptopurine, sulphasalazine, and oral zinc supplementation. surgical procedures, such as vulvectomy, simple excision, curettage, and debridement, are reserved for resistant cases. tacrolimus ointment is currently licensed for use as a second - line agent in the management of atopic eczema. in children, the licensed strength is 0.03% ; however, it is increasingly used in other inflammatory conditions, including a pediatric vulval case of pemphigoid. in conclusion, vulval swelling can be the first or subsequent manifestation of cd and dermatologists should have a high index of suspicion to facilitate early diagnosis and control of the disease. | vulval involvement in crohn s disease (cd) is rare, particularly in children. the clinical features include erythema, edema, ulceration, and labial skin tags. the authors present two cases of children with vulval cd. in both cases, marked labial edema was the presenting feature. in one patient the immunomodulator tacrolimus ointment 0.03% was used with success. in the second patient control was achieved with intralesional triamcinolone in combination with systemic metronidazole. |
despite advances in diagnostic techniques, fever of unknown origin (fuo) remains a formidable challenge, with the cause of fever not being identified in 7%38% of patients.1 oren - gedoku - to (ogt) has been used traditionally to remove heat and poison from the body.2 on the basis of this theory in oriental medicine, it has been used in clinical practice to treat inflammation, hypertension, gastrointestinal disorders, and liver and cerebrovascular disease.2 in japan, ogt is manufactured as a powdered, freeze - dried water extract by tsumura co, ltd (tokyo, japan). a 33-year - old woman was admitted to our general medicine department with fuo which had persisted for longer than 2 months and was resistant to treatment with nonsteroidal anti - inflammatory drugs and prednisolone 20 mg / day. she reported sweating and headache, but did not complain of body weight change, pain, nausea, abnormal vaginal bleeding, or diarrhea. to treat dysmenorrhea and premenstrual syndrome, she had been prescribed oral contraceptives (levonorgestrel, ethinylestradiol) for 7 years, and the dose had remained unchanged during that period. she had no history of pregnancy, and a gynecologic examination revealed no infectious or malignant findings. she had been receiving regular follow - up care for mild depression for 3 years at our department of psychiatry and had been prescribed the antidepressants, aripiprazole and duloxetine hydrochloride, until 2 months before admission. she had asthma, which was well controlled with the inhaled steroid budesonide (200 g, once daily). she was a housewife and only had sexual contact with her husband who had no sexually transmitted diseases. her mental status was alert, and blood pressure was 92/60 mmhg in a sitting position. although the rise in body temperature was accompanied by an increase in pulse rate, her pulse was normal, ranging from 58 to 82 beats per minute. her pulse rate was regular in rhythm, and its size, and tension were within the normal ranges. physical examination revealed no abnormalities, such as focal inflammation, lymph node swelling, skin rash, or abnormal heart sounds. laboratory analysis showed no biological inflammation c - reactive protein 0.0 mg / l, and interleukin-6 (2.1 pg / ml, normal range 38.3c on several occasions, during a period of at least 3 weeks, that remains undiagnosed after one week of investigation.3 after considering the four categories of fuo, ie, classical, neutropenic, nosocomial, and human immunodeficiency virus - associated fever, this patient met the criteria for classical fuo.4,5 an evidence - based approach divides fuo into four general categories, ie, infectious, autoimmune, neoplastic, and miscellaneous diseases, each of which requires certain investigations to be performed.6 a complete history, physical assessment, and laboratory testing revealed no diagnostic clues. among the infectious diseases associated with fuo, tuberculosis is the most common in japan. however, a chest x - ray did not show abnormal findings, and sputum culture for acid - fast bacteria was negative. tuberculosis was thus excluded. among the autoimmune diseases associated with fuo, rheumatoid factor, antinuclear antibody, antineutrophil cytoplasmic antibody, and ferritin were negative. regarding malignancy, contrast thoracic and abdominal computed tomography, brain magnetic resonance imaging, and gallium scintigraphy excluded nonhematologic malignancies. use of aripiprazole and duloxetine hydrochloride had been stopped 2 months before admission. during that 2-month period, she did not report stress in her environment, and her mental condition remained stable. the effects of oral contraceptives (levonorgestrel, ethinylestradiol) on fever were also considered. she had been prescribed oral contraceptives for 7 years, and the dose remained unchanged during that period. she reported sweating and headache but no other side effects of oral contraceptives, such as body weight change, pain, nausea, and abnormal vaginal bleeding. fever due to oral contraceptives is usually low - grade, unlike the continuous high fever in this case. however, they usually complain of muscle weakness, myalgia, arthralgia, or chills. our patient had no such complaints.7 ogt has been used for 2,000 years to remove heat and poison from the body.2 with the development of modern medicine, heat and poison have come to be considered aspects of inflammation, hypertension, gastrointestinal tract disorders, and liver and cerebrovascular disease, which are indications for ogt.2 ogt is contraindicated for patients who are sensitive to cold. ogt comprises four decocted medicinal herbs (g) : rhizoma coptidis (2.0), radix scutellariae (3.0), cortex phellodendri (2.0), and fructus gardeniae (1.5). r. scutellariae has the active ingredients baicalin, baicalein, and wogonin, which suppress the arachidonate cascade by inhibiting cyclo - oxygenase (cox)-2, 5-lipoxygenase, but not cox-1, in rats and mice.8,9 moreover, ogt has an inhibitory effect on free radical production : baicalin, baicalein, and wogonin suppressed lipopolysaccharide - induced nitric oxide, wogonin suppressed lipopolysaccharide - induced cox-2, and ogt directly protected red blood cell membranes from free radical damage.9,10 the four decocted medicinal herbs have been shown to have greater anti - inflammatory effects than each herb used alone.11,12 in our patient, c - reactive protein, interferon-, and inflammatory cytokines, such as interleukin-6 and tumor necrosis factor-, were within normal ranges. in future cases, interleukin-8, a leukocyte chemotactic factor, should also be measured, to understand better the anti - inflammatory action of ogt. although the multiple anti - inflammatory effects of ogt are under investigation, the present results suggest that ogt might be an effective agent for fuo, because its anti - inflammatory effects do not depend only on the arachidonate cascade. it should be stressed, however, that this is a report of only one case. nevertheless, our findings indicate that ogt is a possible treatment for fuo that remains undiagnosed after an extensive diagnostic workup. ogt is a possible treatment for fuo, after exclusion of infectious, rheumatic / inflammatory, neoplastic, and other diseases. in addition, the anti - inflammatory effects of ogt that depend on pathways other than the arachidonate cascade should be investigated in future studies. | oren - gedoku - to is a traditional medicine used for treating inflammatory conditions and is given by prescription in japan, people s republic of china, and korea. its anti - inflammatory effect is related to the arachidonate cascade and inhibition of cyclo - oxygenase, but research on other anti - inflammatory pathways is ongoing. we report a case of fever of unknown origin in a 33-year - old woman. the possibility of infection due to human immunodeficiency virus, autoimmune, neoplastic, or other disease was examined and excluded. oren - gedoku - to was successfully used to treat her symptoms and may thus be a suitable treatment for patients with undiagnosed fever of unknown origin |
adequacy of nutritional support has significant importance in clinical outcomes of critically ill - patients. nutritional therapy in critically ill - patients improves wound healing, reduces rates of certain complications and mortality seems to reduce. enteral nutrition is recommended as the first option for most patients in light of the evidence of significant benefits while parenteral nutrition does not seem to add benefit to most critically ill - patients. however, gastric intolerance is common, associated with the opioid or vasopressor use and shock, it reduces the energy delivery and can increase the incidence of nosocomial pneumonia. the slow gastric emptying may contribute to an increase in gastric residual volume predisposing to bacterial colonization and the occurrence of aspiration pneumonia in critically ill - patients. the nutrition by a postpyloric tube can overcome the difficulty of gastric emptying, and as the jejunum has a higher absorptive capacity and is less susceptible to decreased motility, it could be advantageous. however, studies and meta - analyzes comparing nasojejunal and nasogastric nutrition show inconsistent results regarding the delivery of nutrition or of pneumonia even when patients at risk for reduced gastric motility are included. a meta - analysis published in 2013 evaluated 15 randomized trials until 2011 and concluded that the incidence of pneumonia is increased. davies., in the largest randomized trial comparing the use of nasogastric and nasojejunal tube, did not observe any significant differences in outcome. our hypothesis is that the use of a jejunal tube does not reduce the incidence of nosocomial pneumonia. the primary objective of this study is to evaluate the incidence of pneumonia throughout the stay in intensive care unit (icu) comparing gastric with jejunal nutrition. secondarily, we evaluated the mortality rate in the icu until the 28 day and other complications potentially related to enteral feeding. all patients admitted to a university icu for a period of 12 months were eligible for the study. data collection was performed after approval by the research ethics committee which waived the informed consent considering that there is no consensus on the use of jejunal or gastric tube and the choice is a personal preference of the attending physician. the following variables were obtained at baseline : age, sex, primary diagnosis, glasgow coma scale and score acute physiology and chronic health evaluation ii (apache ii). age > 18 years, need for enteral nutrition without contraindication for placement of naso or oroenteral tube, initiation of enteral feeding within 48 h of admission, duration of icu stay > than 48 h. patients with previous anatomic and/or surgical alteration of the upper gastrointestinal (gi) tract that could prevent the insertion of the enteral tube, such as anastomoses and esophagectomy and ; severe coagulopathy, patients with medical indication for postpyloric nutrition, gastrostomy or jejunostomy, contraindication to enteral nutrition, pregnancy, life expectancy of 38c or 10 cfu / ml) or a simplified clinical pulmonary infectious score 6 points. the comparison between groups was performed by student 's t - test or mann - whitney test for continuous variables and chi - square or fisher exact test for categorical variables. the variables are expressed as mean standard deviation whenever the distribution was normal, or median (confidence interval 2575%). age > 18 years, need for enteral nutrition without contraindication for placement of naso or oroenteral tube, initiation of enteral feeding within 48 h of admission, duration of icu stay > than 48 h. patients with previous anatomic and/or surgical alteration of the upper gastrointestinal (gi) tract that could prevent the insertion of the enteral tube, such as anastomoses and esophagectomy and ; severe coagulopathy, patients with medical indication for postpyloric nutrition, gastrostomy or jejunostomy, contraindication to enteral nutrition, pregnancy, life expectancy of 38c or 10 cfu / ml) or a simplified clinical pulmonary infectious score 6 points. the comparison between groups was performed by student 's t - test or mann - whitney test for continuous variables and chi - square or fisher exact test for categorical variables. the variables are expressed as mean standard deviation whenever the distribution was normal, or median (confidence interval 2575%). age > 18 years, need for enteral nutrition without contraindication for placement of naso or oroenteral tube, initiation of enteral feeding within 48 h of admission, duration of icu stay > than 48 h. patients with previous anatomic and/or surgical alteration of the upper gastrointestinal (gi) tract that could prevent the insertion of the enteral tube, such as anastomoses and esophagectomy and ; severe coagulopathy, patients with medical indication for postpyloric nutrition, gastrostomy or jejunostomy, contraindication to enteral nutrition, pregnancy, life expectancy of 38c or 10 cfu / ml) or a simplified clinical pulmonary infectious score 6 points. the comparison between groups was performed by student 's t - test or mann - whitney test for continuous variables and chi - square or fisher exact test for categorical variables. the variables are expressed as mean standard deviation whenever the distribution was normal, or median (confidence interval 2575%). one hundred and fifteen patients were enrolled, with 61 patients in the gastric tube group and 54 patients into the jejunal group tube. the characteristics of the two groups on admission to the study were similar [table 1 ]. the mean age of the 115 patients was 62 15 years, with a minimum of 18 years and a maximum of 91 years. the most prevalent diagnoses on icu admission were respiratory (33%), and neurological (26%) causes. the mean apache ii score was 22 6 and the glasgow coma score had a median of 7. characteristics of the sample population there were no significant differences between the two groups in the occurrence of pneumonia, icu mortality or until day 28 [table 2 ]. we conducted a randomized controlled clinical trial comparing early nutrition nasojejunal with a nasogastric tube in critically ill - patients. furthermore, there were no differences in rates of vomiting or gi complications ; duration of mv or hospitalization ; and mortality rate. our findings showed that jejunal nutrition did not reduce mortality, duration of mv or icu stay. however, guidelines and experts in nutrition recommend routine use of the jejunal tube when possible, because of potentially beneficial effects on two outcomes, reduced risk of pneumonia and improvement in the delivery of nutrition. we evaluated the risk of pneumonia and did not confirm the beneficial effect of jejunal tube on this outcome. several previous studies found no differences in rates of pneumonia when compared jejunal to gastric nutrition. davies. studied 180 patients randomized to receive feeding via nasogastric or nasojejunal tube and found no difference in the risk of ventilator associated pneumonia. our study did not study only mechanically ventilated patients yet > 80% of them underwent mv. other studies suggest that the incidence of pneumonia can be reduced when nutrition is delivered via nasojejunal tube. a recent meta - analysis concluded that the combined studies using postpyloric feeding as the preferred route shows a decrease in the incidence of pneumonia. however, the results of the studies included in this meta - analysis do not make clear whether the rate of aspiration pneumonia, which would be more related to the place of delivery of nutrition, is actually increased and therefore there is no consensus that the postpyloric position is effective in reducing the incidence of pneumonia. in addition furthermore, this meta - analysis did not include the study of davies. the differences may be explained in part by the different ventilator - associated pneumonia diagnosis criteria between studies and also by the insufficient number of patients to reach statistical significance. gastric intolerance manifested as an increased gastric residual and risk of vomiting would be the main explanation for an increased risk of aspiration and therefore pneumonia. the occurrence of vomiting was common in both groups, reflecting the decreased gastric motility, but the delivery of nutrition on jejunal position has not decreased vomiting or other gi complications. the volume of gastric residual in our study was not assessed, which can be considered an important limitation. however, as noted earlier, there was no difference for vomiting and macroaspiration was not observed for either group. some guidelines and researchers suggest that tube feeding in postpyloric position in critical patients would be helpful in specific situations, particularly in patients with pancreatitis and gastric stasis as these patients have higher gastric intolerance. our study did not exclude patients who might develop gastric stasis and still we did not observe differences between the two groups regarding gi complications. the subject follows controversial, and the studies conducted so far have not provided a more definitive answer. perhaps, therefore, the guidelines of the american society of parenteral and enteral nutrition, the canadian critical care clinical practice guidelines committee suggest that there is no difference between the two types of tube positioning, but recommend the use of postpyloric tube position only in certain patients as in the case of occurrence of severe pancreatitis or elevated gastric residual volume. while the european society of parenteral and enteral nutrition assumes no difference in the position of the tube. the routine use of jejunal tube results in higher cost and requires more experience and training for insertion and confirmation by radiological examination or endoscopic positioning. the strength of our study lies in the number of patients, comparable to a few studies and with similar results. however, our study has several limitations : physicians were not blinded to assess the outcomes ; nurses with different expertise performed the insertion of tubes. some specific nutrition data were not collected, such as caloric balance administration or gastric residual volume. it was also not quantified the number of episodes of diarrhea and vomiting, the report was restricted or not to the occurrence of these outcomes. furthermore, we did not evaluate the use of drugs that reduce or accelerate gi motility. we should be careful in extrapolating the study results to all our icu patients as only 16% of patients were included during the study period, and more medical patients were studied. we conclude that there is no difference in the rate of pneumonia when using the gastric or jejunal tube position. additionally, we did not observe differences in rates of gi complications, icu mortality. the routine placement of a jejunal tube in critically ill patients can not be recommended. | background and aims : studies comparing jejunal and gastric nutrition show inconsistent results regarding pneumonia. the aim of this study was to evaluate the incidence of pneumonia comparing gastric with jejunal nutrition. secondarily, we evaluated 28th day intensive care unit (icu) mortality rate and other complications related to enteral feeding.subjects:age > 18 years ; need for enteral nutrition without contraindication for placement of an enteral tube, duration of icu stay > than 48 h.methods:patients were randomly assigned to receive enteral feed via a gastric or jejunal tube. jejunal tubes were inserted at bedside and placement was confirmed radiographically.results:a total of 115 patients were enrolled, with 61 patients into the gastric tube group and 54 patients into the jejunal group tube. baseline characteristics were similar. there was no difference in pneumonia or icu mortality rates, icu length of stay and ventilator days. complications rates were similar.conclusions:we conclude that the enteral nutrition through a jejunal tube does not reduce the rate of pneumonia in comparison to a gastric tube. in addition, we did not observe differences in rates of gastrointestinal complications or icu mortality. the routine placement of a jejunal tube in critically ill - patients can not be recommended. |
micrornas (mirnas) are small non - coding rnas of approximately 19 to 25 nucleotides that post - transcriptionally regulate gene expression. they bind to the 3'-untranslated region (utr) of their target messenger rnas (mrnas) through complementary recognition, which then leads to mrna degradation or repression of protein expression (1,2). to date, over 2000 mature mirna products have been identified in the human genome and the number registered on the mirna database is still growing. more important than the expanding numbers is the complex regulatory network mediated by mirnas, which controls a spectrum of biological events ranging from cell differentiation, proliferation and homeostasis, cell - cell interactions to intracellular signalling responses (3,4,5,6). furthermore, mirnas play important roles in the development and function of innate and adaptive immune cells (7,8). many immunoregulatory genes, including transcription factors, cofactors and chromatin modifiers, are mirna targets and some even harbour binding sites for eight or more different mirnas (9). likewise, each mirna could potentially recognise many, or even up to hundreds of, target genes (4). therefore, dysfunction of mirnas or dysregulation of their expression in the immune cells would lead to immunodeficiency or autoimmunity. systemic lupus erythematosus (sle) is a potentially lethal chronic autoimmune disease, which affects multiple organ systems ranging from the skin, kidney, central nervous system, to the haematological, musculoskeletal, cardiovascular and the gastrointestinal systems (10,11,12). overall, the array of clinical manifestations in sle is intricate, suggesting that the pathogenesis of sle may involve the interplay of multiple factors. immunologically, sle is the consequence of loss of self - tolerance and amplification of self - antigen - mediated hyperactivation of t and b lymphocytes. since the discovery of mirnas, a growing attention has been drawn to their involvement in autoimmunity (13,14,15). in this review, we will first briefly summarise the key features in mirna biogenesis and how its dysregulation mediates autoimmunity. recent researches on aberrant mirnas expression in sle and current insights on mirna - mediated dysfunction of t and b lymphocytes and their contributions in the development of sle will be discussed. finally, we highlight the immunoregulatory role of mir-146a and its possible association with sle pathogenesis. the biogenesis of mirnas, as illustrated in fig. 1, starts from the transcription of unique mirna genes or intron regions of protein - coding genes by rna polymerase ii (2). the immediate transcription products are hairpin - structured primary mirnas (pri - mirnas) in various lengths. these pri - mirnas are processed into precursor mirnas (pre - mirnas) that are generally 70 to 120 nucleotides long by the microprocessor complex containing the rnase iii enzyme drosha and the dsrna binding domain protein digeorge syndrome critical region 8 (dgcr8) (16). subsequently, the pre - mirnas are transported from the nucleus to the cytoplasm by exportin 5 (xpo5) (17). in the cytoplasm, the rnase dicer excises the terminal loop of the mirna so that it turns into an 18- to 24-nucleotide duplex. the duplex is then incorporated into the rna interfering silencing complex (risc), where it is unwound into single - stranded mature mirna. the other strand, also called the star form of the mirna, is usually degraded soon afterwards. the risc is directed to the target mrna via the complementary base - pairing between the mirna and the mrna. often, the complementary base - pairing is not perfect and there are mismatches and bulges between the two strands. the fate of the target mrna is believed to be dependent on the level of complementarity. when there is near perfect or sufficient complementarity, the target mrna will be cleaved and degraded ; while in cases of insufficient complementarity, the productive translation of the mrna will be repressed instead (18). the importance of mirnas in the immune system and their association with autoimmune diseases have been demonstrated through in vitro and in vivo experiments by inactivating key enzymatic components in the mirna biogenesis. by conditionally deleting drosha or dicer in total t cells or cd4 t cells, it has been shown that mirna biogenesis is indispensable for the function and homeostasis of mature t lymphocytes, particularly in the regulatory t (treg) cell compartment (19,20,21). despite having a reduced number in mature t cells, these mice spontaneously develop inflammatory diseases in conjunction with a compromised treg suppressive activity, suggesting that these mirna processing enzymes are critical for treg function and hence self - tolerance maintenance (20). indeed, mice with dicer - deficiency specifically in treg cells (22,23) are phenotypically similar to the foxp3 knockout (ko) mice (24) and develop systemic autoimmune disease marked by lymphocytic and monocytic infiltrations in multiple organs, lymphadenopathy and splenomegaly. similarly, spontaneous dicer insufficiency in treg cells has been observed in mrl / lpr lupus mice in association with a reduced suppressive activity (25), further indicating the critical involvement of mirnas biogenesis in normal treg function. in parallel, several studies have also reported the importance of mirna biogenesis in b cell development and functions through conditional dicer - ko in early b cell progenitors, cd19 b cells or activated b cells (26,27,28,29). it is noteworthy that dicer - deficiency in the cd19 b cell compartment also promotes autoimmunity and the aged female mice exhibit a skewed antibody repertoire with significantly increased igg titres against dsdna, ssdna and cardiolipin autoantigens, as well as augmented immune complex depositions in the kidneys (26). in addition to being the cause of autoimmunity, dysregulated mirna biogenesis may also be the consequence of autoimmune conditions. intensified oxidative stress, elevated levels of proinflammatory cytokines and autoantibodies could affect the expression of mirnas by interfering key components of the mirna biogenesis machinery (30,31,32). for instance, treatment of h2o2 and type i interferon (ifn) post - transcriptionally represses protein level of dicer and leads to mirnas differential expression in three different human cell lines (30). in addition, the autoreactive anti - su antibodies in sera of patients with systemic rheumatic diseases has been found to cross - react with argonaute 2 (ago2), the catalytic core enzyme in the risc complex, and potentially affecting the mirna synthesis in autoimmune conditions (31,32). taken together, interrupted mirna biogenesis strongly associates with autoimmunity and possibly plays a role in promoting disease progression through reciprocal interactions between the major processors of the mirna pathway and their targets. comprehensive analysis on the expression profiles of mirnas have revealed intriguing patterns and shown to be beneficial in human cancer research (33). similarly, studies on immune cell - derived or circulating mirnas expression profiling in patients with sle is likely to provide useful information for understanding sle pathogenesis or for developing prognostic biomarkers and novel therapeutics. table i summarises several reports from 2007 to 2013 on systematic analysis of mirna profiling in sle patients in comparison with healthy individuals. collectively, there is a lack of distinct pattern in specific dysregulated mirna expression in sle among the reviewed studies. variations in the ethnicity of research subjects, the sizes of screened population and the types of biological sample tested as well as the detection methods could contribute to the discrepancies in the mirnas identified in different studies. for instance, sle serum mir-223 level was found to be increased in the study by wang and colleagues (34), but significantly decreased in patients with active lupus nephritis in the study by carlsen. notably, the latter study collected patient samples mostly from the european ancestry while the former one from the chinese population. potentially, biological samples collected from different ethnic groups, patients recruited at different disease stages or receiving different treatments could yield alternative expression profiles of mirnas. despite the lack of consistency in specific dysregulated mirnas among the profiling studies, there are commonalities in the effector or functional outcomes resulting from the altered mirna expression. firstly, mirnas with the greatest change of expression in peripheral blood mononuclear cells (pbmcs) from lupus patients may target the key components of a common pathway, the type i ifn signalling cascade (36,37). the under - expression of mir-146a has been found negatively correlated with sle disease activity and ifn scores (36). at the molecular level, mir-146a targets irf5 and stat1 (36) which are important transcription factors related to ifn signalling. in a separate study, bioinformatics analyses have revealed several ifn signalling mediators and ifn - inducible genes as the potential targets of five mirnas with major changes in sle pbmcs and lupus patients - derived cell lines (37). type i ifn is recognised as the central player in sle pathogenesis from the striking correlation between the dysregulated type i ifn - inducible gene expression pattern and sle disease activity, also known as the " ifn signature " of sle (38,39,40). therefore, the commonly affected ifn - related pathway indicates the essential roles of distinct groups of mirnas in sle pathogenesis. secondly, profiling studies on pbmcs as well as purified t cells have also highlighted the significance of mirna dysregulation leading to t cell hyperactivity in sle (41,42,43,44). functional studies on lupus t cells further reveal common regulatory patterns by various mirnas (table i) and this will be discussed in the later section. overall, although it is difficult to identify a stable, specific and sensitive " mirna signature " for sle at the current stage, it may be possible to pinpoint distinct groups of dysregulated mirnas according to their shared functional consequences in sle. together with advance technologies, systematic and stringent sample selection, followed by independent validation of individual mirnas, a more representative disease - related mirna profile should promote a better diagnostic and/or therapeutic use in sle. in sle, mirna - mediated dysregulation has been studied mostly in t cells, one of the major cellular effectors of the disease. many of these studies focus on the mechanism(s) mediated by individual mirna which effects in t cell hyperactivity or abnormality. in general, there are several ways that various mirnas bring about the regulatory effect co - operatively. notably, different dysregulated mirnas can target the same molecules to maximize inhibition efficiency. for instance, mir-126 and mir-148a have been found up - regulated in sle t cells, and albeit binding to different regions, they both directly target dna methyltransferase 1 (dnmt1) (43,45), the key methyltransferase for maintaining dna methylation during replication. indeed, lupus patients could have a reduced dnmt1 expression (46) and an abnormal global dna hypo - methylation in t cells, which is a major epigenetic trait in sle (46,47,48). remarkably, dnmt1 also serves as an excellent example to illustrate how various mirnas act in concert on different molecular targets to achieve the same effector outcome(s). overexpression of mir-21, mir-148a (45), mir-126 (43) and mir-29b (49) have been independently reported to positively correlate with dna hypomethylation in lupus cd4 t cells through the inhibition of dnmt1. the suppression is mediated either by directly targeting dnmt1 mrna protein coding region or 3'-utr (43,45), indirectly through the suppression of its transactivator sp1 (49), or even further upstream of dnmt1 through regulation of rasgpr1 via the ras - mapk pathway (45). in these studies, the effector outcomes were the increased expression of cd11a and cd70 (43,45,49), both of which are methylation sensitive genes associated with sle pathogenesis (48), and contributed to the exaggerated t cell responses such as t - cell assisted igg production by plasma cells (43). thus, these mirnas may regulate other lupus - associated and methylation - sensitive components which are yet to be identified. significantly, suppression of mir-21, mir-148a and mir-29b in lupus t cells could restore the normal phenotypes to a certain extent, further indicating their pathogenic involvement in sle (45,49). among the up - regulated mirnas associated with sle, mir-21 has been identified in several studies (44,45,50) and a strong correlation with sledai score has been reported (44). in t cells, mir-21 regulates multiple pathways that lead to overall t and b cell hyperactivity. apart from dnmt1 as described above, mir-21 also directly suppresses the selective protein translation inhibitor pdcd4 expression, leading to an enhanced proliferation, increased il-10 and cd40l expression in lupus cd4 t cells, and in turn promoting the differentiation of plasma cells and igg production (44). similar regulatory pathway has been observed in macrophages where mir-21-mediated suppression of pdcd4 favors the production of il-10 upon tlr-4 stimulation via nf-b pathway (51), supporting the idea that mir-21 may promote inflammation through suppression of negative regulatory mediators. the perturbed lupus t cell functions are regulated by the synchronized down - regulation of several specific mirnas too. it is interesting to note that the reduced expression of mir-142 in lupus cd4 t cells mediates similar outcomes as in the case of mir-21 overexpression. reduced mir-142 - 3p/5p expression in sle cd4 t cells has been found inversely correlated with the expression of their putative targets including slam - associated protein (sap), cd84 and il-10 (52). functionally, inhibition of mir-142 - 3p/5p in normal cd4 t cells leads to over - activation as marked by elevated levels of il-4, il-10, as well as cd40l and icos protein expression. these mir-142 - 3p/5p - suppressed t cells could further promote b cell hyperactivity resulting in a higher igg production while the mir-142 - 3p/5p - transfected lupus cd4 t cells exhibit the reverse phenotypes (52). although it is not clear whether sap and cd84 are the direct molecular targets of mir-142, they are important components for optimal t- and b - cell interaction and are critical for productive igg response (53). the essential role of sap in lupus has been demonstrated in sap - mutated mrl / lpr mice which display a repressed development of autoantibodies, splenomegaly and lymphadenopathy (54). the aberrant production of cytokines and chemokines in sle t cells t cells from sle patients produce remarkably low amounts of il-2 upon activation (55), which is crucial for treg cells maintenance (56). many regulatory factors, including mirnas, contribute to the reduced il-2 production in lupus patients. a recent report has demonstrated that the significant reduction in mir-31 expression in sle t cells is positively correlated with the lowered il-2 production (57). while transfection of mir-31 mimics increases the production of il-2, the knockdown of endogenous mir-31 reduces il-2 expression in primary t cells. further bioinformatics analyses and luciferase reporter assays have revealed that mir-31 could enhance il-2 promoter activity through suppressing the expression of rhoa (57) and the kinase suppressor of ras 2 (ksr2) (58). the former is a small gtpase that negatively regulates nuclear factor of activated t cells (nfat) for il-2 transcription (59), and ksr2 is a repressor factor of ras2 kinase which is an upstream component in t cell activation (58). interestingly, mir-31 (and also mir-125a) has been identified as a signature mirna for human natural (n)treg cells due to its specific down - regulated expression (60). in vitro studies have shown that mir-31 negatively regulates foxp3 expression by binding directly to its potential target site in the 3'-utr, and that the overexpression of mir-31 in ntreg cells can lead to suppression in foxp3 expression. whether through down - regulation of il-2 production or foxp3 suppression, the physiological role of mir-31 in treg maintenance in sle, however, requires further investigation. likewise, the role of mir-125a down - expression in ntreg cells is not clear. yet, its under - expression in sle cd4 t cells is apparently affecting cc chemokine ligand 5 (ccl5, also known as rantes), an inflammatory chemokine whose level was found elevated in sera of sle patients (61,62). showed that the reduced mir-125a in lupus pbmcs was mainly contributed by cd4 t cells and was associated with an increased in kruppel - like factor 13 (klf13) (61), a key component of a regulatory complex controlling the expression of rantes in t cells (63). significantly, a rescued expression of mir-125a in lupus cd4 t cells by transfection could alleviate the elevated rantes expression, which likely resulted from the direct targeting of the 3'-utr of klf13 (61). direct damages caused by autoantibodies and immune complexes in the inflamed tissues are the characteristic features in sle. long - lived and hyperactive b cells are the major sources for autoantibodies. unlike t cells, there are fewer studies that systematically report mirna dysregulation in lupus b cells. liu and colleagues have reported a direct interaction between mir-30a and the 3'-utr of lyn mrna in association with dysregulated b cell functions in sle patients (64). lyn, a key negative regulator of b cell activation, is significantly down - regulated in lupus b cells (65) and the defective lyn expression is associated with b cell spontaneous proliferation and anti - dsdna autoantibody production (66). indeed, the dramatic increase of mir-30a expression in cd19 b cells from sle patients negatively correlates with the expression of lyn, and the mir-30a overexpression increases b cell proliferation and igg production through the inhibition of lyn (64). similarly, mirnas may also affect functions of activated b lymphocytes by interacting with another critical enzyme, the activation - induced cytidine deaminase (aid) which initiates and regulates b cell secondary antibody diversification through somatic hypermutation and class switch recombination (67,68). aid - deficiency in the lupus - prone mrl / lpr mice has led to a complete reduction of anti - dsdna igg and a significant increase in animal survival with delayed nephritis development (69), indicating the pathological roles of aid in sle. subsequent studies have revealed that mir-155 and mir-181b are the negative regulators of aid (70,71,72), both of which have conserved binding sites in the 3'-utr of aid mrna. overexpression of mir-181b in activated b cells leads to down - regulated mrna and protein levels of aid (72). splenic b cells from mice with disrupted mir-155-binding site in aid mrna have a faster and higher aid expression in response to lps and il-4 stimulation (71). in addition, the induction of igg3, igg1 and igg2a upon lps, lps with il-4 or lps with ifn respectively indicated an increased class switching in b cells from these mice in vitro. interestingly, despite its negative regulatory role on aid, mir-155 has been found upregulated in splenic b cells from mrl / lpr lupus mice (73) and deletion of mir-155 in the b6-fas mice results in a reduction of class switched igg antibodies (74). since there are fewer studies on the expression or function of mir-181b in lupus b cells, it remains unclear how mir-155 and mir-181b, and possibly other mirnas, synergistically regulate the function of aid, leading to the development of sle. recently, a study using ifn - accelerated lupus mouse model has revealed the specific effect of mir-15a in regulatory b cell subsets and autoantibody production (75). in this study, ifn administration to the nzb / w f1 lupus mice could promote proteinuria development in association with an increase in splenic and plasma mir-15a expression, which in turn correlated positively with anti - dsdna antibody level. intriguingly, there was a concomitant decrease in immunosuppressive b-10 cells which expressed high level of mir-15a. in addition, mir-15a expression in conventional b-2 cells increased and superseded the level in regulatory b-1 cells as the disease progressed, suggesting that mir-15a may have a regulatory role in balancing different b cell subsets.. mice deficient in mir-146a manifest severe auto immune phenotypes with elevation of autoantibodies, splenomegaly, lymphadenopathy as well as exaggerated immune responses towards lps challenge (76). in sle, mir-146a dysregulation is associated with perturbed ifn responses. in patients, mir-146a down - regulation in pbmcs negatively correlates with disease activity and ifn scores as marked by the elevated expression of signature genes such as ly6e, oas1 and mx1 (36). ifn regulation by mir-146a in pbmcs is likely mediated by direct interference with two ifn - related transcription factors irf5 and stat1. on the other hand, mir-146a has also been shown to negatively modulate type - i ifn production in macrophages through targeting tlr signaling molecules traf6, irak1 and irak2 (77). interestingly, tlr7/9 stimulation in normal pbmcs induces mir-146a expression (36), which likely serves as a negative feedback loop for normal ifn response. a recent genetic analysis has identified a novel genetic variant (rs57095329) in the promoter region of mir-146a which confers association with its expression level (78). the sle risk - associated g allele of the variant is linked to a reduced mir-146a expression in pbmcs, possibly by lowering the protein binding affinity and activity of the promoter. further in vitro analyses have revealed a reduced binding of ets-1, another sle - susceptibility associated transcription factor, to the risk variant, suggesting that the combined effect of at least two risk factors may contribute to the reduced mir-146a expression in sle (78). mir-146a is often bundled with tlr7/9 stimulation, which plays a central role in sle pathogenesis. apart from pbmcs, tlr7/9 stimulation in plasmacytoid dendritic cells (pdcs) also induces mir-146a expression (79). of relevance, despite its scarcity in peripheral blood, pdcs have been implicated for an essential role in sle disease amplification by its unique ability to produce large amount of type - i ifn upon tlr7/9 stimulation (80). two recent studies have indeed suggested mir-146a as a key regulator in pdc survival and functions. first, lentivirus - transduced overexpression of mir-146a in the cal-1 pdc cell line has resulted in increased cell apoptosis, impaired tlr7-induced co - stimulatory molecules, ifn- and il-6 expression, as well as decreased capability of pdcs to drive cd4 t cells proliferation (79). in another study, charrier. have observed a much higher expression of mir-146a (and mir-155) in human umbilical cord blood (ucb) pdcs when compared to adult blood pdcs (81). this higher mir-146a expression in ucb pdcs was associated with a reduced expression of tlr9/irf7 pathway proteins, namely tlr9, myd88, irak1 and irf7, and in turn resulting in a lower production of ifn- upon tlr-9 activation. taken together, mir-146a likely plays a negative modulatory role in pdc survival and functions. interestingly, we have previously reported a significant increase in frequency of pdcs with enhanced t cell stimulatory activity in sle patients (82,83). whether mir-146a down - regulation is involved in the pathogenic development of pdc abnormalities in sle is yet to be verified. since the discovery of mirnas, they have caught immediate attention for their fundamental role in fine - tuning immune cell development as well as adaptive and innate immune responses. to date, majority of the studies have highlighted the regulatory mechanism(s) of specific mirnas in contributing to cellular dysfunction in sle. the therapeutic potential of mirna modulation has also been tested in some animal models of lupus. in bxsb lupus - prone mice, mir-146a restoration by a novel recombinant virus - like - particles (vlps) approach has been shown to ameliorate sle progression (84). ms2-mir-146a vlps therapy has led to a drastic reduction in autoantibodies, total igg and proinflammatory cytokines levels in these mice. conversely, in vivo silencing of mir-21 by a tiny - targeting locked nucleic acid (lna) nucleotides approach has also yielded favourable outcomes in the b6.sle123 lupus mice. for instance, the splenomegaly can be reversed and the expression of the mir-21 target, pdcd4, as well as the frequency of fas - expressing lymphocytes in these lupus mice were also decreased (85). conceptually, lupus disease modulation by mirna manipulation is feasible but the potential application in human awaits more evidence in the clinical settings. as the sanger mirbase sequence database expands rapidly, comprehensive bioinformatics tools for mirnas is needed to facilitate the analysis of the highly intricate regulatory networks. " mirnomics " have already been applied in advanced investigation on cancer research as well as autoimmune diseases like multiple sclerosis (86). while characterisation of mirna expression patterns in sle patients can be of potential diagnostic use, discoveries in cell type - specific mirna expression profile during disease progression may provide a further understanding for sle immunopathogenesis. indeed, a recent study has examined the mirnomes of mouse bone marrow - derived dcs at different stages of development, maturation and differentiation, and eventually pinpointing mir-30b as a negative regulator in immune responses (87). although there is not a mirnomic study specifically on sle pathogenesis yet, tracking the spatial and temporal regulation of mirna expression along with lupus development seems to be an attractive approach to facilitate further understanding of such a complicated disease. hopefully, notions gathered in this review could provide clues for future investigations on sle aetiopathology as well as novel mirna - based therapies. | micrornas (mirnas) are endogenous small rna molecules best known for their function in post - transcriptional gene regulation. immunologically, mirna regulates the differentiation and function of immune cells and its malfunction contributes to the development of various autoimmune diseases including systemic lupus erythematosus (sle). over the last decade, accumulating researches provide evidence for the connection between dysregulated mirna network and autoimmunity. interruption of mirna biogenesis machinery contributes to the abnormal t and b cell development and particularly a reduced suppressive function of regulatory t cells, leading to systemic autoimmune diseases. additionally, multiple factors under autoimmune conditions interfere with mirna generation via key mirna processing enzymes, thus further skewing the mirna expression profile. indeed, several independent mirna profiling studies reported significant differences between sle patients and healthy controls. despite the lack of a consistent expression pattern on individual dysregulated mirnas in sle among these studies, the aberrant expression of distinct groups of mirnas causes overlapping functional outcomes including perturbed type i interferon signalling cascade, dna hypomethylation and hyperactivation of t and b cells. the impact of specific mirna - mediated regulation on function of major immune cells in lupus is also discussed. although research on the clinical application of mirnas is still immature, through an integrated approach with advances in next generation sequencing, novel tools in bioinformatics database analysis and new in vitro and in vivo models for functional evaluation, the diagnostic and therapeutic potentials of mirnas may bring to fruition in the future. |
down syndrome is popularly known as trisomy 21, because it is a genetic disorder caused by a presence of all or part of a third copy of chromosome 21, patterson. globally, as of 2010, down syndrome occurs in about 1 per 1000 live births and results in about 17,000 deaths. most of the hospitals in bangladesh do not have any facilities to confirm the diagnosis of down syndrome using genetic sequencing. thus, we often rely on clinical diagnosis of down syndrome. children with down syndrome are more likely to have multiple health problems than the general population. some of these problems are associated with failure to thrive leading to life threatening serious illness. it is therefore important to be aware of conditions involved and of their presenting symptoms and management. although diarrhea may be a common comorbidity in down syndrome children under 5 years, little is known about such population. like other hospitals of bangladesh and in other developing countries, the case - load of clinically diagnosed down syndrome children having diarrhea is not uncommon at the dhaka hospital of the international centre for diarrhoeal disease research, bangladesh (icddr, b), the only international organization that works on diarrhea disease research. however, there is no published data on the factors associated with clinically diagnosed down syndrome children having diarrhea. identification of factors associated with clinically diagnosed down syndrome and diarrhea in such population may help to reduce morbidity and deaths in resource poor settings. thus, the aim of our study was to describe our experience with down syndrome patients admitted with diarrhea by identifying the factors associated with clinically diagnosed down syndrome in diarrheal children. in this chart review, data were analyzed anonymously ; thus, no parental or ethical consent was required. this was a retrospective chart review that was conducted at the dhaka hospital of icddr, b using electronic database of the hospital (sheba). we used an unmatched case control design and enrolled 8422 diarrheal children of both sexes, aged 059 months, who were admitted to the intensive care unit (icu), high dependency unit (hdu), or longer stay ward (lsw) of the hospital from march 2011 to february 2013. children with clinically diagnosed down syndrome presenting with diarrhea constituted the cases and randomly selected diarrheal children without down syndrome constituted controls. controls were randomly selected by computer randomization using spss (version 17.0 ; spss inc., chicago) from a computerized data source of icddr, b. we used 1 : 3 unmatched case control ratio to increase the statistical power of our analyses. we defined down syndrome clinically if a child had at least seven of the following clinical features : mental impairment, stunted growth, low muscle tone, depressed nasal bridge, slanted eyes, large protruding tongue, abnormal outer ears, wide gap between first and second toes, shortened head and neck, simian crease, and high arch palate. diarrhea was defined if a child had three or more abnormally loose or watery stools per 24 hours, and status of dehydration was defined by dhaka methods of assessment of dehydration that is almost similar to who method and approved by who. the description of the study site (dhaka hospital of icddr, b) has been described in our previously published article. management of the diarrheal children with down syndrome was done symptomatically ; that is, management of pneumonia, sepsis, severe cholera, dysentery, severe malnutrition, and other bacterial infections was done following the hospital 's guidelines. the babies with down syndrome were referred to shishu bikash kendro of dhaka shishu hospital or bangabandhu sheikh mujib medical university hospital for further management and developmental rehabilitation. characteristics analyzed included sociodemographic (age, gender, height and weight, type of residence, source of drinking water, and formula feeding), clinical signs (dehydration and temperature), clinical diagnosis (sepsis, pneumonia, chronic lung disease, pulmonary tb, severe acute malnutrition, congenital heart diseases (chd), motor developmental delay within 059 months (neck control, sitting, standing with or without support, and walking), hypothyroidism, hospital acquired infection (hai) [9, 10 ]), and outcome during discharge. sepsis was defined as presence or presumed presence of infection with hypothermia (35.0c) or hyperthermia (38.5c), tachycardia, tachypnea, and abnormal wbc count (> 11 10/l or < 4 10/l or band and neutrophil ratio 0.10) [11, 12 ]. additionally, there may have been altered organ function such as altered mental status and bounding pulse in absence of clinical dehydration or after correction of dehydration. pneumonia was initially diagnosed clinically following the world health organization recommended classification of pneumonia and was confirmed with radiologic evidence of consolidation or patchy opacities. chronic lung disease was defined if there was moist cough for more than 4 weeks with recurrent chest infections, exertional dyspnea, and growth failure with or without the presence of clubbing, chest wall deformity, adventitious sounds on chest auscultation, and/or hyperinflation. severe acute malnutrition was defined as severe wasting (z score for weight for height / length, < 3 of the median of the who anthropometry), severe underweight (z score for weight for age, < 3 of the median of the who anthropometry), or nutritional edema. pulmonary tuberculosis was diagnosed with supportive evidence such as positive tuberculin skin test or a positive contact history with a sputum positive tuberculosis patient plus if there was no improvement of signs of pneumonia or status of severe malnutrition following standard treatment plus even without microbiological confirmation of tuberculosis follow - up improvement with antitubercular therapy. chd was clinically diagnosed with auscultatory murmur heard by using stethoscope over cardiac area of the chest and was confirmed by echocardiography. common chd were atrioventricular septal defect or ventricular septal defect, mitral valve problems, tetralogy of fallot, and patent ductus arteriosus. hypothyroidism was initially diagnosed clinically with any five of the following : history of feeding difficulties, failure to thrive, history of prolonged jaundice after birth, history of constipation, floppiness, large fontanelles, macroglossia, and cold mottled skin in the extremities and the diagnosis was confirmed by measuring tsh or thyroxine level in blood [1719 ]. the identification of blood isolates and the susceptibility testing were done with the routine methods at the microbiological laboratory. blood culture and serum electrolyte all data were entered into spss for windows (version 17.0 ; spss inc., chicago) and epi - info (version 6.0, usd, stone mountain, ga). normally distributed data differences of means were compared by student 's t - test and mann - whitney test was used for comparison of data that were not normally distributed. strength of association was determined by calculating odds ratio (or) and their 95% confidence intervals (cis). the cases more often presented with developmental delay, congenital heart disease, hypothyroidism, severe acute malnutrition (sam), sepsis, and lower serum calcium level compared to the controls. during hospitalization the cases all other variables among the cases and the controls shown in table 1 were comparable. this study, though weakened by limited sample size, was able to describe our experience with down syndrome patients admitted with diarrhea by identifying different associated factors for clinically diagnosed down syndrome in diarrheal patients aged 059 months. our observation of association of severe acute malnutrition, developmental delay, congenital heart disease, sepsis, hypothyroidism, and hypocalcemia on admission and prolonged hospital stay and hai during hospitalization with down syndrome in diarrheal patients is not surprising but needs to be reported for the better clinical management of such children. developmental delay was found to be strongly associated with down syndrome in diarrheal children and the finding is consistent with previous study conducted in children without diarrhea. although there is a lack of evidence on the relationship between diarrhea and chd, in this study, we have found strong association between chd and down syndrome in diarrhea patients. in our study we found 53% babies had chd among down syndrome and the observation is consistent with previous data which showed that the prevalence of chd in children with down syndrome involving nondiarrheal children was 4050% [22, 23 ]. thus, developmental delay, failure to thrive, and chd might have an impact in contributing to sam. our observation of association of sepsis and other infections (such as diarrhea and pneumonia) with down syndrome in diarrheal children compared to those without down syndrome is also understandable. this is probably due to the fact that children with down syndrome in developing countries invariably present with sam, that is, associated with immunosuppression, and often become prone to severe form of infection such as pneumonia, diarrhea, and sepsis [25, 26 ]. our observation of the association of hypothyroidism with the diarrheal children having down syndrome is also understandable. in our study we found 9.3% babies had thyroid dysfunction among down syndrome whereas the prevalence of thyroid disease with down syndrome in previous studies involving nondiarrheal children was 418% [1719, 23, 2729 ]. hypocalcemia used to occur mostly in children suffering from diarrhea and/or sam as in our study. although no published data were found on the association of hai and prolonged hospitalization with down syndrome in diarrheal children, the observation is quite understandable. in our study, diarrheal children with down syndrome were observed to have had association with severe acute malnutrition, developmental delay, sepsis and various infections. due to management of their multiple ailments, these children required to stay in the hospital for longer period which is strongly associated with hai [31, 32 ]. the limitation of the study is the lack of genetic sequencing in diagnosing the children with down syndrome. another limitation is the small sample that might have an impact of the lesser association of other factors. our data of down syndrome in diarrheal children and the published data in nondiarrheal children suggest that the presentations of down syndrome are almost similar in diarrheal and nondiarrheal children. down syndrome in diarrheal children was found to have an association with severe acute malnutrition, congenital heart disease, hypothyroidism, developmental delay, sepsis, and hypocalcemia on admission. thus, clinicians may look for these simple clinical parameters in clinically diagnosed down syndrome children with diarrhea for their prompt management that may prevent prolonged hospitalization as well as hospital acquired infection. | there is lack of information in the medical literature on clinically diagnosed down syndrome children presenting with diarrhea. our aim was to describe our experience with down syndrome patients admitted with diarrhea by evaluating the factors associated with down syndrome presenting with diarrheal illness. in this retrospective chart analysis, we enrolled all the diarrheal children aged 059 months admitted to the dhaka hospital of the international centre for diarrheal disease research, bangladesh (icddr, b), from march 2011 to february 2013. down syndrome children with diarrhea constituted cases and randomly selected threefold diarrheal children without down syndrome constituted controls. among 8422 enrolled children 32 and 96 were the cases and the controls, respectively. median age (months) of the cases and the controls was comparable (7.6 (4.0, 15.0) versus 9.0 (5.0, 16.8) ; p = 0.496). the cases more often presented with severe acute malnutrition, developmental delay, congenital heart disease, hypothyroidism, sepsis, hypocalcemia, developed hospital acquired infection (hai) during hospitalization, and required prolonged stay at hospital compared to the controls (for all p < 0.05). thus, diarrheal children with clinically diagnosed down syndrome should be investigated for these simple clinical parameters for their prompt management that may prevent hai and prolonged hospital stay. |
a team from oxford outcomes, inc., in collaboration with the american academy of orthopedic surgeons (aaos), developed a survey of orthopedic practices to determine if the orthopedic practice had onsite mri capacity, and if so the type of mri capacity (extremity or full body), the date of acquisition for the mri equipment, and general information about the practice. the survey platform was developed using sawtooth software (orem, ut ; www.sawtoothsoftware.com), web - based survey tool. a web - hosted platform was selected because of the user - friendly, interactive format, and the ability to monitor participation and data collection in real - time. on july 19, 2012, the survey was sent to practice administrators and physician aaos members by means of multiple forms of communication containing an e - mail link to the survey. two rounds of reminder communications at approximately 3-week intervals after the initial communication were used in an effort to increase participation. while the survey was in the field, the oxford outcomes team provided assistance to practices with questions about the survey. 4th, 2012, a total of 770 orthopedic practice survey responses had been received, and the survey data collection was considered complete. after closing the survey data collection process, all survey response data was downloaded into a master excel spreadsheet, and variable names were assigned to each component of the survey. preliminary data verification consisted of the following : (i) deleting duplicate entries ; (ii) converting verbatim responses (e.g., respondent states we do not own an mri) to appropriate code values for survey variable (e.g., mri = 1 for onsite mri, or = 0 for no onsite mri), (iii) converting mri acquisition dates as entered in the survey to a uniform date format (dd / mm / yyyy) ; and (iv) combining web - based survey data with the e - mailed spreadsheets containing practice provider i d numbers. duplicate responses from twenty - nine practices were eliminated, and one additional practice response was eliminated from the final survey sample due to a lack of item response for multiple key questions. thus, after eliminating duplicate surveys and a survey with mostly missing data, the final survey sample consisted of responses from 740 practices. for practices reporting that they had onsite mri capacity, the survey requested that the respondent report the number of providers in the practice authorized to order mri exams as of the acquisition date of the first onsite mri reported. all non - mri practices were asked to report the number of current providers in the practice authorized to order mri exams. unfortunately, approximately 25 percent of the 740 responding practices did not report the number of authorized providers (90 percent of these were non - mri practices). for these practices, the number of providers in the practice was imputed based on the number of unique national provider identifier (npi) numbers associated with the practice address as listed in the cms npi registry database (as of august 2012) (6). the survey response database was augmented with county - level measures of practice area characteristics as of the year of first onsite mri acquisition (or 2012 for practices without an onsite mri). the county location of each practice was assigned based on the zip code location of the primary practice location reported by survey respondents. county - level variables for the initial mri acquisition year (for mri practices) or 2012 (for non - mri practices) were obtained from the area health resources files (7). specific county - level variables added to the survey database included county per capita income, the percentage of the county population age 65 or older, the unemployment rate, and county population density. nominal per capital income for each year was inflated to 2012-equivalent dollars using the consumer price index all items (8). overall, as shown in table 1, the 740 practices responding to the aaos survey reported an average of 8.3 providers authorized to order mri exams within their practice. most practices had fewer mri - authorized providers (median = 3), but the number of mri - authorized providers ranged from 1 to 138 across all practices. most of the practices in the sample were private multiple orthopedic surgeon clinics (61.2 percent) or private solo orthopedic practices (11.6 percent), whereas 9.9 percent were multi - specialty physician clinics that included orthopedic surgery as a specialty for the clinic. in terms of payer mix, for most of the practices, commercial insurance accounted for the largest share of practice revenue (median = 44.5 percent), and medicare accounted for less than 30 percent of total practice revenue for 50.8 percent of the practices. on average, medicaid and workers ' compensation insurance accounted for smaller revenue shares, though some practices reported substantial revenue shares from workers ' compensation. table 1.characteristics of survey sample practices, by onsite mri status, 2012allmrino mri[n = 740][n = 298][n = 442]number of providers mean8.313.84.5 median3.09.01.0 range (min, max)(1,138)(1,116)(1,138)practice setting (%) private practice - ortho61.2%80.5%48.2% private practice - multi9.9%11.7%8.6% private practice - solo11.6%1.3%18.6% academic practice5.5%2.7%7.5% hospital8.0%2.4%11.8% other / no response3.8%1.4%5.4%region (%) northeast15.7%11.4%18.6% midwest18.4%19.5%17.6% south35.9%40.9%32.6% west30.0%28.2%31.2%payer mix (% practice revenue) medicare zero4.3%1.0%6.6% 0.1 - 19.9%18.4%20.5%17.0% 20 - 29.9%28.1%34.6%23.8% 30 - 39.9%23.0%28.9%19.0% 40%+21.9%15.1%26.5% no response4.3%0.0%7.2% medicaid zero28.1%21.1%25.9% mean6.8%4.9%8.2% median4.9%3.0%4.9% commercial zero2.4%1.0%3.1% mean43.9%48.0%40.8% median44.5%49.8%39.5% workers ' compensation insurance zero7.9%3.7%11.0% mean13.4%12.4%14.1% median10.0%10.0%9.5%source : aaos survey data, 2012. characteristics of survey sample practices, by onsite mri status, 2012 source : aaos survey data, 2012. in the survey sample, 298 (40 percent) of the 740 practices reported having one or more onsite mri, whereas 442 (60 percent) indicated they had no onsite mri as of september 2012, as shown in table 1. the number of providers authorized to order mri exams within the practice was substantially different between the practices with onsite mris and those without an onsite mri. specifically, the mri practices had on average 13.8 mri - authorized providers in the practice, compared with an average of 4.5 providers for the non - mri practices (p 1010.77<.0029.03<.0018.74<.001setting private - ortho7.75<.0017.30<.001 private - multi5.64<.0015.89<.001 otherreference reference region northeast0.988.162 midwest1.010.159 south0.988.198 westreference area characteristics per capita income0.616.137 pop age 65 + (%) 0.898.718 unemployment (%) 1.074.770 population density1.000.546source : aaos survey data, 2012 ; area health resources files (various years). logistic regression model estimates of factors associated with practice acquisition of onsite mri capacity [n = 740 ] source : aaos survey data, 2012 ; area health resources files (various years). the logistic model results indicate that practice size (defined as number of physicians or other providers authorized to order an mri exam affiliated with the practice) had a substantial impact on the likelihood of onsite mri acquisition among the aaos survey respondents. specifically, practices with more than ten providers were 8.7 to 10.8 times more likely to acquire an onsite mri compared with practices with less than three providers (p <.01). similarly, practices with six to ten providers were approximately 4.5 times more likely to acquire an onsite mri compared with practices with less than three providers (p <.01). the type of practice organization or setting also influenced the likelihood of onsite mri acquisition. orthopedic surgery specialty practices (consisting of more than 1 orthopedic surgeon) were 7.3 times more likely to acquire an onsite mri compared with providers in other practice settings, a reference category including solo practice or hospital - based practice (p <.01). in contrast, geographic region and county - level characteristics of the practice location did not appear to have had any substantial influence on the likelihood of onsite mri acquisition among the sample of practices in the aaos survey data. among the 740 aaos orthopedic practice survey respondents, a total of 298 (40 percent) reported offering onsite mri services. this suggests that the majority of orthopedic practices did not have onsite mri capacity as of mid-2012. however, because orthopedic practices with onsite mris were much larger than non - mri practices (in terms of number of providers), a majority of orthopedic surgeons were in practices with an onsite mri. nonetheless, a substantial minority of orthopedic surgeons were in practices without an onsite mri as of mid-2012. the geographic distribution of survey - reported mri practices generally is consistent with the geographic distribution of the population across states. however, a few states with relatively small populations but with numerous popular ski resorts (montana, idaho, utah) tend to have more mri practices in the sample than expected given state population, perhaps due to high rates of ski - related orthopedic injuries in those states. some states with relatively large populations (massachusetts, new jersey, ohio) have relatively few mri practices in the survey sample, whereas some smaller states have numerous mri practices in the sample (north carolina). given that the stark laws only apply to patients covered by medicare or medicaid, the payer mix for a practice might be expected to influence the decision to acquire onsite mri capacity. however, as reported in table 1, differences in payer mix for mri and non - mri practices were relatively modest. the mean of the reported medicare payer share was almost identical for mri and non - mri practices in the sample, but with a greater variance for non - mri practices. the mean reported medicaid revenue share was greater for non - mri practices comparted to mri practices (8 percent and 5 percent, respectively), whereas mri practices reported a higher share of revenue from privately insured patients. thus, it does not appear likely that practices acquiring onsite mri capacity did so to take advantage of the ioas exception given large medicare and medicaid practice revenue shares. the relatively smooth trend in onsite mri acquisition over time shown in figure 1 suggests that onsite mri acquisition was motived by an organic, evolutionary process, and not by discrete changes in payer payment policy. for example, ongoing enhancements in mri technology over this period contributed to revisions in authoritative treatment guidelines, which enhanced the role of mri exams in the evaluation and treatment of many orthopedic conditions (12;13). similarly, over this time period there was steady growth in the number of physicians in physician practices (14;15). together, these factors are likely to have increased the expected volume of use for onsite mri capacity within many practices, thereby improving the economies of scale for onsite mri capacity. finally, the survey results indicated that, at any particularly point in time, practices with a large number of providers, or many providers likely to use mri in their practice (e.g., orthopedic specialty practices), were more likely than other types of practices to acquire onsite mri capacity. this is consistent with factors influencing the classic make or buy decision in organizations (16). specifically, in practices with providers who are likely to use mri exams, the practice can reduce transaction costs by making mri exams within the practice (by means of onsite mri capacity) relative to referring patients to external mri service providers (i.e., buying mri exams from others). this fundamental difference between mri and non - mri practices also suggests that simple cross - sectional comparisons of mri volume for mri and non - mri practices will be uninformative regarding the magnitude of any causal effect of onsite mri acquisition on the volume of mri exams. specifically, practices likely to acquire onsite mri capacity would tend to have had a substantially greater volume of mri exams both before and after mri acquisition, compared with practices unlikely to acquire an onsite mri. thus, a spurious positive association between the presence of onsite mri capacity and mri volume is likely in cross - sectional comparisons. future research assessing the impact of onsite mri on mri volume should strive to make use of panel data on practice mri volume for periods before and after mri acquisition for mri practices and for appropriate non - mri comparison practices over the same period. first, the survey response rate was relatively low, and the responding practices may not be representative of all orthopedic practices in the united states. although the survey sample appears to be representative in terms of the geographic distribution of survey practices, if the sample is not representative of all orthopedic practices in other dimensions, the comparisons of characteristics of mri and non - mri practices, and the timing of mri acquisition reported here, may not be valid indicators for all orthopedic practices. the mri practices were asked to list provider characteristics at the time of their first onsite mri acquisition, whereas the non - mri practices were ask to list current (2012) provider characteristics. thus, survey responses relating to practice size are not contemporaneous across mri and non - mri practices. if orthopedic practices in general have become larger over the past decade, the survey results could understate differences in practice size for mri and non - mri practices, as the non - mri practices would be likely to have been smaller at the time the mri practices first acquired an onsite mri (compared with their size in 2012). however, for the mri practices, the survey relied on recall by the survey respondents about the number of providers associated with the practice at the date of the first onsite mri acquisition. it is possible that mri practice respondents might have ignored the survey instructions and reported the number of providers associated with the practice at the time of the survey (2012). to the extent this occurred, the practice size of mri practices at the time of first mri acquisition could be overstated (given that orthopedic practices generally have become larger over time). indeed, using the 2012 npi file to impute practice size for mri practices regardless of reported mri acquisition year yields a somewhat larger average practice size compared with the average for the actual survey responses. this suggests that at least some of the mri practices attempted to follow the survey request to report the number of providers at the time of the first mri acquisition. even if many mri practices reported their current number of providers, the practice size measurement for mri practices would be more contemporaneous with the timing of measurement for non - mri practices. finally, the results reported here are based on a survey of orthopedic practices located within the united states. given that the pattern of onsite mri acquisition over time was undoubtedly affected by specific features of the healthcare system in the united states, the results may not be directly applicable to the patterns of mri acquisition in countries with very different health system features. a companion analysis to this study, which compared medicare claims data for physicians in the mri - acquiring practices before and after the mri acquisition date to physicians in matched non - mri practices over the same time period, found no significant differences in the rate of change in mri usage among medicare patients (17). if mri acquisition primarily affects the site of mri administration and not overall mri volume, the overall growth in mri usage observed over this time period would have been similar without the stark ioas exemption, with growth in onsite mri capacity merely shifted to free - standing facilities. thus, a possible general implication of our findings is that regulatory efforts to control the modality of use of new technology maybe be relatively ineffective in controlling the overall availability or use of new technology. | background : despite ongoing policy debate, little is known about the growth in orthopedic surgery practices with onsite magnetic resonance imaging (mri) capacity, or practice characteristics associated with the acquisition of in - office mri equipment.methods : in july 2012, american academy of orthopaedic surgeons (aaos) member practices received a web - based survey requesting general information about their practice, such as number practice providers authorized to order mris, the type of onsite mri capacity present (if any), and the date of acquisition for the mri equipment. survey responses were augmented with county - level measures of practice area characteristics as of the year of first onsite mri acquisition (or 2012 for practices without an onsite mri).results : the survey obtained usable responses from 740 orthopedic practices, which were geographically representative of aaos member practices. forty percent (298) reported onsite mri capacity. onsite mri acquisition occurred at a steady pace over 20002012, with no dramatic increase occurring in any particular year over that period. multivariate logistic regression indicated that practice size (number of providers) was the most important factor affecting the likelihood of onsite mri acquisition. there was no association between onsite mri acquisition and any of the county - level practice area characteristics included in the analysis.conclusions : orthopedic practices acquiring onsite mri equipment on average are much larger than practices without onsite mri capacity. larger practices may be more likely to attain the economies of scale necessary to absorb the fixed costs associated with onsite mri acquisition. |
the presence of an indwelling urinary catheter (iuc) is the principal risk factor for catheter - associated urinary tract infection (cauti) development. despite the risk of prolonged catheter placement, few hospitals actively track catheterized patients, and providers are often not aware of the presence of catheters in their patients [13 ]. nurses are at the frontline of catheter care. as the providers most involved with iucs in hospitalized patients, nurses are responsible for iuc placement, day - to - day catheter management, and the removal of iucs. responsible for specimen collection, nurses play a vital role in the diagnosis of cautis. among catheterized patients, they are often the first to notice a clinical change or technical problem. despite their central role in iuc care and management, only a handful of published reports the majority of these publications have followed a quality improvement (qi) approach, at times bundled with hospital - wide policy changes [47 ]. in a recent paper by drekonja. however, reeducation of surgical nurses in urinary catheter management has shown to have a modest decrease in catheter days. gaps in knowledge may potentially impair the effectiveness nurses may play in the prevention of catheter - related complications. with a goal of increasing awareness about the presence of iucs among medical inpatients, our team developed an educational curriculum. after eliciting staff engagement by cultivating champions and involving the staff in all stages of the process, we instituted a practical, catheter - care curriculum which introduced qi concepts and incorporated principles of basic microbiology and hand hygiene to mirror established infection - control practices. the curriculum targeted aspects of catheter care within the scope of practice of nursing providers and was built on published guidelines [810 ]. the purpose of the qi project was to improve compliance with documentation of indwelling urinary catheter insertion. as a tangible application of their education, we promoted the use of the catheter labels (tags) and monitored engagement over the course of the educational sessions. nurses of the medical inpatient units of the washington dc veterans affairs medical center voluntarily participated in the initiative between april 2009 and april 2010. nursing providers were defined as registered nurses (rns), licensed practicing nurses (lpns), and clinical nurse assistants (cnas). clinical nurse leaders were invited to participate as project champions, and the educational sessions were built into existing educational time. the use of the cumulative unidentified feedback from the nurses and results from anonymous surveys was approved by our institutional review board and the research and development committee. the interdisciplinary qi team consisted of clinical nurse leader project champions, qi educator, and physician champions. at the onset of the project, the qi team organized and led several focus - groups with small groups of nursing providers of approximately 1012 participants. the focus group format consisted of open - ended questions to explore the role of nurses in catheter care. we engaged stakeholders in eliciting ideas for educational sessions and obtained invaluable perspectives that led to the design of a feasible, easily used catheter label. the iuc label (figure 1) design was adapted from existing intravenous tubing labels, familiar to our nursing staff (manufactured by united ad label, rr donnelly inc., st. the nursing staff was responsible for the tag placement, wrapping each self - adhesive label around the tubing above the catheter drainage bag. the fluorescent yellow tags were designed to be clearly visible standing at the patient 's bedside. label placement instructions were posted, and packets of labels were made accessible to nursing staff in medication - treatment rooms and mobile medicine carts. five thirty - minute educational sessions were cycled over three daily nursing shifts on our two medical floors, to maximize participation. with the support of nursing leadership participation in the case discussions, interactive segments, and surveys were voluntary for the staff. the curriculum introduced the qi process and reinforced use of iuc labels (table 1). the educational curriculum consisted of five sessions : an introduction to the project goals and iuc tags (session i), nursing role in cauti prevention (session ii), case studies (session iii), hands - on microbiology (session iv), and an educational review session (session v). there was a focus on the care of iucs in the context of a nurse scope of practice and the consequences of cautis. we referenced evidence - based guidelines to develop our didactic presentations ; we used case - based scenarios to facilitate discussion and conducted hands - on culturing of the environment. to elicit the final session featured an educational board game reviewing strategies to reduce cautis through catheter - care management and hand - hygiene guidelines. the surveys elicited feedback and provided real - time insight on the learning objectives and content using a 3-point likert - type scale (strongly agree, moderately agree, and disagree). the queries asked nurses to rate the projects workplace importance, its impact on improving patient care, and opportunities for collaboration between disciplines. individually unidentifiable responses gauged interest in the qi process, tested provider knowledge, and assessed the performance iuc identification over time. at the end of each block of educational sessions, nurses were asked to self - report their tagging behavior. the proportion of nurses reporting tagging after the introduction of the iuc tags was compared to the last block of educational sessions utilizing two - tailed chi - square test and accepting a p value of < 0.05 (spss v11, chicago, il). the qi team reinforced tagging between educational sessions with routine rounds of the medical floors. make your work count, tag a tube and let 's work together to reduce cautis. recognition of individual catheter - tagging efforts was published in monthly nursing newsletters, and results of the initiative were widely promoted at hospital - wide quality and educational fairs. nursing providers completed 152 surveys ; 76.3% were from rns including lpns and 31.6% from cnas. at baseline, a minority of participants reported prior experience in qi : only 36.2% (42/116) of rns (including rns and lpns) and 30.5% (11/36) of cnas. at the end of each block of educational sessions, survey responses were collated. among those who responded, 98.4% (121/123) felt increased qi awareness over the course of the educational sessions. in addition, 98.6% (142/144) felt the project facilitated teamwork, and 99.3% (151/152) believed that the project was important to their work. the nurses self - reported catheter - tagging increase after the introduction of the iuc tags in session i (figure 2). in the post - introduction period, we found that there was a significant increase in proportion of nurses reporting use of iuc tags (from 46.2% at the end of session ii to 84.6% at the end of session v, p = 0.001). in the dissemination of a new program, the innovators and early adopters have been implicated in the widespread adaptation of an initiative. from the onset, we targeted nurse providers in the development and implementation of the iuc label consisting of the date of catheter placement. our carefully designed educational curriculum focused on practical, primarily nurse - controlled risk - reduction interventions. we introduced several novel strategies including practical case - based discussions and fun interactive hands - on culturing of hospital surfaces, including the catheters themselves. the board - game format was popular with staff and easily promoted at hospital - wide events. we set out to change behavior through education and renewed cauti awareness in the hospital setting. in the process, we collected informal assessments of staff perceptions and self - reported behaviors. we found that the early engagement of nurses and our primary stakeholders, combined with a targeted educational interdisciplinary initiative led to increased awareness of the presence of iucs, including the concepts of qi. the processes employed in this small scale project can be applied to broader, hospital - wide initiatives and to large - scale initiatives for healthcare interventions. as first line providers with responsibility for the placement and daily maintenance of iucs, | catheter - associated urinary tract infections (cautis) are preventable complications of hospitalization. an interdisciplinary team developed a curriculum to increase awareness of the presence of indwelling urinary catheters (iucs) in hospitalized patients, addressed practical, primarily nurse - controlled inpatient risk - reduction interventions, and promoted the use of the iuc labels (tags). five thirty - minute educational sessions were cycled over three daily nursing shifts on two inpatient medical floors over a 1-year period ; participants were surveyed (n = 152) to elicit feedback and provide real - time insight on the learning objectives. nurse self - reported iuc tagging was early and sustained ; after the iuc tag was introduced, there was a significant increase in tagging reported by the end of the block of educational sessions (from 46.2% to 84.6%, p = 0.001). early engagement combined with a targeted educational initiative led to increased knowledge, changes in behavior, and renewed cauti awareness in hospitalized patients with iucs. the processes employed in this small - scale project can be applied to broader, hospitalwide initiatives and to large - scale initiatives for healthcare interventions. as first - line providers with responsibility for the placement and daily maintenance of iucs, nurses are ideally positioned to implement efforts addressing cautis in the hospital setting. |
most teratomas are immature in nature, and solid lesions having few focii of cystic degeneration, only 2 - 4% of lesions are predominantly cystic (the more mature and well differentiated) in nature whatever the case might be, these lesions usually present with signs and symptoms attributable to mass effect. on rare occasions, however, teratomas may erode into adjacent structures, such as the pleural space, pericardium and lung and/or trachea - bronchial tree. the presenting symptom in the latter scenario is one of expectoration of mature hair follicles known as trichoptysis. the incidence of this complication is exceedingly rare and is seen more commonly with cystic than with solid lesions. trichoptysis as a symptom has been described in only nine cases as yet but remains pathognomonic for a mediastinal teratoma having broncho - pulmonary communication. though computed tomography (ct) scan features of such a lesion have been described previously, none of these reports demonstrates a lesion to bronchus fistula on imaging. in the present report, we not only demonstrate a fistulous communication between the tumor and the bronchial tree, but also suggest certain technical modifications and postprocessing maneuvers, which may enable an unequivocal depiction of such fistulas, to the benefit of our surgical colleagues. a 35-year - old male with intractable cough for the preceding year associated with recurrent hemoptysis was referred for ct scan of the thorax. the patient had been on antitubercular therapy in another hospital for 6 months with no response. on careful interrogation, the patient complained of expectoration of fine white hairy material in his sputum, that was presumed by us to be organized mucus. the patient however insisted that it was hair and not anything else. a contrast - enhanced ct scan of the thorax was done as per standard protocol, which revealed a rounded, well - defined, but heterogeneous mass adjacent to the lower lobe of the left lung. the lesion was epicentered at the anterior mediastinum and was closed abutting the heart and pericardium (though no invasion of these structures was suspected). the lesion had a definable wall with a mixed density core having certain enhancing areas interspersed with few foci of fat attenuation and that of calcific attenuation in addition, air was seen inside the lesion, confirming a broncho - pulmonary communication [figure 1b ]. the mediastinal pleura was displaced laterally at most sites with the anterior mediastinal fat surrounding the lesion on all aspects, associated atelectasis of left lower lobe was seen. these features confirmed our suspicion of an anterior mediastinal cystic teratoma with communication to left lower lobe bronchus. coronal and sagittal thick maximum intensity projection (mip) images demonstrated a fine communication between the lesion and the lower lobe bronchus [figure 1c and d ]. additional scans were taken with an inferior gantry tilt of 12 (i.e. the angle of sweep of the left lower lobe bronchus in coronal plane reconstruction), oblique coronal reconstructions of the scans so achieved depicted the lesion to bronchus (third order tertiary bronchus) communication unequivocally [figure 2 ]. further, the scanning was done in an expiratory phase to decrease the pressure gradient between the mass and the lung and hence that the mucosal flap overlying the communication opens up and becomes easily demonstrable. surgery was planned via a left lateral thoracotomy, a pleural repair however preceded the excision of mass, in order to prevent inadvertent pulmonary hyperinflation through the fistula. this would have caused a difficulty in intraoperative ventilation as well as manipulation of lesion and was made possible only by an unequivocal demonstration of the site of the fistula. the histopathology confirmed the diagnosis of cystic teratoma with occasional immature endodermal glands interspersed with primordial hair follicles and fat / fascia lining the cyst wall [figure 3 ]. (a) plain chest radiograph showing an anterior mediastinal mass silhouetting the cardio - mediastinal outline.(b - d) contrast enhanced computed tomography thorax shows the anterior mediastinal lesion, note the mixed density core having solid enhancing areas with few foci of fat and calcific attenuation (open arrow) and air seen inside the lesion (straight arrow). on initial scanning without any gantry tilt an oblique sagittal reconstruction best demonstrated the fine communication between the lesion and the lower lobe bronchus (curved arrow) oblique coronal reconstructions of additional scans taken with gantry tilt (12 caudal), provides a more accurate and convincing depiction of the lesion to bronchus (third order tertiary bronchus) communication h and e stained sections seen in low power field show features as numbered ; 1-stratified squamous epithelium, 2-hair follicle, 3-sebaceous gland. apart from these multiple small airway lined by respiratory epithelium come in the section (straight arrows) unruptured moderately sized mediastinal teratomas are usually asymptomatic, with the symptoms arising only when these lesions are big enough to cause mass effect. the most common thoracic location of teratomas is that in anterior mediastinum, hence the ruptured lesions usually open up to the local fat planes. occasionally an odd lesion may erode across the mesothelial barrier toward the lung and hence the trachea - bronchial tree. communication with the trachea - bronchial tree gives rise to hemoptysis and trichoptysis, whereas intrapulmonary invasion presents with chest pain, dyspnea, cough and fever. without prior knowledge of presence of mediastinal teratoma, symptoms of chronic cough and hemoptysis may often be misleading, as in our patient who was on antitubercular therapy for 6 months without amelioration of symptoms. ct scan is the modality of choice for evaluation of mediastinal masses, with the features of an unruptured teratoma being well established (1 - 5), these primarily consist of a mass containing tissues of varied attenuation (fat, soft tissue and calcification). on rupture (into lung) the lesion would further become heterogenous with changes of the internal architecture ; the tumor margin becomes irregular, and the fat component takes a stellate configuration from a more spherical one. tracheo - bronchial invasion leads to consolidation in distal lung with visualization of air bubbles in the mass. direct communication of the mass with the airway is however difficult to demonstrate in most cases, even with the most advanced scanners. this may probably be due to the fact that the pressure within the teratoma after rupture becomes much less as compared to the intrapulmonary pressure, hence causing closure of the flap covering the rent in the wall of the airway. the use of oblique plane, in addition to expiratory phase scanning, enabled us to visualize and target the point of communication between the mass and the bronchial tree. this helped the surgeon to attain a closure of the rent prior to excision of the mass. further, thick mip multiplannar reconstructional images maybe more appropriate in demonstrating the lesion, than just axial plane images. such modification of the scanning technique has not been described previously but proved to be of definite importance in the present case. trichoptysis is a rare but diagnostically conclusive symptom as far as clinical evaluation of the patient is concerned. apart from confirming the diagnosis, ct scan with the described technical modifications can help plan the surgical protocol prospectively. further, with the advent of newer endobronchial interventional techniques, such focused demonstration of the point of communication between the mass and lesion can prove to be helpful in a successful expedition of minimally invasive therapy. | trichoptysis is a rare symptom, but pathognomonic of a teratoma having a bronchial communication. thoracic teratomas are usually located within the anterior mediastinum, but rarely present with trichoptysis, as transpleural erosion of a mediastinal teratoma into lung and hence bronchial tree is exceedingly rare. we report the characteristic radiological and clinical features in one such case with ruptured mature mediastinal teratoma having a bronchial communication leading to trichoptysis. only nine cases of trichoptysis have been reported in the literature as yet, but a fistulous communication with the bronchial tree on computed tomography, as seen in the present report, has not been demonstrated in any of these preceding reports. histopathological sample obtained during the surgery further confirmed the presence of a mediastinal teratoma with transpleural broncho - pulmonary communication. |
anterior post - traumatic dislocation of the shoulder is the most common type of dislocation and is caused by excessive external rotation and hyperextension of the arm in the overhead direction. as the humeral head is levered out of the glenoid, the anterior post - traumatic dislocation of the shoulder can be associated with fracture of the glenoid (i.e. bony bankart) ; seldom can it be associated with the impaction fracture of the humeral head or of the greater tuberosity. moreover, anterior shoulder dislocation may be associated with rotator cuff tears, especially in elderly patients. in a very few cases, in contrast, brachial plexus injury is rare and complicated, and very few cases have been reported in the literature. adult traumatic brachial plexus injuries are devastating, and they are occurring with increasing frequency. patient evaluation consists of a focused assessment of upper extremity sensory and motor function, radiological studies and, most importantly, electrodiagnostic studies. conservative management is usually successful, and recovery takes place after several months [68 ]. we report a unique case of anterior dislocation of the shoulder with associated fracture of the greater tuberosity and brachial plexus palsy. a 27-year - old, right - handed male was involved in a high - speed car accident, when his left arm was in abduction - extra rotation. the clinical examination performed in the emergency department showed an asymmetric profile of the left shoulder, with pain and no neurological or vascular problems. x - ray analysis of the shoulder revealed an anteromedial dislocation associated with a fracture of the greater tuberosity (fig. the shoulder was then immobilized in a sling (ir-15 abd with a pillow).fig. 1a x - ray of the right shoulder revealed an antero - medial dislocation associated with a fracture of the greater tuberosity. b at a 3-week follow - up, x - ray showed the prolapse of the humeral head, which appeared inferiorly subluxated a x - ray of the right shoulder revealed an antero - medial dislocation associated with a fracture of the greater tuberosity. b at a 3-week follow - up, x - ray showed the prolapse of the humeral head, which appeared inferiorly subluxated after 3 weeks, the patient presented marked hypotonia of the deltoid and less of the triceps muscles (fig. radiograms showed the prolapse of the humeral head, which appeared inferiorly subluxated (fig. a tear of the rotator cuff was excluded by means of magnetic resonance (mr).fig. 2the anterior (a) and posterior (b) aspects of the shoulder 3 weeks after dislocation : marked hypotonia of the deltoid and less of the triceps muscles the anterior (a) and posterior (b) aspects of the shoulder 3 weeks after dislocation : marked hypotonia of the deltoid and less of the triceps muscles the electromyography (emg) was performed after 3 weeks. it showed retroclavicular brachial plexus palsy with a mild denervation involving deltoid and, to a lesser extent, triceps muscles, and a sufferance of the posterior cord of brachial plexus with mild signs of denervation of both supra- and infra - spinatus. the treatment was conservative, and physical therapy was instituted for 8 months to prevent soft - tissue contractures and strengthen functioning muscles. signs of denervation were mild in deltoid (discrete fibrillations and positive sharp waves in 56 of 10 positions) and signs of reinnervation mild instability of isolated motor unit potentials (mups) appeared, as translation from acute to sub - acute lesion. study of recruitment of mup showed for deltoid muscle a mild reduction in the number and a mild increase in the firing rate of mup. after 4 months, mild denervation (isolated fibrillations and positive sharp waves in 23 of 10 positions) was revealed in deltoid ; reinnervation signs were predominant. triceps showed isolated positive sharp waves in 2 of 10 positions. at 6 months, there was no more denervation activity, and signs remained of mild stabilized reinnervation (increased amplitude and duration of mup) in deltoid and to a lesser extent in triceps muscles. by 12 months after the accident, active shoulder abduction and forward elevation were 160 and external rotation was 40. the triceps and biceps muscles were quoted at m4, and the patient recovered wrist and finger flexion and extension. liveson reported the electrodiagnostic examination of 11 patients with shoulder dislocation and revealed nerve damage not previously reported. although axillary nerve lesions were most common, posterior cord and musculocutaneous nerve damage occurred, each in five cases. lesions can be situated at any level from the base of the nerve roots to the division of the brachial plexus in the axillary region. several types of lesions can be differentiated : supraclavicular lesions at the root or primary trunk level (75% of the cases) ; infra and retroclavicular lesions of the secondary trunk (10%) ; and lesions of the terminal branches (15% of the cases). anterior shoulder dislocation may commonly be associated with retroclavicular or infraclavicular brachial plexus injury with an axillary nerve lesion [3, 1117 ]. contrary to most other reports, he found that the neurological lesions involved the infraclavicular and the supraclavicular brachial plexus. with supraclavicular lesions, patients with brachial plexus stretch lesions are generally observed for spontaneous recovery for several months. those patients who do not demonstrate clinical or electrical recovery by 36 months should undergo operative intervention. however, physicians need to be mindful that electrical signs of reinnervation do not always correlate with useful clinical recovery. alnot reviewed cases of 420 adults treated with surgery for traumatic palsy of the brachial plexus. although secondary sutures could be performed on some injuries, nerve grafting was usually necessary and depended on the length of the gap and the quality of surrounding tissues. the overall prognosis of infra- or retroclavicular plexus injuries is nevertheless better than that of supraclavicular lesions. however, cases of concurrent anterior shoulder dislocation and brachial plexus injury with fracture of the tuberosity are extremely rare [8, 19 ]. in our case, the brachial plexus injury was due to an anteromedial shoulder dislocation, as described previously. nerve injury with a shoulder dislocation has been reported to occur after low - velocity trauma, because the distance between the anchorage points of nerves in the upper limb is short, making the nerves vulnerable to traction. however, in our case, the fracture of the greater tuberosity associated with nerve lesions revealed a high - velocity injury, resulting in a violent shoulder dislocation with significant migration of the humeral head. emg must be proposed 3 weeks after the injury in the case of severe palsies or paralysis of the upper limb associated with a shoulder dislocation. use of this technique can help clinically, because it is possible to miss a nerve palsy in a patient with a massive rotator cuff tear. emg gives reliable results for the phase and the grade of denervation of particular muscle groups ; thus, it is possible to conclude, indirectly, which part of the plexus is in dysfunction. therefore, emg allows us to verify the innervation of the supraspinatus and infraspinatus muscles that is normal in retroclavicular or infraclavicular brachial plexus injury. in the case of total brachial plexus palsy (associated with anterior shoulder dislocation and fracture or rotator cuff tear) confirmed by emg, mri or computed tomography scan 3). however, to our knowledge, no case of all of these lesions occurring simultaneously has ever been described in the literature. in the case of complete infraclavicular brachial plexus palsy, a program of hand, wrist, and elbow mobilization 3the diagnostic algorithm in the case of anterior post - traumatic dislocation of the shoulder and its possible complications the diagnostic algorithm in the case of anterior post - traumatic dislocation of the shoulder and its possible complications the prognosis of this unhappy triad has been established principally for anterior dislocation with axillary nerve injuries. conservative management affords good recovery from these injuries over a period of up to 18 months [6, 21, 22 ]. shin affirmed that the critical concepts in surgical treatment of brachial plexus are patient selection as well as the timing and prioritizing of restoration of function. surgical techniques include neurolysis, nerve grafting, neurotization, and free muscle transfer. in our case, the nerve lesions were not so serious with incomplete infraclavicular brachial plexus palsy and the return to previous range of motion and strength of the upper limb took no longer than reported elsewhere. therefore, in our opinion, the prognosis depends essentially on brachial plexus recovery when the tuberosity has been repaired early. | primary post - traumatic anterior dislocation of the shoulder with associated fracture of the greater tuberosity and brachial plexus injury is rare and, to our knowledge, has never previously been reported in the literature. we present a case of this unhappy triad in which a brachial plexus injury was diagnosed and treated 3 weeks later. the characteristics of this rare condition are discussed on the basis of our case and the published literature in order to improve early diagnosis and treatment of this lesion. |
over the past several decades, researchers understanding of the causes and treatment of diseases has grown exponentially. apart from the financial issues, lack of access to providers, and cultural factors which are most often cited, literacy is one of the prime social determinants. literacy has recently emerged as a key item on the research agenda in medicine and public health. the growth in information technology and the rapid advances in scientific knowledge require that the public have an ever - increasing understanding of diseases to make good decisions about their health. poor literacy can impede one 's ability not only to seek out the needed health information but also to process, understand and use it to make appropriate health care decisions. health literacy is defined as the degree to which individuals have the capacity to obtain, process, and understand basic health information and services needed to make appropriate health decisions. as with general health, achieving and maintaining oral health requires one to be able to understand, interpret and act on various types of health information. oral health communications (brochures, forms, and providers explanations of procedures and treatments, for example) are often dense, unnecessarily technical, and full of jargon, obscured by words like pharynx, orally, occlusal and contraindications instead of more familiar terms used in everyday speech. as a result, these communications are often difficult to understand, especially for individuals with limited literacy skills. this situation creates a significant barrier to improved oral health, exacerbating other barriers such as those related to economics, insurance coverage, and access. a survey is needed to determine the level of oral health literacy among members of the public and its effect on their ability to make good decisions about oral health. an understanding of health literacy and how it differs among dental patients is an important beginning step in determining the relative importance of this barrier to oral health and how it might be addressed in dental practice. the objective of this study was to assess the health literacy among adult patients seeking oral health care at the oxford dental college, hospital and research centre, bangalore, karnataka, india. a cross - sectional study using a 13-item structured questionnaire was conducted to assess the health literacy in a sample of adult patients (n = 600) seeking care at the outpatient department, the oxford dental college, hospital and research centre, bangalore. the data was collected during april - may 2009. to be eligible for the study, patients had to speak and read english / kannada (local language) and be older than 18 years. the patients were informed about the research undertaken and assured that their reluctance to participate in the study would not affect their treatment. section 2 comprised of 13 questions, the answers of which were graded on a 5 point likert scale (a - e). results on continuous measurements were presented as mean + standard deviation and results on categorical measurements were presented in number and percentage. analysis of variance (anova) was used to find the significance of study parameters between three or more groups of patients and student 's t - test (two tailed, independent) was used to find the significance of study parameters on continuous scale between two groups (inter group analysis) at 95% confidence interval. a total of 500 adult patients (above 18 years of age) who were literate in english / kannada (local language) attending the oxford dental college, hospital and research centre participated in the study. educational qualification distribution showed that 4% of the study subjects had completed primary school education, 31.4% completed high school (10 grade), 28% had completed 12 grade or equivalent (diploma in industrial training institute), 23.8% were graduates and 12.8% had completed post graduation. socio - demographic and baseline characteristics of the study participants table 2 shows the mean health literacy score according to different variables (age, gender and educational qualification). mean health literacy score according to age and educational qualification showed a suggestive significance (0.05 < p < 0.01). mean health literacy score according to different variables (age, gender, educational qualification) among the subjects studied, 60.4% had low health literacy level, 29.4% were average and only 10.2% had high health literacy levels [table 3 ]. about 53.8% of the graduates had low health literacy levels and 29.4% had average health literacy levels. it is surprising to note that 57.8% of the postgraduates had low health literacy levels [table 4 ]. levels of health literacy in the patients studied levels of health literacy in different education category oral health is an integral part of overall health and well being. as stated in oral health in america : a report of surgeon general, just as we now understand that nature and nurture are inextricably linked, and mind and body are both expressions of our human biology, so too, we must recognize that oral health and general health are inseparable no one can be truly health unless he or she is free from burden of oral and craniofacial diseases and conditions. the oral diseases constitute a considerable public health problem in india not only causing pain, agony, functional and esthetic problems but also limit social interactions and affects psychology and economy of individuals, families and society. according to the national oral health survey of india (2002 - 2003), more than 50% of the population in all age groups suffers from dental caries and periodontal disease. oral cancer accounts to about 0.3% in 35 - 44 years age group and 0.4% in 65 - 74 years age group. about 0.8% in 35 - 44 years age group and 29.5% in 65 - 74 there are many reasons why these preventable oral diseases are so widespread and why people do not adopt practices that have been scientifically shown to be effective in maintaining oral health. while citing other factors like cultural, financial etc., literacy or more specifically health literacy emerges as one of the major key issues. the literacy rate in india is 65% as per the 2001 census. when addressing health literacy, it is important that a nation 's literacy level is improved first and subsequently the health and the oral health literacy. kerala, a small state in southern india has the highest literacy rate of 90.92% with improved health outcomes when compared to the whole nation. increase in health literacy leads to adoption of effective disease prevention methods, successful adherence to treatment regimen and ultimately improved oral health status. oral health literacy is now believed to be an important determinant of oral health, one that intersects with other determinants in myriad ways. although, literacy is not the only pathway to better oral health outcomes, it is certainly an important avenue. hence, any effort to improve oral health outcomes should take into account the oral health literacy of the patient. for effective disease management and maintenance of oral health, one must be able to understand, interpret, and act on health information, whether it is communicated verbally or in written form. the limited research that has been done focuses mostly on assessing the reading level of dental educational materials and consent forms. unlike other studies found in literature where the authors have used the readability scales (reald, tofhla, stohfla), the present study used a questionnaire which was developed and validated by chew and colleagues (2004) to identify patients with low literacy levels. the results of this study suggest that a large number of patients have low levels of oral health literacy among patients in bangalore, india that may interfere in their ability to process and understand basic oral health information. about 40% of the patients have problems getting to the hospital at the right appointment time because of the difficulty in reading appointment slips, 52% of subjects agree that they have difficulty learning about their general / oral health conditions because of difficulty in understanding written information. around 63% of the patients feel that they are not confident in taking the medication (s) correctly because of problems in understanding written instructions on bottle label and 64% of the subjects agreed that they require help to read hospital materials. studies have linked low oral health literacy with worse oral health outcomes such as oral health status and dental neglect. health education, a widely accepted approach in prevention of oral diseases, is a process of transmission of knowledge and skills necessary for improvement in quality of life. health education can be delivered by either personal instruction or by the use of self - instruction manuals and audiovisual aids. whatever is the mode or method of health education, the effectiveness of the program lies in the fact that people need to understand and interpret it correctly to lead a good quality of life. this study concluded that there is low level of health literacy among patients seeking oral health care at a private dental college in bangalore, india. preventive oral services might be less effective in patients with low literacy level because they do not understand the instructions or the importance of preventive procedures. also, it is to be noted that higher educational qualification does not necessarily mean that the person has to be a health literate. hence, providers need to identify patients who are having difficulty understanding and using oral health information and should take steps to address their needs. these steps might include strategies such as receiving continuing education in effective patient communication techniques and ensuring that educational materials for patients are written at an appropriate reading level. there is a need to look at the health literacy in the context of large systems social systems, cultural systems, education systems and public health systems. further investigation is needed to develop appropriate intervention strategies to improve oral health literacy for better oral health outcomes. | background : poor literacy can impede one 's ability not only to seek out needed health information but also to process, understand and use it to make appropriate health care decisions. the objective of the study was to assess the health literacy among adult patients seeking oral health care at in a private dental hospital in bangalore, karnataka, india.materials and methods : a cross sectional questionnaire survey was carried out on 500 subjects. the questionnaire designed by chew and colleagues (2004) was modified and used as the survey instrument. to be eligible to participate in the study, the participants had to be aged above 18 years and able to read or write english / kannada (local language). analysis of variance (anova) and student 's t - test (two tailed, independent) was used to find the significance of study parameters at 95% confidence interval.results:about 60.4% of the subjects had low health literacy level, 29.4% average and only 10.2% had high health literacy levels. age and educational qualification had a suggestive significant difference with the mean health literacy scores while gender did not have any significant difference. subjects who had completed post - graduation (57.8%) too had low health literacy levels.conclusion:a large number of patients have low levels of health literacy that may interfere with their ability to process and understand basic health information. |
dna in all eukaryotic organisms is bound by nucleosomes, forming a physiological chromatin context in which all molecular processes involving dna operate. the integrity of the chromatin template is constantly compromised by fundamental biological processes, such as dna replication, repair, and transcription, following which the normal chromatin structure is restored with the help of histone chaperone proteins (gurard - levin., 2014, ransom., 2010). advances in recent years have shed light on some of the molecular players involved in chromatin assembly and maintenance, separating (on the molecular level) dna replication - dependent and -independent pathways (burgess and zhang, 2013). histone proteins themselves are central to these processes : the expression and incorporation of canonical histones is tightly coupled to dna replication ; in contrast, histone variants can be incorporated into chromatin independent of the cell cycle (maze., 2014). while it has become increasingly clear that the activity of histone chaperone proteins is of critical importance during dna replication and repair (adam., 2013, hoek and stillman, 2003, polo., 2006, ransom., 2010), studies that have attempted to dissect the importance of histone replacement in the interphase nucleus have revealed only a limited contribution of histone chaperones and/or variants to transcriptional regulation (banaszynski., 2013, goldberg., 2010, hdl and basler, 2009, sakai., 2009). these studies, however, have been complicated by the use of proliferative cell systems that could (at least partially) restore chromatin integrity through replication - coupled chromatin assembly (banaszynski., 2013, hdl and basler, 2009, sakai., 2009, wyrick., 1999). thus, the extent to which basic physiological processes, such as transcription, are dependent on or regulated by histone replacement remains unclear. to overcome the limitations of these previous studies, we took advantage of the unique system presented by mammalian oogenesis. over an extended time span and in the absence of dna replication, postnatal mammalian oocytes execute the oogenesis - specific developmental program, involving widespread transcriptional changes and de novo dna methylation, ultimately acquiring the competencies required for fertilization and embryogenesis (de la fuente, 2006, li and albertini, 2013, tomizawa., 2012). to address the importance of histone turnover during this process, we have generated a mouse oocyte - specific knockout of the histone chaperone hira. as opposed to caf1, which is implicated in the replication - coupled deposition of canonical histones h3.1 and h3.2, hira has been shown to deposit the h3.3 variant during replication - independent chromatin assembly (ray - gallet., 2002, our findings show that depletion of hira in primordial oocytes causes a severe developmental defect associated with extensive oocyte death. on the molecular level this causes significantly increased dna accessibility, accumulation of dna damage, and chromosome segregation defects. the lack of normal chromatin structure has a striking impact on transcriptional regulation : lack of normal h3.3/h4 replacement prevents the oocytes from maintaining full dynamic range of gene expression, and it leads to compromised transcriptional transitions normally associated with the oocyte development. furthermore, we show that histone replacement is necessary for silencing of spurious transcription and, in the context of the oocyte, also for the efficient deposition of de novo dna methylation. our results thus uniquely demonstrate the critical relationship between continuous histone replacement, the structural integrity of the chromatin template, the normal regulation of transcription, and the establishment of dna methylation, in the context of an in vivo developmental system. in the mouse, female germ cells arrest in prophase of the first meiotic division at embryonic day (e)13.5. the female gonocytes subsequently resume growth in postnatal ovaries where they undergo oogenesis and progress through meiosis (de la fuente, 2006). this process involves the following : (1) pronounced transcriptional changes as the developing oocytes progress from primordial to large antral follicle stages ; (2) the deposition of de novo dna methylation starting in the secondary follicle stage ; (3) the silencing of transcription in the germinal vesicle (gv) stage ; and, finally, (4) the condensation of chromosomes in the mii stage, resulting in an oocyte that is competent to undergo fertilization and support early embryonic development (figure 1a). we first addressed the capacity of developing oocytes to incorporate histones by microinjection of mrna for tagged versions of histones. in agreement with the absence of replication during oocyte maturation, growing oocytes did not show any incorporation of canonical histones h3.1 and h3.2 (figure 1b ; akiyama., 2011). in contrast, microinjected flag - tagged h3.3 and h2a.x, previously shown to be enriched in the developing oocyte (akiyama., 2011, 2010), were readily incorporated into the chromatin of growing oocytes (figure 1b). we thus conclude that h3.3 is the only h3 subtype incorporated during postnatal oocyte development. in further support of this observation, oocytes isolated from our h3.3b - egfp knockin mice (figure s1 g) confirmed that both growing and gv oocytes contain high levels of nuclear h3.3 (figure 1e). however, we also detected a high level of chromatin incorporation for flag - tagged h2a.x, h4, and h3.3 upon injection of tagged histone mrna into transcriptionally inactive gv - stage oocytes (figure 1c), demonstrating that the chromatin in the mature gv oocyte is still dynamic even after global transcription has ceased. previous studies have shown that the majority of h3.3 incorporation is critically dependent on the presence of histone chaperone hira (goldberg., 2010, pchelintsev., 2013). in agreement with the observed h3.3 incorporation, hira is expressed and shows nuclear localization during postnatal oocyte development (figure 1d). to investigate whether hira is specifically required for the observed h3.3 incorporation during oogenesis, we took advantage of gdf9- and zp3-driven expression of cre recombinase and deleted hira in the primordial and primary stages of follicle development, respectively (figures 1a and s1a). we confirmed that both gdf9-cre- and zp3-cre - deleted oocytes undergo genetic recombination (figure s1b ; data not shown) and are depleted of hira mrna, protein and complex (figures 1d and s1c s1f). the absence of hira severely decreased h3.3 content and completely abolished the incorporation of microinjected tagged h3.3 in both growing and gv - stage oocytes (figures 1b, 1c, and 1e). the observed impairment of h3.3 incorporation occurred despite the presence of an alternative atrx / daxx chaperone complex that has been well characterized to incorporate h3.3 (burgess and zhang, 2013, maze.,, the presence and the localization of this complex in the gv oocyte were not affected by hira deletion (figure s2a), and we could observe h3.3b - egfp loci overlapping with atrx staining in hira gdf9-cre, h3.3b - egfp gv oocytes at higher laser detection intensity (figure s2c). the severe reduction of h3.3 incorporation in hira gdf9-cre oocytes thus demonstrates that the atrx / daxx chaperone complex can not compensate for the lack of hira, as was also observed in mouse embryonic stem cells (escs) (goldberg., 2010). the lack of hira and h3.3 incorporation also was not compensated for by incorporation of the canonical histones h3.1 or h3.2 (figure 1b), and it coincided with the lack of detectable incorporation of histone h4 (figure 1c). taken together, these findings demonstrate that the histone variant h3.3, rather than h3.1 or h3.2, is actively incorporated into chromatin during oocyte development, and confirm that hira is responsible for the incorporation of the majority of h3.3 in conjunction with histone h4 (figures 1b1e and s2b). of note, although hira - deficient oocytes failed to incorporate tagged h3 and h4 histones, the incorporation of tagged h2a.x was readily detectable (figures 1b and 1c), confirming that distinct molecular pathways are implicated in the deposition of h3/h4 and h2a / h2b histones (burgess and zhang, 2013). assessment of females with oocyte - specific hira deletion revealed that loss of hira led to a severe ovarian phenotype. significantly lower numbers of mii oocytes could be recovered following superovulation (figure 2a) ; zp3-cre - driven deletion of hira led to a more than 50% reduction in the number of ovulated mii oocytes, and this effect was even more dramatic upon earlier gdf9-cre - driven deletion (figure 2a). furthermore, gv oocytes (figure 1a) isolated from both hira zp3-cre and hira gdf9-cre ovaries showed dramatically reduced competency to complete the gv - to - mii transition during in vitro maturation (figure s2e). hira gdf9-cre ovaries were significantly smaller (figures 2b and s2f) ; and, although we could recover some gv oocytes from 3-week - old females, the ovaries of older mice contained only very few oocytes, which were predominantly at early developmental stages (figures 2c and s2 g). further analysis of the superovulated hira gdf9-cre mii oocytes revealed frequent defects in chromosome alignment and segregation and instances of aberrant polar body extrusion (figure 2d). in line with a severe ovarian phenotype and in agreement with recently published reports (inoue and zhang, 2014, lin. 2005), the surviving hira - depleted oocytes were unable to either reprogram the paternal pronucleus or support early embryonic development after fertilization. in agreement with the observed enrichment of h3.3 and hira in the paternal pronucleus of control zygotes (figures s3a s3c), fertilized hira gdf9-cre oocytes could not fully de - condense the male pronucleus (figure s3d), incorporate h3.3 (figure s3e), or support normal zygotic development (figure s3f). failure to incorporate h3.3 occurred despite the efficient removal of protamines (figure s4a), indicating that protamine removal and chromatinization of the paternal genome are mechanistically distinct (inoue and zhang, 2014, lin., 2014). although the histone load of the paternal pronucleus was severely reduced upon maternal hira deletion, we could detect a residual amount of histones on the paternal dna by immunofluourescent staining (figure s4b). however, it remains to be addressed whether the residual histones were inherited from sperm or whether they were incorporated in a hira - independent manner. in agreement with the severe chromatinization defect, the partially decondensed paternal pronucleus of zygotes in which hira had been maternally deleted failed to undergo dna demethylation (figure s4c) and could not provide a normal template for zygotic replication or transcription (figures s4d and s4e ; lin., 2014). apart from the failure to support normal reprogramming of the paternal pronucleus following fertilization, hira - depleted oocytes showed severe maternal defects. the atp content was significantly reduced in hira - depleted mii oocytes (figure s2h), and, upon parthenogenetic activation, only a fraction of these oocytes reached the two - cell stage and none progressed further, contrary to the control oocytes that efficiently supported development of parthenogenetic blastocysts (figure 2e). considering the pronounced oocyte phenotype, we set out to understand the molecular mechanisms by which hira regulates oocyte development. we hypothesized that, in the absence of h3/h4 incorporation, the chromatin structure in hira - depleted oocytes would be severely affected. in agreement with this, the histone content of hira - depleted gv - stage oocytes was severely reduced (figures 3a and s2b), and the resulting chromatin displayed altered structure and increased dnase i sensitivity (figures 3b and 3c). moreover, in accordance with the predicted role of histones in protecting genetic material from environmental stress and mutagenesis (ljungman and hanawalt, 1992), hira - depleted oocytes showed clear signs of dna damage both by increased levels of -h2ax (figure 3d) and upregulation of dna damage - responsive genes (figure 3e). the importance of hira and continuous h3.3 replacement has been previously assessed in the context of proliferating mouse pluripotent escs (banaszynski. these studies surprisingly revealed that hira deletion led to only minor transcriptional changes (banaszynski. the severity of the phenotype observed following the deletion of hira in oocytes, we next asked whether the reduced h3/h4 incorporation and increased dna accessibility (figures 1b1e, 3a, and 3c) affected the transcriptional program of the hira - depleted oocytes. surprisingly, although the lack of maternal hira severely affected the amount of transcription emanating from the paternal pronucleus following fertilization (figure s4e ; lin., 2014), hira - depleted and control growing oocytes showed similar global levels of transcription, as judged by eu incorporation (figure 4a). to address the role of hira in transcription during oocyte development in depth, we carried out single - cell rna sequencing (scrna - seq) on four hira gdf9-cre and four hira control oocytes. we chose to analyze ovulated mii oocytes that had successfully completed their first meiotic division to avoid inconsistencies due to differences in staging or developmental progression. of note, consistent with the identical patterns of eu incorporation in the hira gdf9-cre and control growing oocytes (figure 4a), normalization to the ercc rna spike - ins included in our scrna - seq library preparations revealed no significant differences in the total quantity of poly - adenylated rna between hira gdf9-cre and control mii oocytes (figure 4b). in agreement with the observed severe developmental phenotype, the initial data analysis revealed pronounced transcriptional differences upon deletion of hira (figures 4c and s6a). expression analysis identified 2,101 differentially expressed genes (false discovery rate [fdr ] 1 fragments per kilobase of transcript per million mapped reads [fpkm ]) and often at high level (8% transcripts with > 10 fpkm) in individual knockout samples, expression of a given unannotated intergenic transcript was only ever observed in one biological replicate, reflecting stochastic events consistent with spurious transcription (table s2). also of note, a nearly identical phenotype was observed upon zp3-cre - driven deletion of hira (figures s6d, s6j, and s6k ; table s4). progression through oocyte development is accompanied by the accumulation of dna methylation. during this process, the largely hypomethylated genome of primordial oocytes acquires dna methylation through the activity of the de novo dna methyltransferase dnmt3a and its co - factor dnmt3l (kaneda., 2004, smallwood and kelsey, 2012, smallwood., 2011). acquisition of dna methylation in oocytes is known to be positively correlated with transcription, which could relate to the recruitment of dnmt3a/3l to gene bodies through binding of its pwwp domain to h3k36me3, a histone modification associated with transcriptional elongation (chotalia., 2009, dhayalan. although h3k36me3-driven dna methylation in gene bodies has recently been attributed to the enzymatic activity of dnmt3b in mouse escs (baubec., 2015, yang., 2014), dnmt3a is responsible for the accumulation of oocyte dna methylation as dnmt3b is absent in growing oocytes (kaneda., 2004, shirane., 2013). given the widespread transcriptional changes observed in the hira knockout oocytes, we set out to examine the potential impact of hira deletion on de novo dna methylation in the oocyte. although the total amount of transcription was not altered upon hira deletion (figures 4a and 4b), the observed reduced histone load was connected with lower levels of global h3k36me3 in hira - depleted gv oocytes (figures 3a and s7a). interestingly, initial immunofluorescence (if) detection of 5mc indicated that hira gdf9-cre gv oocytes also contain lower levels of dna methylation (figure s7b). further quantitative assessment by liquid chromatography - mass spectrometry (lc - ms) revealed a dramatic reduction of 5mc in hira - deleted oocytes, with a more pronounced effect following earlier gdf9-cre - driven deletion (figure 6a). importantly, the reduction of dna methylation occurred despite the transcriptional upregulation of dnmt3a and without statistically significant changes in the expression of other dna methyltransferases (figures s5c, s7c, and s7d). to further understand the relationship among hira deletion, transcriptional changes, and global changes in dna methylation, we profiled dna methylation genome - wide by bisulphite sequencing. because of the very limited availability of hira - deleted oocytes, we performed single - cell bisulphite sequencing (scbs - seq) on 14 individual hira gdf9-cre mii oocytes and 14 individual hira control mii oocytes, followed by in silico merging of the individual datasets, as previously described (smallwood., 2014). we first confirmed that our scbs - seq dataset represented an accurate depiction of oocyte methylation, as we observed a high correlation (r = 0.96) between our merged scbs - seq control oocytes and an independent whole - genome bisulphite sequencing (wgbs) dataset of pooled oocytes (shirane., 2013 ; dna data bank of japan : dra000570 ; figures 6c and s7e). in agreement with the lc - ms measurements and if data, our wgbs analysis confirmed the dramatic reduction in dna methylation in both cpg (42.7% decrease) and chh (73.2% decrease) contexts (figures 6b and s7f). further analysis revealed that only 3.8% of the 3-kb genomic windows classed as methylated in wild - type oocytes (> 80% methylation) remained methylated to the same extent in hira - depleted oocytes, with the majority of methylated (> 80%) regions showing less than 50% dna methylation in hira - depleted oocytes (figure 6d). at the whole - genome level, 40.2% of 3-kb genomic windows displayed a statistically significant loss of dna methylation in hira gdf9-cre oocytes (figure 6e ; chi - square test, p < 0.001). this extensive reduction of dna methylation was observed across all types of genomic regions, including genic regions, cpg islands, maternally methylated imprint control regions, and repetitive elements (figures 6f, 6 g, s7 g, and s7h). in agreement with previously published observations (kobayashi., 2012, 2015), we observed a positive correlation between transcription and the level of dna methylation in control oocytes (figure 6h). although the methylome of hira gdf9-cre oocytes was severely reduced in comparison to control oocytes, they too retained a positive correlation between transcription and dna methylation across most of the transcriptional range (figure 6h) ; however, this correlation was abolished for highly expressed genes (figure 6h). consequently, the effect on dna methylation in hira - deleted oocytes was more pronounced at highly expressed genes compared to median expressed genes (figure s7i). surprisingly, beyond the observed relationship between transcription level and dna methylation described above, on average, dna methylation was reduced both at genes whose expression was unaffected by hira deletion and also at genes differentially expressed between control and hira gdf9-cre oocytes, regardless of whether they were up- or downregulated (figure 6i). cumulatively, these observations suggest that, although de novo methylation is still targeted to transcribed regions in hira - depleted oocytes, this process appears to be inefficient, clearly indicating that transcription is not sufficient to ensure normal levels of de novo dna methylation in this system. considering the high levels of dnmt3a and dnmt3l in hira gdf9-cre oocytes (figures s7c and s7d), we reasoned that the observed effect was likely caused either by inefficient recruitment or reduced enzymatic activity on chromatin of the dnmt3a/3l complex. we first asked whether chromatin association of dnmt3a is grossly altered following hira depletion in hira gdf9-cre oocytes. in agreement with our rna - seq and qpcr data, hira knockout oocytes contained higher levels of dnmt3a (figures s7c, s7d, and s5c). importantly, dnmt3a remained associated with chromatin following triton pre - extraction of soluble proteins, confirming that altered chromatin structure in hira - deleted oocytes does not completely abolish recruitment of this enzyme (figure s7j). in this context, the pwwp domain of dnmt3a has previously been shown to interact in vitro with h3k36me3 (dhayalan., 2010). although the recognition of this histone modification by dnmt3b (and not by dnmt3a) has recently been linked to gene body dna methylation in mouse escs (baubec., 2015), it is possible that reduced h3k36me3 levels observed in hira - depleted gv oocytes contribute to the observed loss of dna methylation in this system. in addition, using in vitro biochemical assays, it has recently been shown that the enzymatic activity of dnmt3a is specifically enhanced by binding to the n - terminal tail of histone h3 lacking methylation at lysine 4 (h3k4me0) (guo., 2015). despite the lack of h3.3/h4 replacement, growing hira gdf9-cre oocytes remained highly transcriptionally active (figure 4a). it is, thus, conceivable that passage of the transcriptional machinery would result in histone h3 depletion and increased dna accessibility, both of which we observed (figures 3a and 3c). although our developmental system precludes direct analysis of locus - specific histone turnover due to severely limited material, a very strong correlation had been observed previously between transcription levels and the degree of histone (and specifically h3.3) replacement, a relationship that is conserved among various model organisms including mouse (deal., 2010, kraushaar., 2013, dna methylation was most affected at genes with the highest level of transcription (figures 6h and s7i). we also note that, while the combination of both compromised dnmt3a/3l recruitment and reduced enzymatic activity would explain the reduction of dna methylation in transcribed regions, reduced histone load is likely to underpin the methylation defect observed in other non - transcribed parts of the genome (figure 6f ; guo., 2015). to address the biological significance of continuous histone replacement in a physiological context, we have generated a genetic deletion of the histone chaperone hira in the early stages of mouse oogenesis. developing mouse oocytes represent a unique experimental system as postnatal oocytes undergo developmental transitions, including major transcriptional changes and widespread de novo dna methylation, in the absence of dna replication. our results show that the chromatin of developing oocytes is highly dynamic, with histone turnover being observed also in the transcriptionally inert gv - stage oocytes (figures 1c and 4a). we demonstrate that constant histone replacement is necessary for the maintenance of normal chromatin homeostasis in vivo. depletion of hira during early oocyte development leads to a severe reduction of histone load, compromised developmental progression, and progressive oocyte loss (figures 2, 3a, and s2 g). we note that, albeit pronounced, our observed phenotype is milder in comparison to the recently reported oocyte death in h3.3 knockout mice (tang., 2015). we attribute this difference to the presence of an alternative atrx / daxx h3.3 chaperone complex, which, although present in our system, can not functionally replace hira - driven h3.3 deposition (figures s2a s2c). our experiments document that, while lacking the normal ability to incorporate h3.3 and h4, hira - deleted growing oocytes remain transcriptionally active, which results in chromatin with severely reduced histone content, increased dnase i sensitivity, and signs of dna damage (figures 3 and s2b). reminiscent of the phenotype associated with hira depletion in yeast (blackwell., 2004, greenall., 2006) and h3.3 depletion in mice (bush., 2013, lin., 2013) and drosophila (sakai., 2009), the compromised chromatin structure leads to chromosome segregation defects and aberrant first polar body extrusion (figure 2d). however, the observed chromosome segregation defects in the hira - depleted oocytes are not linked with aberrant cenpa incorporation, as previously suggested in somatic cells (figure s2c ; bush., 2013). non - replicative hira - depleted oocytes uniquely reveal the importance of histone replacement on transcriptional regulation in the absence of replication - coupled chromatin assembly. although transcription can continue from histone - depleted chromatin, our study shows that the lack of histone replacement has a major impact on the dynamic range of gene expression. in the context of histone - depleted chromatin additionally, the lack of normal histone occupancy leads to increased spurious transcription from otherwise not - transcribed regions of the genome, suggesting an evolutionarily conserved role for the hira histone chaperone complex (anderson., 2009). our results additionally reveal an unexpected connection among continuous h3.3 replacement, transcription, and de novo dna methylation in developing oocytes. following hira depletion, more accessible chromatin with reduced histone load leads to significantly reduced dna methylation (figures 6a6 g). we note that, although in other systems dna methylation changes result in pronounced transcriptional outcomes (yang., 2014), reduced dna methylation is not likely to contribute to the observed transcriptional changes in hira - depleted oocytes, as dnmt3l knockout oocytes lacking dna methylation do not display any transcriptional phenotype (kobayashi., 2012). our data suggest that the observed methylation phenotype can not be attributed to downregulation of the dnmt3a/3l complex, and, although we can not exclude locus - specific effects on dnmt3a/3l recruitment, the observed reduced dna methylation is likely due to altered enzymatic activity of dnmt3a in the absence of normal levels of chromatin - bound h3 (figures 1c, 1e, and s2b). in this context, the n - terminal part of h3 has been shown in vitro to be required for allosteric activation of dnmt3a catalytic activity (guo., 2015). our study thus provides the first support for this effect in an in vivo setting. the observed effect is more pronounced in highly expressed genes (figure s7i), in agreement with the expected role of transcription in inducing nucleosome depletion in hira - depleted oocytes. furthermore, cpg island methylation is greatly reduced in hira - depleted oocytes (figure 6 g) and methylation loss is more pronounced at regions with high cpg density (figure s7k). as the dnmt3a enzyme has been shown to operate in a non - processive manner (dhayalan., 2010), stimulatory effect of the unmodified (h3k4me0) h3 tail might be necessary to ensure a high level of methylation at these regions. we also considered that loss of hira early during oocyte development (gdf9-cre - driven deletion) might lead to a variety of secondary effects that could contribute to the observed phenotypes. in this context it is important to note that deletion of hira at a later time point during oogenesis (zp3-cre system) fully recapitulated the transcriptional and dna methylation defects observed in hira gdf9-cre oocytes (figures 6a and s6), providing further support for our findings and indicating that the observed effects are not solely attributable to compromised development of the oocytes. although we can not exclude that some of the effects could be secondary to alterations in gene expression, the most parsimonious view is that the abnormal chromatin resulting from impaired h3.3/h4 deposition is responsible for the majority of the phenotypes we observed. in addition, while it is important to consider that the observed transcriptional and methylation effects could be connected with the specific absence of the h3.3 variant upon hira depletion in oocytes (santenard., 2010), it is likely that the lack of normal chromatin structure due to the inability to continuously replace h3/h4 is the main cause underlying the described phenotype. consistent with this view, the pronounced transcriptional phenotype observed in hira - depleted oocytes is in stark contrast to the only limited transcriptional changes previously described in hira knockout escs (banaszynski., 2013, goldberg., 2010). in that case, replication - dependent deposition of canonical h3 by the caf1 complex was likely to compensate in the absence of hira - mediated h3.3 deposition in rapidly dividing escs (banaszynski. indeed, h3.3 depletion does not lead to pronounced changes in nucleosome occupancy in proliferating escs (banaszynski., in contrast, our findings document that post - replicative cells in vivo require continuous histone replacement in order to maintain an intact chromatin structure, which in turn is required for normal regulation of transcription and for de novo dna methylation in the context of developing oocytes (figure 7). interestingly, the critical role of continuous histone replacement also has been demonstrated recently in post - mitotic neurons, where the lack of h3.3 incorporation had an impact on both transcription and physiological function of neurons (maze collectively, our studies thus provide new insights into the histone dynamics in vivo and highlight the importance of studying chromatin in a physiological context and in non - proliferating post - mitotic cells. oocyte - specific hira depletion was achieved by crossing hira mice with gdf9-icre or with zp3-cre mice, respectively. the h3.3b - egfp knockin strain was generated in the mrc csc transgenic facility and protamine 1-egfp strain was generated by dr. all animal experiments were carried out under a uk home office project license in a home office - designated facility. detailed information is available in the supplemental experimental procedures. in vitro fertilization (ivf), in vitro maturation (ivm), parthenogenesis, mrna microinjection, tunel assay, if, and h&e staining were carried out as described previously (hajkova., 2010, the scrna - seq was performed on hira, hira gdf9-cre, and hira zp3-cre mii oocytes using the smarter ultra low input rna kit (clontech laboratories) with ercc rna spike - in mix 1 (life technologies). detailed information is available in the supplemental experimental procedures. an scbs - seq described previously (smallwood., 2014) was used to profile the dna methylation landscape of hira and hira gdf9-cre oocytes. ultra - sensitive lc - ms was used to determine overall 5-methylcytosine level. for detailed information, | summarythe integrity of chromatin, which provides a dynamic template for all dna - related processes in eukaryotes, is maintained through replication - dependent and -independent assembly pathways. to address the role of histone deposition in the absence of dna replication, we deleted the h3.3 chaperone hira in developing mouse oocytes. we show that chromatin of non - replicative developing oocytes is dynamic and that lack of continuous h3.3/h4 deposition alters chromatin structure, resulting in increased dnase i sensitivity, the accumulation of dna damage, and a severe fertility phenotype. on the molecular level, abnormal chromatin structure leads to a dramatic decrease in the dynamic range of gene expression, the appearance of spurious transcripts, and inefficient de novo dna methylation. our study thus unequivocally shows the importance of continuous histone replacement and chromatin homeostasis for transcriptional regulation and normal developmental progression in a non - replicative system in vivo. |
a 73 year - old patient with mild hemophilia b (factor ix clotting activity 12%) was referred to our department due to a left renal tumor incidentally discovered during ultrasonography performed as follow - up two years after prostate cancer brachytherapy. on admission abdominal and pelvic ct scans revealed a multilocular tumor in the lower left kidney pole (57x52x52 mm) with a solid mass of 3.5 cm in diameter (figure 1). other abdominal and chest imaging showed no abnormalities. twelve hours before surgery, he was transfused with 4200 units of factor ix concentrate (octanine, octapharma ag, switzerland), with the same dose administered one hour prior to the procedure. on october 3 of 2014, the procedure was performed with the patient positioned on his right side. following urinary catheterization, a veress needle was introduced close to the umbilicus and an intraperitoneal pressure of 14 mmhg was created. the descending colon was dissected and the fat renal capsule subsequently cut for access to the left renal artery. the artery was then clipped with polymeric clips (hem - o - lok xl (teleflex, usa) and cut in between. the same was done for the renal vein. the kidney was excised, placed into a hemobag (covidien, usa) and removed through a small incision between the two ports. a plastic drain was placed into the kidney bed and the abdominal wall was closed with layers of sutures. peritoneal drainage was kept in place for two days with no significant output of blood or serous fluid. substitution therapy was continued for 9 days with the level of factor ix clotting activity at 90130% of the normal value on days 13, 6574% on days 46 and 3040% on days 79. the postoperative course was uneventful and the patient was discharged on 10 day after surgery. histopathological investigation revealed renal carcinoma, clear cell type (g2), limited to the parenchyma, without capsule infiltration or angioinvasion. no abnormalities were revealed in ultrasonography and ct scans. computed tomography scan revealed a left kidney tumor mass. hemophilia b (christmas disease) is a congenital bleeding disorder resulting from factor ix deficiency. hemophilia b patients undergoing surgical procedures are at a high risk of severe bleeding complications unless surgery is performed after adequate correction of the diathesis. secure hemostasis in hemophilia b patients is achieved with transfusions of factor ix coagulation factor concentrate, either recombinant or plasma - derived. desirable preoperative activity is 6080% of the normal value and should be maintained until complete wound healing, usually through 710 days. on days 13 the recommended value is 6080%, on days 46 4060% and 3040% on days 710. minimally invasive procedures in patients with hemophilia, apart from well - known benefits such as reduced postoperative pain, fewer complications, better cosmetic effect, shorter hospitalization, quicker convalescence and return to professional activity, also contribute to shorter duration of substitution therapy. the first laparoscopic nephrectomy was performed by clayman. in 1990. since then, the procedure has been performed in an increasing number of urologic centers [4, 5 ]. there are only few reports in the literature of urinary tract operations in patients with congenital coagulation disorders [6, 7 ] ; nonetheless, there have been none of laparoscopic nephrectomy in a hemophilia patient. we present the first case of laparoscopic nephrectomy in a hemophiliac performed with an adrenal - saving, transperitoneal lateral approach using four trocars. no significant complications were observed either postoperatively or in the long - term, which can most likely be attributed to the adequate preparation of the hemophilia patient for surgery, as well as the effective cooperation between urologist and hematologist. perioperative and postoperative bleeding episodes are the most frequent complications reported in hemophilia patients. for patients with no coagulation disorders, tlrn intraoperative bleeds are observed at 2.22.8%, and are frequently a reason for conversion to an open procedure. there are no significant differences in the reported percentage of all surgical complications, hemorrhage included, between hemophilia patients with adequate substitution of deficient coagulation factor and patients with no coagulation disorders [8, 9 ]. it is therefore crucial for hemophilia patients to undergo surgery in special reference centers, which provide expert health - care services and are equipped with a modern laboratory for careful daily monitoring of deficient coagulation factor activity [9, 10 ]. in conclusion, laparoscopic radical nephrectomy in hemophilia patients is a safe and effective procedure for renal carcinoma. surgery should be performed by an experienced urologist in cooperation with a multidisciplinary team, providing both perioperative and postoperative care, supported by a specialized laboratory. | surgery in patients with hemophilia is a serious challenge. it requires a comprehensive approach, as well as careful postoperative monitoring. we present here the first case of a transperitoneal laparoscopic radical nephrectomy (tlrn) for renal cell carcinoma, of the clear - cell type, performed in a hemophilia b patient. the level of factor ix clotting activity before surgery and on postoperative days 16 was maintained at 65130% and at 3040% on subsequent days until healing of the post - operative wound was achieved. the intraoperative and postoperative courses were uneventful. tlrn can therefore be considered safe and effective for renal cell carcinoma. in hemophilia patients, the tlrn procedure requires proper preparation, as well as adequate substitution therapy for the deficient coagulation factor provided by a multidisciplinary team in a comprehensive center. |
viruses are major pathogens in all kingdoms of life. single - stranded (ss)rna viruses make up a significant fraction of these pathogens with detrimental impacts on human health. their control via vaccination will only ever be possible for a limited subset of examples, so innovative routes to antiviral therapy are urgently required. virion formation and uncoating are highly cooperative aspects of the viral lifecycle that are potential drug targets, but these have largely not been exploited thus far. one reason for this, with respect to assembly, is the apparent lack of specificity for rna in in vitro assays of spontaneous co - assembly to form virus - like particles. many viral coat proteins (cps) also seem able to assemble correctly in the absence of rna. the lack of sequence specificity has been interpreted to mean that assembly is driven largely by electrostatics [14 ]. rnas carry a large amount of negative charge that can be neutralized by the positively charged domains or surfaces seen on many viral cps. however, these in vitro results do not reflect the apparent specificity of genome encapsidation seen in vivo, where there is a clear biological imperative to (1) form virions packed with cognate genomes and not cellular rnas ; and to (2) complete the assembly process efficiently before the host defense mechanisms can clear the infection. we review here our recent data that suggest that while electrostatics clearly plays an important role in ssrna virus capsid assembly, it overlooks the vital cooperative roles by which the genomic rna facilitates efficient encapsidation in an environment in which capsid protein concentrations are much lower than in most in vitro studies. thus the genome confers a distinct evolutionary advantage to assembly of these pathogens, as well as encoding their gene products. the deeper understanding of these mechanisms provided by our research paves the way for novel antiviral strategies, targeting these additional roles of the genome in capsid formation. we have recently established single - molecule fluorescence correlation spectroscopy (smfcs) assays to monitor the fates of dye - labeled cps or rnas during in vitro reassembly at the low cp concentrations typical of in vivo scenarios. these allow the conformations of genomic rnas before, during, and after encapsidation to be followed by direct estimation of their hydrodynamic radii (rh). the assays are sensitive in the nanomolar concentrations range (~1 nm for rna & ~100 nm for cp), which are much more reflective of early concentrations within infected cells than most in vitro assays where cp concentrations of 10 \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$\upmu $ \end{document}m are common. working with two model viruses, satellite tobacco necrosis virus (stnv) and bacteriophage ms2 (fig. 1), we were able to show that labeled proteins and capsids had rhs derived from smfcs similar to those determined by other techniques, such as x - ray crystallography and mass spectrometry. furthermore, the technique showed good discrimination between the starting materials (dis - assembled rnas and cps) and the end products (capsids) in in vitro reassembly reactions. fig. the top row shows external views of the capsids of stnv and bacteriophage ms2 based on their pdb entries (3 s4 g & 1aq3, respectively). these are examples of t = 1 and t = 3 capsids. alongside are the sequences and secondary structures of their known packaging signals, b3 & tr, respectively [13, 18 ]. the bottom row shows the results of single - molecule fluorescence correlation spectroscopy (smfcs) assembly assays for both viruses. the hydrodynamic radii (rh), derived from the fcs curves, are plotted for both genomic rnas (~1 nm) before and after (red arrow) the addition of sufficient coat protein subunits to allow assembly of completed capsids around each rna. the protein - free rnas show the presence of multiple conformers in equilibrium, most of which are too large to fit within their respective capsids (the dashed black lines and rh values are for the external radii of the respective capsids). on addition of the cognate, and only the cognate, cp subunits there is a sudden collapse in the hydrodynamic radius of the resulting rna - cp complexes. electron micrographs of the assembly reactions at the end of the fcs measurement show that the cognate reactions have produced the expected capsids in high yield demonstration of rna packaging specificity for two model viruses. the top row shows external views of the capsids of stnv and bacteriophage ms2 based on their pdb entries (3 s4 g & 1aq3, respectively). these are examples of t = 1 and t = 3 capsids. alongside are the sequences and secondary structures of their known packaging signals, b3 & tr, respectively [13, 18 ]. the bottom row shows the results of single - molecule fluorescence correlation spectroscopy (smfcs) assembly assays for both viruses. the hydrodynamic radii (rh), derived from the fcs curves, are plotted for both genomic rnas (~1 nm) before and after (red arrow) the addition of sufficient coat protein subunits to allow assembly of completed capsids around each rna. the protein - free rnas show the presence of multiple conformers in equilibrium, most of which are too large to fit within their respective capsids (the dashed black lines and rh values are for the external radii of the respective capsids). on addition of the cognate, and only the cognate, cp subunits there is a sudden collapse in the hydrodynamic radius of the resulting rna - cp complexes. electron micrographs of the assembly reactions at the end of the fcs measurement show that the cognate reactions have produced the expected capsids in high yield the most interesting information from these assays comes from dye - labeled genomic rnas to which a full complement of cps is added, allowing each rna to form a capsid. initially in the absence of cps, the genomic rnas, and sub - fragments of the ms2 rna (not shown), exhibit a broad range of rh values, consistent with an ensemble of differing conformers in equilibrium (fig. 1). this is consistent with the necessity of these rnas playing multiple roles during the viral lifecycle, each of which requires a different conformational state. most of the conformers seen in the absence of cp are too large to fit within the confines of their respective capsids. upon addition of the cognate cps there is a sudden collapse by up to 20% in rh values that makes the resultant complex smaller than the diameter of the respective capsids. this event is followed by a slower recovery in rh values that then plateau close to the expected values for intact capsids. non - cognate viral rnas are equivalent to non - cognate cellular rnas in these assays. electron microscopy shows that the cognate reactions produce the expected capsids with high yield and fidelity. non - cognate reactions also appear to stimulate assembly under these conditions, but do so highly inefficiently and produce a majority of misshapen and aggregated species with very few structures equivalent to a well - formed capsid. the collapse is a consequence of multiple cp - rna and cp - cp contacts, since an ms2 cp mutant (w82r) that binds rna normally but can not make the protein it is also not cp concentration - dependent above a threshold value, as the amplitude of the collapse is constant. ems of the ms2 reaction just after the collapse show partially formed capsid shells of the correct size and symmetry, implying that the complex forms in an ordered way and is not simply aggregated material that subsequently rearranges. the recovery stage is dependent on cp concentration as expected for recruitment of additional cp subunits to complete capsid formation. we interpret these data to mean that within each genome there are specific cp binding sites that are arranged in three dimensions to facilitate the cp - cp contacts seen in the capsid. the binding energy of these cp - rna complexes is used to overcome the entropic costs associated with rna confinement during assembly. some animal viruses, e.g., polio, are known to package predominantly nascent genomic transcripts as they emerge from the rna - dependent rna polymerase, rather than co - assembling with a fully formed rna as in these experiments. however, in such cases the genomic rnas still need to be confined and so a variant of the ps idea may still explain this behavior. in those cases, the pss may only fold correctly for cp binding on the nascent transcript. the results described above suggest that there should be multiple pss in the genomic sequences that play important functional roles via contacts with cp at defined positions in the capsid. for example, we have shown previously that contacts between characteristic stem - loop motifs in the ms2 sequence and cp subunits result in a conformational change of the symmetric, rna - free cp dimer [711 ], the prevalent conformer in solution, to the asymmetric form required at 60 of the 90 dimer positions in the fully assembled capsid (fig. is significantly accelerated from the order of days in the rna - free case, to minutes if genomic rnas or multiple copies of fragments encompassing pss are present. this suggests a scenario of capsid assembly that we previously termed the dimer switching model (dsm) of assembly, in which the genomic rna is organized in proximity of the capsid in such a way that it meets every asymmetric dimer, extending a stem - loop contact (ps) to cp as it does so, hence enabling the required conformer switch at defined positions in the assembling capsid. the left - hand panel shows the inferred assembly mechanism for stnv based on an x - ray crystal structure of a virus - like particle containing multiple copies of its packaging signal rna and in vitro assembly assays. the stnv cp in solution is monomeric and does not assemble in the absence of rna. in the presence of the ps rna, it assembles rapidly and the vlp structure shows that an additional section of the polypeptide chain towards the n - terminus becomes more ordered, extending the existing alpha helix by four residues. the additional amino acids being ordered contain several that are positively charged, suggesting that rna binding overcomes an electrostatic barrier to assembly within the cp. the middle panel shows our current assembly model for ms2, which is nucleated by binding of its high affinity ps, the tr stem - loop, and proceeds by recruitment of further dimers, mediated via contacts with the other pss. in this case, the cp is a dimer that is symmetrical in the absence of rna but adopts the asymmetric conformer when bound to a ps. the right - hand panel shows a cartoon of the dodecahedral model system that we have used to analyze the principles of these co - assembly scenarios. in this case, the 12 pentagonal building blocks represent the units of assembly (capsomeres, here pentagons), and interact with the 12 packaging signals on a hypothetical rna. ps - capsomere contacts are assumed to take place at the centers of the building blocks. in the fully assembled capsid, all pss are bound to capsomeres, and the specific ps - capsomere pairing across the capsid defines the organization of the rna in proximity to the dodecahedral capsid surface the effects of packaging signals. the left - hand panel shows the inferred assembly mechanism for stnv based on an x - ray crystal structure of a virus - like particle containing multiple copies of its packaging signal rna and in vitro assembly assays. the stnv cp in solution is monomeric and does not assemble in the absence of rna. in the presence of the ps rna, it assembles rapidly and the vlp structure shows that an additional section of the polypeptide chain towards the n - terminus becomes more ordered, extending the existing alpha helix by four residues. the additional amino acids being ordered contain several that are positively charged, suggesting that rna binding overcomes an electrostatic barrier to assembly within the cp. the middle panel shows our current assembly model for ms2, which is nucleated by binding of its high affinity ps, the tr stem - loop, and proceeds by recruitment of further dimers, mediated via contacts with the other pss. in this case, the cp is a dimer that is symmetrical in the absence of rna but adopts the asymmetric conformer when bound to a ps. the right - hand panel shows a cartoon of the dodecahedral model system that we have used to analyze the principles of these co - assembly scenarios. in this case, the 12 pentagonal building blocks represent the units of assembly (capsomeres, here pentagons), and interact with the 12 packaging signals on a hypothetical rna. ps - capsomere contacts are assumed to take place at the centers of the building blocks. in the fully assembled capsid, all pss are bound to capsomeres, and the specific ps - capsomere pairing across the capsid defines the organization of the rna in proximity to the dodecahedral capsid surface similarly, we have shown that contacts between rna stem - loops in the stnv genome sequence and cps at the three - fold axes of symmetry of the t = 1 capsid help overcome an electrostatic barrier between the cp monomers that prevents assembly in the absence of rna (fig. 2b) [13, 14 ]. both scenarios are incarnations of the same co - assembly principle, that we call the packaging signal hypothesis : multiple copies of pss fulfil the same function, albeit different ones in different viruses, at defined positions, repeated according to capsid symmetry, aiding formation of the correct / required cp conformers and thus resulting in significantly enhanced assembly efficiency. these ideas follow on from proposals based on the x - ray structure of satellite tobacco mosaic virus (stmv), where up to 80% of the genomic rna is ordered and has been modeled as a series of stem - loops positioned along the particle two - fold axes. further modeling based on a folded genomic rna constrained to form 30 such stem - loops and chemical footprinting, unfortunately, in this case, it has not been possible to demonstrate the functional roles of these putative packaging signals directly. in all these cases, the implication is that genomic rnas fulfil multiple functions, including formation of repeating motifs for interaction with their coat proteins in the virion, as well as encoding of the viral proteins and gene and replicative control elements. high - affinity pss have been identified in many viral systems, and their roles in initiating capsid assembly and conferring packaging selectivity have been discussed. in ms2, there is a single copy, high - affinity, stem - loop cp - binding site (tr) that plays multiple roles in the viral lifecycle. it serves as an operator for a cp - induced translational repression of the replicase gene, and it is also believed to act as the point of assembly nucleation. in vitro reassembly assays show that flanking sequences also contribute to assembly efficiency [1921 ] and there is genetic evidence that there are likely additional pss throughout the genome. however, the existence of multiple packaging signals, potentially with medium to low affinity for cp, as suggested by the above model, has previously been overlooked. this is perhaps due to the fact that ps motifs vary in their primary structures and reveal characteristic motifs only in the context of their secondary structures. we used clues from rna selex, a method providing insights into relative affinities of rna fragments to cp, to establish the existence of multiple ps consistent with the ps hypothesis in a number of viral systems. for example, stnv t = 1 capsids in vivo package a genomic rna consisting only of mrna for the cp. unusually in this class of virus, our recombinant mrna in e. coli cells is expressed and the recombinant cp assembles to t = 1 particles that encapsidate that mrna, suggestive of packaging specificity. we tested this idea by selecting preferred rna binding ligands using the selex technique in combination with bioinformatics. this identified a short stem - loop (b3) with a single - stranded loop motif of a.x.x.a-, where x = any nucleotide. there are multiple versions of this recognition signal, a putative ps, in all three stnv genomes. we tested whether this sequence was functionally important in in vitro reassembly assays comparing a mutant sequence with a loop of u.u.u.u- as a control. the stnv cp does not assemble beyond monomer in the absence of rna. both b3 and the 4u variant trigger self - assembly of t = 1 capsids with stnv cp, but with dramatically different efficiencies, the a.x.x.a- version being much more efficient. x - ray structure determination of the virus - like particle (vlp) created by b3-induced assembly reveals repeated rna - cp contacts around the helices that occur at the virion three - fold axes. compared to the virion structure, these helices have become more ordered allowing a cluster of positively charged side - chains to come into close contact. these aptamer sequences appear to overcome the potential electrostatic repulsion between cp monomers and are obvious candidates to be the pss in the stnv rna inferred from the smfcs experiment. similarly, rna selex and known structures for cp - binding rna stem - loops suggested a characteristic motif for pss in ms2 [2527 ]. using a novel interdisciplinary approach (dykeman., in preparation), combining selex and structure function data with graph theoretical tools (hamiltonian paths) we were able to identify the 60 pss consistent with the dsm, and map them into the tertiary structure of the packaged genome, i.e., we associated all pss with defined positions in the capsid. this analysis revealed a striking conclusion : the organization of the packaged genome in contact with capsid is much more constrained than previously appreciated. this is consistent with a recent cryo - tomographic structure determination of the ms2 virion in contact with its primary cellular receptor, the bacterial pilus. using the pilus for alignment, it has been possible to determine a tomographic structure for the bound phage without symmetry averaging of the density (dent., tomograms of individual particles have too low a signal - to - noise ratio to provide useful information but by sub - tomographic averaging of many asymmetric particles it is possible to generate an interpretable structure. this confirms that the capsid is based on icosahedral symmetry everywhere except the contact point with the pilus, where it appears that a coat protein dimer has been replaced by the single copy of maturation protein. within the protein shell there is density that must correspond to the genomic rna, both in contact with the protein shell, as expected from the roles of the rna packaging signals, and at lower radii. due to the averaging between particles, the strength of this density shows that the conformation of encapsidated rna in every particle must be very similar. indeed, we tested the data for correlation with the structures of any of the possible hamiltonian path organizations and identified a single path as the best fit (geraets., in preparation). interestingly, it is the same path that had been identified earlier via an independent approach based on assembly kinetics as the path describing the likely organization of genomic rna in proximity to capsid. a similar analysis of the pss in an evolutionarily related phage, ga, revealed a different ps motif and different ps distributions in the secondary structure of that packaged genome, but the same contact pattern between ps in the rna organization in proximity of the capsid, pointing to an evolutionarily conserved packaging arrangement in this family of rna viruses. the tight link between the structure of the packaged genome and capsid assembly implies a conserved assembly mechanism for these rna viruses. this is because the positions of the pss and the way in which the genomic rna is organized between them define the assembly pathways and intermediates. for example, for ms2 assembly is assumed to nucleate at the highest affinity ps (tr, fig. 1), which in this case is located approximately at the center of the genomic sequence. after this, assembly proceeds along the rna towards the 5 and 3 ends simultaneously via recruitment of additional cp dimers, consistent with the experimental observation of capsid intermediates seen via mass spectrometry. in such a co - assembly scenario, formation of cp complexes is correlated with the organization of the genomic rna in contact with it. hence, the organization of the genome and the associated positioning of the pss reflect the geometry of the capsid intermediates and the final virion. therefore, mathematical tools describing capsid geometry can be used to characterize the assembly process. in particular, the concept of hamiltonian paths, which we introduced as a tool to enumerate all possible organizations of the packaged genomes in contact with capsid [28, 29 ], allowed us, in combination with techniques from biochemistry and biophysics, to characterize the local rules according to which these viruses form. this work has revealed a preferred assembly pathway, which is consistent both with the independent analysis of the ps distribution, and with results of the recent cryo - tm study. these results pave the way for a better understanding of how the pss contribute to making capsid assembly both efficient and accurate. the existence of multiple pss suggests that they fulfil a regulatory role during capsid assembly, which is perhaps surprising, given that the largest fraction of them (e.g., over 70% in ms2 (dykeman., in preparation)) have relatively weak affinity for their cognate cp. in order to understand this phenomenon, we have analyzed capsid assembly for a dodecahedral model system consisting of 12 pentagonal building blocks that can interact with 12 packaging signals on a hypothetical rna (fig. 3a) assume nucleation at a designated high affinity signal via recruitment of a cp (pentagon). further cp - rna contacts can be formed or broken with defined on- and off - rates, and cps bound to neighboring pss can associate (and potentially dissociate again). we analyzed the efficiency of capsid assembly in terms of particle yield depending on the strengths of the ps - cp contacts across the rna genome using a gillespie - type algorithm to sample the possible assembly pathways. the gillespie algorithm uses a stochastic framework to compute the reaction kinetics of a solution of chemicals. given a set of possible reactions, such as a ligand - binding event or the dissociation of a ligand protein complex, the algorithm computes the probability that each reaction would occur within a time increment and picks one reaction to fire based on these probabilities. our algorithm for capsid assembly in the presence of rna uses the algorithm to compute the reaction kinetics for a solution of cp and rnas that contain multiple pss with varying affinities for cp. the reaction probabilities are estimated from the forward and backwards reaction rates, which satisfy the equilibrium equation : \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \frac{k_f } { k_b } = e^{-{\delta}{g}/rt } $ $ \end{document}where r is the gas constant and t is the temperature (here chosen as 298 k). fig. 3modeling the effects of different packaging signal affinities. in order to assess the impact of different distributions of ps affinities to capsomeres, these assume nucleation at a designated high affinity signal via recruitment of a cp (pentagon). further cp - rna contacts can be formed or broken with defined on- and off - rates, and cps bound to neighboring pss can associate (and potentially dissociate again). the right panel shows the resulting particle yield depending on the strengths of the ps - cp contacts across the rna genome (varying between 0 and 12 kcal / mol in increments of 0.1 kcal / mol), obtained via a gillespie - type algorithm sampling the possible assembly pathways. the analysis revealed that heterogeneous ps affinities distributions performed consistently better in terms of completed capsid than scenarios in which all ps affinities are equal ; an example of each is shown for illustration modeling the effects of different packaging signal affinities. in order to assess the impact of different distributions of ps affinities to capsomeres, we analyze the assembly scenario given by the assembly reactions in the left panel. these assume nucleation at a designated high affinity signal via recruitment of a cp (pentagon). further cp - rna contacts can be formed or broken with defined on- and off - rates, and cps bound to neighboring pss can associate (and potentially dissociate again). the right panel shows the resulting particle yield depending on the strengths of the ps - cp contacts across the rna genome (varying between 0 and 12 kcal / mol in increments of 0.1 kcal / mol), obtained via a gillespie - type algorithm sampling the possible assembly pathways. the analysis revealed that heterogeneous ps affinities distributions performed consistently better in terms of completed capsid than scenarios in which all ps affinities are equal ; an example of each is shown for illustration the analysis revealed that heterogeneous ps affinity distributions (in this model of cp - rna affinities between 0 and 12 kcal / mol) performed consistently better than rnas with identical pss, such as homogeneous polymers (i.e., the situation when all ps affinities are equal). an analysis of the assembly pathways of better performing rnas revealed that pss of weak affinity are located predominantly in positions where dissociation may be important for error correction on the pathways, while strong packaging signals mark positions that do not require dissociation to complete capsid formation. this suggests an intimate link between capsid geometry and assembly kinetics that is mediated via the affinities of the pss., in preparation), like knobs on a radio, adapting the rna to capsid geometry so as to optimize capsid yield during assembly. inspired by the remarkable insights into rna virus assembly provided by the single - molecule experiments for ms2 and stnv, we have developed a new model for the capsid - genome co - assembly process in ssrna viruses. a central element of this approach is the packaging signal hypothesis, which suggests that repeated contacts between rna and cp, mediated by the ps, have a regulatory role in capsid assembly, hence making this process more efficient. this regulatory role can manifest itself in different ways, e.g., via allosteric dimer switching as in ms2, or overcoming of electrostatic barriers in capsid protein association as in stnv. we have shown that the affinities of ps to capsid protein are key in adapting the rna for efficient packaging into a capsid of a defined geometry, making the genomic rna a finely tuned molecular machine primed to optimize capsid assembly. this is vital given that capsid efficiency is important in each viral particle s race against its host s natural defense mechanisms. our analysis has shown that electrostatics alone does not account for the packaging mechanism in ssrna viruses as it overlooks these subtle, yet vital, effects. indeed, in vitro studies at unnaturally high cp concentrations mask this effect, which is perhaps why it had not been discovered previously. for instance, in the smfcs assays of stnv assembly at low cp concentrations (100 nm), there is clear discrimination in favor of the cognate cp - genomic rna complex against ms2 genomic rna and its fragments, and vice versa (fig. 1). however, ms2 pss also have loop sequences that match those of stnv (-a.u.u.a- vs. a.x.x.a). the relative locations of these pss in the respective rnas are, however, optimized to promote only the cognate cp - cp contacts required to form the appropriate capsid, hence preventing assembly with non - cognate rnas at low concentration. this effect is reduced when we compare discrimination of ms2 and stnv rnas at typical in vitro reassembly concentrations (10 \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$\upmu $ \end{document}m). as our modeling has shown, capsids can be formed around any negatively charged polymers as long as they fit into the volume of the capsid ; however, for non - cognate rnas, the efficiency of this process is much reduced. our approach is a vehicle to quantify this, and for relating ps affinities with capsid yield. we have shown that under comparable conditions (solution conditions and assumptions on on / off - rates), heterogeneous distributions of ps affinities perform consistently better, and that there is at least a difference of 5% in capsid yield with regards to the best performing polymer with a homogeneous ps distribution. this difference, albeit small, is important in an evolutionary context, as a population of viruses would out - compete another over which it has a 5% advantage in yield in only a couple of generation cycles. these insights suggest a novel approach to anti - viral drug design, i.e., targeting the formation of the vital ps - cp contacts, and/or their consequences. indeed, we have shown that blocking the cp - induced collapse of ms2 rna ablates capsid assembly and others have demonstrated that a clinically approved alkaloid that binds to extra helical bases in rna blocks assembly of tmv in vitro from its known ps. | the formation of a protective protein container is an essential step in the life - cycle of most viruses. in the case of single - stranded (ss)rna viruses, this step occurs in parallel with genome packaging in a co - assembly process. previously, it had been thought that this process can be explained entirely by electrostatics. inspired by recent single - molecule fluorescence experiments that recapitulate the rna packaging specificity seen in vivo for two model viruses, we present an alternative theory, which recognizes the important cooperative roles played by rna coat protein interactions, at sites we have termed packaging signals. the hypothesis is that multiple copies of packaging signals, repeated according to capsid symmetry, aid formation of the required capsid protein conformers at defined positions, resulting in significantly enhanced assembly efficiency. the precise mechanistic roles of packaging signal interactions may vary between viruses, as we have demonstrated for ms2 and stnv. we quantify the impact of packaging signals on capsid assembly efficiency using a dodecahedral model system, showing that heterogeneous affinity distributions of packaging signals for capsid protein out - compete those of homogeneous affinities. these insights pave the way to a new anti - viral therapy, reducing capsid assembly efficiency by targeting of the vital roles of the packaging signals, and opens up new avenues for the efficient construction of protein nanocontainers in bionanotechnology. |
junn virus (junv) is a south american arenavirus, the etiological agent of a severe endemo - epidemic disease called argentine hemorrhagic fever (ahf). arenaviridae is a family composed of a growing number of enveloped viruses with a bipartite single stranded rna genome. members of the arenaviridae family were subdivided into two groups based on the geographical site of isolation, serological cross - reactivity and genetic data. the prototype of the family, lymphocytic choriomeningitis virus (lcmv) is a member of the old world arenavirus group, which also includes ippy (ippv), lassa (lasv), mobala (mobv), and mopeia (mopv) viruses. junv is a member of the new world arenavirus group, that also includes allpahuayo (allv), amapari (amav), bear canyon (bcnv), flexal (flxv), guanarito (gtov), latino (latv), machupo (macv), oliveros (olvv), paran (parv), pichind (picv), pirital (pirv), sabi (sabv), tacaribe (tcrv), tamiami (tamv), and whitewater arroyo (wwavs) viruses. in addition, there are several recently described species that have not yet been classified by the ictv (http://www.ictvonline.org/virustaxonomy.asp?version=2008). the two rna segments of the junn virus genome are designated l and s and have approximate sizes of 7.2 and 3.5 kb, respectively. each rna segment directs the synthesis of two proteins ; their open reading frames are arranged in opposite orientations (ambisense coding strategy) and are separated by a noncoding intergenic region that folds into a stable stem - loop structure. the s rna codes for the major structural proteins of the virion : the precursor of the envelope glycoproteins (gpc) and the viral nucleocapsid protein (n). posttranslational cleavage of gpc renders a signal peptide and the two viral glycoproteins (gp1 and gp2). the l rna segment codes for the viral rna - dependent rna polymerase (l) and the small protein (z). z is a 94 residue long polypeptide, and its central portion is predicted to fold into a ring finger domain. moreover, z has been implicated in several aspects of arenavirus biology [46 ]. based on nucleotide sequence data, a better comprehension of the taxonomy and evolution of the arenaviridae has been achieved. it has been suggested that new world arenaviruses should be classified into four different lineages, named a, b, c, and rec. lineage a would contain allv, flxv, parv, picv and pirv ; lineage b contains amav, gtov, junv, macv, sabv, and tcrv, lineage c contains latv and olvv, and lineage rec, with the wwav, tamv, and bcnv. currently (ictv website) the last three viruses are classified with clade a. the role of z in the virus life cycle is not completely elucidated, and homologues of z are not found in other ambisense or negative - stranded rna viruses. z is a structural component of the virion, and by means of in vivo and in vitro experiments, the interaction of z with several cellular factors has been reported, including the promyelocytic leukemia protein and the eukaryotic translation initiation factor 4e [9, 10 ]. because of this latter interaction, it was proposed that z inhibits cap - mediated translation [11, 12 ]. other researchers suggested that z could be a transcriptional regulator of the viral cycle or even an inhibitor of viral replication. furthermore, prez and coworkers proposed, for lcmv and lasv, that z is the functional counterpart of the matrix proteins found in other negative - stranded enveloped rna viruses. late domains (lds), found in matrix proteins from negative - stranded rna viruses and in gag protein from retroviruses, have an essential role in the viral budding process. three types of motifs have been defined within viral lds : p[ts]ap, ppxy, and yxxl, where x is any amino acid. later, martn serrano and coworkers redefined the last as : ypxl / lxxlf. lds are highly conserved and have been shown to mediate interaction with host cell proteins, in particular with members of the vacuolar protein - sorting pathway [19, 20 ]. for instance, the ptap motif from ebola virus vp40 matrix protein and from hiv gag protein interacts with tsg101, a member of the vacuolar protein - sorting pathway. in this work, we show the strategies employed for the expression, purification, and specific antibody generation against z protein from candid#1 strain of junn virus. here we report the optimized expression from a synthetic gene of z protein tagged with different peptides, using three expression systems (two bacterial and a baculoviral one), in order to obtain recombinant z protein suitable for functional characterization studies. the parental junn virus xj strain was isolated in junn city (buenos aires, argentina) from a human ahf patient. the bhk21 cells were cultured in growth medium (dulbecco 's minimal essential medium dmem supplemented with 10% fetal bovine serum and 2 mm l - glutamine) to 50% confluence and infected at a multiplicity of infection (moi) of 1 plaque forming unit (pfu) per cell. after virus adsorption for 1 h at room temperature, infected cells were washed with phosphate - buffered saline (pbs) and maintained at 37c in mem containing 2% fetal bovine serum. virions were recovered and purified from the supernatant media ; viral and total infected cell rnas were isolated according to procedures described previously. virus titers were determined by plaque assay on vero e6 (atcc, ccl 1586, c1008) cell monolayers as described elsewhere. the cell monolayers were harvested 72 h post infection by scraping and recovered by centrifugation. rna was isolated from pelleted virions or infected cells, using the qiamp viral rna mini kit or rneasy mini kit (qiagen, valencia, ca). the z open reading frame (orf) from junv candid#1 strain, was amplified by rt - pcr (superscript iii reverse transcriptase for rt, and platinum taq dna polymerase high fidelity for pcr, invitrogen), from junn virus rna using the forward primer jzv 5-atgggcaactgcaacggggcatc-3 (z orf translation initiation sequence is underlined), and the reverse primers jzvc 5- tggtggtggtgctgttggctccac -3, and jzvc - stop : 5-ctatggtggtggtgctgttggctccac -3 (sequence complementary to the z stop codon is underlined). the amplicon was cloned into pzero and the recombinant plasmid (zpz) was amplified in escherichia coli strain top10 (invitrogen). the recombinant plasmids were confirmed by nucleotide sequencing. for cloning z orf into pet102/d - topo (invitrogen), a variant from jzv primer was used, named jzvclamp : 5-ccac atgggcaactgcaacggggcatc-3 (the four nucleotides, added to facilitate cloning, upstream of the atg initiation codon, are indicated in italics). the recombinant clone was named pet - z and used for expression experiments in bacterial cell culture (e. coli bl21). the produced protein was fused to different tags : thioredoxine by the n - terminus, and his tag and v5 epitopes by the c - terminus. this fusion protein was called tio - z - v5-his. for the subsequent cloning procedures the plasmid zpz was digested with xhoi and hindiii. this digestion rendered a product of 366 bp, comprising z orf and a portion of the alpha fragment of lacz (from pzero mcs), hereafter designated as z. this fragment was cloned into different expression vectors : pgz (pgex - b, novagen). the z fragment was ligated into pqe-30 (qiagen, valencia, ca) previously digested with hindiii and sali. the obtained plasmid, pqz was digested with smai and hindiii and the 374 pb fragment was ligated into pgex - b, previously digested with the same enzymes. the recombinant plasmid (pgz) the recombinant protein, called gst - z, contains glutathione - s - transferase (gst) fused to the n - terminus of z. pbac - z (pfastbac - hta, invitrogen). the z fragment was ligated into the vector pfastbac - hta, previously digested with hindiii and sali. z orf was fused to a his - tag to the amino end of z. this his - tagged version of z was named z - his. the recombinant plasmid (pbac - z) was amplified in e. coli top10 and the insert was confirmed by nucleotide sequencing. the bac - to - bac system (invitrogen) was used to generate recombinant baculoviral genomes (acmnpv) harboring z - his gene (bacmid_ac - z). briefly, z orf in pbac - z was transposed to an acmnpv genome using e. coli strain dh10 bac, which carries the target baculoviral genome and the machinery required for transposition. the recombinant acmnpv genomes (bacmid_ac - z) were purified by minipreparation from bacterial culture and then used to generate recombinant baculoviruses (v_ac - z) by transfecting different insect cell lines (cellfectin, invitrogen). the recombinant baculovirus (v_ac - z) was amplified by infection of insect cells. viruses were recovered from the supernatant media of infected cell monolayers and purified by ultracentrifugation. optimization procedures of the expression levels consisted in testing different multiplicities of infection and insect cell lines. two cell lines were used, sf9 from spodoptera frugiperda and high five (bti - tn-5b1 - 4) from trichoplusia ni. these cells were cultured on 25 cm polystyrene flasks with grace medium (invitrogen), supplemented with 10% fetal bovine serum and 0.1% gentamicin, to 70% confluence and infected with the recombinant baculovirus (> 10 pfu / ml) at different multiplicities of infection (moi). after virus adsorption for 1 h at room temperature, infected cells were washed with phosphate - buffered saline (pbs) and maintained at 25c in grace containing 10% fetal bovine serum. the protein expression was analyzed by sds - page and western blotting using z protein - specific antibodies and his - tag antibodies. a variety of expression strains were tested : rosetta plys and origami b (de3) from novagen ; bl21 (de3), bl21 (plyss), bl21-codonplus (de3) ripl and xl1blue from stratagene ; bl21 si from invitrogen ; overexpress c41 (de3) and c43 (de3) from lucigen. cells were grown on luria broth (lb) growth medium and supplemented with the proper antibiotic when required (34 g / ml kanamycin, 100 g / ml ampicillin, 50 g / ml chloramphenicol, 12.5 g / ml tetracycline). tio - z - v5-his (pt - z). for tio - z - v5-his fusion protein, transformed cells were cultured in 500 ml of lb medium containing 100 g / ml ampicillin, at 37c. when the culture absorbance at 600 nm reached a value of 1.5, cells were induced with 600 m isopropyl--d - thiogalactopyranoside (iptg) for 4 h at 37c. bacteria were then harvested by centrifugation at 4000 g for 15 min, and resuspended in 25 ml of 50 mm nah2po4 ph 8.2 ; 300 mm nacl ; 20 mm imidazole ; 1% triton x-100 and complete protease inhibitor cocktail tablets 1x (roche). cells were disrupted by french press and, after centrifugation at 20,000 g for 30 min, the soluble fraction was collected and analyzed by sds - page (4x loading sample buffer containing 200 mm tris - hcl, 8% sds, 40% glycerol, and 0.4% bromophenol blue and 400 mm dtt, ph 6.8). sds - page analyses were performed according to laemmli, using 1215% polyacrylamide gels stained with r250 coomassie blue. very similar expression levels were obtained from the different host cells studied for the gst - z fusion protein, as detected by tris - glycine 15% sds - page. the selected strain and culture conditions were the same as employed by volpon and coworkers, with buffers containing zn. bacteria were harvested by centrifugation at 4,000 g for 15 min, and the pellet was resuspended in 25 ml of pbs, 200 mm nacl, ph 8 ; 0.1% triton x-100, 100 m dtt, and complete protease inhibitor cocktail tablets 1x (roche). cells were disrupted by french press and, after centrifugation at 20,000 g for 30 min, the soluble fraction was collected and analyzed by sds - page. analyses were performed according to laemmli, using 1215% polyacrylamide gels stained with r250 coomassie blue. tio - z - v5-his the soluble fraction (25 ml) obtained after the induction of pet - z was clarified by centrifugation at 12,000 g for 30 min and loaded on a his - trap 5 ml column (amersham), using a running buffer 50 mm nah2po4 ph 8.2, 300 mm nacl. after column wash, a step gradient of 500 mm imidazole was applied at 1 ml / min flow for 20 min using an akta fplc (amersham). each fraction collected was analyzed by sds - page and those containing tio - z - v5-his were pooled, and concentrated down to 1 ml on a spin concentrator (vivaspin 15, 10,000 mwco, sartorius). this was then run on a gel filtration column superdex 200 10/300 gl (amersham) using running buffer 50 mm nah2po4 ph 8.2, 300 mm nacl at 0.5 ml / min flow. again, every fraction was analyzed by sds - page and those containing tio - z - v5-his were pooled and dialyzed overnight against tris - hcl 20 mm ph 8.0 at 4c. the soluble fraction (25 ml) obtained after the induction of pet - z was clarified by centrifugation at 12,000 g for 30 min and loaded on a his - trap 5 ml column (amersham), using a running buffer 50 mm nah2po4 ph 8.2, 300 mm nacl. after column wash, a step gradient of 500 mm imidazole was applied at 1 ml / min flow for 20 min using an akta fplc (amersham). each fraction collected was analyzed by sds - page and those containing tio - z - v5-his were pooled, and concentrated down to 1 ml on a spin concentrator (vivaspin 15, 10,000 mwco, sartorius). this was then run on a gel filtration column superdex 200 10/300 gl (amersham) using running buffer 50 mm nah2po4 ph 8.2, 300 mm nacl at 0.5 ml / min flow. again, every fraction was analyzed by sds - page and those containing tio - z - v5-his were pooled and dialyzed overnight against tris - hcl 20 mm ph 8.0 at 4c. cleavage and purification of tio - z - v5-hispurified tio - z - v5-his was dialyzed against enterokinase cleavage buffer (50 mm tris - hcl ph 8 ; 1 mm cacl2 ; 0.1% tween-20) and then concentrated with a spin concentrator (vivaspin 6 10,000 mwco, sartorius) down to 1 ml at a final concentration of 0.3 mg / ml. a fraction of 500 l of this sample was subjected to proteolysis with enterokinase on a final volume of 600 l overnight at 4c. after this, the sample was loaded on a his - trap 5 ml column (amersham). the running buffer was 50 mm nah2po4 ph 8.2 ; 300 mm nacl. finally, a 500 mm imidazole step gradient was applied for 20 min. purified tio - z - v5-his was dialyzed against enterokinase cleavage buffer (50 mm tris - hcl ph 8 ; 1 mm cacl2 ; 0.1% tween-20) and then concentrated with a spin concentrator (vivaspin 6 10,000 mwco, sartorius) down to 1 ml at a final concentration of 0.3 mg / ml. a fraction of 500 l of this sample was subjected to proteolysis with enterokinase on a final volume of 600 l overnight at 4c. after this, the sample was loaded on a his - trap 5 ml column (amersham). the running buffer was 50 mm nah2po4 ph 8.2 ; 300 mm nacl. finally, a 500 mm imidazole step gradient was applied for 20 min. gst - zthe soluble fraction (25 ml), obtained after the induction of pgz and cell disruption by cell press, was clarified by centrifugation at 12,000 g for 30 min, loaded into 1 ml of glutathione sepharose 4b (ge healthcare), and incubated at 4c overnight. after five washes with 50 ml of pbs, the sample was eluted with 2 ml of 25 mm reduced glutathione (sigma) in 50 mm tris - hcl ph 9.5. the eluted fraction was dialyzed against phosphate buffer 20 mm na2hpo4 ph 7.2 at 4c overnight, concentrated down to 1 ml (vivaspin 2, 10,000 mwco, sartorious), and loaded into a superdex 200 column (amersham) using the same buffer conditions at 0.5 ml / min flow. the soluble fraction (25 ml), obtained after the induction of pgz and cell disruption by cell press, was clarified by centrifugation at 12,000 g for 30 min, loaded into 1 ml of glutathione sepharose 4b (ge healthcare), and incubated at 4c overnight. after five washes with 50 ml of pbs, the sample was eluted with 2 ml of 25 mm reduced glutathione (sigma) in 50 mm tris - hcl ph 9.5. the eluted fraction was dialyzed against phosphate buffer 20 mm na2hpo4 ph 7.2 at 4c overnight, concentrated down to 1 ml (vivaspin 2, 10,000 mwco, sartorious), and loaded into a superdex 200 column (amersham) using the same buffer conditions at 0.5 ml / min flow. cleavage and purification of gst - zgst - z was dialyzed against factor xa cleavage buffer (50 mm tris - hcl ph 7.5 ; 150 mm nacl ; 1 mm cacl2) and 600 l of this sample were subjected to proteolysis with factor xa protease at room temperature overnight. the reaction product was incubated with glutathione sepharose for 1 h at room temperature to retain the cleaved gst fusion peptide, while z protein was recovered in the supernatant. finally the bound gst protein was eluted with 25 mm reduced glutathione in 50 mm tris - hcl ph 9.5. the reaction products were analyzed by sds - page and western blotting with a polyclonal antiserum specific for the z protein. gst - z was dialyzed against factor xa cleavage buffer (50 mm tris - hcl ph 7.5 ; 150 mm nacl ; 1 mm cacl2) and 600 l of this sample were subjected to proteolysis with factor xa protease at room temperature overnight. the reaction product was incubated with glutathione sepharose for 1 h at room temperature to retain the cleaved gst fusion peptide, while z protein was recovered in the supernatant. finally the bound gst protein was eluted with 25 mm reduced glutathione in 50 mm tris - hcl ph 9.5. the reaction products were analyzed by sds - page and western blotting with a polyclonal antiserum specific for the z protein. columns packed with 24 ml bead volumes of superdex 200 gl and superdex 75 gl were used to obtain the target protein in its monomeric form. columns were loaded with 1 ml of sample and run at 0.5 ml / min flow using an akta fplc (amersham). for tio - z - v5-his recombinant protein, the running buffer was 50 mm nah2po4, 300 mm nacl ph 8. for the gst - z recombinant protein it was 20 mm na2hpo4 ph 7.2. before each protein separation, a molecular weight marker (bio - rad) was run for calibration purposes using the corresponding running buffer. a serial dilution 1/10 to 1/10,000 from a stock of 0.1 mg / ml of chymotrypsin (roche) and trypsin (roche) were incubated with a 0.5 g/l of gst - z recombinant protein, for 2 h at room temperature. the reaction was stopped by adding sds - page sample buffer or by incubating the reaction at 20c. the samples subjected to limited proteolysis with chymotrypsin were loaded on a 15% sds - page and blotted to a pvc membrane (amersham). the n - terminal sequence of relevant peptides was then obtained using an applied biosystems sequencer abi494. briefly, the purified tio - z - v5-his fusion protein was used to inoculate two female new zealand white rabbits with an average weight of 2.5 kg. before each inoculation, the animals were bled from the marginal ear vein for evaluation of antibody titers. for the first injection, 50 g of purified recombinant protein / kg of body weight were emulsified in an equal volume of complete freund 's adjuvant (sigma chemicals co) and administered subcutaneously. after 25 days, the animals were bled as described above and inoculated with 50 g of purified recombinant protein / kg of body weight emulsified in an equal volume of incomplete freund 's adjuvant (sigma chemicals co). this procedure was repeated twice with a time interval of 15 days and a last bleeding was carried out by cardiac puncture. the antibody titer was estimated by inhouse eia as described in argelles.. tio - z - v5-his fusion protein was used as antigen in different assays, with the exception of the cutoff determination, where gst - z was used as antigen against the heterologous sera. purification of g type immunoglobulin (igg) fractions from antiserum was carried out by affinity chromatography on protein g - sepharose fast flow (pharmacia) according to the manufacturer 's recommendations. igg yield, determined by absorbance at 280 nm, was 3.2 mg / ml serum. for inhouse eia, microtiter plates (nunc, roskilde, denmark) were coated overnight at 4c with tio - z - v5-his fusion protein diluted to 10 g / ml in 0.1 m bicarbonate buffer (ph 9.6) as antigen. after this, and after each of the following steps, the plates were washed three times with washing solution, that is, phosphate - buffered saline (pbs), 0.5 m nacl, and 0.2% (v / v) fifty microliters of each serum sample diluted 1/300 in sample buffer (i.e., 1% wt / vol bovine serum albumin in washing solution) were added to the antigen - coated wells, and the plates were incubated at 37c for 1 h. peroxidase - conjugated antirabbit igg (santa cruz biotechnology) diluted 1/16,000 in sample buffer was added at 50 l / well and incubated further for 1 h at 37c. bound antibodies and conjugates were then developed with orthophenylenediamine (sigma chemical co), 30% h2o2,and citrate buffer ph 5.0 at a ratio of 1 mg/l / ml according to standard procedures. the optical density (od) was measured at a wavelength of 490 nm (od490) (max line tm enzyme - linked immunosorbent assay reader ; molecular devices, sunnyvale, ca). each serum was simultaneously tested with corresponding control antigens, that is, preimmune serum. the results were expressed as the value of the od of the control antigen subtracted from the od of the fusion protein antigen for each serum sample. the enzyme - linked immunosorbent assay cutoff value was estimated as the mean od obtained with 20 certified negative specimens plus 3 standard deviations. these negative specimens were heterologous sera, diluted 1/300, and the antigen used was the gst - z fusion protein. the extracts of bacterial cells and insect cell lines infected with recombinant baculovirus were separated by sds - page (1215% polyacrylamide gel) and blotted onto nitrocellulose membranes (hybond p, amersham pharmacia) in tris - glycine buffer containing 20% (v / v) methanol. to avoid nonspecific binding of the antibodies, the membranes were blocked by incubation with 5% wt / vol skimmed powder milk in pbs for a minimum of 2 h at 37c. for the primary antibody incubation the blocked membrane was probed with a 1/1,000 dilution of the polyclonal antiserum specific for the z protein on pbs 2% casein 0.1% tween-20 at 37c for 1 h, followed by an incubation with horseradish - peroxidase conjugated goat anti - rabbit igg (santa cruz biotechnology), diluted 1/10,000 on pbs 0.1% tween-20 at 37c for 1 h. after each step the membrane was washed three times with pbs 0.1% tween-20, 5 minutes each time. supernatants were then ultracentrifuged in order to pellet down small particles, and these fractions were treated with proteinase k (0.1 mg / ml, 37c, 30 min), or a combination of proteinase k plus 1% triton x-100 in the same conditions. proteolysis was stopped by adding 100 mm pmsf and boiling the samples for 10 min. sequencesamino acid sequences of the following arenavirus were obtained from the genbank database (accession numbers are indicated between brackets) : amav - bean70563 (aby59841.1), cpxv - bean119303 (aby59842.1), gtov - cvh-961104 (aat77691.1), gtov - vhf-3990 (aat77689.1), junv - mc2 (aby59838.1), junv - candid#1 (aau34182.1), macv - maru-222688 (aay27821.1), macv-9530537 (aay27823.1), tacv (np_694847.1), latv - maru-10924 (aay27824.1), olvv-3229 (aby59840.1), pirv - vav488 (aby59836.1), pirv-1743 (aat77682.1), allv - clhp2472 (aby59833.1), picv - an3739 (yp_138535.1), bcnv - a0060209 (aby59834.1), bcnv - ava0070039 (aax99343.1), wwav - av9310135 (aax99351.1), tamv - w10777 (aax99348.1), lcmv - clone#13 (abc96003.1), lcmv - mx (caa10342.1), lasv - csf (aao59514.1), lasv - av (aao59508.1), ippy - dakanb188 (yp_516232.1), mobv - acar3080 (yp_516228.1), mopv - an20410 (yp_170707.1), mopv - mozambique (abc71136.1), lujo (yp_002929492), and morogoro (acj24975.1). amino acid sequences of the following arenavirus were obtained from the genbank database (accession numbers are indicated between brackets) : amav - bean70563 (aby59841.1), cpxv - bean119303 (aby59842.1), gtov - cvh-961104 (aat77691.1), gtov - vhf-3990 (aat77689.1), junv - mc2 (aby59838.1), junv - candid#1 (aau34182.1), macv - maru-222688 (aay27821.1), macv-9530537 (aay27823.1), tacv (np_694847.1), latv - maru-10924 (aay27824.1), olvv-3229 (aby59840.1), pirv - vav488 (aby59836.1), pirv-1743 (aat77682.1), allv - clhp2472 (aby59833.1), picv - an3739 (yp_138535.1), bcnv - a0060209 (aby59834.1), bcnv - ava0070039 (aax99343.1), wwav - av9310135 (aax99351.1), tamv - w10777 (aax99348.1), lcmv - clone#13 (abc96003.1), lcmv - mx (caa10342.1), lasv - csf (aao59514.1), lasv - av (aao59508.1), ippy - dakanb188 (yp_516232.1), mobv - acar3080 (yp_516228.1), mopv - an20410 (yp_170707.1), mopv - mozambique (abc71136.1), lujo (yp_002929492), and morogoro (acj24975.1). alignmentssequence alignments were done using the clustal x program [31, 32 ]. sequence alignments were done using the clustal x program [31, 32 ]. synthetically, the sequence logo is a graphic representation of a multiple alignment of sequences. the stacking height indicates the local information content in this position, while the height of each symbol inside the stacking is the fraction of information content representing the frequency of each residue in that position. because of the characteristics of the software, and to avoid bias towards particular species that are found over - represented in the sequence data bank, at most two strains for each viral species were selected. moreover, to get a more accurate representation, gap positions within the sequences in the alignment were considered as another character. the usual behavior of the software does not take into account the gaps, calculating the values relative to the number of sequences with an amino acid in that position. all the motif descriptions were annotated according to the syntax rules of prosite, and represent more than 60% of all z protein sequences. synthetically, the sequence logo is a graphic representation of a multiple alignment of sequences. the stacking height indicates the local information content in this position, while the height of each symbol inside the stacking is the fraction of information content representing the frequency of each residue in that position. because of the characteristics of the software, and to avoid bias towards particular species that are found over - represented in the sequence data bank, at most two strains for each viral species were selected. moreover, to get a more accurate representation, gap positions within the sequences in the alignment were considered as another character. the usual behavior of the software does not take into account the gaps, calculating the values relative to the number of sequences with an amino acid in that position. all the motif descriptions were annotated according to the syntax rules of prosite, and represent more than 60% of all z protein sequences. biochemical properties of different recombinant proteins the different biochemical parameters were calculated from the amino acid sequence data using the protparam tool found at the expasy proteomics server (www.expasy.ch, proteomics tools, primary structure analysis ;). the different biochemical parameters were calculated from the amino acid sequence data using the protparam tool found at the expasy proteomics server (www.expasy.ch, proteomics tools, primary structure analysis ;). in figure 1, three z protein alignments (old world, new world, and all arenaviruses) are shown separately. in the top of the figure a diagram of the z protein we observe a myristoylation recognition motif in the amino end region, a ring finger domain, characterized by the seven cysteines (at positions 43, 46, 56, 62, 65, 76, and 79 in the alignment) and one histidine at the 59 position in the central core region, and different late domains (found in other viral matrix proteins) at the carboxyl end region. in the amino end region the most conserved island contains 7 amino acids comprising the first two amino acids (mg) that include the glycine modified by the myristic acid aggregate (gly2, completely conserved) (gray shadowed in figure 1). the other amino acids in this region are basic residues (k or r), or amino acid residues with amide (q or n), sulfhydryl (c), or hydroxyl (s or y) groups, probably constituting additional factors for membrane attachment. the rest of the fragment has poor conservation degree, with the exception of another island for the old world arenavirus group (rx4pd, where x is any amino acid, underlined in figure 1). in the z protein core region, particularly, the 7 cysteines and the histidine residues required for zn binding and folding of the predicted ring finger domain (gray shadowed in figure 1). these residues are totally conserved in the viral family, indicating strong selection pressure for keeping the predicted ring finger domain. other positions within this region also show high conservation degree between both groups (new and old world arenavirus). for example residues k44, w47, and l53 are completely conserved among all arenaviruses, suggesting they might play a critical role in protein folding, or maybe protein - protein interactions required for function, such as eif4e interaction. furthermore, the amino end of this domain, shows a sequence motif characteristic for each group (l[yh]gr[yf]n, for the new world arenavirus, and gp[elq][fns ], for the old world arenavirus). until the moment, the role of this region is unknown, but it is interesting to highlight that the degree of conservation is unique within the z protein, although differing among groups. it is therefore possible to hypothesize that this region could be associated with the arenavirus host range. in addition, at the carboxyl end of the ring finger domain, another conserved site within groups is detected, described as kx(0,1)plptx[il ] (where x can be any amino acid). this putative site is underlined in figure 1, where it can be seen that the conservation is stronger in the old world arenavirus group. furthemore, by modifying the first conserved leucine in this site (l83), it was demonstrated that this residue is involved in both the rescue of nucleocapsids and the incorporation of glycoproteins into infectious virus - like particles. finally, a cluster of conserved sites, in an island configuration, can also be found at the carboxyl end region. this island includes the characteristic motifs found in viral matrix proteins of retroviruses (late domains) : p[ts]ap and pppy (gray shadowed in figure 1). these two motifs are present in the old world arenavirus group, while in the new world arenavirus group only the first one is found. another late domain found but situated in the core region was ylcl (yxxl [18, 19, 39, 40 ]) (underlined in figure 1). the ylcl motif is also present in the tacaribe virus z protein and was observed not to be involved with budding of virus like - particles. interestingly, tacaribe z protein does not posses the p[ts]ap motif present in the majority of arenaviruses including junin z. another late domain frequently identified in matrix proteins of negative - stranded rna viruses is pxv (where indicates a hydrophobic residue and x any aminoacid,), however the same was not found in the sequence of arenaviruses z protein. for the different fusion proteins, several parameters were calculated and are shown in table 1. the z protein indicates the product of translation from the 366 bp fragment (z). near 90 days after first inoculation with the tio - z - v5-his protein, the inoculated rabbits were heart bled, obtaining 30 ml of blood. after serum separation, the same was used to determine the cutoff value, yielding a number of 0.165. afterwards, the polyclonal serum titer was determined, defined as the bigger serum dilution that renders a positive reaction (more than the cutoff value). for this determination, the assay conditions were the same as those in the assay cutoff determination, obtaining an antiserum titer of 128,000. then, the iggs were purified by affinity chromatography to later obtain more specific z detection. the different fractions were analyzed by sds - page (data not shown) and quantified by bradford method using a goat igg as concentration reference in a calibration curve. the expression profile of the recombinant tio - z - v5-his protein is shown in figure 2. in figure 2(a) a diagram of the expressed recombinant orf is shown. in figure 2(b) the lanes corresponding to t0 indicate the moment when the iptg was added to the culture, while the tf lanes indicate the final culture time. after induction, a protein of expected size was expressed (figure 2(b)). following cell disruption, sds - page analysis confirmed it was possible to obtain a considerable amount of tio - z - v5-his in the soluble fraction (figure 2(c)). the soluble fraction of tio - z - v5-his was loaded into a his - trap column and monitored at uv280 and uv254. the peak fractions were collected and analyzed by 12% sds - page, containing a main band corresponding to the molecular weight of tio - z - v5-his (ca. 27 kda) (figure 2(d)). final yield of pure tio - z - v5-his protein was between 10 and 12 mg per liter of culture. in order to further purify tio - z - v5-his, selected fractions were pooled, concentrated and loaded into a superdex 200 gel filtration column (figure 2(e)). the obtained tio - z - v5-his was dialyzed, concentrated and subjected to proteolysis with enterokinase. the cleaved products, thioredoxine (12.8 kda) and z - v5-his (14.5 kda) were visible after 2 h at 37c incubation (figure 2(f)). the products of this reaction were loaded into a his - trap column, as previously described and two major peaks were observed after elution. the first peak corresponded to thioredoxine, which eluted at 100 mm imidazole concentration, and the second peak corresponded to z - v5-his protein, which eluted at 250 mm imidazole concentration (data not shown). the fractions of the second peak were pooled, concentrated (vivaspin 2 5,000 mwco, sartorius) and analyzed by sds - page and western blotting with anti - z igg (figure 2(g) and 2(h)). in both cases a band of ca. the expression profile of the recombinant gst - z protein is shown in figure 3. a diagram of the expressed recombinant orf can be seen in figure 3(a). in figure 3(b), the overexpression of a protein with a size of about 37 kda is shown, where the lane t0 indicates the moment when the iptg was added to the culture, while the tflane indicates the final culture time. the soluble fraction, after cell lysis, was mixed with glutathione sepharose resin for batch purification of the gst - z protein. a protein of about 37 kda was present in the first wash fraction ; nevertheless, it was possible to obtain significant quantities of a ca. 37 kda protein retained in the glutathione sepharose (figure 3(c), lanes e1 and e2). these two peptides, retained together with the bigger protein, were probably degradation products of the ca.. final yield of pure gst - z protein was between 5 and 8 mg per liter of culture. the eluted fractions were pooled, concentrated and loaded into a superdex 200 gel filtration column. the molecular weight of the peaks was estimated from the chromatogram profile (figure 3(d)). 37 kda band and the other two, of approximately 29 kda and 25 kda, were present in different proportions. most of the 37 kda polypeptide was present at the high molecular weight peak (ca. 700 kda), indicating that most of the overexpressed gst - z protein was aggregated (figure 3(d)), lanes 6 to 10). in the collected fractions of the second peak, the 37 kda band was also detected, indicating that a portion of the overexpressed protein was soluble and monomeric (figure 3(d), lanes 11 to 16). to obtain the z protein without the gst fusion peptide, the purified gst - z obtained after the glutathione sepharose purification was dialyzed against cleavage buffer and subjected to proteolysis with factor xa. the expected cleavage products, gst fusion peptide and z protein were observed. to confirm the identity of the last product the sample was analyzed by western blot with polyclonal antiserum specific for the z protein (-tio - z - v5-his) and antibodies specific for fusion protein (-gst). finally, as shown in figure 3(f), it was possible to detect a ca. 11.5 kda protein corresponding to z. however, it was evident that the cleavage reaction was incomplete, because the full - length ca. 29 kda peptide was also recognized by the z polyclonal antiserum, strengthening the hypothesis that it was a degradation product of gst - z. to confirm this hypothesis, the purified gst - z (obtained after gel filtration in the 40 kda peak) the peptides thus obtained were subjected to n - terminal sequencing (figure 3(g)). the bands indicated with i match with the first six amino acids of the gst protein sequence, and the bands pointed out with ii and iii matched the c - terminal of gst and the middle region of z protein, respectively. expression results obtained for the recombinant his - z protein are shown in figure 4. a diagram of the tagged protein obtained using the bac - to - bac expression system is shown in figure 4(a). the v_ac - z construct (recombinant bacmid) was transfected into high five or sf9 insect cells, and the resulting viral stock was amplified by infection in the same type of cells. the infection assays, optimized to obtain high virus titers, rendered a stock with a titer of 1.2 10 pfu / ml. in addition to infecting different cell lines, different multiplicities of infection (moi) were tested, as shown in figure 4(b). sf9 insect cells were infected and, after 36 h, the monolayer fraction was collected and analyzed by 16% sds - page. in this case z - his protein was detected in the cellular fraction (lane 1 and 2, figure 4(c)) when the purified -tio - z - v5-his igg was used in a western blot. in this experiment, two z corresponding bands appeared, same as observed previously by jcamo and coworkers when tacaribe virus recombinant z protein was expressed. nevertheless, by using anti - his polyclonal serum for western blotting it was not possible to visualize his - z expression (figure 4(d)). this suggests that possibly in insect cell lines his - z could be subjected to a post - translational process that modifies the amino end of his - z. in order to ascertain the location of this protein in the supernatant fraction, the same was analyzed by western blot and a proteinase k protection assay (figure 5) the general aim of any heterologous expression system is to obtain a purified protein in its native conformation. 11 kda) viral protein normally expressed in the late phases of the arenavirus infection in mammalian cells. however, there are some applications for which it is not necessary to obtain the protein in the native conformation, for example for antibodies production. also, it has been reported that post - translational modifications are few in many proteins ; therefore in these cases the bacterial expression systems are really advantageous because they have higher expression levels and lower costs when compared to eukaryotic expression systems. thus, the system will be selected depending on the application of the recombinant product. using the sequence logo (figure 1) the conservation of amino acids for the arenaviral z proteins z proteins could be divided into three characteristic regions named amino, core and carboxyl regions. each region comprises previously described z protein domains. the myristoylation domain into the amino region, the ring finger domain into the core, and the late domains into the carboxyl region. although the role of these last domains is today unknown, they could be a likely target for studies associated with the arenavirus host range. simple methodologies that allowed z protein expression and facilitated its subsequent purification were employed. during the analysis of the z protein expression in bacteria it was not possible to obtain the product without a fusion protein or tags. probably, the reason for low z protein yield during purification is its hydrophobicity, causing it to form relatively insoluble intracellular inclusion bodies that must be denatured. the borden laboratory discovered that including zn in the iptg - induction media or in the lysis buffers greatly improved yields of recombinant z protein. although we included zn in the purification process, we have not yet tested a purification protocol that uses denaturing buffers. several expression strategies were tested, including cell hosts with different biological properties ; it was only possible to achieve the goal when z 's amino terminus was fused to a bacterial protein. this fusion stabilized the recombinant protein and improved the expression levels. in this work the over - expression of three different recombinant variants of z protein : (1) tio - z - v5-his, (2) gst - z, and (3) his - z, was achieved. this last fusion protein was obtained from a baculoviral system in an insect cell line, while the other two were obtained from bacterial systems. the three variants of z protein obtained can be cleaved from their n - fusion protein ; tio - z - v5-his after proteolysis keeps the v5 epitope and the his tag. any of the expressed recombinant z proteins could be used to obtain polyclonal or monoclonal antibodies that would allow immunological experiments to answer questions about the molecular biology of junn virus. for example, studies of biological activity in different cell lines, cellular localization and protein interactions. moreover, this serum could be useful for affinity chromatography designed to allow simple purification of z protein without tags, or z protein obtained after proteolysis of its fusion partner. tio - z - v5-his recombinant protein was selected for antibody production, mainly because it showed the best expression level and solubility. purified igg fraction for subsequent western blotting and eia, was also obtained. on the other side, the purified tio - z - v5-his was used as substrate for the enk reaction, in order to obtain z - v5-his, employed as positive control in different assays. tio - z - v5-his and his - z fusion proteins can be purified by imac, since both peptides have his - tags. however, this purification method could be counterproductive for the purification of native z, since it is not known how co or ni ions could modify z structure by binding and affecting its ring finger domain. it was observed that the native structure of z protein contains two zn atoms, and other transition metals could interfere with these sites. on the other hand, the gst - z fusion protein can be purified by affinity chromatography with glutathione resins, without using immobilized metals. its expression and purification was optimized with the aim to obtain the viral protein without tags on its native conformation, ready for crystallographic studies. the proteolysis of gst - z protein with factor xa, produced only two peptides : gst and z. the proteolysis reaction was successful because : (1) in sds - page analysis, at different times of the proteolysis reaction with factor xa, decreasing of gst - z and increasing of individual gst and z was observed ; and (2) by western blot analysis, the z protein identity after the proteolysis reaction was asserted (figures 3(e) and 3(f)). consequently, high concentrations of z protein (necessary for crystallographic studies) could be obtained. in addition, after gst - z purification, the presence of two proteins that copurified with gst - z was observed (indicated with i in the figure 3(g)). a similar phenomenon has been previously reported. the western blot, with igg purified from polyclonal anti - z serum recognized the gst - z protein and other copurified peptide (ca. 29 kda), whiles the control, gst alone, did not generate signal. nevertheless, apparently this peptide is not a substrate of factor xa. in summary, the copurified peptides had high affinity for glutathione resin, so they probably contained gst derived amino acids, and one of them was recognized by the anti - z serum, so it had z derived amino acids. to confirm these facts the n - terminus of the copurified peptides, and some peptides obtained by limited proteolysis with chymotrypsin were sequenced (figure 3(g)). this assay allowed the identification of structured domains, which were less sensitive to proteolysis, and could be better candidates for crystallographic studies. we found that one of the copurified peptides, the one of approximately 25 kda, was stable even at high chymotrypsin concentrations. the n - terminus of this peptide shared the sequence with the first six amino acids of gst, indicating that degradation occurred by the carboxyl terminus of the recombinant protein. the same results were obtained after analyzing the n - terminus of the approximately 29 kda copurified protein, which was also stable after the chymotrypsin treatment. thus, it was possible that these low molecular weight peptides contained fragments of z protein at its c - terminus. two of them were sequenced at the n - terminus because, according to the molecular weight estimated by the electrophoretical migration, the z protein sequence would be included (indicated with ii and iii in the figure 3(g)). we could not establish the c - terminal sequence of the two copurified peptides, so we still do not know the specific site of cleavage of gst - z in order to determine a stable domain. however, the approximate stable polypeptide corresponds to most of gst, which is not of our interest for crystallographic studies. a subsequent approach to obtain z protein in a native conformation could take advantage of its interactions with host proteins, such as the promyelocytic leukemia protein (pml) and others ; it might be possible to overexpress z and its interaction partner fused to a suitable tag for affinity purification. this would allow the copurification of the complex by affinity chromatography to later obtain native z. for lassa arenavirus it was demonstrated that expression of z in mammalian cell lines was sufficient for budding of pseudo - virions or z - containing membranous particles. apparently, glycine myristoylation at position 2 of z sequence is critical for this phenomenon [4749 ]. this glycine residue is completely conserved in z protein from all members of arenaviridae (figure 1). this suggests that all z homologues within the arenaviridae family are myristoylated at this position. currently, all reports of pseudo - virion budding employed mammalian cell lines. at the present it is not known whether insect cell lines are capable of recognizing this post - translational modification signal present in z, so during this work we started testing this possibility. when insect cell lines were used for z expression, high levels of expression were not achieved (figure 4(b)). for this system, z was his - tagged so it could be purified by imac and then untagged by tev protease cleavage. interestingly, z was detected in the cellular fraction by means of western blotting with -tio - z - v5-his iggs, but it was not possible to detect it using an anti -his tag antibody (figures 4(c) and 4(d), resp.). the absence of his - tag signal could indicate the removal of the his - tag from the protein, by a yet unidentified cellular process, or possible protein degradation at this particular site. besides protein western blot, a purification of the protein by imac was attempted, but no retention of protein from a cellular protein extract was observed (data not shown). interestingly, when the cell culture supernatant fraction was analyzed using a proteinase k protection assay, the results indicated that z was included within small lipid vesicles, although other confirmatory assays such as immuno electron microscopy will be required in order to unambiguously confirm this. the next step will be to further investigate the z - membrane vesicles obtained from these cell lines. if n - myristoylation of z in insect cells is proven to be effective, it will be necessary to modify the constructions for purification purposes. the employment of insect cell lines would represent a much safer methodology to obtain virus like particles, which have potential use as vaccine against arenaviruses for which successful treatment has not yet been established. | arenaviridae comprises 23 recognized virus species with a bipartite ssrna genome and an ambisense coding strategy. the virions are enveloped and include nonequimolar amounts of each genomic rna species, designated l and s, coding for four orfs (n, gpc, l, and z). the arenavirus junn (junv) is the etiological agent of argentine hemorrhagic fever, an acute disease with high mortality rate. it has been proposed that z is the functional counterpart of the matrix proteins found in other negative - stranded enveloped rna viruses. here we report the optimized expression of a synthetic gene of z protein, using three expression systems (two bacterial and a baculoviral one). one of these recombinant proteins was used to generate antibodies. a bioinformatic analysis was made where z was subdivided into three domains. the data presented contributes methodologies for z recombinant production and provides the basis for the development of new experiments to test its function. |
in critical care, as in other areas of health care, clinicians are faced with rising health care costs and aging and increasingly complex patients. furthermore, the rate of research knowledge production is outstripping our ability to incorporate this information into patient care. these factors, as well as the increasing awareness of the risks of medical error, have highlighted the potential benefits of information technology to clinical care. the paper by morrison and colleagues in the previous issue of critical care describes the impact of the introduction of an electronic patient record on interdisciplinary communication during intensive care unit (icu) ward rounds. critical care is a data - rich environment where it appears obvious that computing technology would be of benefit in managing the large amount of data generated by each patient, but few studies have formally evaluated the effects of introducing an information system into the icu. some studies have addressed the benefits of clinical information systems with automated data capture from icu devices, demonstrating a reduction in nursing workload, but this finding is certainly not uniform. furthermore, the reduction in common errors of omission and commission may be replaced by new errors facilitated by the technology itself. it is with this fairly limited background that the paper by morrison and colleagues provides an important insight into another potential problem introduced by computing technology in the icu. these investigators evaluated the effect of the introduction of an electronic patient record on team interactions and communication during icu rounds. in a before - and - after study of the implementation of a fully integrated electronic patient record into their 25-bed icu, they observed and video - recorded team interactions during daily rounds. in the physical setup after implementation, data were presented on a computer screen (rather than on a large observation chart plus additional charts and folders) and as a result were accessible to only a few team members. the attention of the group was no longer focused on the patient data and it was noted that team members had difficulty entering the conversation, impairing communication. one year after implementation, the process had improved ; the physician leading rounds stood further back from the screen and the team members reoriented themselves. staff reported preparing for the ward round by reviewing data that they would not have access to during the round. multidisciplinary communication and teamwork are essential to icu care, and impaired communication in high - intensity clinical settings has been documented. however, the paper by morrison and colleagues demonstrates that information technology may, in fact, introduce new barriers to communication. while these were overcome to some extent over a period of time by changing the format of the ward round, this is an issue that needs to be recognized, anticipated, and resolved. a single small screen may not be adequate to view the large amount of patient data generated daily, even with optimal software solutions. morrison and colleagues discuss the fact that the cost of larger screens was prohibitive and handheld devices discourage communication, while ironically a paper printout for each team member was beneficial. morrison and colleagues are to be congratulated for their foresight in evaluating an important component of their new information and communication technology. while information systems and electronic patient records may be a solution for many of the current problems in health care, this clinical intervention requires an evidence - based assessment similar to that to which other clinical innovations are subject. it is essential to identify and prevent the potential hazards and negative effects of information technology. the use of fully integrated icu clinical information systems is not yet widespread in many areas, providing the opportunity for preplanned, comprehensive, and continual evaluation during the full life cycle of implementation and use of such systems. | information and communication technology has the potential to address many problems encountered in intensive care unit (icu) care, namely managing large amounts of patient and research data and reducing medical errors. the paper by morrison and colleagues in the previous issue of critical care describes the adverse impact of introducing an electronic patient record in the icu on multi - disciplinary communication during ward rounds. the importance of evaluation and technology assessment in the implementation and use of new computing technology is highlighted. |
stroke patients are characterized by an asymmetric posture due to decreased movement, and this asymmetric posture makes balance control in a standing posture difficult, as a result of the center of pressure moving toward the lower limb of the unaffected side, triggering problems with postural control ability1. loss of balance ability in stroke patients may cause increased postural sway, reduction of weight on the lower limb of the affected side, and increased fall risk2. in general, balance or postural stability refers to maintaining the center of mass within the support surface to maintain static action and to perform desired motions. balance ability is essential for functional activities, as well as for actions such as sitting, standing, and walking3. to maintain and adjust balance, the proprioceptive, visual, and vestibular senses must interact4. however, 65% of stroke patients experience loss of tactile and proprioceptive senses, largely because of impaired in proprioception resulting from lowered muscle tone5. these include therapeutic exercises, such as weight shifting to the lower limb of the affected side, proprioceptive neuromuscular facilitation techniques, bobath techniques, neurodevelopmental facilitation techniques, and task - oriented exercises6, 7. repetitive exercise is necessary to improve balance, and ankle - foot orthoses are used for hours when there is excessive spasticity or deformity. ankle orthoses stabilize the ankle joint and compensate for insufficient ankle dorsiflexion and mediolateral instability of the subtalar joint, increasing balance ability. they also facilitate medial shift of the center of mass and weight shift toward the foot of the affected side, reducing asymmetric body posture8. dysfunction of the foot and the ankle joint of stroke patients are closely associated with functional and kinetic aspects of the lumbar region and lower limbs, inevitably triggering overall body imbalance9. the ankle joint and the hip joint play important roles in providing body stability during stroke patients balance training. the first type of postural control strategy is the ankle joint strategy, which primarily improves standing balance through muscle contraction of the ankle joint10. while walking with an ankle - foot orthosis, the moment of the dorsiflexion angle during the stance phase and plantarflexion during the terminal stance may increase11. in a static standing position, the ankle joint is used frequently12, and according to comparisons of muscular strength between those who have experienced falls and those who have not, the extensors of the hip joint and the plantar flexor of the ankle joint show significant differences13, indicating that loss of balance ability is closely related to the weakening of ankle strength14. therefore, the purpose of this study was to examine the effects of balance training with an ankle - foot orthosis on stroke patients lower limb muscle activities and static balance maintenance. the subjects of this study were 25 stroke patients, and they were randomly assigned to a group with ankle - foot orthosis shoes (afo, n=13) and a group with shoes (n=12) (table 1table 1. the general characteristics of the subjectsvariablesgroupafo group (n=13)shoes group (n=12)sexmale5 (38.5%)4 (33.3%)female8 (61.5%)8 (66.7%)diagnosisinfarction5 (38.5%)3 (25%)hemorrhage8 (61.5%)9 (75%)affected sideleft10 (76.9%)7 (58.3%)right3 (23.1%)5 (41.7%)onset time (months)9.0 1.29.9 1.0age (years)58.9 5.557.2 4.4height (cm)160.8 8.5159.2 7.4weight (kg)56.6 8.557.2 8.2ashworth scalegastrocnemius2 12 1values are number (%) or mean sd). prior to participation in this study, the purpose was explained to the subjects and their guardians, and they consented to participate voluntarily. the research and development review board for human subjects of hallym university approved this study. inclusion criteria were : a diagnosis of stroke within the previous 612 months ; no evidence of vestibular system disorders, neurological deficits in the bilateral lower limbs, or visual or auditory disorders ; a mini mental state examination - korean score of 23 or higher ; a berg balance scale score of 40 or higher without any musculoskeletal deficit that affected standing balance ; and agreement to wear a plastic ankle - foot orthosis of the plantar flexion 90 ankle stop - type. values are number (%) or mean sd a tele myo 2400 t dynamic electromyograph (emg, noraxon inc. arizona, usa) was employed to measure muscle activities of the lower limbs. the electrodes were attached to the affected side over the tibialis anterior muscle at one - third of the distance from the proximal tibialis anterior muscle, and the muscle belly of the medial gastrocnemius muscle 2 cm proximal from where the achilles tendon encounters the medial gastrocnemius muscle. the collected surface emg signals were digitized using myoresearch - xp 1.07 software : emg signals were sampled at 1000 hz, bandpass - filtered between 20 to 500 hz, and processed with a 60 hz notch filter. a tetrax portable multiple system (tetrax, tetrax ltd, ramat gan, israel) was used to measure balance ability15. when a subject places a foot on the force plate, the data of the pressure on the force plate is amplified and filtered before being delivered to a computer. for the measurement of static balance ability, the stability index was obtained, and the collected data were recorded as percentages of the subjects body weights. the ankle - foot orthosis used in this study was a joint type, and it was appended and raised by 1/8 of an inch so that the medial malleolus and the lateral malleolus did not meet, and the arch support maintained or supported the longitudinal arch when it was worn. the medial and lateral sides of the caput metatarsals tend to widen when they support weight ; therefore, each of the medial sides and the lateral sides were widened by 1/16 inch and the orthosis was made to be a plantar flexion 90 ankle stop - type using a 5 mm thick thermoplastic material that melted at 170 c. bands wrapped around the top of the shoes so that they were not easy to remove, and they were made lightweight so that they could be used indoors. prior to and after the balance training, muscle activities and balance ability were measured. four balance exercises were conducted, two on flat ground and two on a balance pad (balance pad, airex, switzerland) for a total of 20 minutes (table 2table 2. program for balance trainingperiodcompositiontraining methodstimerest06 weekson the floor standing on two feet 1 m15 sstanding with both knees flexed1 m15 sstanding on the affected leg while holding a chair with the unaffected arm1 m15 salternate leg raise : standing on a foothold 20 cm high 1 m15 s06 weekson a balance pad standing on two feet 1 m15 sstanding with both knees flexed1 m15 sstanding on the affected leg while holding a chair with the unaffected arm1 m15 salternate leg raise : standing on a foothold 20 cm high 1 m15 s)16, 17. to measure the muscle activities in a standing position, the subject maintained a standing position in bare feet for five seconds. data were recorded for three seconds from the tibialis anterior muscle and the medial gastrocnemius muscle of the affected side ; the first and the last one seconds were excluded from the data analysis. muscle activity signals of each muscle were converted to root mean square values, and expressed as % maximum voluntary isometric contraction (% mvic). for the measurement of balance ability, the subjects stood on a hard surface with their eyes open and with their eyes closed and on a soft pillow with their eyes open and with their eyes closed. measurements were made three times in each position, and the average values were used the analysis. we used the independent t - test to compare differences between the two groups, and the paired t - test to compare within - group differences, before and after the intervention. muscle activity prior to and after the balance training was compared between the afo and shoes group. muscle activity of the tibialis anterior muscle of the affected side of the afo group decreased from 19.93 4.85% prior to the balance training to 16.71 3.88% after the balance training and muscle activity of the medial gastrocnemius muscle of the affected side increased from 23.65 8.10% prior to the balance training to 26.64 5.83% after the balance training, and both differences were significant (p<0.05). muscle activity of the tibialis anterior muscle of the affected side of the shoes group decreased from 20.26 3.83% prior to the balance training to 20.23 3.49% after the balance training and muscle activity of the medial gastrocnemius muscle of the affected side increased from 24.87 4.59% prior to the balance training to 25.51 5.11% after the balance training ; neither of the differences was significantly different. there was a significant difference in the muscle activities of the tibialis anterior muscle of the affected side between the afo and shoes groups (p<0.05) (table 3table 3. comparison of muscle activities between the two groupsvariablesgroupafo group (n=13)mean sdshoes group (n=12) mean sdpta (%) pre-19.93 4.8520.26 3.83post-16.71 3.8820.23 3.49change3.22 0.570.03 0.49pmg (%) pre-23.65 8.1024.87 4.59post-26.64 5.8325.51 5.11change3.00 0.810.63 0.59indicates a significant difference between before and after, indicates a significant difference between the two groups, p<0.05. pta : paralyzed side tibialis anterior muscle, pmg : paralyzed side medial gastrocnemius, afo : ankle foot orthosis. comparison within the group and comparison between the groups were made using the paired sample t - test and the independent sample t - test, respectively.). stability indexes prior to and after the balance training between the afo and shoes group were compared. for the afo group, the stability index in a standing position with eyes open (no) decreased from 25.72 2.98 prior to the balance training to 24.07 2.90 after the balance training, the stability index in a standing position with eyes closed (nc) decreased from 35.37 7.19 prior to the balance training to 34.08 6.93 after the balance training, the stability index in a standing position on the pillow with eyes open (po) decreased from 30.13 5.64 prior to the balance training to 29.57 5.95 after the balance training, and the stability index in a standing position on the pillow with their eyes closed (pc) decreased from 38.80 6.70 prior to the balance exercise to 35.76 6.38 after the balance exercise. for the shoes group, the stability index showed significant decreases from 22.45 4.31 to 21.05 4.19 in no, and from 28.03 6.01 to 27.01 6.03 in po (p<0.05). regarding changes in stability index resulting from balance training, there was a significant difference in no between the afo group and the shoes group (p<0.05) (table 4table 4. comparison of the stability index between the two groupscondition groupafo group (n=13)mean sdshoes group (n=12)mean sdnopre-25.72 2.9822.45 4.31post-24.07 2.9021.05 4.19change1.65 0.741.40 0.80ncpre-35.37 7.1931.57 9.28post-34.08 6.9330.52 10.04change1.29 1.351.05 3.22popre-30.13 5.6428.03 6.01post-29.57 5.9527.01 6.03change0.56 0.591.02 1.20pcpre-38.80 6.7032.37 7.51post-35.76 6.3832.25 7.26change3.05 1.750.13 1.40indicates a significant difference between before and after, indicates a significant difference between the two groups, p<0.05. no : normal open, nc : normal close, po : pillow open, pc : pillow close, afo : ankle foot orthosis. comparison within the group and comparison between the groups were made using the paired sample t - test and the independent sample t - test, respectively.). indicates a significant difference between before and after, indicates a significant difference between the two groups, p<0.05. pta : paralyzed side tibialis anterior muscle, pmg : paralyzed side medial gastrocnemius, afo : ankle foot orthosis. comparison within the group and comparison between the groups were made using the paired sample t - test and the independent sample t - test, respectively. indicates a significant difference between before and after, indicates a significant difference between the two groups, p<0.05. no : normal open, nc : normal close, po : pillow open, pc : pillow close, afo : ankle foot orthosis. comparison within the group and comparison between the groups were made using the paired sample t - test and the independent sample t - test, respectively. this study examined the effects of ankle - foot orthosis during balance training of chronic stroke patients on muscle activities and static balance of the lower limbs of stroke patients. after the six weeks of balance training, the data of the two groups were compared to examine muscle activities and static balance around the ankles related to wearing of the ankle - foot orthosis. the stability index was significantly different in the no condition between the groups, and the afo group showed statistically significant differences in all conditions between prior to and after the balance training. the changes in afo group muscle activities were significantly greater than those of the shoes group. after balance training with the ankle - foot orthosis, there was no significant difference in the medial gastrocnemius muscle activity of the affected side, but there was a significant difference in the tibialis anterior muscle activity of the affected side. during balance training with the ankle - foot orthosis, the muscle activity of the tibialis anterior muscle of the affected side decreased and the muscle activity of the medial gastrocnemius muscle increased. however, in the group without the ankle - foot orthosis, there was no pre - post statistically significant difference in either the muscle activity of the tibialis anterior muscle or the medial gastrocnemius muscle of the affected side. this result is consistent with a study in which the ankle muscle activities of nine males and one female in a static standing posture were examined, and the use of the ankle plantar flexor was predominant18. it is also in agreement with a study in which the anterior - posterior center of pressure of six multiple sclerosis patients and four ordinary subjects were examined in a standing position and the use of the gastrocnemius was predominant19. however, an ankle - foot orthosis used postural adjustment by 42 stroke patients whose onset of a stroke was 6 months prior or earlier, and 61 stroke patients whose onset of a stroke was 12 months ago or longer, was effective at providing stability for the ankle of early phase stroke patients but not chronic phase stroke patients, as structural changes has occurred, including changes in alignment and muscle shortening20. there was a statistically significant difference in the stability index of no between the afo and shoes group, but there were no statistically significant differences in nc, po, and pc between the two groups. in the group who wore the ankle - foot orthosis, there were significant differences in the stability indexes of no, nc, po, and pc, and in the group who wore only shoes, there were significant differences in no and po. this result is similar to that of study in which postural sway of 28 stroke and traumatic brain injury patients was measured with and without an ankle - foot orthosis ; when the ankle - foot orthosis was worn, postural sway was small2. our results are also consistent with those of a study in which balance maintenance of 11 stroke patients and 10 ordinary subjects wearing an ankle - foot orthosis was examined : weight shift to the lateral side and an increase in weight bearing on the affected side resulted in more use of an ankle strategy than a hip strategy for stability4. in the rehabilitation process of stroke patients, improvement of balance ability is important. in prescribing orthoses, improvement in balance ability and gait use of an ankle - foot orthosis may be helpful for some stroke patients balance, but stroke patients differ in degree and area of anatomical damage. balance training variables appropriate for patients should be selected, and effective treatment methods should be utilized to maximize patients potential capabilities. generalization of this study is limited, as only those patients meeting the selection criteria were examined. future research that includes the same kind of patients with classification of etiology and brain lesions is necessary. | [purpose ] this study examined the effects of an ankle - foot orthosis worn during balance training on lower limb muscle activity and static balance of chronic stroke patients. [subjects ] the subjects were twenty - five inpatients receiving physical therapy for chronic stroke. [methods ] the chronic stroke patients were divided into two groups : thirteen patients were assigned to the ankle - foot orthosis group, while the remaining twelve patients wore only their shoes. each group performed balance training for 20 minutes, twice per day, 5 days per week, for 6 weeks. the lower limb muscle activities of the paralyzed side tibialis anterior, medial gastrocnemius, and the stability index were measured before and after the 6-week intervention. [results ] comparison of the groups indicated a significant difference in the muscle activity of the paralyzed side tibialis anterior and the stability index of the eyes - open standing position. after the intervention, the ankle - foot orthosis group evidenced a significant difference in the muscle activities of the paralyzed side tibialis anterior and paralyzed side medial gastrocnemius as well as the stability index of the eyes - open standing position, eyes - closed standing position, eyes - open standing position on a sponge, and eyes - closed standing position on a sponge. the group that only wore their shoes showed significant differences in the stability indexes of eyes - open standing and eyes - open standing on a sponge. [conclusion ] using the ankle - foot orthosis was effective during the initial training of lower limb muscle activities and the static balance training of chronic stroke patients. however, it was not effective for a variety of dynamic situations. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.