article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
asthma is a chronic disease characterized by a variety of features including increased airway responsiveness and reversible airways obstruction and inflammation (1). studies on animals and humans have shown that bronchoconstriction is most likely due to the release of inflammatory mediators from different cells (2). although these drugs are effective, but there are many side effects. therefore, the physicians try to find the new drugs that have fewer side effects. scientists are trying to find out new and valid therapies, traditional or folk medicines in parallel with modern medicine (3). nigella sativa l., and its oils have been used traditionally for the treatment of many inflammatory diseases such as asthma (4, 5). thymoquinone is an active ingredient isolated from n. sativa, and previous in vitro and in vivo studies demonstrated its beneficial effects (6). therapeutic effects of thymoquinone on patients with allergic diseases (including allergic rhinitis, bronchial asthma, and atopic eczema) were also demonstrated (7). this constituent attenuates allergic airway inflammation by inhibiting th2 cytokines and eosinophil infiltration into the airways ; thus demonstrates its potential anti - inflammatory role during the allergic response in the lung (9). evidence has increasingly implicated adenosine, the breakdown product of atp, in the pathophysiology of asthma (10). elevated levels of adenosine have been found in blood, bronchoalveolar lavage and exhaled breath condensate of asthmatic patients (11). a number of evidences suggest that adenosine modulates the function of different cells involved in airway inflammation (2). biological functions of adenosine are mediated by four distinct subtypes of receptors (a1, a2a, a2b, and a3). although adenosine receptors are ubiquitously expressed throughout the body, but the relative expression of adenosine receptor sub types is little known. some studies in healthy peripheral lung tissue have suggested that a2 receptor subtypes are much more abundant than the a1 and a3 receptor subtypes (12). the exact mechanism of thymoquinone on asthma has not been cleared yet and adenosine effect in pathophysiology of this disease has been shown before. so in this investigation, the effect of thymoquinone in the presence of selective a2a and a2b adenosine receptor antagonists (zm241385 and mrs1706 respectively) were examined on tracheal responsiveness to methacholine and ovalbumin (oa), and total and differential cell count in lung lavage fluid of sensitized guinea pigs. seventy adult dunkin - hartley guinea pigs (400 to 700 g, male sex) were used throughout the study. the animals were group - housed in individual cages in climate - controlled animal quarters with water and food ad libitum and a12-hr on/12-hr off light cycle. after ten days, for adapting to the new situation, animals were randomly divided into seven groups ; control group (c), oa sensitized group (s), sensitized groups pretreated with thymoquinone (s+tq), sensitized groups pretreated with selective a2a antagonist (zm241385) and selective a2b antagonist (mrs1706) (s+anta a2a and s+anta a2b), sensitized groups pretreated with selective a2a antagonist and thymoquinone (s+anta a2a+tq) and selective a2b antagonist and thymoquinone (s+anta a2b+tq). thymoquinone and each of these antagonists (tocris bioscience ltd., uk) with 3 mg / kg dose were injected intraperitoneally on 10 day of sensitization protocol. sensitization of animals to oa was performed according to our previous study (13). briefly, guinea pigs were sensitized to oa (grade ii sigma chemical ltd., uk) dissolved in saline by injecting 100 mg ip and 100 mg sc on 1 day and a further 10 mg ip on 8 day. from 14 day, sensitized animals were exposed to an aerosol of 4% oa for 181 days, 4 min daily. guinea pigs were slaughtered by a blow on the neck and the trachea was then removed. one tracheal chain in each animal was prepared as follows : the trachea was cut into 10 rings (each containing 2 to 3 cartilaginous rings). then, in order to form a tracheal chain, all the rings were cut open opposite the trachealis muscle and sutured together. tissue was then suspended in a 20ml organ bath (schuler organ bath type 809, germany). the organ bath chambers contained krebs - henseliet solution of the following composition (mm) : kh2po4 (1.2), kcl (4.72), nacl (120), nahco3 (25), mgso4 (0.5), cacl2 (2.5) and dextrose (11). the krebs solution was maintained at 37c and gassed with 95% o2 and 5% co2. tissue was suspended under isotonic tension of 1 g and allowed to equilibrate for at least 1 hr while it was washed with krebs solution every 15min (14). responses were measured by means of an isometric transducer (adinstruments, spain) with a sensitivity range of 0 to 25 g, and amplified with an amplifier (ml/118 quadribridge amp ; march - hugstetten, germany) and recorded on a powerlab (ml-750, 4 channel recorder ; march - hugstetten, germany). in each experiment, a cumulative concentration response curve of methacholine induced contraction of the tracheal chain was obtained. consecutive concentrations (containing 10 to 10 m, dissolved in saline) were added every 3 min. the contraction of each concentration was recorded at the end of 3 min and the effect reached a plateau in all experiments. the percentage of contraction of the tracheal smooth muscle due to each concentration of methacholine in proportion to the maximum contraction obtained by its final concentration was plotted against log concentration of methacholine. the concentration - response curve of methacholine was done in the tracheal chain of all animals of experimental groups. the effective concentration of methacholine causing 50% of maximum response (ec50) was measured from the methacholine response curve in each experiment using 50% of the maximum response in the y axis and measuring the dose of methacholine causing this response in the x axis. the magnitude of contraction as the contractility response to 10 m methacholine was also measured. the tracheal response of all animals to a 0.1% solution of oa was measured in each studied animal as follows : 0.5 ml of 4% oa solution (dissolved in saline) was added to the 20ml organ bath and the degree of tracheal chain contraction was recorded after 15 min and was expressed as a proportion (in percentage) to the contraction obtained with 10 m methacholine. the tracheal responsiveness to methacholin and ovalbumin coincident with preparing the tracheal chain, a cannula was put into the remaining trachea, and the lungs were lavaged with 5ml normal saline for 4 times (total : 20 ml). one ml of lung lavage fluid (llf) was stained with turk solution and counted in duplicate in a hemocytometer (in a burker chamber). the turk solution composed of 1 ml of gentiac violet solution 1%, 1ml of glacial acetic acid and 100 ml of distilled water. differential cell analysis was performed under a light microscope, according to staining and morphological criteria, by counting 100 cells twice and the percentage of each cell type was calculated (15). the data of tracheal response to methacholine (ec50), tracheal response to oa, tracheal contractility response, total wbc numbers and differential wbc counts were quoted as mean sem. the data of six sensitized groups were compared with controls using one - way analysis of variance (anova) with tukey - kramer post - test. in addition, the data of the sensitized group were compared with pretreated groups using one - way analysis of variance (anova) with tukey - kramer post - test. seventy adult dunkin - hartley guinea pigs (400 to 700 g, male sex) were used throughout the study. the animals were group - housed in individual cages in climate - controlled animal quarters with water and food ad libitum and a12-hr on/12-hr off light cycle. after ten days, for adapting to the new situation, animals were randomly divided into seven groups ; control group (c), oa sensitized group (s), sensitized groups pretreated with thymoquinone (s+tq), sensitized groups pretreated with selective a2a antagonist (zm241385) and selective a2b antagonist (mrs1706) (s+anta a2a and s+anta a2b), sensitized groups pretreated with selective a2a antagonist and thymoquinone (s+anta a2a+tq) and selective a2b antagonist and thymoquinone (s+anta a2b+tq). thymoquinone and each of these antagonists (tocris bioscience ltd., uk) with 3 mg / kg dose were injected intraperitoneally on 10 day of sensitization protocol. sensitization of animals to oa was performed according to our previous study (13). briefly, guinea pigs were sensitized to oa (grade ii sigma chemical ltd., uk) dissolved in saline by injecting 100 mg ip and 100 mg sc on 1 day and a further 10 mg ip on 8 day. from 14 day, sensitized animals were exposed to an aerosol of 4% oa for 181 days, 4 min daily. guinea pigs were slaughtered by a blow on the neck and the trachea was then removed. one tracheal chain in each animal was prepared as follows : the trachea was cut into 10 rings (each containing 2 to 3 cartilaginous rings). then, in order to form a tracheal chain, all the rings were cut open opposite the trachealis muscle and sutured together. tissue was then suspended in a 20ml organ bath (schuler organ bath type 809, germany). the organ bath chambers contained krebs - henseliet solution of the following composition (mm) : kh2po4 (1.2), kcl (4.72), nacl (120), nahco3 (25), mgso4 (0.5), cacl2 (2.5) and dextrose (11). the krebs solution was maintained at 37c and gassed with 95% o2 and 5% co2. tissue was suspended under isotonic tension of 1 g and allowed to equilibrate for at least 1 hr while it was washed with krebs solution every 15min (14). responses were measured by means of an isometric transducer (adinstruments, spain) with a sensitivity range of 0 to 25 g, and amplified with an amplifier (ml/118 quadribridge amp ; march - hugstetten, germany) and recorded on a powerlab (ml-750, 4 channel recorder ; march - hugstetten, germany). in each experiment, a cumulative concentration response curve of methacholine induced contraction of the tracheal chain was obtained. consecutive concentrations (containing 10 to 10 m, dissolved in saline) were added every 3 min. the contraction of each concentration was recorded at the end of 3 min and the effect reached a plateau in all experiments. the percentage of contraction of the tracheal smooth muscle due to each concentration of methacholine in proportion to the maximum contraction obtained by its final concentration was plotted against log concentration of methacholine. the concentration - response curve of methacholine was done in the tracheal chain of all animals of experimental groups. the effective concentration of methacholine causing 50% of maximum response (ec50) was measured from the methacholine response curve in each experiment using 50% of the maximum response in the y axis and measuring the dose of methacholine causing this response in the x axis. the magnitude of contraction as the contractility response to 10 m methacholine was also measured. the tracheal response of all animals to a 0.1% solution of oa was measured in each studied animal as follows : 0.5 ml of 4% oa solution (dissolved in saline) was added to the 20ml organ bath and the degree of tracheal chain contraction was recorded after 15 min and was expressed as a proportion (in percentage) to the contraction obtained with 10 m methacholine. the tracheal responsiveness to methacholin and ovalbumin coincident with preparing the tracheal chain, a cannula was put into the remaining trachea, and the lungs were lavaged with 5ml normal saline for 4 times (total : 20 ml). one ml of lung lavage fluid (llf) was stained with turk solution and counted in duplicate in a hemocytometer (in a burker chamber). the turk solution composed of 1 ml of gentiac violet solution 1%, 1ml of glacial acetic acid and 100 ml of distilled water. differential cell analysis was performed under a light microscope, according to staining and morphological criteria, by counting 100 cells twice and the percentage of each cell type was calculated (15). the data of tracheal response to methacholine (ec50), tracheal response to oa, tracheal contractility response, total wbc numbers and differential wbc counts were quoted as mean sem. the data of six sensitized groups were compared with controls using one - way analysis of variance (anova) with tukey - kramer post - test. in addition, the data of the sensitized group were compared with pretreated groups using one - way analysis of variance (anova) with tukey - kramer post - test. concentration - response curves to methacholine showed left ward shift of the curve in all groups compared to controls. all the groups except group s+anta a2a, showed right ward shift in comparison with sensitized group. concentration - response curve of s+tq+anta a2b group was adjacent to that of c group. the highest response was related to the group s+anta a2a and the lowest response was related to the group s+tq+anta a2b (figure 1). cumulative log concentration - response curves of methacholine induced contraction of isolated trachea in control (c), sensitized (s), sensitized pretreated with thymoquinone (s+tq), sensitized pretreated with selective a2a antagonist (zm241385) and selective a2b antagonist (mrs1706) (s+anta a2a and s+anta a2b), sensitized groups pretreated with selective a2a antagonist and thymoquinone (s+anta a2a+tq) and selective a2b antagonist and thymoquinone (s+anta a2b+tq) guinea pig tracheal chains in the organ bath (for each group, n=7) the mean value of ec50 in tracheal chains in all groups except s+tq+anta a2b group were significantly lower than in group c (p<0.001 to p<0.05). the mean value of ec50 in tracheal chains in groups s+tq and s+tq+anta a2b increased significantly in comparison with group s (p<0.05), whereas this parameter in s+anta a2b and s+tq+anta a2a groups was non significantly higher than group s (figure 2). individual values and meansem (big symbols with bars) of tracheal response to methacholine (ec50) in control (c), sensitized (s), sensitized pretreated with thymoquinone (s+tq), sensitized pretreated with selective a2a antagonist (zm241385) and selective a2b antagonist (mrs1706) (s+anta a2a and s+anta a2b), sensitized groups pretreated with selective a2a antagonist and thymoquinone (s+anta a2a+tq) and selective a2b antagonist and thymoquinone (s+anta a2b+tq) (for each group, n=7). statistical differences between control and different groups : ns : non significant differences, + ; p<0.05, + + ; p<0.01, + + + ; p<0.001. statistical differences between pretreated groups vs sensitized group : ns : non significant differences, : p<0.05 the contractility response of tracheal chains to methacholine was increased in all groups in comparison to group c (p<0.001 to p<0.05). compared with s group, just pretreated group with selective a2b antagonist (s+anta a2b group) showed significant decrease in this parameter (p<0.01, figure 3). individual values and meansem (big symbols with bars) of tracheal contractility response to 10 m methacholine in control (c), sensitized (s), sensitized pretreated with thymoquinone (s+tq), sensitized pretreated with selective a2a antagonist (zm241385) and selective a2b antagonist (mrs1706) (s+anta a2a and s+anta a2b), sensitized groups pretreated with selective a2a antagonist and thymoquinone (s+anta a2a+tq) and selective a2b antagonist and thymoquinone (s+anta a2b+tq) (for each group, n=7). statistical differences between control and different groups : + ; p<0.05, + + ; p<0.01, + + + ; p<0.001. statistical differences between pretreated groups vs sensitized group : ns : non significant differences, ; p<0.01 tracheal response to oa in tracheal chains in all groups was increased significantly compared to group c (p<0.001 to p<0.05). tracheal response to oa in groups s+tq, s+tq+anta a2a, and s+tq+anta a2b was significantly decreased compared to group s (p<0.01) ; however, there was no significant difference in groups s+anta a2b and s+anta a2a in comparison with group s (figure 4). individual values and meansem (big symbols with bars) of tracheal response to ovalbumin (percent concentration in proportion to contraction obtained by 10 m methacholine) in control (c), sensitized (s), sensitized pretreated with thymoquinone (s+tq), sensitized pretreated with selective a2a antagonist (zm241385) and selective a2b antagonist (mrs1706) (s+anta a2a and s+anta a2b), sensitized groups pretreated with selective a2a antagonist and thymoquinone (s+anta a2a+tq) and selective a2b antagonist and thymoquinone (s+anta a2b+tq) guinea pigs (for each group, n=7). statistical differences between control and different groups : + ; p<0.05, + + ; p<0.01, + + + ; p<0.001. statistical differences between pretreated groups vs sensitized group : ns : non significant differences, : p<0.01 the mean value of total white blood cell (wbc) in llf in all groups increased significantly compared to group c (p<0.001 to p<0.01). however, the mean value of total wbc in all groups except s+anta a2a decreased compared to group s, but this difference was significant only in pretreated group with thymoquinone and selective a2b antagonist (p<0.05, figure 5). individual values and meansem (big symbols with bars) of total llf wbc number in control (c), sensitized (s), sensitized pretreated with thymoquinone (s+tq), sensitized pretreated with selective a2a antagonist (zm241385) and selective a2b antagonist (mrs1706) (s+anta a2a and s+anta a2b), sensitized groups pretreated with selective a2a antagonist and thymoquinone (s+anta a2a+tq) and selective a2b antagonist and thymoquinone (s+anta a2b+tq) guinea pigs (for each group, n=6). statistical differences between control and different groups : + + ; p<0.01, + + + ; p<0.001. statistical differences between pretreated groups vs sensitized group : ns : non significant differences, ; p<0.05 there was a significant increase in llf eosinophil and decrease in llf lymphocyte count in all groups compared to c group (p<0.001 to p<0.05). there was also a significant decrease in llf neutrophil in s, s+anta a2a and s+tq+anta a2a groups in comparison with controls (p<0.001 to p<0.01). in addition, there was a significant decrease in llf monocyte count in all group except s+a2b group compared to c group (p<0.001 to p<0.05). in all groups (except s+anta a2a group), there was a significant decrease in llf eosinophil and increase in llf neutrophil, lymphocyte and monocyte count compared to s group (p<0.001 to p<0.01). significant decrease was observed in llf basophil in s+tq, s+anta a2b and s+tq+anta a2a groups in comparison with sensitized animals (p<0.01 to p<0.05)(figure 6a - e). the percentages of eosinophil (a), neutrophil (b), lymphocyte (c), monocyte (d) and basophil (e) of lung lavage fluid in control, sensitized (s), sensitized pretreated with thymoquinone (s+tq), sensitized pretreated with selective a2a antagonist (zm241385) and selective a2b antagonist (mrs1706) (s+anta a2a and s+anta a2b), sensitized groups pretreated with selective a2a antagonist and thymoquinone (s+anta a2a+tq) and selective a2b antagonist and thymoquinone (s+anta a2b+tq) guinea pigs (for each group, n=15). statistical differences between control and different groups : ns ; non significant differences, + ; p<0.05, + + ; p<0.01, + + + ; p<0.001. statistical differences between pretreated groups vs sensitized group : ns ; non significant differences, : p<0.05, ; p<0.01, : p<0.001 pretreatment with anta a2a caused significant decrease in the mean value of ec50 (p<0.01), and llf neutrophil, lymphocyte and monocyte count (p<0.001 for all) and significant increase in the tracheal response to oa (p<0.01), llf total wbc (p<0.01) and eosinophil count (p<0.001) compared to s+tq group. there was significant increase in llf eosinophil and monocyte counts in s+antaa2b group compared with s+tq group (p<0.001 for both, (table 1). the mean value of different parameters in control (c), sensitized (s), sensitized pretreated with thymoquinone (s+tq), sensitized pretreated with selective a2a antagonist (zm241385) and selective a2b antagonist (mrs1706) (s+anta a2a and s+anta a2b), sensitized groups pretreated with selective a2a antagonist and thymoquinone (s+anta a2a+tq) and selective a2b antagonist and thymoquinone (s+anta a2b+tq). statistical differences between pretreated groups vs s+tq group : ns : non significant differences, + ; p<0.05, + + ; p<0.01, + + + ; p<0.001 there were not any significant differences between parameters of pretreated groups with thymoquinone and antagonists with s+tq group except there was significant increase in llf eosinophil count (p<0.001) and significant decrease in llf neutrophil and monocyte count (p<0.001 to p<0.01) in s+tq+anta a2a group compared to s+tq group (table 1). concentration - response curves to methacholine showed left ward shift of the curve in all groups compared to controls. all the groups except group s+anta a2a, showed right ward shift in comparison with sensitized group. concentration - response curve of s+tq+anta a2b group was adjacent to that of c group. the highest response was related to the group s+anta a2a and the lowest response was related to the group s+tq+anta a2b (figure 1). cumulative log concentration - response curves of methacholine induced contraction of isolated trachea in control (c), sensitized (s), sensitized pretreated with thymoquinone (s+tq), sensitized pretreated with selective a2a antagonist (zm241385) and selective a2b antagonist (mrs1706) (s+anta a2a and s+anta a2b), sensitized groups pretreated with selective a2a antagonist and thymoquinone (s+anta a2a+tq) and selective a2b antagonist and thymoquinone (s+anta a2b+tq) guinea pig tracheal chains in the organ bath (for each group, n=7) the mean value of ec50 in tracheal chains in all groups except s+tq+anta a2b group were significantly lower than in group c (p<0.001 to p<0.05). the mean value of ec50 in tracheal chains in groups s+tq and s+tq+anta a2b increased significantly in comparison with group s (p<0.05), whereas this parameter in s+anta a2b and s+tq+anta a2a groups was non significantly higher than group s (figure 2). individual values and meansem (big symbols with bars) of tracheal response to methacholine (ec50) in control (c), sensitized (s), sensitized pretreated with thymoquinone (s+tq), sensitized pretreated with selective a2a antagonist (zm241385) and selective a2b antagonist (mrs1706) (s+anta a2a and s+anta a2b), sensitized groups pretreated with selective a2a antagonist and thymoquinone (s+anta a2a+tq) and selective a2b antagonist and thymoquinone (s+anta a2b+tq) (for each group, n=7). statistical differences between control and different groups : ns : non significant differences, + ; p<0.05, + + ; p<0.01, + + + ; p<0.001. statistical differences between pretreated groups vs sensitized group : ns : non significant differences, : p<0.05 the contractility response of tracheal chains to methacholine was increased in all groups in comparison to group c (p<0.001 to p<0.05). compared with s group, just pretreated group with selective a2b antagonist (s+anta a2b group) showed significant decrease in this parameter (p<0.01, figure 3). individual values and meansem (big symbols with bars) of tracheal contractility response to 10 m methacholine in control (c), sensitized (s), sensitized pretreated with thymoquinone (s+tq), sensitized pretreated with selective a2a antagonist (zm241385) and selective a2b antagonist (mrs1706) (s+anta a2a and s+anta a2b), sensitized groups pretreated with selective a2a antagonist and thymoquinone (s+anta a2a+tq) and selective a2b antagonist and thymoquinone (s+anta a2b+tq) (for each group, n=7). statistical differences between control and different groups : + ; p<0.05, + + ; p<0.01, + + + ; p<0.001. statistical differences between pretreated groups vs sensitized group : ns : non significant differences, ; p<0.01 tracheal response to oa in tracheal chains in all groups was increased significantly compared to group c (p<0.001 to p<0.05). tracheal response to oa in groups s+tq, s+tq+anta a2a, and s+tq+anta a2b was significantly decreased compared to group s (p<0.01) ; however, there was no significant difference in groups s+anta a2b and s+anta a2a in comparison with group s (figure 4). individual values and meansem (big symbols with bars) of tracheal response to ovalbumin (percent concentration in proportion to contraction obtained by 10 m methacholine) in control (c), sensitized (s), sensitized pretreated with thymoquinone (s+tq), sensitized pretreated with selective a2a antagonist (zm241385) and selective a2b antagonist (mrs1706) (s+anta a2a and s+anta a2b), sensitized groups pretreated with selective a2a antagonist and thymoquinone (s+anta a2a+tq) and selective a2b antagonist and thymoquinone (s+anta a2b+tq) guinea pigs (for each group, n=7). statistical differences between control and different groups : + ; p<0.05, + + ; p<0.01, + + + ; p<0.001. statistical differences between pretreated groups vs sensitized group : ns : non significant differences, : p<0.01 the mean value of total white blood cell (wbc) in llf in all groups increased significantly compared to group c (p<0.001 to p<0.01). however, the mean value of total wbc in all groups except s+anta a2a decreased compared to group s, but this difference was significant only in pretreated group with thymoquinone and selective a2b antagonist (p<0.05, figure 5). individual values and meansem (big symbols with bars) of total llf wbc number in control (c), sensitized (s), sensitized pretreated with thymoquinone (s+tq), sensitized pretreated with selective a2a antagonist (zm241385) and selective a2b antagonist (mrs1706) (s+anta a2a and s+anta a2b), sensitized groups pretreated with selective a2a antagonist and thymoquinone (s+anta a2a+tq) and selective a2b antagonist and thymoquinone (s+anta a2b+tq) guinea pigs (for each group, n=6). statistical differences between control and different groups : + + ; p<0.01, + + + ; p<0.001. statistical differences between pretreated groups there was a significant increase in llf eosinophil and decrease in llf lymphocyte count in all groups compared to c group (p<0.001 to p<0.05). there was also a significant decrease in llf neutrophil in s, s+anta a2a and s+tq+anta a2a groups in comparison with controls (p<0.001 to p<0.01). in addition, there was a significant decrease in llf monocyte count in all group except s+a2b group compared to c group (p<0.001 to p<0.05). in all groups (except s+anta a2a group), there was a significant decrease in llf eosinophil and increase in llf neutrophil, lymphocyte and monocyte count compared to s group (p<0.001 to p<0.01). significant decrease was observed in llf basophil in s+tq, s+anta a2b and s+tq+anta a2a groups in comparison with sensitized animals (p<0.01 to p<0.05)(figure 6a - e). the percentages of eosinophil (a), neutrophil (b), lymphocyte (c), monocyte (d) and basophil (e) of lung lavage fluid in control, sensitized (s), sensitized pretreated with thymoquinone (s+tq), sensitized pretreated with selective a2a antagonist (zm241385) and selective a2b antagonist (mrs1706) (s+anta a2a and s+anta a2b), sensitized groups pretreated with selective a2a antagonist and thymoquinone (s+anta a2a+tq) and selective a2b antagonist and thymoquinone (s+anta a2b+tq) guinea pigs (for each group, n=15). statistical differences between control and different groups : ns ; non significant differences, + ; p<0.05, + + ; p<0.01, + + + ; p<0.001. statistical differences between pretreated groups vs sensitized group : ns ; non significant differences, : p<0.05, ; p<0.01, : p<0.001 pretreatment with anta a2a caused significant decrease in the mean value of ec50 (p<0.01), and llf neutrophil, lymphocyte and monocyte count (p<0.001 for all) and significant increase in the tracheal response to oa (p<0.01), llf total wbc (p<0.01) and eosinophil count (p<0.001) compared to s+tq group. there was significant increase in llf eosinophil and monocyte counts in s+antaa2b group compared with s+tq group (p<0.001 for both, (table 1). the mean value of different parameters in control (c), sensitized (s), sensitized pretreated with thymoquinone (s+tq), sensitized pretreated with selective a2a antagonist (zm241385) and selective a2b antagonist (mrs1706) (s+anta a2a and s+anta a2b), sensitized groups pretreated with selective a2a antagonist and thymoquinone (s+anta a2a+tq) and selective a2b antagonist and thymoquinone (s+anta a2b+tq). statistical differences between pretreated groups vs s+tq group : ns : non significant differences, + ; p<0.05, + + ; p<0.01, + + + ; p<0.001 there were not any significant differences between parameters of pretreated groups with thymoquinone and antagonists with s+tq group except there was significant increase in llf eosinophil count (p<0.001) and significant decrease in llf neutrophil and monocyte count (p<0.001 to p<0.01) in s+tq+anta a2a group compared to s+tq group (table 1). in this investigation, the effect of single dose of thymoquinone on tracheal responsiveness to methacholin and ovalbumin, and total and differential cell count in bronchoalveolar lavage of sensitized guinea pigs examined in the presence of selective a2a and a2b adenosine receptor antagonists (zm241385 and mrs1706). the tracheal responsiveness to methacholine and oa, contractility response and llf total wbc and eosinophil count seemed to be increased in this study, but llf neutrophil, lymphocyte and monocyte count in sensitized group decreased compared to control animals which conformed to the results of previous studies (8, 13, 15 - 18). in this study, anti - inflammatory and anti - asthmatic effects of thymoquinone have already been demonstrated in our previous studies (8, 17). although in these studies, thymoquinone was administrated orally during 33 days, but in current study, single dose of thymoquinone was administrated intraperitoneally. pretreatment of sensitized animals with thymoquinone was more effective on bronchoalveolar lavage differential cell count. it shows that thymoquinone mainly affects the eosinophilic inflammation and immunological aspects of sensitized animals, which is similar to previous study (17). in addition, hajhashemi in 2004 showed that the preventive effect of thymoquinone may be due to its ability to suppress airway inflammation(19). in this study, single dose administration of selective adenosine a2a antagonist, and zm241385, caused increased tracheal responsiveness (decreased ec50 and incremental contractility), tracheal response to oa and total wbc count and eosinophil and basophil number in llf, and decrease in neutrophil, monocyte and lymphocyte count compared to controls. exogenous and endogenous adenosine has essential role in the pathogenesis of asthma and other lung inflammatory disorders. this notion is based on the fact that adenosine receptors are present in many cell types involved in airway inflammation (20). it is now clear that the main mechanism responsible for exogenous adenosine inhalation - induced bronchoconstriction is mediators that release from mast cells ; although there is some evidence for neural pathways activation (21). in addition to this effect, the level of adenosine increased in biological fluids of asthmatic patients, bronchoalveolar lavage and exhaled breath condensate (11). the data strongly suggest that activation of adenosine a2a receptors, which are present in most of the inflammatory cells, affect multiple aspects of the inflammatory process including modulating neutrophils activation and degranulation, production of oxidative species, release of cytokines and mast cells degranulation, so adenosine a2a receptors activation can inhibit inflammatory responses (12, 22 - 24). in s+anta a2a group, it showed that this a2a receptor antagonist deteriorated the effect of ovalbumin in inducing asthma in guinea pigs, which has been predicted because of the inhibitory effects of these receptors on multiple inflammatory cell types. administration of single dose of mrs1706 (selective a2b receptor antagonist) caused improvement in tracheal responsiveness, llf total and differential wbc count, but it could not convey them to the control levels. these results are compatible with mustafa and his colleagues study in 2007 (25). expression of adenosine a2b receptors has been found in bronchial epithelium, human mast cells, monocytes and fibroblasts and cultured human airway smooth muscle (2). increasing evidences suggest that in rodents and man activation of adenosine a2b receptors modulates mast cells function and stimulates the production of il-8, il-4, il-13 and vegf from mast cells (26). adenosine, via a2b receptors participates in the remodeling process occurring in chronic inflammatory lung diseases (27). taken together, these evidences suggest that adenosine a2b receptor is deeply involved in the mechanisms underlying mediators release by mast cells, the major mechanism of adenosine induced bronchoconstriction and airway inflammation in asthma. therefore, it has been proved that targeting adenosine receptors might be a possible approach for the development of anti - inflammatory treatments in diseases characterized by chronic airway inflammation such as asthma and copd. currently, there is agreement that development of selective adenosine a2b receptor antagonists might be the most appealing approach (21, 28). in this investigation, pretreatment with a2a receptor antagonist (zm241385) increased tracheal responsiveness and caused llf changes. co - administration of thymoquinone and zm241385 in group s+tq+antaa2a, prevented these variations in comparison with group s+anta a2a. therefore, it can be concluded that thymoquinone could somehow recover the blockage of a2a receptors. however, it could not prevent completely in comparison to controls and s+tq group. on the other hand, as co - administration of selective a2b antagonist (mrs1706) and thymoquinone improved the changes in comparison with s+tq and s+anta a2b groups specially the ec50 level and llf neutrophil count. so, it can be concluded that a part of thymoquinone anti - asthmatic effect is due to controlling the adenosine receptors in trachea. however, more studies are required for the exact mechanism(s) causing the beneficial effects of thymoquinone in asthma. these results showed that thymoquinone affects adenosine receptors which suggest that some of its anti - inflammatory effects may be mediated by these receptors. | objective(s):for determining the mechanism of anti - asthmatic effect of thymoquinone, this investigation evaluated the effect of thymoquinone in the presence of selective a2a and a2b adenosine receptor antagonists (zm241385 and mrs1706, respectively).materials and methods : seventy guinea pigs were randomly divided to 7 groups ; control (c), sensitized with ovalbumin (s), sensitized groups pretreated with thymoquinone (s+tq), zm241385 (s+anta a2a), mrs1706 (s+anta a2b), thymoquinone and antagonists (s+anta a2a+tq and s+anta a2b+tq). thymoquinone and each of these antagonists with 3 mg / kg dose were injected i.p. on 10th day of sensitization protocol. tracheal responsiveness (tr) to methacholine and ovalbumin (oa), and total and differential cell count in lung lavage fluid (llf) in different groups were measured.results:increased ec50 and llf neutrophil count and decreased tr to methacholine and oa, llf eosinophil and basophil counts were observed in s+tq group compared to s group (p<0.001 to p<0.05). significant decrease in ec50 (p<0.01), llf neutrophil, lymphocyte and monocyte count (p<0.001 for all) and significant increase in tr to oa (p<0.01), llf total wbc (p<0.01) and eosinophil count (p<0.001) were observed in s+a2a group compared to s+tq group. there was significant increase in llf eosinophil and monocyte counts in s+anta a2b group compared with s+tq group (p<0.001 for both). in s+tq+anta a2a group, there was significant increase in llf eosinophil (p<0.001) and significant decrease in llf neutrophil (p<0.01) and monocyte (p<0.001) counts compared with s+tq group.conclusion:thymoquinone affects adenosine receptors, which suggest that some of its anti - inflammatory effects may be mediated by these receptors. |
brds have an important role in the targeting of chromatin - modifying enzymes to specific sites. often they act with other protein - interaction modules to guarantee a high level of targeting specificity for these essential enzymes. for example, the methyltransferase ash1l contains a combination of one brd and one plant homology domain (phd), as well as a bromo - adjacent homology domain (bah) (ref., ash1l activates ultrabithorax expression, and mammalian homologues have been associated with actively transcribed genes. another example of a multidomain methyltransferase containing a brd is the mixed lineage leukaemia (mll) gene product (ref. 21), which is an essential gene and acts as a key regulator of the expression of many genes. mll is required for proper segment identity in mammals, it displays haplo - insufficiency and regulates self - renewal of haematopoietic stem cells by controlling hox (homeobox) gene expression (refs 22, 23, 24). in addition, the hats crebbp and ep300 contain several protein - interaction modules, including one brd, and zinc finger and kix domains (ref. 25). both proteins share a high degree of sequence similarity and act as transcriptional coactivators that control a large variety of biological processes, including cell growth, genomic stability, development, neuronal plasticity and memory formation, as well as energy homeostasis (ref. crebbp is a coactivator of the camp response element - binding creb transcription factor. the fundamental role of crebbp is reflected by the severe phenotype of homozygous knockout mice, which die in utero with signs of defective blood vessel formation in the central nervous system, developmental retardation, and delays in both primitive and definitive haematopoiesis (ref. similarly, homozygous deletion of ep300 results in mice that die between days 9 and 11.5 of gestation as a result of defects in neurulation, cell proliferation and heart development (ref. two additional hat - containing brds have been reported and these interact with ep300 and crebbp : pcaf [also known as k(lysine) acetyltransferase 2b (kat2b) ] and the related gcn5. both proteins acetylate histones and transcription factors, and act as transcriptional coactivators. gcn5-knockout mice die during embryogenesis because of severe growth retardation, failure in the development of dorsal mesoderm lineages and anterior neural tube closure (refs 29, 30). by contrast, homozygous deletion of the closely related pcaf gene does not show gross abnormalities, but leads to short - term memory deficits and an exaggerated response to acute stress and conditioned fear, associated with increased plasma corticosterone levels (ref. recent data identified evolutionarily conserved aaa atpase ancca (aaa nuclear coregulator cancer - associated protein)/atad2 as a protein required for recruitment of transcription factors of the e2f family to their target sites, and as a transcriptional coregulator of myc, oestrogen and androgen receptors (ars). atad2 associates through its brd with histone h3 acetylated at lys 14 during late mitosis, regulating the expression of genes required for cell cycle progression (refs 32, 33, 34). dual brd proteins of the bet (bromodomain and extra - terminal) family also have a pivotal role regulating the transcription of growth - promoting genes and cell cycle regulators. the bet family is represented by four members in humans (brd2, brd3, brd4 and the testis - specific isoform brdt), with each containing two n - terminal brds. brd4 and brd2 are key mediators of transcriptional elongation by recruiting the positive transcription elongation factor complex (p - tefb). the p - tefb core complex is composed of cyclin - dependent kinase-9 (cdk9) and its activator cyclin t. cdk9 phosphorylates the rna polymerase ii (rnapii) c - terminal domain, a region that contains 52 heptad repeats. rnapii undergoes sequential phosphorylation at ser5 during promoter clearance and at ser2 by p - tefb at the start of elongation. it has been shown that brd4 couples p - tefb to acetylated chromatin through its brds. interestingly, in contrast to other brd - containing proteins and transcription factors, bet proteins remain associated with condensed and hypoacetylated mitotic chromosomes (ref. 35), suggesting a role in epigenetic memory (refs 36, 37). homeostasis of bet expression levels is important for cell cycle control because both inhibition of brd4 by microinjected specific antibodies and overexpression of brd4 lead to cell cycle arrest in the g2 m and g1s phases, respectively (refs 38, 39), and genetic knockdown of brd4 in cultured human cells significantly reduces cell growth (ref. brd2 associates with the e2f transcription factors and with the swi / snf (switch mating type / sucrose nonfermenting) complex to regulate the expression of diverse genes (ref. brd2 can function as a transcriptional coactivator or corepressor in a promoter - specific or tissue - specific manner. deletion of either brd2 or brd4 in mice is lethal, and brd4 mice also show severe developmental defects (refs 43, 44, 45). mutagenesis of the brd2 promoter region resulted in mice that expressed reduced levels of brd2 without causing gross developmental abnormalities. the testis - specific bet family member brdt is essential for normal spermatogenesis, and specific deletion of the first brd in mice results in abnormal spermatids and sterility (ref. 47). in agreement with studies in mice, altered histone modifications have been observed in the brdt promoter region of subfertile patients (ref. 48), and genome - wide association studies linked polymorphism in brdt to sterility in european men (ref. tandem brds are also present in taf1 [rnapii, tata box binding protein (tbp)-associated factor, 250 kda formerly called tafii250 ], the largest subunit of the general transcription factor tfiid. taf1 binds to the core promoter sequence encompassing the transcriptional start site, and also interacts with other transcriptional regulators, thereby modulating the rate of transcription initiation (ref. it acts as a general transcriptional activator and as such regulates a variety of essential biological processes, including myogenesis, dna - damage response, the cell cycle and apoptosis (refs 51, 52, 53, 54). the c - terminal tandem brds have been shown to specifically recognise the diacetylated histone h4 tail at k5/k12 or k8/k16, as well as diacetylated p53 at k373/k382 at the p21 promoter (refs 55, 56). taf1l is x - linked and might act as a functional substitute for taf1 during male meiosis, when sex chromosomes are transcriptionally silenced. similarly to taf1, taf1l can bind to the tata - binding protein (tbp) and can functionally substitute for taf1 in a temperature - sensitive hamster cell line (ref. members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis and gene regulation (refs 58, 59)., brwd1 is widely expressed, and its expression levels are dynamic during mouse development. it associates with the swi / snf complex component and functions as a transcriptional regulator involved in chromatin remodelling (ref. however, in drosophila, brwd3 function has been genetically linked to the jak stat pathway (ref. single brd modules are present in some members of the tripartite motif (trim) family of transcriptional regulators (ref. trim proteins are characterised by the presence of a ring finger, one or two zinc - binding motifs named b - boxes, and an associated coiled - coil region (ref. trim24 (tif1), for instance, contains an n - terminal trim domain, a nuclear receptor (lxxll) interaction motif and a c - terminal phd - brd (ref. 66) and mediates ligand - dependent activation of ar and the retinoic acid receptor (rar), and has been shown to interact with other nuclear receptors such as thyroid, vitamin d3 and oestrogen receptors (ref. trim28 (tif1) is a corepressor for krppel - associated box - domain - containing zinc finger proteins (ref. trim28 associates with heterochromatin - associated factors hp1, hp1 and hp1 to promote the silencing of euchromatic genes (ref. 69), and recruitment of trim28 to centromeres is required for induction of the parietal and visceral endoderm differentiation pathways (refs 70, 71, 72). interestingly, the phd domain of the trim28 corepressor functions as an intramolecular e3 ligase, leading to sumoylation of the adjacent brd. sumoylation is required for trim28-mediated gene silencing, suggesting that the tightly linked phd - brd module functions as an intramolecular ubiquitin - like modifier (sumo) e3 ligase (refs 73, 74). formation of transcription regulatory complexes of smad4 with receptor - phosphorylated smad2 and smad3 is a key event in canonical tgf signalling. consequently, depletion of trim33 in human cell lines inhibits smad4-dependent cell proliferation by competing with smad4 for selective binding to receptor - phosphorylated smad2 and smad3 (ref. mice deficient in trim33 die in utero, demonstrating that trim33 has an important role in development (ref. the relatively poorly studied trim66 (tif1) is mainly expressed in testis and, similarly to trim24/33, associates with heterochromatin - associated factors (hps) but not with nuclear receptors, and functions as a transcriptional silencer (ref. the trim family member pml (promyelocytic leukaemia protein trim19) has no brd itself but associates with sp proteins, a family of three proteins in humans (sp100, sp110 and sp140) that all contain a phd - brd tandem module n - terminally flanked by a sand dna - binding domain. the complex of pml and sp100 is found in nuclear bodies, which are nuclear structures that have been associated with the pathogenesis of acute promyelocytic leukaemia (ref. nuclear bodies are implicated in the regulation of many cellular functions, including chromatin organisation (ref. 80), dna repair and genome stability (refs 81, 82), as well as regulation of transcription (refs 83, 84, 85). in addition, the nuclear body is a target of autoantibodies in patients with primary biliary cirrhosis (ref. however, little is known about the precise mechanisms whereby nuclear body proteins exert their functions. brds have an essential role in the assembly and correct targeting of swi / snf complexes, which are particularly rich in brd interaction modules. swi / snf complexes, also called brahma - associated factors (bafs), remodel chromatin structure, contributing to either transcriptional activation or repression of target genes, depending on the composition of the various complexes. the components of swi / snf complexes were originally identified in screens for mutants that result in defects in mating - type switching in yeast or that were unable to grow on sucrose (refs 88, 89, 90). microarray studies later showed that swi / snf functions as a transcriptional regulator that affects about 5% of all genes in yeast (ref. mammalian swi / snf complexes have a key role in cell differentiation and proliferation, and represent an essential component of the embryonic stem cell core pluripotency transcriptional network (refs 92, 93). all swi / snf complexes contain a core subunit, which alters chromatin structure in an atp - dependent manner, resulting in an open and accessible conformation with increased affinity for transcription factors (ref. these two proteins are mutually exclusive in swi / snf complexes and have been named after the drosophila homologue brahma as brg1 (brahma - related gene-1, smarca4) and the related protein brm (smarca2). brg1 and brm contain a c - terminal brd that has been implicated in the recognition of acetylated lysines within histone h3 and h4 tails (ref. several swi / snf complexes have been shown to mediate critical interactions between a number of hormone and other nuclear receptors (refs 96, 97, 98, 99). in addition, brg1 has been shown to associate with rb proteins, inducing cell cycle arrest and transcriptional repression in an hdac - dependent manner. brg1/hdac - containing complexes have been shown to repress expression of genes involved in cell cycle regulation (refs 100, 101). the chromatin - remodelling activity of brg1 has also been shown to be important for traversal of the nucleosome by rnapii (ref. the swi / snf complex pbaf (polybromo - associated brg1-associated factor) is characterised by the presence of the polybromo protein (pb1) (also called baf180) (refs 103, 104). pb1 is required for ligand - dependent transactivation by nuclear hormone receptors and contains six brds, two bromo - associated domains (bah) and a homeobox dna - binding domain. pbaf complexes, but not baf, activate vitamin - d - receptor - dependent transcription in response to vitamin d, and mice lacking pb1 have defects in heart development (ref. 105) because of impaired epithelial - to - mesenchymal transition and arrested maturation of the epicardium as a result of the downregulation of fgf, tgf and vegf signalling (ref. pb1 also has a role in cell cycle regulation and is a key regulator of senescence (ref. brds are present in chromatin - remodelling complexes of the iswi (imitation swi) family that assemble into at least seven different complexes containing a central core atpase of the two snf2-like mammalian homologues snf2l and snf2h of yeast iswi. the iswi complex nurf (nucleosome remodelling factor) contains the brd phd finger transcription factor bptf. bptf contains a c - terminal phd - brd and was identified as a highly expressed protein in patients with alzheimer disease as fetal alz-50 reactive clone 1, and in fetal brain in patients with neurodegenerative diseases (fetal alzheimer antigen, falz) (refs 108, 109). the phd domain in bptf associates with trimethylated histone h3 lys4, an interaction that is required for the recruitment of snf2l1 to promoters (ref.. the iswi complex acf / wcrf (atp - utilising chromatin remodelling and assembly factor / williams syndrome transcription factor) contains baz1 (also called wcrf or acf1), a protein of the baz (brd adjacent zinc finger) family, which is represented by four related genes in humans (baz1a, baz1b, baz2a and baz2b), with similar domain organisation, including a phd - brd interaction module. baz1a was first identified in hela cell nuclear extract as a factor associating with snf2h forming a complex with atp - dependent chromatin - remodelling activity (ref. later, the snf2h / baz1a remodelling activity was shown to be required for the dna - replication machinery to penetrate condensed chromatin structures. snf2h / baz1a is particularly enriched in replicating pericentromeric heterochromatin, and knockdown of baz1a by rnai impairs replication of condensed chromatin (refs 112, 113). baz2a (tip5, ttf-1-interacting protein 5) is a key subunit of the norc (nucleolar remodelling complex), which mediates transcriptional silencing of ribosomal rna (ref. interestingly, mutation of a tyrosine residue in the baz2a brd in yeast impairs interaction with acetylated histones (ref. 115) and the mutation y1775f represses norc interaction with chromatin and rna polymerase i transcription (ref. a table containing all human brd proteins identified to date and a phylogenetic tree of this protein family is shown in table 1 and figure 1a, respectively. (a) phylogenetic tree based on sequence alignments of predicted brds. for targets with multiple brds, the domains have been numbered starting from the n - terminus and the number is shown in parentheses. 118) with monoacetylated lys14 in histone h3 and a diacetylated h4 peptide monoacetylated on both lys5 and lys8. (a) phylogenetic tree based on sequence alignments of predicted brds. for targets with multiple brds, the domains have been numbered starting from the n - terminus and the number is shown in parentheses. 118) with monoacetylated lys14 in histone h3 and a diacetylated h4 peptide monoacetylated on both lys5 and lys8. given the central role of brds in epigenetic gene regulation, it is surprising that only a few substrates have been reported and mapped to specific sites. reported affinities range from low micromolar to millimolar kd values, raising questions regarding the physiological relevance of described weak in vitro substrate interactions, as well as which additional factors contribute to binding specificity (table 2). brds are often associated with other protein - interaction modules, a mechanism that is thought to generate high target selectivity and increased binding affinity with substrates owing to avidity that is generated on simultaneous binding of several interaction domains. this property led to the suggestion that epigenetic regulation recognises patterns of post - translational modifications (words) rather than single modifications (letters) (ref., the reading process might require combinations of several modifications for high - affinity interaction with a single brd. recently, moriniere and coworkers showed that the testis - specific bet isoform brdt requires the presence of several acetylation sites for high - affinity binding to histone tails (ref. interestingly, both acetylated lysines interact with the same binding pocket in brdt (fig. it is also likely that other post - translational modifications, such as phosphorylation and methylation, influence substrate recognition, providing the basis for crosstalk of transcription control and cellular signalling. similarly, the related brd protein brd3 also requires two adjacent acetylation sites for tight interaction with the transcription factor gata1 (ref. histone h3 residues 1 - 25 with single acetylations on k4, k9, k14, k18 or k23.abbreviations : fa, stopped - flow fluorescence anisotropy ; fp, fluorescent polarization ; itc, isothermal titration calorimetry ; nmr, nuclear magnetic resonance ; spr, surface plasmon resonance. histone h3 residues 1 - 25 with single acetylations on k4, k9, k14, k18 or k23. abbreviations : fa, stopped - flow fluorescence anisotropy ; fp, fluorescent polarization ; itc, isothermal titration calorimetry ; nmr, nuclear magnetic resonance ; spr, surface plasmon resonance. many proteins that use brds for their recruitment to specific regulatory complexes have been implicated in the development of cancer. brd - containing proteins are usually multicomponent, and often the reported disease association has not been directly linked to defects in the brd module itself. however, a number of dominant oncogenic rearrangements and correlation of overexpression of brd proteins with patient survival provide a strong case for targeting brds in cancer. genetic rearrangements of brd - containing proteins have been linked to the development of a number of extremely aggressive tumours. a very aggressive poorly differentiated carcinoma that originates mainly from midline locations such as the head, neck or mediastinum is nut (nuclear protein in testis) midline carcinoma (nmc) (ref. 132). nmcs are genetically characterised by translocations that involve the nut protein with brd4, brd3 or an unknown partner gene. both brd4nut and brd3nut fusion genes encode proteins composed of the n - terminal tandem brds and almost the entire nut gene (fig. nut blocks cellular differentiation, and depletion of this oncogene by rnai results in squamous differentiation and cell cycle arrest (refs 133, 134). brd4nut specifically recruits cbp / p300, leading to stimulation of cbp / p300 hat activity, formation of nuclear foci and inactivation of p53 (ref. selective inhibition of brd4nut by recently developed acetyl lysine competitive inhibitors results in epithelial differentiation, tumour shrinkage and survival in brd4nut xenograft mice (ref. other domain types are labelled directly in the figure and breakpoints are indicated by arrows. other domain types are labelled directly in the figure and breakpoints are indicated by arrows. chromosomal translocations of crebbp with the mll protein and the monocytic leukaemia zinc finger protein (moz) have been described in myeloid and lymphoid acute leukaemia and myelodysplasia secondary to therapy with drugs targeting dna topoisomerase ii (refs 137, 138) (fig. in addition, crebbp mutations have been identified in relapsed acute lymphoblastic leukaemia (ref. 140) and are very common in diffuse large b - cell lymphoma and follicular lymphoma, constituting the major pathogenetic mechanism shared by common forms of b - cell non - hodgkin 's lymphoma (ref. crebbp and the related hat ep300 are also highly expressed in advanced prostate cancer, and expression levels have been linked with cancer patient survival (ref. overexpression of several brd proteins has been reported in cancer and has been linked to patient survival. for instance, a recent study showed that atad2 is overexpressed in more than 70% of breast tumours and that higher protein levels correlate with tumour histological grades, poor overall survival and disease recurrence (ref. revenko and coworkers showed that atad2 is required for recruitment of specific e2f transcription factors and for chromatin assembly of the host cell factor 1mll histone methyltransferase complex. as a result of its association with the mll methyltransferase, depletion of atad2 results in a marked decrease of trimethylation of lys4 in histone h3, which has been linked to transcriptional activation. brd mutations disable atad2 function as an e2f coactivator and its ability to promote cancer cell proliferation (ref. the closely related protein atad2b has recently been shown to be highly expressed in glioblastoma and oligodendroglioma, as well as in breast carcinoma (ref. aberrant expression has also been reported for trim24 in breast cancer, and high expression levels have been shown to negatively correlate with survival of breast cancer patients (ref., however, trim24 seems to function as a liver - specific tumour suppressor (ref. trim24 also interacts with ar and enhances transcriptional activity of the ar by dihydrotestosterone in prostate cancer cells (ref. these data suggest that trim24 function and its role in tumourigenesis might be highly context dependent. the testis - specific bet family member brdt is frequently overexpressed in non - small - cell lung cancer (ref. 147), but the functional consequences of brdt overexpression have not been investigated so far. the role of brd4 in cancer is better understood. brd4 has been shown to be a key regulator of cell cycle control and transcriptional elongation of growth - promoting genes. in particular, the key role of brd4 in the recruitment of p - tefb (cdk9/cyclint) to transcriptional start sites provides an alternative strategy to targeting cdk9, which emerged as a validated target in chronic lymphocytic leukaemia (ref. 148). in breast cancer, however, brd4 has been identified as an inherited susceptibility gene for disease progression and its expression levels have been associated with patient survival (ref. brd4 and brd2 also have a key role for the transmission of tumour viruses during mitosis by providing a chromatin anchor to viral episomes. for instance, during latent viral infection of herpes viruses associated with development of kaposi sarcoma, the transmission of viral genomes to daughter cells during mitosis is mediated by the episome 's latency - associated nuclear antigen 1, which is tethered to chromatin through its interaction with brd4 (ref. also, papilloma viruses that have been linked to the development of cervical cancers and epstein barr viruses associate with brd4 in order to anchor their viral genomes to mitotic chromosomes (refs 151, 152). transcriptional control of proinflammatory cytokines is the central mechanism in the aetiology of inflammatory disease, and given the success of hdac inhibitors in this area, it is likely that selective brd inhibitors will modulate these processes. a first example has been provided by the recent pan - bet inhibitor ibet, which leads to the disruption of chromatin complexes responsible for the expression of inflammatory genes and conferred protection against lipopolysaccharide - induced endotoxic shock and bacteria - induced sepsis (ref. three sites of polymorphism in brd2 have recently been linked to rheumatoid arthritis (ref. 154) and brd2-hypomorphic mice are severely obese and have reduced inflammation in fat tissue (ref. the brd - containing hats ep300/crebbp have been proposed as therapeutic targets in inflammatory diseases such as lung inflammation and asthma (ref. activation of proinflammatory genes is intimately linked to activation of nuclear factor b (nfb). the activated p65 subunit translocates to the nucleus, where its affinity to its target genes and transcriptional activity is regulated by acetylation by ep300/crebbp. compounds that inhibit nfb acetylation such as the natural product gallic acid have anti - inflammatory properties (refs 156, 157). ep300 and pcaf also regulate inflammatory responses through their regulation of cyclooxygenase-2 (cox2) expression. cox2 is a key enzyme of prostaglandin biosynthesis that is well established as a major player in inflammatory response and a clinically successful target for the development of anti - inflammatory drugs. stimulation by bacterial lipopolysaccharides and other cytokines leads to increased binding of pcaf and ep300 to the cox2 promoter, and its activation. conversely, inhibitors of ep300 have been shown to reduce cox2 protein levels and promoter activities (ref. the concerted activation of several proinflammatory genes is regulated by the swi / snf class of atp - dependent remodelling complexes, which make the promoters of inflammatory genes permissive for transcriptional induction. the presence of the catalytic atpase subunit brg1 at the promoter of proinflammatory genes such as il6 has been shown to be necessary for activation of these genes, and termination of transcriptional activation is regulated by proteasomal degradation of brg1, ensuring a timely and adequate immune response (ref. although experimental data are still missing, it is intriguing to speculate that removal of brg1 from promoter regions might have an effect on inflammatory conditions. increasing evidence points to the fact that epigenetic targets have a role in the molecular manifestation of stress and related disorders. because brd inhibitors have only just been discovered, no study has addressed the role of brd inhibition in neurological disorders so far. however, several studies report important functions of brd - containing proteins in several diseases. trim28, for instance, is highly expressed in the mouse hippocampus and cerebellum. inducible deletion of trim28 in the forebrain of adult mice resulted in stress - related behaviour and cognitive impairment of these mice similar to effects observed in behavioural disorders such as borderline personality or bipolar disorder. chromatin immunoprecipitation experiments confirmed changes in histone methylation and acetylation patterns in the promoter regions of trim28 target genes such as mkrn3 and pcdhb6 (refs 160, 161). two other brd - containing proteins, smarca2 (brm) and brd1, have been identified in genome - wide association studies as susceptibility genes for schizophrenia and bipolar disorder in several independent studies, but the molecular mechanisms are still unclear (refs 162, 163). in addition, low levels of smarca2 have been found in the post - mortem prefrontal brains of schizophrenic patients, and the gene expression profiles in the diseased brains match those after downregulation of smarca2 in cells and in smarca2-knockout mice, which show impaired social interaction and prepulse inhibition. interestingly, smarca2 expression can be increased in the mouse brain on application of antipsychotic drugs, providing further evidence of the potential of this protein as a target for the treatment of schizophrenia (refs 164, 165). mutations in crebbp, and less frequently in ep300, are the genetic background for rubinstein taybi syndrome (rts), a rare human genetic disorder characterised by mental retardation and physical abnormalities ; many patients with rts have either breakpoints or microdeletions in chromosome 16p13.3 where the crebbp gene is located, but also heterozygous point mutations can lead to rts (refs 166, 167, 168). several of the pathological features can be mirrored by heterozygous crebbp - deficient mice strains (refs 169, 170, 171). although the precise mechanisms underlying the disease are not yet understood, it is thought that the hat activity of crebbp and reduced transcriptional activity result in altered synaptic plasticity, which ultimately influences long - term memory, leading to mental retardation (ref. ep300 also has a role in the aetiology of amyotrophic lateral sclerosis, alzheimer disease and huntington disease. huntington disease is a polyq disease in which polyglutamine repeats are added to the huntingtin protein, causing its translocation to the nucleus and formation of aggregates. crebbp and pcaf interact directly with huntingtin aggregates, resulting in their depletion (refs 173, 174). indeed, hdac inhibitors have long been used as mood stabilisers and are studied for the treatment of huntington and alzheimer diseases (ref. brds share a conserved fold that comprises a left - handed bundle of four alpha helices (z, a, b, c), linked by highly variable loop regions (za and bc loops), which form the rim of the substrate - binding pocket and determine substrate recognition (refs 55, 127) (fig. 3a). despite the conservation of the overall brd fold, the surface and loop regions of brds cocrystal structures with peptidic substrates have demonstrated that the acetyl lysine is recognised by a central deep hydrophobic cavity, where it is anchored by a hydrogen bond to an asparagine residue present in most brds (ref. acetylation of lysine residues neutralises the charge of the - amino group. as a consequence, the central cavity of acetyl lysine binding sites in brds is quite hydrophobic and particularly rich in aromatic residues ; it also has sufficient size to accommodate potent acetyl lysine competitive ligands. these properties make brds attractive targets for the design of pharmacologically active molecules that compete with protein interactions mediated by these modules. figure 3structural overview of a bromodomain and binding mode of bromodomain inhibitors. the main structural elements as well as the acetyl lysine binding site residues are labelled. (b) superimposition of a diacetylated bet substrate peptide and the inhibitor jq1. inhibitor and peptide molecules are shown in stick representation and are coloured according to atom types. (c) binding of jq1 to the bromodomain of brd4. conserved water molecules in the active site are highlighted and hydrogen bonds are shown as dashed lines. the main structural elements as well as the acetyl lysine binding site residues are labelled. (b) superimposition of a diacetylated bet substrate peptide and the inhibitor jq1. inhibitor and peptide molecules are shown in stick representation and are coloured according to atom types. (c) binding of jq1 to the bromodomain of brd4. conserved water molecules in the active site are highlighted and hydrogen bonds are shown as dashed lines. potent and very selective inhibitors have recently been published for bet brds (refs 136, 153, 178). all inhibitors that have been published so far are based on a triazolo - diazepine scaffold that successfully mimics interactions observed in bet peptide complexes (fig. interestingly, a number of tightly bound and conserved water molecules remain in cocrystal structures of bet triazolo - diazepine complexes, which interact with the inhibitor through a network of hydrogen bonds (fig. two bet inhibitors have been studied in two different disease models, providing compelling support of bet brds as targets in drug discovery. the inhibitor jq1 has been studied in midline carcinoma where inhibition of brd4nut led to terminal differentiation, cell cycle arrest and apoptosis of carcinoma cells, and significant reduction of tumour growth in patient - cell - line - derived xenograft models (ref. the inhibitor ibet led to significant reduction of the expression of proinflammatory genes in activated macrophages, and conferred protection against lipopolysaccharide - induced endotoxic shock and bacteria - induced sepsis, supporting inhibition of bet brds as a strategy for the generation of immunomodulatory drugs (ref. acetyl lysine mimetic inhibitors have also been reported in the case of crebbp, competing for its interaction with p53. these inhibitors were identified by nmr screening using a library of compounds that consists of one aromatic ring connected to an nhcoch3 group by different types of linkers (ref. the same laboratory also reported a series of cyclic peptides with improved binding affinities over natural substrates (ref. 179) and azobenzene - based inhibitors such as 4-hydroxyphenylazo - benzenesulfonic acid (ms456) and ischemin. ischemin binds to the brds of crebbp with a dissociation constant (kd) of 19 m and shows at least fivefold selectivity over other human brds. the binding mode of ischemin in crebbp is shown in figure 3d. in cellular assays ischemin alters post - translational modifications of p53 and histones, inhibits p53 interaction with cbp and transcriptional activity in cells, and prevents apoptosis in ischaemic cardiomyocytes (ref. early lead compounds such as n1-aryl - propane-1,3-diamine have also been identified for pcaf (ref. a summary of the chemical structures of the currently most advanced brd inhibitors is shown in figure 4. targeting brds for the development of protein - interaction inhibitors has recently emerged as a strategy for the design of pharmacologically active reagents. the relatively weak interaction of brds with their substrates, the diversity and physicochemical properties of the acetyl lysine binding site, and the large number of available crystal structures will facilitate the rational design of such inhibitors. however, brds usually constitute only one of the interaction domains found in brd - containing proteins, and whether selective inhibition of the acetyl lysine interaction alone will result in the desired phenotype needs to be investigated in future research projects. the large number of diseases that have been linked to brd - containing proteins and the success of particular hdac inhibitors indicate that brd inhibitors will find a large number of applications in pharmaceutical sciences and basic research. | acetylation of lysine residues is a post - translational modification with broad relevance to cellular signalling and disease biology. enzymes that write (histone acetyltransferases, hats) and erase (histone deacetylases, hdacs) acetylation sites are an area of extensive research in current drug development, but very few potent inhibitors that modulate the reading process mediated by acetyl lysines have been described. the principal readers of - n - acetyl lysine (kac) marks are bromodomains (brds), which are a diverse family of evolutionary conserved protein - interaction modules. the conserved brd fold contains a deep, largely hydrophobic acetyl lysine binding site, which represents an attractive pocket for the development of small, pharmaceutically active molecules. proteins that contain brds have been implicated in the development of a large variety of diseases. recently, two highly potent and selective inhibitors that target brds of the bet (bromodomains and extra - terminal) family provided compelling data supporting targeting of these brds in inflammation and in an aggressive type of squamous cell carcinoma. it is likely that brds will emerge alongside hats and hdacs as interesting targets for drug development for the large number of diseases that are caused by aberrant acetylation of lysine residues. |
during 20092010, an outbreak of dengue fever occurred in key west, florida (9). shortly thereafter, the florida keys mosquito control district proposed the first release of a gm mosquito, ox513a ae. the proposal was met with controversy. on publication of this article, the release was undergoing inspection by the us food and drug administration and had not occurred. we conducted a survey in june 2012 to examine awareness and support of the release after 80 media and outreach activities had been conducted in key west and stock island, florida. we randomly selected 400 residences from the monroe county property appraisers office database and administered a cross - sectional knowledge, attitudes, and practices survey about mosquito control and dengue virus. we collected information on demographics, perception of dengue risk, mosquito knowledge and prevention activities, and health care seeking behavior, among other topics. support was determined on a scale of 1 (strongly oppose) to 5 (strongly support). we requested reasons for participants level of support ; themes raised by 9 respondents were coded into study categories by 2 investigators (k.c.e. and m.h.h.). in this study, the use of gm male mosquitoes results in death of offspring in the larval or pupal stage of gestation ; because of this outcome, outreach activities in the area preceding the survey referred to the mosquitoes as sterile. the survey we used included sterile because this term had been used in community awareness activities and should have been familiar to those who had heard of the proposed release, and we added genetically modified as a descriptor of the mosquitoes. we divided participant groups into participants into those who had or had not heard of the release plans. we used logistic regression to assess associations between hearing of the release and possible explanatory factors. distribution of levels of support of the release among those who had heard of the plan was stratified and tested for differences by demographic factors and participation in dengue and mosquito awareness and prevention activities. we used the mantel - haenszel test for trend for ordinal variables (e.g., education, income) and the test of heterogeneity for categorical variables. of the 400 participants (table 1), 75 (18.8%) were from the originally selected households. of the 386 participants who responded to the question of whether they had heard of the proposed release before the survey, 195 (51.1%) answered yes. prior awareness was more common in white non - hispanics, residents with income levels > $ 50,000 per year, older adults, those who resided on key west island, and residents with knowledge of the local action to break the cycle of dengue public health campaign (table 1). among the 195 who were aware of the release, the distribution of support was : 9.7% strongly opposed, 8.2% opposed, 25.1% neutral, 22.1% supportive, and 34.9% strongly supportive. men, less educated persons, and those willing to pay $ 100 or more for mosquito control were more likely to be strongly supportive (table 2). the most common reasons for opposing the release were disturbance of nature and that it was an unproven technology. most supporters of the release expressed a desire to do anything to get rid of mosquitoes or preferred the method to chemicals and spraying (figure). on the basis of effectiveness, safety, and/or lack of unintended consequences, 22 of the 195 indicated that their support was conditional. all variables listed are included in the adjusted model. demographic totals may not add up to 400 because some participants refused to report demographic information. abcd, florida keys - based action to break the cycle of dengue public health campaign. na, not applicable ; nd, calculation not done ; abcd, florida keys - based action to break the cycle of dengue public health campaign. proportion of respondents reporting different themes for their level of support of plans to release genetically modified, referred to as for community acceptance of the release of gm mosquitoes, several issues must be addressed. release of gm mosquitoes into the community should be transparent ; therefore, the florida keys mosquito control district has begun to disseminate information through public events, articles, and presentations. identification of solutions to reduce risk for vector - borne disease should involve stakeholders from the public, and community leaders in public health, vector control, and municipal administrators. open communication with community members and stakeholders through a health advisory board was instrumental in quelling a 1989 invasion of mediterranean fruit flies in california that had become a crisis event (10). in key west and stock island, public awareness and communication campaigns had limited success. awareness of the release varied across sections of the city and by demographic group. at the time of the survey, the release was planned for key west ; in stock island, awareness was much lower. knowledge of current events has been associated with gender, education level, race and ethnicity, and age (12). support was more commonly reported than opposition among those aware of the release ; a large portion was neutral. most neutral respondents reported they did not know enough to make a decision, and many supporters wanted more information or had concerns. to progress from awareness to knowledge, to understanding, and then to decision - making would require considerable effort and improvement in overall scientific literacy (13). the scientific community is divided about the amount of information that should be provided to community members on highly technical vector control strategies such as the release of the ox513a mosquito (14). benchmarks for acceptable engagement and support should be set by public health organizations before gm vector releases are planned, which will require input from scientists, stakeholders, and the community. strongly opposed participants most commonly reported unintended consequences or disturbing natural ecosystems as their reason for opposition. conversely, some supporters considered the mosquito release a more natural way of controlling mosquito populations than insecticides. participants may not have fully represented the community because of seasonal housing closures and inaccessibility of some gated communities. a systematic replacement strategy was used to minimize bias. to obtain information on support, we provided a short statement about the release, modeled after earlier community outreach efforts and that used the term sterile mosquito instead of genetically modified mosquito. we excluded responses of participants without prior awareness from our analysis because our informational statement was cursory. follow - up studies in key west that provided more extensive information yielded the same 9% strong opposition rate (15). introduction of gm mosquitoes has the potential to reduce mosquito - borne disease ; however, little data exist on the type and extent of outreach required or community support needed to reduce opposition. as of december 2014, a short - term release of oxitec ox513a mosquitoes is proposed on key haven, a peninsula adjacent to key west. this is part of an application by oxitec : regulatory clearance for investigational use of a new animal drug. this release is proposed before broader implementation in key west or elsewhere in the florida keys (m.s. if approved, this release could serve as a model of best practices for establishing community relations and engagement before implementing vector control strategies. | after a dengue outbreak in key west, florida, during 20092010, authorities, considered conducting the first us release of male aedes aegypti mosquitoes genetically modified to prevent reproduction. despite outreach and media attention, only half of the community was aware of the proposal ; half of those were supportive. novel public health strategies require community engagement. |
idiopathic macular epiretinal membrane (ierm) is a relatively common disorder, with an incidence reaching 12% in those older than 70 years. on one hand, ierm seems to begin with microfractures in the inner retina after posterior vitreous detachment, while, on the other hand, it seems to occur when the external layer of the posterior vitreous cortex remains attached to the macula. ierm can vary from a single layer to a thick, multilayer fibrocellular proliferation shrinking the retinal surface. although patients with ierm can be asymptomatic at the beginning, they may complain of various degree of visual symptoms : distortion of lines (metamorphopsia), decreased visual acuity, macropsia, micropsia, and monocular diplopia. in symptomatic patients, the surgical removal of the epiretinal membranes with pars plana vitrectomy (ppv) is the gold standard surgical procedure [3, 4 ]., it could be advisable to remove ilm to reduce erm recurrence by eliminating the scaffold for the proliferation of fibrocellular tissue. on the contrary, liu. reported that ilm + erm peeling compared to erm peeling alone, achieved better best - corrected visual acuity (bcva) 12 months after surgery but not after 18 months, showing that a longer follow - up would be advisable. quality of life, contrast, and color sensitivity are becoming useful parameters in the workup of patients affected by ierm, together with visual acuity and retinal morphology. microperimetry provides information on foveal fixation, macular sensitivity, and depth of central macular defects and is gaining interest in the assessment of various retinal diseases [612 ]. microperimetry, before and after ierm surgery, can help the surgeon in evaluating which kind of patients could benefit from surgery and what could be their prognosis. moreover, thanks to the autotracking system that corrects involuntary eye movements and the possibility to do follow - up examinations, it allows a greater reliability and reproducibility of the tests than automated perimetry [13, 14 ]. long - term follow - up is a useful tool to evaluate the effectiveness of a treatment, especially when a total consensus about the timing of a surgical procedure is still not available. aim of the study was to investigate the potential recovery of retinal functions assessing the microperimetric outcomes in patients affected by ierm and cataract who underwent 25-gauge ppv with ilm peeling combined with phacoemulsification and intraocular lens (iol) implantation in a long - term follow - up. this interventional open label study has been approved by the local institutional ethics committee and review board and registered on clinicaltrials.gov (number nct01771939). the research adhered to the tenets of the declaration of helsinki and written informed consent was obtained from all patients before participation in the study. from october 2009 to july 2010, 30 eyes of 30 consecutive patients affected by idiopathic epiretinal membranes and various degree of cataract were recruited for the study. inclusion criteria were ierm clinical finding, macular thickness > 250 m as measured by spectral - domain oct (sd - oct, rtvue 100, optovue, fremont, ca), presence of metamorphopsia at the amsler grid chart, and a visual acuity loss of 2 snellen lines in the last six months. exclusion criteria were glaucoma, corneal or lens opacities that precluded an acceptable retinal visualization, ocular axial length > 25 mm (measured with a - scan biometry), epiretinal membrane secondary to trauma or vascular diseases, any macular degeneration, diabetic retinopathy, and/or previous ophthalmic surgery. all patients underwent a routine ophthalmic examination (before and at 1, 7, 30, 90, 180, and 360 days after surgery) including slit - lamp biomicroscopy, bcva with the early treatment diabetic retinopathy study (etdrs) score at 4 meters, dilated fundus examination, and intraocular pressure measurement using goldmann tonometry. oct examination calculating central retinal thickness (crt) in the central mm using the macular map 5 5 mm (mm5) and microperimetry with the mp1 (nidek technologies, padova, italy) were performed before surgery and at 90, 180, and 360 days after surgery. patients were called back to our center four years after the intervention to assess long - term functional and morphological outcomes. an expert vitreoretinal surgeon (mdv) performed all surgical procedures. after the insertion of three 25-gauge cannulas, through a 2.75 mm clear - cornea incision, phacoemulsification of the lens was performed. a foldable intraocular lens (iol) akreos ao (bausch and lomb, rochester, the core vitrectomy was performed with the accurus machine 25 g+ (alcon laboratories, fort worth, tx, usa). the posterior hyaloid membrane, if not spontaneously detached, was dyed with micronized triamcinolone acetonide (ivt, bioos, italy), separated by aspiration, and removed. after the extension of vitrectomy to the ora serrata the membraneblue - dual dye (dorc, zuidland, netherlands) was used in order to peel the erm and the ilm within the vascular arcades, with a 25-gauge micro forceps (alcon laboratories). a second stain with membraneblue - dual dye was applied to check whether the ilm peeling was completed. an accurate inspection of the peripheral retina and the photocoagulation of eventual retinal holes, tears, or rhegmatogenous degenerations was followed by the exchange of the balanced salt solution (bss) with filtered air and cannulas removal. tobramycin 0.3% and dexamethasone 0.1% eye drops were prescribed 3 times a day for a month after surgery. patient sat in front of the mp1 with the head carefully aligned in the chin rest and against the forehead strap. all subjects underwent the exam under dim light conditions with dilated pupil in the study eye. stimulus size was goldmann iii white spot, with a stimulus duration of 200 ms. threshold strategy was hfa 4 - 2, and background luminance was 1.27 cd / m (4 asb). stimulus attenuation ranged from 0 db that represents the instrument 's maximum stimulus luminance to 20 db that represents the minimum stimulus luminance. the automatic eye tracker was used to compensate eye movements and to calculate horizontal and vertical shifts relative to a reference frame during the examination. the recorded fixation points were classified into three categories for fixation stability analysis (stable, relatively unstable, and unstable). fixation was regarded as stable if more than 75% of the fixation points were inside the 2 diameter circle, as relatively unstable if 2 etdrs lines, respectively. mean bcva change was of 3.1 etdrs lines at one year and 3.3 etdrs lines at 4 years. preoperative mean crt significantly changed (p < 0.01) after surgery at both 1 and 4 years. baseline mean value was 381.22 69.86 m, while at one and four years 293.71 47.66 m and 280.74 39.57 m were, respectively, measured. in one patient, the crt increased (31 m at one year and 18 m at 4 years) probably due to preoperative borderline crt value (252 m). no significant changes were observed in mean crt values between 1 and 4 years (p = 0.08). significant differences (p < 0.01) were found between preoperative and postoperative data at one and four years for both mean retinal sensitivity and mean defect (figure 1). at baseline, one year, and four years the mean retinal sensitivity in the 10 central area was 10.48 4.17 db, 12.33 3.66 db, and 14.18 3.46 db, respectively. at baseline, one year, and four years the mean retinal defect in the 10 central area was 9.18 4.40 db, 7.49 3.31 db, and 4.66 2.85 db, respectively. significant differences were found in ms and md between one and four years after surgery (p < 0.001). no significant differences in fixation stability in the central 2 and 4 were found at all visits. surgical approach in symptomatic patients with ierm showed good results in terms of visual acuity and retinal function recovery with minimal surgical complications and no recurrence of pathology. the application of dyes during vitreoretinal surgery improved visualization of erm and the vitreoretinal interface. the toxic effect of dyes used during the peeling can not be excluded. however, trypan blue and brilliant blue g used in this study are recognized safe staining agents with no or minimal toxic effects on retina at the concentrations used. when patients present a certain degree of cataract, the association of ppv with cataract surgery enables a better visualization of the retina. moreover, ppv in phakic eyes determines a progression of nuclear sclerosis, and, after vitreoretinal surgery, phacoemulsification is more difficult and with a greater rate of complications [16, 17 ]. our patients showed a significant and early improvement of functional outcomes and a reduction of crt at oct, as reported in the literature [1820 ]. although after ierm surgery bcva continues to improve up to 2 years, best values are reached at about 1 year, in accordance with our findings, as no changes have been detected between 1 and 4 years [2123 ]. as observed by ripandelli. in patients who underwent ilm peeling, in our study the number of microscotomas in the 10 analyzed area improved after surgery, although not significantly. with a steady fixation stability over time, ms and md interestingly increased between 1 and 4 years, demonstrating a significant dissociation between bcva and retinal sensitivity, as has already been demonstrated in other retinal pathologies, underlying the microperimetry capability to detect even subtle changes in patients ' quality of life. as in our study combined surgery was performed in all cases, it was impossible to determine if the immediate postoperative outcome improvements were completely associated with the ierm removal or with cataract extraction or both. on the other hand, the double procedure removed an important potential confounding factor in the evaluation of the outcomes after surgery. this study has some limitations : the small sample size analyzed might have influenced the power of the study, the incomplete follow - up of some patients (only 67% at four years), and the absence of a quantification of metamorphopsia (e.g., m - chart) providing another quality of life parameter. in conclusion, microperimetry proved an effective diagnostic tool in evaluating subtle changes in retinal function, undetectable with a visual acuity exam. long - term follow - up after vitreoretinal surgery would be advised to reveal changes in retinal sensitivity affecting patients quality of life. the use of high definition imaging techniques to analyze further aspects of this pathology such as correlation between long - term anatomical changes and microperimetric data are recommended. | purpose. to investigate retinal function using microperimetry in patients affected by idiopathic epiretinal membrane (ierm) and cataract who underwent combined surgery : 4-year follow - up. design. prospective, interventional case series. methods. 30 eyes of 30 consecutive patients with ierm and age - related cataract underwent 25-gauge vitrectomy and cataract surgery. at baseline, 90 and 180 days, and 1 and 4 years, we examined retinal mean sensitivity (ms), retinal mean defect (md), fixation stability, and frequency of microscotomas using mp1 microperimetry. best - corrected visual acuity (bcva) and central retinal thickness (crt) using a spectral domain optical coherence tomography (sd - oct) were also performed. results. all patients completed 1-year follow - up, while 23 patients reached last follow - up. baseline ms and md (10.48 4.17 and 9.18 4.40 db) significantly changed at one year (12.33 3.66 and 7.49 3.31 db, p < 0.01), at four years (14.18 3.46 and 4.66 2.85, p < 0.01), and between one and four years (p < 0.01) after surgery. compared to baseline, crt and bcva significantly changed at one year and remained stable at four years. no variations were observed in fixation stability and frequency of microscotomas compared to baseline. conclusions. long - term follow - up using microperimetry seems useful to evaluate patients after ierm surgery : retinal sensitivity changes even when bcva and crt remain stable. |
the role of targeted therapies in medical oncology has tremendously increased over the last ten years. a high number of novel molecular substances have already been approved for clinical use and several compounds are in ongoing trials at present (1,2). despite some very successful therapeutics like the tyrosine kinase inhibitor imatinib, which greatly ameliorated the outcome of patients suffering from chronic myelogenous leukemia (3), several of the molecular drugs have not met the expectations from preclinical data when applied clinically. we reason that one cause for this discrepancy could be that many drugs are tested under non - physiological two - dimensional (2d) cell culture conditions not sufficiently reflecting the microenvironment in vivo. three - dimensional (3d) cell culture models are in use for several decades now. amongst scientists from various fields of biology and medicine, the culturing of cells in three dimensions opened new avenues of experimentation and thinking. aside from its potential for tissues engineering, our understanding of cell biology has reached a new dimension ranging from gene expression to protein - protein interactions and signal transduction. the groundbreaking work of bissell and co - workers and many others strikingly exhibited the essence of 3d growth conditions for single cells and higher order multicellular organisms (47). today, a large body of literature evidently demonstrates that the response of 3d grown cells to external stress and stimuli such as drug treatment or exposure to ionizing radiation more reliably reflects the cell response in vivo than the results obtained under 2d cell monolayer growth conditions (4,816). this effect could be due to both, the change in morphology and the activation of integrins and other cell adhesion receptors by binding to the ecm components, which strongly impact on cell behavior, functionality, gene and protein expression, protein - protein interactions, signal transduction and cellular sensitivity to cytotoxic stress (7,15,1728). for in vitro investigation, cell phenotype and an example of even higher clinical relevance is a whole genome gene expression analysis of 3d grown human breast cancer cell lines, which was elegantly used to demonstrate predictive power for the probability of relapse and overall survival of breast cancer patients (12,22). by keeping in mind the heterogeneous distribution and expression patterns of ecm proteins in the different types of human malignancies, cell phenotypes of normal epithelial cells and cancer cells can be reproducibly maintained or restored by culturing them in laminin - rich basement membrane extracellular matrix (lrecm ; matrigel) (7,29). on top with subsequent lrecm overlay, the lrecm isolated from the engelbreth - holm - swarm mouse sarcoma provides a broad spectrum of applications for 3d cell investigations including measurement of apoptosis, cell proliferation, malignant transformation and differentiation. a variety of published protocols explains how cells can be isolated from lrecm gels for protein expression and functional exploration or examined in situ using microscopy on living cells or histology (immunohistochemistry, immunofluorescence) on fixed cells, organotypic cell cultures or tissues (23,29). cell survival in vitro is often measured in terms of apoptosis, dye exclusion or proliferation. although more time consuming, the colony forming assay has been shown to reliably determine tumor cell kill and reflect tumor control, whereas proliferation assays are used to explore tumor growth delay (30,31). consequently, the colony forming assay is the gold standard for all disciplines for evaluating dose - effect relationships between e.g. drug concentration or radiation dose and cell survival (32). however, to date, there is no existing assay to determine clonogenic cell survival as well as tumor proliferation under 3d cell culture conditions in a large scale for drug efficacy testing. on this basis, in the present study, we describe a high - throughput 3d lrecm based cell culture technique that greatly broadens the spectrum of already existing 3d cell culture protocols and enables a robust, reliable and reproducible analysis of the cancer cell response to cytotoxic drugs, targeted therapeutics or different kinds of radiation. fadu, a549 and dld1 carcinoma cells were obtained from the american type culture collection (atcc ; manassas, va, usa). the origin and stability of the cells were routinely monitored by short tandem repeat analysis (microsatellites). cells were cultured in dulbecco 's modified eagle 's medium (dmem ; paa laboratories gmbh, coelbe, germany) supplemented with 10% fetal bovine serum (fbs ; paa laboratories) and 1% non - essential amino acids (paa laboratories) at 37c in a humidified atmosphere containing 7% co2. for all experiments asynchronously growing cell cultures were used. irradiation (x - rays, 200 kv, 20 ma) was performed at room temperature using a yxlon y.tu 320 (yxlon international ct development gmbh, hattingen, germany) containing a 0.5-mm copper filter. for measurement of the absorbed dose a duplex dosimeter (ptw freiburg gmbh, freiburg, germany) was used. the dose - rate was ~1.3 gy / min and applied doses ranged from 0 to 4 gy. asynchronously growing cells were trypsinized, counted using a neubauer counting chamber (paul marienfeld gmbh & co. kg, lauda - knigshofen, germany) and plated as single cells in 6-well cell culture plates. after 24 h, cells were irradiated with 4 gy or treated with cisplatin (25 m) or cetuximab (5 g / ml ; merck, darmstadt, germany) or left untreated. after 1 h cells were washed with 1x pbs to remove cisplatin from the cell culture medium. for determination of long - term survival cells were cultured for 8 days (a549, dld1) or 11 days (fadu) enabling colony growth. counting of cell colonies with > 50 cells was performed using a stemi 2000 microscope (carl zeiss, jena, germany). surviving fractions were calculated as follows : numbers of colonies formed/[numbers of cells plated (irradiated) plating efficiency (unirradiated) ]. each point on survival curves represents the mean surviving fraction from at least three independent experiments. asynchronously growing cells were trypsinized, counted and mixed with cell culture medium containing 0.5 mg / ml lrecm (cat. then, 100 l of this mixture was placed in 96-well plates precoated with 50 l of 1% agarose. after 2 h, the cell - lrecm layer was covered with 100 l of cell culture medium. to prevent evaporation of medium, circumjacent wells 1). after 24 h cells were irradiated with 4 gy or treated with cisplatin (25 m) or cetuximab (5 g / ml) or left untreated similar to 2d cell culture conditions. to withdraw cisplatin from the cell culture, medium was carefully removed without touching the cell - lrecm layer and new cell culture medium was added. cells were cultured for 8 days (a549, dld1) or 11 days (fadu). cell clusters (with the minimum size of a cell cluster containing 50 cells) were either counted microscopically without staining using a axiovert 25 with a 2.5 objective (carl zeiss) or evaluated automatically as described below. for automated analysis of survival and proliferation, each well was imaged in at least 7 different z - levels using an axio observer microscope with a 2.5 objective (carl zeiss). imagej / fiji (33) was used for image processing and an example imagej macro is shown in table i. briefly, focus stacking was applied to the z - level images to yield a single clear image of all 3d colonies. a watershed algorithm was used to separate overlapping colonies, and automatic colony counting followed. the resulting tables can be further summarized and analyzed using r (34). the example scripts (imagej : table i ; r : table ii) automatically process images from multiple wells. the r script generates a histogram of colony size for each well and a summary result table of all wells imaged containing the number of colonies, the average colony area and the total colony area as a measurement of proliferation. fadu, a549 and dld1 carcinoma cells were obtained from the american type culture collection (atcc ; manassas, va, usa). the origin and stability of the cells were routinely monitored by short tandem repeat analysis (microsatellites). cells were cultured in dulbecco 's modified eagle 's medium (dmem ; paa laboratories gmbh, coelbe, germany) supplemented with 10% fetal bovine serum (fbs ; paa laboratories) and 1% non - essential amino acids (paa laboratories) at 37c in a humidified atmosphere containing 7% co2. for all experiments asynchronously growing cell cultures were used. irradiation (x - rays, 200 kv, 20 ma) was performed at room temperature using a yxlon y.tu 320 (yxlon international ct development gmbh, hattingen, germany) containing a 0.5-mm copper filter. for measurement of the absorbed dose a duplex dosimeter (ptw freiburg gmbh, freiburg, germany) was used. the dose - rate was ~1.3 gy / min and applied doses ranged from 0 to 4 gy. asynchronously growing cells were trypsinized, counted using a neubauer counting chamber (paul marienfeld gmbh & co. kg, lauda - knigshofen, germany) and plated as single cells in 6-well cell culture plates. after 24 h, cells were irradiated with 4 gy or treated with cisplatin (25 m) or cetuximab (5 g / ml ; merck, darmstadt, germany) or left untreated. after 1 h cells were washed with 1x pbs to remove cisplatin from the cell culture medium. for determination of long - term survival cells were cultured for 8 days (a549, dld1) or 11 days (fadu) enabling colony growth. counting of cell colonies with > 50 cells was performed using a stemi 2000 microscope (carl zeiss, jena, germany). surviving fractions were calculated as follows : numbers of colonies formed/[numbers of cells plated (irradiated) plating efficiency (unirradiated) ]. each point on survival curves asynchronously growing cells were trypsinized, counted and mixed with cell culture medium containing 0.5 mg / ml lrecm (cat. then, 100 l of this mixture was placed in 96-well plates precoated with 50 l of 1% agarose. after 2 h, the cell - lrecm layer was covered with 100 l of cell culture medium. to prevent evaporation of medium, circumjacent wells 1). after 24 h cells were irradiated with 4 gy or treated with cisplatin (25 m) or cetuximab (5 g / ml) or left untreated similar to 2d cell culture conditions. to withdraw cisplatin from the cell culture, medium was carefully removed without touching the cell - lrecm layer and new cell culture medium was added. cells were cultured for 8 days (a549, dld1) or 11 days (fadu). cell clusters (with the minimum size of a cell cluster containing 50 cells) were either counted microscopically without staining using a axiovert 25 with a 2.5 objective (carl zeiss) or evaluated automatically as described below. for automated analysis of survival and proliferation, each well was imaged in at least 7 different z - levels using an axio observer microscope with a 2.5 objective (carl zeiss). imagej / fiji (33) was used for image processing and an example imagej macro is shown in table i. briefly, focus stacking was applied to the z - level images to yield a single clear image of all 3d colonies. a watershed algorithm was used to separate overlapping colonies, and automatic colony counting followed. the resulting tables can be further summarized and analyzed using r (34). the example scripts (imagej : table i ; r : table ii) automatically process images from multiple wells. the r script generates a histogram of colony size for each well and a summary result table of all wells imaged containing the number of colonies, the average colony area and the total colony area as a measurement of proliferation. in the present study, we describe a novel method to measure automatically clonogenic survival and proliferation of cells in a 3d matrix consisting of lrecm which has been reported to mimic physiologic in vivo growth conditions in a better way than conventional 2d cell culture plastic (411,14,16). importantly, this approach can also be used in a high - throughput setting. according to previous data, we found that the response of all three tested human carcinoma cell lines exposed to the chemotherapeutic drug cisplatin (cddp) or to x - ray irradiation was affected by the growth conditions with cells being significantly more resistant when cultured in 3d (fig. this cell adhesion - mediated radioresistance and therapy resistance might result from a multitude of cellular processes including differences in transcriptional, translational, post - translational processes and signal transduction (811,22,36). not surprising and particularly alerting with regard to molecular drug efficacy is that molecular compounds like the egfr inhibitor cetuximab are also less effective under 3d growth conditions and that this cellular drug response correlates more closely with in vivo results (fig. 1) (911,37). these data confirm the necessity to test targeted substances and more conventional therapeutics in a 3d matrix - based in vitro assay prior to animal studies to minimize costs, time and effort. the workflow of plating and treatment of cells for the 3d clonogenic assay is depicted in figs. 2 and 3. agarose, cell / lrecm mixture and medium can be applied with a multi - channel pipette allowing time - efficient plating for large - scale analysis. another advantage over most of the existing matrix - based 3d methods is that the lrecm solution with the concentration of 0.5 mg / ml can be produced with pre - heated medium (37c) and processed at room temperature for at least 30 min without becoming solid. therefore, cells do not have to be cooled down which likely provoke a cold stress response and perturb molecular processes (38). to assess the cell number per colony and proliferation of cells embedded into lrecm, we evaluated the number of grown a549 cells over a period of 8 days microscopically (fig. phase contrast microscopy and dapi / f - actin staining revealed similar proliferation rates of this cell line in a 3d matrix in comparison to 2d monolayer cell cultures (~22 h according to atcc) with doubling times of about 24 h after a lag phase of 1 day. importantly, at the time of treatment (1 day after plating), 3d cell cultures are still in the single cell status, a key requirement to measure clonogenic survival (fig. 4) (3032). manually counting of colonies is a time - consuming and error - prone process. therefore, automated evaluation can reduce the working time and improve the inter - observer reliability and validity of data. as the colonies are in a 3d matrix, we took images of the wells in different z - levels and performed focus stacking to create a clear image of all colonies (fig. 5b) enabling the evaluation of the specific treatment effects on tumor cell proliferation as well as on clonogenic survival (fig. 5c). while irradiation or cisplatin treatment reduced both, the size of the colonies and the colony number, cetuximab mainly affected the tumor growth and had no significant impact on cell survival (fig. 5c). a comparison with manually counted results showed an excellent correlation (r=0.81) indicating a high reliability of the obtained data (fig. the role of cancer stem cells for therapy resistance (39), analysis on a single cell base can be crucial to evaluate the potential of targeted therapeutics. with the described technique the size and distribution of every single colony (which grows out of one single cell) 6, control cell cultures had a wide spectrum of colony sizes with several small and medium - sized but also few larger colonies. in contrast, after exposure to cisplatin, ionizing radiation or cetuximab the distribution shifted to the left resulting in an overall decrease of colony size. these data could give valuable information about the different treatment effects in a tumor cell population. in summary, the described protocol is a cost and time - efficient method to analyze the tumor response to cancer therapy in a more physiologic cell culture model. taking into account that 3d lrecm based assays have been shown to reflect the in vivo conditions more reliably than 2d monolayer cells, it would be beneficial to employ this technique in a large - scale evaluation of molecular compounds prior to in vivo studies. | three - dimensional ex vivo cell cultures mimic physiological in vivo growth conditions thereby significantly contributing to our understanding of tumor cell growth and survival, therapy resistance and identification of novel potent cancer targets. in the present study, we describe advanced three - dimensional cell culture methodology for investigating cellular survival and proliferation in human carcinoma cells after cancer therapy including molecular therapeutics. single cells are embedded into laminin - rich extracellular matrix and can be treated with cytotoxic drugs, ionizing or uv radiation or any other substance of interest when consolidated and approximating in vivo morphology. subsequently, cells are allowed to grow for automated determination of clonogenic survival (colony number) or proliferation (colony size). the entire protocol of 3d cell plating takes ~1 h working time and pursues for ~7 days before evaluation. this newly developed method broadens the spectrum of exploration of malignant tumors and other diseases and enables the obtainment of more reliable data on cancer treatment efficacy. |
the antimicrobial peptides (amps) are biologically active molecules produced by wide variety of organisms as an essential component of their innate immune response. the primary role of the amps is host defense by exerting cytotoxicity on the invading pathogenic microorganisms, and they also serve as immune modulators in higher organisms. amps are considered as a promising and potential drug candidate for the future due to their broad range of activity, lesser toxicity, and decreased resistance development by the target cells. the amps were found to exist in a wide range of secondary structures such as -helices, -strands with one or more disulphide bridges, loop and extended structures. the existences of such diverse structural forms of amps are highly essential for their broad spectrum antimicrobial activity. besides these properties, certain crucial factors such as size, charge, hydrophobicity, amphipathic stereo geometry, and peptide self - association to the biological membrane also attributes for their broad spectrum antimicrobial activity. the smaller size of amps facilitates the rapid diffusion and secretion of peptide outside the cells, which is required for eliciting immediate defence response against pathogenic microbes. the differences in the lipid composition between prokaryotic and eukaryotic cell membranes represent the targets for amps. the antimicrobial specificity of amps towards the target cells was highly dependent on the preferential interaction of peptides with the microbial cells, which enable them to kill specific target cells without affecting the host cells. in addition, net charge and hydrophobicity of amps play a crucial role in cellular association of these peptides to selective target cellular membranes in exerting antimicrobial activity. amps have been reported from different sources such as plants, mammals, insects, marine invertebrates, and environmental libraries (table 1). currently, more than 2,000 amps have been reported in antimicrobial peptide database (http://aps.unmc.edu/ap/main.php/). most of them are cationic peptides, and only a few of them are anionic, which shared the ability to fold into amphipathic conformation upon interacting with the membranes. besides antimicrobial function, amps also serve as drug delivery vectors, antitumor agents, mitogenic agents, contraceptive agents, and signalling molecules in signal transduction pathways. this review provide insight into antimicrobials as well as multifunctional properties of amps that provides better understanding of versatile biological properties of amps for prophylactic and therapeutic application. amps are generally defined as peptides of less than 100 amino acid residues with overall net charge of + 2 to + 9, represented by positively charged amino acids such as lysine and arginine along with a substantial portion of hydrophobic residues. the structural and physicochemical properties of amps play an essential role in determining its specificity towards the target cells. insight into the conserved structural elements of amps provides information regarding the evolutionary significance of amps that serves as template for the design of novel peptide antibiotics. the antimicrobial peptide with proline - arginine - proline (prp) motif includes proline / arginine - rich cationic peptides, callinectin, and astacidin 2. these peptides contain one or more prp motif, which showed potent antibacterial activity against gram - positive and gram - negative bacteria. armadillidin is a glycine rich, cationic antimicrobial peptide with unique five - fold repeated motifs of gggfhr or gggfhs and amidation at the c - terminal end that displayed potent antibacterial activity against gram - positive bacteria. penaeidins are chimeric cationic peptides that consist of prp motifs at the n - terminal end (prp - domain) and cysteine rich region at the c - terminal end (cysteine - rich domain) with a conserved chitin binding motif that possessed antimicrobial activity against gram - positive bacteria and fungi. it possessed a wap domain at the c - terminal region with eight conserved cysteine residues forming four disulphide core (4dsc), which was highly responsible for protease inhibitory or regulatory mechanisms. kalata, circulin a & b and cyclopsychotride are macrocyclic cysteine knot - peptides with end - to - end macrocycle and cysteine - knot motif that displayed potent antimicrobial activity against gram - positive, gram - negative bacteria, and yeast. disulphide bridge containing antimicrobial peptides such as hnp-3, mbd-8, phormicin, drosomycin, ah - amp-1, mgd-1, protegrin-1, big defensin, gaegurin-1, tachyplesin-1, polyphemusin-1, mytilin a, gomesin, thanatin, and afp-1 contain conserved gxc or cxg motif (-core signature). the amps with heparin binding ability contained heparin binding motif such as xbbbxxbx or xbbxbx (where x represents hydrophobic or uncharged amino acids, and b represents basic amino acids). the ll-37 is an amphipathic peptide with helical structure and xbbxbx motifs responsible for heparin binding property. certain amps such as penaeidin, tachystatin, cy - amp, ee - cbp, and mmgp1 contain conserved cysteine residues at the c - terminal ends responsible for chitin binding activity. the structural and physicochemical properties of amps play an important role in conferring specific toxicity against the target cells. tachystatin is an antimicrobial peptide identified from the hemocytes of the horseshoe crab, tachypleus tridentatus, which showed broad spectrum of antimicrobial activity against gram - positive, gram - negative bacteria, and fungi. the amphiphilic -sheet at the c - terminal end of tachystatin was highly responsible for their cytolytic activity against the target cells. tenecin 1 is an inducible antibacterial peptide from larvae of tenebrio molitor, with -helical and -sheet fragments at their c - terminal and n - terminal ends that displayed potent antimicrobial activity specifically towards gram - positive bacteria. the chemical synthesis of truncated peptides revealed that the c - terminal -sheet domain of tenecin 1 is highly responsible for both the antifungal and antibacterial activity. this might be due to difference in the net positive charge of both -helical (+ 1) and -sheet region (+ 5). thanatin is an inducible antimicrobial peptide reported from the insect podisus maculiventris with a broad spectrum of antimicrobial activity against gram - positive, gram - negative bacteria, and fungi. the mechanism of action of thanatin involved binding of peptide to the target cell membrane and thereby reduced the surface charge density of lipopolysaccharide and the electrostatic repulsion between the cells, which cause rapid aggregation of target cells and cell death. unlike antibacterial peptides, the amps rich in positively charged amino acids such as arginine and lysine induced energy dependent endocytic pathway such as macropinocytosis for entering into the cells, whereas other amps such as mmgp1 and maganin entered the cells through energy independent direct cell - penetration mechanism, which does not require atp [4244 ]. most of the naturally occurring amps are not optimised for efficient activity and need to be improved through different strategies, before it could be used as therapeutics. recently, several methods have been tested using the native templates to generate more efficient amps such as random mutagenesis, quantitative structure - activity relationship (qsar), altering the peptide structures by cyclization, or by increasing the charge or hydrophobicity of the peptide by tagging. random mutagenesis involved methods that modify the naturally existing amps by addition / deletion / replacement of single or more residues or truncation at the n- or c - terminal or generation of chimeric peptides by combination of both methods. qsar provides a working conceptual model of bioactive peptides, which attempt to find consistent relationship between biological activity and molecular properties. amps based qsar studies involve limited set of systemic modification of residues in naturally occurring amps to form peptides with amphipathic structures. in this, a few aminoacids with specific characteristics such as basic (lysine or arginine) or hydrophobic amino acids (alanine, leucine, phenylalanine or tryptophan) are used to obtain peptide with maximum activity and minimum toxicity towards the host. further, the chemical attachment of aliphatic acids to the n - terminus of biologically inactive peptides with different lengths (10, 12, 14, and 16 aa) resulted in generation of lipopeptides with lytic activity. the selectivity of these lipopeptides against bacteria, fungi, and human erythrocytes was influenced by the length of fatty acids chain, which attributed for increased antimicrobial activity and resistance to proteases. in addition, chemically induced cross links or introduction of covalent lactam bonds in amps provided a way for introducing conformational constraint in peptides that confer newer properties to amps. the formation of covalent cross link between trp 6 and trp 9 in synthetic indolicidin analogue showed decreased susceptibility to protease. similarly, the formation of covalent lactam bond between cecropin - melittin hybrid peptide improved its antibacterial activity. the antimicrobial activity of amps could also be enhanced through modification of their existing structural forms by manipulating the hydrophobicity or flexibility of the peptide secondary structures. the antimicrobial activity of antibacterial peptide, indolicidin isolated from bovine neutrophils was increased by bringing the c - termini and n - termini regions of peptide closer to each other, and the modified peptide was stabilized with disulphide bond by introducing cysteine residues at both the ends, which showed enhanced antibacterial activity against gram - negative bacteria. many amps have unusual amino acids and hence have unusual structures, which attributed for wide range of bioactivities (figure 1 and table 3). depsipeptides are nonribosomal peptides characterized by one or more of the amide (conhr) bonds replaced by an ester bonds (coor). examples for depsipeptides include discodermin a, jaspamide, theonellamide f, cyclolithistide a, callipeltin a, dolastatin 10, and theonegramide. lantibiotics are ribosomal synthesized antibacterial peptides produced by some gram - positive bacteria and are characterized by the presence of unusual amino acids such as lanthionine and dehydrated amino acid dehydroalanine and 2-aminoisobutyric acid, which includes nukacin isk-1, mersacidin, microbisporicin, lacticin 3147, planosporicin, and nisin. amps have attained dynamic interchange in their structure and topologies upon interacting with the microbial cell membranes. the outer surface of prokaryotic cell is negatively charged due to the presence of lipopolysaccharides or teichoic acid, whereas the outer leaflet of eukaryotic cell is composed of zwitterionic phosphatidylcholine and sphingomyelin phospholipids. the electrostatic interaction of peptides with the negatively charged molecules on the membrane seems to be the primary mechanism for antimicrobial activity. in other cases, amps exert antimicrobial activity in target cells by translocating across the cell membrane and inhibit essential cellular processes such as protein synthesis, nucleic acid synthesis, enzymatic activities, and cell wall synthesis. certain other factors such as magnitude and charge of the outer membrane, the concentration of negatively charged molecules, molecular architecture, and fluidity of the outer membrane were also essential for the transport of peptide across the membrane. the fluidity of the membrane was found to regulate the adsorption and insertion of amps into the biological membrane. based on the mechanisms of action, antimicrobial peptides are broadly categorized into membrane acting and nonmembrane acting peptides. membrane permeabilizing peptides are mostly represented by cationic peptides capable of forming transient pores on the membrane, whereas nonmembrane permeabilizing peptides have the ability to translocate across the cell membrane without permeabilizing the membrane. certain antibacterial peptides forming transmembrane pores on the target cell membrane include defensin, melittin, magainins, and ll-37. antimicrobial peptides such as buforin ii, dermaseptin, hnp-1, pleurocidin, indolicidin, pyrrhocidin, and mersacidin get translocated across the cell membrane and inhibit essential cellular processes that lead to cell death. certain antifungal peptides such as papiliocin, melittin histatin, and lactoferrin exert their antimicrobial action through formation of reactive oxygen species. amps promote membrane damage in target cells either by membrane thinning or by pores formation or by lipid bilayer disruption. the cellular uptake mechanisms of amps are categorized into energy dependent and energy independent uptake mechanisms (figure 2). energy independent uptake mechanisms include barrel - stave model, carpet model, or toroidal model, and energy dependent uptake mechanism includes macropinocytosis. in barrel - stave mechanism the aggregated peptides get inserted into the membrane and orient themselves in such a way that their nonpolar side chains direct the hydrophobic lipid core of the membrane, and the hydrophilic surfaces of peptides point inward and formed water filled transmembrane pore that caused release of intracellular content and consequent cell death. an example for antimicrobial peptides that follows barrel - stave mechanisms includes alamethicin and gramicidin s [7678 ]. in carpet model, the peptides once particular threshold concentration was reached, the peptide induced membrane permeation that leads to disruption of cell membrane and causes lysis of the microbial cells. in toroidal pore model, the aggregated peptides either prior or after binding with the membrane surfaces induced membrane depolarization and form a toroidal shaped transmembrane pores with micellar formation that leads to cell death. macropinocytosis is the energy independent uptake route of amps, in which the plasma membrane of the target cells folds inward along with the peptide and forms vesicles called macropinosomes. subsequently, the amps within the vesicles get released into the cytoplasm and exert their antimicrobial action. nonlytic cell - penetrating amps were used as drug delivery vector to treat and manage several diseases. certain large hydrophilic drugs can not easily penetrate through the cell membrane barriers. in such cases, amps with efficient membrane translocating property, which could enter the cells without causing damage to the membranes, were used as drug delivery vectors. the main feature of amps to serve as delivery vector is that they should be able to penetrate the cell membrane at very low concentrations (micromolar) without any specific receptors and capable of efficiently delivering electrostatically or covalently bound biologically active cargoes such as drugs into the cell interior. antibacterial peptides such as ll-37, tp10, and pvec were associated with bacterial membrane damage shown to act as cell penetrating peptides (cpps) without exhibiting toxicity to eukaryotic host cells [84, 85 ]. representative analogue of antimicrobial peptides magainin 2 and buforin 2 was found to enter the human carcinoma cells through membrane translocating mechanisms. the translocation of magainin 2 analogue required transient pore formation as an intermediate steps, which showed higher toxicity to the carcinoma cells, whereas buforin 2 analogue translocated across the membrane in a less concentration dependent passive mechanism without causing significant toxicity to carcinoma cells. synb vectors are new family of peptide vectors derived from an antimicrobial peptide protegrin-1 (pg-1), lacking the cysteine residues responsible for membrane disrupting activity in protegrin-1. synb vectors are capable of transporting very large molecules such as streptavidin (mw : 60 kda) and iggs (mw : 150 kda) and were used to deliver drugs efficiently into complex biological membranes such as blood - brain barrier. pyrrhocoricin and bac7 are cell - penetrating antimicrobial peptides that translocate across the cell membrane through binding of receptors [88, 89 ]. certain antimicrobial peptides such as tat, penetratin, pep1, and mmgp1 were reported to enter the target cells through energy independent direct cell - penetration mechanisms [43, 90 ]. the ability of amps to interact with different cell membranes makes it to serve as the multifunctional effector molecules (figure 3). increased susceptibility of tumour cells to cationic membrane active amps due to the presence of high content of anionic phosphatidylserine molecules on their membranes than the normal cells makes it an interesting candidate to use amps as antitumour agents. amps such as magainins, defensins, bmap-27 and bmap-28, gaegurins, tachyplesin i, cecropins, and melittin were reported to exhibit tumoricidal activity against melanoma and carcinoma cells both under in vitro and in vivo conditions. for instance, magainin ii (mg2) exhibited cytotoxicity in tumour cells only at higher concentration, likely due to the inefficiency of mg2 in cell membrane binding and its subsequent entry. conjugation of cpp penetratin (antp) to mg2 showed enhanced cytotoxicity to tumour cells at a lesser concentration. furthermore, amps are more susceptible to degradation by proteases in the extracellular matrix of the tumour cells, which leads to loss in their tumoricidal activity. this could be overcome by expression of amp encoding gene directly into the tumour cells or by replacement of peptide amino acids by their d - amino acids and modification of peptide terminal by amidation. recent synthesis of truncated fragments of antibacterial peptides such as epinecidin-8 and pardaxin-6 showed higher tumoricidal activity against human epithelial carcinoma (hela) and fibrosarcoma (ht-1080) cell lines. the combination of cell - penetrating- peptide, peg-1, with antimicrobial undecapeptides showed efficient anticancer properties against mda - mb-231 human breast cancer cells. certain amps such as pexiganan msi-78, citropin 1.1, protegrin 1, synthetic lipopeptide, and n--palmitoyl - l - lysine l - lysine amide (pal - lys - lys - nh2) showed cytotoxic activity against u937 histiocytic cell line. of these, pexiganan msi-78, protegrin 1, and lipopeptide showed increased tumoricidal activity due to their stronger membranolytic activity that leads to necrosis. cecropins a and b showed selective inhibitory and antiproliferative efficacy against bladder tumour cells lines, rt4, 647v, j82, 486p, and benign fibroblast cell line, 3t6. defensin stimulated the growth of normal fibroblast and epithelial cell under in vitro conditions, which was highly essential for the healing wounds under in vivo conditions. dermaseptin (drs) b2 is an amp identified from the skin secretion of the amazonian tree frog ; phyllomedusa bicolor had both antitumour and angiostatic activities against prostate adenocarcinoma cell line, pc3 in a xenograft model in vivo. these functional dualism of amps to act as antitumor and mitogenic agent makes it an interesting candidate to study every aspect is of their biological activity for clinical applications. host defense peptides (hdps) are short cationic amps produced by the immune systems of most organisms, which plays a crucial role in innate immunity. most hdps are involved in modulation of immune response as host defense and also act as modulators of signal transduction pathways by influencing the activity of intracellular signalling targets such as protein kinases (table 5). defensins are hdps produced by different cell types such as lymphocytes, neutrophils, tissue macrophages, small intestinal epithelial cells, keratinocytes, and cardiomyocytes and are classified into two groups such as -defensins and -defensins. defensins were known to involve in host cell receptor interaction, chemo attractant of immune cells, recruitment of neutrophils, mobilization of immunocompetent t - cells as well as enhancer of cell adhesion, and activation of classical complement pathways [129133 ]. especially, murine defensins regulate the migration and recruitment of antigen presenting and immunocompetent cells by binding with cc - chemokine receptors during inflammatory and immunological responses. guinea pig defensins induced adhesion of neutrophils and inhibit generation of superoxide anion during phagocytosis of complement - opsonized particle. ll-37 is a host defense amp produced by different cell types such as neutrophils, mast cells, monocytes, and macrophages that serve as a chemoattractant of neutrophils and mast cells, inhibit neutrophil and keratinocytes apoptosis, promote chemokine induction, angiogenesis, and stimulate differentiation of monocytes and proliferation of vascular endothelium. pr-39 is a proline and arginine rich antimicrobial peptide isolated from pig intestine, which regulate various processes such as cell development, cell proliferation, cell cycle control, cell survival, migration, and invasion by binding with the cas family adapter protein, p130. besides antimicrobial and immune regulating action, amps play a key role in immune neuroendocrine interactions, taking part in the pathogenesis of stress reactions (corticostatic action) and also serve as regulatory peptides of adaptogenic action. the epidermoid carcinoma derived antimicrobial peptide (ecap)inhibits autophosphorylation of epidermal growth factor receptor and leads to decreased activity of lyn and syk tyrosine kinases. sigma factors are an essential component of rna polymerases and determine the selectivity of promoter. the substitution of one sigma factor for another can redirect rna polymerases in a cell to activate the transcription of genes. the extra cytoplasmic function (ecf) sigma factors are small regulatory proteins that are quite divergent in sequence relative to most other sigma factors, and they function as antisigma factors that bind and inhibit cognate sigma factor upon receiving a stimulus from the environment naturally derived amp such as ll-37 and pg-1 serves as an activator of ecf sigma factors regulons such as sigw and sigm in a weak manner, whereas their synthetic analogue poly - l - lysine seems to be the strong activator of sigw. sigm is required for maintaining the integrity of the cell envelope during stress induced by antibiotics, ethanol, heat, acids, and superoxides. it is also essential for the cells to survive under high salt concentrations [138, 139 ]. sigw is activated on stress induced by alkaline shock, inhibition of cell wall synthesis, disruption of membrane integrity by detergents [140, 141 ]. certain immunomodulatory anti - infectives with antimicrobial properties in commercial development are cd - np, a chimeric synthetic peptide np (37 mer) used for the treatment of heart failure and opebacan, xoma 629 (xoma), and cp-226 (migenix), which could be used for the treatment of allogeneic stem cells transplantation - associated infections, endotoxemia in haematopoietic stem cells, impetigo, and catheter / dermatology - related infections. a number of amps have been described in the reproductive tract of mammals that serves dual role on regulating fertility and preventing sexually transmitted diseases [143, 144 ]. lactoferrin was found to be localized in the vaginal fluid and mucosal plug, which inhibit viral fusion and its subsequent entry by binding and disruption of the microbial membranes under acidic conditions. cathelicidin was found to be present in mucosal secretions, vaginal secretions, and seminal plasma, which prevented the microbial infections following sexual intercourse by neutralizing the lipopolysaccharides of microbial cells. defensins were reported to be present in ectocervix, vagina, testis, epididymis, seminal plasma, sperm, and germ cells that impair with the metabolic processes of microbes by penetrating the microbial membranes [145, 146 ]. dermaseptins and magainins are two classes of cationic, amphipathic -helical peptides identified in the skin extracts of frogs phyllomedusa sauvagei and xenopus laevis, which showed contraceptive activities against various sexually transmitted infections (stis) causing pathogens and hiv infections. nisin possessed contraceptive effect by arresting the movement of spermatozoa, whereas magainin al inhibited the sperm motility without causing damage to vaginal epithelial cells, thereby could be used as novel contraceptive microbicides [148, 149 ]. plants are constantly threatened by pathogenic microorganisms present in the environment. in recent, years, transgenic expression of genes encoding amps could help to enhance resistance against a wide range of phytopathogens. amps have been reported to be expressed in plant systems such as tobacco, banana, and potato for the production of pharmaceutical peptides and to develop transgenic plants that confer resistance to several plant diseases [17, 150 ]. the amps such as d4e1, esculestin, msi-999, human lactoferrin, shiva-1, and sb-37 were successfully expressed in plant systems that developed resistance against plant pathogens. a synthetic substitution analogue of antimicrobial peptide maiganin, msi-99 imparts enhanced resistance to pathogenic fungi, aspergillus niger in transgenic potato cultivars. integration of antimicrobial peptide genes np3 and np5 from chinese shrimp (fenneropenaeus chinensis) into the rice plant, oryza sativa l. subsp. expression of a novel antimicrobial peptide penaeidin 4 - 1 from the shrimp, litopenaeus setiferus in creeping bent grass, agrostis stolonifera l. showed enhanced resistance to fungal disease, dollar spot, and brown patch. thus, the application of amps in plant transgenesis seems to be the alternative strategy for plant disease control. amps are potent agents with diverse structural and antimicrobial properties, which represent one of the most promising future drug candidate for combating infections and microbial drug resistance. in addition to their microbicidal activity, amps also possess other biological activities and have potential applications as signalling molecules, immune modulators, antitumour agents, drug delivery vehicles, and plant transgenesis mediators. thus, understanding the versatile biological properties of amps can be of extreme importance for clinical development of peptide - based therapeutics. | antimicrobial peptides are diverse group of biologically active molecules with multidimensional properties. in recent past, a wide variety of amps with diverse structures have been reported from different sources such as plants, animals, mammals, and microorganisms. the presence of unusual amino acids and structural motifs in amps confers unique structural properties to the peptide that attribute for their specific mode of action. the ability of these active amps to act as multifunctional effector molecules such as signalling molecule, immune modulators, mitogen, antitumor, and contraceptive agent makes it an interesting candidate to study every aspect of their structural and biological properties for prophylactic and therapeutic applications. in addition, easy cloning and recombinant expression of amps in heterologous plant host systems provided a pipeline for production of disease resistant transgenic plants. besides these properties, amps were also used as drug delivery vectors to deliver cell impermeable drugs to cell interior. the present review focuses on the diversity and broad spectrum antimicrobial activity of amps along with its multidimensional properties that could be exploited for the application of these bioactive peptides as a potential and promising drug candidate in pharmaceutical industries. |
case one was 13 years old and had severe sudden onset low back pain with radiation to anterior aspect of right thigh during extension of leg. computerized tomography at l2-l3 level (figure 1) showed a bony fragment similar to an osteophyte extending to canal. in lumbosacral mri we detected a l2-l3 disc bulging with impingement of l3 root and thecal sac compression (figure 23). the second case was 14 years old and had sudden onset low back pain with radiation to right lower extremity for one month. he had pain in territory of l5 root with intact muscle power and deep tendon reflexes. note the avulsed bony particle from apophyseal rim intervertebral disc herniation at level of l2-l3 in sagittal view mri (axial view) from l2-l3 inter vertebral disc lateral lumbosacral radiography showed a small bony extension into vertebral canal at l4-l5 intervertebral disc level (figure 4). he was disable and had no recovery after several medical and conservative management and physiotherapy. lateral lumbosacral x - ray.small bony particle adjust to posterior margin of l4 rim is seen in his lumbosacral mri, he had a herniated l4-l5 disc herniation with compression effect on the thecal sac and right l5 root (figure 5). mri(axial view) from l4-l5 inter vertebral disc due to failed conservative management by other referral centers, we operated them in prone position. avulsed, hard and sharp particles of the posterior rim of vertebral body, including overlying cartilage of the annulus fibrosus similar to takata classification type - ii were seen. retropulsed bony fragment was removed after careful separation from peripheral tissue. then herniated intervertebral disc the calcification of the cartilaginous rim occurs around age 13 and fused with the vertebral body by the end of skeletal growth, i.e. by the age of 18 - 25 years.3791011 the development occurs at different rates in various spinal segments. intervertebral disc of immature spine is fastened to the ring apophysis by the outermost fibers of annulus fibrosis (sharpey 's fibers).3 avulsion of lumber vertebral apophyseal rim is very rare and there are two possible mechanisms by which the fracture can occur. first, the force transmitted to sharpey 's fibers by annulus pulpous during herniation may cause disruption at the weak point of osteocartilagenous junction, thus resulting in an avulsion fracture. second, migration of the nucleus pulpous may occur through the weak point, similar to the mechanism which results in limbus vertebra.3710 apophyseal avulsion is a very rare lesion and accurate diagnosis is often delayed because of concerns for neoplasm, infection and spondylolisthesis.4111317 takata have classified these fractures in three types on basis of ct - scan studies : type i, a simple separation of the entire arcuate posterior margin of the vertebra, type ii, an avulsion fracture of the posterior rim of the vertebral body, including the overlying cartilage of the annulus fibrosus, resulting in a thicker and larger fragment and type iii, a more localized fracture involving a large amount of the vertebral body so that the resulting fragment is larger than the vertebral rim.317 according to takata classification, type i and type ii can be treated conservatively and type iii and iv require surgical intervention. epstein proposed an additional cate - gory : type iv, a fracture of both cephalad and caudal end plates, which spans the full length of the posterior margin of vertebral body.317 these fractures need to be accurately diagnosed compared to simple disc herniations, specially in children and adolescents.56711 these type of fractures require more suspension and knowledge for diagnosis and need more extensive exposure during laminectomy for better resection of pathology and decompression of nerve roots.313 so, unilateral laminatomy is not recommended in these patients because mobile and sharp retropulsed particle can displace cephalad or caudal and can damage neural structures. for early detection of epiphyseal fracture, computerized tomography is recommended to show bony component of herniated material.6912 computerized tomography scans can be a good diagnostic technique for early detection of epiphyseal slipping, so we recommend it. mrf : carried out the design, coordinated the study and participated in most of the experiments and prepared the manuscript. | avulsion or fracture of posterior ring apophysis of lumbar vertebra is an uncommon cause of radicular low back pain in pediatric age group, adolescents and athletes. this lesion is one of differential diagnosis of disc herniation. we reported two teenage boys with sever low back pain and sciatica during soccer play that ultimately treated with diagnosis of slipped vertebral apophysis. |
various large - scale and high - throughput techniques, such as chromosome banding (1,3), comparative genomic hybridization (cgh) (4) and fluorescence in situ hybridization (fish) (5), are being used in modern cancer cytogenetics to detect structural and copy number changes in chromosomes. the most common type of mutation among the known cancer genes is chromosomal translocation (6). it can deregulate the gene expression by disrupting the promoter region of the gene or by joining the gene with enhancer elements like immunoglobulin or t - cell receptor genes (7). alternatively, fusion of two coding regions creates a chimeric gene that encodes a fusion protein that interferes with the normal regulating pathways (2,8). abl, the target protein of the drug gleevec treating chronic myeloid leukemia (cml) (8,9). cml is associated in most cases with a chromosomal translocation between chromosomes 9 and 22 that creates the philadelphia chromosome. the bcr gene in chr22 is fused with the gene abl in chr9, so called the t(9;22)(q34;q11) translocation. the tyrosine kinase activity of abl is constantly activated by the bcr gene (gtpase activator) in the fusion protein, resulting in the rapid cellular mitosis and inability of the cell to perform apoptosis. two adjacent, independent genes may be co - transcribed and the intergenic region is spliced out so that the resulting fused transcript possesses exons from both genes (10). this phenomenon, termed as cotranscription and intergenic splicing (cotis), can lead to fusion protein or altered promoter region for the downstream gene in the same way as chromosome translocation. furthermore, trans - splicing can join two independently transcribed mrna sequences at canonical exon even though several cases of natural trans - splicing are reported in human (11,12), it is generally considered to be rare and will be ignored in this work. given the importance of chromosome aberration in cancer detection, prognosis and target identification, it is quite natural to search for chimeric sequences in the genbank. alterbi and co - workers (13) developed a screening procedure to identify heterologous, spliced mrnas with potential origin from chromosomal translocation, mrna trans - splicing and multi - locus transcription. hahn. (14) extended this approach to include expressed sequence tag (est) sequences that expanded the search scope significantly. ncbi 's database of cancer chromosomes (15) integrated the nci / ncbi sky / m - fish and cgh database and the nci mitelman database of chromosome aberrations in cancers. the cancer genome project at the sanger institute maintains a list of cancer genes based on published scientific literatures (6). mutation data and associated information for these cancer genes are stored in the cosmic database (16). atlas of genetics and cytogenetics in oncology and haematology is a peer - reviewed resource that contains concise and updated cards on genes involved in cancer, cytogenetics and clinical entities in oncology, and cancer - prone diseases (17). in this paper, we describe a new database of fusion genes, chimerdb. it aims to be a knowledgebase that integrates bioinformatics analysis of transcript sequences (mrna and est), literature data from scientific journals (6) and omim data on translocation (18). all mrna and est sequences in the genbank (release 148 ; june 15, 2005) were aligned onto the human genome (ncbi build 35) using the blat program (19). minimum length and percent identity of valid alignments were 100 bp and 93%, respectively. small overlap (< 10 bp) was allowed due to uncertainty in blat alignments. alignments in the same chromosome were restricted to be in opposite orientation to avoid fusion by cotis. we found 261 mrna and 2484 est sequences as fusion candidates, including artificial chimeras created by accidental ligation of different cdnas during the cloning procedure. fusion points in true chimeras usually coincide with a splice site since chromosome breakage tends to take place in long intronic regions rather than in short exons (14). allowing 10 bp deviation from known splice sites fusion cases owing to cotis can be identified using the ecgene clustering system (20,21). ecgene clusters sequences that share any splice sites in the genomic alignment, taking gene orientation into consideration. fusion transcripts cause two neighboring genes to join to form a single cluster in the ecgene system. therefore, we searched for ecgene clusters (version 1.2) that contained two non - overlapping known genes and identified fusion transcripts. fusion by cotis creates a subtle problem in the genome - based est clustering procedure that groups sequences sharing any splice sites. we also imported the list of cancer genes associated with chromosome translocation from the cancer genome project at the sanger institute (6). current cancer gene census contains 257 translocation cases involving 346 genes, most of which coincide with our pubmed search result. literature databases should greatly extend the utility of fusion database by providing literature proof and relevant medical information for each computationally identified event. one of the major problems in dealing with heterogeneous databases, especially the literature data, is the use of aliases for the same gene. alias field in entrez gene database (22) was used to deal with different names for the same gene. in silico results from transcript mapping, literature and furthermore, mitelman 's recurrent aberration database and the atlas chromosomes in cancer data were also integrated into chimerdb. currently, chimerdb contains 1258 fusion cases that involve 1777 genes, 381 mrna and 654 est sequences. assuming total number of human genes 25 000, this implies that 4.4% of human genes are involved in chromosome translocation and another 2.7% of human genes show fusion between neighboring genes (cotis). it should be noted that overlap between the transcript mapping data and other known databases is not large. this suggests that majority of known chromosome translocations are not supported by transcript data, such as mrna and est. unless transcripts were discarded owing to low alignment quality, they would be from non - sequence - based methods and it would be interesting to obtain clone - based sequence data for those cases. all mrna and est sequences in the genbank (release 148 ; june 15, 2005) were aligned onto the human genome (ncbi build 35) using the blat program (19). minimum length and percent identity of valid alignments were 100 bp and 93%, respectively. small overlap (< 10 bp) was allowed due to uncertainty in blat alignments. alignments in the same chromosome were restricted to be in opposite orientation to avoid fusion by cotis. we found 261 mrna and 2484 est sequences as fusion candidates, including artificial chimeras created by accidental ligation of different cdnas during the cloning procedure. fusion points in true chimeras usually coincide with a splice site since chromosome breakage tends to take place in long intronic regions rather than in short exons (14). allowing 10 bp deviation from known splice sites fusion cases owing to cotis can be identified using the ecgene clustering system (20,21). ecgene clusters sequences that share any splice sites in the genomic alignment, taking gene orientation into consideration. fusion transcripts cause two neighboring genes to join to form a single cluster in the ecgene system. therefore, we searched for ecgene clusters (version 1.2) that contained two non - overlapping known genes and identified fusion transcripts. fusion by cotis creates a subtle problem in the genome - based est clustering procedure that groups sequences sharing any splice sites. we also imported the list of cancer genes associated with chromosome translocation from the cancer genome project at the sanger institute (6). current cancer gene census contains 257 translocation cases involving 346 genes, most of which coincide with our pubmed search result. literature databases should greatly extend the utility of fusion database by providing literature proof and relevant medical information for each computationally identified event. one of the major problems in dealing with heterogeneous databases, especially the literature data, is the use of aliases for the same gene. all records use the official hugo gene to avoid this problem. alias field in entrez gene database (22) was used to deal with different names for the same gene. in silico results from transcript mapping, literature and furthermore, mitelman 's recurrent aberration database and the atlas chromosomes in cancer data were also integrated into chimerdb. currently, chimerdb contains 1258 fusion cases that involve 1777 genes, 381 mrna and 654 est sequences. assuming total number of human genes 25 000, this implies that 4.4% of human genes are involved in chromosome translocation and another 2.7% of human genes show fusion between neighboring genes (cotis). it should be noted that overlap between the transcript mapping data and other known databases is not large this suggests that majority of known chromosome translocations are not supported by transcript data, such as mrna and est. unless transcripts were discarded owing to low alignment quality, they would be from non - sequence - based methods and it would be interesting to obtain clone - based sequence data for those cases. the contents of chimerdb can be accessed at. it supports various types of queries such as gene name and cytogenetic band position. query can be a breakpoint (e.g. aml1) or a fusion event (e.g. bcr details page opens an output page for a specific fusion case that consists of a summary table, detailed information table and fusion transcript table as shown in figure 1a. it includes extensive links to relevant resources, such as the entrez gene, omim and pubmed databases. links to ncbi cancer chromosomes provide detailed information on sky / m - fish and cgh and mitelman databases primary databases for cancer cytogenetics. links to atlas of genetics and cytogenetics in oncology and haematology database allow access to community efforts to annotate cancer genes, rich in cytogenetic and clinical information. transcript direction, aligned region, number of exons, deviation of fusion boundary from known splice site and so on. intact and affected domains before and after translocation are also summarized using the interpro database (23). figure 1b is the custom genome browser showing alignment of fusion transcripts in each gene. most fusion genes owing to cotis do not have detailed information on their functional significance yet. therefore, we simply provide the minimal information fused genes, genomic locus, functional domains, alignment browser and exon / intron properties. chimerdb is an integrated database for fusion sequences that includes bioinformatics analysis, literature data and omim data. however, functional significance of fusion events should be examined thoroughly so that these fusion events could serve as drug targets for cancer treatment. expression analysis of fused transcripts in different histological and pathological conditions should be performed with the bioinformatics analysis such as domain and promoter changes, frame shift and so on. integrative approach that combines high - throughput techniques, such as sky, cgh, snp chip, microarray, proteomics, interactions and pathway analysis, would prove to be powerful in elucidating the functional significance of fusion genes. | chromosome translocation and gene fusion are frequent events in the human genome and are often the cause of many types of tumor. chimerdb is the database of fusion sequences encompassing bioinformatics analysis of mrna and expressed sequence tag (est) sequences in the genbank, manual collection of literature data and integration with other known database such as omim. our bioinformatics analysis identifies the fusion transcripts that have non - overlapping alignments at multiple genomic loci. fusion events at exon exon borders are selected to filter out the cloning artifacts in cdna library preparation. the result is classified into two groups genuine chromosome translocation and fusion between neighboring genes owing to intergenic splicing. we also integrated manually collected literature and omim data for chromosome translocation as an aid to assess the validity of each fusion event. the database is available at for human, mouse and rat genomes. |
this study was based at the armed forces research institute of medical sciences (afrims)kwai river christian hospital clinical center, sangkhlaburi district, kanchanaburi province, thailand. (the protocol was approved by the human subjects research review board of the u.s. army, ethical review committee for research in human subjects of the thai ministry of public health, and scientific review committee of afrims.) patients were selected from those enrolled and sampled from june 1999 to february 2002 in an on - going fever study, which focuses on the etiology of undifferentiated febrile illnesses (oral temperature > 38c or history of fever within the past 48 h) in local residents > 20 years of age. criteria leading to the suspicion of rickettsioses included 1) a rash or eschar, 2) arthropod bites or recent exposure to the jungle, 3) a negative giemsa - stained malaria smear, and 4) serum specimens that tested positive by enzyme - linked immunosorbent assay (elisa) for sfg specific immunoglobulin (ig) m (panbio, brisbane, australia) or dot - elisa for total ig of r. rickettsii or r. typhi (panbio - indx, baltimore, md). serum specimens were sent to the unit des rickettsies in marseille for specific diagnosis of rickettsioses. serologic testing was performed by indirect immunofluorescence (if) on acute - phase (day 0) and convalescent - phase (approximately day 21) samples. serum specimens were tested by using a panel of 13 rickettsial antigens, including sfg rickettsiae (r. conorii indian, r. japonica, r. honei, r. helvetica, r. slovaca, at1 rickettsia, r. felis, r. heilongjiangii) typhus group rickettsiae (r. typhi), orientia tsutsugamushi (strain gilliam, kato, karp, and kawazaki), anaplasma phagocytophilum, ehrlichia chaffeensis, and coxiella burnetii. the rationale for the antigen screening panel included the presence of the strains in asia and results of previous serosurveys for a. phagocytophilum and e. chaffeensis. the standard procedure was followed for the use of western blot and cross - adsorption studies to complete the if assay at the unit des rickettsies (14,15). an immunofluorescence assay was considered positive for 1) igg with titers > 128 and/or igm titers > 64 for r. conorii ; and 2) for igg titers > 64 and/or igm titers > 32 for other rickettsial antigens. when cross - reactions were noted between several rickettsial antigens, the standard procedure comprised three steps : 1) a rickettsial antigen was considered to represent the agent of infection when titers of igg and/or igm antibody against this antigen were at least two serial dilution higher than titers of igg and/or igm antibody against other rickettsial antigens. 2) when the difference in titers between several antigens was lower than two dilutions, western blot assays were performed. a rickettsial antigen was considered to represent the agent of the infection when acute - phase or convalescent - phase sera reacted only with the specific proteins of this antigen. 3) when western blot assays were not diagnostic, cross - absorption studies were performed : igg / igm titers had to be > 128/32. specific diagnosis criteria after cross - absorption studies included a) if serologic test results positive for a single antigen or b) a western blot assay showing an exclusive reactivity with specific proteins of a sole agent. from june 1999 to february 2002, 46 patients were selected to be specifically tested for rickettsioses. these 46 patients were empirically treated by a 7-day doxycycline regimen (200 mg / d). rickettsioses were serologically confirmed in 15 (33%) patients by evidence of seroconversion, igm at significant titers, or both. serum specimens from patients 1 and 3 provided the highest titers against gilliam and karp strains, and serum from patient 2 had titers against gilliam strain only. two of these patients had returned from a trip into the jungle, and the third became sick several days after cutting grass in the fields. one patient was initially thought to have bacterial meningitis and had been treated unsuccessfully by a broad - spectrum third - generation cephalosporin for 3 days before doxycycline was started. one patient (no.13) had an eschar at a tick bite site, and another had a rash (no.15). one patient (no. 8) with sfg rickettsioses seroconverted to r. felis, indicated by high level of antibody titers. further, although igg titers were more than two serial dilutions higher than those for r. typhi, western blot assay was performed to confirm if findings. two patients (nos. 9 and 10) were shown to have the highest titers to r. conorii strain indian. 1115) had the highest titers to r. helvetica. for patients 4, 9, 10, 13, and 15, if results showed differences lower than two dilutions in igg titers, igm titers, or both, between several antigens. thus, if assays were completed by western blot and with cross - absorption studies for patient 4 (table). no cases of infection due to c. burnetii or ehrlichioses were diagnosed in the 46 tested patients. abbreviations : a., arthropod ; ig, immunoglobulin ; r, rash ; e, eschar ; n, nodes ; rh, rickettsia helvetica ; rc, r. conorii indian ; rjap, r. japonica ; rhon, r. honei ; rslo, r. slovaca ; at1, rickettsia strain at1 from japan ; rheil, r. heilongjiangii ; rfel, r. felis ; g, strain gilliam ; kw, strain kawazaki ; kp, strain karp ; ko, strain kato. immunofluorescence assay was completed by western blot and cross - adsorption as described in the text. for typhus and spotted fever group antigens, the rickettsia considered potentially responsible for the infection are in bold type. in this study, we report rickettsioses in sangkhlaburi, including the first case of r. felis infection reported in asia. r. felis was likely first detected (as r. ctenocephali) in european cat fleas (ctenocephalides felis) in 1918 (16), then rediscovered in 1990 in the united states (17). r. felis was then cultivated and characterized as a unique sfg rickettsia (18). its pathogenic role was recently demonstrated in patients with serologic evidence of infection in brazil, france, and germany. r. felis dna has also been detected in sera in texas, mexico, brazil, and germany (19). this rickettsia has also been recently detected in fleas in brazil, africa, spain, and france (20). further, during an entomologic survey, r. felis like rickettsiae were detected in fleas collected in sanghklaburi (p. parola, unpub. murine typhus, a mild disease with nonspecific signs (21), was found in four of our patients. although this disease has a worldwide distribution, it is often unrecognised, and documented cases are rarely reported. the classic triad of fever, headache, and skin rash is observed in < 15% of cases (22). arthralgia, myalgia, and respiratory and gastrointestinal symptoms (as demonstrated by one of our patients) are frequent (21,22). regarding disease transmission, although rats and mice are very common within and around houses in the villages, our patients did not report contact with rat fleas or a flea bite. in this study, seven patients with sfg rickettsioses may have been infected by r. helvetica (five patients) or r. conorii indian strain (two patients), according to if assays completed for some cases by western blot and cross - adsorption studies. r. helvetica is an emerging pathogen known to be prevalent in europe (23) and japan (13). in both areas, r. helvetica is associated with ixodes ticks, which are also found in thailand, although they have not previously been reported in sangkhlaburi (24). r. conorii indian is known as an agent of tick - borne rickettsioses prevalent in india, where it is associated with the dog tick (rhipicephalus sanguineus) (25), which is found worldwide. however, an unknown rickettsia sp. that is cross - reactive with r. conorii indian and r. helvetica could also be responsible for the cases reported here. in particular, we have recently detected, by polymerase chain reaction, rickettsia spp. from ticks that have bitten people in the sangkhlaburi area, including dermacentor auratus and dermacentor sp. larvae (9). the pathogenic role of these rickettsiae has yet to be demonstrated. scrub typhus is essentially an occupational disease among rural residents in the asia - pacific region (2). this disease is often underdiagnosed or misdiagnosed when the classic eschar at the chigger bite sites and the rash are absent, as reported for two of our three patients (2). the severity of the disease varies from asymptomatic to fatal (up to 30%). delayed or inappropriate treatment such as with third - generation cephalosporins, as reported for one of our patients, the four major serotypes studied here have been shown to have sufficient cross - reactivity with antigens from other strains to be used for serologic diagnostic testing. in our patients, although the highest titers were obtained by using o. tsutsugamushi strain gilliam antigens, other strains that share common epitopes and cross - react with this strain could be involved. patients with rickettsioses may have isolated fever or fever with nonspecific clinical and laboratory findings. these diseases are easily misdiagnosed because rash or eschar (the hallmark for rickettsial diseases) is absent, the diseases are not recognized by local physicians, or the diseases have never been reported in the area. more studies are needed on tropical rickettsioses, in particular, molecular detection or rickettsial isolation from patient samples, complemented by detailed case reports. studying possible vectors and animal reservoirs would provide estimates of the degree of zoonotic potential. ultimately, such studies will provide the basis for determining prevalence of rickettsiosis in the tropics and their effects on public health. | to investigate the presence of rickettsioses in rural residents of the central thai - myanmar border, we tested the blood of 46 patients with fever. four patients had murine typhus, three patients had scrub typhus, and eight patients had spotted fever group rickettsioses, including the first case of rickettsia felis infection reported in asia. |
transgenic mice are sacrificed using carbon dioxide gas, followed by decapitation and the brain extracted. the other will be submerged in 4% paraformaldehyde (pfa) for at least 48 hours at 4c. after fixation in 4% pfa for at least 48 hours, the hemi brain is transferred directly into 30% sucrose solution and placed at 4c. at the point, when the hemi brain sank to the bottom, usually requiring about 48 hours, it is ready to be embedded in oct for cryosectioning. before cryosectioning, mount a thin layer of oct on the knob and allow to freeze at -20c. remove the cerebellum from the rest of the hemi brain and place onto the layer of frozen oct. immediately cover the hemi brain with oct and allow to slowly freeze at -20c. once the oct embedding the brain has turned opaque, it is ready to be sectioned. after formic acid treatment, the section will temporarily turn opaque and may appear to shrivel. remove each section into a plate and wash with tx - pbs (0.3% triton x-100 in pbs) for 5 min x 3 with gentle shaking. block endogenous peroxide blocking 0.5% h2o2 in tx - pbs, rt 30 min with gentle shaking. block section with 5% non - fat skim milk dissolved in tx - pbs at room temperature for 1 hour with gentle shaking. incubate sections in primary antibody (biotinylated 4g8, 1:500 - 1:2000, signet) diluted in tx - pbs containing 5% milk at 4c overnight with gentle shaking. wash section with tx - pbs for 10 min x 3 with gentle shaking. prepare abc solution following manufacturer 's protocol (elite abc, vector laboratories,). free - floating brain sections are mounted on gelatin coated slides, to help with tissue adhesion. sections are then air dried followed by clearing with a series of xylene and mounted in entellen. plaques are visualized under light microscopy at 40x magnification and are quantified by assessing the mean plaque count per slice for each mouse. mount 4 to 5 hemi brain sections onto a glass slide and allow to completely air dry prior to staining. incubate slides in filtered (0.2 m filter) thioflavin s solution (1% in 80% of ethanol) for 15 minutes. (thioflavin s solution needs to be filtered before each use). note : protect thioflavin s from light and protect stained slides from light. mount slides in aqueous mounting media and allow slides to dry in the dark for at least 2 hour, followed by sealing coverslip with clear nail polish. analyze slides within one week because the staining will fade with time. in our recent study on the efficacy of the anti - epileptic drug and mood stabilizer valproic acid (vpa) to inhibit neuritic plaque formation, we used the above described immunostaining and thioflavin s staining procedures to identify neuritic plaques in ad model mice (3). figure 1 represents a typical 9 month old app23 transgenic mouse, stained with anti - a using biotinylated 4g8 and detected via the abc method. neuritic plaques are clearly labeled with the antibody and are indicated by the white arrows. we detected neuritic plaque deposition 2 month old app23xps transgenic mice (figure 2). thioflavin s bound a-containing neuritic plaques appears green under fluorescence microscopy (indicated by white arrows). we showed that with vpa treatment, neuritic plaque formation is significantly reduced (3). in another study again, using both 4g8 anti - a immunohistochemistry staining and thioflavin s staining, we found that hypoxia facilitated the formation of a containing neuritic plaques (4). app23 mice at the age of 9 months were sacrificed and were dissected, fixed, and sectioned. neuritic plaques in the hippocampal were detected using an anti - a antibody 4g8 and were developed using the abc and dab methods. app23xps45 double transgenic mice at 8 weeks old were sacrificed and were dissected, fixed, and sectioned. neuritic plagues in the hippocampal are were confirmed using thioflavin s fluorescent staining and visualized by microscopy at 40x magnification. transgenic mice are sacrificed using carbon dioxide gas, followed by decapitation and the brain extracted. the other will be submerged in 4% paraformaldehyde (pfa) for at least 48 hours at 4c. after fixation in 4% pfa for at least 48 hours, the hemi brain is transferred directly into 30% sucrose solution and placed at 4c. at the point, when the hemi brain sank to the bottom, usually requiring about 48 hours, it is ready to be embedded in oct for cryosectioning. before cryosectioning, mount a thin layer of oct on the knob and allow to freeze at -20c. remove the cerebellum from the rest of the hemi brain and place onto the layer of frozen oct. immediately cover the hemi brain with oct and allow to slowly freeze at -20c. once the oct embedding the brain has turned opaque, it is ready to be sectioned. after formic acid treatment, the section will temporarily turn opaque and may appear to shrivel. remove each section into a plate and wash with tx - pbs (0.3% triton x-100 in pbs) for 5 min x 3 with gentle shaking. block endogenous peroxide blocking 0.5% h2o2 in tx - pbs, rt 30 min with gentle shaking. block section with 5% non - fat skim milk dissolved in tx - pbs at room temperature for 1 hour with gentle shaking. incubate sections in primary antibody (biotinylated 4g8, 1:500 - 1:2000, signet) diluted in tx - pbs containing 5% milk at 4c overnight with gentle shaking. prepare abc solution following manufacturer 's protocol (elite abc, vector laboratories,). free - floating brain sections are mounted on gelatin coated slides, to help with tissue adhesion. sections are then air dried followed by clearing with a series of xylene and mounted in entellen. plaques are visualized under light microscopy at 40x magnification and are quantified by assessing the mean plaque count per slice for each mouse. mount 4 to 5 hemi brain sections onto a glass slide and allow to completely air dry prior to staining. incubate slides in filtered (0.2 m filter) thioflavin s solution (1% in 80% of ethanol) for 15 minutes. mount slides in aqueous mounting media and allow slides to dry in the dark for at least 2 hour, followed by sealing coverslip with clear nail polish. stained sections should be stored in the dark at 4c. the green fluorescence stained plaques could be visualized with fluorescent microscropy. in our recent study on the efficacy of the anti - epileptic drug and mood stabilizer valproic acid (vpa) to inhibit neuritic plaque formation, we used the above described immunostaining and thioflavin s staining procedures to identify neuritic plaques in ad model mice (3). figure 1 represents a typical 9 month old app23 transgenic mouse, stained with anti - a using biotinylated 4g8 and detected via the abc method. neuritic plaques are clearly labeled with the antibody and are indicated by the white arrows. using thioflavin s staining, we detected neuritic plaque deposition 2 month old app23xps transgenic mice (figure 2). thioflavin s bound a-containing neuritic plaques appears green under fluorescence microscopy (indicated by white arrows). we showed that with vpa treatment, neuritic plaque formation is significantly reduced (3). in another study, we studied the molecular link underlying hypoxia and ad pathogenesis. again, using both 4g8 anti - a immunohistochemistry staining and thioflavin s staining, we found that hypoxia facilitated the formation of a containing neuritic plaques (4). app23 mice at the age of 9 months were sacrificed and were dissected, fixed, and sectioned. neuritic plaques in the hippocampal were detected using an anti - a antibody 4g8 and were developed using the abc and dab methods. app23xps45 double transgenic mice at 8 weeks old were sacrificed and were dissected, fixed, and sectioned. neuritic plagues in the hippocampal are were confirmed using thioflavin s fluorescent staining and visualized by microscopy at 40x magnification. immunohistochemistry using the biotinylated labeled 4g8 antibody stains neuritic plaques in ad modeled mice with specificity. because the hemi brains are not perfused prior to extraction from the skull, care should be used during the extraction process in order to prevent damages to the hemi brain. moreover, since the hemi brain is passively perfused, we recommend incubating it in 4% pfa for at least 48 hours at 4c prior to submerging in the 30% sucrose solution. if the brain is fixed properly, it should have a rubbery texture. in the case where the brain is not fixed properly, the sections will easily tear in the d'olomos solution or during the staining procedures. the 4g8 monoclonal antibody is reactive to amino acid residues 17 - 24 of a and recognized the epitope in the core sequence (vffae). since 4g8 thus, we chose to incubate the sections at the indicated dilution with considerations to achieving a true signal while minimizing background staining. in addition to immunostaining for neuritic plaques detection using the 4g8 antibody, a thioflavin s staining method is also used to identify plaques. thioflavin s is a homogenous dye mixture that results from methylation of dehydrothiotoluidine with sulfonic acid. thioflavin s non - selectively binds beta sheet contents of proteins, such as those in amyloid oligomers. upon binding conversely thioflavin s binding to the monomeric forms will not elicit a blue shift and could not be detected with florescent microscope. thioflavin s staining provides a quick alternative to screen for amyloid as the intensity of fluorescence allows good visualization of small amounts of amyloid deposits. many other tissue components including containing extensive beta sheets, such as fibrinoids, hyaline, keratin, etc, have a rather affinity for this dye. all experiments were conducted in accordance with the university of british columbia animal care and use committee and cihr guidelines. | alzheimer 's disease (ad) is the most common neurodegenerative disorder leading to dementia. neuritic plaque formation is one of the pathological hallmarks of alzheimer 's disease. the central component of neuritic plaques is a small filamentous protein called amyloid protein (a)1, which is derived from sequential proteolytic cleavage of the beta - amyloid precursor protein (app) by -secretase and -secretase. the amyloid hypothesis entails that a-containing plaques as the underlying toxic mechanism in ad pathology2. the postmortem analysis of the presence of neuritic plaque confirms the diagnosis of ad. to further our understanding of a neurobiology in ad pathogenesis, various mouse strains expressing ad - related mutations in the human app genes were generated. depending on the severity of the disease, these mice will develop neuritic plaques at different ages. these mice serve as invaluable tools for studying the pathogenesis and drug development that could affect the app processing pathway and neuritic plaque formation. in this protocol, we employ an immunohistochemical method for specific detection of neuritic plaques in ad model mice. we will specifically discuss the preparation from extracting the half brain, paraformaldehyde fixation, cryosectioning, and two methods to detect neurotic plaques in ad transgenic mice : immunohistochemical detection using the abc and dab method and fluorescent detection using thiofalvin s staining method. |
systemic lupus erythematosus (sle) is a systemic autoimmune and inflammatory disease that affects many organs and systems through formation and deposition of autoantibodies and immune complexes leading to severe tissue and organ damage [1, 2 ]. it is characterized by hyperreactivity of t and b cells and a failure to eliminate apoptotic bodies [24 ]. patients with sle may present with several oral manifestations, the prevalence varies from 20 to 80%, and usually more than one injury is present [513 ]. the terms salivary hypofunction or hyposalivation and xerostomia are often incorrectly used interchangeably. hyposalivation refers to a diminished salivary flow, whereas xerostomia refers to a subjective experience of mouth dryness. this is further complicated by the fact that some patients with hyposalivation are not xerostomic and, conversely, those with xerostomia may have normal salivary flow rates. however, xerostomia is a common and primary symptom associated with salivary gland hypofunction. usually when salivary secretion has decreased to half its normal values an individual will begin to experience xerostomia. more than 75% of patients with sle suffer from oral complaints like dryness (xerostomia) and soreness. systemic lupus erythematosus has also been associated with a decrease in salivary flow, resulting in xerostomia and hyposalivation has already been described in these patients [511, 13, 1517 ]. this dysfunction in the salivary glands and the detection of salivary changes present in sle patients can reflect a distinct and specific multisystem presentation [16, 17 ]. 1993 studied a group of sle patients with no other systemic diseases and none of the patients complained of xerostomia. yet, those patients had significantly lower salivary flow rates than controls. in other studies, patients with sle experienced some degree of xerostomia and had significantly lower sws compared with healthy controls. the complexity of the molecular composition of saliva has shown its importance related to the maintenance of oral and systemic integrity, and it is critical for the first line of oral defense. functions of saliva include tissue repair (presence of epidermal growth factor (egf) promotes healing of the oral, oropharynx, and gastric mucosa), protection (lubrication of the mouth, oropharynx, and esophagus), tamponage (phosphate, bicarbonate, and proteins maintain unfavorable ph for microorganism colonization, neutralization of acidity), digestion (formation of the food bolus and digestion of starch, proteins, and lipids), gustation (solubilization of molecules and maturation of taste buds), antimicrobial action (presence of antibodies iga / igm and igg, lysozyme and lactoferrin - bacterial antagonism, system of peroxidase / cystatin / mucin, and immunoglobulins - antiviral activity, histatin / chromogranin a, and immunoglobulins - antifungal activity), and maintenance of tooth integrity (maturation of the enamel and remineralization) [9, 1922 ]. in addition, patients may experience halitosis, sleep disorders, dysphagia, and difficulty in swallowing and speaking [23, 24 ]. the salivary flow rate reduction can be caused by several factors, including a dysfunction in the salivary gland, systemic diseases, age, other autoimmune diseases such as sjgren 's syndrome, and several drugs [13, 14, 16, 21, 2527 ]. although some studies investigated the prevalence of hyposalivation in sle patients [5, 7, 15, 28 ], none of them employed a scientific approach towards the evaluation of the factors associated with this variable in this group of patients. the aim of this study was to determine the prevalence of hyposalivation in patients with systemic lupus erythematosus and evaluate the factors associated with this variable. after approval by the ethics committee of the university general hospital, university of cuiab, all patients with sle in cuiab university general hospital (hgu - unic), mato grosso, brazil, from july 2010 to december 2013, were included. the criteria for the diagnosis of sle were according to the american college of rheumatology revised classification. a medical history, including information related to current systemic disease, disease activity scores using sledai (systemic lupus erythematosus disease activity), and on - going medications, was obtained for all patients. activity categories have been defined on the basis of sledai scores : no activity (sledai = 0), mild activity (sledai = 15), moderate activity (sledai = 610), high activity (sledai = 1119), and very high activity (sledai 20). exclusion criteria included the presence of any of the following : previous history of radiation therapy in the head and neck area, poorly uncontrolled diabetes mellitus, chronic thyroid disease, known sjogren 's disease, missing complete data, and not collecting the saliva. total salivary flow rates (sfrs) at rest were determined according to the guidelines for collecting unstimulated whole saliva. the participants were asked to collect saliva in their mouth and to split it into a wide test tube for 5 minutes. as a reference, a rate of 0.3 ml / min was considered a normal salivary flow of unstimulated saliva. a value less than 0.3 ml / min in 5 minutes (totaling 27 years old) because the second and third age groups have very similar amounts of saliva (1.01 and 1.09, resp.). these two age groups showed that saliva decreased from less than 27 years to greater than 27 years, and this decrease was statistically significant (p = 0.021), as indicated by student 's t - test. table 1 presents the descriptive statistics, confidence intervals of 95%, and p values for the amount of saliva in ml, collected within 5 minutes per category of variables, and shows that the activity level and age group (years) were statistically significant at 5% (p = 0.004 and p = 0.021, resp.). this is the first study to evaluate the risk factors for hyposalivation in sle patients. the prevalence found in this study (79.2%) is higher than in the general population (20%) but within the previously published data [511, 13, 1517 ]. few studies have been published in sle patients [511, 13, 1517 ] and the differences between these may be due to the differences in the diagnostic criteria of hyposalivation. systemic lupus erythematosus is a chronic inflammatory, multisystem disease, and although the involvement of the salivary glands and salivary flow rate is not commonly described in the literature, we observe in clinical practice that patients with sle frequently complain of xerostomia associated or not with hyposalivation. authors consider the decrease in salivary flow rate in sle as a result of secondary sjogren 's syndrome [3436 ], but histopathologic features of the minor salivary glands are distinctly different in this syndrome and lupus erythematosus. alterations in salivary glands of le patients may be a specific manifestation of the disease (lupus sialadenitis), reflecting its multisystemic presentation, instead of an association of secondary ss [16, 17 ]. the patients included in this study have not yet been subjected to minor salivary gland biopsy for sjogren 's syndrome, but 18% had positivity for anti - ro / ssa and 9% for anti - la / ssb. 2008 found prevalent hyposalivation in younger adults and this unexpectedly high prevalence in younger age groups indicates that this may be of significance for oral health in these groups of patients. salivary gland function declined with age and may be related to the number of medications they take on a regular basis, the number of systemic disorders they report, and the length of time for which they consume the drugs [26, 27 ]. with increasing age, the focus of inflammatory cells increases, and acinar atrophy, ductal dilatation, and variable degrees of fibrosis in the salivary glands this study shows that age can be analyzed based on two age groups (27 years and > 27 years old) because the second and third age groups have very similar amounts of saliva (figure 1). these two age groups showed that saliva decreased from less than 27 years to greater than 27 years, and this decrease was statistically significant (p = 0.021). 1994 distributed the patients in four groups (2039 years, 4059 years, 6079 years, and 80 years) and a significant decrease in the secretion rates of unstimulated whole saliva in relation to age was also observed in the study population (p 27 years were factors associated with hyposalivation in patients with systemic lupus erythematosus indicating that these factors decrease the amount of saliva in a statistically significant manner. the prevalence of hyposalivation presented in this study is limited to a relatively homogenous group of patients. however, in the absence of information about hyposalivation in patients with systemic lupus erythematosus in a brazilian subpopulation, this present study seems to offer the only available information. future longitudinal studies are needed to learn more about hyposalivation in this group of patients and further studies to confirm this finding. | background. systemic lupus erythematosus (sle) is a chronic inflammatory, multisystem, and autoimmune disease. objective. the aim of this study was to describe the prevalence of hyposalivation in sle patients and evaluate factors associated. methods. this is a cross - sectional study developed at the cuiaba university general hospital (unic - hgu), mato grosso, brazil. the study population consisted of female sle patients treated at this hospital from 06/2010 to 12/2012. unstimulated salivary flow rates (sfrs) were measured. descriptive and inferential analyses were performed in all cases using a significance level p 27 years, and the drugs used were factors associated with hyposalivation, resulting in a statistically significant decrease in saliva production. |
aquaporins belong to a family of membrane proteins that passively transport water, glycerol, and other small molecules (nielsen., 2002). the archetypical water channel aqp1 has been shown to be highly specific for water and excludes protons, ammonia, and sugars such as glycerol (zeidel., 1992, 1994). the specificity of the channel arises from the presence of two highly conserved npa motifs (asn - pro - ala residues) that form the narrow constriction of the pore region, which acts as a molecular sieve. crystallographic studies suggest that the pore is narrow at the constriction and lets only water diffuse through it (murata., 2000 ; molecular dynamics (md) simulation studies suggest the presence of another energy barrier that offers both steric and electrostatic selectivity, named the aromatic (ar / r) constriction, which is formed by the four amino acids phe-56, his-180, cys-189, and arg-195 (rat aqp1) in water - selective aquaporins (de groot., 2003 ; chakrabarti., 2004 ; chen., this constriction region is wider, as his-180 is usually replaced by gly, which allows for water and glycerol to pass through as shown in glpf (fu., 2000). although general geometry of aquaporin channels differs only slightly between aquaporin family members, its water permeability may differ by several orders of magnitude. water is thought to hydrogen bond to arginine in the npa region (miloshevsky and jordan, 2004 ; vidossich., 2004) and the degree of hydrogen bonding or the energy barrier caused by hydrogen bonding is thought to dictate the rate of water flow through aquaporins. furthermore, in a study of model channel desformylgramicidin, which shows a 100-fold increase in water permeability compared with gramicidin a, the lowered hydrogen bond mediated energy barrier is thought to be responsible for large differences observed in water permeability (de groot., 2002). to determine whether such a finely tuned water channel allows the passage of deuterium oxide (d2o), a close analogue of water, we measured the permeability of d2o in aqp1-reconstituted proteoliposomes. d2o differs from h2o in the following respects : d2o has a lower zero - point vibrational energy leading to a stronger o - d bond and a stronger deuterium bond compared with the h - bond (scheiner and cuma, 1996). the effect of the stronger deuterium bond plus the heavier mass of d is believed to result in a self diffusion coefficient of d2o that is 18.6% lower than that of water (mills, 1973 ; grigera, 2001). since water is thought to interact with specific residues phe-56 and agr-195 in the pore via hydrogen bonding (miloshevsky and jordan, 2004), it would be interesting to study the passage of d2o, which has a stronger deuterium bond. to test if kinetics of d2o permeability is different from h2o we simulated d2o flux and then measured it, allowing us to determine the predictive power of md simulations. both md simulations and experimental results indicate that d2o and h2o permeate aqp1 at similar rates. molecular dynamics (md) simulations were used to calculate the diffusion and osmotic permeability of h2o and d2o through aqp1. the x - ray structure of bovine aqp1 was downloaded from the protein data bank (www.rcsb.org) with pdb code 1j4n (sui., 2001). the tetrameric structure was assembled from the coordinates of the monomer using transformation matrices provided in the pdb file. the tetramer was then embedded in a preequilibrated patch of 177 palmitoyl - oleoyl - phosphatidyl - ethanolamine (pope) molecules and solvated by 15,079 charmm modified tip3p water molecules (jorgensen., 1983 ; (referred to here as tip3p), so that the total system contained 80,434 atoms. this system was energy minimized and equilibrated for 3 ns at 298 k and 1 atm. to construct the aqp1/d2o system, the tip3p water model was replaced with a tip3p - hw model (described below) and equilibrated for 1 ns at 298 k and 1 atm. the system equilibrium was checked by monitoring potential energy and volume over the course of the simulation. the standard deviation of potential energy from the mean was 0.13% (210 kcal / mol) and for volume was 0.15% (1150), which suggests that the system is in equilibrium. diffusion permeabilities were calculated for both aqp1/h2o and aqp1/d2o systems from equilibrium md simulations at constant volume and constant temperature of 298 k from 31 and 26 ns trajectories, respectively. a weak harmonic restraining potential of 0.12 kcal / mol / was applied in all three dimensions to aqp1 backbone carbons to prevent the protein form drifting., 2004):(1)\documentclass[10pt]{article } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{pmc } \usepackage[euler]{upgreek } \pagestyle{empty } \oddsidemargin -1.0 in \begin{document } \begin{equation}p_{d}=\frac{v_{w}}{n_{a}}q_{0}=v_{w}q_{0},\end{equation}\end{document}where pd (cm / s / pore) is the diffusion permeability coefficient per pore, vw is the molar volume of the solvent, na is avogadro 's number, q0 is the unidirectional permeation rate, and vw is the volume of a single solvent molecule. q0 was calculated by counting the number of h2o or d2o molecules passing from one side of the channel to the other per unit time. the pore region was chosen to be the narrow central section of the channel, 22 in length, where water molecules pass in single file or nearly single file fashion (see fig. osmotic permeabilities were calculated by following the nonequilibrium md method described by zhu. a hydrostatic pressure gradient was established across the membrane by applying extra force to a layer of solvent molecules parallel to the membrane interface. applied pressure md simulations of different time length were performed at 25, 50, 100, and 200 mpa for both aqp1/h2o and aqp1/d2o systems. kcal / mol / was applied to oxygen atoms of h2o / d2o within an 8- solvent layer to generate 25, 50, 100, and 200 mpa pressure, respectively. to prevent the protein and the lipid bilayer from moving under the influence of this external force, a harmonic restraint of 0.12 kcal / mol / was applied in all three dimensions to the backbone carbons of the protein and a harmonic restraint of 0.8 kcal / mol / to the phosphorus atoms of the pope molecules. (2004). however, our calculated osmotic permeability for h2o turned out to be similar to zhu. (2004) (see below), implying that small differences in the restraining procedure do not have a major effect on the calculated osmotic permeabilities. the net flux of h2o / d2o through aqp1 was calculated by averaging the number of molecules that crossed three planes located 5 away from each other inside the channel per pore per unit time. osmotic permeabilities were calculated from the slope of the best (linear least squares) fit line of h2o / d2o flux versus applied hydrostatic pressure according to the following equation (zhu., 2004):(2)\documentclass[10pt]{article } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{pmc } \usepackage[euler]{upgreek } \pagestyle{empty } \oddsidemargin -1.0 in \begin{document } \begin{equation}p_{f}=\frac{j}{{\mathrm{{\delta}}}p}k_{b}t,\end{equation}\end{document}where pf (cm / s / pore) is the osmotic permeability coefficient per pore, j (molecules / s) is the net solvent flux through a single water channel, p is the applied hydrostatic pressure, kb is the boltzmann constant, and t is the absolute temperature. for our md simulations we used the charmm 27 force field (mackerell., 1998), which was derived to be consistent with the tip3p model (neria., 1996). for the parameterization of deuterium oxide we started with the tip3p model as a reference, doubled the mass of the hydrogen atoms, and adjusted the partial charges of both the deuterium and oxygen atoms. the physical motivation for modifying these partial charges is to take into account the quantum effect that liquid d2o is characterized by a stronger deuterium bond than the h bond found in liquid h2o. this quantum effect arises because d2o has a lower zero - point vibrational energy than h2o (scheiner and cuma, 1996). it is well known that tip3p water considerably overestimates (by more than a factor of 2) the self diffusion constant of water (van der spoel., 1998 ; mark and nilsson, 2001). for this reason, we chose as a target for parameterization to reproduce the experimentally measured 18.6% difference in the self diffusion constants of h2o vs. d2o (mills, 1973) rather than the experimental self diffusion constant of heavy water. a similar reparameterization of the spc / e model for deuterium oxide has been reported recently in which only the mass and partial charges of the hydrogen atoms were changed in order to reproduce the experimental self diffusion constant, the molar volume and the potential energy of heavy water (grigera, 2001). for our reparameterization, a simulation box of 3921 tip3p water molecules was constructed, energy minimized, and equilibrated at 298 k and 1 atm. the mass of hydrogen atoms was set to 2 amu and atomic partial charges were incremented by fractions of a percent. the system was equilibrated for 0.5 ns followed by 1 ns production runs performed at a constant temperature of 298 k and a constant pressure of 1 atm. the self diffusion constant was calculated from the collected coordinate time series using the mean - square - displacement method (allen and tildesley, 1987). adjustment of d2o atomic partial charges along with recalculation of the self diffusion constant was repeated until we generated a diffusion coefficient 18% smaller than the value obtained with tip3p under the same conditions. all md simulations were performed using the namd package (kale., 1999) the particle mesh ewald method (essmann., 1995) was used as implemented in the namd program along with periodic boundary conditions. the md time step was set to 2 fs and the bonds between each hydrogen atom and its mother atom were fixed via the shakeh algorithm (kale., 1999) md coordinates of aqp1 simulations were saved every 1 ps and for the parameterization of tip3p - hw water model every 100 fs. most simulations were performed on lemieux supercomputer at the pittsburgh supercomputing center (www.psc.edu). it took 4.6 h to run 1 ns of aqp1 simulations on 160 cpus of lemieux. all visualizations and analysis of md trajectories were made with the vmd program (humphrey., 1996). bovine aqp1 was purified from bovine red blood cells using methods similar to that used for purifying human aqp1 (zeidel., 1992). the aqp1 reconstitution procedure was similar to that described earlier (zeidel., 1994). in brief, 68 mg of palmitoyl - oleoyl - phosphatidylcholine (popc) lipids (avanti lipids) was bath sonicated for three cycles of 3 min duration at 4 mw setting in 20 mm mops, ph 7.4. n - octylglucoside (og) was added to the sonicated lipids to achieve a final concentration of 1.2% (vol / vol). to this, 5060 g of aqp1 in 1.5% og was added and incubated for 30 min on ice. the mixture was diluted 25-fold into reconstitution buffer (150 mm nacl, 20 mm mops, ph 7.4) containing 10 mm carboxyfluorescein (cf). the proteoliposomes formed were collected by centrifugation at 100,000 g for 1 h. the external cf was removed by two additional centrifugal washes. the final pellet was resuspended in 300 l of reconstitution buffer and used for permeability studies. macroscopic osmotic permeabilities (pf) of h2o and d2o were measured as described earlier (zeidel.,, the proteoliposomes were subjected to a doubling of external osmotic pressure in a stopped - flow fluorimeter (applied photophysics, sx.17 mv), and the fluorescence decrease of carboxyfluorescein due to self quenching caused by shrinkage of the vesicle was measured as a function of time. pf was calculated by comparing the single - exponential time constants fitted to a family of simulated curves generated using the water permeability equation in which pf was varied to that obtained experimentally. mathcad was used to numerically integrate the water permeability equation:(3)\documentclass[10pt]{article } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{pmc } \usepackage[euler]{upgreek } \pagestyle{empty } \oddsidemargin -1.0 in \begin{document } \begin{equation}\frac{dv_{r}(t)}{dt}=p_{f}{\times}r_{sv}{\times}v_{w}{\times } \left \left(\frac{c_{in}}{v_{r}(t)}-c_{out}\right) \right.\end{equation}\end{document}in eq. 3, vr(t) is the relative volume of the vesicle at time t (i.e., volume at time t, divided by the initial volume), pf (cm / s) is the macroscopic osmotic water permeability coefficient, rsv is the surface area to volume ratio of a vesicle, and cin and cout are initial solute concentrations inside and outside the vesicle, respectively. the size of the vesicle was measured by laser light scatter using a dynapro particle sizer. molecular dynamics (md) simulations were used to calculate the diffusion and osmotic permeability of h2o and d2o through aqp1. the x - ray structure of bovine aqp1 was downloaded from the protein data bank (www.rcsb.org) with pdb code 1j4n (sui., 2001). the tetrameric structure was assembled from the coordinates of the monomer using transformation matrices provided in the pdb file. the tetramer was then embedded in a preequilibrated patch of 177 palmitoyl - oleoyl - phosphatidyl - ethanolamine (pope) molecules and solvated by 15,079 charmm modified tip3p water molecules (jorgensen., 1983 ; (referred to here as tip3p), so that the total system contained 80,434 atoms. this system was energy minimized and equilibrated for 3 ns at 298 k and 1 atm. to construct the aqp1/d2o system, the tip3p water model was replaced with a tip3p - hw model (described below) and equilibrated for 1 ns at 298 k and 1 atm. the system equilibrium was checked by monitoring potential energy and volume over the course of the simulation. the standard deviation of potential energy from the mean was 0.13% (210 kcal / mol) and for volume was 0.15% (1150), which suggests that the system is in equilibrium. diffusion permeabilities were calculated for both aqp1/h2o and aqp1/d2o systems from equilibrium md simulations at constant volume and constant temperature of 298 k from 31 and 26 ns trajectories, respectively. a weak harmonic restraining potential of 0.12 kcal / mol / was applied in all three dimensions to aqp1 backbone carbons to prevent the protein form drifting., 2004):(1)\documentclass[10pt]{article } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{pmc } \usepackage[euler]{upgreek } \pagestyle{empty } \oddsidemargin -1.0 in \begin{document } \begin{equation}p_{d}=\frac{v_{w}}{n_{a}}q_{0}=v_{w}q_{0},\end{equation}\end{document}where pd (cm / s / pore) is the diffusion permeability coefficient per pore, vw is the molar volume of the solvent, na is avogadro 's number, q0 is the unidirectional permeation rate, and vw is the volume of a single solvent molecule. q0 was calculated by counting the number of h2o or d2o molecules passing from one side of the channel to the other per unit time. the pore region was chosen to be the narrow central section of the channel, 22 in length, where water molecules pass in single file or nearly single file fashion (see fig. osmotic permeabilities were calculated by following the nonequilibrium md method described by zhu. a hydrostatic pressure gradient was established across the membrane by applying extra force to a layer of solvent molecules parallel to the membrane interface. applied pressure md simulations of different time length were performed at 25, 50, 100, and 200 mpa for both aqp1/h2o and aqp1/d2o systems. kcal / mol / was applied to oxygen atoms of h2o / d2o within an 8- solvent layer to generate 25, 50, 100, and 200 mpa pressure, respectively. to prevent the protein and the lipid bilayer from moving under the influence of this external force, a harmonic restraint of 0.12 kcal / mol / was applied in all three dimensions to the backbone carbons of the protein and a harmonic restraint of 0.8 kcal / mol / to the phosphorus atoms of the pope molecules. (2004). however, our calculated osmotic permeability for h2o turned out to be similar to zhu. (2004) (see below), implying that small differences in the restraining procedure do not have a major effect on the calculated osmotic permeabilities. the net flux of h2o / d2o through aqp1 was calculated by averaging the number of molecules that crossed three planes located 5 away from each other inside the channel per pore per unit time. osmotic permeabilities were calculated from the slope of the best (linear least squares) fit line of h2o / d2o flux versus applied hydrostatic pressure according to the following equation (zhu., 2004):(2)\documentclass[10pt]{article } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{pmc } \usepackage[euler]{upgreek } \pagestyle{empty } \oddsidemargin -1.0 in \begin{document } \begin{equation}p_{f}=\frac{j}{{\mathrm{{\delta}}}p}k_{b}t,\end{equation}\end{document}where pf (cm / s / pore) is the osmotic permeability coefficient per pore, j (molecules / s) is the net solvent flux through a single water channel, p is the applied hydrostatic pressure, kb is the boltzmann constant, and t is the absolute temperature. for our md simulations we used the charmm 27 force field (mackerell., 1998), which was derived to be consistent with the tip3p model (neria., 1996). for the parameterization of deuterium oxide we started with the tip3p model as a reference, doubled the mass of the hydrogen atoms, and adjusted the partial charges of both the deuterium and oxygen atoms. the physical motivation for modifying these partial charges is to take into account the quantum effect that liquid d2o is characterized by a stronger deuterium bond than the h bond found in liquid h2o. this quantum effect arises because d2o has a lower zero - point vibrational energy than h2o (scheiner and cuma, 1996). it is well known that tip3p water considerably overestimates (by more than a factor of 2) the self diffusion constant of water (van der spoel., 1998 ; mark and nilsson, 2001). for this reason, we chose as a target for parameterization to reproduce the experimentally measured 18.6% difference in the self diffusion constants of h2o vs. d2o (mills, 1973) rather than the experimental self diffusion constant of heavy water. a similar reparameterization of the spc / e model for deuterium oxide has been reported recently in which only the mass and partial charges of the hydrogen atoms were changed in order to reproduce the experimental self diffusion constant, the molar volume and the potential energy of heavy water (grigera, 2001). for our reparameterization, a simulation box of 3921 tip3p water molecules was constructed, energy minimized, and equilibrated at 298 k and 1 atm. the mass of hydrogen atoms was set to 2 amu and atomic partial charges were incremented by fractions of a percent. the system was equilibrated for 0.5 ns followed by 1 ns production runs performed at a constant temperature of 298 k and a constant pressure of 1 atm. the self diffusion constant was calculated from the collected coordinate time series using the mean - square - displacement method (allen and tildesley, 1987). adjustment of d2o atomic partial charges along with recalculation of the self diffusion constant was repeated until we generated a diffusion coefficient 18% smaller than the value obtained with tip3p under the same conditions. all md simulations were performed using the namd package (kale., 1999) the particle mesh ewald method (essmann., 1995) was used as implemented in the namd program along with periodic boundary conditions. the md time step was set to 2 fs and the bonds between each hydrogen atom and its mother atom were fixed via the shakeh algorithm (kale., 1999) md coordinates of aqp1 simulations were saved every 1 ps and for the parameterization of tip3p - hw water model every 100 fs. most simulations were performed on lemieux supercomputer at the pittsburgh supercomputing center (www.psc.edu). it took 4.6 h to run 1 ns of aqp1 simulations on 160 cpus of lemieux. all visualizations and analysis of md trajectories were made with the vmd program (humphrey., 1996). bovine aqp1 was purified from bovine red blood cells using methods similar to that used for purifying human aqp1 (zeidel., 1992). the aqp1 reconstitution procedure was similar to that described earlier (zeidel., 1994). in brief, 68 mg of palmitoyl - oleoyl - phosphatidylcholine (popc) lipids (avanti lipids) was bath sonicated for three cycles of 3 min duration at 4 mw setting in 20 mm mops, ph 7.4. n - octylglucoside (og) was added to the sonicated lipids to achieve a final concentration of 1.2% (vol / vol). to this, 5060 g of aqp1 in 1.5% og was added and incubated for 30 min on ice. the mixture was diluted 25-fold into reconstitution buffer (150 mm nacl, 20 mm mops, ph 7.4) containing 10 mm carboxyfluorescein (cf). the proteoliposomes formed were collected by centrifugation at 100,000 g for 1 h. the external cf was removed by two additional centrifugal washes. the final pellet was resuspended in 300 l of reconstitution buffer and used for permeability studies. macroscopic osmotic permeabilities (pf) of h2o and d2o were measured as described earlier (zeidel., 1994). in brief, the proteoliposomes were subjected to a doubling of external osmotic pressure in a stopped - flow fluorimeter (applied photophysics, sx.17 mv), and the fluorescence decrease of carboxyfluorescein due to self quenching caused by shrinkage of the vesicle was measured as a function of time. pf was calculated by comparing the single - exponential time constants fitted to a family of simulated curves generated using the water permeability equation in which pf was varied to that obtained experimentally. mathcad was used to numerically integrate the water permeability equation:(3)\documentclass[10pt]{article } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{pmc } \usepackage[euler]{upgreek } \pagestyle{empty } \oddsidemargin -1.0 in \begin{document } \begin{equation}\frac{dv_{r}(t)}{dt}=p_{f}{\times}r_{sv}{\times}v_{w}{\times } \left \left(\frac{c_{in}}{v_{r}(t)}-c_{out}\right) \right.\end{equation}\end{document}in eq. 3, vr(t) is the relative volume of the vesicle at time t (i.e., volume at time t, divided by the initial volume), pf (cm / s) is the macroscopic osmotic water permeability coefficient, rsv is the surface area to volume ratio of a vesicle, and cin and cout are initial solute concentrations inside and outside the vesicle, respectively. the size of the vesicle was measured by laser light scatter using a dynapro particle sizer. earlier studies before discovery of aquaporins showed that permeation of d2o across erythrocytes and red cell ghosts was inhibited by mercury (karan and macey, 1980 ; ye and verkman, 1989). however, mercurial compounds are nonspecific and do not inhibit the aqp1 channel completely (zeidel., 1992). in this study we have performed a quantitative permeability measurement using purified aqp1, reconstituted into proteoliposomes, which eliminates the background permeability due to other proteins (roudier., 1998 ; yang., 2001). 1 shows the time course of relative volume change of liposomes on application of an osmotic gradient, causing the efflux of h2o (fig. it was found that the measured osmotic permeability of d2o (1.8 10 0.42 10 cm / s) is 21% lower than that for h2o (2.3 10 0.310 cm / s). this difference in permeability can be attributed to the higher viscosity of d2o vs. h2o and an 18.6% lower self diffusion coefficient of d2o compared with that of water (mills, 1973). in red blood cells, before discovery of aquaporins, the decreased permeability of d2o was attributed to higher viscosity of d2o (karan and macey, 1980). a similar decrease of conductance of d2o through gramicidin was also attributed to higher viscosity of d2o (tredgold and jones, 1979). the background osmotic permeabilities of h2o and d2o in the absence of a water channel through popc lipid membranes are 0.0032 cm / s and 0.0034 cm / s respectively. to confirm that the observed difference in permeability is not an isotope effect, we measured the osmotic permeability of aqp1 at various osmotic pressure values. 1 c shows that there is a linear increase in rate of efflux of h2o and d2o with increasing osmotic pressure. furthermore the efflux of h2o and d2o shows a parallel increase with increasing osmotic pressure, suggesting that there are no additional interactions between the permeant and the channel as flux increases at higher osmotic pressures. shown is the time course of volume change of aqp1-containing vesicles and control lipid vesicles on abrupt exposure to a doubling of external osmotic pressure in h2o (a) and d2o (b). c shows the effect of varying osmotic pressure (mosm / kg) on permeability of h2o and d2o through aqp1. the force field parameters of our tip3p - hw (d2o) model are summarized in table i. partial atomic charges are 0.96% higher compared with the tip3p model. this implies a larger dipole moment of 7.904 10 cm which is also 0.96% larger than for the tip3p model. the dimer potential energy in the most favorable configuration is 6.759 kcal / mol, which is 2.4% larger in magnitude than for the tip3p model. the heat of vaporization for tip3p - hw is 10.68 kcal / mol, which is 2.9% larger than for the tip3p model and compares well with the experimentally determined value of 11.11 kcal / mol for d2o (nemethy and scheraga, 1964). in our md simulations, the tip3p - hw model was characterized by a bulk diffusion coefficient of 4.00 10 cm / s, which is 18.7% lower than that of the tip3p model of water (4.92 10 cm / s). this difference is in good agreement with the experimentally measured difference of 18.6% between h2o and d2o (mills, 1973). the densities of tip3p and tip3p - hw models were found to be 1.00 g / cm and 1.13 g / cm, respectively. this is also in good agreement with experimental densities of 0.997 g / cm for h2o and 1.104 g / cm for d2o (weast, 1977). these solvent models were subsequently used to calculate the osmotic and diffusion permeabilities of h2o and d2o in aqp1. force field parameters of tip3p - hw model a snapshot of the aqp1/h2o system from the equilibrium md trajectory is presented in fig. 2, with only one monomer and channel shown for the sake of clarity. the single file arrangement and rotation of the orientation of the water dipole, which are unique properties of the aqp family (de groot and grubmuller, 2001 ; tajkhorshid., 2002), are correctly reproduced in our simulations. the single file channel occupancy for h2o and d2o are 9.7 and 9.5 molecules, respectively. the concentration profile of h2o across the channel system at equilibrium conditions is compared in fig. when hydrostatic pressure was applied, the concentration of water became slightly higher on the left side and lower on the right side of the membrane due to the compressibility of water. the main results of our equilibrium md simulations for h2o and d2o are summarized in table ii. the unidirectional permeation rate (q0) of h2o was found to be 0.29, which compares well to the value of 0.2 predicted by another aqp study (de groot and grubmuller, 2001). this difference can be attributed to the fact that the authors used a different (lower resolution) structure of aqp1 and a different water model. we found that q0 for d2o is 7% higher than for h2o, albeit with relatively large error bars (table ii). a snapshot from md simulation of aqp1/h2o system. concentration profile of h2o along z axis (channel axis) at equilibrium conditions (black line) and 100 mpa applied hydrostatic pressure (red line). note the low concentration region between approximately z = 11 and z = + 11 ; this is the channel pore region discussed in the text. results of equilibrium md simulations results of our osmotic pressure simulations are reported in table iii and fig. we found that the osmotic permeability of d2o (8.5 10 cm / s / pore) is 15% lower than that of h2o (10.0 10 cm / s / pore). we could not compare the individual values of the osmotic permeabilities because of the experimental uncertainty in the number of the aqp1 channels per proteoliposome. the osmotic permeability of h2o 10.0 10 cm / s / pore obtained in our md simulations is similar to that predicted by another md study where a value of 7.1 10 cm / s / pore was reported (zhu., 2004). in addition it also compares well with the experimentally measured unit osmotic conductance (pf) of 11.7 10 1.8 10 cm / s / pore reported by zeidel. (1994). since water moves in a single file fashion through the aqp1 channel, the pf / pd ratio should give the number of solute molecules lining the pore (finkelstein, 1987). the calculated pf / pd ratios for h2o and d2o are 11.8 and 8.4, respectively. the pf / pd ratio of h2o is in good agreement with the value 11.9 predicted in zhu. (2004) and 13.2 measured experimentally (mathai., 1996). results of applied pressure md simulations for h2o computed flux versus applied hydrostatic pressure for h2o (a) and d2o (b). circles (black) represent the calculated (average) data point values, which are shown along with the best - fit line (red). standard error for the best fit line for h2o is 5.6% and for d2o 5.3%. results of applied pressure md simulations for d2o in conclusion, a new tip3p - hw model for d2o was developed for simulation of d2o transport through aqp1. this model reproduces the experimental differences observed in the density and the self diffusion coefficient of h2o vs. d2o. both md simulations and experimental measurements confirm that d2o and h2o permeate the aqp1 channel. the observed lower permeability of d2o is attributed to the lower self diffusion coefficient and higher viscosity of d2o compared with h2o. our study showed that md could accurately predict the decreased permeability of d2o in aqp1 in advance of experimental measurements. this study will be helpful for designing md simulations to study permeation of solutes through aqp1 that are not easily amenable to experiments such as carbon dioxide, hydrogen sulfide, and oxygen. | determining the mechanisms of flux through protein channels requires a combination of structural data, permeability measurement, and molecular dynamics (md) simulations. to further clarify the mechanism of flux through aquaporin 1 (aqp1), osmotic pf (cm3/s / pore) and diffusion pd (cm3/s / pore) permeability coefficients per pore of h2o and d2o in aqp1 were calculated using md simulations. we then compared the simulation results with experimental measurements of the osmotic aqp1 permeabilities of h2o and d2o. in this manner we evaluated the ability of md simulations to predict actual flux results. for the md simulations, the force field parameters of the d2o model were reparameterized from the tip3p water model to reproduce the experimentally observed difference in the bulk self diffusion constants of h2o vs. d2o. two md systems (one for each solvent) were constructed, each containing explicit palmitoyl - oleoyl - phosphatidyl - ethanolamine (pope) phospholipid molecules, solvent, and aqp1. it was found that the calculated value of pf for d2o is 15% smaller than for h2o. bovine aqp1 was reconstituted into palmitoyl - oleoyl - phosphatidylcholine (popc) liposomes, and it was found that the measured macroscopic osmotic permeability coefficient pf (cm / s) of d2o is 21% lower than for h2o. the combined computational and experimental results suggest that deuterium oxide permeability through aqp1 is similar to that of water. the slightly lower observed osmotic permeability of d2o compared to h2o in aqp1 is most likely due to the lower self diffusion constant of d2o. |
a total of 1,633 male body weight (bwt) and age measurements, for 232 thoroughbred colts, were collected by the japan bloodhorse breeders association (jbba) between 2005 and 2009. the data with extreme values over 4 residual standard deviations were preliminary analyzed by using logistic growth curve equation, and removed from this study. the scatterplot of the weight - age data is shown with gray dots in fig. 1.scatterplot of the 1,633 male body weight (bwt) data of thoroughbred colts (light gray dots). thin black line indicates expected (actual) data averages of bwt, and the thick gray line indicates estimated richards growth curve (i.e., equation 2).. in the figure, the tendency of the seasonal compensatory growth can be recognized between about 300 and 600 days, which is the period of compensatory growth. scatterplot of the 1,633 male body weight (bwt) data of thoroughbred colts (light gray dots). thin black line indicates expected (actual) data averages of bwt, and the thick gray line indicates estimated richards growth curve (i.e., equation 2). seven sigmoid growth curve equations (logistic, gompertz, von bertalanffy, brody, richards, bridges and janoscheck ; see) were fit to the weight - age data. the best - fit equation based on akaike s information criterion (aic) was the richards equation as follows : in this general richards equation (equation 1), body weight (bwt, kg) is described as a function of age (t, day). the biological interpretations of the four parameters (a, b, k and m) have been discussed previously. briefly, a is the asymptotic limit for bwt as t approaches infinity ; b is a scaling parameter that defines the degree of maturity ; k is a rate constant that determines the spread of the curve along the time axis ; m is the point of inflection in the sigmoid curve in relation to age. the estimated richards equation using the weight - age data was as follows : in fig. 1, the thick gray line indicates the estimated richards growth curve listed on equation 2, and the thin black line is a plot of the expected (actual) data averages of the bwt, where the averages were computed based on the monthly averages of the bwt data and their monthly daily gain. this thin black line is identical to that published in the japanese feeding standard for horses. the deviation of the thin black line (expected data averages) from the thick gray line (richards growth curve) is clear between about 300 and 600 days. the deviation of the expected data averages from the richards growth curve is shown in fig. 2.deviation of the expected (actual) data averages of the male body weight (bwt) from the estimated richards growth curve (i.e., equation 2). deviation of the expected (actual) data averages of the male body weight (bwt) from the estimated richards growth curve (i.e., equation 2). to adjust for the deviation caused by compensatory growth shown in fig. 2, a sigmoid sub - function was designed as follows. a general sigmoid function f(t) is expressed as : where e is the base of the natural logarithm, t is time, where < t <, and 0 f(t) 1. a sigmoid function is a monotonous increase function, and the shapes of the function depend on the values. the results around 1 t 1 are shown in fig. 3fig. 3.sigmoid curve with two different values of. black and gray lines are with =10.0 and =5.0, respectively.. sigmoid curve with two different values of. black and gray lines are with =10.0 and =5.0, respectively. the subtraction between two sigmoid functions with different values leads to a function having only a single wave (down and up wave) at t=0. by using this subtraction and application of several modifications around the t parameter, the following sigmoid sub - function f(t) can be obtained : and the shape of the sub - function is shown in fig. 4.constructed sigmoid sub - function f(t) for adjustment of seasonal compensatory growth.. this sub - function curve crosses the x axis at 432 days with the wave length (i.e., distance between the starting and ending point of the wave) of 268.49 2. this sub - function has zero value when t = or. only when t is around 432 days, do the non - zero f(t) values appear. this characteristic of the sub - function is like the shape of the deviation shown in fig. 2 especially for the period of compensatory growth. therefore, it was assumed that the f(t) sub - function can empirically adjust the deviation caused by compensatory growth. in the original richards equation (equation 1) the maturity related parameter is b, and the newly developed f(t) sub - function can be used for the adjustment of the b parameter. in general, the newly developed f(t) sigmoid sub - function can be added to the b parameter in equation 1. specifically, this leads to the replacement of 0.94513 by 0.94513 + f(t) in equation 2 where is a coefficient of f(t). with this replacement and combination of equation 2 and equation 4, the growth curve equation adjusting for the seasonal compensatory growth was obtained as : the optimal coefficient value of 0.3582 (i.e.,, the coefficient of f(t)) and also the optimal wave length of 268.49 were estimated again by using the weight - age data and sas nlmixed procedure. equation 5 looks complicated but is a single function of age t in days. the insertion of f(t) in equation 5 affects the bwt only when t is within about 432 268.49 days. the growth curve of this new richards equation (equation 5) combined with the sigmoid sub - function is shown with thick gray line in fig. 5.scatterplot of the 1,633 male body weight (bwt) data of thoroughbred colts (light gray dots). thin black line indicates expected (actual) data averages of bwt, and thick gray line indicates estimated richards growth curve with the developed sigmoid sub - function (i.e., equation 5)., where the black line and dots are the same as in fig. the shapes of the two lines were almost identical in the period of compensatory growth. by using this approach, the aic value decreased from 13,053 (equation 2) to 12,794 (equation 5), indicating the better fit of equation 5 to the weight - age data than equation 2. scatterplot of the 1,633 male body weight (bwt) data of thoroughbred colts (light gray dots). thin black line indicates expected (actual) data averages of bwt, and thick gray line indicates estimated richards growth curve with the developed sigmoid sub - function (i.e., equation 5). the deviation of the expected data averages from the new richards growth curve adjusting for compensatory growth is shown in fig. 6.deviation of the expected (actual) data averages of the male body weight (bwt) from the estimated richards growth curve with the developed sub - function (i.e., equation 5).. the deviation in the period of compensatory growth is clearly reduced when compared to the case of non - adjusted (fig. these results suggest the usefulness of this proposed approach for handling compensatory growth typical in thoroughbred horses. deviation of the expected (actual) data averages of the male body weight (bwt) from the estimated richards growth curve with the developed sub - function (i.e., equation 5). as richards noted, some researchers may consider that the parameter b is unimportant biologically. we can choose an alternative approach to adjust parameter k by the sub - function. if k was adjusted by the f(t) sub - function, the combined equation became more complicated and difficult in numerical computation for parameter estimation because parameter k is the one used in the exponential. we aimed at simplicity for the combined equation, and chose b parameter to be adjusted in the f(t) sub - function. accounting for compensatory growth in thoroughbreds, staniar. assumed that their growth rate consists of baseline and systematic deviation components. even though they did not propose any unique growth curve equations handling compensatory growth, their idea shows a similarity to our approach of using both standard richards function as the baseline and sigmoid sub - function as the systematic deviation.. showed a biphasic growth curve equation by combining two different equations with different phases (i.e., two different periods of age), and this may be an alternative approach to handle the compensatory growth because it has generally two different phases.. proposed their new sigmoidal growth curve functions but these equations seem not to be applicable for handling compensatory growth. concerning developmental orthopaedic disease in horses, donabedian. investigated the relationship between nutrient intake and growth rate, and raub discussed the making of a durable equine. the standard growth curve equation handling compensatory growth would be useful for such experiments that relate secure development of thoroughbred horses in winter and spring time. in conclusion, the proposed method in this study is one of the useful approaches for adjusting seasonal compensatory growth in growth curve estimations for thoroughbreds. based on this approach, the optimal growth curve equations can be estimated also for female bwt data of thoroughbreds or another growth traits such as body height or entire width of chest that are considered to be also affected by seasonal compensatory growth. this approach is easily applicable to the general sigmoidal growth curve equation families such as those having biological parameters (e.g. a, b and k parameters in richards equation). | thoroughbred horses are seasonal mating animals, raised in northern regions or countries. foals born yearly in spring generally show a typical seasonal compensatory growth pattern, in which their growth rate declines in the first winter and increases in the next spring. in this study, a new empirical adjustment approach is proposed to adjust for this compensatory growth when growth curve equations are estimated, by using 1,633 male body weights of thoroughbreds as an illustrating example. based on general richards growth curve equation, a new growth curve equation was developed and fit to the weight - age data. the new growth curve equation had a sigmoid sub - function that can adjust the compensatory growth, combined with the richards biological parameter responsible for the maturity of animals. the unknown parameters included in the equations were estimated by sas nlmixed procedure. the goodness of fit was examined by using akaike s information criterion (aic). the aic values decreased from 13,053 (general richards equation) to 12,794 (the newly developed equation), indicating the better fit of the new equation to the weight - age data. the shape of the growth curve was improved during the period of compensatory growth. the proposed method is one of the useful approaches for adjusting seasonal compensatory growth in growth curve estimations for thoroughbreds, and for their management during the compensatory period. based on this approach, the optimal growth curve equations can be estimated also for female body weight of thoroughbreds or other growth traits affected by seasonal compensatory growth. |
gastric cancer is one of the most common types of cancer and often spreads from the stomach to other parts of the body, particularly to the liver, lungs, bones, the abdominal lining, and lymph nodes. during the last decade, considerable research has been conducted on the induction of apoptosis by traditional chinese medicines (tcms). in addition, tcm can be combined with modern medicine to improve symptoms, enhance quality of life, prevent recurrence and metastasis, and prolong survival. however, comparably little is known of the mechanisms whereby tcms affect cancer cells. scutellaria barbata d. don is an important component of numerous medicinal formulas that have been traditionally used in china and korea to treat various cancers. scutellaria barbata d. don is known to induce the apoptosis of human colon carcinoma cells by activating mitochondria and the signal transducer and activator of transcription 3 (stat3), extracellular signal - regulated kinase (erk), and p38 signaling - dependent pathways [3, 4 ]. in tumor - bearing lewis - bearing c57bl/6 mice, scutellaria barbata d. don decreased interleukin (il)-17, il-10, forkhead box p3 (foxp3), transforming growth factor beta (tgf-1), rort, and il-6 levels, but remarkably increased il-2 and interferon gamma (ifn-) levels and inhibited tumor growth by regulating immune function. scutellaria barbata d. don induced the apoptosis of human hepatocarcinoma mhcc97-h cells via the dose - dependent up - regulations of caspase-3 and -9, and combined treatment with scutellaria barbata d. don and low dose 5-fluorouracil (5-fu) significantly inhibited tumor growth in vitro and in vivo possibly via apoptosis and regulating 5-fu metabolism. also, zhang investigated the anti - tumor effect of different solvent fractions of scutellaria barbata d. don and the potential underlying molecular mechanisms. they suggested that the chloroform fraction of scutellaria barbata d. don exhibited the most potent inhibitory effect on the growth of colon cancer cell lines and that sw620 cells exhibited the most sensitive response to the chloroform fraction of scutellaria barbata d. don treatment. apoptosis is a form of programmed cell death that occurs in multicellular organisms and is associated with changes in cell morphology, such as, blebbing, cell shrinkage, nuclear fragmentation, chromatin condensation, and chromosomal deoxyribonucleic acid (dna) fragmentation [9, 10 ]. however, the mechanisms whereby ethanol extracts of scutellaria barbata d. don exert anti - cancer activity in gastric cancer cells are poorly understood. in this study, we investigated the anti - cancer effect of scutellaria barbata d. don on gastric cancer by using the mkn-45 cell line (a human gastric adenocarcinoma cell line), a cell model of a human gastric carcinoma. our results demonstrate that scutellaria barbata d. don triggers the apoptosis of mkn-45 cells by activating caspase-, mitogen - activated protein kinase (mapk)- and reactive oxygen species (ros)-dependent pathways. powdered ethanol extract of rhizomes of scutellaria barbata (catalog number : ca01 - 061 (2)) was obtained from the plant extract bank at the korea research institute of bioscience and biotechnology (kribb) (daejeon, korea). for the purification of this extract for the present study, it was immersed in ethanol, sonicated for 15 minutes, and extracted for 72 hours. the mixture obtained was then filtered through non - fluorescent cotton, evaporated under reduced pressure by using a rotary evaporator (n-1000swd, eyela, japan) at 45c, and lyophilized using a modul spin 40 dryer (biotron corporation, calgary, canada) for 24 hours. the yield of lyophilized powder obtained (extract of scutellaria barbata d. don (esb)) was 12.3%. esb was then dissolved in dimethyl sulfoxide (dmso, jersey lab supply, livingston, nj, usa) at a concentration of 100 mg / ml and stored at 4c. this stock solution was then diluted with medium to the desired concentrations prior to use. the final concentration of dmso was always < 0.1% and did not affect the results. this cell line was established at the cancer research center, college of medicine, seoul national university, korea. cells were propagated in rpmi-1640 medium (gibco - brl) supplemented with 10% heat - inactivated fetal bovine serum and 20 g/ ml of penicillin and streptomycin in a 5% co2 atmosphere at 37c. briefly, mkn-45 cells were seeded into each well of 12-well culture plates, cultured in rpmi-1640 supplemented with other reagents for 72 hours, treated with 100 l/ well of mtt solution (5 mg / ml in phosphate buffered saline (pbs)), and incubated for 4 hours at 37c. after the supernatant had been removed and shaken with 200 l of dmso (jersey lab supply, livingston, nj, usa) for 30 minutes, the absorbance was measured at 570 nm. caspase-3 and -9 assay kits were purchased from biomol (plymouth, pa, usa). after experimental treatments, cells were centrifuged at 1,000 g and 4c for 10 minutes, washed with pbs, re - suspended in ice - cold cell lysis buffer, incubated on ice for 10 minutes, and centrifuged at 1,000 g and 4c for 10 minutes. supernatants (10 l) were incubated with 50 l of substrate (400-m ac - devd - pna) in 40 l of assay buffer at 37c, and the absorbance at 405 nm was read at different times. the pna concentrations in samples were read off standard pna concentration / absorbance plots. a flow cytometric analysis with propidium iodine (pi) staining was used to determine the cell - cycle distributions [12, 13 ]. mkn-45 cells (1 10) were placed in an e - tube, and ice - cold fixation buffer (ethyl alcohol : 700 l) was then slowly added with vortexing. tubes were sealed with parafilm, incubated at 4c overnight, and spun for 3 minutes at 106 g and 4c. after the supernatants had been discarded, cell pellets were re - suspended in 200 l of pi staining solution (2 l of pi at 5 mg / ml, and 2 l of rnase in 196 l of pbs) at 20,817 g for 5 seconds and left for 30 minutes in the dark at room temperature. samples were analyzed using a fluorescence - activated cell sorter (facscan ; becton - dickinson, mountain view, ca, usa) at = 488 nm by using cell - quest software (becton - dickinson). the dna content distributions of normal cells were characterized using the two peaks corresponding to the g1/g0 and the g2/m phases. the g1/g0 phase represents normal function and the resting state of the cell cycle with greatest diploid dna content while the g2/m phase more than diploid dna content. with respect to the cell cycle, cells in the sub - g1 phase have the least dna content and are described as hypodiploid, which reflects dna fragmentation. mitochondrial membrane depolarization was evaluated using a 5,5',6,6-tetrachloro-1,1,3,3-tetraethylbenzimidazolylcarbocyanine iodide (jc-1) fluorescence probe (molecular probes, eugene, or) according to the manufacturer s instructions. briefly, mkn-45 cells were labeled with 2 m of jc-1 for 30 minutes at 37c and then analyzed using flow cytometry at an excitation wavelength of 488- nm with 530/30 or 585/42 nm bypass emission filters. intracellular ros generation was determined using carbo xy - h2dcfda (5-(and-6)-carboxy-20,70-dichlorodihydrofluorescein diacetate ; molecular probes, eugene, or). briefly, after treatments, cells were treated with 100-m carboxy - h2dcfda in culture medium, incubated at 37c for 30 minutes, and washed with pbs. fluorescence was measured using a facscan (becton - dickinson, mountain view, ca) at an excitation wavelength of 488 nm and an emission wavelength of 525 nm. statistical significance was accepted for p values < 0.05. the drugs used in the experiments, namely, pd 98059 (erk inhibitor), sb203580 (p38 kinase inhibitor), and ly294002, were purchased from sigma - aldrich (st. jnk inhibitor ii (sp600125) was purchased from calbiochem (san diego, ca, usa). the chemotherapeutic agents, namely, paclitaxel, 5-fluorouracil, cisplatin, etoposide, doxorubicin, and docetaxel, were purchased from tocris bioscience (bristol, uk). all other agents were purchased from sigma - aldrich (st. louis, mo, usa). treatment of mkn-45 cells with esb (40 200 g / ml) for 24 hours reduced cell viability by 83.7% 4.1% at 40 g/ ml, 67.8% 5.2% at 80 g / ml, 50.3% 4.3% at 120 g / ml, 37.7% 5.5% at 160 g / ml and 20.0% 5.2% at 200 g / ml (fig. the half maximal inhibitory concentration (ic50) of esb for 24 hours is 105.6 g / ml. in addition, treatment with esb for 72 hours reduced viability by 42.6% 9.3% at 40 g / ml, 19.4% 5.2% at 80 g / ml, 10.6% 2.4% at 120 g / ml, 5.3% 1.2% at 160 g / ml and 1.5% 1.1% at 200 g / ml (fig. ic50 of esb for 72 hours is 31.5 g / ml. these findings indicate that esb has a dose - dependent cytotoxic effect on mkn-45 cells. after treatment with esb for 24 hours, mkn-45 cells were stained with pi, and cell - cycle progression was assessed by using flow cytometry. esb increased cell numbers in the sub - g1 peak in a dose - dependent manner, which was consistent with cell - death results (fig. 2). treatment with esb for 24 hours resulted in accumulations in the g1 phase of 22.6% 3.1% at 40 g / ml, 31.3% 4.3% at 80 g / ml, 50.0% 3.3% at 120 g / ml, and 56.9% 5.0% at 200 g / ml as compared with 17.6% for vehicle control cells, and the corresponding accumulations after treatment with esb for 24 hours were 47.6% at 40 g / ml, 46.4% at 80 g / ml, 30.7% at 120 g / ml, and 21.8% at 200 g / ml. in addition, treatment with esb for 24 hours resulted in accumulations in the g2/m phase of 12.9% at 40 g / ml, 12.1% at 80 g / ml, 11.4% at 120 g / ml, and 7.7% at 200 g / ml, which were lower than that observed in vehicle control cells (15.3%) (fig. these results suggest that esb has an anti - cancer effect and that this is closely associated with the induction of apoptosis in mkn-45 cells. mitochondrial membrane depolarization (an early event of intrinsic apoptosis signaling) was elevated by using esb. flow cytometry showed that the mitochondrial membrane depolarization caused by 24 hours of treatment with esb was markedly increased by 19.1% 5.1% at 40 g/ ml, 28.2% 3.3% at 80 g / ml, 41.4% 4.2% at 120 g / ml, 51.4% 5.4% at 160 g / ml, and 69.4% 6.4% at 200 g / because caspase activation is required for apoptosis, caspase activity assays were used to observe the activities of caspase-3 and -9 in mkn-45 cells. caspase activities were found to be dose - dependently elevated after cells had been treated with esb at doses from 40 to 200 g / ml for 24 hours, and these activities were found to be repressed by pre - treating cells with zvad - fmk, a pan - caspase inhibitor (fig. these results suggest that esb - induced apoptosis is mediated by mitochondria- and caspase - dependent pathways in mkn-45 cells. to investigate the relationship between the regulation of mapk pathways and the inhibition of cancer - cell proliferation by esb, we pretreated the mkn-45 cells with the mapk inhibitors pd98059 (an erk1/2 inhibitor), sb203580 (a p38 inhibitor), or sp600125 (a jnk inhibitor) and then treated them with esb (160 g / ml) for 24 hours (fig. all three mapk inhibitors significantly diminished the cell death induced by esb : pd98059 reduced cell death by 41.3% 2.1%, sb203580 by 36.3% 1.3%, and sp600125 by 39.5% 2.3% as compared with the vehicle control. in contrast, esb - induced cell death was not attenuated by ly294002. taken together, these data suggest that the anti - proliferative effect of esb on mkn-45 cells is due to modulation of mapk signaling pathways, which results in apoptosis. in addition, because intracellular ros play important roles in apoptosis, we examined whether esb was capable of generating ros in mkn-45 cells. cells were treated with different concentrations of esb from 40 to 200 g / ml for 24 hours, and the levels of ros generation were measured by using flow cytometry. as shown in (fig. 4b), treatment with esb significantly and dose - dependently increased ros generation by almost 1.4-fold versus the vehicle control. we also measured cell viabilities after co - treating cells with esb (40 200 g / ml) and n - acetyl- l - cysteine (nac ; a ros scavenger) for 24 hours., we investigated whether esb was able to enhance the sensitivity of mkn-45 cells to chemotherapeutic agents in vitro. combinations of esb and several chemotherapeutic agents, used individually, suppressed cell growth more than each agent in isolation did (fig. 5). in particular, cisplatin, etoposide, or doxorubicin, when administered with esb, markedly suppressed cell growth. scutellaria barbata d. don has been shown to possess various anti - cancer effects in liver, colorectal, lung, and breast cancer [17 - 20 ], but little is known of its effect on gastric cancer. therefore, in the present study, we investigated the anti - cancer effect of scutellaria barbata d. don on gastric cancer and the mechanism involved by using an ethanol extract of sb and mkn-45 cells. our results show esb dose - dependently reduces the viability of mkn-45 cells (fig. 1), increases cell numbers in the sub - g1 peak, which is consistent with our cell viability findings, and reduces cell numbers in the g2/m phase (fig., flow cytometry showed that mitochondrial membrane depolarization was markedly increased by esb, and that the activities of caspase-3 and -9 were dose - dependently elevated at the molecular level by esb (fig. 3). to investigate the mechanisms underlying apoptotic pathways, we pretreated the mkn-45 cells with the mapk inhibitors pd98059 (an erk1/2 inhibitor), sb203580 (a p38 inhibitor), or sp600125 (a jnk inhibitor), and all three were found to diminish esb - induced cell death significantly (fig. furthermore, co - treatment with esb plus anti - cancer agents, one at a time, suppressed cell growth more so than using these agents in isolation did ; this effect was most obvious for cisplatin, etoposide, and doxorubicin (fig. 5). several research groups are investigating the anti - cancer effects of scutellaria barbata d. don on various cancer cells. scutellaria barbata d. don has been reported to have anti - tumour effects in mice transplanted with human hepatocellular carcinoma (hepg2) cells, and to induce the deaths of lovo cells (a human colon cancer cell line) and a549 cells (a human lung cancer cell line). and on metastatic breast cancer. in addition, scutellaria barbata d. don induced the apoptosis of human colon carcinoma cells [3, 4 ] and human hepatocarcinoma mhcc97-h cells. mechanistically, tcm have been reported to inhibit the growth and survival of gastric adenocarcinoma cells via transient receptor potential melastatin 7 (trpm7) ion channels [21 - 23 ]. therefore, in the future we intend to determine the involvements of trpm7 channels in the anti - cancer effects of esb. furthermore, sophorae radix, orostachys japonicus, ulmi pumilae cortex, buxus microphylla var. koreana nakai extract and flos carthami have been reported to inhibit the growth and survival of gastric cancer cells by blockading trpm7 channel and mapk signaling, and thus, they have been considered a starting point for the development of agents against gastric cancer. according to results of the present study, pretreating mkn-45 cells with pd98059 (an erk1/2 mapk inhibitor), sb203580 (a p38 inhibitor), or sp600125 (a jnk inhibitor) attenuated the suppressive effect of esb on mkn-45 cells, but akt pretreatment had no such effect. these results support our hypothesis that esb act as chemopreventive agent in gastric cancer cells by blockading mapk pathways, and that targeting of the mapk signaling pathways by esb offers a strategy for the development of a therapy for gastric cancer. esb was found to reduce mkn-45 cell proliferation and induce apoptosis, which was confirmed by accumulation of cells in the sub - g1 phase. furthermore, esb - induced apoptosis was found to be associated with activations of caspases and mitochondrial dysfunction, and inhibition of the mapk pathway inhibited esb - induced mkn-45 cell apoptosis. these findings suggest that esb should be considered a potential agent for the treatment of human gastric adenocarcinoma. esb, extract of scutellaria barbata d. don ; mtt, 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide ; sds, standard deviations. esb, extract of scutellaria barbata d. don ; facs, fluorescence - activated cell sorter ; sds, standard deviations. esb, extract of scutellaria barbata d. don ; facs, fluorescence - activated cell sorter ; sds, standard deviations. mapk, mitogen - activated protein kinase ; esb, extract of scutellaria barbata d. don ; ros, reactive oxygen species ; nac, n - acetyl - lcysteine ; mtt, 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide ; sds, standard deviations ; n.s., not significant versus esbtreated cells. esb, extract of scutellaria barbata d. don ; mtt, 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide ; sds, standard deviations. | objectives : the crude extracts of scutellaria barbata d. don (sb) have traditionally demonstrated inhibitory effects on numerous human cancers both in vitro and in vivo. gastric cancer is one of the most common types of cancer on world. the authors investigated the effects of an ethanol extract of scutellaria barbata d. don (esb) on the growth and survival of mkn-45 cells (a human gastric adenocarcinoma cell line).methods : the mkn-45 cells were treated with different concentrations of esb, and cell death was examined using an mtt (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) assay. analyses of sub - g1 peaks, caspase-3 and -9 activities, and mitochondrial membrane depolarizations were conducted to determine the anti - cancer effects of sb on mkn-45 cells. also, intracellular reactive oxygen species (ros) generation was investigated.results:esb inhibited the growth of mkn-45 cells, caused cell cycle arrest, and increased the sub - g1 population. in addition, esb markedly increased mitochondrial membrane depolarization and the activities of caspase-3 and -9. esb exerted anti - proliferative effects on mkn-45 cells by modulating the mitogen - activated protein kinase (mapk) signaling pathway and by increasing the generation of ros. furthermore, combinations of anti - cancer drugs plus esb suppressed cell growth more than treatments with an agent or esb, and this was especially true for cisplatin, etoposide, and doxorubicin.conclusion:esb has a dose - dependent cytotoxic effect on mkn-45 cells and this is closely associated with the induction of apoptosis. esb - induced apoptosis is mediated by mitochondria-, caspase- and mapk dependent pathways. in addition, esb enhances ros generation and increases the chemosensitivity of mkn-45 cells. these results suggest that treatment with esb can inhibit the proliferation and promote the apoptosis of human gastric adenocarcinoma cells by modulating the caspase-, mapk- and ros - dependent pathway. |
chironomus riparius (chironomidae, diptera), is widely used in aquatic exotoxicological studies for assessing acute and sub - lethal toxicities of contaminated sediments and for water monitoring due to their widespread occurrence, short life - cycle, easy to be reared in the laboratory, physiological tolerance to various environmental conditions. to date, the endpoints used for monitoring such effects in c. riparius are based on a small number of specific biomarkers and measurements of organism level effects, such as survival and reproduction. genomic - based techniques based on expression analysis of genes are important tools for investigating molecular level effects caused by exposure to environmental pollutants, which will provide the ability to detect mechanisms of action and subsequent adverse cellular level effects and associated with different types of toxicity. as a pre - requisite for genomic based eco - toxicological studies knowledge of the c. riparius transcriptome is important but despite its eco - toxicological importance, no large scale transcriptome analysis of c. riparius has been done so far. in a previous report arvestad. reported the transcriptome analysis of c. tentans midgut and an epithelial cell line using cdna sequencing using conventional cdna synthesis and sequencing method. however, with the advent of new high throughput pyrosequencing technologies using several genome sequencers, such as gs - flx, gs - flx - titanium and solexa, extensive cdna sequence information can be obtained in a short period of time. the gs - flx pyrosequencer, from 454 life science / roche, is well - suited for de novo transcriptome sequencing for the rapid production of sequence data with reduced time, labor and cost, and generates the longest reads. moreover, well characterized reference genomes of insects [8 - 10 ] could provide platforms for comparative genome analyses of non model organisms like c. riparius. in this study, we present the first comprehensive characterization of the transcriptome of c. riparius 4 instar larvae using 454 pyrosequencing. based on data corresponding to one single run on the flx gene sequencer from 454 life science, almost 49,774,676 bases were assembled into transcripts and the majority of these have been annotated and functionally classified. in light of limited genomic and transcriptomic information, these data would significantly enrich the molecular aspects of c. riparius and its role in genomics based ecotoxicological studies. c. riparius strains were obtained from korea institute of chemical technology (daejon, korea). the larvae were reared on an artificial diet of fish flake food (tetramin, tetrawerke, melle, germany) in glass chambers containing dechlorinated tap water and acid washed sand, with aeration under a 16 - 8 h light - dark photoperiod at room temperature (201). the larvae were collected and total rna samples were isolated using trizol reagent (invitrogen life technology, usa). the rna samples (a260/a280>1.8) were collected and mrna was purified from the pooled total rna (500 g) by binding to oligo (dt) cellulose twice (poly (a) purist, ambion). for first strand synthesis, 10 l of the purified mrna (5 g), denatured at 65 for 10 minutes in a rnase free tube, rapidly chilled on ice, mixed with 5 l of 10x first - strand buffer, 5 lof 100 mm dtt, 5 lof dntps (2.5 mm each), 5 lof oligo dt20 (50 m), 2.5 lof strata script reverse transcriptase (200 u/l) in a 50 lreaction volume. first strand cdna was synthesized at 42 for 60 minutes and cdna synthesis and heat inactivated at 70 for 15 minutes and the tubes were placed on ice. for second strand cdna synthesis, h2o (61 l), 100 m tris - hcl, 20 l of second - strand buffer, dntps (6 l, 10 mm each), dna polymerase i (4 l, 10 u/l), and rnase h (2 l, 1.5 u/l) were mixed with the first strand synthesis reaction and incubated at 16 for 150 minutes. for end blunting, 23 l of blunting dntp mix, 2 l of cloned pfu dna polymerase (2.5 u/l) was incubated with the second strand synthesis reaction at 16 for 5 minutes. the cdna was purified using qiaquick pcr purification kit (qiagen, ca, usa) in a final elution volume of 50 l. approximately, 1 g of the final pcr product dna was used to generate dna library for genome sequencer flx titanium (roche, mannheim, ge). the fragments ends were polished (blunted), and short two adapters were ligated onto both ends. the adapters provide priming sequences for both amplification and sequencing of the sample library fragments, as well as the " sequencing key ", a short sequence of 4 nucleotides used by the system software for base calling and, following repair of any nicks in the double - stranded library, release of the unbound strand of each fragment (with 5,-adaptor a). finally the quality of the library of single - stranded template dna fragments (ssdna library) was assessed using 2100 bioanalyzer (agilent, waldbronn, ge), and the library was quantitated, including a functional quantitation to determine the optimal amount of the library to use as input for emulsion - based clonal amplification. single " effective " copies of template species from the dna library to be sequenced were hybridized to dna capture beads. the immobilized library was then resuspended in the amplification solution, and the mixture is emulsified, followed by pcr amplification. after amplification, the dna - carrying beads were recovered from the emulsion and enriched. the second strands of the amplification products were melted away as part of the enrichment process, leaving the amplified single - stranded dna library bound to the beads. after amplification, the dna - carrying beads were set into the wells of a picotiterplate device (ptp) such that wells contain single dna beads. the loaded ptp was then inserted into the genome sequencer flx instrument, and sequencing reagents were sequentially flowed over the plate. information from all the wells of the ptp is captured simultaneously by the camera, and can be processed in real time by the onboard computer. after assembly, the resulting contigs and singlets were blastx searched against the protein databases " nr " and " uniprot " (the uniprot consortium, 2008). the sequences were annotated using the gene ontology (go) terms where possible according to molecular function, biological process and cellular component using database (http://www.geneontology.org/). pathway assignments according to kyoto encyclopedia of genes and genomes (kegg) mapping was carried out using unique sequences that had blastx scores with a cut off value of e = 10 the sequences were mapped to different kegg biochemical pathways according to the ec distribution in the pathway database (http://www.genome.ad.jp/kegg/). c. riparius strains were obtained from korea institute of chemical technology (daejon, korea). the larvae were reared on an artificial diet of fish flake food (tetramin, tetrawerke, melle, germany) in glass chambers containing dechlorinated tap water and acid washed sand, with aeration under a 16 - 8 h light - dark photoperiod at room temperature (201). the larvae were collected and total rna samples were isolated using trizol reagent (invitrogen life technology, usa). the rna samples (a260/a280>1.8) were collected and mrna was purified from the pooled total rna (500 g) by binding to oligo (dt) cellulose twice (poly (a) purist, ambion). for first strand synthesis, 10 l of the purified mrna (5 g), denatured at 65 for 10 minutes in a rnase free tube, rapidly chilled on ice, mixed with 5 l of 10x first - strand buffer, 5 lof 100 mm dtt, 5 lof dntps (2.5 mm each), 5 lof oligo dt20 (50 m), 2.5 lof strata script reverse transcriptase (200 u/l) in a 50 lreaction volume. first strand cdna was synthesized at 42 for 60 minutes and cdna synthesis and heat inactivated at 70 for 15 minutes and the tubes were placed on ice. for second strand cdna synthesis, h2o (61 l), 100 m tris - hcl, 20 l of second - strand buffer, dntps (6 l, 10 mm each), dna polymerase i (4 l, 10 u/l), and rnase h (2 l, 1.5 u/l) were mixed with the first strand synthesis reaction and incubated at 16 for 150 minutes. for end blunting, 23 l of blunting dntp mix, 2 l of cloned pfu dna polymerase (2.5 u/l) was incubated with the second strand synthesis reaction at 16 for 5 minutes. the cdna was purified using qiaquick pcr purification kit (qiagen, ca, usa) in a final elution volume of 50 l. approximately, 1 g of the final pcr product dna was used to generate dna library for genome sequencer flx titanium (roche, mannheim, ge). the fragments ends were polished (blunted), and short two adapters were ligated onto both ends. the adapters provide priming sequences for both amplification and sequencing of the sample library fragments, as well as the " sequencing key ", a short sequence of 4 nucleotides used by the system software for base calling and, following repair of any nicks in the double - stranded library, release of the unbound strand of each fragment (with 5,-adaptor a). finally the quality of the library of single - stranded template dna fragments (ssdna library) was assessed using 2100 bioanalyzer (agilent, waldbronn, ge), and the library was quantitated, including a functional quantitation to determine the optimal amount of the library to use as input for emulsion - based clonal amplification. single " effective " copies of template species from the dna library to be sequenced were hybridized to dna capture beads. the immobilized library was then resuspended in the amplification solution, and the mixture is emulsified, followed by pcr amplification. after amplification, the dna - carrying beads were recovered from the emulsion and enriched. the second strands of the amplification products were melted away as part of the enrichment process, leaving the amplified single - stranded dna library bound to the beads. the sequencing primer is then annealed to the immobilized amplified dna templates. after amplification, the dna - carrying beads were set into the wells of a picotiterplate device (ptp) such that wells contain single dna beads. the loaded ptp was then inserted into the genome sequencer flx instrument, and sequencing reagents were sequentially flowed over the plate. information from all the wells of the ptp is captured simultaneously by the camera, and can be processed in real time by the onboard computer. after assembly, the resulting contigs and singlets were blastx searched against the protein databases " nr " and " uniprot " (the uniprot consortium, 2008). the sequences were annotated using the gene ontology (go) terms where possible according to molecular function, biological process and cellular component using database (http://www.geneontology.org/). pathway assignments according to kyoto encyclopedia of genes and genomes (kegg) mapping was carried out using unique sequences that had blastx scores with a cut off value of e = 10 the sequences were mapped to different kegg biochemical pathways according to the ec distribution in the pathway database (http://www.genome.ad.jp/kegg/). to get an overview of c. riparius transcriptome, total rna was isolated from fourth instar larvae, and mrna purification, cdna synthesis, and sequence determination was done. these were then pyrosequenced, and in total, 138,091 reads were obtained, constituting a total of 49,774,676 bases of cdna. following the assembly of the sequences, a total of 8,565 contigs and 11,455 singletons were obtained (table 1). among the 8,565 contigs, 3,131 and 5,434 had lengths more than 500 and 100 base pairs, respectively (table 2). after assembly, the contigs and singletons were blastx searched against the protein databases " nr " and " uniprot " (the uniprot consortium, 2008). of the 8,565 c. riparius contigs, 5,102 matched proteins in " uniprot " and 5,114 matched proteins in " nr ", while the numbers for the 11,455 singlets where 4,697 and 4,710, respectively (table 3). after removing all redundant sequences, 9,512 sequences were obtained, representing a significant part of the c. riparius transcriptome. gene ontology (go) has been widely used to characterize gene function, annotation and classification. as a whole, 24% of the sequences matched with known function genes to existing gene models in blastx searches (e - value 1), 24% showed no significant match and 52% of the pyrosequencing assemblies (e - value 1) did not match with any known sequences in the existing genbank database and ; thus, are likely to represent novel transcripts identified in this study (figure 1). similarities based on the results of blastx searches showed the highest percentage of sequences match with aedes aegypti (26%), followed by culex quinquefasciatus (21%), drosophila spp. (18%), anopheles gambiae (15%), tribolium castaneum (4%), apis mellifera (2%) and nasonia vitripennis (2%). a small number of sequences (1%) showed similarities with previously characterized genes of different chironomus species and 6% of sequences matched with other insects and rest of the 5% matched with other (human, chicken, mouse, zebrafish, c. elegans or other organisms) species (figure 2). kegg pathway analyses are widely used as a reference for the systematic interpretation of sequence data by linking individual genes to components of the kegg biochemical pathways. the pyrosequenced transcriptome of c. riparius was searched for the number of annotated gene sequences involved in shared specific kegg pathways among animal phyla, using the unique sequences that had blastx scores with a cut off value of e = 10. it was found that 2908 (34.73%) genes were involved in proteins with a binding function or cofactor requirement, 1,165 (13.91%) genes were involved in subcellular localizations, 915 (11%) in metabolism, 917 (10.95%) in regulation of metabolism and protein function and 700 (8.36%) in cellular transport, transport facilities and transport routes representing the largest groups with putative function, indicating the important metabolic activities in c. riparius (table 4). these results showed the effectiveness of our transcriptome analysis of c. riparius, and indicated many of the candidate genes involved in many pathways and cellular processes. a closer examination of the annotations revealed several genes that are of particular interest for environmental monitoring and ecological research. several proteins catalyzing biotransformation of many xenobiotic and a number of important biomarkers for a large number of different compounds were present. among the sequenced c. riparius transcripts, 117 different cytochrome p450 variants from 13 different families could be identified. other interesting classes of proteins such as heat shock protein (24.1, 27, 67b2, 70, 90), genes coding for oxidative stress such as catalase, glutathione peroxidase, glutathione s - transferase, superoxide dismutase, thioredoxin reductase and several other biomarker genes such as metallothionein, vitellogenin were also present (table 5). to get an overview of c. riparius transcriptome, total rna was isolated from fourth instar larvae, and mrna purification, cdna synthesis, and sequence determination was done. these were then pyrosequenced, and in total, 138,091 reads were obtained, constituting a total of 49,774,676 bases of cdna. following the assembly of the sequences, a total of 8,565 contigs and 11,455 singletons were obtained (table 1). among the 8,565 contigs, 3,131 and 5,434 had lengths more than 500 and 100 base pairs, respectively (table 2). after assembly, the contigs and singletons were blastx searched against the protein databases " nr " and " uniprot " (the uniprot consortium, 2008). of the 8,565 c. riparius contigs, 5,102 matched proteins in " uniprot " and 5,114 matched proteins in " nr ", while the numbers for the 11,455 singlets where 4,697 and 4,710, respectively (table 3). after removing all redundant sequences, 9,512 sequences were obtained, representing a significant part of the c. riparius transcriptome. gene ontology (go) has been widely used to characterize gene function, annotation and classification. as a whole, 24% of the sequences matched with known function genes to existing gene models in blastx searches (e - value 1), 24% showed no significant match and 52% of the pyrosequencing assemblies (e - value 1) did not match with any known sequences in the existing genbank database and ; thus, are likely to represent novel transcripts identified in this study (figure 1). similarities based on the results of blastx searches showed the highest percentage of sequences match with aedes aegypti (26%), followed by culex quinquefasciatus (21%), drosophila spp. (18%), anopheles gambiae (15%), tribolium castaneum (4%), apis mellifera (2%) and nasonia vitripennis (2%). a small number of sequences (1%) showed similarities with previously characterized genes of different chironomus species and 6% of sequences matched with other insects and rest of the 5% matched with other (human, chicken, mouse, zebrafish, c. elegans or other organisms) species (figure 2). kegg pathway analyses are widely used as a reference for the systematic interpretation of sequence data by linking individual genes to components of the kegg biochemical pathways. the pyrosequenced transcriptome of c. riparius was searched for the number of annotated gene sequences involved in shared specific kegg pathways among animal phyla, using the unique sequences that had blastx scores with a cut off value of e = 10. it was found that 2908 (34.73%) genes were involved in proteins with a binding function or cofactor requirement, 1,165 (13.91%) genes were involved in subcellular localizations, 915 (11%) in metabolism, 917 (10.95%) in regulation of metabolism and protein function and 700 (8.36%) in cellular transport, transport facilities and transport routes representing the largest groups with putative function, indicating the important metabolic activities in c. riparius (table 4). these results showed the effectiveness of our transcriptome analysis of c. riparius, and indicated many of the candidate genes involved in many pathways and cellular processes. a closer examination of the annotations revealed several genes that are of particular interest for environmental monitoring and ecological research. several proteins catalyzing biotransformation of many xenobiotic and a number of important biomarkers for a large number of different compounds were present. among the sequenced c. riparius transcripts, 117 different cytochrome p450 variants from 13 different families could be identified. other interesting classes of proteins such as heat shock protein (24.1, 27, 67b2, 70, 90), genes coding for oxidative stress such as catalase, glutathione peroxidase, glutathione s - transferase, superoxide dismutase, thioredoxin reductase and several other biomarker genes such as metallothionein, vitellogenin were also present (table 5). c. riparius has been studied extensively because of their importance as an ecologically important biomonitoring species. however, due to limited knowledge of genomic resources necessary for mechanistic study, the effect of toxicants at the genomic level was rarely studied. this work describes the first assessment of the use of pyrosequencing in c. riparius and we have obtained a significant portion of the c. riparius transcriptome using this approach. to facilitate identifying sets of genes involved in a broad range of processes we developed our ests set from a normalized whole - body library. as compared to sanger - based approaches, which require cdna cloning and bacterial transformation, transcriptome sequencing using massively parallel pyrosequencing exhibits high sensitivity and detection of low - abundant transcripts. transcripts that previously have been hard to sequence can therefore be detected as in the case of arabidopsis transcriptome profiling using pyrosequecing as reported by weber.. even though, the length of the sequence is shorter than as compared to sanger sequencing, the flx gene sequencer used in this study generated 3,131 contigs with an average of 924 bp length which is longer compared to previous studies. in our study, sequence names to the assembled sequences were given based on the best blast match for that sequence available in the public sequence data base and almost 50% of the genes were assigned gene names. however, another 50% of the sequences not matching to known genes in public sequence databases. in our studies we obtained 9,512, non - redundant genes and thus, a major part of the transcriptome of c. riparius has been obtained. one of the limitations in non - model organisms lacking fully sequenced genome where the transcriptome pyrosequencing is based on the number of genes expressed and without a fully - sequenced genome no clear data is available. genome sequences for the insects d. melanogaster, a. gambiae and a. aegypti have been reported and many other species are nearing completion. in our studies 81% of the c. riparius transcriptome closely related to insects a. aegypti, d. melanogaster, c. quinquefasciatus, and a. gambiae and therefore will provide a rich source of information for further investigation using comparative genome analyses. the expression levels of unknown transcripts were also as high as those aligning in annotated regions and these transcripts are likely to represent novel transcripts, which offer possibility to study new genes which may be specific to c. riparius. in earlier reports, many unique genes are observed in transcriptome studies of m. sexta. in data analysis, many genes involved in different pathways, cellular processes and genes involved in metabolism of toxic substances or well - known biomarker genes (table 4) are identified. since c. riparius is extensively used in ecotoxicological studies, gene expression analysis are needed for mechanistic studies to understand changes in aquatic environment and the large collection of annotated sequences produced in this study represents a reasonably complete description of the c. riparius larval transcriptome. by correlating morphological as well as physiological charecters with molecular - level responses, caused by exposure to various toxicants, the subtle effect of various toxicants pyrosequencing offers rapid characterization of a large portion of the transcriptome and therefore provides a comprehensive tool for gene discovery. pyrosequencing the ests of 4 instar c. riparius larvae resulted in the identification of many sequences of ecotoxicological relevance. analysis of the c. riparius transcriptome has revealed several gene candidates of ecotoxicological interest and further functional characterization will identify genes with relevance to ecotoxicology. the obtained transcriptome offers the additional option to design microarrays to study transcript regulation to understand the effect of environmental stressors. transcriptome comparison with well - studied organisms will facilitate further the understanding of how environmental stressors effect at higher organisms levels using c. riparius as a model system. the platform will allow correlation of molecular - level responses, caused by exposure to various toxicants, to the unique morphological and physiological characters of c. riparius. | objectiveschironomus riparius, a non - biting midge (chironomidae, diptera), is extensively used as a model organism in aquatic ecotoxicological studies, and considering the potential of c. riparius larvae as a bio - monitoring species, little is known about its genome sequences. this study reports the results of an expressed sequence tags (ests) sequencing project conducted on c. riparius larvae using 454 pyrosequencing.methodsto gain a better understanding of c. riparius transcriptome, we generated ests database of c. ripairus using pyrosequencing method.resultssequencing runs, using normalized cdna collections from fourth instar larvae, yielded 20,020 expressed sequence tags, which were assembled into 8,565 contigs and 11,455 singletons. sequence analysis was performed by blastx search against the national center for biotechnology information (ncbi) nucleotide (nr) and uniprot protein database. based on the gene ontology classifications, 24% (e - value 1 - 5) of the sequences had known gene functions, 24% had unknown functions and 52% of sequences did not match any known sequences in the existing database. sequence comparison revealed 81% of the genes have homologous genes among other insects belonging to the order diptera providing tools for comparative genome analyses. targeted searches using these annotations identified genes associated with essential metabolic pathways, signaling pathways, detoxification of toxic metabolites and stress response genes of ecotoxicological interest.conclusionsthe results obtained from this study would eventually make ecotoxicogenomics possible in a truly environmentally relevant species, such as, c. riparius. |
the biomedical community has traditionally used two types of ceramic implants for bone tissue regeneration technologies : inert materials such as alumina, zirconia, and carbon (hulber 1993 ; wise 1995) and bioactive ceramics (vallet - reg 2001a), which interact with the physiological environment when implanted leading to their integration in the living tissue (hench 1984 ; kokubo 1990 ; langer 1993 ; hench 1998). depending on the patient needs, an appropriate ceramic material should be selected to manufacture a determined implant. when hard tissues, natural composite materials, are aimed, the synthetic approach of these composite materials is a way to mimic nature in the laboratory (vallet - reg 2006a). in the past few years bioactive ceramics like calcium phosphates (yamamuro 1990a), bioactive glasses and glass - ceramics (yamamuro 1990b) have been deeply investigated. organic - inorganic hybrid materials have been also widely proposed as good candidates in the biomaterials field because they combine the properties of ceramics and organic polymers on the nanometric scale (tsuru 1997 ; chen 1999 ; sanchez 2005 ; colilla 2006 ; vallet - reg 2006a). star gels have been recently reported as alternative materials for bone tissue regeneration because they combine the good mechanical properties of certain organic - inorganic hybrids with the bioactivity of conventional glasses (manzano 2006 ; vallet - reg 2006b). however, much research effort has been committed to the investigation of ordered mesoporous silica materials in the biomedical field for two main reasons : their capability to regenerate bone tissue (vallet - reg 2006c, 2006d) combined with their drug delivery possibilities (vallet - reg 2006e, 2007a). when these silica - based ordered mesoporous materials are exposed to the physiological environment, a series of chemical reactions take place in the material - living tissue interface, which lead to the material incorporation into the living tissue. those processes are confirmed through the nucleation and growth on the bioceramic surface of a layer of carbonated hydroxyapatite which is analogous to the mineral phase of bone tissues (vallet - reg 2004a). recently, much research effort has been devoted to the design of mesoporous matrices with appropriated structural, textural and chemical properties in order to accelerate the formation of the apatite - like layer (izquierdo - barba 2005a ; vallet - reg 2005). the open texture and outstanding textural properties of mesoporous materials have inspired the usage of this type of materials as controlled delivery systems of biologically active molecules (vallet - reg 2001b). in fact, their high pore volume permits to host a large amount of a determined biologically active molecule. also their ordered pore network allows a fine control of the molecule load and release kinetics. since molecules adsorption into the mesopores is a surface phenomenon, their high surface area will also favor the adsorption of a large amount of molecules into their mesopores. and the last, but no the least, is the possibility of functionalizing the silanol - containing surface with a selected organic group depending on the molecule to be adsorbed to allow a better control over molecule loading and release. this double perspective of the mesoporous materials, tissue regeneration and drug delivery, has promoted the research of these materials for biomedical applications in the last few years (vallet - reg 2008 ; izquierdo - barba 2008). in fact, the outstanding properties of silica - based ordered mesoporous materials make them suitable to be used as starting materials for the further design of scaffolds for bone tissue engineering. the regular repeating mesoporous structures of these silica - based mesoporous materials has motivated the adsorption in their pores and subsequent release of a large variety of biologically active species such as proteins, polypeptides or amino acids. (yiu 2001a ; deere 2002 ; balas 2008). within their possible biomedical applications, the case of protein delivery systems using serum albumins should be highlighted (vallet - reg 2007b) because these proteins represent one of the major components in plasma proteins in humans. albumin is usually composed of a single - chain of 582 amino acids with an average length of 10 nm and width of 6 nm (peters 1995 ; sugio 1999 ; rcsb 2008). besides contributing to colloid osmotic blood pressure and to the maintenance of the blood ph, the most outstanding property of albumin is its ability to bind reversibly an incredible variety of ligands. as a consequence, this multifunctional transport protein can be used as carrier or reservoir of certain polypeptides with special interest in osseous regeneration technologies. therefore, albumin could store, protect, and deliver determined peptides useful for bone regeneration to specific places. moreover, albumins are also capable of binding a wide variety of drugs than can be delivered to sites of pharmacological action (carter 1994). several proteins have been demonstrated to retain their functionality without being denatured inside the frameworks of silica - based mesoporous materials (deere 2002 ; cheng 2003 ; lei 2004 ; vinu 2004 ; hartmann 2005 ; katiyar 2005 ; lee 2006 ; slowing 2007). these findings open up many expectations for the research in the adsorption of proteins and other biologically active agents into mesoporous silicas. the adsorption and release characteristics of each porous material depend on the physicochemical properties of the individual material. among those properties, it should be highlighted the pore diameter, surface area, and pore volume, which are critically reviewed here. to achieve this task, it is necessary to look into the synthesis conditions of these materials, which modulate the physicochemical properties of each structure. silica - based ordered mesoporous materials are synthesized using a surfactant templating method (figure 1) and present ordered porous structures with narrow pore size distributions and some of them with thick walls, which enhance their stability. they also show large surface areas and large pore volumes. in the early 1990s, japanese researchers (yanagisawa 1990 ; inagaki 1993) and mobil corporation research and development scientists (kresge 1992) for the first time reported the synthesis of novel periodic mesostructured materials, known as ksw - n and m41s family, respectively. these materials are characterized by regular arrays of uniform channels, whose dimensions can be tailored through the choice of surfactants, additives and synthesis conditions in the so - called liquid crystal templating mechanism (beck 1992). this process is based on the formation of liquid crystals in mixtures of polar solvents and surfactants with a non - polar tail group. the formation of the liquid crystals is as follows : an increasing amount of surfactant molecules is dissolved in an aqueous solution, and when surfactant concentration reaches the critical micellar concentration (cmc), the surfactant molecules cluster together as micelles. these micelles are formed because the hydrophobic tails of the surfactant tend to congregate while their hydrophilic heads are procuring protection in water (figure 1). the final mesostructure of the material will depend on the organization of the surfactant molecules into the micellar liquid crystals which act as templates for the formation of the mesoporous materials. these liquid crystal structures depend on the composition and chemical nature of the surfactant, and also on the solution mixture conditions, such as surfactant concentration, ph, temperature, the presence of additives, etc. in the final step of the synthetic process, once the silica source has condensed around the micelles, the surfactant is removed by thermal degradation or solvent extraction. this surfactant removal gives rise to a network of cavities within the silica framework that governs the physicochemical properties of the material. different mesoporous structures have been developed in the last few years as a consequence of different modifications in the synthetic procedure. among them, the most representative and employed materials are mcm - n (mobil composition of matter) series (beck 1992 ; kresge 1992 ; firouzi 1997 ; zhang 1997 ; kruk 2001 ; kaneda 2002), sba - n (santa barbara materials) series (zhao 1998 ; ravikovitch 2002a, 2002b), msu - n (michigan state university) series (bagshaw 1995), kit - n (korean advanced institute of science and technology) series (ryoo 1996), fsm - n (folded sheet material) series (inagaki 1996), and ams - n (anionic surfactant templated mesoporous silica) series (che 2003). in general, silica - based ordered mesoporous materials display exceptional properties, such as stable mesoporous structure, high surface area (ca 1000 m / g), large pore volume (ca 1 cm / g), regular and tunable pore size (250 nm), homogeneous pore morphology, non - toxic and biocompatible behavior, and the possibility of undergoing chemical functionalization of pore walls with different organic groups. in fact, these inorganic mesoporous materials offer the possibility of tuning the chemical properties of their surfaces to achieve the desired properties (hoffmann 2006). two major methods of producing functionalized materials have been widely used : direct functionalization (antochshuk 2000), which involves the addition of a trialkoxysilane with the selected functional group to the reaction mixture during the synthesis process ; and post - synthesis functionalization (liu 1998), which involves the grafting of the functional group onto the mesoporous material after surfactant removal. the direct functionalization method, also known as the co - condensation process, presents some advantages like a homogeneous dispersion of the functional group, retention of the width of the pores of the original framework, and the presence of available silanol groups for the adsorbates. however, there are some drawbacks like the possibility of absence of the functional groups on the surface of the material, the possible loss of structure and order of the final structure, and the need of removing the surfactant by solvent extraction rather than by calcination, which could lead to an incomplete removal of the surfactant molecules. on the other hand, the post - synthesis functionalization method presents the advantages of retention of the order and structure, and the sureness that the functional groups will be located on the surface of the pore walls. though this pathway means an extra step in the synthetic process and a reduction in the pore diameter, and also it might present a heterogeneous distribution of the grafted groups, it brings a noticeable change in the adsorption characteristics of the silica surface as well as in its polarity. the chemical modification of the pore walls would be selected depending on the molecule to be adsorbed, taking into account the desired load and release kinetics. since 2001, when mcm-41 was proposed for the first time as controlled delivery system (vallet - reg 2001b), different mesoporous matrices have been tested as delivery systems of several drugs, such as ibuprofen (muoz 2003 ; izquierdo - barba 2005b ; manzano 2008), gentamicin (xue 2004 ; doadrio 2006), amoxicillin (vallet - reg 2004b), erythromycin (izquierdo - barba 2005b ; doadrio 2006), vancomycin (yang 2005), naproxen (cavallaro 2004), aspirin (zeng 2005 ; zhu 2005), diflunisal (yang 2005), captopril (qu 2006), and alendronate (balas 2006 ; nieto 2008). moreover, mesoporous silicas have been also evaluated as carriers of other biologically active species, such as proteins, eg, bovine serum albumin [bsa ] (song 2005 ; vallet - reg 2007b) and certain amino acids, eg, l - tryptophan (l - trp) (balas 2008). the textural properties of silica - based ordered mesoporous materials seem to govern the loading and release of biologically active molecules. therefore, the influence of pore diameter, surface area, and pore volume in molecule adsorption and delivery kinetics will be tackled and critically discussed in the following sections. moreover, organic modification of silica walls with different functional groups to achieve a better control over molecule loading and release rate will be also described. the adsorption of molecules into silica - based ordered mesoporous materials is a size - selective process and consequently, the mesopore diameter determines the size of the molecule to be hosted. that is, if the molecule is smaller in size than the pore opening, it would have access to the large internal surface area and mesoporous volume of the material. on the contrary, usually, the molecule - loading process is carried out by soaking the mesoporous carrier in a highly concentrated molecule solution. hence, the adsorptive properties of mesoporous materials will determine the amount of adsorbate loaded. therefore, considering that the size of common drugs falls into the nanometer scale and that mesopore diameters can be tuned from 1.5 nm to several tens of nanometers, it seems reasonable to think that mesoporous matrices are able to host a wide range of biologically active molecules, ranging from small drugs to macromolecules such as large - size proteins. pore diameter has been probed to act as a drug - release rate modulator. when mcm-41 was reported for the first time as a drug delivery system (vallet - reg 2001b), several cationic surfactants with different chain lengths thus, the surfactant with the longest chain led to the mcm-41 with the largest pore diameter. ibuprofen was chosen as the model drug and drug loading and release studies were carried out. loading tests showed that the mcm-41 with the largest pore size released 68% of the loaded drug after 24 h into a simulated body fluid. on the contrary, the mcm-41 with the smallest pore diameter released only 55% of the loaded drug after the same time period. further studies confirmed the influence of pore size on drug delivery rate (horcajada 2004). in this research, cationic surfactants with hydrocarbon chains of different lengths were used as structure directing agents, leading to mcm-41 materials with diverse mesopore diameters, ranging from 2.5 nm (short - chain surfactants) to 3.6 nm (long - chain surfactants), as displayed in table 1. the resulting release parameters, which are summarized in table 1, revealed that the greater the mesopore diameter, the larger the amount of ibuprofen released. pore diameter is a limiting factor in molecule adsorption when the confinement of really large molecules, such as proteins and other biologically active molecules, is targeted. therefore, the adsorption of globular proteins on mesoporous mcm-41 (with pore diameters ranging from 2 to 5 nm) has been reported in the literature (deere 2002). in general, proteins with hydrodynamic dimensions larger than the mesopore diameter were adsorbed on the outer surface of mcm-41 (katiyar 2005). for this reason, when the confinement of proteins into mesoporous matrices is targeted, large pore mesoporous materials should be employed. wright (yiu 2001b) investigated the influence of protein dimensions on the adsorption into sba-15 mesoporous molecular sieve, whose silica walls were organically modified using thiol groups. for this purpose, a series of proteins with molecular weights ranging from 12000 to 76000 u were used to investigate adsorption on sba-15 materials. the structures of the employed proteins together with their dimensions in nanometers (rcsb 2008) are displayed in figure 2. further adsorption studies revealed that the proteins with the smallest sizes, ie, cytochrome c, lysozyme, myoglobin, and -lactoglobulin, showed significant adsorption. on the contrary, the proteins with the largest sizes, ie, conalbumin, serum albumin and ovalbumin were excluded from the internal surfaces of thiol - functionalized sba-15. this fact agrees with the sieving expected from the 5.1 nm pore size of thiol - functionalized sba-15 when compared to the proteins dimensions. moreover, the exclusion of ovalbumin (4.0 5.0 7.0 nm), with dimensions quite close to thiol - functionalized sba-15 matrix, indicates that this size selectivity is rigorous and that there are very few pores appreciably larger than the average pore size. it should be remarked that the maximum amounts of protein loaded, expressed as a volume percent of the available internal pore volume (5% for -lactoglobulin, 15% for myoglobin, and 43% for cytochrome c) showed that the protein molecules were adsorbed within the mesopores and not only on the external surfaces. from the above results it can be deduced that when the confinement of large size proteins is the aim, large pore mesoporous matrices are needed. this fact inspired the idea of using sba-15 as a mesoporous carrier employing different hydrothermal treatments during the synthesis to wide the pore diameter of sba-15 (vallet - reg 2007b). hence, pore diameters ranging from 8.2 nm to 11.4 nm were obtained for sba-15 materials submitted to hydrothermal treatments periods ranging from 1 to 7 days (figure 3a). moreover, bsa loading dependence on sba-15 diameter was observed, as displayed in figure 3b. hence, the amount of bsa loaded was 15%, 23%, 24%, and 27% (weight percentage) for sba-15 exhibiting pore diameters of 8.2, 9.5, 10.5, and 11.4 nm, respectively. with the aim of promoting host - guest sba-15-protein interaction, an organic modification of silica surface was performed using aminopropyl groups and following the post - synthesis method (vallet - reg 2007b). thus, the amino groups of sba-15 modified materials would undergo attracting electrostatic interactions with the carboxylic fraction of amide groups from the protein. as mentioned before the bsa molecule is just on the limit of the mesopore dimensions, and thus, after amino - functionalization the amount of bsa loaded decreased compared to unmodified matrices (see table in figure 3c). however, the bsa loading on amino - modified sba-15 matrices underwent a behavior comparable to unmodified - matrices in terms of loading increment as the pore size increased. the amino functionalization of sba-15 had a noticeable influence on bsa delivery kinetics (figure 3d). the bsa release from pure silica mesopore surfaces essentially showed a burst profile, where more than 90% of the adsorbed protein was released within the initial 24 h of tests. the rest of the adsorbed protein was linearly released up to complete delivery in 192 h in all tested materials, regardless of the hydrothermal treatment carried out for synthesis. however, amino - modified sba-15 materials showed an incomplete release of the protein from the mesopores in all cases. this partial protein retention was attributed to the strong attracting interaction of silica walls amine groups with the protein. after 192 h, the released protein ranged from 25% (sba-15 - 7d - nh2) up to 60% (sba-15 - 3d - nh2) of the initially loaded amount of protein. as an illustrative example, figure 3d shows bsa release profiles of sba-15 submitted to 7 days of hydrothermal treatment. therefore, the pore size has been revealed as a key factor governing the adsorption of proteins in mesoporous materials. the pore size should be noticeably larger than the protein to allow the diffusion of the protein into the mesopores. however, once the protein is adsorbed, the ruling factor on the release kinetics has been shown to be the organic functionalization, due to the host - guest attracting interactions. the adsorption of biologically active molecules into meso - porous matrices is governed by the chemical interaction between silanol groups covering the silica surface and the functional groups of the guest molecule. therefore, surface area is expected to determine the amount of molecules confined into the silica matrix. this fact was probed when mcm-41 mesoporous matrices exhibiting different surfaces areas, sbet, ranging from 768 to 1157 m / g, which were synthesized using surfactants with diverse length - chains, were employed as ibuprofen delivery systems (horcajada 2004). the amount of ibuprofen loaded was found to depend on the surface area, as graphically displayed in figure 4. as expected, there was an increase in ibuprofen loading amount with the enlargement in the surface area values. surface area influence was also shown when alendronate, a potent bisphosphonate used in osteoporosis treatments, was confined into mcm-41 and sba-15 mesoporous matrices (balas 2006). both mesoporous matrices exhibited the same structure (2d hexagonal and p6 mm symmetry) but different surface areas, sbet of 1157 and 719 m / g for mcm-41 and sba-15, respectively. when both matrices were loaded with alendronate under the same conditions, the maximum amounts of drug loaded were 14% and 8% for mcm-41 and sba-15, respectively. this fact showed the clear dependence of maximum drug load on the matrix surface area in agreement with results reported later in the literature (qu 2006). mcm-41 and sba-15 were functionalized using amino groups with the aim of increasing the attracting host - guest interactions, and alendronate loading and release studies were carried out (balas 2006). the amount of alendronate loaded followed the same trend that unmodified materials, ie mcm-41-nh2 loaded more alendronate (37%) than sba-15-nh2 (22%) as a result of the higher surface area of mcm-41 (table 2). in addition, it should be noticed that the amount of alendronate loaded in modified materials was almost 3 times larger than those of unmodified materials. this fact can be explained by the stronger attracting interactions between phosphonate groups and amino groups of modified materials compared to the weaker interaction taking place between phosphonate groups and silanol groups from unmodified matrices (figure 5). regarding alendronate release, it should be highlighted that in all cases an initial burst effect was observed. this fast release of the drug could be due to several reasons : alendronate that could be adsorbed in the outer surface of the matrix or by the existent alendronate gradient between mesoporous matrix and delivery medium. therefore, after 24 h of assay, 28% of the total amount of alendronate adsorbed was delivered from mcm-41-nh2, whereas at the same time this percentage was 58% for unmodified mcm-41 (table 2). on the other hand, 11% of the total alendronate loaded was released after 24 h of assay from sba-15-nh2 matrix, whereas 55% of alendronate loaded was delivered after this time from sba-15. after such burst effect, the alendronate was released to the medium in a sustained manner following first order kinetics for unmodified and modified mcm-41 materials and zero order or linear kinetics for unmodified and modified sba-15 materials. moreover, the increase in the total drug delivery time in functionalized materials compared with unmodified matrices (table 2) can be ascribed to the stronger interactions between phosphonate groups from alendronate and amino groups covering the pore walls. this work evidences that the amount of alendronate adsorbed and drug delivery rate can be controlled by appropriately modifying the mesoporous carriers with amino groups. in this sense, organic functionalization allows a higher control over drug loading and release kinetics. thus, surface area was found to be an important factor in the loading capacity of these mesoporous materials. it was found that the higher the surface area, the higher the drug adsorption. adsorption of biologically active molecules is a surface phenomenon that takes place by attracting interactions between the silanol groups in the pore walls (or functional groups in the case of functionalized materials) and functional groups of the guest molecule. thus, the amount of molecules adsorbed will depend on the pore diameter and surface area as the limiting factor. however, when the confinement of really large molecules is aimed, such as large - size and large - volume proteins, pore volume seems to play a key role in molecule adsorption. recently, in an effort to promote the loading of large biomolecules, mesostructured cellular foams (mesocellular foams, mcfs) have been employed as host matrices for the adsorption of different enzymes and proteins (han 1999 ; zhang 2007). the synthesis of mcfs type materials is carried out by employing triblock copolymers and introducing a swelling agent, such as 1,3,5-trimethylbenzene (tmb) into the structure directing template (schmidt - winkel 1999). tem images of mcf compared to mcm-41 and sba-15 mesoporous materials are displayed in figure 6. the characteristic two - dimensional hexagonal arrays of pores of mcm-41 and sba-15 mesoporous matrices can be observed. moreover, mcf exhibits three - dimensional, continuous, ultra - large pore mesoporous structures with large spherical cells interconnected by uniform windows (see arrows in figure 6). n2 adsorption measurements revealed that mcm-41 and sba-15 mesoporous materials exhibit type iv isotherms, typical of ordered mesoporous materials. the shape of the hysteresis loops points to cylindrical mesopores with very narrow pore size distributions (figure 6) (gregg 1982). in the case of mcfs, the sharp rise in the adsorption / desorption isotherms at relative pressures close to 1 points to the existence of large mesopores in these materials (gregg 1982). the pore diameter of mcm-41 and sba-15 materials are ca 3 and 9 nm, respectively. the diameter of spherical cells and windows can be modulated by adjusting the amount of swelling agents and the synthesis temperature (schmidt - winkel 1999). when the confinement of large - size bsa is targeted, mesoporous matrices exhibiting large pore diameters are needed. thus, sba-15 and mcf before and after functionalization using amino groups where tested as delivery systems for bsa. the amount of bsa loaded in mcf materials was higher (24%) than in sba-15 matrices (15%), due to the higher pore volume in the former (table 3). it should be highlighted that the surface area is not the determinant factor that governs protein adsorption, because it exhibits the opposite trend to protein loading (table 3). the amount of bsa loaded after functionalization followed the same trend that unmodified materials, ie, mcf - nh2 loaded more bsa (27%) than sba-15-nh2 (10%), as a result of the higher pore volume of the former. the increase in bsa loading after functionalization of mcf matrix can be attributed to the higher attracting electrostatic interactions of amino groups with the amide groups of protein. however, as it was previously mentioned, organic functionalization always leads to a decrease in pore diameter (table 3). the pore diameter of sba-15 (8.5 nm) is just on the limit of bsa size and therefore, after functionalization the pore diameter decreased to 6.9 nm and consequently, a decrease in the amount of bsa adsorbed was observed. on the other hand, as it can be observed in figure 7, unmodified matrices exhibited an initial burst effect when almost 60% of the protein was quickly released to the delivery medium and then the loaded protein was delivered in a controlled fashion. on the contrary, the initial burst in amino - modified matrices was drastically reduced to ca 10%, and more than 80% of the loaded bsa was released to the medium in a sustained manner. after 24 h of assay, 74% of the total bsa loaded in sba-15 was released to the medium, whereas after the same time only 27% was released to the medium from sba-15-nh2 matrix. moreover, after 24 h of delivery test 62% of the loaded bsa was released from unmodified mcf material and this percentage decreased to 22% after functionalization with amino groups. this research work demonstrates that bsa can be successfully adsorbed into large - volume mesoporous matrices exhibiting the appropriate pore diameter to allow protein confinement. therefore, when the loading of large - size and large - volume biologically active molecules is targeted, pore diameter acts as the limiting factor and pore volume determines the amount of molecule hosted. the adsorption of molecules into silica - based ordered mesoporous materials is a size - selective process and consequently, the mesopore diameter determines the size of the molecule to be hosted. that is, if the molecule is smaller in size than the pore opening, it would have access to the large internal surface area and mesoporous volume of the material. on the contrary, usually, the molecule - loading process is carried out by soaking the mesoporous carrier in a highly concentrated molecule solution. hence, the adsorptive properties of mesoporous materials will determine the amount of adsorbate loaded. therefore, considering that the size of common drugs falls into the nanometer scale and that mesopore diameters can be tuned from 1.5 nm to several tens of nanometers, it seems reasonable to think that mesoporous matrices are able to host a wide range of biologically active molecules, ranging from small drugs to macromolecules such as large - size proteins. pore diameter has been probed to act as a drug - release rate modulator. when mcm-41 was reported for the first time as a drug delivery system (vallet - reg 2001b), several cationic surfactants with different chain lengths were employed, which led to mcm-41 materials with different pore sizes. thus, the surfactant with the longest chain led to the mcm-41 with the largest pore diameter. ibuprofen was chosen as the model drug and drug loading and release studies were carried out. loading tests showed that the mcm-41 with the largest pore size released 68% of the loaded drug after 24 h into a simulated body fluid. on the contrary, the mcm-41 with the smallest pore diameter released only 55% of the loaded drug after the same time period. further studies confirmed the influence of pore size on drug delivery rate (horcajada 2004). in this research, cationic surfactants with hydrocarbon chains of different lengths were used as structure directing agents, leading to mcm-41 materials with diverse mesopore diameters, ranging from 2.5 nm (short - chain surfactants) to 3.6 nm (long - chain surfactants), as displayed in table 1. the resulting release parameters, which are summarized in table 1, revealed that the greater the mesopore diameter, the larger the amount of ibuprofen released. pore diameter is a limiting factor in molecule adsorption when the confinement of really large molecules, such as proteins and other biologically active molecules, is targeted. therefore, the adsorption of globular proteins on mesoporous mcm-41 (with pore diameters ranging from 2 to 5 nm) has been reported in the literature (deere 2002). in general, proteins with hydrodynamic dimensions larger than the mesopore diameter were adsorbed on the outer surface of mcm-41 (katiyar 2005). for this reason, when the confinement of proteins into mesoporous matrices is targeted, large pore mesoporous materials should be employed. wright (yiu 2001b) investigated the influence of protein dimensions on the adsorption into sba-15 mesoporous molecular sieve, whose silica walls were organically modified using thiol groups. for this purpose, a series of proteins with molecular weights ranging from 12000 to 76000 u were used to investigate adsorption on sba-15 materials. the structures of the employed proteins together with their dimensions in nanometers (rcsb 2008) are displayed in figure 2. further adsorption studies revealed that the proteins with the smallest sizes, ie, cytochrome c, lysozyme, myoglobin, and -lactoglobulin, showed significant adsorption. on the contrary, the proteins with the largest sizes, ie, conalbumin, serum albumin and ovalbumin were excluded from the internal surfaces of thiol - functionalized sba-15. this fact agrees with the sieving expected from the 5.1 nm pore size of thiol - functionalized sba-15 when compared to the proteins dimensions. moreover, the exclusion of ovalbumin (4.0 5.0 7.0 nm), with dimensions quite close to thiol - functionalized sba-15 matrix, indicates that this size selectivity is rigorous and that there are very few pores appreciably larger than the average pore size. it should be remarked that the maximum amounts of protein loaded, expressed as a volume percent of the available internal pore volume (5% for -lactoglobulin, 15% for myoglobin, and 43% for cytochrome c) showed that the protein molecules were adsorbed within the mesopores and not only on the external surfaces. from the above results it can be deduced that when the confinement of large size proteins is the aim, large pore mesoporous matrices are needed. this fact inspired the idea of using sba-15 as a mesoporous carrier employing different hydrothermal treatments during the synthesis to wide the pore diameter of sba-15 (vallet - reg 2007b). hence, pore diameters ranging from 8.2 nm to 11.4 nm were obtained for sba-15 materials submitted to hydrothermal treatments periods ranging from 1 to 7 days (figure 3a). moreover, bsa loading dependence on sba-15 diameter was observed, as displayed in figure 3b. hence, the amount of bsa loaded was 15%, 23%, 24%, and 27% (weight percentage) for sba-15 exhibiting pore diameters of 8.2, 9.5, 10.5, and 11.4 nm, respectively. with the aim of promoting host - guest sba-15-protein interaction, an organic modification of silica surface was performed using aminopropyl groups and following the post - synthesis method (vallet - reg 2007b). thus, the amino groups of sba-15 modified materials would undergo attracting electrostatic interactions with the carboxylic fraction of amide groups from the protein. as mentioned before the bsa molecule is just on the limit of the mesopore dimensions, and thus, after amino - functionalization the amount of bsa loaded decreased compared to unmodified matrices (see table in figure 3c). however, the bsa loading on amino - modified sba-15 matrices underwent a behavior comparable to unmodified - matrices in terms of loading increment as the pore size increased. the amino functionalization of sba-15 had a noticeable influence on bsa delivery kinetics (figure 3d). the bsa release from pure silica mesopore surfaces essentially showed a burst profile, where more than 90% of the adsorbed protein was released within the initial 24 h of tests. the rest of the adsorbed protein was linearly released up to complete delivery in 192 h in all tested materials, regardless of the hydrothermal treatment carried out for synthesis. however, amino - modified sba-15 materials showed an incomplete release of the protein from the mesopores in all cases. this partial protein retention was attributed to the strong attracting interaction of silica walls amine groups with the protein. after 192 h, the released protein ranged from 25% (sba-15 - 7d - nh2) up to 60% (sba-15 - 3d - nh2) of the initially loaded amount of protein. as an illustrative example, figure 3d shows bsa release profiles of sba-15 submitted to 7 days of hydrothermal treatment. therefore, the pore size has been revealed as a key factor governing the adsorption of proteins in mesoporous materials. the pore size should be noticeably larger than the protein to allow the diffusion of the protein into the mesopores. however, once the protein is adsorbed, the ruling factor on the release kinetics has been shown to be the organic functionalization, due to the host - guest attracting interactions. the adsorption of biologically active molecules into meso - porous matrices is governed by the chemical interaction between silanol groups covering the silica surface and the functional groups of the guest molecule. therefore, surface area is expected to determine the amount of molecules confined into the silica matrix. this fact was probed when mcm-41 mesoporous matrices exhibiting different surfaces areas, sbet, ranging from 768 to 1157 m / g, which were synthesized using surfactants with diverse length - chains, were employed as ibuprofen delivery systems (horcajada 2004). the amount of ibuprofen loaded was found to depend on the surface area, as graphically displayed in figure 4. as expected, there was an increase in ibuprofen loading amount with the enlargement in the surface area values. surface area influence was also shown when alendronate, a potent bisphosphonate used in osteoporosis treatments, was confined into mcm-41 and sba-15 mesoporous matrices (balas 2006). both mesoporous matrices exhibited the same structure (2d hexagonal and p6 mm symmetry) but different surface areas, sbet of 1157 and 719 m / g for mcm-41 and sba-15, respectively. when both matrices were loaded with alendronate under the same conditions, the maximum amounts of drug loaded were 14% and 8% for mcm-41 and sba-15, respectively. this fact showed the clear dependence of maximum drug load on the matrix surface area in agreement with results reported later in the literature (qu 2006). mcm-41 and sba-15 were functionalized using amino groups with the aim of increasing the attracting host - guest interactions, and alendronate loading and release studies were carried out (balas 2006). the amount of alendronate loaded followed the same trend that unmodified materials, ie mcm-41-nh2 loaded more alendronate (37%) than sba-15-nh2 (22%) as a result of the higher surface area of mcm-41 (table 2). in addition, it should be noticed that the amount of alendronate loaded in modified materials was almost 3 times larger than those of unmodified materials. this fact can be explained by the stronger attracting interactions between phosphonate groups and amino groups of modified materials compared to the weaker interaction taking place between phosphonate groups and silanol groups from unmodified matrices (figure 5). regarding alendronate release, it should be highlighted that in all cases an initial burst effect was observed. this fast release of the drug could be due to several reasons : alendronate that could be adsorbed in the outer surface of the matrix or by the existent alendronate gradient between mesoporous matrix and delivery medium. therefore, after 24 h of assay, 28% of the total amount of alendronate adsorbed was delivered from mcm-41-nh2, whereas at the same time this percentage was 58% for unmodified mcm-41 (table 2). on the other hand, 11% of the total alendronate loaded was released after 24 h of assay from sba-15-nh2 matrix, whereas 55% of alendronate loaded was delivered after this time from sba-15. after such burst effect, the alendronate was released to the medium in a sustained manner following first order kinetics for unmodified and modified mcm-41 materials and zero order or linear kinetics for unmodified and modified sba-15 materials. moreover, the increase in the total drug delivery time in functionalized materials compared with unmodified matrices (table 2) can be ascribed to the stronger interactions between phosphonate groups from alendronate and amino groups covering the pore walls. this work evidences that the amount of alendronate adsorbed and drug delivery rate can be controlled by appropriately modifying the mesoporous carriers with amino groups. in this sense, organic functionalization allows a higher control over drug loading and release kinetics. thus, surface area was found to be an important factor in the loading capacity of these mesoporous materials. it was found that the higher the surface area, the higher the drug adsorption. as previously commented, adsorption of biologically active molecules is a surface phenomenon that takes place by attracting interactions between the silanol groups in the pore walls (or functional groups in the case of functionalized materials) and functional groups of the guest molecule. thus, the amount of molecules adsorbed will depend on the pore diameter and surface area as the limiting factor. however, when the confinement of really large molecules is aimed, such as large - size and large - volume proteins, pore volume seems to play a key role in molecule adsorption. recently, in an effort to promote the loading of large biomolecules, mesostructured cellular foams (mesocellular foams, mcfs) have been employed as host matrices for the adsorption of different enzymes and proteins (han 1999 ; zhang 2007). the synthesis of mcfs type materials is carried out by employing triblock copolymers and introducing a swelling agent, such as 1,3,5-trimethylbenzene (tmb) into the structure directing template (schmidt - winkel 1999). tem images of mcf compared to mcm-41 and sba-15 mesoporous materials are displayed in figure 6. the characteristic two - dimensional hexagonal arrays of pores of mcm-41 and sba-15 mesoporous matrices can be observed. moreover, mcf exhibits three - dimensional, continuous, ultra - large pore mesoporous structures with large spherical cells interconnected by uniform windows (see arrows in figure 6). n2 adsorption measurements revealed that mcm-41 and sba-15 mesoporous materials exhibit type iv isotherms, typical of ordered mesoporous materials. the shape of the hysteresis loops points to cylindrical mesopores with very narrow pore size distributions (figure 6) (gregg 1982). in the case of mcfs, the sharp rise in the adsorption / desorption isotherms at relative pressures close to 1 points to the existence of large mesopores in these materials (gregg 1982). pore size distributions of different mesoporous matrices are also shown in figure 6. the pore diameter of mcm-41 and sba-15 materials are ca 3 and 9 nm, respectively. the diameter of spherical cells and windows can be modulated by adjusting the amount of swelling agents and the synthesis temperature (schmidt - winkel 1999). when the confinement of large - size bsa is targeted, mesoporous matrices exhibiting large pore diameters are needed. thus, sba-15 and mcf before and after functionalization using amino groups where tested as delivery systems for bsa. the amount of bsa loaded in mcf materials was higher (24%) than in sba-15 matrices (15%), due to the higher pore volume in the former (table 3). it should be highlighted that the surface area is not the determinant factor that governs protein adsorption, because it exhibits the opposite trend to protein loading (table 3). the amount of bsa loaded after functionalization followed the same trend that unmodified materials, ie, mcf - nh2 loaded more bsa (27%) than sba-15-nh2 (10%), as a result of the higher pore volume of the former. the increase in bsa loading after functionalization of mcf matrix can be attributed to the higher attracting electrostatic interactions of amino groups with the amide groups of protein. however, as it was previously mentioned, organic functionalization always leads to a decrease in pore diameter (table 3). the pore diameter of sba-15 (8.5 nm) is just on the limit of bsa size and therefore, after functionalization the pore diameter decreased to 6.9 nm and consequently, a decrease in the amount of bsa adsorbed was observed. on the other hand, as it can be observed in figure 7, unmodified matrices exhibited an initial burst effect when almost 60% of the protein was quickly released to the delivery medium and then the loaded protein was delivered in a controlled fashion. on the contrary, the initial burst in amino - modified matrices was drastically reduced to ca 10%, and more than 80% of the loaded bsa was released to the medium in a sustained manner. after 24 h of assay, 74% of the total bsa loaded in sba-15 was released to the medium, whereas after the same time only 27% was released to the medium from sba-15-nh2 matrix. moreover, after 24 h of delivery test 62% of the loaded bsa was released from unmodified mcf material and this percentage decreased to 22% after functionalization with amino groups. this research work demonstrates that bsa can be successfully adsorbed into large - volume mesoporous matrices exhibiting the appropriate pore diameter to allow protein confinement. therefore, when the loading of large - size and large - volume biologically active molecules is targeted, pore diameter acts as the limiting factor and pore volume determines the amount of molecule hosted. in this work it has been shown that available pore volume and surface play a key role in the protein loading capacity of silica - based ordered mesoporous materials. however, if the pore opening is not wide enough, access of the protein molecules to much of this surface area and pore volume will be restricted. ideally, if large biomolecules such as certain proteins are targeted to be adsorbed in ordered mesoporous materials, these matrices should present several characteristics : pore size large enough to allow diffusion into the pores, surface area as high as possible to allow a large retention percentage, and pore volume as high as possible to offer available space into the mesopores to be filled by the protein. recent advances in nanotechnology offer the possibility of appropriately tailoring the structural and textural properties of mesoporous silicas depending on the desired application. the outstanding features of silica - based ordered mesoporous materials open up promising expectations in the biomedical field because they can be employed as starting materials for the further design of scaffolds for bone tissue regeneration. | research in the development of new bioceramics with local drug delivery capability for bone regeneration technologies is receiving great interest by the scientific biomedical community. among bioceramics, silica - based ordered mesoporous materials are excellent candidates as bone implants due to two main reasons : first, the bioactive behavior of such materials in contact with simulated body fluids, ie, a carbonate hydroxyapatite similar to the mineral phase of bone is formed onto the materials surfaces. second, their capability of acting as delivery systems of a large variety of biologically active molecules, including drugs to treat bone infection, inflammation or diseases, and molecules that promote bone tissue regeneration, such as peptides, proteins, growth factors, and other osteogenic agents. the recent chemical and technological advances in the nanometer scale has allowed the design of mesoporous silicas with tailored structural and textural properties aimed at achieving a better control over molecule loading and release kinetics. moreover organic modification of mesoporous silica walls has been revealed as a key strategy to modulate molecule adsorption and delivery rates. |
the reconstruction of the distal dorsal fingers is difficult as the fingertip skin is hard and inflexible.[14 ] we have experienced cases of minor distal dorsal finger skin defects due to digital mucous cyst (dmc) excision. in addition, some studies on the operative procedures of digital dorsal finger reconstruction have also been conducted.[16 ] however, these methods cause long and visible scars [14 ] or are not suitable for the reconstruction of small defects. we felt a simpler and easier method was needed ; thus, we decided to treat distal dorsal skin defects after dmc resection using lateral finger flap (lff). this flap can be harvested under local anesthesia and our method can repair defects easily and simply after the resection of tumors of the nail matrix. from 2006 through 2014, we treated nine patients (five males and four females) with an average age of 59.5 years (5270 years). surgery was performed under digital nerve block using 1% lidocaine solution (astrazeneca japan, osaka, japan). the size of the skin defect was detected, the skin defect was measured and the lff was designed at the volar side of the finger just below the mid - lateral line (figure 1), and the incision was made on the distal and dorsal side. the lff was harvested with fat from the distal side and was transferred to the defect using 5 - 0 ethilon suture (ethicon, baltimore, md). the donor site was closed directly, also by using 5 - 0 ethilon suture. (a) flap design : the flap was designed just below the mid - lateral line. (b) the flap was elevated from the proximal side of the finger and harvested with fat (solid line). the skin defects were located as follows : on the thumb in one case ; the middle finger in three cases ; the ring finger in two cases ; the little finger in two cases and the third toe in one case (table 1). the average flap width was 5.9 0.9 mm (range 57 mm). although three patients had paresthesia of the finger for one month postoperatively, there was no flap necrosis, infection or hematoma. the scars and dog ear deformities were considered esthetically acceptable. in three cases, small trap - door deformity was observed. she was referred to our department because the tumor had been increasing in size and her nail showed grooving deformity. we performed tumor resection and lff transfer under digital nerve block (figure 2a and b). the flap was elevated from the distal and dorsal side and fixed to the defect (figure 2c). three years postoperatively, no tumor recurrence was observed and the dog ear deformity was considered to be esthetically acceptable. small trap - door deformity is still left. however, patient is satisfied with the result (figure 2d). although she received liquid nitrogen treatment for six months in other clinic, the tumor recurred. she was referred to our department because the tumor had been increasing in size and her nail showed grooving deformity. we performed tumor resection and lff transfer under digital nerve block (figure 2a and b). the flap was elevated from the distal and dorsal side and fixed to the defect (figure 2c). three years postoperatively, no tumor recurrence was observed and the dog ear deformity was considered to be esthetically acceptable. small trap - door deformity is still left. however, patient is satisfied with the result (figure 2d). although she received liquid nitrogen treatment for six months in other clinic, the tumor recurred. various reconstructive methods of fingertip have been reported.[14 ] the bipedicled flap transfer or rotation flap combined with skin grafting was also reported for the nail fold reconstruction and the reconstruction of distal dorsal finger defects after trauma or tumor resection was performed using digital artery island flap. however, we sometimes experience not only minor but also full - thickness defects of distal dorsal lesions that have been caused by dmc excision. reported a reconstructive procedure using rotation flap which was designed at the dorsal side of the finger, and has since commonly performed. the flap was easy to harvest ; however, a large flap was required even if the tumor was small. additionally, a long visible scar typically remained because of the flap size and location. to avoid harvesting a large flap, imran. used a rhomboid flap to reconstruct skin defects after dmc resection. however, the flap size was limited because the donor site of this flap was the groove of the distal interphalangeal joint the digital artery perforator flap transfer is a useful technique for the reconstruction of fingertip by koshima. however, different from their procedure, lff is not required to dissect digital artery perforator. they demonstrated a rich vascular network which was observed at subcutaneous tissue of the pulp and hauck. also reported this rich vascular network. recently, some authors have reported that osteophyte is an important step in treating dmc. on the other hand, kasdan. have suggested that aggressive osteophytectomy causes a decreased range of movement of the distal phalangeal joint. reported the successful treatment of dmc without osteophytectomy. instead of excising the cyst, they performed total dorsal capsulectomy. constant. reported the surgical results of skin grafting. in their study, 25% of patients who had received primary closure showed tumor recurrence, whereas only 3% of the skin grafting group showed tumor recurrence. reported tumor recurrence in only 1.4% of their patients. in our study, to prevent damage of distal phalangeal joints, we only performed cystectomy ; however, no patients in the present study experienced tumor recurrence, even after long - term follow - up. the donor - site scar of lff is linear and simple, and the scar of the pulp side as well as dog ear deformity is considered esthetically acceptable. our results suggest that lff is an easy and useful procedure for reconstructing defects after dmc excision. the authors declare that there is no conflict of interest regarding the publication of this paper. | abstractwe treated nine patients with skin defect produced by digital mucous cyst (dmc) excision on the finger and toe using lateral finger flap (lff). the postoperative scars were esthetically acceptable and no recurrence of mucous cysts was observed. our lff is a simple method to repair minor distal dorsal finger defects. |
hypertension is a common and major public health problem associated with a high level cardiovascular morbidity and mortality worldwide. it remains the major risk factor for heart failure, stroke, coronary artery disease, and chronic renal failure in nigeria. hypertension which was initially considered rare in sub - saharan africa is now a major noncommunicable disease threatening sub - saharan africa. previous studies in sub - saharan africa had shown a higher prevalence of hypertension in urban centers than in rural communities [3, 4 ], but recent studies show a growing trend in prevalence of hypertension in rural communities compared to that of the urban communities [5, 6 ]. this may be attributed to a growing increase in the age and lifestyle changes in the rural communities. prevalence of hypertension in nigeria has progressively increased from 10.113.3% and 8.9% in the late sixties to between 38.8 to 44.5% and 34.8% recently in rural and urban communities, respectively. this difference in prevalence is partly due to changes in definition of hypertension from 160/95 mmhg earlier to 140/90 mmhg in jnc vii. most of these studies were done either in the south - west or the south - east nigeria and very few were done in south - south, nigeria. as a result of these identified changes in the epidemiologic trend of hypertension and its complications, there is therefore the need to regularly conduct a survey on the prevalence of hypertension. this study was therefore conducted to find the recent prevalence of hypertension in both the rural and urban communities of akwa ibom state of nigeria and also identify other risk factors associated with hypertension. this is a cross sectional study of people in urban and rural communities for prevalence of hypertension and its predictors. one local government was then randomly selected from the 9 or 10 local governments in each of the 2 selected senatorial zones. one urban community was selected in the local government and a rural community was identified. in the urban community, radio and tv advertorials were used to invite members of the community for a free screening program for hypertension and its risk factors. in the rural community, awareness for the program was created using town criers and church announcements. the two rural communities were about 50 km apart and consist mainly of farmers while the distance between uyo and ikot ekpene, the two urban centres, is 28.6 km. the distance between the uyo urban and use abat was about 22 km while the distance between ikot ekpene urban and asiak village was about 18 km. consented participants had their sociodemographic data, including age, sex, educational status, marital status, and occupation obtained. their medical and family history of hypertension, diabetes, and renal disease were also obtained. abdominal and hip circumferences were measured using a flexible tape on a horizontal plane without compression of the skin. the blood pressure was taken using aneroid sphygmomanometer on the right arm after 10-minute rest in a sitting position. the first and fifth phases of korotkoff sounds were taken as systolic and diastolic blood pressure, respectively. blood pressure measurements were done by the same volunteer nurses and doctors in all the communities. participants had urinalysis done with combur-10 test strips and random blood sugar test using accu - check active glucometer manufactured by roche india pvt limited. diabetes was defined based on a previous history of diabetes on drugs or random plasma glucose of 11.1 mmol / l. hypertension was defined using the seventh edition of joint national committee on detection, prevention, evaluation, and treatment of high blood pressure (jncvii) of systolic bp 140 mmhg and diastolic bp 90 mmhg or patient is on drugs for control of hypertension. prior knowledge of hypertension and diabetes was defined as participants that were diagnosed hypertensive and/or diabetic before the screening. data analysis was performed using stata 10, statacorp, and college station, texas, usa. multivariate logistic regression model was built using variables with p values of < 0.25 at the univariate level or those known to have effect on blood pressure changes in a forward selection method. a receiver operator characteristic (roc) curve was used to assess the utility of the final multivariate model. the final multivariate model was adjusted for the effect of age on the relationship between location of the participants and the risk of being hypertensive. a total of 1565 participants (590 urban, 978 rural) were recruited from the screening program over this period. table 1 details the sociodemographic and clinical characteristics of the participants while table 2 compares the prevalence of cardiovascular disease risk factors in both groups. the independent risk factors for hypertension were age (6% increased risk for every one year increase), bmi (7% increased risk for every 1 kg / m increase), and proteinuria (59% increased risk for those proteinuric compared to the nonproteinuric). the prevalence of hypertension in the urban centers was lower than the rural centers (27.5% (95% ci 23.931.2%) versus 44.3% (95% ci 41.147.4%)). the awareness of personal hypertension status was low in both groups but significantly lower among the rural dwellers (table 1). an awareness of a family history of hypertension was more prevalent among the urban dwellers than in the rural populace. mean arterial blood pressure (mabp) was rising as age was increasing in both groups (figure 1). on the average, on multivariate logistic regression (table 3), there was a higher risk of being hypertensive in the rural group than the urban group after adjusting for the effects of age, sex, body mass index, diabetic status, and proteinuria status. in this study we found a higher prevalence of hypertension in the rural communities than in the urban communities, 44.3% versus 27.5% (p < 0.001). this was not consistent with previous studies which demonstrated a higher prevalence of hypertension in urban societies than in rural societies [7, 8 ]. this may be attributed to a rise in westernized life style among the rural dwellers or it may be because the urban dwellers are more likely to be aware of their blood pressure status and, therefore, less likely to come out for the screening exercise. also we found that rural dwellers were statistically older than the urban dwellers. this is because hypertension is known to increase with increasing age [8, 9 ]. there have been increasing trends in the prevalence of hypertension in the rural communities as demonstrated by recent studies ranging from 20.8% by oladapo., 23.6% by andy., to as much as 44.5% and 46.4% by ahaneku. and onwubere., respectively these may be attributed to the increasing age of the rural communities as most young people prefer to migrate to the cities for white collar jobs while retirees moved in opposite direction back to the villages. this trend appears to be alarming and efforts should be made to check it before it is too late.. this may be because they studied adult between the ages of 4070 years while we included subjects from 18 years and above. however, our study had a higher prevalence of hypertension than that of andy. done two years earlier using almost the same population. the difference between the urban and rural prevalence was maintained in this study even after predictors for hypertension such as age, obesity, sex, proteinuria, and diabetes were corrected using multivariate analysis (table 3). genders were equally distributed in both urban and rural communities, although more women turned up for the screening exercise demonstrating the general poor attitude of men towards healthcare. urban dwellers were more likely to be obese as shown by higher bmi and waist circumference than the rural population. there was no statistical significant risk of having hypertension between the male and female gender. this was not consistent with previous studies where men were found to be at a greater risk of being hypertensive [9, 13, 14 ]. this may be as a result of the relatively few numbers of males in this study. however a study by adediran. did not also find any statistically significant gender difference in tendency of being hypertensive in their study of hypertension prevalence in an urban and rural area of nigeria. age and bmi were the most important predictors of hypertension in both rural and urban communities in this study. increasing age has been found to be the most single predictor of hypertension [9, 14 ]. also bmi had been found to be positively associated with hypertension in previous studies [7, 13 ]. the number of persons diagnosed with diabetes mellitus in the urban communities was higher than the rural communities although this difference was not statistically significant. about 2.8% of the rural participants had diabetics mellitus which was lower than data from previous studies in nigeria [15, 16 ]. these epidemiologic trends indicate that the hitherto gap that existed in prevalence of hypertension between the urban - rural communities is gradually being eroded and prevention strategies must be instituted urgently. | recent studies have shown an increasing trend in the prevalence of hypertension in rural communities compared to that of the urban communities. this study was therefore carried out to determine the prevalence of hypertension and its predictors (if any) in both urban and rural communities of akwa ibom state of nigeria. subjects and method. this was a cross - sectional study of urban and rural communities of akwa ibom state for the prevalence of hypertension and its predictors. two urban cities and two rural communities were randomly selected from the three senatorial districts of the state. hypertension was defined based on the seventh report of the joint national committee on the prevention, detection, evaluation, and treatment of hypertension. results. nine hundred and seventy - eight (978) participants were recruited from rural areas and five hundred and ninety (590) from urban centers. the rural populace had higher systolic, diastolic, and mean arterial blood pressure than the urban populace (p < 0.001, < 0.002, < 0.001, resp.). the prevalence of hypertension was significantly higher in the rural populace than in the urban populace [44.3% (95% ci 41.147.4%) versus 28.6% (95% ci 24.932.3%) ]. age, bmi, and proteinuria were independent predictors of hypertension occurrence. conclusion. there is an epidemiologic change in the prevalence of hypertension in the rural communities of nigeria. |
breast cancer is the most common type of malignancy and one of the major causes of death in women worldwide. in advanced nations, breast cancer is a very frequent malignancy diagnosed among women, and in the developing nations, it is placed second to cervical cancer (1). breast cancer is also the primary cause of cancer death among women globally, responsible for around 375,000 deaths in the year 2000 (2). a total of 39,620 women died from this disease in the united states in 2013 (3). studies have identified numerous risk factors for breast cancer in women, including increasing age, personal and family history, genetic factors, race and even socio - economic factors (1, 35). breast cancer is estimated to account for 27% of all new cancer cases and 15% of cancer - related mortality in women in the usa (5). it is estimated that $ 17.2 billion has been spent on breast cancer care in the united states in 2014 (6). it is shown that a number of major developing economies such as india, china and brazil will be facing breast cancer epidemics by 2020 (7). also, breast cancer is considered as a costly disease, and inflicts a notable burden on economic resources of every nation because of its high incidence and prevalence (8). iran has the highest incidence rate of cancer in the middle east (9). in asian nations such as iran currently, the incidence and prevalence of breast cancer in iranian women is 22 per 100,000 and 120 per 100,000 respectively (11). according to the national center for cancer registration, breast cancer incidence has increased dramatically from 2001. in 2010, 23% of all cancers diagnosed in women were breast cancer cases. the incidence rate of breast cancer is estimated to be 22.09% in 100,000 women, with the age - standardized incidence rate estimated at 28.25% in 100,000 women (12). in iran, breast cancer has a leading rank compared to other types of cancer identified in females (13) comprising 24.4% of all malignancies with a crude incidence rate and asr of 17.4 and 23.1 per 100,000, respectively (14). investigations have specified that the mean age of breast cancer patients in iran is approximately 10 years younger than in western countries (1517). given that scopus covered more iranian journals (18) and also was available, we used this database. the aim of this study was to analyze iran research performance on breast cancer in national and international context, as reflected in its publications indexed in scopus database during 19912015. the current experiment was rooted from the studies of breast cancer research from iranian authors over a twenty - five - year period. data were retrieved from scopus citation database produced by elsevier. to estimate the global number of published works on breast cancer, the following string was used ; breast cancer or breast malignancy or breast tumor or mammary ductal carcinoma our main strings were keywords in title, abstract and keywords as well as iran in the affiliation field. also, the above mentioned expressions were looked for in the document search tab of scopus. the search was performed on december 31, 2015. by utilizing searching and analyzing strategies in scopus, we first searched the data, then we used scopus analyzer, and analyzed the results. also, to recover the statistics of world research in breast cancer, the key words breast cancer or breast malignancy or breast tumor or mammary ductal carcinoma were looked for in various sections, such as title, keyword and abstract, using the software of scopus search tab. from 1991 to 2015, the total number of articles about breast cancer research found in scopus, were about 353,893 articles. during the study period, 126 nations with more than 10 papers, contributed to the literature on the topic of breast cancer. the share of global publication for the top 30 most prolific nations in breast cancer research fluctuated from 0.46 to 34.57% during 19912015. the united states scored the 1 rank with a global publication share of 34.57% (122,370 papers) during 19912015, followed by the united kingdom (7.79% share, 27,584 papers), germany (5.66% share, 20,045 papers), china (5.56% share, 19,711 papers) and italy (5.15% share, 18,229 papers) at 2, 3, 4 and 5 positions, respectively. france, japan, canada, netherlands, australia, spain, india, south korea, sweden, switzerland, belgium, turkey, denmark, taiwan, greece and poland ranked from 6 to 21 positions with their global publication share ranging from 4.59 to 1.44%. brazil, austria, israel, finland, norway, iran, singapore, ireland and egypt contributed less than 1% share in world research output in breast cancer (table 1). interestingly, among 30 most productive countries in terms of continental share in breast cancer research, there are 16 countries from europe with publication share of 38.72%, 9 asian countries with share of 18.16%, 2 countries from north america with share of 38.79%, 1 country from south america, 1 from australia / oceania and 1 from africa with publication share of 0.99%, 2.57% and 0.46% respectively (table 1). breast cancer research and treatment with 7,348 items was the first in rank, and 20 journals were the highest publishing journals, which published almost 25% of literature on breast cancer (table 2). iran s cumulative publication output during 19912015 in breast cancer research which indexed in scopus, consists of 2,399 papers with an average of 95.96 papers per year and achieved an h - index of 48. hence ; with 2,399 papers, iran ranked 27 among the top 30 nations with a worldwide share of 0.67 %. over the 25-year period from 1991 to 2015, iranian breast cancer research outputs increased from 1 paper in 1991 to 432 papers in 2015. the publication output in breast cancer has increased rapidly. from 2,399 papers, a total of 1,753 (73%) papers iranian cancer research articles have received 15,574 citations during 19912015, and average citations per paper were 6.49, the highest average citations per paper was for 2015 (8.79) and the lowest was during 19912005 (1.96) (table 3). the 20 top publishing journals published 744 (31%) iranian research articles on breast cancer, among them, there were 15 iranian journals. from the 20 top publishing journals, ranks the first with 252 published articles and international journal of hematology oncology and stem cell research ranks 20 (table 4). the higher numbers of publications were in the article type with 84.66%, followed by the review with 6.23%, conference papers with 4.25%, letters with 2.41%, articles in press with 1.20%, book chapters with 0.33%, editorials with 0.33%, short surveys with 0.25%, notes with 3.39%, errata with 0.08%, and the least number of publications was in books with 0.04%. iran has collaborated with 103 countries in breast cancer research, among them, the united states ranked 1 with 124 papers followed by canada with 84 papers, united kingdom with 55 papers, malaysia with 53 papers, germany with 48 papers, sweden with 47 papers, australia with 32 papers, italy with 31 papers, india with 21 papers and france with 18 papers. in total, these ten countries published 513 (21%) papers in collaboration with iran. altogether, 160 iranian universities and research centers have produced a total of 2,399 papers on breast cancer. tehran university of medical sciences has contributed 638 (26.59%) publications followed by shahid beheshti university of medical sciences 220 (9.17%), shiraz university of medical sciences 217 (9%), tarbiat modares university 209 (8.7%), isfahan university of medical sciences 182 (7.58%), mashhad university of medical sciences 155 (6.46%), tabriz university of medical sciences 152 (6.33%), islamic azad university 152 (6.33%) and university of tehran 143 (5.96%). we found six authors who wrote more than thirty documents on breast cancer studies as follows : abdolrasoul talei from shiraz university of medical sciences with 59 papers and h - index of 15, abbas ghaderi from shiraz university of medical sciences with 46 papers and h - index of 25, ali montazeri from iranian institute for health sciences research with 42 papers and h - index of 37, mohammad esmaeil akbari form shahid beheshti university of medical sciences with 36 papers and h - index of 11, zuhair mohammad hassan from pasteur institute of iran with 35 papers and h - index of 22 and ramin sadeghi from mashhad university of medical sciences with 33 papers and h - index of 14. this study specified that iran, with 2,399 papers in breast cancer research, ranked 27th amongst the top thirty countries and its worldwide portion was 0.67 %. although the number of papers have increased over 19912015, breast cancer cases are increasing too. iran has the highest incidence of cancer in the middle east at 110 cases per 100 000 population per year, leading to 105 deaths every day (9, 19). iran is quickly moving toward an elderly society with an associated growth in cancer incidence, including breast cancer (19). statistics show that the prevalence of non - communicable diseases such as cancer increased dramatically in iran, also, the results of the iranian cancer registry, displays that the screening programs are not yet operative in the initial screening of the cases (20). this increases significant concern for law makers to describe suitable diagnostic and treatment facilities, and improve breast cancer control policies in iran (19). it seems that more effort should be made to control breast cancer, including screening and diagnostic programs also conducting supported studies in this field. the findings of the present study indicated that the higher numbers of publications were in the article type with 84.66%, followed by the review with 6.23%, and the least number of publications was in books with 0.04%. it seems that books are neglected, and not only iranian researchers but also all researchers on breast cancer research worldwide should pay more attention to this issue. iranian researchers have published their papers, mostly in domestic journals ; the reason for this is that, most iranian journals have only recently been qualified to be indexed by scopus. in a study by rasolabadi, there were 5 journals publishing 140 (20%), of which there was just one iranian publication which became the first amongst other publications (22). biglu in his study, found that most of the iranian studies were issued in thailand, the united states and the united kingdom (23), which is not consistent with the current study. results showed that iranian cancer research articles have received 15,574 citations during 19912015, and average citations per paper were 6.49. this finding is consistent with findings of rasolabadi, which showed iran s publication output in diabetes research as measured by average citation per paper was 6.19 on the whole (24). iran has collaborated with 103 countries in breast cancer research, among them united states ranked 1st followed by canada, united kingdom, malaysia, germany, sweden, australia, italy, india and france. in total, these ten international collaborative partners published 513 (21%) papers in collaboration with iran. this finding is inconsistent with findings of rasolabadi studies (12, 24 and 25). among ten international collaborative partners, malaysia ranked fourth, perhaps the reason is that in past decade many iranian students had graduated from malaysian universities. there were 9 most productive iranian universities with more than 140 papers in the field of breast cancer research including ; tehran, shahid beheshti, shiraz, isfahan, mashhad, tabriz university of medical sciences, tarbiat modares university, islamic azad university and university of tehran. these 9 most productive iranian universities have published 2,068 (86.20%) papers out of 2,399 papers in total. this finding is inconsistent with findings of rasolabadi and the biglu study (2224). though ; these 9 iranian universities are among the biggest domestic universities, with predictable productivity. the results showed that 6 authors have produced 251(10.46%) papers in breast cancer research, namely abdolrasoul talei, abbas ghaderi, ali montazeri, mohammad esmaeil akbari, zuhair mohammad hassan and ramin sadeghi. according to the lotka s law (the quantitative percentage of researchers in a discipline that have contributed to its many research practices), they are regarded as prolific researchers in the production of information on breast cancer in iran. the number of iranian research papers on breast cancer and also the number of citations to them are increasing. although the quantity and quality of papers are increasing, regarding the prevalence of breast cancer in iran and also the ineffectiveness of screening programs in the early detection of the cases, more effort should be done and iranian strategy designers should invest more on breast cancer research. | introductionas a common type of malignancy, breast cancer is one of the major causes of death in women globally. the purpose of the current study was to analyze iran research performance on breast cancer in the context of national and international studies, shown in the publications indexed in scopus database during 19912015.methodsdata were retrieved from the scopus citation database in this scientometric study. the following string was employed ; breast cancer or breast malignancy or breast tumor or mammary ductal carcinoma keywords in the main title, abstract and keywords and iran in the affiliation field were the main related keywords. the terms used were searched in scopus using the tab specified for searching documents. time span analyzed was 1991 to 2015 inclusive. using the analyzing software of scopus, we analyzed the results.resultsirans increasing publication production during 19912015 in breast cancer research which indexed in scopus, consists of 2,399 papers with an average of 95.96 papers per year, and achieved an h - index of 48. iranian cancer research articles have received 15,574 citations during 19912015, and average citations per paper were 6.49. iran ranked 27th among the top 30 nations with a worldwide stake of 0.67 %, the 20 top publishing journals published 744 (31%) iranian research articles on breast cancer, among them, there were 15 iranian journals.conclusionthe number of iranian research papers on breast cancer and also the number of citations to them, is increasing. although the quantity and quality of papers are increasing, regarding the prevalence of breast cancer in iran and also the ineffectiveness of screening programs in the early detection of the cases, more effort should be made, and iranian policy makers should consider more investment on breast cancer research. |
it is the second most abundant transition metal ion in living organisms, including humans. zinc is present in all the tissues, fluids, and organs within the human body, for a total body content of approximately 1.42.3 g. it is necessary for catalytic, structural, and regulatory functions in hundreds of enzymes and in thousands of protein domains. enumerating and discussing the role of zinc in these functions is far beyond the aim of this study [25 ]. the recommended dietary intake for zinc varies with age and physiological status, ranging between 5 and 18 mg day. severe zinc deficiency causes a number of adverse physiological consequences on the epidermal, gastrointestinal, central nervous, immune, skeletal, and reproductive systems [4, 6, 7 ]. it has been demonstrated that the form of the trace elements affects the intake efficiency in animals. several studies reported that certain organic compounds of trace elements (including iron, zinc, magnesium, and selenium) are more bioavailable than the inorganic forms, possibly because the mechanisms for absorption have adapted to these kinds of nutrients during species evolution [812 ]. moreover, in order to develop biotechnological sources of trace elements for diet supplementation, microorganisms (e.g., yeast, lactobacilli, and spirulina strains) were proposed as organic matrixes for incorporation of minerals [10, 13, 14 ]. in fact, the addition of inorganic salts into cultivation media enables the biosorption of the mineral ions by the microbial biomass. as a consequence, the biomass becomes enriched with organic forms of trace elements, which are present as complexes with amino acids, proteins, lipids, and polysaccharides. the present study investigated zinc biosorption by 16 strains of lactobacilli and bifidobacteria, in the perspective to evaluate whether they can function as organic matrixes for zinc incorporation. sixteen human strains of lactobacillus and bifidobacterium (table 1) were obtained from atcc, dsmz, and our own collection (deptartment of life sciences, university of modena and reggio emilia). the strains were cultured anaerobically in mrs broth (difco laboratories) containing 0.5 g l l - cysteine hcl. for the evaluation of zinc inhibitory concentration and metal uptake, solutions of znso4 7h2o or zncl2 were filter sterilized (0.22 m) and added to sterile mrs - cysteine medium to obtain the appropriate concentration. all chemicals were provided by sigma - aldrich (steinheim, germany), unless otherwise specified. the minimum inhibitory concentration (mic) of zinc salts was evaluated in mrs - cysteine agar plates containing znso4 7h2o or zncl2 at the following concentrations : 0.05, 0.2, 1, 5, 10, 15, 25, 50, 75, and 100 mmol l. overnight liquid cultures of lactobacilli or bifidobacteria were diluted with saline as appropriate ; 10 colony forming units were spread on the zn - containing agar plates. plates were inspected for growth after anaerobic incubation at 37c for 48 h. the presence of a single colony or a faint residual haze was disregarded. the lowest concentration which inhibited bacterial growth was recorded as the mic. to determine zinc uptake, the strains of lactobacillus and bifidobacterium were cultured in mrs broth supplemented with 10 mmol l znso4. the kinetics of zinc uptake by l. acidophilus wc 0203 was determined in ph - controlled batch cultures. the strain was cultured in labfors bioreactor (infors ag, bottmingen, switzerland) containing 2 l of mrs - cysteine broth supplemented with 10 mmol l znso4. the bioreactor was inoculated (10% v / v) with an exponential - phase preculture grown in mrs - cysteine broth. the ph was continuously measured (405-dpas probe, mettler toledo, switzerland) and kept at ph 5.0 by automatic titration with 4 mol l naoh. anaerobic conditions were maintained by sparging the culture with 0.05 v / v / min filter - sterilized (0.22 m) nitrogen. samples were collected periodically to monitor growth and to quantify zinc uptake. to investigate the mechanism of zinc uptake by l. acidophilus wc 0203, ph controlled 48 h batch fermentations were carried out as follows (figure 1) : the strain was cultured in mrs - cysteine broth for 48 h cultivation in the absence (negative control) and the presence of 10 mmol l znso4 (s0 and s1, resp.) ; the strain was cultured for 24 h in mrs - cysteine broth, then the culture was supplemented with 10 mmol l znso4, and further incubated for 24 h (s2) ; the strain was cultured for 24 h in mrs - cysteine broth, then the culture was pasteurized (70c for 15 min), supplemented with 10 mmol l znso4, and further incubated for 24 h (s3). for all the treatments, bacterial biomass was harvested after 48 h for zinc quantification. to quantify zinc in microbial biomass, the cells contained in 50 ml of culture were collected by centrifugation (6,000 g for 10 min at 4c) and repeatedly washed with d.d. water until zinc concentration of in the supernatant decreased below the limit of detection (0.1 mol l). the microbial pellet was resuspended 1 : 1.5 (w / v) with 1.44 mol l hno3 and heated in a water bath at 100c for 40 min. the supernatant was collected and the precipitate was washed twice with 1 ml of d.d. the supernatant and washing waters were mixed and supplemented with 0.1 ml of 14.4 mol l hno3. water, filtered through a 0.22 m cellulose acetate filter (millex - gv, millipore), and analyzed for zinc concentration using icp - aes (perkin elmer optima 4200 dv). a calibration curve was prepared using standard solutions from 0.15 to 300 mol l zn in 288 mmol l hno3. cell bound zinc was expressed as mol per gram of dry biomass weight (mol g). all values are means of three separate experiments and are expressed as mean standard deviation (sd). within each strain, differences among treatments were evaluated using one - way anova with repeated measures, followed by bonferroni post hoc comparisons. differences among strains were evaluated using one - way anova followed by tukey post hoc comparisons. the minimum inhibitory concentration (mic) of zncl2 and znso4 was determined for 11 strains of lactobacillus and 5 of bifidobacterium (table 1). the anion did not affect the mic of zinc salts (p > 0.05). for all the strains of lactobacillus and bifidobacterium, the mic of zinc salts was never below 15 mmol l. among the strains of lactobacillus, 6 grew abundantly on 100 mmol l zinc (l. acidophilus wc 0202, l. acidophilus dsmz 20552, l. brevis atcc 4006, l. gasseri wc 0213, l. plantarum wc 0214, and l. reuteri wc 0215). among the strains of bifidobacterium, the highest mic of zinc (100 mmol l) was observed for b. breve wc 0480. cell - bound zinc was determined after 48 h of growth in mrs versus mrs supplemented with 10 mmol l zinc. zinc concentration in the un - supplemented mrs broth was determined and was 0.015 mmol l. in this medium, all the strains accumulated less than 4.6 mol g. cell - bound zinc was always significantly higher (p 0.05). some species of lactobacillus and bifidobacterium are extensively used as probiotics in fermented foods and nutraceutical products. among probiotics beneficial effects, lactobacilli and bifidobacteria acidify the large intestine restricting putrefactive and potentially pathogenic bacteria, cause immune - stimulation, exert antioxidant and anticarcinogenic activities, produce vitamins, and activate biologically active compounds [1518 ]. an increasing number of complete genome sequences of lactic acid bacteria are being added to databases and plenty of information about physiology, metabolism, and probiotic properties is available. however, only recently few strains of lactobacilli have been investigated for zinc biosorption. in order to propose probiotic carriers of organic zinc, the present study investigated the ability of 16 human strains of lactobacillus and bifidobacterium to bind zinc. results from our screen revealed a significant variation in both mic and metal uptake of zinc among the various strains tested. cell - bound zinc ranged between 15 and 32 mol g in bifidobacteria and between 11 and 135 mol g in lactobacilli. any correlation between mic and cell - bound zinc seems to be excluded (r = 0.064). the strains which presented both the highest and the lowest level of zinc uptake belonged to the species l. acidophilus. l. acidophilus wc 0203 bound 135 mol g ; l. acidophilus dsmz 20552 bound 11 mol g ; the corresponding mics were 15 mmol l and higher than 100 mmol l, respectively. a deeper characterization of zinc uptake mechanism and kinetics of l. acidophilus wc 0203 revealed that the amount of cell - bound zinc increased progressively during a batch process. however, most of the uptake occurred during the stationary phase, when growth ceased. in fact, zinc content was similar in biomass collected from 48 h batch cultures where the salt was added at the beginning of the process and in biomass of cultures where zinc was supplied in the late stationary phase. a passive mechanism is probably involved in zinc uptake by l. acidophilus wc 0203, because pasteurized and viable cultures accumulated similar amount of zinc. under these conditions, biomass incorporated up to 131 mol g zinc, corresponding to approximately 8.5 mg g. since zinc uptake seems to occur through nonmetabolically mediated mechanism of uptake, it is conceivable that zinc incorporation could be further enhanced if stationary phase cells are exposed to zinc concentrations even higher than the mic. our results are in agreement with the observation that, in lactobacillus mesenteroides, zinc was mostly bound to carboxylate groups of proteins and that the cell wall was the major site of zinc localization, even though active internalization progressively occurred too. diets composed primarily of plant ingredients contain diverse antinutritional factors which inhibit mineral absorption. among them, phytate exerts the major inhibitory effects on zinc absorption. the phosphate groups of phytate can form strong and insoluble complexes with zinc ions, causing them to escape absorption and to be excreted with feces. low molecular weight ligands of zinc can form soluble complexes with zinc, thus counteracting the effect of phytate. therefore, chelators (e.g., edta), amino acids (e.g., glycine, histidine, and methionine), and organic acids (e.g., citrate) have been used to enhance zinc bioavailability [20, 21 ]. certain animal proteins of food were demonstrated to improve zinc absorption as well, likely due to the amino acids and peptides, which are released with digestion, that keep zinc in solution. similar to zinc, the organic forms of other trace elements (e.g., magnesium and iron) are more bioavailable and tend to be more effective against deficiency than the mineral ones [812 ]. for the same reason, the utilization of microbial biomass for the delivery of microelements has been increasingly explored. above all, the dietary supplementation with selenium - enriched biomass of yeast or lactobacilli resulted in higher concentrations of selenium in tissues and body fluids than supplementation with inorganic selenium did [13, 14 ]. the ability of l. acidophilus wc 0203 to function as an organic matrix for zinc incorporation could be exploited to supply organic forms of this metal. this approach for zinc supplementation could be of interest if zinc complexes are released from enriched biomass upon passing through the upper gastrointestinal tract, counteracting the effects of antinutritional factors. if biosorbed zinc is fully bioavailable, 1 g of zinc - enriched biomass of l. acidophilus wc 0203 could provide the host with a zinc amount (8.5 mg) staying within the recommended daily intake (518 mg). therefore, the bioavailability of lactobacillus - bound zinc may deserve deeper investigation. the results of this study provide new perspectives on the specific use of probiotics, such as to combine the healthy probiotic effects of the genus lactobacillus with the delivery of organic zinc, preventing sequestration by antinutritional factors. | the study aims to investigate zinc biosorption by strains of lactobacilli and bifidobacteria with a view to exploit them as organic matrixes for zinc dietary supplementation. sixteen human strains of lactobacillus and bifidobacterium were assayed for zinc uptake. the minimum inhibitory concentration of zinc salts differed among the strains, but was never below 15 mmol l1. when cultured in mrs broth containing 10 mmol l1 znso4, all the strains were capable of accumulating zinc in the range between 11 and 135 mol g1. the highest amount of cell - bound zinc was obtained in l. acidophilus wc 0203. ph - controlled batch cultures of this strain revealed that zinc uptake started in the growth phase, but occurred mostly during the stationary phase. pasteurized and viable cultures accumulated similar amount of zinc, suggesting that a nonmetabolically mediated mechanism is involved in zinc uptake. these results provide new perspectives on the specific use of probiotics, since l. acidophilus wc 0203 could function as an organic matrix for zinc incorporation. the bioavailability of lactobacillus - bound zinc deserves to be investigated to provide a future basis for optimization of zinc supplementation or fortification. |
celiac disease (cd), an inflammatory disorder of the upper small intestines, is characterized by intestinal villous atrophy and crypt hyperplasia and is caused by an abnormal immune reaction to wheat gliadin. it may be associated with different symptoms and signs, depending on the degree of intestinal involvement. the damage to the intestine makes it difficult for the body to absorb nutrients, especially fat, calcium, iron, and folate. this often results in diarrhea, abdominal distension, generalized malnutrition and failure to thrive, or subclinical deficiencies along with isolated nutrient deficiencies such as anemia, aphthous ulcer, bone pain, etc. the prevalence of cd is high in saudi patients (4%) when compared to the prevalence rates reported from the usa and europe (i.e., 3%) and is comparable to the rates reported from other tropical countries. moreover, a high prevalence of serological markers of cd has been reported among patients with autoimmune thyroid disease. osteomalacia and iron deficiency anemia were common clinical presentations of adult cd in saudi arabia. hence, the presence of either one of these presentations in a female patient should raise the possibility of cd. trichotillomania has been classified as an obsessive - compulsive and related disorder (dsm-5) that is characterized by recurrent body - focused repetitive behavior (hair pulling) and repeated attempts to decrease or stop the behavior. it may result in impairment in important areas of functioning, such as relationships, social functioning, etc.. in addition, it is 7 times more prevalent in children (peak prevalence observed between 417 years of age) than in adults. hair pulling in early childhood (< 5 years of age) can be regarded as a distinct clinical entity that tends to be self - limiting without the need for intervention. however, pathological hair pulling has been observed in 1.5% of adult males and 3.4% adult females. trichotillomania is typically confined to one or two sites, frequently affecting the scalp, but it can also involve the eyelashes, eyebrows, pubic hair, body hair, and facial hair [8, 9 ]. the patients tend to be highly secretive about the condition and regard their behavior as shameful. many hair pullers exhibit additional stereotypic movements such as nail biting, knuckle cracking, touching or playing with pulled hair, and hair eating (trichophagia). insufficient data exist on the association of cd with various neurological disorders, including certain common and soft neurological conditions such as headache, learning disorders, attention deficit hyperactivity disorder, and tic disorders, in children, adolescents, and young adults. to the best of our knowledge, there are only four articles that have reported on the association between cd and trichobezoars [11, 12, 13, 14 ]. a 22-year - old saudi female university student presented with cd and complaints of an uncontrollable, irresistible, and repetitive urge to pull her scalp hair. this condition started 15 years ago with the pulling of hair on the legs and then shifted to scalp hair 2 years ago after a year of no hair pulling. the hair pulling had currently become distressing, problematic, and out of control. in addition, there was a significant deterioration in her academic performance and social adjustment. the patient engaged in hair pulling on a daily basis for 13 h irrespective of whether she was relaxed (like watching tv) or under stress (like preparing for exams). however, when she was anxious during her exams or when assigned a project (with minor changes in sleep and appetite), her hair pulling behavior increased. immediately before pulling her hair, she felt a mounting tension, which was relieved with the successful pulling out of a hair root. she carefully examined the hair root but did not ingest them. if the hair root remained intact and instead the hair shaft was broken, she repetitively pulled the hairs until successful. she felt guilty and embarrassed by her hair pulling behavior and wore a head scarf most of the time to cover the bald patches of 12 cm on her scalp. the hair, particularly on the top of her head, was very thin, brittle and uneven. two years ago, she was diagnosed with cd and had symptoms like digestive problems (abdominal bloating, pain, and gas), skin eczema and psoriasis, iron deficiency anemia, and diarrhea. she then started a gluten free diet and noticed a decrease in the frequency of symptoms and hair pulling. the trichotillomania symptom severity scale showed that the patient had moderate symptoms (20 out 30). the hamilton anxiety rating scale showed mild anxiety and the hamilton rating scale of depression showed no depression in the patient. trichotillomania is associated with significant social and functional impairment [5, 6 ]. along with the cosmetic and psychosocial consequences, this disorder is also associated with certain medical complications, including infection, permanent loss of hair, repetitive stress injury, carpal tunnel syndrome, and gastrointestinal obstruction with bezoars as a result of trichophagia. the patients actively disguise their symptoms to avoid disclosure, and clinicians should be vigilant when patients present with inappropriate or unusual head coverings. in addition, the assessment of such disorders requires great clinical sensitivity as patients frequently regard their behavior as shameful. studies have reported a history of psychiatric disorders in a high proportion of adults who were newly diagnosed with cd. in our case this was further supported by the fact that her symptoms improved when she started a gluten - free diet. screening for comorbid anxiety disorders, obsessive - compulsive and related disorders, and depression in patients with cd by general practitioners and gastroenterologists is recommended. | trichotillomania is an underreported and underdiagnosed condition associated with significant impairments in social and functional relationships. the connection between celiac disease and trichotillomania is not yet established clearly. only a few cases of trichotillomania have been reported to date. here, we report the case of a 22-year - old saudi female, who presented with celiac disease and trichotillomania to the psychiatry clinic. this is the first report of its kind in saudi arabia. by reporting this case, i highlight the importance of psychiatric and comprehensive approaches in patients with celiac disease. |
capmul mcm was gifted by abitec corporation, usa. tween 20 and peg 400 were purchased from sulab chemicals, vadodara, india. all the other reagents were analytical grade. for the selection of components of microemulsion, solubility study was carried out in number of components according to procedure given by lianli. the oil, surfactant and cosurfactant were selected on the basis of solubility of drug in the solvent, hlb value as well as their gras status. to find out the microemulsion region, microemulsions having different composition [table 1 ] were prepared by dissolving the required amount of drug (27 mg/ ml) in a mixture of oil - smix at 405c and after cooling at 305c adding required volume of water. they were evaluated for globule size, pdi, zeta potential and % transmittance for optimization. for the selection of components of microemulsion, solubility study was carried out in number of components according to procedure given by lianli. the oil, surfactant and cosurfactant were selected on the basis of solubility of drug in the solvent, hlb value as well as their gras status. to find out the microemulsion region, microemulsions having different composition [table 1 ] were prepared by dissolving the required amount of drug (27 mg/ ml) in a mixture of oil - smix at 405c and after cooling at 305c adding required volume of water. they were evaluated for globule size, pdi, zeta potential and % transmittance for optimization. from the solubility data, capmul mcm, tween 20 and polyethylene glycol 400 were selected as oil, surfactant and cosurfactant component respectively as rosuvastatin is having higher solubility in above solvents. tween 20:peg 400 [3:1% w / w ] resulted in higher microemulsion region compared to [1:1% w / w ] and [2:1% w / w ]. this indicates that increasing the surfactant concentration, maximum amount of oil can be solubilized. pseudo - ternary phase diagram table 1 indicates the different batches of microemulsion and results of evaluation parameters. optimized batch was selected which is having lower globule size, zeta potential, pdi and higher % transmittance. the logic behind selecting these criteria for optimization is that lower globule size can result in enhanced permeation as well as provide larger surface area for drug release, pdi is the measure of uniformity of the formulation and less than 1 is desirable. more negative zeta potential is considered as more physical stability of the formulation and % transmittance was selected as higher as it shows the isotropic uniform system. from the results shown in table 1, batch me-1 (5% capmul mcm, 50% smix) was selected as optimized batch having globule size of 19.56 nm, -2.62 mv zeta potential, 0.334 pdi and 99.2% transmittance. from the solubility data, capmul mcm, tween 20 and polyethylene glycol 400 were selected as oil, surfactant and cosurfactant component respectively as rosuvastatin is having higher solubility in above solvents. tween 20:peg 400 [3:1% w / w ] resulted in higher microemulsion region compared to [1:1% w / w ] and [2:1% w / w ]. this indicates that increasing the surfactant concentration, maximum amount of oil can be solubilized. optimized batch was selected which is having lower globule size, zeta potential, pdi and higher % transmittance. the logic behind selecting these criteria for optimization is that lower globule size can result in enhanced permeation as well as provide larger surface area for drug release, pdi is the measure of uniformity of the formulation and less than 1 is desirable. more negative zeta potential is considered as more physical stability of the formulation and % transmittance was selected as higher as it shows the isotropic uniform system. from the results shown in table 1, batch me-1 (5% capmul mcm, 50% smix) was selected as optimized batch having globule size of 19.56 nm, -2.62 mv zeta potential, 0.334 pdi and 99.2% transmittance. present study demonstrates the potential use of microemulsion system for enhancement in solubility and hence bioavailability for the poorly water soluble drug. | due to very less bioavailability (20%) of rosuvastatin calcium, an attempt was made to develop and optimize microemulsion formulation. capmul mcm, tween 20 and peg 400 were selected as oil, surfactant and cosurfactant respectively as the drug is having higher solubility in them. 3:1% w / w s : cos was selected as it gave higher microemulsion area. optimized batch (me-1) was selected having 5% capmul mcm, 50% tween 20:peg 400 and 45% water based on evaluation parameters globule size, zeta potential, pdi, % transmittance. |
resin cements are composite resins developed to deliver mechanical properties and handling characteristics that are important for luting indirect restorations. due to their application under an indirect restoration, in most cases the physical activation (photo activation) has very limited effect. activation of the polymerization means to induce the photo initiator (e.g., camphorquinone) or to break the molecule of the chemical initiator (benzoyl peroxide) so as to form free radicals that will initiate the polymerization. the continuous addition of monomers to a growing chain results in a polymeric chain. in general, the maximum degree of conversion (dc) the percentage of aliphatic c = c (double) bonds converted into c - c (single) bonds to form the polymeric network reached by resin cements is around 60%, due to the increase of cement viscosity during the polymerization reaction, hindering the mobility of the reactive species. the reaction slows down progressively up to a moment when new bonds can not be made. resin cements have been frequently employed for bonding indirect restorations to the teeth due to their mechanical behavior superior to conventional cements (resin - free), possibility of adhesion to the restorative material and to the tooth structure with or without an adhesive system, and superior optical properties when compared with conventional cements. however, limitations associated with the incomplete polymerization (low dc) of the cement may result in higher sorption and solubility values, causing faster degradation of the cement finish line by the acids present in the oral biofilm. degradation of resin - based cements reduces the bond strength between them and the substrate and causes dissolution of the finish line at the restoration margin, which may mean the clinical loss of the restoration either by debonding, fracture or secondary caries. unreacted monomers (not bonded to the polymeric chain) may also irritate the pulp and generate a local inflammatory response. there are multiple factors that may interfere with the dc of resin cements and, therefore, compromise the longevity of indirect restorations. some of them are the material composition (monomers and other components of the activation system), possible inadvertent interactions between the bonding system and the cement, characteristics of the restoration to be cemented (optical properties and thickness of the restoration) and characteristics of the photo activation step. this article aims to perform a comprehensive review of the factors involved in the dc of the resin - based luting systems and the impact of dc on luting system properties. as previously mentioned, photo - activated or light - activated resin cements are indicated for situations where the light of the curing unit may pass through the restoration, such as translucent veneers and shallow inlays. these cements are provided in a single paste with a photoinitiator system composed of a photosensitive component (usually camphorquinone) and a tertiary amine. the presence of light with a wavelength of 480 nm (blue region of the visible spectrum) activates camphorquinone, which binds to the tertiary amine and then releases two free radicals that will start the monomers conversion. photo - cured resin cements have unlimited working time, with the polymerization starting right after the exposure of the material to light. chemically cured (self - cured) cements are indicated under thick restorations, for luting intrarradicular posts and crowns made of materials that block the light, such as metallic copings or highly opaque ceramics, aiming to guarantee maximum properties over time in areas that light energy is unable to reach. the limitations of these systems are the reduced working time as opposed to the extended setting time and the tendency to become yellowish, due to the higher concentration of tertiary amines (activators). the polymerization reaction in self - cured cements requires the components of the activation system tertiary amine and benzoyl peroxide to get in contact by the mixing of two pastes, base and catalyst. dual - cure resin cements were developed in an attempt to combine the benefits of both photo and chemically activated systems, obtaining optimized dc in the deepest locations under a restoration, controlled working time and short setting time. in such systems, there is a catalyst paste with a chemical initiator, usually benzoyl peroxide, and a base paste containing the photo - cured resin cement and the tertiary amine responsible for the activation of the self - cure reaction. when both pastes are mixed together and exposed to light, the polymerization happens by physical (photo) and chemical (redox) activation. the appropriate working time is controlled by inhibitors of the self - cure reaction or by the amount of activators of the polymerization. it is expected that in areas where there is not enough light, the interaction between the tertiary amine and benzoyl peroxide will be enough to ensure the cement polymerization. however, when not properly photo - activated, dual - cure resin cements may present reduced dc, which implicates in lower hardness, higher solubility, lower flexural and compressive strengths, and lower bond strength to dentin in comparison to directly light - cured dual cements. for instance, a self - adhesive dual cement applied in self - curing mode may show dc as low as 11% after a 10-minute setting time. considering the clinical application of the resin - based luting systems, which are used for the cementation of indirect restorations onto tooth structure, 10 min is an undesirably long time for a luting agent to obtain a great percentage of the optimal setting characteristics, without compromising the integrity of the margins and the cement layer under functional loading. in general, light - cured and dual - cured cements activated by light through a restoration thinner than 2.0 mm have higher dc than self - cured cements. when a dual cement is self - cured (no activation by light), mechanical properties such as flexural strength, modulus and hardness are reduced by 68.9%, 59.2% and 91.1%, respectively, in comparison to original values presented by dual - cured samples. there are different factors that may affect the dc of self - cured luting systems, such as the relatively high concentration of polymerization inhibitors used to extend the material s shelf life and to provide a clinically viable working time, ranging from 2 to 5 minutes, which adversely inhibits polymerization during the luting procedure ; the slow rate of polymerization activation and subsequent propagation of radicals in comparison to a directly light - activated material ; and the low concentration of benzoyl peroxide incorporated into those materials. furthermore, the hand - mixing of the two pastes incorporates air bubbles that further inhibit polymerization due to the presence of oxygen and may act as stress concentrators that potentially result in cracking throughout the cement layer. although it has been demonstrated that the high incidence of air voids reduces the stress generated by the polymerization shrinkage of the cement due to a change in ratio of bonded to unbonded surfaces, the clinical benefits of the inclusion of pores have not been determined. pores are also incorporated in dual - cured cements during mixing and they may become an esthetic concern when cementing veneers. to minimize the undesired consequences of the hand - mixing procedure, some manufacturers provide cements in a self - mixing apparatus (figure 1), which eliminates the manual mixing step, generates a homogeneous mix and reduces the incorporation of bubbles. however, voids have been observed after automatic mixing as well. figure 1summary of some resin - based luting systems currently available and their characteristics based on the papers included in this review. composition may vary significantly among different materials interestingly, if light incidence on the cement layer is significantly compromised, the chemical activator of dual cements improves dc when compared to photo - activated - only systems but the efficacy of the self - curing mode is still controversial and varies from one material to another. it has been demonstrated that the absence of the self - curing component in light - activated systems negatively affects the dc of these cements when the light - curing component is not able to guarantee an acceptable degree of conversion, for example when applied underneath onlays of greater thickness. considering a clinical application in which almost no light reaches the cement layer, it is desirable to use dual resin cements that present a chemical curing mechanism as efficient as photo - curing. however, there is currently no resin luting system in the market capable of overcoming this limitation. in general, the chemical activation of dual cements does not seem enough to compensate for the absence of light under thick or opaque restorations, even 24 hours after the beginning of the activation. the dc of a self - adhesive dual cement may vary from 37% when light - cured for 20 seconds to 58% when light - cured for 40 seconds, evidencing that there is also a direct correlation between light intensity received by a photo - activated material and its dc. laboratorial studies bring evidence that the activation time generally recommended by the manufacturer (figure 1) is not sufficient to result in maximum degree of conversion. therefore, when highly opaque or thicker restorations need to be employed, a prolonged light exposure time is recommended (please read indirect restorative material below), since a gradual increase in light - curing time and, therefore, in light transmission, gradually increases the knoop hardness of resin - based luting systems. additionally, the use of a dual - cure system should always be considered to possibly increase the dc by means of a chemical activation of the monomeric system. with regard to post - activation time, the 24-hour dc of light - cured and dual - cured cements is directly related to the dc obtained right after light exposure. even though dc is maximized during the first 30 minutes after light activation, some cements present gradual increase in dc for up to 24 hours, mainly when used in the dual - curing mode. however, it has been speculated that a delay in light activation of dual - cured materials would enhance their properties by allowing the self - polymerization promoters to react at some extent before being entrapped by the polymeric chains as soon as the photo - activation begins. delaying the light activation for 2 min may, for instance, compensate for a lower dose of light reaching the cement layer, but no effect is observed on the bond strength of resin cements to the substrate. on the other hand, prolonged self - curing of the cement may also compromise the overall dc and increase water sorption when light activation is delayed for 10 min for the same reason, indicating that an ideal balance between self - curing and photo - activation is yet to be determined. under ideal circumstances, light - activated resin cements show higher dc than chemically cured resin cements, irrespective of brand names. however, the dc of dual - cured cements is material - related, which means that it is more associated with the brand name than with the material classification per se and some systems are significantly more dependent on light activation than others. just as an illustration, the dc of a given dual - cured cement (relyx arc, 3 m espe, st. paul, mn, usa) may vary from 81% to 61% when cured under light as opposed to total absence of light respectively, and from 56% to 26% when another dual - cured cement (relyx unicem, 3 m espe, st. for instance, some resin - based cements present twice as much benzoyl peroxide than others. the lower dc may affect some critical properties of the resin - based cements. dual cements cured under a dual mode (photo+chemical) present lower toxicity and solubility than dual cements cured under the self - curing mechanism (chemical only). dual curing also leads to a rapid increase in hardness whereas chemically cured specimens are still soft 30 minutes or even one hour after mixing. dual - curing mode also results in improved bond strength and mechanical properties such as flexural strength, modulus and hardness, in comparison to light curing or chemical curing only. adhesive and self - adhesive resin cements have functional monomers such as 10-methacryloyloxydecyl dihidrogen phosphate (10-mdp), 4-methacryloxyethyl trimellitate anhydride (4-meta) and phosphoric esters. self - adhesive cements have acidic functionalities in order to demineralize tooth structure, and an acid - base reaction between the acid groups of the monomers and the glass filler of the core material or the mineralized tooth surface starts immediately after the mixing of the components and application of the cement on the tooth surface. however, those acidic monomers have been shown to negatively affect the cement degree of conversion, since they interfere with the amine initiator. this interference compromises both the self - cure and the dual - cure modes. the very low polymerization shrinkage strain of some self - adhesive cements may also be an evidence of reduced dc. indeed, there is a significant variation between the dc of different materials and increasing the light - exposure from 20 s to 40 s does not improve dc values after 6 hours as much as a temperature increase of the cement improves. however, when the absence (self - cure) and the presence (dual - cure) of photo - activation are compared, the presence of light may result in a 10-fold increase in the material degree of conversion. although another initiator system based on sodium aryl sulfate or aryl - borate salts has been proposed to compensate for the interaction between acidic monomers and the amine initiator in self - adhesive systems, no evidence has been found of any significant improvement in the dc for sodium persulfate - containing materials. another way to improve the polymerization kinetics of resin - based luting systems is to increase the temperature of the material. high viscosity cements have significantly lower degree of conversion than low viscosity cements, probably due to the reduced mobility of the monomers in viscous materials. increased temperature prior to and during polymerization leads to higher dc, due to increased free radical and monomer mobility and collision frequency of the unreacted active groups resulting from the decrease in the viscosity of the material. however, pre - heating (50c) dual - cured resin cements with a higher concentration of the chemical activator (benzoyl peroxide) may result in significant decrease in working time, thus compromising the clinical application of the material, and still may not compensate for the absence of light. the clinical applicability of the pre - heating technique is questionable, since the tooth structure could not be possibly heated up to 50c, which would immediately result in the cement temperature decrease. therefore, any evaluation on this topic should limit the pre - heating temperature to 37c. the bonding between resin cement and the tooth structure (or the core build - up material) is generally made possible by the use of a self - adhesive resin cement or by the application of a bonding agent / system. the bonding agent / system may either be self - etch or total - etch (etch - and - rinse). however, there are restrictions for the application of some simplified adhesive systems, more precisely two - step total - etch (primer and adhesive in one bottle) and all - in - one self - etch systems and resin cements with some chemical activation, either self - cured or dual - cured. it has been shown that the lower the ph of the bonding agent employed, the lower the bond strength between self - cured cement and dentin. the use of a simplified adhesive bonded to a self - cured cement results in 10 - 50% of the bond strength presented when the same adhesive is bonded to a light - cured cement. the reason for those diminished bond strength values is that when simplified - step adhesives are used together with chemical - cured cements, there is an interaction between the residual acidic monomers from the adhesive inhibition layer and the binary peroxide - amine catalytic components that are commonly employed in chemically cured resin composites. therefore, the tertiary amine of the resin cement is neutralized and does not react with the initiator, resulting in low bond strength at the adhesive - cement interface. besides that, the adhesive layer of simplified systems (all - in - one) is highly permeable to dentinal fluids due to incomplete polymerization, and these are then kept at the interface between the adhesive and the cement, compromising the bonding between those two substrates, which is demonstrated by exclusively adhesive failure modes. to maximize the performance of the resin cements, self - cured or dual - cure cements are to be employed only in association either with three - step total etch systems or with self - etching primer systems containing a separate bonding agent. for all of the other adhesive systems, the resin cement employed should be exclusively photo - activated. when photo - activation of a resin cement is performed, part of the visible light that reaches the crown is transmitted through the restoration, part is absorbed and part of it is reflected on the surface. consequently, the light intensity that effectively reaches the cement varies according to the optical characteristics of the restorative material, such as opacity and shade, and the final thickness of the restoration. the higher the thickness and the lower the value (darkness) of the restoration, the lower the light intensity reaching the cement layer, which may compromise the dc of a given cement. there are many restorative systems nowadays that may be used for the manufacturing of all - ceramic crowns (figure 2). each one of these ceramic systems has a microstructure that directly interferes with the amount of light that may be transmitted through the restoration. considering restorations with similar shade and thickness, ceramics with a higher number of light scattering centers (interface between different microstructural phases) are more opaque and prone to block visible light, compromising the intensity of the physical polymerization of the resin cement. pores, frequently found in feldspathic porcelains and glass - infiltrated composites due to the processing method of these materials, act as light scattering centers as well. a free of pores porcelain would be a material with no light scattering interface and would thus show transmittance, resulting in high dc for dual cements even under a 3 mm - thick layer. a multi - phase material would scatter the light because the incident light beam will change direction from one phase to another and the result will be a weaker incident light. a multi - phase structure within a material also results in light scattering and low transmittance. thereafter, glass - infiltrated alumina - zirconia (in - ceram zirconia system, vita zahnfabrik, bad sckingen, baden - wrttemberg, germany) is the most opaque alternative among current clinical options, due to the presence of four distinct phases with different refraction indexes (alumina, ceria - stabilized zirconia, lantanium glass and pores), with a final maximum transmittance of only 6% in 0.5 mm - thick copings, and when the thickness of the same material increases to 1.5 mm the transmittance becomes as low as 1% of the initial light intensity. glass - infiltrated spinel ceramic (in - ceram spinell, vita zahnfabrik, bad sckingen, baden - wrttemberg, germany) presents significantly higher transmittance because it has only two phases (glass and spinel), with similar refraction indexes. figure 2correlation between indirect restorative materials and the curing properties of the resin cement underneath when comparing the translucency of lithium - disilicate glass - ceramic and leucite - reinforced glass ceramic, illie,. (2008) observed that the first is more opaque than the latter (figure 2). lithium - disilicate glass ceramic contains a main crystalline phase of elongated crystals building a scaffold of many small interlocking needle - like crystals randomly oriented, with a second crystalline phase consisting of lithium orthophosphate. on the other hand, leucite - reinforced glass - ceramic is a less dense material, characterized by the single crystal formation of leucite crystals, indicating that lithium - disilicate ceramics scatter more light than leucite ceramics. light delivered to the cement layer through lithium - disilicate ceramic (shade medium opacity 1) is reduced to 45% under 1 mm ceramic slabs, 16% under 2 mm slabs and approximately 8% under 3 mm slabs. leucite - reinforced glass ceramic slabs reduce the light transmittance to 80%, 64% and 43% under 0.7, 1.4 and 2.0 mm thick samples, respectively. as previously mentioned, the relationship between restoration thickness and transmittance is highly dependent on the opacity of the material. however, the impact of the amount of light reaching the cement layer on its dc is controversial. dual - cure resin cements activated by light under a 1.5 mm lithium - disilicate glass ceramic (shade a2 low translucency) surface presented a dc similar to that of cements cured under direct light exposure, whilst samples cured through 1.4 mm - thick leucite - reinforced glass - ceramic slabs may or may not show significantly lower hardness values than groups activated with direct light exposure, depending on the luting system employed. in another study, samples light - cured under 1 or 2 mm thick lithium - disilicate slabs only showed decreased hardness when light exposure time was 20 s or less, indicating that longer exposure times may compensate for light attenuation of the indirect restorative material. a randomized clinical split - mouth study evaluating the longevity of glass - infiltrated alumina crowns cemented with three different cements (two resin - based and one glass - ionomer) evidenced acceptable survival rates for all groups, with dual - cured cements showing higher survival rate than glass - ionomer cement, indicating that the opacity of the crown did not affect the performance of the cement / restoration. it is important to remember that the final absolute transmittance values of a restoration would be even more compromised considering the thickness and the optical characteristics of the porcelain veneer layer. the dc of a dual - cured cement activated under glass - infiltrated alumina (1.2 mm thickness) with porcelain veneer layer (0.8 mm thickness) is significantly reduced when compared to feldspathic porcelain samples (2 mm thick) and to the control group, activated under direct light exposure. when the impact of the shade of the ceramic system is evaluated, it can be observed that if shades with higher chroma are used, less energy reaches the cement layer, since dark pigments absorb a significant amount of light, negatively influencing the cure of light - dependant cements. dual - cured cements light - activated under 2 mm - thick samples of darker dentin shade of feldspathic porcelain present significantly lower dc than cements light - activated under lighter shades. when yellow and translucent shades of a resin cement were light - activated under the darker porcelain, only prolonged light - exposure time (40 seconds) was capable of increasing the dc of the cement yellow shade, indicating that the combination of darker shades in both the cement and the indirect restorative material compromise the overall dc of the cement layer. with regard to laminate veneers, some studies show that although the bond strength between veneers and tooth structure is not affected by shade or opacity of the ceramic system, the dc of the cement may be diminished by either thicker, darker or more opaque restorations, frequently used to mask severely darkened teeth, and a lower dc of the cement layer may compromise the esthetic result due to the continuous discoloration of the material. the analysis of the dc of a light - cured resin cement after the superimposition of different veneer materials with different thicknesses indicated that the effect of light attenuation on the degree of conversion is not significant only for ceramic thicknesses of 1.0 mm or less. considering the optical properties of the indirect restorative composites, there are different factors playing a role in light transmittance, such as particle size distribution, thickness of the restoration and shade. the smaller the particles, the more interfaces will be present acting as light scattering centers, consequently increasing the opacity of the material employed, which indicates that larger particles allow for deeper activation of the cement layer by light. interestingly, the hardness of dual resin - based cements is less affected when photo - activation is performed through an indirect restorative composite either microfilled or micro - hybrid than when it is performed through an all - ceramic system lithium disilicate and glass ceramic. when the effect of thickness is evaluated, there is indeed an inverse correlation between thickness of an indirect composite resin restoration and knoop hardness of the resin based luting system. dual resin cements cured under 2 mm - thick micro - hybrid composite samples show significantly lower dc than samples cured under ideal conditions, and the dc of dual cements is 12% lower under 4 mm onlays in comparison to that measured under 2 mm thick onlays. with regard to the effect of shade on indirect composite resin light transmittance, arrais,. (2008) demonstrated that only 11% of light reaches the cement layer when cured through a 2 mm microhybrid composite a2 shade as opposed to 8% when a4 shade was employed, but no effect on dc was observed for dual - cured resin cements with higher concentration of benzoyl peroxide. the authors pointed out that the adhesive component also presented a chemical activator of the polymerization and could, therefore, compensate for the absence of light. it has been demonstrated that the hardness of dual - cured cements is dependent on the level of exposure to the curing light. as previously mentioned, the component responsible for the chemical activation of the material can not compensate for the total absence of light. the higher the light intensity and the longer the exposure time of the resin cement, the higher the knoop hardness of the dual - cured materials. however, even when under direct light exposure, there is a limit above which the dc of a photo or dual - cure cement can not be increased. quartz - tungsten - halogen (qth) light curing units (lcu) deliver light irradiance varying between 400 and 1360 mw / cm2. when exposure time (40 s, 60 s or 120 s) and intensity (1200, 800 or 400 mw / cm) of light exposure on dc of dual cements was evaluated, different materials showed different results, although all the associations resulted in the same amount of energy (48 j). activation of dual cements under 2 mm resin composite onlays using low light intensity for prolonged time presented a trend towards higher dc, probably due to the slow increase in the material viscosity, allowing more monomers mobility. light - emitting diodes (led)-based units were introduced in the market in 2001 and are another option to activate photo - cured resin cements. these units generate light under a narrower spectrum (between 450 and 490 nm) with the peak around 468 nm, the ideal wavelength for resin - based materials using camphorquinone as the photoinitiator. when the photo - activation of a cement is performed through a ceramic system, light transmittance increases for higher wavelengths. the higher mean wavelength of led lights improves the capacity of the equipment to activate resin cements under indirect restorations. however, light - intensity is also critical, since led with relatively low light intensity (320 mw / cm) results in decreased knoop hardness at the bottom of dual - cured cement samples. the effect of qth (905 mw / cm) and led (1585 mw / cm) curing units on knoop hardness of resin - based cements indicated that there was no effect of lcu on the hardness of dual - cure cements. samples cured under 1.4 and 2.0 mm ceramic slabs (leucite glass ceramic, shade a3) showed lower hardness values than samples cured under direct light exposure and under 0.7 mm slabs. authors observed that hardness on dual - cured luting agents may not be dependent on the light source, as long as the irradiance level for the effective wavelength region to activate the photo - initiator is similar. with the application of high - power curing units in dentistry, led - based equipment with high light intensity (1000 - 1600 mw / cm) are being advertised as an alternative to reduce the curing time of resin - based materials. however, the minimum time required to properly cure a dual - cured luting system is 15 s under ideal conditions, so that maximized mechanical properties can be obtained. therefore, it is not recommended to reduce the light exposure time to less than 15 seconds on each side of a restoration, irrespective of light intensity. indeed, it has been demonstrated that light - curing a dual - cure cement for 9 s with a led device (1100 mw / cm) results in significantly reduced degree of conversion. the authors observed that exposing dual - cure material to high intensity light may increase its viscosity more rapidly, hindering the migration of active radical components responsible for further polymerization. similar results were obtained when led device (1100 mw / cm) with different activation modes and qth (600 mw / cm) were used to photoactivate resin cements between ceramic samples (lithium disilicate) and human dentin, and the authors found out that groups photo - activated for 10 s presented inferior bond strength. higher bond strength results were obtained when led devices under exponential mode and qth were used, and since the exponential mode was applied for twice as much time as the other led groups, the overall energy delivered was increased, which may have enhanced the dc. authors also observed that higher light intensity produces higher contraction strains during resin polymerization, which may promote debonding at the adhesive interface. therefore, prolonged exposure times are desirable not only to increase the energy delivered to the luting material, in an attempt to compensate for the attenuation of the light promoted by the indirect restorative material, but also to reduce stress generation at the cement - substrate interface, to ensure preservation of the bonding. a comparison of different light curing equipment (qth 600 mw / cm ; led 1400 mw / cm ; argon ion laser 600 mw / cm) used to activate resin cements under 2 mm - thick samples of composite resin indicated that the degree of conversion of the resin cements is again more related to the commercial brand and, consequently, to the material composition than to the curing device itself, with led and argon ion laser devices resulting in lower dc for one of the materials in the photo - cured mode. although the short range of the spectra peak for led devices may be advantageous when curing under ceramic systems, a wider range may be clinically interesting to photo - activate alternative photoinitiators, promoting a higher dc for qth lights even in the presence of lower light intensity. in addition to the factors presented above, there are other variables playing a role in the dc of light - activated resin - based cements, such as the distance between the tip of the curing device and the cement layer and other indirect factors reducing the light intensity being delivered. based on the results presented and the number of studies indicating that prolonged light - activation may be beneficial for the dc of dual- or photo - cured cements, increasing the light exposure time, even though this would mean a couple more minutes of clinical procedure, would be certainly beneficial for the clinical performance of an indirect restoration. the clinical success of an indirect restoration is not only attributed to the dc of the resin cement or to its mechanical properties, since there are other aspects that determine the clinical performance of dental prostheses. nonetheless, ensuring a high dc is paramount to obtain the best out of the chemical and physical properties of the resin cement, besides being a critical factor for biocompatibility. when performing a luting procedure, one should pay attention to the characteristics of the indirect restorative material to be employed, and make a conscious decision of using a cement system that would be more indicated to the clinical case necessities. curing modes and the best light - curing technique are examples of information that is to be available. it is crucial for clinicians to know and understand the cement systems they are working with. | resin - based cements have been frequently employed in clinical practice to lute indirect restorations. however, there are numerous factors that may compromise the clinical performance of those cements. the aim of this literature review is to present and discuss some of the clinical factors that may affect the performance of current resin - based luting systems. resin cements may have three different curing mechanisms : chemical curing, photo curing or a combination of both. chemically cured systems are recommended to be used under opaque or thick restorations, due to the reduced access of the light. photo - cured cements are mainly indicated for translucent veneers, due to the possibility of light transmission through the restoration. dual - cured are more versatile systems and, theoretically, can be used in either situation, since the presence of both curing mechanisms might guarantee a high degree of conversion (dc) under every condition. however, it has been demonstrated that clinical procedures and characteristics of the materials may have many different implications in the dc of currently available resin cements, affecting their mechanical properties, bond strength to the substrate and the esthetic results of the restoration. factors such as curing mechanism, choice of adhesive system, indirect restorative material and light - curing device may affect the degree of conversion of the cement and, therefore, have an effect on the clinical performance of resin - based cements. specific measures are to be taken to ensure a higher dc of the luting system to be used. |
acute lymphoblastic leukemia (all) in adults accounts for 15% of acute leukemia.total body irradiation (tbi) for adult patients with all is a vital technique used prior to bone marrow transplant. a total body irradiation regime is used in the treatment of all to destroy malignant cells and to suppress the immune system to allow for bone marrow transplant by preventing rejection of the donor bone marrow. since the treatment is delivered at an extended source - to - skin distance (ssd) of 400 cm, the treatment planning system (tps) the dose has to be calculated by a point - dose determination at the dose prescription point which is typically at the mid - plane of the patient. it is important to monitor the skin dose to ensure the precision of the dose delivered to patients. the aim of the present work was to compare the target prescribed dose to the dose that measured by two dosimetry systems : the newer onedose metal oxide semiconductor field effect transistor (mosfet) detectors and traditional dosimetry thermoluminescent dosimeters (tlds). tlds have been widely used for radiation monitoring, for monitoring staff dealing with radiation, and to monitor patient exposure to radiation during radiation therapy treatments. the widespread use of tlds may be due to these advantages : their small size ; that they can operate under any conditions ; and that they do not rely on any external power supply. when a tld is exposed to radiation, it absorbs radiation energy and then emits luminescence light, and the light emitted is proportional to the x - ray energy absorbed. these are a solid - state detector used in radiation therapy treatment applications to measure the entrance and exit dose during the treatment. mosfet detectors are characterized by their energy response ; however, the variation in the energy dependence is beyond the scope of the present study. the onedose system is small, with a measured area of 3 mm in diameter and 25 mm in length. the detectors are factory calibrated with a co-60 beam with full build - up conditions. the accuracy of the detectors as specified by the manufacturer is 1 cgy for a dose that is less than 20 cgy and 5% for a dose of 20 cgy to 500 cgy (sicel technologies inc). onedose mosfet detectors are considered a safe, non - invasive dose verification system that could be used with all types of radiation therapy treatments. it has been suggested that mosfet has a high input impedance, is voltage controlled, and produces real - time dose measurements. its superiority over tld is in producing the result of the exposure immediately, whereas the tld needs hours to process and obtain the reading. the secondary aim of the study was to evaluate the simplicity of use of the detectors and determine if one system was superior to the other in clinical use for monitoring and measuring the skin doses during tbi treatment for all. the thermoluminescent detectors used were the lif chip type (tld-100, 3 3 0.9 mm) (harshaw, bicron - ne solon, oh, us). the metal oxide semiconductor field - effect transistors were onedose mosfet detectors (sicel technologies, inc, morrisville, nc ; distributed by medtec, orange city, usa. the onedose system with the detector (left), and close - up of the detector (right). twelve adult patients, all diagnosed with acute lymphoblastic leukemia (all) participated in this study. all patients signed an informed consent for the study prior to treatment. the patients were selected on the basis of having the same prescribed dose and a similar pathology report to our other all patients. the total target prescribed dose was 1200 cgy delivered in six fractions as recommended by the aapm task group 29. through greater understanding of bone marrow recovery, the total dose of 1200 cgy has been determined to be effective and less toxic. less toxicity occurs with this dose even when large amounts of bone marrow are exposed. monitoring the skin dose during tbi treatment, it is essential to monitor the dose that is actually delivered and compare it with the target prescribed dose. the tbi technique used in the department of radiation oncology, king fasial specialist hospital and research center, riyadh, saudi arabia takes into account the recommendations of the aapm task group 29 by delivering two opposed bilateral fields, right lateral and left lateral, using extended source - to - skin distance (ssd). the patient is supine and the radiation beam is directed horizontally across the treatment room directly on the patient. the treatment is delivered at a source - to - surface distance (ssd) of 400 cm, with a radiation field size of 40 40 cm at one meter and the collimator rotated through 45 using 18 mv x - ray beams generated by a varian clinac-2300 ex linear accelerator (palo alto, california, usa). a perspex beam spoiler with a thickness of 1.5 cm was used in front of the patient to create a uniform dose. rice bags and tissue - equivalent boluses were used to compensate for missing tissues and to create a uniform dose around the patient 's body. the number of fractional mus were calculated using the target prescribed dose which was in this study 200 cgy divided by the output factor of the linear accelerator (of) in cgy per mu at a distance of 400 cm (ssd) at a depth of 10 cm in water, percentage depth dose (pdd) for the patient 's separation and the try factor for the linear accelerator. tlds were calibrated with 6 mv photon beams using a 600 c machine (palo alto, ca, usa) with a field size of 10 cm 10 cm and ssd of 100 cm. the tlds were exposed to 100 cgy, and the reading output from the chamber was recorded. the chamber used was a farmer chamber (nuclear enterprises 0.6 cc, model 2571, serial number 1504, radiation products design, inc, 6 mn, and usa). ionization chamber cross calibration was done using method based on iaea-398, in terms of absorbed dose to water (dw), beam quality (qo) and correction factor for quality beam (kq0) in reference point of an ion chamber. the same set of tld, in which each set contains three tld chips, was used with six patients out of the total number of patients, and the readings were recorded. the selected point 's doses were verified by placing a set of three tld at the entrance and exit side of body. the ten total points that were selected were the neck (right and left), lungs (right and left), midline point of the patient which is between the legs, abdominal area (right and left), umbilicus level, and right knee ; the last point was the ionization chamber point which was used at the groin for absolute dose verification, placed between the thighs in the mid - perineal region to monitor the dose during treatment. the output reading from the chamber was divided by the reading when it is used with a patient and multiplied by 200cgy (which is the fractional dose for each patient) to give us the calibrations factor for the tld. the tlds were read after 24 hours and the average of the readings was calculated using a commercial tld reader (tld system 4000, harshow, usa). onedose mosfet detectors (fig 1) were first zeroed by the handheld reader immediately before irradiation, and then were placed at the ten selected anatomical points for every patient. following the treatment the detectors were collected from the patients and then two minutes later, each detector was placed in the handheld reader, and the result of measured doses was recorded. measured doses from the mosfet and tld were then compared with the target prescribed dose for each point. data from each sample were run in duplicate and expressed as means sd (cgy, n = 12 patients). the results were compared using one - way anova analysis followed by turkey 's test for multiple comparisons. statistical analysis was performed using a graphpad prism package for personal computers (graphpad software, inc., san diego, usa) and figures were drawn using a grafit package for personal computers (erithacus software limited, surrey, uk). the thermoluminescent detectors used were the lif chip type (tld-100, 3 3 0.9 mm) (harshaw, bicron - ne solon, oh, us). the metal oxide semiconductor field - effect transistors were onedose mosfet detectors (sicel technologies, inc, morrisville, nc ; distributed by medtec, orange city, usa. the onedose system with the detector (left), and close - up of the detector (right). twelve adult patients, all diagnosed with acute lymphoblastic leukemia (all) participated in this study. all patients signed an informed consent for the study prior to treatment. the patients were selected on the basis of having the same prescribed dose and a similar pathology report to our other all patients. the total target prescribed dose was 1200 cgy delivered in six fractions as recommended by the aapm task group 29. through greater understanding of bone marrow recovery, the total dose of 1200 cgy has been determined to be effective and less toxic. less toxicity occurs with this dose even when large amounts of bone marrow are exposed. monitoring the skin dose during tbi treatment, it is essential to monitor the dose that is actually delivered and compare it with the target prescribed dose. the tbi technique used in the department of radiation oncology, king fasial specialist hospital and research center, riyadh, saudi arabia takes into account the recommendations of the aapm task group 29 by delivering two opposed bilateral fields, right lateral and left lateral, using extended source - to - skin distance (ssd). the patient is supine and the radiation beam is directed horizontally across the treatment room directly on the patient. the treatment is delivered at a source - to - surface distance (ssd) of 400 cm, with a radiation field size of 40 40 cm at one meter and the collimator rotated through 45 using 18 mv x - ray beams generated by a varian clinac-2300 ex linear accelerator (palo alto, california, usa). a perspex beam spoiler with a thickness of 1.5 cm was used in front of the patient to create a uniform dose. rice bags and tissue - equivalent boluses were used to compensate for missing tissues and to create a uniform dose around the patient 's body. the number of fractional mus were calculated using the target prescribed dose which was in this study 200 cgy divided by the output factor of the linear accelerator (of) in cgy per mu at a distance of 400 cm (ssd) at a depth of 10 cm in water, percentage depth dose (pdd) for the patient 's separation and the try factor for the linear accelerator. tlds were calibrated with 6 mv photon beams using a 600 c machine (palo alto, ca, usa) with a field size of 10 cm 10 cm and ssd of 100 cm. the tlds were exposed to 100 cgy, and the reading output from the chamber was recorded. the chamber used was a farmer chamber (nuclear enterprises 0.6 cc, model 2571, serial number 1504, radiation products design, inc, 6 mn, and usa). ionization chamber cross calibration was done using method based on iaea-398, in terms of absorbed dose to water (dw), beam quality (qo) and correction factor for quality beam (kq0) in reference point of an ion chamber. the same set of tld, in which each set contains three tld chips, was used with six patients out of the total number of patients, and the readings were recorded. the selected point 's doses were verified by placing a set of three tld at the entrance and exit side of body. the ten total points that were selected were the neck (right and left), lungs (right and left), midline point of the patient which is between the legs, abdominal area (right and left), umbilicus level, and right knee ; the last point was the ionization chamber point which was used at the groin for absolute dose verification, placed between the thighs in the mid - perineal region to monitor the dose during treatment. the output reading from the chamber was divided by the reading when it is used with a patient and multiplied by 200cgy (which is the fractional dose for each patient) to give us the calibrations factor for the tld. the tlds were read after 24 hours and the average of the readings was calculated using a commercial tld reader (tld system 4000, harshow, usa). onedose mosfet detectors (fig 1) were first zeroed by the handheld reader immediately before irradiation, and then were placed at the ten selected anatomical points for every patient. following the treatment the detectors were collected from the patients and then two minutes later, each detector was placed in the handheld reader, and the result of measured doses was recorded. measured doses from the mosfet and tld were then compared with the target prescribed dose for each point. data from each sample were run in duplicate and expressed as means sd (cgy, n = 12 patients). the results were compared using one - way anova analysis followed by turkey 's test for multiple comparisons. statistical analysis was performed using a graphpad prism package for personal computers (graphpad software, inc., san diego, usa) and figures were drawn using a grafit package for personal computers (erithacus software limited, surrey, uk). the thermoluminescent detectors used were the lif chip type (tld-100, 3 3 0.9 mm) (harshaw, bicron - ne solon, oh, us). the metal oxide semiconductor field - effect transistors were onedose mosfet detectors (sicel technologies, inc, morrisville, nc ; distributed by medtec, orange city, usa. the onedose system with the detector (left), and close - up of the detector (right). twelve adult patients, all diagnosed with acute lymphoblastic leukemia (all) participated in this study. all patients signed an informed consent for the study prior to treatment. the patients were selected on the basis of having the same prescribed dose and a similar pathology report to our other all patients. the total target prescribed dose was 1200 cgy delivered in six fractions as recommended by the aapm task group 29. through greater understanding of bone marrow recovery, the total dose of 1200 cgy has been determined to be effective and less toxic. less toxicity occurs with this dose even when large amounts of bone marrow are exposed. monitoring the skin dose during tbi treatment is considered an essential tool for quality assurance in radiation therapy. for tbi, it is essential to monitor the dose that is actually delivered and compare it with the target prescribed dose. the tbi technique used in the department of radiation oncology, king fasial specialist hospital and research center, riyadh, saudi arabia takes into account the recommendations of the aapm task group 29 by delivering two opposed bilateral fields, right lateral and left lateral, using extended source - to - skin distance (ssd). the patient is supine and the radiation beam is directed horizontally across the treatment room directly on the patient. the treatment is delivered at a source - to - surface distance (ssd) of 400 cm, with a radiation field size of 40 40 cm at one meter and the collimator rotated through 45 using 18 mv x - ray beams generated by a varian clinac-2300 ex linear accelerator (palo alto, california, usa). a perspex beam spoiler with a thickness of 1.5 cm was used in front of the patient to create a uniform dose. rice bags and tissue - equivalent boluses were used to compensate for missing tissues and to create a uniform dose around the patient 's body. the number of fractional mus were calculated using the target prescribed dose which was in this study 200 cgy divided by the output factor of the linear accelerator (of) in cgy per mu at a distance of 400 cm (ssd) at a depth of 10 cm in water, percentage depth dose (pdd) for the patient 's separation and the try factor for the linear accelerator. tlds were calibrated with 6 mv photon beams using a 600 c machine (palo alto, ca, usa) with a field size of 10 cm 10 cm and ssd of 100 cm. the tlds were exposed to 100 cgy, and the reading output from the chamber was recorded. the chamber used was a farmer chamber (nuclear enterprises 0.6 cc, model 2571, serial number 1504, radiation products design, inc, 6 mn, and usa). ionization chamber cross calibration was done using method based on iaea-398, in terms of absorbed dose to water (dw), beam quality (qo) and correction factor for quality beam (kq0) in reference point of an ion chamber. the same set of tld, in which each set contains three tld chips, was used with six patients out of the total number of patients, and the readings were recorded. the selected point 's doses were verified by placing a set of three tld at the entrance and exit side of body. the ten total points that were selected were the neck (right and left), lungs (right and left), midline point of the patient which is between the legs, abdominal area (right and left), umbilicus level, and right knee ; the last point was the ionization chamber point which was used at the groin for absolute dose verification, placed between the thighs in the mid - perineal region to monitor the dose during treatment. the output reading from the chamber was divided by the reading when it is used with a patient and multiplied by 200cgy (which is the fractional dose for each patient) to give us the calibrations factor for the tld. the tlds were read after 24 hours and the average of the readings was calculated using a commercial tld reader (tld system 4000, harshow, usa). onedose mosfet detectors (fig 1) were first zeroed by the handheld reader immediately before irradiation, and then were placed at the ten selected anatomical points for every patient. following the treatment the detectors were collected from the patients and then two minutes later, each detector was placed in the handheld reader, and the result of measured doses was recorded. measured doses from the mosfet and tld were then compared with the target prescribed dose for each point. data from each sample were run in duplicate and expressed as means sd (cgy, n = 12 patients). the results were compared using one - way anova analysis followed by turkey 's test for multiple comparisons. statistical analysis was performed using a graphpad prism package for personal computers (graphpad software, inc., san diego, usa) and figures were drawn using a grafit package for personal computers (erithacus software limited, surrey, uk). the 12 patients in this study were between 18 - 34 years old with a mean age of 22 years. patient 's characteristics table 2 shows the means sd of the measured skin doses for the selected ten anatomical sites in each patient measured either by onedose mosfet or tlds. the results indicated that the dosimeter measurements using the onedose mosfet or tlds gave precise measurements compared to the prescribed dose. there was agreement between the detectors and the target prescribed doses especially in the flat surfaces of the body. measured skin doses means and sd, (n = 12 patients) for selected points in adult patients with mosfet (n = 6) and tld (n = 6) during tbi treatment with linac 2300 ex. the skin dose was measured for a single fraction from parallel opposed field for each patient. figure 2 shows the means and sd of the prescribed dose and the doses measured by onedose mosfet detectors and tlds for all ten sites measured. there was no significant difference between the measured dose by using either mosfet or tld in comparison with and the target prescribed dose. means + sd, n=12 patients of the prescribed dose and measured doses using one dose mosfet (n=6 patients) and tlds (n=6 patients). ns : not significantly different as compared the target prescribed dose with either one - dose mosfet or tlds (anova analysis, turkey 's test for multiple companion tests). for tbi it is vital to measure and monitor the skin dose using patient 's dosimetry such as mosfets or tld. the present study was designed to measure variation between skin dose measurements using onedose mosfet detectors and tld in tbi. precise dose measurement is important because clinical decisions are currently made with respect to skin dose. it is necessary to monitor the skin reaction while ensuring accurate dose delivery to patients. our data showed no significant difference between the measured doses using either mosfet or tld in comparison with the target prescribed dose. theses variations could be a result of additional buildup from the rice bag and/or the bolus placed on the patient 's anatomical sites, since the use of a 1.5-cm acrylic spoiler plate, the bolus, and the large field size should have been in a relatively flat dose region close to depth of the maximum dose. furthermore, although the onedose mosfet has an inherent buildup of 0.88 mm, we expected that the dose absorbed by the mosfet detectors and tld should have been nearly the same at most of the selected points. rice bags have an approximate thickness of 2 cm ; we put detectors beyond the depth of the maximum dose, where the additional inherent buildup of the mosfet should have led to a negligible decrease in the percent difference of 3% compared to the measurements close to depth of the maximum dose. the quality control of the tld reading and calibration procedures for the onedose detectors may have added to differences between the readings. on other hand, the discrepancies could result from errors made in the tld determination or evaluation, such as placement errors of the tld chips, insufficient shielding, or inadequate patient immobilization. however, the difference between the neck and umbilicus is larger than expected ; therefore, we suspected the difference to be the result of statistical uncertainty of both the tlds and the mosfets. our results are consistent with previous studies that found a small variation between the measured doses using mosfet as compared to the ones measured by tld [1214 ]. no significant difference between the onedose mosfet detectors and tlds compared to the target prescribed dose during the treatment of tbi for all were found in this study. however, the onedose mosfet detectors are easier to use than the tlds with wireless set - up and factory calibration. the onedose mosfet dosimeters, due to reliable and fast real time monitoring, were preferred to measurements using tlds. mosfet is therefore, a suitable option when measuring skin dose for total body irradiation treatment. | background : total body irradiation is a protocol used to treat acute lymphoblastic leukemia in patients prior to their bone marrow transplant. it involves the treatment of the whole body using a large radiation field with extended source - skin distance. therefore, it is important to measure and monitor the skin dose during the treatment. thermoluminescent dosimeters (tlds) and the onedose metal oxide semiconductor field effect transistor (mosfet) detectors are used during treatment delivery to measure the radiation dose and compare it with the target prescribed dose.aims:the primary goal of this study was to measure the variation of skin dose using onedose mosfet detectors and tld detectors, and compare the results with the target prescribed dose. the secondary aim was to evaluate the simplicity of use and determine if one system was superior to the other in clinical use.material and methods : the measurements involved twelve adult patients diagnosed with acute lymphoblastic leukemia. tld and onedose mosfet dosimetry were performed at ten different anatomical sites of each patient.results:the results showed that there was a variation between skin dose measured with onedose mosfet detectors and tld in all patients. however, the variation was not significant. furthermore, the results showed for every anatomical site there was no significant different between the prescribed dose and the dose measured by either tld or onedose mosfet detectors.conclusion:there were no significant differences between the onedose mosfet and tlds in comparison to the target prescribed dose. however, onedose mosfet detectors give a direct read - out immediately after the treatment, and their simplicity of use to compare with tld detectors may make them preferred for clinical use. |
as part of a national study to evaluate addiction tcs in the kingdom of saudi arabia, the author visited all saudi addiction tcs (in saudi arabia, there are only 5 tcs) in september, october and november of 2014. at least one week was spent in each tc, evaluating infrastructure, policies and procedures, treatment and rehabilitation programs, and staff competencies. many tools were used in the evaluations, including questionnaires for residents and treatment teams ; interviews with directors, treatment teams and residents ; observations of tc approaches and activities ; and reviews of documents and residents files.18 at the end of each tc visit, using these observations and tools, a short version of the seeq was completed. the internal review board of the college of medicine, al imam muhammad ibn saud islamic university, riyadh, kingdom of saudi arabia ethically approved the design and execution of this study. the survey instrument consisted of the seeq, which is the most well studied and validated questionnaire to investigate the essential elements of tc. melnick & de leon developed the seeq constructs (dimensions, domains, and items) based on a theoretical framework of the tc treatment model.22,23 a national panel of 11 tc directors and one research expert conducted a modified delphi process of the questionnaire and made further modifications and amendments after an extensive review.3,20 the final questionnaire contained 135 likert - type items arranged in 6 broad dimensions highlighting the different components of tc treatment, and 27 domains reflecting the core philosophy and essential components.3,18,20 respondent evaluated every item with the accompanying scale : 0=objectionable ; 1=very little importance ; 2=some importance ; 3=moderate importance ; 4=fairly important ; 5=extremely important. for this study, the short version of the seeq was used, which amended the original seeq by condensing and consolidating different items per domain into one statement (table 1).18,20 the original seeq demonstrates high overall reliability, with a cronbach s alpha value of 0.97. the short version of the seeq exhibited cronbach s alpha values of 0.81 and 0.85 in 2 independent samples,3,20 suggesting that it has an acceptable reliability. survey of essential elements questionnaire (short version) domain scores utilized at tcs in kingdom of saudi arabia. data were collected and stored in microsoft excel 2010, then coded and imported into statistical package for social sciences, version 20.0 (ibm inc, chicago, illinois, usa) for analysis. mean and standard deviation were calculated for each domain for all tcs and for all dimensions of each tc. one - way analysis of variance (anova) was used to determine whether there were any differences in scoring among the tcs. the confidence interval was set at 95%, where a corresponding p - value<0.05 was used to identify statistical significance. as part of a national study to evaluate addiction tcs in the kingdom of saudi arabia, the author visited all saudi addiction tcs (in saudi arabia, there are only 5 tcs) in september, october and november of 2014. at least one week was spent in each tc, evaluating infrastructure, policies and procedures, treatment and rehabilitation programs, and staff competencies. many tools were used in the evaluations, including questionnaires for residents and treatment teams ; interviews with directors, treatment teams and residents ; observations of tc approaches and activities ; and reviews of documents and residents files.18 at the end of each tc visit, using these observations and tools, a short version of the seeq was completed. the internal review board of the college of medicine, al imam muhammad ibn saud islamic university, riyadh, kingdom of saudi arabia ethically approved the design and execution of this study. the survey instrument consisted of the seeq, which is the most well studied and validated questionnaire to investigate the essential elements of tc. melnick & de leon developed the seeq constructs (dimensions, domains, and items) based on a theoretical framework of the tc treatment model.22,23 a national panel of 11 tc directors and one research expert conducted a modified delphi process of the questionnaire and made further modifications and amendments after an extensive review.3,20 the final questionnaire contained 135 likert - type items arranged in 6 broad dimensions highlighting the different components of tc treatment, and 27 domains reflecting the core philosophy and essential components.3,18,20 respondent evaluated every item with the accompanying scale : 0=objectionable ; 1=very little importance ; 2=some importance ; 3=moderate importance ; 4=fairly important ; 5=extremely important. for this study, the short version of the seeq was used, which amended the original seeq by condensing and consolidating different items per domain into one statement (table 1).18,20 the original seeq demonstrates high overall reliability, with a cronbach s alpha value of 0.97. the short version of the seeq exhibited cronbach s alpha values of 0.81 and 0.85 in 2 independent samples,3,20 suggesting that it has an acceptable reliability. survey of essential elements questionnaire (short version) domain scores utilized at tcs in kingdom of saudi arabia. data were collected and stored in microsoft excel 2010, then coded and imported into statistical package for social sciences, version 20.0 (ibm inc, chicago, illinois, usa) for analysis. mean and standard deviation were calculated for each domain for all tcs and for all dimensions of each tc. one - way analysis of variance (anova) was used to determine whether there were any differences in scoring among the tcs. the confidence interval was set at 95%, where a corresponding p - value<0.05 was used to identify statistical significance. the average total score of saudi addiction tcs on the short version of the seeq was 3.7 of 5 (table 1). on the individual dimensions, the tcs scored 4.2 on the tc perspective 4.15, on the agency treatment approach and structure 3.72, on community as therapeutic agent 4.40, on educational and work activities 2.60, on formal therapeutic elements 3.50 and 4.30 on process (table 2). there were no statistically significant differences between the tcs in the dimension scores (table 2). academic and/or vocational training is available (2.4), life skills training is available (2.2), treatment approach is centered on member participation (2.8), and family members are included as part of therapy (2.8). mean survey of essential elements questionnaire (short version) dimension scores among tcs in the kingdom of saudi arabia. no statistical significant value at 0.05, standard deviations are shown in parentheses, tc - therapeutic communities addiction tcs in the kingdom of saudi arabia scored fairly highly on the seeq questionnaire, which reflects a good implementation of the tc essential elements. this scoring is not far from american and european tcs scores.3,19,20 however, the saudi tcs were rated by an independent addiction tc expert who stayed at and observed each tc for one week, rather than a tc director, which may add more validity to the scores and reduce conflicts of interest. this achievement is shared by all saudi addiction tcs, which may reflect the strict standards and policies held by the related licensing authority. the dammam addiction tc was the first and only tc in saudi arabia for more than 9 years, serving as a role model for the development of other addiction tcs, which may provide another explanation for the high scoring and lack of variability between the saudi tcs. they scored between 3.3 and 4.3 out of 5 in all dimensions except educational and work activities, which had an average score of 2.8. the low scoring in this dimension was observed in all tcs, which may reflect a lesser focus on academic, vocational and life skills training. saudi tcs scored even 3 or more in all domains of other dimensions except in 2 ; however, each of these scores was limited to a single tc. in conclusion however, the essential components of this model tested by seeq may need special adaptation to the social culture and values. vocational ; life - skills training, and work activities are essential elements of tcs and represent major elements in rehabilitation programs to which saudi tcs aspire. low scoring in this dimension warrants further studies to analyze the situation, investigating for the causes and suggesting solutions. although the existence of the essential elements in the saudi tcs may point indirectly to treatment efficacy through good quality program implementation, other elements of tcs like infrastructure, treatment team competencies, resident and family satisfaction, and quality of services have to be evaluated to properly gauge saudi tc efficacy. a longitudinal outcome - based effectiveness study would be the best measure of saudi addiction tc efficacy. | objective : to investigate whether saudi therapeutic communities (tcs) implement essential elements of tcs.methods:this is a cross sectional study where the author visited all of the saudi addiction tcs between september and december 2014. at least one week was spent in each tc, attending many therapeutic activities, reviewing patient files and program documents, and interviewing directors, treating teams and residents. at the end of each visit, a short version of the survey of essential elements questionnaire (seeq) was conducted, which is a reliable tool to evaluate the essential elements of tcs.results:in 2014, there were only 5 tcs in saudi arabia. all of them were traditional tcs for adult male residents. the average total score was 3.72 out of 5 on the seeq. regarding the 6 dimensions of the seeq, the tcs scored 4.15 on the tc perspective, 3.72 on the agency treatment approach and structure, 4.40 on community as therapeutic agent, 2.60 on educational and work activities, 3.50 on formal therapeutic elements, and 4.3 on process. there were no significant differences in dimensions scores among the 5 saudi tcs.conclusion:in general, all of the saudi tcs scored fairly high on the seeq, which may reflect a sufficient implementation of the tc as a therapeutic model. educational and work activities lagged behind the other dimensions and should be improved and re - evaluated. |
the main aim of radiotherapy is to maximize the tumor control probability with less complication to the surrounding critical structures. a treatment plan is generated based on this simple rule and several methods of treatment delivery techniques, including 3d conformal radiotherapy, intensity modulated radiation therapy (imrt), stereotactic radiosurgery / radiotherapy, image - guided radiotherapy, brachytherapy are currently available in radiotherapy. each of the above techniques has its own advantages and disadvantages in achieving the goal. in fractionated radiotherapy, the biological factors that affect response of normal and tumor tissues are repair, repopulation, reoxygenation, redistribution, and radiosensitivity (5r 's of radiobiology). in reality, it is difficult to quantify the individual effect these factors have on normal tissues and tumor tissues for a routine clinical case. based on previous clinical experience, the radiation oncologists prescribe the dose to the tumor after critical evaluation of the dose to critical structures. in external beam radiotherapy, dose - volume histograms (dvh) play a key role in selecting the optimal plan for treatment delivery and it is presented in the form of cumulative dvh[24 ] and differential dvh. indices such as conformality index (ci) and dose homogeneity index have been proposed to assess the target coverage and dose uniformity inside the target volume. in addition to these, slice - based plan evaluation methods were also proposed for treatment plan evaluation. the dose to critical structures plays a key role in treatment plan evaluation and presents a major challenging parameter in radiotherapy treatment planning. the dose to critical structure is analyzed based on the information available from the dvh. the concept of minimal (td5/5) and maximal (td50/5) tissue tolerance dose was introduced by rubin and casserett in 1972 and applied to whole or partial organ volume receiving daily fractionations of 1.8 - 2 gy. the tolerance dose td5/5 represents the radiation dose that would result in 5% risk of severe complications within 5 years after irradiation and td50/5 represents the dose that would result in 50% probability of developing severe complications within 5 years after irradiation. a landmark publication by emami. compiled the normal tissue tolerance doses for various critical structures in terms of td5/5 and td50/5 and it is widely used in radiotherapy treatment planning. these normal tissue tolerance data are defined for uniformly irradiated 1/3, 2/3, and 3/3 partial volumes of the normal tissues and organs and are applicable for conventional fractionation schedules of 1.8 - 2 gy per fraction, 5 fractions a week. even though, many other researchers have also reported the tolerance doses for individual organs, but the data are scattered in the literature and the tolerance doses for same organ differ among different investigators. recently, a new set of recommendations known as the quantitative analysis of normal tissue effects in the clinic (quantec) has been published based on evidence - based guidelines.[1012 ] the tolerance data published by emami. represents the dvh in the form of 1/3, 2/3, and 3/3 of a critical structure and it is much simpler to compare two plans. in this study, a simple index, pni has been proposed for treatment plan evaluation, based on the doses to surrounding critical structures and on correlating these dose values with the tolerance dose compiled by emami. and kehwar. to demonstrate the proposed index, four different critical treatment sites that include prostate, upper abdominal cancer (uac), lung, and head and neck were selected for this study. all the patients were planned on eclipse treatment planning system. in case of prostate, five different treatment plans : (1) three fields with open anterior and two lateral wedged fields (3f), (2) three fields with open anterior and two lateral wedged fields (3f - m) fitted with mulitleaf collimator (mlc), (3) four field box technique fitted with mlc (4f - m), (4) six fields fitted with mlc (6f - m), and (5) seven field intensity modulated radiotherapy technique (imrt) were generated in the treatment planning system. for plan comparison, the dvh for the bladder, rectum, right femur, and left femur were exported to a software (pnicalc) developed in visual basic.net 2008 (microsoft corporation) that computes pni. figure 1 shows the screen shot of pnicalc comparing the dvh of two rival plans. the software has the provision for importing the dvh data from the treatment planning system and the user can select the critical structures to be included for pni computation. in addition to this, the pnicalc can also compute the ratio of near - maximum to near - minimum doses (d2/d98) to the target volume, volume of planning target volume (ptv) receiving greater than 107% (d > 107%) and less than 95% (d 107%, d < 95%, and ci. the figure also shows that the percentage of rectum volume receiving v65, v70, and v75 exceeds the threshold limit recommended by quantec for six - field 3d - crt plan. the pni for 3f, 3f - m, 4f - m, 6f - m, and 7f - imrt were 1.54, 1.30, 1.27, 0.96, and 0.73, respectively. (1), pni can also be computed for individual structures as shown in table 2 and these values illustrate the ratio of actual dose received by a partial / whole volume to the tolerance dose. these figures indicate that imrt considerably reduces the doses to the overall combined critical structures as compared to other techniques and 3f - o results in more doses to the critical structures. the rectal and femoral doses are significantly affected with the number and orientation of treatment fields. 3f - m, 4f - m, 6f and 7f - imrt were 1.90, 1.29, 1.34, 1.27, and 1.09, respectively. figure 2 shows the prescription isodose colorwash for the 3-f mlc plan and imrt for uac and figure 3 compares the dvh of ptv, ctv, rt. the ci computed for the 3f - mlc and imrt were 1.6 and 1.16, respectively. the computed pni for 3f - mlc and imrt were 1.26 and 1.05 indicating that imrt relatively reduces the overall dose to critical structures. figure 4 shows the comparison of 3d - crt and imrt plan for lung cancer. table 4 shows the comparison of pni with 3d - crt and imrt for lung cancer. in this particular case, the decrease in the dose to right lung and liver with imrt is offsetted by dose to the contralateral lung and spinal cord. but at the same time, the imrt plan demonstrates a good ci (1.16) as compared to 1.45 for 3d - crt. table 5 shows the comparison of pni with 3d - crt and imrt for head and neck cancer. the pni for 3d - crt and imrt were 3.27 and 1.77, respectively. in the case of 3d - crt, both the parotids have exceeded the tolerance doses due to the arrangement of parallel opposed fields to a dose of 50 gy and hence the pni for parotids are high as compared to imrt plan. comparison of pni with different treatment planning techniques for prostate cancer comparison of prescription isodose color wash for 3-f mlc plan (3d - crt) and imrt for uac comparison of dose - volume histograms for 3-f mlc and imrt treatment plans comparison of pni with 3d - crt and imrt for upper abdominal malignancy comparison of 3-f mlc plan and imrt for lung cancer comparison of pni with 3d - crt and imrt for a lung cancer comparison of pni with 3d - crt and imrt for a head and neck cancer the pni is a function of critical structures and 1/3, 2/3, 3/3 fraction of the critical structure and which can also be used for evaluating the treatment plans for a given fraction of the structure volume. the 1/3, 2/3, and 3/3 of the dvh curve represent the overall dvh for the critical structure and by incorporating these parameters for computing the pni gives an overall trend of the dvh. are used in many clinics for assessing the normal tissue complications and form the basis of the decision - making process conducted by the radiation oncologist. the proposed index is applicable to treatment plans with conventional fractionation schedule of 1.8 - 2 gy per fraction. the tissue tolerance data are stored in the software and it has the flexibility for the user to add any new tolerance data to the existing tissue tolerance table. the pni should be as low as possible for a given plan and if it reaches 3 then all / most of the critical structures have exceeded the tolerance dose. it is clearly evident from table 5 that the pni with 3d - crt has exceeded 3, thus indicating that both of the parotids are receiving higher than the acceptable tolerance doses predicting possible xerostomia. if the pni for a partial / whole organ of an individual structure exceeds 1, then the plan has resulted in a dose higher than the tolerance dose. the treatment plan, 3f - o in table 2 shows that rectum and right and left femur have exceeded the tolerance dose. similarly in table 5, with 3d - crt both of the parotids have exceeded their tolerance dose. except for the lung cancer treatment plan, all other plans showed that imrt considerably reduced the overall dose to surrounding critical structures. in the case of lung cancer, five beams were employed resulting in a good ci as compared to 3d - crt with three fields. moreover the orientation of the treatment fields with 3d - crt resulted in less dose to the spinal cord. 1 incorporates the minimal tolerance dose (td5/5) and can also be used for computing pni for maximal tolerance dose (td50/5) by substituting td5/5 with td50/5.. are applicable to a uniform dose distribution, they are frequently used in radiotherapy in most situations for assessing the normal tissue complications, and moreover the proposed pni is essentially used for comparing treatment plans. the comparison of the overall pni can be used for comparing rival plans, and their subsets can be used for analyzing the plan selected for treatment. the proposed index, pni provides a quick comparison of the treatment plans for the radiation oncologist and also for the physicist to assess their treatment plans. the comparison of treatment plans based on quantec recommendations helps in identifying those structures that exceed the threshold limit as set by the quantec guidelines. the proposed index, pni, gives a quick comparison of the plan that results in reduced dose to the critical structures and totally relies on the tolerance doses to the critical structures. | the dose to critical structures plays a very important role in treatment plan evaluation and forms a major challenging parameter in radiotherapy treatment planning. in this study, a simple index, plan normal tissue complication index (pni) has been proposed for treatment plan evaluation based on the dose to surrounding critical structures. to demonstrate the proposed index, four different critical treatment sites that include the prostate, upper abdominal cancer, lung, and head and neck were selected for this study. a software progam (pnicalc) has been developed to compute the pni from the exported dose - volume histogram data and from the tissue tolerance data published by emami. and kehwar. the software also shows the parameters that exceed the threshold limits of dose - volume parameters presented in the quantec recommendations (2010). in all the studied cases, pni gave an overall picture of the dose received by the critical structures and also indicate the fractional volume exceeding the tolerance limit. the proposed index, pni gives a quick comparison and selection of treatment plans that result in reduced dose to the critical structures. it can be used as an additional tool for routine treatment plan evaluation in external beam radiotherapy. |
high - titer engineered retrovirus (110unit / ml) is produced by co - transfection of retroviral vectors and vsvg into hek293 t cells, followed by ultracentrifugation of viral supernatant. for sources and production methods, see the excellent jove demonstration (3). note : young adult (4 - 6 weeks old) female c57bl/6 mice (charles river) are housed under standard conditions. all procedures follow the national research council 's guide for the care and use of laboratory animals under a protocol approved by the stony brook university iacuc. anaesthetize (100 g ketamine + 10 g xylazine per gram body weight) and mount the animal on a stereotaxic frame (steolting). remove the hair on the head and wipe the skin with 70% ethanol. expose the skull and drill four shallow holes using a dental drill (0.6 mm drill bit) at the following coordinates : anterioposterior = -2 mm from bregma ; lateral = 1.6 mm ; ventral = 2.5 mm ; anterioposterior = -3 mm from bregma ; lateral = 2.6 mm ; ventral = 3.2 mm.anterioposterior = -2 mm from bregma ; lateral = 1.6 mm ; ventral = 2.5 mm ; anterioposterior = -3 mm from bregma ; lateral = 2.6 mm ; ventral = 3.2 mm. anterioposterior = -2 mm from bregma ; lateral = 1.6 mm ; ventral = 2.5 mm ; anterioposterior = -3 mm from bregma ; lateral = 2.6 mm ; ventral = 3.2 mm. anterioposterior = -2 mm from bregma ; lateral = 1.6 mm ; ventral = 2.5 mm ; anterioposterior = -3 mm from bregma ; lateral = 2.6 mm ; ventral = 3.2 mm. mount a 1l hamilton, flat - tip syringe and inject 0.5 l retrovirus per site at a rate of 0.25 l / min into the dentate gyrus. pause 2 minutes after each injection before slowly withdrawing the syringe to prevent fluid backflow. between injections, briefly rinse the external surface of the syringe tip with sterile pbs and an applicator to remove traces of blood. close the wound with sterile surgical suture material (type p-1 ; size 6 - 0) and return the animal to standard housing conditions until the desired time stages after injection. to obtain high - quality acute slices from adult mice, we use a modified cutting solution for slice preparation (see below). pre - chill cutting solution to 0 - 4 c on ice and bubble with 95% o2 - 5% co2 for at least 30 minutes. anaesthetize and transcardially perfuse an animal with ice - cold oxygen - saturated cutting solution. quickly remove the brain into a petri - dish with filter - paper pre - wetted with cold, oxygenated cutting solution. cut off the cerebellum and slice a mounting surface at least 1 mm anterior to the (visible) injection coordinates. glue the brain -onto a vibrotome stage and mount it into the cutting chamber filled with cold and oxygenated cutting solution. prepare coronal or horizontal slices (300 - 350m) and transfer them with a large - bore pipette to an incubating chamber containing room - temperature acsf bubbled with 95% o2/5% co2. incubate the slices, bubbling continuously, at 32c for 30 - 60 minutes. return the chamber to room temperature for the duration of the recording. slices are transferred into the recording chamber which is continuously perfused with oxygen - saturated acsf at 32c - 34c. a bipolar tungsten stimulation electrode is placed in the molecular layer of the dentate gyrus using a low magnification microscope objective (10x). newborn dgcs in the sub - granular zone/ granular cell layer are identified by the expression of gfp or dtomato. whole - cell patchclamp recording is performed on newborn neurons under high magnification (40x). firing properties of the recorded cells are obtained by injection of a series of currents under current - clamp mode. electric stimuli are delivered by the stimulation electrode via a stimulation isolator controlled by the recording software, and evoked postsynaptic currents in the newborn dgcs are recorded. amplitudes of evoked postsynaptic responses are analyzed at different developmental stages of adult - born neurons. using the above protocol, gfp expression in newborn dentate gyrus neurons similar to figure 1 is common. note that newborn neurons are easily visualized and both dendrites and axons are robustly labeled. expression in thin dgc axons and small spines depends on the quality and titer of the virus, the promoter used and the length of in vivo expression. in our hands, newborn cells and sub - cellular organelles are usually visible within a few days following injection, and spine expression can be traced from the earliest stages of development. whole - cell recordings from newborn neurons at different time stages allow the study of unique newborn cell properties, e.g. action potentials (figure 2a), as well as the process of synaptic integration into existing neural circuits during maturation (figure 2b). figure 1 2-photon confocal image of newborn neurons in a horizontal dentate gyrus section of an adult mouse. green cells are 21dpi (days post injection) gfp - expressing newborn dgcs labeled with pux - gfp retrovirus. figure 2 a) action potential firing properties of a newborn dgc at 21 dpi. b) representative evoked excitatory postsynaptic currents (epscs) recorded on a newborn dgc at 21 dpi. high - titer engineered retrovirus (110unit / ml) is produced by co - transfection of retroviral vectors and vsvg into hek293 t cells, followed by ultracentrifugation of viral supernatant. for sources and production methods, see the excellent jove demonstration (3). note : young adult (4 - 6 weeks old) female c57bl/6 mice (charles river) are housed under standard conditions. all procedures follow the national research council 's guide for the care and use of laboratory animals under a protocol approved by the stony brook university iacuc. anaesthetize (100 g ketamine + 10 g xylazine per gram body weight) and mount the animal on a stereotaxic frame (steolting). remove the hair on the head and wipe the skin with 70% ethanol. expose the skull and drill four shallow holes using a dental drill (0.6 mm drill bit) at the following coordinates : anterioposterior = -2 mm from bregma ; lateral = 1.6 mm ; ventral = 2.5 mm ; anterioposterior = -3 mm from bregma ; lateral = 2.6 mm ; ventral = 3.2 mm.anterioposterior = -2 mm from bregma ; lateral = 1.6 mm ; ventral = 2.5 mm ; anterioposterior = -3 mm from bregma ; lateral = 2.6 mm ; ventral = 3.2 mm. anterioposterior = -2 mm from bregma ; lateral = 1.6 mm ; ventral = 2.5 mm ; anterioposterior = -3 mm from bregma ; lateral = 2.6 mm ; ventral = 3.2 mm. anterioposterior = -2 mm from bregma ; lateral = 1.6 mm ; ventral = 2.5 mm ; anterioposterior = -3 mm from bregma ; lateral = 2.6 mm ; ventral = 3.2 mm. mount a 1l hamilton, flat - tip syringe and inject 0.5 l retrovirus per site at a rate of 0.25 l / min into the dentate gyrus. pause 2 minutes after each injection before slowly withdrawing the syringe to prevent fluid backflow. between injections, briefly rinse the external surface of the syringe tip with sterile pbs and an applicator to remove traces of blood. close the wound with sterile surgical suture material (type p-1 ; size 6 - 0) and return the animal to standard housing conditions until the desired time stages after injection. to obtain high - quality acute slices from adult mice, we use a modified cutting solution for slice preparation (see below). pre - chill cutting solution to 0 - 4 c on ice and bubble with 95% o2 - 5% co2 for at least 30 minutes. anaesthetize and transcardially perfuse an animal with ice - cold oxygen - saturated cutting solution. quickly remove the brain into a petri - dish with filter - paper pre - wetted with cold, oxygenated cutting solution. cut off the cerebellum and slice a mounting surface at least 1 mm anterior to the (visible) injection coordinates. glue the brain -onto a vibrotome stage and mount it into the cutting chamber filled with cold and oxygenated cutting solution. prepare coronal or horizontal slices (300 - 350m) and transfer them with a large - bore pipette to an incubating chamber containing room - temperature acsf bubbled with 95% o2/5% co2. slices are transferred into the recording chamber which is continuously perfused with oxygen - saturated acsf at 32c - 34c. a bipolar tungsten stimulation electrode is placed in the molecular layer of the dentate gyrus using a low magnification microscope objective (10x). newborn dgcs in the sub - granular zone/ granular cell layer are identified by the expression of gfp or dtomato. whole - cell patchclamp recording is performed on newborn neurons under high magnification (40x). firing properties of the recorded cells are obtained by injection of a series of currents under current - clamp mode. electric stimuli are delivered by the stimulation electrode via a stimulation isolator controlled by the recording software, and evoked postsynaptic currents in the newborn dgcs are recorded. amplitudes of evoked postsynaptic responses are analyzed at different developmental stages of adult - born neurons. using the above protocol, gfp expression in newborn dentate gyrus neurons similar to figure 1 is common. note that newborn neurons are easily visualized and both dendrites and axons are robustly labeled. expression in thin dgc axons and small spines depends on the quality and titer of the virus, the promoter used and the length of in vivo expression. in our hands, newborn cells and sub - cellular organelles are usually visible within a few days following injection, and spine expression can be traced from the earliest stages of development. whole - cell recordings from newborn neurons at different time stages allow the study of unique newborn cell properties, e.g. action potentials (figure 2a), as well as the process of synaptic integration into existing neural circuits during maturation (figure 2b). figure 1 2-photon confocal image of newborn neurons in a horizontal dentate gyrus section of an adult mouse. green cells are 21dpi (days post injection) gfp - expressing newborn dgcs labeled with pux - gfp retrovirus. figure 2 a) action potential firing properties of a newborn dgc at 21 dpi. b) representative evoked excitatory postsynaptic currents (epscs) recorded on a newborn dgc at 21 dpi. continuous neurogenesis in the hippocampus of adult mammalian brains provides a unique experimental model system to study neuronal development and integration in the mature brain. the protocol presented here combines retroviral labeling and electrophysiological methods to study the integration of newborn dentate granule neurons in the brains of adult mice. to ensure that your experiments are successful, we recommend the following during critical steps of the procedure : to avoid unwanted infection and inflammation, all tools should be sterilized (by autoclaving, any type of sterilizer, or 70% ethanol) before surgery. use sterile pbs to wash the tip of the syringe needle before injection. for virus injection, animals must to be well mounted on the stereotaxic device and sources of unnecessary movement must be minimized during injection. make sure the head is well fixed and firm, and adjust the nose position of the mouse to level bregma and lambda prior to calculating injection coordinates. extract virus into the syringe quickly to minimize exposure to room temperatures - retroviruses are particularly temperature sensitive. inject virus slowly at the recommended rate to minimize pressure damage. using the recommended flat - tipped syringe (vs. common beveled tip) will ensure an evenly distributed dentate gyrus infection area. before preparing slices, cutting solution and incubating acsf must be bubbled with 95% o2 - 5% co2 for at least 30 minutes to allow oxygen to saturate the solutions. animals should be perfused quickly and tissue maintained in cold, oxygen - saturated solution for best slice quality. for recording, change location of the stimulation electrode within the molecular layer of dentate gyrus as necessary. in summary, the recommended approach offers a way to explore distinct properties and possible functional roles of adult - born neurons during early - stage integration into active, mature circuitry. | neurogenesis occurs in adult mammalian brains in the sub - ventricular zone (svz) of the lateral ventricle and in the sub - granular zone (sgz) of the hippocampal dentate gyrus throughout life. previous reports have shown that adult hippocampal neurogenesis is associated with diverse brain disorders, including epilepsy, schizophrenia, depression and anxiety (1). deciphering the process of normal and aberrant adult - born neuron integration may shed light on the etiology of these diseases and inform the development of new therapies.sgz adult neurogenesis mirrors embryonic and post - natal neuronal development, including stages of fate specification, migration, synaptic integration, and maturation. however, full integration occurs over a prolonged, 6-week period. initial synaptic input to adult - born sgz dentate granule cells (dgcs) is gabaergic, followed by glutamatergic input at 14 days (2). the specific factors which regulate circuit formation of adult - born neurons in the dentate gyrus are currently unknown.our laboratory uses a replication - deficient retroviral vector based on the moloney murine leukemia virus to deliver fluorescent proteins and hypothesized regulatory genes to these proliferating cells. this viral technique provides high specificity and resolution for analysis of cell birth date, lineage, morphology, and synaptogenesis.a typical experiment often employs two or three viruses containing unique label, transgene, and promoter elements for single - cell analysis of a desired developmental process in vivo. the following protocol describes a method for analyzing functional newborn neuron integration using a single green (gfp) or red (dtomato) fluorescent protein retrovirus and patch - clamp electrophysiology. |
a 35-year - old healthy lady presented with high grade fever, severe abdominal pain, nausea, vomiting and profuse watery diarrhea, sometimes green in color. there was no history of animal contact, recent travel or camping. on exam, the patient was hypotensive and was looking acutely ill. she also had hypokalemia of 3.3 mmol / l, acute kidney injury with elevated creatinine of 1.6 mg / dl from a baseline of 0.6 secondary to dehydration. murphy 's sign was positive which prompted us to do a right upper quadrant ultrasound which showed thickened gall bladder wall of upto 1 cm consistent with cholecystitis. patient started feeling better after the surgery and was discharged home. during the post - hospitalization follow - up after 2 weeks campylobacter is a small, slender, gram - negative curved rod, which is one of the most common causes of enteritis in humans. campylobacter fetus may have some attraction towards the gallbladder as in a survey, 20% of slaughtered 700 cattle and sheep harbored this bug in their gallbladder.1 campylobacter can cause cholecystitis without diarrhea unlike the case that we report here. the diagnosis of campylobacter cholecystitis is usually missed because culture of campylobacter is not routinely requested after cholecystectomy. however, even if the bile is cultured, campylobacter appears to be a less common cause of cholecystitis. darling cultured about 280 bile samples post cholecystectomy for campylobacter. but none of them grew campylobacter.2 hence routine ordering of bile culture under microaerophilic condition is not recommended unless the gram stain shows gram negative curved rods. 3 resistance of campylobacter fetus to cephalosporins and penicillins was reported as early as 1986.4 majority of the reported cases including our patient had good outcome with cholecystectomy and antibiotics especially erythromycin (see table 1). only one of the reported cases died, however she had advanced hepatocellular carcinoma.3 there is one case report of relapse of campylobacter bacteremia in a aids patient in about 8 months after the first episode of campylobacter cholecystitis.1 in conclusion, campylobacter cholecystitis is rare but should be kept in the back of the mind while treating a patient with campylobacter enteritis. | there are 13 cases of campylobacter cholecystitis reported so far in the medical literature. among them, only 4 patients had diarrhea. we report another case of acalculous cholecystitis in a setting of campylobacter enteritis. the case report is followed by a literature review regarding this rare condition. |
iranian ministry of health and medical education (mohme) began implementation of primary health care as the main theme of the healthcare networks to provide health services for all people in 1977. government policy in the health system was based on three major axes : priority of preventive services to health care servicespriority of rural and underserved areas to urban areaspriority of outpatient services to inpatient services priority of preventive services to health care services priority of rural and underserved areas to urban areas priority of outpatient services to inpatient services primary health care was established in 1980s ; afterward world health report in 2000 revealed disappointing results for iran obtaining 93 ranking amongst all countries a series of health sector reforms started in iran. some of these initiatives included : providing national health insurance for all residents in rural, tribal and urban areas with less than 20,000 populations which facilitated access to health care through rural family medicine program and referral system (2005)administration of the preliminary and pilot phases of family physician program in urban areas, and implementation of family medicine program in cities with more than 20,000 populations (approved in 2006 iran budget law). providing national health insurance for all residents in rural, tribal and urban areas with less than 20,000 populations which facilitated access to health care through rural family medicine program and referral system (2005) administration of the preliminary and pilot phases of family physician program in urban areas, and implementation of family medicine program in cities with more than 20,000 populations (approved in 2006 iran budget law). meanwhile mohme was committed to implement the family medicine program in the whole country till the end of the fourth development plan (2009), but its initiation postponed till 5 development plan as a result of budgeting issues [figure 1 ]. timeline of family medicine program in iran and tehran since more than three decades ago primary health care was the base of health care delivery systems and family physicians were the most active health care providers in developed countries. after establishment of primary health care (phc) and integration of medical education in former iranian ministry of health and formation of ministry of health and medical education (mohme), implantation of family physician program in cities accounts for the third major health program after islamic revolution in iran. family physician program and the health referral system was one of the important steps of 4 and 5 five year development plan of islamic republic of iran. studies on rural family physician program in iran disclosed substantial gains in preventive programs, especially in hindering problems related to chronic diseases, the most important concerns of public health these days and environment health. on the other hand, some studies have been performed on public awareness and attitudes about rural family physician program and the source of their information. researchers believed that since people 's appropriate knowledge about public health programs is one the major factors to get more achievements, increasing educative programs are inevitable. mohme planned to establish family physician program in tehran after confirming the success of pilot programs. as a result, in summer 2012, tehran inhabitants started to register officially and informative advertisements about the program were conducted through billboards and mass media (tv, radio, newspapers). the main objective of this study was to investigate whether these programs have been successful in informing people about the details or not ; also we aimed to demonstrate public 's attitudes about the future of family physician plan and their tendency to participate in it. households from tehran 's residential areas were included in the survey through random digit dialing (rdd) by means of within - household respondent selection method. when the random numbers dialed a house and absolutely after obtaining the consent to precede the conversation, the samples were being selected among all family members above 18 years old by the nearest birthday method. the qualified member of the family whose birthday was the latest among all was invited to participate in telephone interview. requirements for eligibility of calls included : belonging to residential areasnot being faced with answering machines during callsexistence of the qualified individual in the household members (18 years old or older without any physical or language barrier, alert and without any mental or physical problem inhibiting his / her proper participation in the survey able to communicate through phone). belonging to residential areas not being faced with answering machines during calls existence of the qualified individual in the household members (18 years old or older without any physical or language barrier, alert and without any mental or physical problem inhibiting his / her proper participation in the survey able to communicate through phone). first of all researchers reviewed all the guidelines about family physician program, published on behalf of mohme. afterwards two separate focus group discussions (fgd) were conducted around the points extracted from reviews and also to obtain group members ideas and their expectations from family physician program. discussions groups included expert (consisted of members from tehran health policy research center, community based participatory research center and knowledge utilization research center) and general population. the discussions and guideline reviews resulted in a questionnaire which was supposed to be filled out by study participants in the next step of the study to measure their knowledge, attitude and practice about the program (cronbach 's alpha = 0.73 & icc = 0.762). after preparing appropriate instruments we performed rdd method to choose study participants. we designed to ask all subjects one major question to find out their awareness about the program. in continue, those people who were aware about the program must have answer the rest of the questions as well so that we could measure their awareness level about family physician program, their attitudes towards the program and finally their tendency to participate in the program. according to the responses provided by individuals each person attributed a knowledge score of 0 - 27, this point for unaware persons also was attributed a zero knowledge score. after data gathering process and scoring the participants, data analysis were performed by spss software version 17. the most important tests we utilized included : anova, t - test and regression analysis. to compute study sample size a pilot study was conducted in compliance with all principles of rdd surveys. according to our pilot rdd study we needed 373 completed interviews. after computing in rdd sample size calculation formula, the basis for calculation of the sample size is by considering the possible completed interviews divided by the product of expected values for the rate of residential numbers, eligible respondents and the rate of cooperation within dialed numbers. detail of this formula is presented by the american association of public opinion research (aapor). this study was conducted in conformity with the institutional review board (irb) of tehran university of medical sciences, which follows the helsinki declaration on research ethics. other ethical issues (including plagiarism, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc) have been completely observed by the authors. first of all researchers reviewed all the guidelines about family physician program, published on behalf of mohme. afterwards two separate focus group discussions (fgd) were conducted around the points extracted from reviews and also to obtain group members ideas and their expectations from family physician program. discussions groups included expert (consisted of members from tehran health policy research center, community based participatory research center and knowledge utilization research center) and general population. the discussions and guideline reviews resulted in a questionnaire which was supposed to be filled out by study participants in the next step of the study to measure their knowledge, attitude and practice about the program (cronbach 's alpha = 0.73 & icc = 0.762). we designed to ask all subjects one major question to find out their awareness about the program. in continue, those people who were aware about the program must have answer the rest of the questions as well so that we could measure their awareness level about family physician program, their attitudes towards the program and finally their tendency to participate in the program. according to the responses provided by individuals each person attributed a knowledge score of 0 - 27, this point for unaware persons also was attributed a zero knowledge score. after data gathering process and scoring the participants, data analysis were performed by spss software version 17. the most important tests we utilized included : anova, t - test and regression analysis. to compute study sample size a pilot study was conducted in compliance with all principles of rdd surveys. according to our pilot rdd study we needed 373 completed interviews. after computing in rdd sample size calculation formula, the basis for calculation of the sample size is by considering the possible completed interviews divided by the product of expected values for the rate of residential numbers, eligible respondents and the rate of cooperation within dialed numbers. detail of this formula is presented by the american association of public opinion research (aapor). this study was conducted in conformity with the institutional review board (irb) of tehran university of medical sciences, which follows the helsinki declaration on research ethics. other ethical issues (including plagiarism, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc) have been completely observed by the authors. total of 386 questionnaires were completed by study participants. among all samples 48% (185) of respondents were 18 - 35 and the rest were 35 and above. more than half of them were females (79.8% female and 20.2% males), 60% (231) were housewives and 33.1% (127) of them had academic educations. considering the important principles of an unbiased rdd sampling, 386 questionnaires were completed by respondents. among total contacted numbers we reached 1500(7.5%) defined numbers (actual telephone numbers), and only 52.6% (789) attributed to residential areas. among those 789 telephone numbers 603 were eligible to perform the interviews also 148 rejected to interview or did not finish the interview (38 unfinished interviews). the response rate as defined by the aapor criterions was 80%, cooperation rate was 54% and contact rate was 28%. given tehran 's population, the margin of sampling error was 4.8% (95%confidence level) for 386 interviews, meaning that reported responses to survey questions if the entire population were to be polled were likely to fall within that range at that confidence level. among all study participants 214 persons (57.4%) gave positive response to our major question, so for the other 159 participants (42.6%) family physician program was completely unknown. 49.1% of total participants (183 subjects) had some information about the project, however most of the answers were incorrect or even completely opposite. this means that some of the aware people also got a zero score and only 6.4% of the interviewees that answered the total questionnaire had somewhat reasonable information about the family physician project (knowledge score 10). the main resource that people had obtained their information about family physician program was tv (78.8% of the people who knew the program) ; other informative resources included radio, newspapers, health providers, billboards, friends or coworkers. there was not any significant difference in average level of awareness among the groups of respondents with different source of information [table 1 ]. the information resources among population 86.8% of people who had heard about the project (186 subjects) did not have any information about the ways to choose their family physician, 34.4% (74 subjects) were aware about the possibility of changing already attributed physician. only 4.8% (91 subjects among 189) were aware about free of costs services which have been planned to be provide by family physicians. only 14.9% of those who knew about implementation of the program had some information about the rule of referral system for treating by specialist. 2.5%(47 subject) of aware participants stated that they usually do nt see any kind of physician whenever they become sick, while 146 person(77.3%) chose general practitioners and the rest 36 (18.9%) preferred specialist doctors. 74.1% (141subjects) were planning to enroll in the program and the others 25.8% (49 people) preferred not to participate. comparing two groups of aware people (those with and without willing to enroll was observed) we could nt find any mean difference between the average level of awareness between two groups. study participants were questioned about their intention to enroll in the program to receive family physician services. after responding to this question next time they should have demonstrated their degree of agreement with establishment of this program in tehran. 141 subjects (74.6% of aware participants) were determined to enroll and participate in the program ; amongst these people 85.1% (120 subjects) confirmed family physician program as a helpful program in health promotion in a city like tehran. on the other hand among those people who were in hesitation about participation in the program 52.1% (25 subjects) believed that a successful family physician program improves the quality of medical services [table 2 ]. participants opinion toward family physician program considering their intention to participate in the program participants expressed their positive or negative ideas about the implementation of the family physician program in tehran which was mostly based on their views about the experience of this program in other countries table 3 shows people 's positive and negative believes about the future of the family physician program in iran. the point here is that the positive opinions were based on what people already have seen or heard about family physician program in other countries. participants positive and negative beliefs about the future of the family physician program after designing the causal dag for variables which could have influence on person 's agreement or disagreement with implementation of family physician program in tehran, linear and logistic regression resulted in two models. as demonstrated in figure 2 in the first model participants awareness score had a significant positive influence on their agreement with the program. in second model subject 's educational level and socioeconomic status (ses), health insurance, also his / her access to internet were entered in logistic regression model. as brought in table 4 after adjustment for other factors (educational status, ses, access to internet,) people without any type of health insurance were more likely to disagree with the implementation of family physician program in tehran. directed acyclic graph for the factors influencing people 's agreement level with family physician program effective factors on person 's agreement with establishment of family physician program total of 386 questionnaires were completed by study participants. among all samples 48% (185) of respondents were 18 - 35 and the rest were 35 and above. more than half of them were females (79.8% female and 20.2% males), 60% (231) were housewives and 33.1% (127) of them had academic educations. considering the important principles of an unbiased rdd sampling, 386 questionnaires were completed by respondents. among total contacted numbers we reached 1500(7.5%) defined numbers (actual telephone numbers), and only 52.6% (789) attributed to residential areas. among those 789 telephone numbers 603 were eligible to perform the interviews also 148 rejected to interview or did not finish the interview (38 unfinished interviews). the response rate as defined by the aapor criterions was 80%, cooperation rate was 54% and contact rate was 28%. given tehran 's population, the margin of sampling error was 4.8% (95%confidence level) for 386 interviews, meaning that reported responses to survey questions if the entire population were to be polled were likely to fall within that range at that confidence level. among all study participants 214 persons (57.4%) gave positive response to our major question, so for the other 159 participants (42.6%) family physician program was completely unknown. 49.1% of total participants (183 subjects) had some information about the project, however most of the answers were incorrect or even completely opposite. this means that some of the aware people also got a zero score and only 6.4% of the interviewees that answered the total questionnaire had somewhat reasonable information about the family physician project (knowledge score 10). the main resource that people had obtained their information about family physician program was tv (78.8% of the people who knew the program) ; other informative resources included radio, newspapers, health providers, billboards, friends or coworkers. there was not any significant difference in average level of awareness among the groups of respondents with different source of information [table 1 ]. the information resources among population 86.8% of people who had heard about the project (186 subjects) did not have any information about the ways to choose their family physician, 34.4% (74 subjects) were aware about the possibility of changing already attributed physician. only 4.8% (91 subjects among 189) were aware about free of costs services which have been planned to be provide by family physicians. only 14.9% of those who knew about implementation of the program had some information about the rule of referral system for treating by specialist. 2.5%(47 subject) of aware participants stated that they usually do nt see any kind of physician whenever they become sick, while 146 person(77.3%) chose general practitioners and the rest 36 (18.9%) preferred specialist doctors. 74.1% (141subjects) were planning to enroll in the program and the others 25.8% (49 people) preferred not to participate. comparing two groups of aware people (those with and without willing to enroll was observed) we could nt find any mean difference between the average level of awareness between two groups. study participants were questioned about their intention to enroll in the program to receive family physician services. after responding to this question next time they should have demonstrated their degree of agreement with establishment of this program in tehran. 141 subjects (74.6% of aware participants) were determined to enroll and participate in the program ; amongst these people 85.1% (120 subjects) confirmed family physician program as a helpful program in health promotion in a city like tehran. on the other hand among those people who were in hesitation about participation in the program 52.1% (25 subjects) believed that a successful family physician program improves the quality of medical services [table 2 ]. participants opinion toward family physician program considering their intention to participate in the program participants expressed their positive or negative ideas about the implementation of the family physician program in tehran which was mostly based on their views about the experience of this program in other countries table 3 shows people 's positive and negative believes about the future of the family physician program in iran. the point here is that the positive opinions were based on what people already have seen or heard about family physician program in other countries. participants positive and negative beliefs about the future of the family physician program after designing the causal dag for variables which could have influence on person 's agreement or disagreement with implementation of family physician program in tehran, linear and logistic regression resulted in two models. as demonstrated in figure 2 in the first model participants awareness score had a significant positive influence on their agreement with the program. in second model subject 's educational level and socioeconomic status (ses), health insurance, also his / her access to internet were entered in logistic regression model. as brought in table 4 after adjustment for other factors (educational status, ses, access to internet,) people without any type of health insurance were more likely to disagree with the implementation of family physician program in tehran. directed acyclic graph for the factors influencing people 's agreement level with family physician program effective factors on person 's agreement with establishment of family physician program our survey emphasizes that to achieve successful results from family physician program in cities in an iranian community we need to increase public awareness about details and objectives of family physician program. enhanced awareness can appeal people 's trust towards family physicians and consequently encourage their active collaboration in this program. we identified two important factors that enhance people 's agreement with establishment of family physician program and consequently their intension to participate in the program including : awareness score (or=1.12(1.02 - 1.21)) and owning health insurance (or=2.38(1.05 - 5.38)). even though we can infer that those whose health expenses are paid via insurance companies can trust in preparing appropriate health services by another network like family physician program, still the fact that already insured people are more likely to agree with the program reveals a knowledge deficiency among population. in a recent survey about rural family physician program in iran, social workers were the most important source to inform people about the program and they had moderate awareness. our study demonstrated that the major resource which people received their information - although insignificant - about the family physician program was television. television was the most informative resource, but unfortunately those people- who had been informed through television also had very low levels of awareness. previous studies also suggested that users awareness about newly established programs helps to obtain more desirable achievements. specifically when users of family physicians services in rural regions did not have efficient knowledge about the conditions and benefits of family physician program 's health coverage facility, they did not cooperate well in this program as well. current research showed that people who already had health coverage more than others were in favor of the establishment of this program (or=2.38(1.05 - 5.38)). also our findings underlines the importance of public awareness on their tendency to participate in the program (or=1.12(1.02 - 1.21)). lack of enough mutual trust in telephone surveys is an important issue because communications do not happen face - to - face. specifically as a result of coincidence of current survey with recently raised arguments about possible changes in allocation of subsidies to families, people seemed to be reluctant in revealing their real health assurance condition, socioeconomic status and so on. interviewers were completely instructed to perform the interviews according to guidelines especially when they confronted with individuals who rejected to interview or wanted to terminate their interviews before finishing it. to our surprise even though there were various advertisements to inform people about family physician program, around half of the participants did not have any information about this program. a substantial contrast which we found in this survey is that despite their poor awareness about details of family physician program most of people planned to participate in the program (63.5% of already aware population). it seems that even partial information about an ongoing health promotion program, is effective to draw people 's attention and encourage their participation in the program. as previously brought in results almost half of the participants did not have any information about family physician program ; in this condition more innovative methods to enhance the awareness is required. an important point in our results is the public concerns about abandoning the program after a while even before its complete implementation. they were disappointed that it would end in failure since they have already witnessed major national projects that had imposed high costs on society but never resulted in desirable achievements. on the other side, the optimist participants in stating their agreement implicitly indicated that their beliefs were mostly based on what they have heard or seen about other countries successful experiences in family physician. based on cbpr1 principles, in order to meet the objectives of an extensive health program, it is crucial to enhance community participation. as above mentioned, most of the study participants did nt have any idea about this program and its advantages for the community. to achieve successful results in family physician program it seems that providing effective instructive programs to clarify the objectives and details of this program can help people to feel ownership in this context. as we know for implementation of a complicated task like family physician program, which requires a broad - based support and involvement, establishing a decentralized2 network would be appropriate. since television was the most dominant source for informing public about family physician program, providing informative programs about the objectives and details of the family physician may terminate totally idealistic or pessimistic opinions among community. in addition to the information channel, during the transferring a message its quality and quantity like being concise, interesting and usefulness also should be considered. the question is whether or not the programs were efficiently sufficient or the problem is that the people were not interested in receiving information about new project ? | background : upon successful experiences of family physician program in the rural regions, iranian ministry of health and medical education (mohme) made a decision to expand this program to urban areas. for this reason a pilot program were designated and some cities have been selected to determine dos and donts of performing family physician program in the cities. various studies were published during this period demonstrating the advantages and disadvantages of family physicians care in these cities. after this process in 2012 and 2013 mohme announced implementation of family physician program in tehran. our study investigated public attitudes, knowledge and practice about the newly introduced program.methods:this cross - sectional study was performed in tehran during november to december 2012. a telephone survey was carried out using the random digit dialing (rdd) method and data was gathered by a researcher designed questionnaire. a total of 386 residents aged 18 years and over participated in the study. to compare the differences between various groups knowledge scores data were analyzed performing chi - square test, t - test, anova, and logistic regression by spss software version 17, to find factors that affected individuals agreement with the program.results:among all samples 214(57.4%) knew about the program and almost 120(85.1%) of these aware people were planning to participate in the program. television and radio were the major information resources. after adjusting for educational status, access to internet and socio economic status(ses) those people who did nt have any kind of health coverage systems(health insurance) were most likely to accept the program and agree with that[or= 2.38(1.05 - 5.38)].conclusions : the fact that despite low levels of information, most of aware people intend to enroll in the new program reveals that expanding informative programs would bring more participation and involvement among community. |
this retrospective study was performed at the l. v. prasad eye institute in india from september 2012 to january 2013. prior approval from the institutional review board of the institute was obtained, and informed consent was obtained from each study subject for the diagnostic procedures. fifty - one eyes (26 patients) with a diagnosis of some form of macular dystrophy other than retinitis pigmentosa were included in this study. all participants underwent a comprehensive ophthalmic examination including best - corrected visual acuity (bcva) testing using early treatment diabetic retinopathy study charts, slit - lamp biomicroscopy, intraocular pressure measurement using goldmann applanation tonometer and dilated fundoscopic examination. all patients underwent electroretinography and electrooculogram for diagnosis of dystrophy as per physician 's discretion. exclusion criteria included optic atrophy, visually significant cataract, high myopia or hyperopia (> 6 or + 3 diopters of refractive error), poor image quality, any other associated retinal pathology, or history of any intraocular surgery. control group included age - matched healthy subjects with no ocular disease and without high refractive power (more than 6d or + 3d), which included 251 subjects (467 eyes), ranging from 5 to 80 years (unpublished data). the sd - oct scans were obtained using cirrus high - definition (hd)-oct (carl zeiss meditec, inc., dublin, ca, usa) after dilatation of the pupil with 1% tropicamide and 10% phenylephrine eye drops. the scan used for imaging in this study is hd 1-line raster with edi which is a 6-mm line consisting of 4096 a - scans, an imaging speed of 27,000 a - scans per second, an axial resolution of 5 microns, and a transverse resolution of 15 microns in tissue and averages 20 frames (b - scans). edi, which automatically sets the choroid closer to the zero - delay line and thus theoretically provides better visualization of the choroidescleral interface, was used for all scans. scans with a signal strength of more than or equal to 6 were used for analysis. using the cirrus linear measurement tool, a single observer measured ct perpendicularly from the outer portion of the hyperreflective line corresponding to the rpe, to the inner surface of the sclera at 500 microns intervals temporal and nasal from the fovea, up to 3000 microns as published in the literature. we also evaluated choroidal contour to note if any area of focal thinning was noted, especially in the areas of outer retinal thinning. as both eyes of 25 subjects were included for analysis, the correlation between the two eyes of the same subject was adjusted using generalized estimating equations (gee) during the calculation of summary descriptive parameters. multivariate models adjusted using gee methods were fit to assess the effects of age, gender, and macular thickness on the ct measurements. statistical analyses were performed using medcalc for windows, version 12.5 (medcalc software, ostend, belgium). the alpha level (type i error) all the graphs were performed made using graphpad prism (graphpad software, version 6.00 for windows, la jolla california, usa, www.graphpad.com). the sd - oct scans were obtained using cirrus high - definition (hd)-oct (carl zeiss meditec, inc., dublin, ca, usa) after dilatation of the pupil with 1% tropicamide and 10% phenylephrine eye drops. the scan used for imaging in this study is hd 1-line raster with edi which is a 6-mm line consisting of 4096 a - scans, an imaging speed of 27,000 a - scans per second, an axial resolution of 5 microns, and a transverse resolution of 15 microns in tissue and averages 20 frames (b - scans). edi, which automatically sets the choroid closer to the zero - delay line and thus theoretically provides better visualization of the choroidescleral interface, was used for all scans. scans with a signal strength of more than or equal to 6 were used for analysis. using the cirrus linear measurement tool, a single observer measured ct perpendicularly from the outer portion of the hyperreflective line corresponding to the rpe, to the inner surface of the sclera at 500 microns intervals temporal and nasal from the fovea, up to 3000 microns as published in the literature. we also evaluated choroidal contour to note if any area of focal thinning was noted, especially in the areas of outer retinal thinning. using the cirrus linear measurement tool, a single observer measured ct perpendicularly from the outer portion of the hyperreflective line corresponding to the rpe, to the inner surface of the sclera at 500 microns intervals temporal and nasal from the fovea, up to 3000 microns as published in the literature. we also evaluated choroidal contour to note if any area of focal thinning was noted, especially in the areas of outer retinal thinning. as both eyes of 25 subjects were included for analysis, the correlation between the two eyes of the same subject was adjusted using generalized estimating equations (gee) during the calculation of summary descriptive parameters. multivariate models adjusted using gee methods were fit to assess the effects of age, gender, and macular thickness on the ct measurements. statistical analyses were performed using medcalc for windows, version 12.5 (medcalc software, ostend, belgium). the alpha level (type i error) all the graphs were performed made using graphpad prism (graphpad software, version 6.00 for windows, la jolla california, usa, www.graphpad.com). present study included 51 eyes of 26 subjects with inherited retinal disease other than rp. mean age of the study group was 28.49 16.7 years, with 20 males and 6 females. mean bcva was 0.59 0.33 logmar (snellen equivalent 20/70), ranging from 0 to 1.1 (snellen equivalent 20/2020/250)). mean spherical equivalent was 1.2d 0.75d. mean subfoveal ct and central macular thickness (cmt) among study subjects was 266.33 76 microns and 122.39 77 microns respectively. 1. ct profile at different points from fovea in study subjects composite image showing color photograph (a and b), and autofluorescence (c and d) and spectral domain optical coherence tomography (e and f) with choroidal thickness measurements in a case of stargardt 's disease age - matched control groups included 466 eyes of 233 eyes subjects with mean age of 25.9 18.11 years (range : 580 years). mean spherical equivalent in control group was 0.22d 0.9 d. all patients were phakic. mean subfoveal ct and cmt was 297.66 48 microns and 204.4 32.2 microns respectively. on regression analysis, no significant correlation was found between subfoveal ct and any other variable such as age (p = 0.9), gender (p = 0.5), cmt (p = 0.1), spherical equivalent (p = 0.3), and bcva (p = 0.6). while comparing with age - matched healthy subjects decade - wise, no significant statistical difference was noted (p > 0.05) among all age groups [table 2 ]. clinical and oct characteristics of study subjects we did not find any areas of focal choroidal thinning at the areas of outer retinal damage irrespective of the type of dystrophy. our study reports ct distribution at different locations in hereditary retinal diseases in indian population. age, gender, spherical equivalent has been shown to be related to ct in normal population ; however, we did not find any significant correlation between subfoveal ct and any other variables among eyes with inherited retinal diseases. there was no significant difference between study group and age - matched healthy subjects, among all age groups. there is only one study by yeoh., which reports changes in choroidal structures in eyes with inherited retinal diseases. they reported focal areas of mild to moderate choroidal thinning on edi oct in 5 patients, which corresponded with the clinically visible areas of discrete outer retinal, rpe and choriocapillaris atrophy. in our study, we did not notice any focal thinning, and change in contour of choroid in relation to outer retinal structure damage. as reported by yeoh., we also noticed a choroidal thinning in eyes with bietti 's crystalline dystrophy and best disease. yeoh., reported 3 of 6 eyes with stargardt 's having thinning of choroid ; however, in our study, we did not notice any significant choroidal thinning in eyes with stargardt 's disease. while the histopathological studies have demonstrated the degeneration of choriocapillaris, loss of photoreceptors, and rpe in the region of atrophy in eyes with various dystrophies, we did not find any choroidal thinning in areas of retinal thinning, specifically outer retinal thinning in our study subjects. due to limited resolution of presently available sd - oct devices, measurement of choriocapillaris thickness is not possible. as there was no choroidal thinning noted in areas of outer retinal damage, further improvement in resolution or angiographic studies. limitations of our study include retrospective nature ; small sample size and unavailability of genetic analysis for our subjects, however, clinical diagnosis as supported by investigations when required. no statistically significant difference compared to age - matched controls could be due to small sample size ; however, our study provides an outline for future studies. our study reports quantitative changes in ct in various common inherited retinal diseases seen in indian populations. to validate changes in choroid, a longitudinal study with larger sample size further understanding of individual layers of choroid may provide more insight into inherited retinal diseases, which may help to plan therapeutic interventions and follow - up. | purpose : to evaluate changes in choroidal thickness (ct) in inherited retinal diseases and its relationship with age, spherical equivalent, visual acuity, and macular thickness.methods:retrospective analysis of 51 eyes with features of retinal dystrophy of 26 subjects, who underwent enhanced depth imaging using spectral domain (sd) optical coherence tomography (oct), were included. the ct measurements were made at the fovea and at 5 points with an interval of 500 microns in both directions, nasal and temporal from the fovea and were compared with age - matched healthy subjects. step - wise regression was used to find the relationship between age, spherical equivalent, best - corrected visual acuity (bcva), central macular thickness (cmt), and subfoveal ct.results:disease distribution was as follows : stargardt 's disease 18 eyes (9 subjects) ; best disease 5 eyes (3 subjects) ; cone - rod dystrophy 26 eyes (13 subjects) ; and bietti 's crystalline dystrophy 2 eyes (1 subject). mean subfoveal ct was 266.33 76 microns. on regression analysis, no significant correlation was found between subfoveal ct and any other variable such as age (p = 0.9), gender (p = 0.5), cmt (p = 0.1), spherical equivalent (p = 0.3) and bcva (p = 0.6). while comparing with age - matched healthy subjects, no significant statistical difference was noted (p < 0.05) among all age groups.conclusion:our study reports quantitative changes in ct in various common inherited retinal diseases seen in indian populations. to validate changes in choroid, a longitudinal study with larger sample size is warranted. |
a retrospective, comparative cohort study was conducted on patients who underwent 152 primary pcl reconstruction surgeries performed by a single surgeon between april 2004 and october 2008. grade ii pcl injuries combined with other ligamentous or grade iii pcl injuries were considered for surgical treatment when the patients had persistent pain or functional disability (discomfort when going down stairs). in this situation, the status of the remnant pcl tissue (determined using mri) was considered before surgery in order to select the most appropriate reconstruction option. the remnant pcl - preserving stent procedure using the transtibial tunnel technique was chosen if there was partial continuity or the remnant tissue was sufficient in the acute (6 months). a double - bundle reconstruction was performed if there was no remnant pcl or a very weak pcl remnant according to the mri and arthroscopic findings in the subacute or chronic stage. thirty - three patients were excluded because they met one of the following exclusion criteria : 1) concomitant anterior cruciate ligament (acl) or medial collateral ligament reconstruction (12 patients) ; 2) an associated fracture in the lower extremities that could affect knee function (2 patients) ; 3) combined severe life - threatening medical disease (1 patient) ; and 4) revision surgery (8 patients). moreover, ten patients were also excluded because of loss to outpatient follow - up before 24 months. the grading of plc injuries has been described elsewhere (table 1).15,19) to minimize the effect of combined plc injuries, only patients with grade ii plc injury treated by plc sling (modified larson technique) simultaneously with a pcl reconstruction were enrolled in the present study. twenty patients, assessed as having grade i or iii plc injuries, were excluded (table 2). therefore, the records of 89 patients, who had been followed up for a minimum of 24 months after pcl reconstruction were included in the analysis. the study was approved by the institutional review board at chung - ang university hospital, and all patients provided informed consent. out of 89 patients, 34 were treated with a pcl remnant - preserving alb reconstruction using the transtibial tunnel technique in the acute and subacute stage of injury (group 1) ; 40 patients were treated with remnant tensioning and alb reconstruction using the modified inlay technique in the chronic stage of injury (group 2) ; and 15 patients were treated with double - bundle reconstruction using the modified inlay technique (group 3). the mean age of patients in group 1 (32 males and 2 females), group 2 (36 males and 4 females), and group 3 (14 males and 1 female) was 31.1 years (range, 18 to 51 years), 31.2 years (range, 16 to 59 years), and 32.1 years (range, 19 to 24 years), respectively. an achilles tendon allograft was used in the pcl double - bundle reconstruction and an autogenous hamstring tendon was used in the other two groups. the plc reconstruction was performed with a contralateral autogenous hamstring tendon through the fibular head tunnel in all patients. the surgical technique has been described elsewhere6,20) and we describe only the specific technical aspects of arthroscopically - assisted pcl reconstruction here. in order to prepare the femoral tunnel without removing the remains of the pcl, the surgeon placed the tip of the guide pin on the pcl at the 12:30 to 1 o'clock position for the right knee while looking through the anterolateral portal. after placing the femoral guide (acufex microsurgical, mansfield, ma, usa) 5 to 6 mm proximal to the margin of the articular cartilage of the medial femoral condyle at the pin a switching stick was then inserted through the posteromedial portal via an arthroscope sleeve to reach the septum. under direct visualization, the stick was gently pushed into the posterolateral compartment by piercing the posterior septum just posterior to the pcl remnant and then it was pushed until it reached the capsule at the posterolateral portal site. a skin incision was made at this point, which was approximately 1 cm posterior to the lateral femoral condyle and 1 cm proximal to the joint line, to create the posterolateral portal (modified transeptal portal). a motorized shaver was inserted through the posteromedial portal to reach the posteromedial compartment under direct visualization of the arthroscope which had been inserted earlier through the posterolateral portal. the posterior capsule was carefully separated from the pcl with the shaver and electric vapr (depuy mitek, raynham, ma, usa), starting from the articular surface level to the tibial attachment, without disrupting the remnant pcl bundle. it was important to keep the shaver 's cutting surface in the anteroinferior direction to avoid damaging any posterior neurovascular structure. while looking arthroscopically through the posteromedial or posterolateral portal using a c - arm, the surgeon introduced the tip of the pcl tibial guide (acufex microsurgical) through the anteromedial portal and advanced it to the back side of the pcl. the surgeon positioned the guide 1.5 cm below the articular surface just distal to the tibial insertion of the pcl in order to avoid damaging the remnant pcl attachment. the drill guide angle of the tibia was oriented at 55 to 60, and the tunnel diameter was determined as the same size as the graft diameter. the autogenous hamstring quadruple graft was passed through the femoral tunnel first, and then passed through the tibial tunnel with secured about the soft tissue impingement. for the tibial side fixation, a rigidfix guide (depuy mitek) insert and two cross pin guides were placed into the lateral side of the tibial plateau. after the tension and accurate positioning of the graft were assessed arthroscopically, the graft was cyclic loaded in tension with 15 to 20 lb and fixed with a biodegradable interference screw at the femoral tunnel additionally, and a post and tie were made with a screw and washer in both the tibial and femoral sides with the knee joint flexed at 90. the surgical technique has been described elsewhere,19,21 - 24) and we only describe the specific technical aspects of the arthroscopically - assisted pcl reconstruction here. the femoral tunnel was made in the same manner as the transtibial tunnel (stent operation). for the posterior approach, the knee is flexed 70 to 90 to provide easier access to the popliteal area and the operating table is tilted over 30 so that the operated knee is lower than the contralateral knee. after the posteromedial approach,25) the pcl tibial attachment was demarcated as a 1.5 2 cm area using an osteotome, and a 7-mm - thick bone block was detached from the distal to the proximal area using a 1.2 to 1.5 cm wide curved osteotome. a bony trough was made at the medial side of the pcl tibial insertion just distal to the portion of the detached bone block site to which the detached bone block and graft were to be fixed. the autogenous hamstring quadruple graft was passed through the knee joint to the femoral tunnel and fixed to the cortical bone of the distal and medial side of the tibial insertion of the pcl with a 10-mm staple. the remnant pcl was tensioned by pulling distally and the step - off as an anatomic reduction was confirmed at the anteromedial aspect of the tibiofemoral condyle. the remnant pcl was fixed through the tibia using a 5- or 6.5-mm cannulated screw with a spiked washer. the graft was cyclically loaded in tension with 15 to 20 lb of tension and fixed with a biodegradable interference screw at the femoral tunnel with the knee joint flexed 70 to 90 and additionally fixed with a 10-mm staple or post - tie on the femoral side. for pcl double - bundle reconstruction surgery, the double femoral tunnel and modified tibial inlay technique with an allograft tendon was employed in all 15 patients. for the allograft, a tibial bone block with two femoral bundles was prepared. the achilles tendon graft was transected sagittally into two strands, each sutured with no. 5 non - absorbable sutures using a locking whipstitch to to be 6 to 8 mm in diameter (fig. the achilles tibial bone block was 20 mm long, 15 mm wide, and 7 to 8 mm thick. the femoral tunnel of the alb was made in the same manner as the other two techniques. the femoral tunnel of the pmb was made from an accessory anterolateral portal using an inside - out technique, where the desired femoral tunnel was placed 8 mm proximal to the margin of the articular cartilage of the medial femoral condyle at the 3 (right knee) or 9 o'clock position (left knee) (fig. after the posteromedial approach with a tilting operation table and lower down affected side which was flexion, abduction and external rotation of the hip and 90 flexion of the knee position on the ancillary table, the tibial attachment point of the pcl was demarcated and a bony trough was made just distal to the pcl tibial insertion where the detached bone block was to be fixed. the two femoral achilles allograft bundles were passed through the knee joint to the femoral tunnel ; the pmb was passed first, followed by the alb. the achilles bone block was fixed to the tibia using a 5- or 6.5-mm cannulated screw with a spiked washer. the postoperative rehabilitation regimen has been described elsewhere,6,19) and it was customized for each patient depending on the rigidity of graft fixation, degree of isometricity, and results of the final intraoperative stress test after the reconstruction. since the plc reconstructions were performed at the same time as the pcl reconstructions, passive range of motion exercises usually started on the 3rd to 5th postoperative day. during the first six weeks, the range of motion was increased from 0 to 90 and the full range of motion was regained by the 12th to 24th postoperative week. the knee was immobilized with a long leg removable splint for two weeks after surgery. the pcl brace,26) which is made up with a tibial supporter including an elastic spring at the posterior aspect of the proximal tibia, was used until the 6th postoperative week. full weight bearing without the use of crutches was generally achieved within the 8th postoperative week. to compare the clinical and stability outcomes of the pcl reconstructions, serial postoperative evaluations were performed at 6 weeks, 3, 6, and 12 months, and every 12 months thereafter. knee stability was evaluated by posterior stress radiography (push view) performed using a telos stress device (austin & associates, fallston, md, usa) and by a maximum manual displacement test using a kt-1000 arthrometer (instrumented drawer testing, kt-1000, medmetric, san diego, ca, usa). the tests were performed preoperatively and at every follow - up after the 3rd postoperative month. the subjective and objective international knee documentation committee (ikdc) score and orthopdische arbeitsgruppe knie (oak) score were used for the clinical evaluation. all evaluations were made by a single observer not involved in the operation. to test posetrolateral rotator instability, the posterolateral drawer test, dial test, and varus stress test were performed at every follow - up, and the results were compared with the results from the contralateral side, and classified as overconstrained, constrained and lax.19) a power analysis was performed. if the subjective scores differed by more than 10 points and the posterior stress radiograph results differed by more than 2 mm, they were considered clinically different results. to achieve a power of 80% under a significance level of 5%, a sample size of 14 cases the statistical comparison between the 3 groups was made using a kruskal - wallis test. all statistical analyses were performed using spss ver. 10.0 (spss inc., chicago, il, usa), and sas ver. cary, nc, usa). statistical significance was set at p 6 months). a double - bundle reconstruction was performed if there was no remnant pcl or a very weak pcl remnant according to the mri and arthroscopic findings in the subacute or chronic stage. thirty - three patients were excluded because they met one of the following exclusion criteria : 1) concomitant anterior cruciate ligament (acl) or medial collateral ligament reconstruction (12 patients) ; 2) an associated fracture in the lower extremities that could affect knee function (2 patients) ; 3) combined severe life - threatening medical disease (1 patient) ; and 4) revision surgery (8 patients). moreover, ten patients were also excluded because of loss to outpatient follow - up before 24 months. the grading of plc injuries has been described elsewhere (table 1).15,19) to minimize the effect of combined plc injuries, only patients with grade ii plc injury treated by plc sling (modified larson technique) simultaneously with a pcl reconstruction were enrolled in the present study. twenty patients, assessed as having grade i or iii plc injuries, were excluded (table 2). therefore, the records of 89 patients, who had been followed up for a minimum of 24 months after pcl reconstruction were included in the analysis. the study was approved by the institutional review board at chung - ang university hospital, and all patients provided informed consent. out of 89 patients, 34 were treated with a pcl remnant - preserving alb reconstruction using the transtibial tunnel technique in the acute and subacute stage of injury (group 1) ; 40 patients were treated with remnant tensioning and alb reconstruction using the modified inlay technique in the chronic stage of injury (group 2) ; and 15 patients were treated with double - bundle reconstruction using the modified inlay technique (group 3). the mean age of patients in group 1 (32 males and 2 females), group 2 (36 males and 4 females), and group 3 (14 males and 1 female) was 31.1 years (range, 18 to 51 years), 31.2 years (range, 16 to 59 years), and 32.1 years (range, 19 to 24 years), respectively. an achilles tendon allograft was used in the pcl double - bundle reconstruction and an autogenous hamstring tendon was used in the other two groups. the plc reconstruction was performed with a contralateral autogenous hamstring tendon through the fibular head tunnel in all patients. the surgical technique has been described elsewhere6,20) and we describe only the specific technical aspects of arthroscopically - assisted pcl reconstruction here. in order to prepare the femoral tunnel without removing the remains of the pcl, the surgeon placed the tip of the guide pin on the pcl at the 12:30 to 1 o'clock position for the right knee while looking through the anterolateral portal. after placing the femoral guide (acufex microsurgical, mansfield, ma, usa) 5 to 6 mm proximal to the margin of the articular cartilage of the medial femoral condyle at the pin a switching stick was then inserted through the posteromedial portal via an arthroscope sleeve to reach the septum. under direct visualization, the stick was gently pushed into the posterolateral compartment by piercing the posterior septum just posterior to the pcl remnant and then it was pushed until it reached the capsule at the posterolateral portal site. a skin incision was made at this point, which was approximately 1 cm posterior to the lateral femoral condyle and 1 cm proximal to the joint line, to create the posterolateral portal (modified transeptal portal). a motorized shaver was inserted through the posteromedial portal to reach the posteromedial compartment under direct visualization of the arthroscope which had been inserted earlier through the posterolateral portal. the posterior capsule was carefully separated from the pcl with the shaver and electric vapr (depuy mitek, raynham, ma, usa), starting from the articular surface level to the tibial attachment, without disrupting the remnant pcl bundle. it was important to keep the shaver 's cutting surface in the anteroinferior direction to avoid damaging any posterior neurovascular structure. while looking arthroscopically through the posteromedial or posterolateral portal using a c - arm, the surgeon introduced the tip of the pcl tibial guide (acufex microsurgical) through the anteromedial portal and advanced it to the back side of the pcl. the surgeon positioned the guide 1.5 cm below the articular surface just distal to the tibial insertion of the pcl in order to avoid damaging the remnant pcl attachment. the drill guide angle of the tibia was oriented at 55 to 60, and the tunnel diameter was determined as the same size as the graft diameter. the autogenous hamstring quadruple graft was passed through the femoral tunnel first, and then passed through the tibial tunnel with secured about the soft tissue impingement. for the tibial side fixation, a rigidfix guide (depuy mitek) insert and two cross pin guides were placed into the lateral side of the tibial plateau. after the tension and accurate positioning of the graft were assessed arthroscopically, the graft was cyclic loaded in tension with 15 to 20 lb and fixed with a biodegradable interference screw at the femoral tunnel additionally, and a post and tie were made with a screw and washer in both the tibial and femoral sides with the knee joint flexed at 90. the surgical technique has been described elsewhere,19,21 - 24) and we only describe the specific technical aspects of the arthroscopically - assisted pcl reconstruction here. the femoral tunnel was made in the same manner as the transtibial tunnel (stent operation). for the posterior approach, the knee is flexed 70 to 90 to provide easier access to the popliteal area and the operating table is tilted over 30 so that the operated knee is lower than the contralateral knee. after the posteromedial approach,25) the pcl tibial attachment was demarcated as a 1.5 2 cm area using an osteotome, and a 7-mm - thick bone block was detached from the distal to the proximal area using a 1.2 to 1.5 cm wide curved osteotome. a bony trough was made at the medial side of the pcl tibial insertion just distal to the portion of the detached bone block site to which the detached bone block and graft were to be fixed. the autogenous hamstring quadruple graft was passed through the knee joint to the femoral tunnel and fixed to the cortical bone of the distal and medial side of the tibial insertion of the pcl with a 10-mm staple. the remnant pcl was tensioned by pulling distally and the step - off as an anatomic reduction was confirmed at the anteromedial aspect of the tibiofemoral condyle. the remnant pcl was fixed through the tibia using a 5- or 6.5-mm cannulated screw with a spiked washer. the graft was cyclically loaded in tension with 15 to 20 lb of tension and fixed with a biodegradable interference screw at the femoral tunnel with the knee joint flexed 70 to 90 and additionally fixed with a 10-mm staple or post - tie on the femoral side. for pcl double - bundle reconstruction surgery, the double femoral tunnel and modified tibial inlay technique with an allograft tendon was employed in all 15 patients. for the allograft, a tibial bone block with two femoral bundles was prepared. the achilles tendon graft was transected sagittally into two strands, each sutured with no. 5 non - absorbable sutures using a locking whipstitch to to be 6 to 8 mm in diameter (fig. the achilles tibial bone block was 20 mm long, 15 mm wide, and 7 to 8 mm thick. the femoral tunnel of the alb was made in the same manner as the other two techniques. the femoral tunnel of the pmb was made from an accessory anterolateral portal using an inside - out technique, where the desired femoral tunnel was placed 8 mm proximal to the margin of the articular cartilage of the medial femoral condyle at the 3 (right knee) or 9 o'clock position (left knee) (fig. after the posteromedial approach with a tilting operation table and lower down affected side which was flexion, abduction and external rotation of the hip and 90 flexion of the knee position on the ancillary table, the tibial attachment point of the pcl was demarcated and a bony trough was made just distal to the pcl tibial insertion where the detached bone block was to be fixed. the two femoral achilles allograft bundles were passed through the knee joint to the femoral tunnel ; the pmb was passed first, followed by the alb. the achilles bone block was fixed to the tibia using a 5- or 6.5-mm cannulated screw with a spiked washer. the postoperative rehabilitation regimen has been described elsewhere,6,19) and it was customized for each patient depending on the rigidity of graft fixation, degree of isometricity, and results of the final intraoperative stress test after the reconstruction. since the plc reconstructions were performed at the same time as the pcl reconstructions, passive range of motion exercises usually started on the 3rd to 5th postoperative day. during the first six weeks, the range of motion was increased from 0 to 90 and the full range of motion was regained by the 12th to 24th postoperative week. the knee was immobilized with a long leg removable splint for two weeks after surgery. the pcl brace,26) which is made up with a tibial supporter including an elastic spring at the posterior aspect of the proximal tibia, was used until the 6th postoperative week. full weight bearing without the use of crutches was generally achieved within the 8th postoperative week. to compare the clinical and stability outcomes of the pcl reconstructions, serial postoperative evaluations were performed at 6 weeks, 3, 6, and 12 months, and every 12 months thereafter. knee stability was evaluated by posterior stress radiography (push view) performed using a telos stress device (austin & associates, fallston, md, usa) and by a maximum manual displacement test using a kt-1000 arthrometer (instrumented drawer testing, kt-1000, medmetric, san diego, ca, usa). the tests were performed preoperatively and at every follow - up after the 3rd postoperative month. the subjective and objective international knee documentation committee (ikdc) score and orthopdische arbeitsgruppe knie (oak) score were used for the clinical evaluation. all evaluations were made by a single observer not involved in the operation. to test posetrolateral rotator instability, the posterolateral drawer test, dial test, and varus stress test were performed at every follow - up, and the results were compared with the results from the contralateral side, and classified as overconstrained, constrained and lax.19) if the subjective scores differed by more than 10 points and the posterior stress radiograph results differed by more than 2 mm, they were considered clinically different results. to achieve a power of 80% under a significance level of 5%, a sample size of 14 cases was needed for each study group. the statistical comparison between the 3 groups was made using a kruskal - wallis test. cary, nc, usa). statistical significance was set at p < 0.05. for the 34 patients in group 1, the mean side - to - side difference in posterior translation, as measured by posterior stress radiography, improved from 10.1 2.5 mm preoperatively to 2.3 1.4 mm at the last follow - up (p < 0.001). at the last evaluation, 23 patients (67.1%) exhibited a displacement of less than 3 mm, 8 patients (23.5%) had between a 3 and 5 mm displacement, and 3 patients (8.8%) showed displacement exceeding 5 mm (fig. the mean side - to - side difference as measured by the maximal manual test using the kt-1000 arthrometer also improved from 6.8 2.0 mm preoperatively to 2.2 2.2 mm at the last follow - up (p < 0.001). for 40 patients in group 2, the mean side - to - side difference in posterior translation, as measured by posterior stress radiography, improved from 10.6 2.4 mm preoperatively to 2.3 1.5 mm at the last follow - up (p < 0.001). at the last evaluation, 23 patients (57.5%) exhibited a displacement of less than 3 mm, 15 patients (37.5%) had between a 3 and 5 mm displacement, and 2 patients (5.0%) showed displacement exceeding 5 mm. the mean side - to - side difference, as measured by the maximal manual test using the kt-1000 arthrometer, also improved from 8.4 2.2 mm preoperatively to 2.0 1.4 mm at the last follow - up evaluation (p < 0.001). for the 15 patients in group 3, the mean side - to - side difference in posterior translation, as measured by posterior stress radiography, improved from 12.8 3.2 mm preoperatively to 4.0 2.5 mm at the last follow - up (p < 0.001). at the last evaluation, 3 patients (20%) exhibited a displacement of less than 3 mm, 9 patients (60%) had between a 3 and 5 mm displacement, and 3 patients (20%) showed displacement exceeding 5 mm. the mean side - to - side difference, as measured by the maximal manual test using the kt-1000 arthrometer, also improved, from 7.7 2.2 mm preoperatively to 3.6 1.9 mm at the last follow - up (p < 0.001). one case in group 1 and one in group 3 showed a displacement greater than 10 mm compared to the normal side. statistical analyses revealed both group 1 and 2 showed similar posterior stress radiography results or kt-1000 arthrometer stability. however, the results of group 3 were inferior to groups 1 and 2 at the last follow - up evaluation (p = 0.022). at the last evaluation, rotational stability was assessed according to different knee flexion values (30 and 90 of flexion) : 4 knees were overconstrained, 27 were constrained, and 3 were lax as compared with the normal side in group 1. in group 2, 6 knees were overconstrained, 31 were constrained, and 3 were lax. in group 3, there were no statistical differences among the three groups in terms of rotational stability (p = 0.214). the mean oak score improved significantly for the 34 patients in group 1 from 71.7 9.3 preoperatively to 85.0 6.7 postoperatively the mean ikdc subjective score improved significantly from 46.7 16.6 preoperatively to 65.1 18.4 postoperatively (p < 0.001). with regard to the ikdc objective evaluation, 11 patients (32.4%) and 23 patients (67.6%) were rated as c (abnormal) and d (severely abnormal), respectively, at the preoperative evaluation. at the last evaluation, 21 patients (61.8%), 9 patients (26.5%), 3 patients (8.8%), and 1 patient (2.9%) were rated as a (normal), b (nearly normal), c and d, respectively (fig. 4). therefore, 88.3% of the patients had a rating of either a or b at the last evaluation. for the 40 patients in group 2, the mean oak score improved significantly from 63.5 10.4 preoperatively to 88.9 7.6 postoperatively (p < 0.001). the mean ikdc subjective score improved significantly from 63.5 10.4 preoperatively to 79.7 13.3 postoperatively (p < 0.001). with regard to the final ikdc evaluation, 13 patients (32.5%) and 27 patients (67.5%) were rated as c and d, respectively, at the preoperative evaluation. at the last evaluation, 17 patients (42.5%), 19 patients (47.5%), and 4 patients (10%) were rated as a, b, and c, respectively. hence, 90% of the patients had a rating of either a or b at the last evaluation. the mean oak score for the 15 patients in group 3 improved significantly from 71.3 12.9 preoperatively to 83.0 5.9 postoperatively (p < the mean ikdc subjective score improved significantly from 50.7 17.6 preoperatively to 61.5 12.9 postoperatively (p < 0.001). with regard to the final ikdc evaluation, 6 patients (40%) and 9 patients (60%) were rated as c and d, respectively, at the preoperative evaluation. at the last evaluation, 3 patients (20%), 9 patients (60%), 2 patients (13.3%), and 1 patient (6.7%) were rated as a, b, c, and d, respectively. hence, 80% of the patients had a rating of either a or b at the last evaluation (fig. 4). there was no a significant difference among the three groups in terms of the clinical results, namely the oak score and ikdc objective and subjective scores. for the 34 patients in group 1, the mean side - to - side difference in posterior translation, as measured by posterior stress radiography, improved from 10.1 2.5 mm preoperatively to 2.3 1.4 mm at the last follow - up (p < 0.001). at the last evaluation, 23 patients (67.1%) exhibited a displacement of less than 3 mm, 8 patients (23.5%) had between a 3 and 5 mm displacement, and 3 patients (8.8%) showed displacement exceeding 5 mm (fig. the mean side - to - side difference as measured by the maximal manual test using the kt-1000 arthrometer also improved from 6.8 2.0 mm preoperatively to 2.2 2.2 mm at the last follow - up (p < 0.001). for 40 patients in group 2, the mean side - to - side difference in posterior translation, as measured by posterior stress radiography, improved from 10.6 2.4 mm preoperatively to 2.3 1.5 mm at the last follow - up (p < 0.001). at the last evaluation, 23 patients (57.5%) exhibited a displacement of less than 3 mm, 15 patients (37.5%) had between a 3 and 5 mm displacement, and 2 patients (5.0%) showed displacement exceeding 5 mm. the mean side - to - side difference, as measured by the maximal manual test using the kt-1000 arthrometer, also improved from 8.4 2.2 mm preoperatively to 2.0 1.4 mm at the last follow - up evaluation (p < 0.001). for the 15 patients in group 3, the mean side - to - side difference in posterior translation, as measured by posterior stress radiography, improved from 12.8 3.2 mm preoperatively to 4.0 2.5 mm at the last follow - up (p < 0.001). at the last evaluation, 3 patients (20%) exhibited a displacement of less than 3 mm, 9 patients (60%) had between a 3 and 5 mm displacement, and 3 patients (20%) showed displacement exceeding 5 mm. the mean side - to - side difference, as measured by the maximal manual test using the kt-1000 arthrometer, also improved, from 7.7 2.2 mm preoperatively to 3.6 1.9 mm at the last follow - up (p < 0.001). one case in group 1 and one in group 3 showed a displacement greater than 10 mm compared to the normal side. statistical analyses revealed both group 1 and 2 showed similar posterior stress radiography results or kt-1000 arthrometer stability. however, the results of group 3 were inferior to groups 1 and 2 at the last follow - up evaluation (p = 0.022). at the last evaluation, rotational stability was assessed according to different knee flexion values (30 and 90 of flexion) : 4 knees were overconstrained, 27 were constrained, and 3 were lax as compared with the normal side in group 1. in group 2, 6 knees were overconstrained, 31 were constrained, and 3 were lax. in group 3, there were no statistical differences among the three groups in terms of rotational stability (p = 0.214). the mean oak score improved significantly for the 34 patients in group 1 from 71.7 9.3 preoperatively to 85.0 6.7 postoperatively (p < 0.001). the mean ikdc subjective score improved significantly from 46.7 16.6 preoperatively to 65.1 18.4 postoperatively (p < 0.001). with regard to the ikdc objective evaluation, 11 patients (32.4%) and 23 patients (67.6%) were rated as c (abnormal) and d (severely abnormal), respectively, at the preoperative evaluation. at the last evaluation, 21 patients (61.8%), 9 patients (26.5%), 3 patients (8.8%), and 1 patient (2.9%) were rated as a (normal), b (nearly normal), c and d, respectively (fig. 4). therefore, 88.3% of the patients had a rating of either a or b at the last evaluation. for the 40 patients in group 2, the mean oak score improved significantly from 63.5 10.4 preoperatively to 88.9 7.6 postoperatively (p < 0.001). the mean ikdc subjective score improved significantly from 63.5 10.4 preoperatively to 79.7 13.3 postoperatively (p < 0.001). with regard to the final ikdc evaluation, 13 patients (32.5%) and 27 patients (67.5%) were rated as c and d, respectively, at the preoperative evaluation. at the last evaluation, 17 patients (42.5%), 19 patients (47.5%), and 4 patients (10%) were rated as a, b, and c, respectively. hence, 90% of the patients had a rating of either a or b at the last evaluation. the mean oak score for the 15 patients in group 3 improved significantly from 71.3 12.9 preoperatively to 83.0 5.9 postoperatively (p the mean ikdc subjective score improved significantly from 50.7 17.6 preoperatively to 61.5 12.9 postoperatively (p < 0.001). with regard to the final ikdc evaluation, 6 patients (40%) and 9 patients (60%) were rated as c and d, respectively, at the preoperative evaluation. at the last evaluation, 3 patients (20%), 9 patients (60%), 2 patients (13.3%), and 1 patient (6.7%) were rated as a, b, c, and d, respectively. hence, 80% of the patients had a rating of either a or b at the last evaluation (fig. 4). there was no a significant difference among the three groups in terms of the clinical results, namely the oak score and ikdc objective and subjective scores. the present study evaluated the outcomes of three pcl reconstruction procedures applied according to our pcl treatment algorithm. the most important finding of this study was that combined pcl - plc instabilities can be treated successfully using different pcl reconstruction techniques, depending on the pcl remnant status, combined with a reconstruction of the plc structures. although the three groups did not differ in terms of clinical outcomes, the posterior knee stability of the double - bundle reconstruction group (group 3) was inferior to the single bundle reconstruction groups (groups 1 and 2). in 2004, our institute began using the same pcl treatment algorithm.21) if the pcl injury at the acute or subacute stage was grade ii or less in severity and other ligament injuries (e.g., medial collateral injury or plc injuries) were absent, active conservative treatment was initiated using anti - sagging cast immobilization and a pcl brace.26) subsequently, the stability and function of the injured knee were reevaluated at the end of the conservative treatment period. conversely, for grade ii injuries combined with other ligament injuries or for grade iii injuries, surgical treatment was considered even in the subacute stage, according to the activity level and patient demand. in the present study, we could not compare the results according to the timing and different techniques were applied according to the stage (acute or chronic). however, the remnant pcl fibers were tensioned and the alb was augmented if there was abundant remnant pcl for tensioning in the chronic cases at least six months after the initial pcl injury in this series. it was hypothesized that the remnant pcl fibers could play an important role in posterior knee stability and clinical outcomes. several studies on cadavers have shown that double - bundle pcl reconstruction is biomechanically superior to single - bundle pcl reconstruction.27,28) furthermore, kim.3) reported that arthroscopic tibial inlay double - bundle pcl reconstruction resulted in better posterior stability than did the two single - bundle methods. however, this present study showed that the posterior knee stability of the double bundle reconstruction group was inferior to those of the single bundle reconstruction group although the three groups did not differ in terms of the clinical outcomes first, the initial status of the patients in the double bundle group might have had more severe instability than those in the other two groups. a double bundle reconstruction was only performed if there was no remnant pcl or a very weak pcl remnant in the subacute or chronic stage. in addition, most of the patients in the double bundle group had combined associated injuries although only patients with grade ii plc injury were enrolled in this series. the second possible reason is that the achilles allograft, which may have disadvantages including the possible tendency of elongation and delayed revascularization, was only used in the double bundle group although hamstring autografts were prepared in the other two groups. therefore, the augmentation procedure for the alb using the double stranded autogenous semitendinosus may be needed if the achilles allograft is not strong enough for the double bundle reconstruction after preparation. the pcl had better synovial coverage, blood circulation, and potential to spontaneously heal than the acl. numerous mri studies8 - 10) and an experimental animal study11) reported that an acute ruptured pcl has the potential to heal. therefore, the pcl appears to have spontaneous healing potential even in the cases of rupture of the substance, but laxity often remains. the results of the remnant preservation technique as both a stent procedure in the acute or subacute stage and tensioning of the remnant pcl in the chronic stage, particularly in terms of stability, were improved considerably compared to the double - bundle pcl reconstruction procedure. safran.13) reported that the mechanoreceptors in pcl - injured knees act as knee stabilizers, which explains why patients with posterior instability develop degenerative changes more slowly than patients with anterior instability. we theorized that if the remnant pcl is not removed but preserved, or tensioning is performed surgically, there could be an advantage potentially in enhancing synovialization and in preserving the proprioceptive function of the mechanoreceptor in a continuous pcl as well as in conferring stability similar to a normal pcl.11,13) therefore, we would recommend that the pcl remnant be preserved as much as possible, including avoiding sacrifice of the pcl remnant during pcl surgery. furthermore, pcl reconstruction could be applied with different techniques depending on the pcl remnant status and post trauma stage. however, long - term studies and a new functional system which can reflect proprioception will be needed to demonstrate the potential benefit of these surgical methods. first, the study was a non - randomized retrospective study, and a proprioceptive function test was not performed. therefore, the results do not indicate whether the pcl remnant preservation technique enhances the clinical outcome with regard to proprioception. prospective studies, including assessment of the correlations with the clinical outcomes, and possible long - term follow - up will be needed. second, the overall number of cases was small and the sample sizes were not uniform across the three groups. furthermore, the initial status of the patients in the three groups was not equivalent because the pcl surgery was applied according to different surgical indications. third, the selection of the autograft or allograft, and the fixation methods were different for each group, potentially affecting the healing potential and stability. nevertheless, an advantage of the present study was that all pcl operations were performed by a single surgeon using a standardized surgical technique, in order to minimize the treatment variables. moreover, multiple knee scores as well as stress radiographs were used to evaluate the method. however, only patients with a grade ii plc injury were enrolled in the present study, to minimize the effect of combined plc injuries. excellent posterior stability and good clinical results were achieved with an alb reconstruction, with preservation of the injured remnant pcl in the acute and subacute stages, and remnant pcl tensioning with alb reconstruction in the chronic stage. pcl injuries could be surgically corrected with different techniques, depending on both the remnant pcl status and the interval between the knee trauma and operation. | backgroundthe purpose of the present study was to compare the clinical results of 3 posterior cruciate ligament reconstruction techniques according to the time from injury to surgery and remnant pcl status and to evaluate the efficiency of each technique.methodsthe records of 89 patients who underwent primary pcl reconstructions with a posterolateral corner sling were analyzed retrospectively. thirty - four patients were treated by anterolateral bundle (alb) reconstruction with preservation of the remnant pcl using a transtibial tunnel technique in the acute and subacute stages of injury (group 1). forty patients were treated with remnant pcl tensioning and an alb reconstruction using the modified inlay technique in the chronic stage (group 2), and fifteen patients were treated with double - bundle reconstruction using the modified inlay technique (group 3). the double - bundle reconstruction was performed if there was a very weak or no pcl remnant.resultsthe mean side - to - side differences in posterior tibial translation on the stress radiographs were reduced from 10.1 2.5 mm in group 1, 10.6 2.4 mm in group 2, and 12.8 3.2 mm in group 3 preoperatively to 2.3 1.4 mm in group 1, 2.3 1.5 mm in group 2, and 4.0 2.5 mm in group 3 at the last follow - up (p < 0.001, p < 0.001, and p < 0.001, respectively). statistical analyses revealed that group 1 and group 2 were similar in terms of side - to - side difference changes in posterior tibial translation on the stress radiographs ; however, group 3 was inferior to group 1 and group 2 at the last follow - up (p = 0.022). the clinical results were not significantly different among the three groups.conclusionsexcellent posterior stability and good clinical results were achieved with alb reconstruction preserving the injured remnant pcl in the acute and subacute stages and remnant pcl tensioning with alb reconstruction in the chronic stage. the pcl injuries could be surgically corrected with different techniques depending on both the remnant pcl status and the interval between the knee trauma and operation. |
commercial porcine vaccines and viruses a total of 25 commercially available porcine vaccines were obtained from licensed manufacturers and pharmaceutical suppliers in taiwan (table 1). viral dna was extracted from each vaccine using the qiaamp dna extraction kit (qiagen, usa) according to the manufacturer s instructions. for evaluating specificity of the lamp, 21 virus isolates, comprising six pcv1, five pcv2, two porcine parvovirus (ppv), three pseudorabies virus (prv), three classic swine fever virus (csfv), and two porcine reproductive and respiratory syndrome virus (prrsv) isolates, were used ; all of the isolates were previously identified by determining their partial nucleotide sequences (wang. the dna of pcv1, pcv2, ppv, prv, and cdna of csfv and prrsv isolates were produced as described previously (huang. 2004, 2008)table 1detection of pcv1 dna in commercial vaccines by the lamp and the nested pcrmanufactureragentlampnested pcracsfvaprvbcsfv++bprvccsfv++cprv, b. bronchiseptica, p. multocidadcsfvdfmdvecsfv++eprvfcsfvfprv, e. rhusiopathiae, p. multocida, m. hyopneumoniaeffmdvgfmdvgprrsvhfmdvhprv, m. hyopneumoniae, e. coliiprrsvjppvjfmdvkfmdvlppvmprv, ppv, e. rhusiopathiaencsfvnfmdvcsfv classic swine fever virus, prv pseudorabies virus, fmdv foot - and - mouth disease virus, prrsv porcine reproductive and respiratory syndrome virus, ppv porcine parvovirus detection of pcv1 dna in commercial vaccines by the lamp and the nested pcr csfv classic swine fever virus, prv pseudorabies virus, fmdv foot - and - mouth disease virus, prrsv porcine reproductive and respiratory syndrome virus, ppv porcine parvovirus primers specific primer sets of the lamp for pcv1 detection were designed by primerexplorer v4 software (http://primerexplorer.jp/elamp4.0.0/index.html) based on different reference pcv1 isolates (genbank accession no. af012107, ay184287, ay219836, ay660574, dq472013, dq659154, ef493843, fj475129, and gu722334). the primer sets consisted of two outer primers (f3 and b3) and two inner primers (fip and bip) targeting a conserved region within the pcv1 orf2 gene. to further validate the lamp, the primers pcv - f1, pcv - r1, pcv - f2, and pcv - r2 were used for nested polymerase chain reaction (nested pcr) targeting the conserved region of the pcv1 orf2 gene (victoria. nucleotide sequences and locations of the primers are shown in table 2.table 2oligonucleotide primer sets used for the lamp and nested pcr primerpositiontypesequence (53)lampf31,2101,228forward outerttg ttt ggt cca gct cag gb31,4001,381backward outercag aga ccc cat cac ctc tafip1,2891,271, 1,2301,248forward innerctc ctc ctc ccg cca cac cat af1c - tttt - f2-tttt- ttg ggg gtg aag tac ctg gbip1,3061,327, 1,3721,354backward innercat agg cca agt tgg tgg acg gb1c - tttt - b2-tttt- ggt gtt ggg tcc act gtt gnested pcrpcv - f11,1461,167first forwardttg gtg tgg gta ttt aaa tgg apcv - r11,6771,659first reversegca gcc atc ttg gaa aca tpcv - f21,2971,318second forwardtat agg ggt cat agg cca agt tpcv - r21,4521,431second reverseccc tac ctt tcc aat act acc glocation of the primers based on the nucleotide sequence of the orf2 gene of pcv1 (genbank accession no. ay219836)both inner primers fip and bip contained two binding regions and were connected by a tttt bridge oligonucleotide primer sets used for the lamp and nested pcr location of the primers based on the nucleotide sequence of the orf2 gene of pcv1 (genbank accession no. ay219836) both inner primers fip and bip contained two binding regions and were connected by a tttt bridge lamp reaction a 25-l reaction mixture consisted of 12.5 l of 2 lamp reaction buffer (eiken chemical, japan), 8 u bst dna polymerase (new england biolabs, usa), 2 l of the extracted target dna sample, 40 pmol each of fip and bip primers, and 5 pmol each of f3 and b3 primers. the lamp reaction was conducted by incubating the reaction mixture at 60c for 60 min and then inactivating the bst dna polymerase at 80c for 2 min. the reaction was monitored in real - time at 6-s intervals by measuring the turbidity at a650 using a loopamp real - time turbidimeter (la-320 ; eiken chemical, japan). the cutoff turbidity was set at 0.1 turbidity units and was determined by analyzing negative controls in replicates. a sample with turbidity remaining below 0.1 turbidity units throughout the 60-min incubation period was considered to be negative for pcv1 dna. if the turbidity of a sample increased above 0.1 turbidity units within the 60-min incubation period, it was considered to be positive, indicating contamination with pcv1 dna. the lamp amplicons were further analyzed by electrophoresis through a 2% agarose gel containing 0.5 mg / ml sybr safe dna gel stain (invitrogen, usa) in tris acetate nested pcr reaction a total of 25 pcr reaction mixtures of the first round pcr in the nested pcr consisted of 2.5 l of 10 buffer (100 mmol / l tris hcl at ph 8.8, 500 mmol / l kcl, 15 mmol / l mgcl2, 1% triton x-100), 1.25 mol / l each of four nucleoside triphosphates, 20 mol / l of each primer, 0.5 l of dna polymerase power taq (2 u/l ; bertec, taipei, taiwan), and 2 l of the dna sample. the first round pcr was performed at 95c for 5 min, followed by 30 cycles of denaturation at 95c for 20 s, annealing at 55c for 30 s, and extension at 72c for 30 s. finally, the samples were subjected to a terminal extension step at 72c for 10 min. from this reaction, 2 l of the first round pcr product was used as a template for the nested pcr. in the nested pcr, 25 l of reaction mixture consisted of 2.5 l of 10 buffer (100 mmol / l tris hcl at ph 8.8, 500 mmol / l kcl, 15 mmol / l mgcl2, 1% triton x-100), 1.25 mol / l each of four nucleoside triphosphates, 20 mol / l of each primer, and 0.5 l of dna polymerase power taq (2 u/l ; bertec, taiwan). the nested pcr was performed at 95c for 5 min, followed by 30 cycles each of denaturation at 95c for 20 s, annealing at 55c for 20 s, and extension at 72c for 20 s. finally, the samples were subjected to a terminal extension step at 72c for 10 min. amplicon of the nested pcr were analyzed by electrophoresis through a 2% agarose gel as described above. construction of recombinant plasmids full - length orf2 gene of pcv1 (genbank accession no. the amplicon was ligated into the pcrii - topo plasmid that was supplied with the dual promoter topo ta cloning kit (invitrogen, usa). top10fescherichia coli competent cells (invitrogen, usa) were transformed with the recombinant plasmid according to the manufacturer s instructions. the inserted target gene carried by the recombinant plasmid was directly sequenced as described previously (wang. the recombinant plasmid was quantified by measuring its absorbance a260 on a u2100 pro uv / vis spectrophotometer (general electronic healthcare, singapore) and diluted to 10 copies/l to develop a standard curve for evaluating the analytical sensitivity of the lamp. analytical specificity and sensitivity of the lamp to determine the analytical specificity of the lamp, dna samples extracted from the 21 virus isolates were tested by the lamp. dna extracted from specific - pathogen - free (spf) swine tissue samples was used as the negative control. to evaluate the analytical sensitivity of the assay, 10-fold serial dilutions of the recombinant plasmid were performed to prepare the dilutions at concentration from 10 copies/l to 1 copy/l, and each dilution was tested by both the lamp and the nested pcr (victoria. for quantification of the diluted samples, a standard curve was generated for the lamp, with serial 10-fold dilutions of the recombinant plasmid that were positive for pcv1 dna on the x - axis and the time of positivity (min) on the y - axis. evaluation of lamp with commercial swine vaccines two batches of each vaccine were tested for detection of pcv1 dna by the lamp and the nested pcr, respectively. to evaluate the vaccine matrices for interference or inhibition of the lamp reaction, all extracted dna of tested vaccine samples were spiked with plasma containing the recombinant plasmid. the final concentration of the recombinant plasmid for each spiked vaccine sample was 10 copies / ml. detection of pcv1 dna for each spiked vaccine sample was performed by the lamp as an internal control. the analytical specificity of lamp was evaluated using dna extracted from pcv1, pcv2, ppv, and prv, and cdna derived from csfv and prrsv. pcv1 dna was successfully detected, and a ladder - like amplicon was generated (fig. 1). the lamp amplified the pcv1 target gene, but not the nucleic acids extracted from pcv2, ppv, prv, csfv, and prrsv (fig. lane m 2,000100 bp ladder marker (50 u/l ; protech, taiwan) ; lanes 17 extracted dna of pcv1, pcv2, ppv, prv, cdna of csfv, prrsv, and negative control, respectively analytical specificity of the lamp was observed using agarose gel electrophoresis. lane m 2,000100 bp ladder marker (50 u/l ; protech, taiwan) ; lanes 17 extracted dna of pcv1, pcv2, ppv, prv, cdna of csfv, prrsv, and negative control, respectively by testing 10-fold serial dilutions (10 copies/l to 1 copy/l) of the recombinant plasmid, the lamp demonstrated a detection limit of 10 copies (fig. 2, lane 7), lane 15). the standard curve for lamp was generated from the amplification plots of the 10-fold serial dilutions of the recombinant plasmids (10 copies/l to 10 copies/l) vs. time (min) (fig. 3a). a linear regression line with a coefficient of r = 0.97 was plotted for the lamp (fig. 2analytical sensitivities of the lamp (lanes 18) and the nested pcr (lanes 916) were compared by detecting 10-fold serial dilutions of the recombinant plasmid (10 copies/l to 1 copy/l) by agarose gel electrophoresis. lane m 2,000100 bp ladder marker (50 u/l ; protech, taiwan). the pcr products of lanes 915 were 155 base pairs (bp) in lengthfig. 3analytical sensitivity of the lamp (a) was performed by real - time monitoring with 10-fold serial dilutions of the recombinant plasmid : 10 copies/l to 1 copy/l and negative control (nt). the linear function fitted to the plot of the mean threshold time against the log of the input pcv1 the recombinant plasmid is also shown (b) analytical sensitivities of the lamp (lanes 18) and the nested pcr (lanes 916) were compared by detecting 10-fold serial dilutions of the recombinant plasmid (10 copies/l to 1 copy/l) by agarose gel electrophoresis. lane m 2,000100 bp ladder marker (50 u/l ; protech, taiwan). the pcr products of lanes 915 were 155 base pairs (bp) in length analytical sensitivity of the lamp (a) was performed by real - time monitoring with 10-fold serial dilutions of the recombinant plasmid : 10 copies/l to 1 copy/l and negative control (nt). the linear function fitted to the plot of the mean threshold time against the log of the input pcv1 the recombinant plasmid is also shown (b) pcv1 dna was detected in three commercial csfv vaccines by the lamp and the nested pcr (table 2). these vaccines were manufactured by three different commercial companies (b, c, and e). all extracted dna of tested vaccine samples were spiked with pcv1 recombinant plasmids and yielded positive results for detection of pcv1 dna by the lamp (data not shown). these results also indicated that inhibition was not observed in the extracted dna of 25 commercial swine vaccine samples. the products generated by this method can be analyzed not only by conventional agarose gel electrophoresis but also spectrophotometry, which enables real - time analysis and quantification of the amplicons in commercial swine vaccines. amplification of a specific genomic region by conventional or nested pcr alone, or by pcr in combination with gene sequencing, has long been used to confirm the accuracy of amplicons generated by pcr (muhling. however, with or without gene sequencing, conventional detection procedures for pcv1 require several hours to complete. in contrast, dna detection with the lamp was much faster than with conventional pcr or nested pcr. after preparation of the sample dna, the lamp could be completed in approximately 1 h, whereas other methods required several hours to a few days. furthermore, pcv1 dna could be specifically and sensitively amplified using the two lamp primer sets ; no amplification was observed when the method was used to detect nucleic acids of pcv2, ppv, prv, csfv, fmdv, and prrsv. these results indicate the specificity and wide applicability of our lamp method in the detection of viral contaminants in commercial swine vaccines. our results showed that the lamp is highly sensitive and can detect small amounts of pcv1 dna present in samples. this method enables the detection and quantification of pcv1 dna in commercial swine vaccines. in this study, using the lamp, we found that three commercially available csfv vaccines were contaminated with pcv1 dna, although the source of pcv1 dna contamination in some commercial porcine vaccines has remained unknown. recently, pcv1 dna was also found in two commercial human rotavirus vaccines (baylis. although pcv1 is not regarded as a potential pathogen in humans (victoria. 2010), avoiding virus contamination during the process of vaccine production is absolutely essential. the detected pcv1 dna may originate from the cell lines used for vaccine production (quintana. presence of pcv1 dna in the vaccines does not necessarily imply that infectious pcv1 particles are present in the vaccines. the contaminating pcv1 may have been inactivated during the manufacturing process or may have been present in the live vaccine products in too small amounts to cause an infection (quintana. the presence of viral dna other than the vaccine dna itself is absolutely unacceptable. to fulfill this requirement, a rapid, specific, and sensitive method such as lamp can be easily incorporated in the production process to screen for pcv1 contamination in vaccines and in cell lines used for cultivation of the vaccine viruses. the spiking study was performed by deliberately spiking pcv1 virus into the vaccine samples to account for inhibition ; this avoids a potential problem that may result in the under - detection of pcv1 (i.e., false negatives). a previous study indicated that some human medicines contain heparin, adjuvant, phenol, or formaldehyde, which are common pcr inhibitors and always remain with the extracted nuclear acid (yokota., no evidence of inhibition has been observed in any extracted dna of swine vaccine sample for spiked recombinant plasmids. however, this was necessary to perform spiking studies as an internal control for the lamp reaction ; this assessed individual vaccine matrices that may be the cause of amplification product inhibition. in conclusion, this method can be used to rapidly detect cell lines and commercial swine vaccines for pcv1 contamination with high sensitivity and specificity. | a loop - mediated isothermal amplification (lamp) method with a real - time monitoring system was developed for the detection of porcine circovirus type 1 (pcv1) in commercial swine vaccines. this method was highly specific for pcv1. no cross - reaction to porcine circovirus type 2, porcine parvovirus, pseudorabies virus, classical swine fever virus, and porcine reproductive and respiratory syndrome virus was observed. the analytical sensitivity of the lamp for pcv1 dna was 10 copies/l in the case of positive recombinant plasmid comparable to that obtained from the nested polymerase chain reaction (nested pcr). furthermore, 25 commercial swine vaccines were tested by both the lamp and the nested pcr, and three of them were tested positive for pcv1 dna. these results indicate that pcv1 dna can be real - time detected by the lamp ; the method was highly specific, sensitive, and rapid for the detection of pcv1 dna, particularly in commercial swine vaccines. |
idiopathic sudden sensorineural hearing loss (issnhl) is one of the emergent conditions among various otologic diseases. it is the acute onset of hearing loss of 30 db in three contiguous frequencies, which may occur instantaneously or progressively over several days (1). it occurs mostly unilaterally, with a bilateral occurrence in 1 - 7.1% (2). treatment strategy is variable, while steroids, vasodilators, and anti - viral agents are most frequently prescribed. stahl and cohen (3) recently determined the outcome in patients with issnhl in their only hearing ear, and concluded that they may be treated the same way as those with normal contralateral ear. however, treatment regimens other than conventional ones may have to be considered in those who do not recover. therefore, we aimed to determine the outcome of this specific patient group and to define the timing to consider other treatment regimen such as cochlear implantation. medical records of issnhl patients who were admitted to chonnam national university hospital, gwangju, korea, from august 1999 to june 2006 were retrospectively analyzed. the control group consisted of 192 patients having issnhl in one ear and normal contralateral ear. they were given prednisolone (solu - dacortin, hanall, seoul, korea) starting from 1 - 1.5 mg / kg / day and tapered for next 12 days. mgso4 (4 g / day), dextran 40-dex (10 ml / kg in 5% dextrose) and carbogen inhalation were also given for 7 days with prednisolone. complete blood cell counting, routine serum chemistry, immunologic markers, viral markers, temporal magnetic resonance imaging or computed tomography were taken. if the patient did not recover until the day of discharge, he / she was then given intratympanic steroid injection once a week for 3 weeks. the intratympanic injection was started with local anesthesia by placing cotton pledget soaked with xylocaine (10% lidocaine, 10 mg / dose ; astrazeneca, tx, usa) at the tympanic membrane. after 15 min, the cotton pledget was removed, and 0.3 - 0.4 ml dexamethasone (5 mg / ml) solution was injected by puncturing the anterosuperior aspect of tympanic membrane with 25-gauge spinal needle. patients ' age, sex, underlying diseases, the degree of hearing loss, and the presence of dizziness or tinnitus were reviewed. the duration from the attack of issnhl to the first hospital visit, recovery rate, duration until the recovery, and follow - up period after discharge were compared between the groups. the degree of hearing loss was defined as mild (26 - 40 db), moderate (41 - 55 db), moderate - severe (56 - 70 db), severe (71 - 90 db), and profound (91 db or worse) using the mean level of 3 frequencies (500, 1,000, 2,000 hz). the patients were divided into two groups according to the degree of hearing loss : one group included mild, moderate and moderate - severe losses, and the other severe and profound losses. the recovery rate was determined by siegel 's criteria (2) : complete, partial, and slight recovery, and no improvement. in those who could not recover and finally received cochlear implantation, the ability of sound perception and the time elapsed to recover the communication were also determined. the ability of sound perception was examined using category auditory performances (cap) scores (4) : 0, no awareness of environmental sounds ; 1, awareness of environmental sounds ; 2, response to speech sounds ; 3, identification of environmental sounds ; 4, discrimination speech sounds ; 5, understand common phrases, no lip - reading ; 6, understand conversation, no lip - reading ; 7, use of telephone with known speaker. the statistics included chi - squared test for the analysis of demographic parameters, and independent sample t - test for the duration or recovery rates. medical records of issnhl patients who were admitted to chonnam national university hospital, gwangju, korea, from august 1999 to june 2006 were retrospectively analyzed. the control group consisted of 192 patients having issnhl in one ear and normal contralateral ear. they were given prednisolone (solu - dacortin, hanall, seoul, korea) starting from 1 - 1.5 mg / kg / day and tapered for next 12 days. mgso4 (4 g / day), dextran 40-dex (10 ml / kg in 5% dextrose) and carbogen inhalation were also given for 7 days with prednisolone. complete blood cell counting, routine serum chemistry, immunologic markers, viral markers, temporal magnetic resonance imaging or computed tomography were taken. if the patient did not recover until the day of discharge, he / she was then given intratympanic steroid injection once a week for 3 weeks. the intratympanic injection was started with local anesthesia by placing cotton pledget soaked with xylocaine (10% lidocaine, 10 mg / dose ; astrazeneca, tx, usa) at the tympanic membrane. after 15 min, the cotton pledget was removed, and 0.3 - 0.4 ml dexamethasone (5 mg / ml) solution was injected by puncturing the anterosuperior aspect of tympanic membrane with 25-gauge spinal needle. patients ' age, sex, underlying diseases, the degree of hearing loss, and the presence of dizziness or tinnitus were reviewed. the duration from the attack of issnhl to the first hospital visit, recovery rate, duration until the recovery, and follow - up period after discharge were compared between the groups. the degree of hearing loss was defined as mild (26 - 40 db), moderate (41 - 55 db), moderate - severe (56 - 70 db), severe (71 - 90 db), and profound (91 db or worse) using the mean level of 3 frequencies (500, 1,000, 2,000 hz). the patients were divided into two groups according to the degree of hearing loss : one group included mild, moderate and moderate - severe losses, and the other severe and profound losses. the recovery rate was determined by siegel 's criteria (2) : complete, partial, and slight recovery, and no improvement. in those who could not recover and finally received cochlear implantation, the ability of sound perception and the time elapsed to recover the communication were also determined. the ability of sound perception was examined using category auditory performances (cap) scores (4) : 0, no awareness of environmental sounds ; 1, awareness of environmental sounds ; 2, response to speech sounds ; 3, identification of environmental sounds ; 4, discrimination speech sounds ; 5, understand common phrases, no lip - reading ; 6, understand conversation, no lip - reading ; 7, use of telephone with known speaker. the statistics included chi - squared test for the analysis of demographic parameters, and independent sample t - test for the duration or recovery rates. patients ' age was 47.815.8 yr in the study group, and 51.015.3 yr in the control. underlying diseases included mostly diabetes mellitus and hypertension, and associated symptoms were dizziness and tinnitus ; with no significant differences between the groups. there were no significant differences of the initial degree of hearing loss between the groups (table 1). among the 25 patients in the study group, 14 patients (56%) did not recover the hearing at the time of discharge, 4 of which (29%) received the intratympanic injection of steroids. in the control, 59% did not recover the hearing at the time of discharge, 24% of which received the intratympanic injection. the underlying entities of deafness on contralateral ear in the study group were issnhl in 4, chronic otitis media in 7, enlarged vestibular aqueduct syndrome in 2, acoustic schwannoma in 1, acoustic trauma in 1, temporal bone fracture in 1, and unknown in 8. table 2 shows the time elapsed from the attack of issnhl to the hospital visit. in the study group, it was 5.1 days in those showing less than moderate - severe degree, and 3.0 days in those showing severe or profound degree. in the control group, it was 7.3 days in those showing less than moderate - severe degree, and 4.5 days in those showing severe or profound degree (p>0.05). the total follow - up period was longer in the study group than in the control. in the study group, it was 269.4 days in those having smaller than moderate - severe degree and 329.8 days in those having severe or profound degree. in the control group, it was 62.7 days in those having less than moderate - severe degree and 89.7 days in those having severe or profound degree. the recovery rate was quite similar between the groups : 64.0% in the study group and 62.5% in the control group (p>0.05). in the study group, according to siegel 's criteria, 3 were completely recovered (12%), 6 partially recovered (24%), 7 slightly recovered (28%), and 9 were not (36%). in the control group, there were 43 showing complete recovery (22%), 36 showing partial recovery (19%), 41 showing slight recovery (21%), and 72 showing no recovery (38%). the recovery rate of those who had issnhl worse than severe degree was 52.9% in the study group and 58.0% in the control group, being not significantly different between the groups. the time duration until recovery was 17.6 days in the study group and 11.0 days in the control group, the difference being not statistically significant (p>0.05). in both groups, recovery patterns were similar and the recovery was achieved mostly within 1 - 2 weeks after the initiation of the treatment (fig. all the recovery was achieved before 12 weeks (3 months), with only one patient recovering after that time (116 days). among 8 of those who did not recover in the study group and ended with total deafness in both ears, 6 patients underwent cochlear implantation. most of the patients reached cap score 5 within 2 - 3 months and could communicate without visual help (table 3). and about in an year they could talk on the telephone with a familial speaker (cap score 7). note that the duration to reach cap score 7 were longest in patients who received their cochlear implantation latest after sudden deaf attack (patient # 1 & # 2 in table 3). issnhl occurring in the only hearing ear is a quite important issue because it can cause a sudden blockade of entire verbal communication. however, very few studies have documented its outcomes. the prognostic factors include age, treatment fastness, degree of hearing loss, and presence of dizziness (5). although it was not the main aim of our study, we also observed that the degree of hearing loss was an important factor of the recovery. the hearing recovery following the treatment was similar between these two groups : 64.0% of recovery in the study group and 62.5% in the control group. we could see that conventional treatment strategy also worked with issnhl patients on their only hearing ear since demographic properties, recovery rate and recovery pattern (fig. it is suggested that patients with issnhl in their only hearing ear may be treated the same way as issnhl patients with normal opposite hearing ear. the follow - up duration in the study group was far longer than in the control group. it is likely that the patients with the only hearing ear would more eagerly seek a professional consult. they may be more nervous and worried about their outcomes, even in those who have mild or moderate degree hearing loss. the recovery was achieved mostly within 1 - 2 weeks after the start of treatments. the longest duration caused for recovery was 90 days in the study group and 116 days in the control group. most of the patients in both groups achieved recovery within 3 months and the recovery curve showed a plateau after that time (fig. 1). among 8 patients who did not show hearing recovery in the study group, 6 patients underwent cochlear implantation. one of the postoperative performance prognostic factors of cochlear implantation is the duration of deafness (6). although there may be some environmental or genetic differences, the time needed for the patient to communicate verbally without visual help was longest in patients who got their implantation after 2 - 3 yr from issnhl attack (table 3). most of the patients could communicate without visual help within 2 - 3 months (cap score 5). and finally they could hear and talk on the telephone with an known speaker about in an year. similar as in previous reports, we could see that the duration of deaf is an important prognostic factor in cochlear implantation of sudden deafened only hearing ear patients. for those who do not attain a hearing recovery from issnhl in the only hearing ear, it may not be proper just to wait and hope for a recovery. because for more the duration of deafness occurs, the poorer result of cochlear implantation might happen. an active treatment such as cochlear implantation may be considered as early as 3 months in order to return the patient to daily verbal communication. | the present study was undertaken to learn the outcome of patients with idiopathic sudden sensorineural hearing loss (issnhl) in their only hearing ear. timing to conduct a cochlear implantation was also determined in those who did not recover the hearing. the study group comprised 25 patients who confronted issnhl in their only hearing ear. a total of 192 patients, who had issnhl in one ear and had normal contralateral ear, served as the control. demographically there were no significant differences between the groups. the recovery rate was similar between the groups : 64.0% in the experimental and 62.5% in the control group. the duration until the recovery of issnhl in the only hearing ear was 5 - 90 days (average 17.6 days). in the experimental group, 8 patients did not recover from issnhl, and underwent cochlear implantation in 6 with satisfactory results. these results suggest that the same treatment is applicable for patients with issnhl regardless of whether their contralateral ear is deaf or normal. for those who do not recover from issnhl in their only hearing ear, culminating in bilateral deafness, we may consider further definitive treatment including cochlear implantation as early as 3 months after initiating the treatment of issnhl. |
attenuated familial adenomatous polyposis (afap) is a milder variant of familial adenomatous polyposis (fap), which manifests with fewer than hundred colorectal polyps, later age of onset of polyps and cancer, and a predilection toward involvement of the proximal colon in clusters.1 - 5 much of mutations in afap have already been reported.4 - 9 infrequently few mutations are still being discovered around the world. herein, we report two cases of same novel germline mutation in the adenomatous polyposis coli (apc) gene of afap patients within family members who were treated with sulindac after they refuse to perform colectomy. a 23-year - old man with no previous medical history and incidentally discovered multiple gastric polyps was referred to gangnam severance hospital. endoscopic submucosal dissection (esd) was performed for the gastric adenoma in the antrum, and multiple biopsies were done for the variable sized polyps in the upper body and fundus (fig. final pathologic report showed tubular adenoma with low grade dysplasia for the antral lesion (fig. suspected of having polyposis, the patient underwent colonoscopy which showed fewer than 100 colorectal polyps of 3 to 5 mm size from hepatic flexure to the rectum. the colorectal polyps confirmed as tubular adenoma with low grade dysplasia on pathologic report (fig. colonic polyps close or equal to 5 mm in size were endoscopically removed using polypectomy snare. genetic analysis using polymerase chain reaction (pcr) denaturing high performance liquid chromatography and direct sequencing revealed a novel frameshift mutation in the exon 15 of the apc gene. deletion of adenine - guanine (ag) and insertion of thymine (t) in codon 3833 - 3834 resulted in the formation of stop codon 1287 (c.3833 - 3834delaginst) (table 1, fig. multiple colonic polyps of 2 to 5 mm size were detected from ascending to sigmoid colon on colonoscopy (fig. colonic polyps close or equal to 5 mm in size were polypectomized and confirmed as tubular adenoma with low grade dysplasia. the patient 's sibling died of lymphoma but there was no history of colorectal cancer in the first degree relatives. genetic analysis also revealed same novel frameshift mutation in the exon 15 of the apc gene with deletion of ag and insertion of t in codon 3833 - 3834 resulting in the formation of stop codon in 1287 (c.3833 - 3834delaginst) which was identical to the son in the mother (table 2, fig. 4). evaluation with abdomen computerized tomography revealed no demonstrable malignancy in both patients. both patients were treated with sulindac 200 mg daily, as chemoprophylaxis after they refused to undergo colectomy. annual follow - up upper endoscopy for surveillance showed no evidence of recurrence at the site of previous esd for 2 consecutive years. colorectal polyps were much regressed in the first year and maintained that way in the second year on follow - up colonoscopy in both patients. most of the polyps in the ascending, transverse, and descending colon were regressed, and only a few diminutive, sessile polyps were remaining in the rectum after sulindac treatment (fig. a 23-year - old man with no previous medical history and incidentally discovered multiple gastric polyps was referred to gangnam severance hospital. endoscopic submucosal dissection (esd) was performed for the gastric adenoma in the antrum, and multiple biopsies were done for the variable sized polyps in the upper body and fundus (fig. final pathologic report showed tubular adenoma with low grade dysplasia for the antral lesion (fig. suspected of having polyposis, the patient underwent colonoscopy which showed fewer than 100 colorectal polyps of 3 to 5 mm size from hepatic flexure to the rectum. the colorectal polyps confirmed as tubular adenoma with low grade dysplasia on pathologic report (fig. colonic polyps close or equal to 5 mm in size were endoscopically removed using polypectomy snare. genetic analysis using polymerase chain reaction (pcr) denaturing high performance liquid chromatography and direct sequencing revealed a novel frameshift mutation in the exon 15 of the apc gene. deletion of adenine - guanine (ag) and insertion of thymine (t) in codon 3833 - 3834 resulted in the formation of stop codon 1287 (c.3833 - 3834delaginst) (table 1, fig. multiple colonic polyps of 2 to 5 mm size were detected from ascending to sigmoid colon on colonoscopy (fig. colonic polyps close or equal to 5 mm in size were polypectomized and confirmed as tubular adenoma with low grade dysplasia. the patient 's sibling died of lymphoma but there was no history of colorectal cancer in the first degree relatives. genetic analysis also revealed same novel frameshift mutation in the exon 15 of the apc gene with deletion of ag and insertion of t in codon 3833 - 3834 resulting in the formation of stop codon in 1287 (c.3833 - 3834delaginst) which was identical to the son in the mother (table 2, fig. 4). evaluation with abdomen computerized tomography revealed no demonstrable malignancy in both patients. both patients were treated with sulindac 200 mg daily, as chemoprophylaxis after they refused to undergo colectomy. annual follow - up upper endoscopy for surveillance showed no evidence of recurrence at the site of previous esd for 2 consecutive years. colorectal polyps were much regressed in the first year and maintained that way in the second year on follow - up colonoscopy in both patients. most of the polyps in the ascending, transverse, and descending colon were regressed, and only a few diminutive, sessile polyps were remaining in the rectum after sulindac treatment (fig. germline mutation in the apc gene located on chromosome 5q21 or in some cases, biallelic mutation in the muty homologue (myh) gene are responsible for classic fap.3 like classic fap, apc mutations in afap are likely to be frameshift or single base pair changes that result in premature stop codons and thus truncated protein.5 mutations at the 5 ' end of apc have been reported as both the first and most frequently encountered mutations related to afap.4 mutations at the 3 ' end, exon 9, or intron 9 of apc have also been reported to be the cause of afap.6 - 8 infrequently, mutations of myh gene located in chromosome 1p32 - 34 is associated with development of afap with variable phenotypic expressions.9,10 the classic fap is characterized by early onset of numerous colonic adenomas, with inevitable progression to colorectal cancer.3 other manifestations include gastroduodenal polyps, desmoids tumors, and extraintestinal features such as congenital hypertrophy of the retinal pigment epithelium, osteoma, and other malignancies. absolute life time risk of extracolonic cancer range from 0.6% in gastric to 15% in desmoids tumors.3,11,12 strict endoscopic surveillance is recommended for fap patients and those who are at risk family members and the optimal treatment remains to be prophylactic colectomy.3,13 on the other hand, afap is much subtle in presentation with less than hundred colorectal polyps, delayed onset of colorectal cancer and death compared with fap. due to its right side preference and tendency for rectal sparing, colonoscopy is preferred to sigmoidoscopy for surveillance.3 - 5 even though there are some expectations that the prognosis of afap is better than fap, the risk of missing early colorectal cancer during surveillance and limited knowledge of the risk and prognosis in afap still favors prophylactic colectomy with ileorectal anastomosis as standard option.14,15 surveillance for afap is different from that of fap. since there has been no case reported of colorectal cancer in afap under age of 20 years, full colonoscopy is recommended starting from age 18 to 20 years in contrast to 10 to 12 years in fap with an interval of 2 years.16 there are reports of higher cumulative probability of cancer - free survival in afap compared to classic fap even though its intra - familial heterogeneity and phenotypic expression.17 mounting evidence supports that endoscopic management with polypectomy might be sufficient enough to manage afap.4 recently, certain nonsteroidal antiinflammatory drugs are used to prevent polyp progression in patient with afap.18 a japanese study done with sulindac reduced colorectal adenomas of protruding type in uncolectomized fap, and its effect is unrelated to the locus of apc mutations.19 other more recent report showed regression of polyps in long term treatment with cyclo - oxygenase-2 inhibitor in a patient with afap and previous colonic carcinoma.20 our cases also demonstrated statisfying results with sulindac showing regression of small colonic polyps in both patients, although more time and evidence is required to be certain. infrequently, some cases of afap with newly discovered mutation manifest far greater malignant potentials in gastrointestinal tract.21 reports of gastric cancer in fundic gland polyps without metaplasia or atrophy in afap suggest that other carcinogenesis pathway might play a role.22 in other respect, lack of polyps or cancerous lesions in interpositioned large intestine for esophageal atresia during infancy suggests that various environmental differences also play important role in developing the expression of afap phenotype.23 phenotypic expression of benign course even in identical germline mutations in siblings warrants us to further study and puts absolute necessity for prophylactic colectomy in all afap patients in debate.9,24 ideal prophylactic colectomy age for afap is controversial and still under debate compared with 20 to 25 in fap, and ileorectal anastomosis would be sufficient for afap in contrast to ileal pouch - anal anastomosis in fap for surgery because of low risk of cancer formation in the remaining rectum.25 in regards to diagnosing afap or fap, there are issues with detection of mutations. nielsen.26 reported that 19 out of 296 polyposis patients (6%) who had been previously tested negative for apc or mutyh mutations by protein truncation test and sequence analysis, turned out to carry germline mutations when tested with multiplex ligation - dependent probe amplification. routine mutation detection techniques such as dna sequencing, protein truncation test, denaturing gradient gel electrophoresis, and single strand conformational analysis can only identify mutations in 70% of classical fap and 10% of afap.27 use of real - time pcr allowed detection of apc germline mutation not apparent by conventional methods.27 it should be noted that conventional mutation detection techniques can be misleading, especially in afap and further genetic testing using real - time pcr is necessary in case of no apparent mutation with polyposis patients. gastric and duodenal adenomas are most frequently seen extracolonic manifestations in afap as well as in fap.4 rates of duodenal adenomas in fap range from as high as 100% in the japanese reports to 33% in western reports.28 similar to the duodenum, stomach is also a major site of morbidity and potential mortality in fap.29 for unknown reasons, gastric cancer in fap is increased in the some asians (4.2% in korea and 2.1% in japan).28,29 and the site of gastric cancers occurring in afap and fap patients were mostly from fundic gland polyps.29,30 gastric cancer of adenomatous origin occurring sites other than fundus, especially in the antrum were rare.29 despite routine endoscopic surveillance, gastric cancers tend to develop in fundic gland polyps in afap and fap patients, and the malignant risk increased as the polyps got bigger.29 some physicians argue that more aggressive approach, including complete excision of large fundic gland polyps and prophylactic gastrectomy for patients with high grade dysplasia or large fundic gland polyps (> 7 mm), but further study is obviously needed to confirm these assertions.20 in conclusion, we report a novel germline mutation in codon 3833 - 3834 at exon 15 of the apc gene of afap which were detected in both mother and son. high risk polyps were treated with endoscopic polypectomies in the colon in both patients, and remaining small polyps were managed with the treatment of sulindac. consequently, it would be reasonable to have them under strict surveillance and chemoprophylaxis to control further growth of polyps, and hopefully regress them. considering between son 's young age versus the possibility of benign phenotypic expression in some afap mutations, early prophylactic colectomy is still a standard treatment option, as well as in the case of the mother, but sulindac has shown satisfactory results as an alternative treatment after they refused to go colectomy. further investigations for the optimal treatment of afap according to genotypic and phenotypic difference are needed. | attenuated familial adenomatous polyposis (afap) is a variant of familial adenomatous polyposis with fewer than one hundred colorectal polyps and a later age of onset of the cancer. here, we report two cases of afap within family members. each patient demonstrated the same novel germ line mutation in exon 15 of the adenomatous polyposis coli (apc) gene and was successfully managed with sulindac after refusal to perform colectomy : a 23-year - old man with incidentally diagnosed gastric adenoma and fundic gland polyps underwent colonoscopy, and fewer than 100 colorectal polyps were found ; a 48-year - old woman who happened to be the mother of the 23-year - old man also showed fewer than 100 colorectal polyps on colonoscopy. genetic analysis revealed a novel frameshift mutation in exon 15 of the apc gene. the deletion of adenine - guanine with the insertion of thymine in c.3833 - 3834 resulted in the formation of stop codon 1,287 in both patients. the patients were treated with sulindac due to their refusal to undergo colectomy. the annual follow - up upper endoscopy and colonoscopy in the following 2 years revealed significant regression of the colorectal polyps in both patients. |
blood samples : heparinized blood samples were collected from cattle with swallowing difficulty and from asymptomatic cattle from the same cowsheds where the affected cattle were raised. the sampling was conducted on the two farms (farms a and b) where the clinical cases were observed, on october 25 and 31, respectively. the blood samples were separated into plasma and blood cells by centrifugation at 2,150 g for 10 min. the blood cells were washed three times with phosphate - buffered saline (pbs) and resuspended in pbs. serum samples were obtained from the above - mentioned cattle at the same time and 2 weeks later. in june 2013, 120 calves that had not experienced summer were selected from all over kagoshima prefecture for sentinel arbovirus surveillance. heparinized blood and serum samplings were obtained from the calves in june, august, september and november. the processed plasmas and blood cells were kept at 80c until the virus isolation and viral genome detection. the serum samples were preserved at 20c until they were used for the virus neutralization test (vnt). virus isolation : hamster lung (hmlu-1) and baby hamster kidney (bhk-21) cells were grown in eagle s minimum essential medium (mem ; nissui, tokyo, japan) supplemented with 0.295% tryptose phosphate broth, 0.015% sodium bicarbonate and 5% bovine serum at 37c. virus isolation was conducted with the processed blood samples as described. in brief, tube - cultured cells were washed three times with earl s solution, inoculated with the processed samples and incubated for 1 hr at 37c. after the inocula were replaced with maintenance medium (mem containing 0.295% tryptose phosphate broth and 0.015% sodium bicarbonate), the inoculated cultures were maintained rolling and observed for cytopathic effects (cpes) over 7 days. if no cpes were observed, two further passages were allowed for the supernatant of the primary inoculated culture. virus neutralization test : the serum samples were heat - inactivated at 56c for 30 min. fifty l of serial two - fold dilutions of serum, in duplicate rows, were mixed with an equal volume of cultured medium containing 100 tcid50 of the virus in flat - bottomed 96-well plates. the mixtures were incubated at 37c for 1 hr, and then, 100 l of the suspension of hmlu-1 cells in serum - free medium (git ; wako pure chemical industries, osaka, japan) was added to each well. after incubation at 37c for 7 days under a 5% co2 atmosphere in a humid chamber, the plates were microscopically observed for the presence of cpes. the antibody titer is expressed as the reciprocal of the highest serum dilution at which cpes were inhibited. viral rna extraction and rt - pcr : viruses were propagated in hmlu-1 and bhk-21 cells. viral rna was extracted from cultured fluid and blood cell suspensions with the high pure viral rna kit (roche, mannheim, germany) per the manufacturer s instructions. reverse transcription - polymerase chain reaction (rt - pcr) was conducted with the titan one tube rt - pcr kit (roche) using the following conditions. cdna synthesis was carried out for 30 min at 50c, followed by heat inactivation for 2 min at 94c. the pcr conditions applied were 10 cycles of 30 sec at 94c, 30 sec at 55c and 45 sec at 68c, followed by 25 cycles of 30 sec at 94c, 30 sec at 55c and 45 sec at 68c, with the latter time increased by 5 sec per cycle. for rna extracted from the blood samples, 10 additional cycles were used in the latter condition. the partial sequence of segment 3 of ehdv was detected with a group - specific primer set, ep3u1416f and e31931r. ehdibal2f + ehdibal2r-2 and ehd97l2f + ehd97l2r were designed for ibav and the ibav 1997 variant, respectively (table 1table 1.oligonucleotide sequences for rt - pcr assays and sequencing for segment 2 of ehdvsoligonucleotidesequence (53)positionpurposereferencesfor ibavibavl2 - 1 - 17fgttaaattgtccccaga 117rt - pcr, sequencingibavl2 - 552 - 571fctatgcatcgggtcaggaac552571sequencingibavl2 - 1107 - 1126fgccatatggggagataatag11071126sequencingehdibal2ftacgcaaggtaagagaccaga16671687rt - pcr, sequencingibavl2 - 2284 - 2305fatgaggacctattaccaatgta22842305sequencingibavl2 - 661 - 642rgttcttcctgaaacatcaac661642sequencingibavl2 - 1212 - 1193rgccacatcatatctgttcgc12121193sequencingibavl2 - 1785 - 1766rcagtcatacagaacgctcgg17851766sequencingehdibal2r-2tcttctccacctcttgcatt22832264rt - pcr, sequencingibal2rgtaagtttgttgttcccagtaaacc30022978rt - pcr, sequencingfor ehdv serotype 1ehdv-1/s2/103 - 124fatatcctggcggaaccatatgg103124rt - pcr, sequencingehdv-1/s2/462 - 481fgctcgcatacacctatgaat462481sequencingehdv-1/s2/609 - 590racatctggtcgactatgcct609590sequencingehdv-1/s2/1021 - 1001ratctgcctgatgtggtgtttg10211001rt - pcr, sequencingfor ibav 1997 variantehd97l2fgatgcgatcctatacaaccatc499520rt - pcrehd97l2raatcgtcagcactctggttatc868847rt - pcra) oligonucleotide primers were designed from ibaraki (genbank accession number : ibaraki-2 (am745078), dpp2209 (hm156728) and ksb-14/e/97 (ab078628) strain / isolates for ibav, ehdv serotype 1 and ibav1997 variant, respectively.). a published primer set, ehdv-1/s2/103 - 124f and ehdv-1/s2/1021 - 1001r, was used for specific detection directed to segment 2 of ehdv serotype 1. ibavl2 - 1 - 17f and ehdibal2r-2, and ehdibav2f and ibal2r (table 1) were applied for the amplification of the entire sequence of segment 2 of ibav. the annealing temperature on the pcr the rt - pcr products were electrophoresed in 1.5% agarose and tae (tris - acetate - edta) gel, and ethidium bromide - stained gels were visualized with ultraviolet light. a) oligonucleotide primers were designed from ibaraki (genbank accession number : ibaraki-2 (am745078), dpp2209 (hm156728) and ksb-14/e/97 (ab078628) strain / isolates for ibav, ehdv serotype 1 and ibav1997 variant, respectively. sequencing and phylogenetic analysis : the rt - pcr products were processed with the qiaquick pcr purification kit (qiagen, hilden, germany) and then sequenced directly using bigdye terminator cycle chemistry on an abi 3100-avanti genetic analyzer (life technologies, carlsbad, ca, u.s.a.). the oligonucleotide primers used for the cdna synthesis and the sequencing for segment 2 of ibav and ehdv serotype 1 are listed in table 1. 10.1.3 software (genetyx, tokyo, japan) and compared with the deposited sequences in genbank by using the genetyx homology search tools. neighbor - joining (nj), maximum likelihood (ml) and maximum parsimony (mp) consensus trees were constructed using mega 6 from clustal sequence alignments of ehdv segment 3 nt sequences and muscle sequence alignments of ehdv vp2 aa sequences (table 2table 2.list of ehdvs used for phylogenetic analysis in this studystrain / isolateserotypelocation (year)isolation sourcegenbank accession no.segment 2segment 3ibaraki-22japan (1959)affected cattleab078620ab078621y870612japan (1987)cattleab078624ab078625ksb-14/e/97untypedjapan (1997)cattleab078628ab078629ks-7/e/13untypedjapan (2013)cattlelc018714lc042608kawanabe1japan (1984)cattle lc042606ks-1/e/13untypedjapan (2013)cattle lc042607new jersey1u.s.a. (1955)white - tailed deernc_013397am744979ib ar 226191nigeria (1967)culicoides spp.am745008am745009alberta2canada (1962)white - tailed deeram744998am744999csiro 4392australia (1979)cattleam744988am744989ib ar 338534nigeria (1968)culicoides spp.am745018am745019csiro 1575australia (1977)cattleam745028am745029csiro 7536australia (1981)cattleam745038am7450393186bahrain (1983)cattleam745068am745069csiro 7757australia (1981)cattleam745048am745049dpp598australia (1982)cattleam745058am745059) with default parameters. the reliability of the inferred consensus tree was tested by a boot - strap resampling of 1,000 pseudo - replicate data sets. clinical cases : in october 2013, suspected cases of ibaraki disease were reported at two cattle breeding farms (farms a and b) located in the northwestern part of the mainland region of kagoshima prefecture (fig. 1.geographical distribution of clinical cases and ibav seroprevalence in kagoshima prefecture, japan.). farms a and b were 10 km apart and maintained 450 and 15 japanese black beef cattle, respectively. the affected cow at farm a developed a fever over 40c, foamy salivation, dysphagia, exophthalmos and swelling of the tongue. a cow at farm b showed fever, anorexia, foamy salivation, dysphagia and abdominal distension during the same period. the diseased cattle recovered after 2224 days with supportive care and antibiotic treatment. rt - pcr for ehdv detection : we tested samples from the two diseased cattle (a-1 of farm a and b-1 of farm b) and 13 asymptomatic cattle (a-2 to -6 of farm a and b-2 to -9 of farm b) by rt - pcr using primer sets for the detection of ehdv segment 3 (group - specific) and ibav segment 2 (strain - specific) (table 3table 3.rt-pcrs and serological tests to detect the prevalence of ehdv in cattle sampled in the farms where clinical cases were observedfarmcattlert - pcrvirus isolationtiter of neutralizing antibodyibaraki-2ks-1/e/13ehdv segment 3ibav segment 2hmlu-1bhk-21prepostprepostaa-1++nt1,0241,02422a-2+nt282256a-3++nt2512<2<2a-4nt<216<2<2a-5nt<2<2<2<2a-6nt<2<2<2<2bb-1++1281,02442b-2<2512<22b-3+51225622b-4<2512<22b-5+2416128b-6++64128<28b-7+++ (ks-7/e/13)8256<2<2b-8<22<2<2b-9++ (ks-8/e/13)<2128<22a) cattle showing swallowing difficulty, b) parenthesis indicates virus isolate, c) ehdv isolates used for vnts, nt : not tested.). the group - specific primer set successfully amplified cdna of the expected size from both of the diseased cattle and seven of the asymptomatic cattle. a) cattle showing swallowing difficulty, b) parenthesis indicates virus isolate, c) ehdv isolates used for vnts, nt : not tested. of the ehdv - positive cattle, the two diseased cattle and three of the asymptomatic cattle (a-1 and -3, and b-1, -6 and -7, respectively) tested positive by the ibav - specific rt - pcr, but the other four asymptomatic cattle tested negative. sequences of the cdna by the group - specific rt - pcr were divided into two groups with 9% nt diversity. the sequence that was detected in the two diseased cattle and five asymptomatic cattle (a-1 and -3, and b-1, -3, -6, -7 and -9) showed high identity with segment 3 of previous ibav isolates, ibaraki-2 and y87061 (97.297.8% nt identity). the other sequence amplified from two asymptomatic cattle (a-2 and b-5) had relatively low nt identities (92%) with the ehdv segment 3 sequence deposited in genbank. the cdna from segment 2 in the blood samples had 95.595.6% nt identity with that of the previous ibav isolates. virus isolation : two viruses were isolated in bhk-21 cells from blood cells obtained from two of the asymptomatic cattle (b-7 and b-9) on farm b (table 3) and designated as ks-7/e/13 and ks-8/e/13, respectively. the group - specific rt - pcr successfully amplified cdna from these viruses. six additional viruses were isolated from sentinel cattle blood samples collected between september and november 2013. of these virus isolates, three were identified as ehdv by the group - specific rt - pcr and designated as ks-1/e13, ks-2/e/13 and ks-5/p/13. the other three isolates were identified as daguilar virus of the genus orbivirus using a specific rt - pcr assay as described (data not shown). we performed a strain - specific rt - pcr directed to segment 2 of ibav, the ibav 1997 variant and ehdv serotype 1 using the ehdv isolates (fig. 2.electrophoretic analysis of the rt - pcr product from segment 2 of ehdv isolates using ibav - specific (a), ehdv serotype 1-specific (b) and ibav 1997 variant - specific (c) primer pairs. each primer set expectedly generates a specific product with the lengths 617, 919 and 370 bp, respectively. lanes : 1, ks-1/e/13 ; 2, ks-2/e/13 ; 3, ks-5/p/13 ; 4, ks-7/e/13 ; 5, ks-8/e/13 ; 6, ibaraki-2 (positive control for ibav) ; 7, kawanabe (positive control for ehdv serotype 1) ; 8, ksb-14/e/97 (positive control for ibav 1997 variant) ; 9, negative water control ; m, 100 bp dna ladder.). the rt - pcr product was amplified with the ibav - specific primer set from ks-7/e/13 and ks-8/e/13. in contrast, ks-1/e/13, ks-2/e/13 and ks-5/p/13 tested positive by the ehdv serotype 1-specific rt - pcr. no amplification of the ehdv isolates was detected by the ibav 1997 variant - specific rt - pcr. electrophoretic analysis of the rt - pcr product from segment 2 of ehdv isolates using ibav - specific (a), ehdv serotype 1-specific (b) and ibav 1997 variant - specific (c) primer pairs. each primer set expectedly generates a specific product with the lengths 617, 919 and 370 bp, respectively. lanes : 1, ks-1/e/13 ; 2, ks-2/e/13 ; 3, ks-5/p/13 ; 4, ks-7/e/13 ; 5, ks-8/e/13 ; 6, ibaraki-2 (positive control for ibav) ; 7, kawanabe (positive control for ehdv serotype 1) ; 8, ksb-14/e/97 (positive control for ibav 1997 variant) ; 9, negative water control ; m, 100 bp dna ladder. sequences of segments 2 and 3 of ks-7/e/13 and ks-8/e/13 were identical to those detected in the two diseased cattle and three of the asymptomatic cattle (a-1 and -3, and b-1, -6 and -7). the amplicons by the group - specific rt - pcr from the two asymptomatic cattle (b-3 and -9) that tested negative in the ibav - specific rt - pcr were also identical to those of segment 3 of ks-7/e/13 and ks-8/e/13. the rt - pcr product from segment 3 of ks-1/e/13, ks-2/e/13 and ks-5/p/13 matched the sequence from the two asymptomatic cattle (a-2 and b-5) from which the ibav - related sequences were negative. the rt - pcr product from segment 2 of the isolates shared 97.3% and 96.8% nt identity with the corresponding region of japanese (kawanabe) and australian (dpp2209) strains of ehdv serotype 1, respectively. in our comparative analysis of the aa sequence of vp2, the isolates shared 99.3% and 98.3% identity with the japanese and australian strains, respectively. vnts for bovine sera : in a vnt using ibav, high neutralization antibody (na) titers ranging from 1:128 to 1:1,024 were observed in post - sera of the two diseased cattle and the seven asymptomatic cattle on farms a and b (table 3). in contrast, the na titers 1:128 and 1:256 were detected against ks-1/e/13 in post - sera of two of the asymptomatic cattle (a-2 and b-5). a significant rise in the na titers against both ibav and ks-1/e/13 was observed between pre- and post - serum collections from the studied farms, indicating that the viruses spread simultaneously in those days. the cross - reactions between the two viruses in the vnt were not significant (1:8), and none of the serum samples contained high na titers against both of the viruses at once. the seroconversion of sentinel cattle to ibav was found in october and november 2013 at three other farms located in the northwestern part of kagoshima prefecture (fig. 1). phylogenetic analysis of ehdv : the phylogenetic tree based on the partial sequence of segment 3 shows that all of the japanese and australian isolates / strains composed a single cluster (fig. 3fig. 3.phylogenetic comparison of the partial nucleotide sequence of segment 3 of japanese field isolates and reference strains of ehdv. however, kawanabe and ks-1/e/13 formed a single clade and were relatively less related to other members in the cluster. we identified 2,960 nt of segment 2 of ks-7/e/13, and they were shown to code for a deduced 982-aa length of vp2 protein, similar to the previously reported ibav isolates. the vp2 sequence from ks-7/e/13 shared 95.6% nt and 97.5% aa identities with ibaraki-2, and 96.1% nt and 98.2% aa identities with y87061. phylogenetic comparison of the partial nucleotide sequence of segment 3 of japanese field isolates and reference strains of ehdv. the sequence identity was also high between ks-7/e/13 and an australian strain (csiro 439) of ehdv serotype 2 (93.0% nt and 96.0% aa identities). relatively low identities were observed with a north american strain (alberta) of ehdv serotype 2 (71.3% nt and 73.6% aa identities). in contrast, ks-7/e/13 was highly diverged from the ibav 1997 variant (ksb-14/e/97) (69.7% nt and 67.5% aa identities). the nj consensus tree based on the aa sequences of ehdv vp2 demonstrated that ks-7/e/13 clustered with previous ibav isolates (fig. 4.phylogenetic tree of full - length amino acid sequence of vp2 between reference strains and japanese field isolates of ehdv listed in table 2. ksb-14/e/97 was less related to ehdv serotype 2 isolates, but it formed a distinct clade with ehdv serotype 7 (csiro 775). the trees constructed by ml and mp supported the nj consensus tree (data not shown). phylogenetic tree of full - length amino acid sequence of vp2 between reference strains and japanese field isolates of ehdv listed in table 2. our observation of typical ibaraki disease manifestations, such as fever and dysphagia, and the detection of ibav - related sequences and antibodies in the diseased cattle clearly demonstrated the occurrence of ibaraki disease in the northwestern part of kagoshima prefecture in 2013. the ehdv isolates from one of the studied farms were genetically close to previously reported ibav isolates and caused the typical clinical signs in the infected cattle. in contrast, the present phylogenetic comparison showed that ksb-14/e/97 is less related to ehdv serotype 2 (including ibavs) and should be classified as ehdv serotype 7. a low level of cross - reaction in the vnt between ibav and ehdv serotype 7 might have led to the misidentification at the time, when the vp2 sequence from all serotypes was not available [3, 20, 22 ]. because the 199798 epidemic was caused by a different ehdv serotype, it should be distinguished from the other outbreaks of ibaraki disease. of interest is that ehdv serotype 1 also spread in the same area (even on the same farms) during the instances of ibaraki disease in 2013. ehdv serotype 1 caused hemorrhagic disease of wild deer in north america and may have been involved in the febrile disease of cattle on reunion island [6, 19 ], but no association of ruminant morbidity was reported in other regions. it is likely that ehdv serotype 1 was not involved in the cattle morbidity in 2013, as shown in its previous spread in an overlapping region. the phylogenetic tree based on segment 3 showed that ehdv serotype 1 isolates from japan were primarily sorted into the eastern topotype, but diverged from other japanese and australian isolates. this finding suggested that these isolates had been geographically separated from the other isolates in their evolution for a certain period of time. like other segmented viruses, reassortants between heterogeneous serotypes of ehdv were sometimes recovered in the field [1, 2 ]. co - circulation of the ibav and ehdv serotype 1 suggested the potential reassortment between them. a full genome analysis of ehdv isolates in 2013 is needed to determine whether reassortment has occurred. surprisingly, the co - infection was not found in the ehdv - positive cattle by the genetic and serological tests, although the viruses spread in the studied farms during the same period. interference between two viruses might restrict the replication of either virus, as shown by an experimental co - infection of calves with bluetongue virus serotypes 1 and 8. although seroconversion in cattle to ibav has been detected sporadically, no occurrence of ibaraki disease has been seen in japan for 26 years, until the present study. reports of clinical cases and the sentinel seroconversion to ibav in the northwestern part of kagoshima prefecture are limited. no occurrence of ibaraki disease was reported in the other 46 prefectures of japan in 2013, suggesting the local spread of ibav. the present sentinel surveillance suggested that the incursion of ibav happened in october 2013. the mean of the average temperatures at four observation points close to the studied and seroconverted farms generally reached 20c or above during the beginning and middle of october, but rapidly decreased in november (japan meteorological agency). the inadequate temperatures for culicoides flight behavior might have prevented the transmission cycle and thus restricted the viral spread to within the small area. in the 1959 epizootic outbreak, ibaraki disease was first recognized in southern japan in august and swept over the southern half of the nation in the following four months. the history of outbreaks implied that the earlier incursion of the virus may have caused the larger outbreak of the disease in japan. the current live attenuated and inactivated vaccines against ibaraki disease were developed based on ibaraki-2. the small aa sequence diversity of vp2 between ibaraki-2 and ks-7/e/13 suggested that the current commercial vaccines are still effective for the prevention of ibaraki disease. the reemergence of ibaraki disease reminds us of the importance of continuous vaccination in cattle populations to minimize economic losses. in the meantime, diagnostic and preventive measures should be prepared for other ehdv serotypes that are associated with cattle morbidity in japan and other countries [22, 26, 31 ]. sentinel surveillance will be useful to identify the incursion and circulation of ehdvs in southern japan with a high risk of arbovirus infections. | in japan in 2013, two cattle in the northwestern part of kagoshima prefecture developed fever and swallowing difficulty and were suspected of having ibaraki disease. the epizootic hemorrhagic virus (ehdv) genome was detected from diseased and asymptomatic cattle by reverse transcription - polymerase chain reaction (rt - pcr). high neutralization antibody titers to ibaraki virus (ibav) ranging from 1:128 to 1:1,024 were observed in the rt - pcr - positive cattle, and the virus was isolated in one of the ibav - positive farms. a pairwise alignment and phylogenetic analysis based on the major outer coat protein vp2 encoded in segment 2 revealed a close relationship between the isolated viruses and previous ibav isolates. the phylogeny of vp2 also suggested that an ibav variant isolated in 1997 was distinct from ibav and sorted into a heterogeneous serotype, ehdv serotype 7. the findings revealed the reemergence of ibaraki disease in japan after a 26-year absence. interestingly, the co - circulation of ehdv serotype 1 with ibav was observed in the affected region, suggesting the potential reassortment between two heterogeneous serotypes in the field. sentinel surveillance in kagoshima prefecture indicated that the incursion of ibav occurred in october 2013 and that its spread was limited within the small area. inadequate environmental temperatures for vector transmission in late autumn might have limited the virus spread to a wider region. the reemergence of ibaraki disease showed us the importance of continuous vaccination to prevent economic losses. |
in addition to classical endpoints, toxicogenomics methods have been used to characterize the assays and to classify toxicants. for regulatory purposes, the descriptive data from, e.g., transcriptomics or metabolomics approaches need to be converted to quantifiable measures allowing one to compare and predict the hazard of chemicals and drugs. first attempts to determine benchmark concentrations on the basis of transcriptomics data have already been undertaken in vivo.(6,7) their application to in vitro test systems is expected to yield important information about low - dose toxicant effects. the developing central nervous system is one of the most frequent targets of systemic toxicity. moreover, testing of nervous system development and possible long - term effects is particularly challenging. animal testing for example according to oecd guidelines 414 (2-generation reproduction) or 426 (developmental neurotoxicity) is time - consuming and labor intensive. the testing capacities are by far not sufficient to test all compounds in vivo that should be studied for reproductive toxicity or developmental neurotoxicity (dnt) in the context of reach. moreover, toxicological risk assessment needs to be adapted to the modern needs of the pharmaceutical as well as the chemical industry. between 1999 and 2011, 19% of the 279 new approved drugs in europe were reported to have postapproval safety - issues, and 5 drugs were withdrawn from the market. the chemical industry, however, is confronted with the reach initiative asking them to provide more detailed toxicological data regarding new compounds as well as on chemicals already on the market. consequently the national research council of the usa has published their vision of toxicology for the 21st century in 2007 in which they favor the development of mostly human based in vitro test systems, which can be used for high - throughput screening and for high content endpoints such as for transcriptomics approaches. cultures of differentiating pluripotent stem cells, such as human embryonic stem cells (hesc) or human induced pluripotent stem cells, offer unique possibilities of studying the very early steps of human development that lead to the formation of germ layers and primordial tissues. this opportunity was seized by the european commission - funded research consortium for the use of embryonic stem cell - based novel alternative tests (esnats) for the prediction of toxicity of drug candidates (www.esnats.eu). within this context, several tests have been established that recapitulate critical processes of early neuronal development in vitro.(4,1623) recently, two positive control compounds of developmental neurotoxicity, valproic acid (vpa) and methylmercury, have been tested in four test systems. the use of two compound concentrations indicated that the number of altered genes and the extent of deregulation strongly depend on the concentration of the test compound. the highest concentration used in this previous study was a benchmark concentration (bmc) that reduced overall cell viability by not more than 10%. this procedure was chosen to avoid testing of cytotoxic concentrations that might generate unspecific gene expression patterns due to cell death. however, our previous study also showed that exposure to a concentration that reduces viability by exactly 10% is difficult to perform. however, it has not yet been tested if cytotoxic concentrations really cause a death associated expression signature and how the transcriptome changes are affected qualitatively by concentrations deviating from the bmc. comparisons between test systems and test compounds in this earlier study suggested that different toxicants may regulate the same master transcription factors. as such factors define cell identity and they show coordinated regulation in different pathologies, it may be assumed that they also play a role in developmental toxicity, and the threshold of their activation may determine the threshold of teratogenicity. to address the above issues, we used the ukn1 test system for more detailed experiments. in this assay, hesc differentiate to neuroepithelial precursor cells (nep) within 6 days, and they were exposed to vpa during the entire period of differentiation. we used in this study eight concentrations of vpa covering a range from completely nontoxic to strongly cytotoxic and analyzed genome wide expression patterns. vpa was chosen as a well - studied positive control compound of developmental neurotoxicity. the data were analyzed by classical biostatistical approaches, but we also developed quantitative measures of developmental disturbance, based on systems biology considerations. for instance, we quantified not only alterations of individual gene ontologies (go), as pioneered by the piersma lab, but we also addressed superordinate cell biological processes to gain overall insight. we report that concentrations at the uppermost limit of the noncytotoxic range may be a reasonable compromise for gene array classification studies because with such concentrations, (i) the genes that indicate a teratogenic mode of action are sufficiently deregulated, and (ii) dilution by unspecific cytotoxicity associated genes only start to emerge. gelatin, putrescine, selenium, progesterone, apotransferin, glucose, insulin, and valproic acid were obtained from sigma (steinheim, germany). fgf-2 (basic fibroblast growth factor) and noggin were obtained from r&d systems (minneapolis, mn, usa). y-27632, sb-43154, and dorsomorphine dihydrochloride were from tocris bioscience (bristol, uk). all cell culture reagents were from gibco / invitrogen (darmstadt, germany) unless otherwise specified. human embryonic stem cells (hesc) (h9 from wicells, madison, wi, usa) were differentiated according to the protocol published by chambers and colleagues with the following modifications. instead of using 500 m noggin, we used the combination of 35 m noggin and 600 nm dorsomorphine together with 10 m sb-431642 for dual smad inhibition as described earlier. this was used to prevent bmp and tgf signaling, and thus to achieve a highly selective neuroectodermal lineage commitment. for handling details, treatment with valproic acid (vpa) was done with the indicated concentrations from 25 m to 1000 m vpa dissolved in pbs. dod0 medium was prepared as indicated in ref (28) and supplemented with the indicated concentrations of vpa. medium supplemented with vpa was changed to dod1, 2, and 4. in order to determine cytotoxicity, after the resazurin assay, the medium was removed, and the cells were lysed in rna protect solution (quiagen). affymetrix chip - based dna microarray analysis (human genome u133 plus 2.0 arrays) was performed exactly as described earlier. (24) the following analyses were performed using the statistical programming language r - version 3.0.1. for the normalization of the entire set of 30 affymetrix gene expression arrays, the extrapolation strategy (rma+) algorithm was used that applies background correction, log2 transformation, quantile normalization, and a linear model fit to the normalized data in order to obtain a value for each probe set (ps) on each array. as reference, after normalization, at each concentration the difference between gene expression and corresponding controls was calculated (paired design). differential expression was calculated using the r package limma. here, the combined information of the complete set of genes is used by an empirical bayes adjustment of the variance estimates of single genes. this form of a moderated t test is abbreviated here as the limma t test. the resulting p - values were multiplicity - adjusted to control the false discovery rate (fdr) by the benjamini yekutieli procedure. as a result, for each concentration, a gene list was obtained, with corresponding estimates for log fold change and p - values of the limma t test (unadjusted and fdr - adjusted). color encodes the magnitude of the values, ranging from blue (low) to yellow (high). principal component analysis (pca) plots were used to visualize expression data in two dimensions, representing the first two principal components, that is, the two orthogonal directions of the data with highest variance. the software r, version 3.0.1, was used for all calculations and display of pca and heat maps (r_development_core_team 2012). the calculation and display of toxicity curves was done using graphpad prism 5.0 (graphpad software, la jolla, usa). the venn diagrams for the comparison of gene expression, gene ontology (go) terms, and transcription factor binding sites (tfbs) between test systems were constructed according to chow and rodgers. the size of circles and areas was chosen proportional to the number of elements included if possible, i.e., if there is no empty section (zero in venn diagram). before clustering first, we filtered out all of the ps with too small variation. for this, we used a standard deviation cutoff of 0.25. second, we standardized the expression measurements for each ps, by subtracting its mean and dividing with its standard deviation. the clustering itself was performed using the k - means function from r. for the index of overrepresented gos, the significantly regulated genes were identified for each drug concentration. then, the sum of ogo among up - regulated ps (at a given drug concentration), of ogo among down - regulated ps, and among all regulated ps was calculated. this sum was divided by 2 (to account for redundancies in this sum) to arrive at the used index number. for the gene regulation index, then, for each condition, the top 100 genes were selected (highest fold changes, irrespective of the direction of regulation). for each of these genes, the negative log of the fdr corrected p - value was determined, and then, the sum of these 100 values was formed. the teratogenicity index is expressed by two coordinates in the plane formed by the index of ogos and the gene regulation index. the gene ontology group enrichment was performed using r - version 3.0.1 with the topgo package, and only results from the biological process ontology were kept. the category was considered only if it was annotated with more than 100 genes, and the minimal enrichment p - value across all concentrations was below 0.001. a new biostatistical method for measuring activation profiles of go the method uses a segmentation test to identify significant enrichment with up- or down - regulated genes (restricted by p - value 2-fold change. after fdr correction, no significantly altered ps were found for the two lowest tested vpa concentrations of 25 and 150 m (figure 2a). between 350 and 1000 m vpa, the numbers of up- or down - regulated probe sets (ps) gradually increased (figure 2a and table s1, supporting information). from these data, it is not clear, whether genes regulated, e.g., at 450 m, were not at all regulated at lower concentrations or whether they were regulated but did not pass our stringent selection threshold (p 2). therefore, we selected the ps that were regulated by 450 m vpa and determined their average fold change (fc). therefore, we determined the fc of the same set of ps at lower and higher concentrations (figure 2b). as a complementary approach, we selected all ps regulated significantly (p 2). left panel (red) represents the amount of up - regulated ps and the right panel (green) the amount of down - regulated ps. (b) the ps identified in a to be regulated by 450 m vpa (up, n = 554 ; down, n = 110) were examined for their regulation at all drug concentrations. the average fc of this set of up - regulated ps is shown in the left panel for different vpa concentrations ; the data for the down - regulated ps are in the right panel. (c) significantly up- and down - regulated ps and their potential upstream regulators were identified by bioinformatic approaches. the numbers of ogos (left panel) and tfbs (right panel) are displayed for 350, 550, and 1000 m vpa. red represents the go (left panel) and tfbs (right panel) overrepresented among up - regulated ps and green from down - regulated ps. (d) the ogos determined in c were classified in superordinate cell biological processes by expert knowledge. the identified processes are given in the middle ; the left panel refers to up- and the right panel down - regulated ps. next, we analyzed the significantly (p - value 2) for each concentration were compared to the ps of the next higher concentration. (b) comparison of up- and down - regulated ps (and of tfbs overrepresented among these ps) between the indicated concentrations. overlaps are displayed as venn diagrams with absolute numbers of altered elements in the circles, and the number of nonaltered elements in the lower right corner. the percentage number refers to elements affected by 1000 m only, relative to all affected elements. also, ogo between different vpa concentrations were compared in a venn diagram to visualize the degree of overlap. this analysis showed that ogo groups behave more similarly to tfbs than to ps (figure 4 and table s5, supporting information) : for up- and down - regulated genes, most ogo groups started to be overrepresented at 350 m, and relatively few ogo groups are added at higher concentrations. these findings are illustrated at higher detail in dendrograms (figure s1, supporting information). a relatively large fraction of ogo groups overrepresented at 350 m overlaps with ogo groups overrepresented at 550 and 1000 m (n = 55). for down - regulated genes, ogo groups began to emerge at slightly higher concentrations, with only 6 ogo groups being overrepresented at 350 m. the overall features remained the same : 22 of the 25 go overrepresented at 1000 m were already overrepresented at 550 m (figure 4b). again, we also classified the ogos in superordinate cell biological processes. also, on these higher levels, the results were confirmed. taken together, these analyses illustrate different progression models for genes on the one side and ogo groups and tfbs on the other. increasing vpa concentrations however, most ogo groups and tfbs were already overrepresented at 350 or 450 m with relatively little added at higher concentrations. (a) up - regulated and (b) down - regulated ps were analyzed for ogo, and then the identified ogo were compared between drug concentrations. the overlaps of ogo at vpa concentrations of 350 m (low), 550 m (medium), and 1000 m are displayed as venn diagrams. right : the ogos from specified areas of the diagrams (see legend ; 550 1000 means overlap area of 550 m and 1000 m circles) were grouped according to superordinate cell biological processes, and the absolute numbers within these groups are displayed. the previous analysis focused on the differentially expressed ps for each concentration compared to the control., we grouped the responses into clusters of 5 different up - regulation responses and 5 types of down - regulations (figure 5a and table s6, supporting information). the number of ps falling into each cluster and the number of ogos among these ps are given in figure 5b. response courses showed a monotonic pattern, but clusters 1, 5, and 6 contained ps with nonmonotonic regulation patterns. together, the latter clusters comprised 6.8% of all ps (n = 9624) considered in the cluster analysis. (b) the number of ps in each cluster (solid bars) and ogos within each cluster (hatched bars) are displayed. red, up - regulated ; green, down - regulated ; gray, nonmonotonic. (c, d) all ogos containing less than 1000 genes are displayed for clusters 5 and 10. clusters 5 and 10 were chosen for further investigation, as they contained the genes that were regulated at high drug concentrations (800 and 1000 m) only. nevertheless, a relatively high number of go terms was overrepresented among these genes (figure 5b and table s7, supporting information). the ogo identified were relatively heterogeneous, and no dominant superordinate cell biological process was identified. in particular, there was no overrepresentation of genes relating to cell death, cell stress, or degeneration (figure 5c, d). this result was well in line with our earlier data. to further follow up on this, and to investigate which types of responses were triggered at which drug concentration, we chose in the following analyses a more targeted approach to specifically investigate the concentration dependency of the regulation of biological processes. all analyses in the previous paragraphs (figure 2 to figure 5) are driven by single gene results. first, genes were combined to clusters with respect to similar expression trajectories across the whole concentration range. then functional gene groups (e.g., go groups) were analyzed for overrepresentation with genes from these identified clusters. a meaningful alternative is to use a go group (or any other functional gene group representing, e.g., a biological process) as the starting point for the analysis. therefore, we applied a new biostatistical method that analyzes the activity (up- or down - regulation) of genes annotated to a go group across all concentrations. the method uses a segmentation test to identify significant enrichment with up- or down - regulated genes (restricted by p - value 30%. the concentration dependence of the regulation of superordinate biological processes indicated three major groups : those mainly affected at high concentrations (00000++ and 000000 +), those activated already at medium concentrations and then being maintained (000++++ and 0000+++), and finally those represented already among low concentrations and remaining up - regulated at higher concentrations (0++++++ and 00+++++) (figure 6b). these findings agreed well with those obtained by other analytical approaches, such as unbiased k - means clustering (figure 5) or comparison of the concentration dependence of ogo and ps (figures 2 and 4). application of the go profiler analysis to the concentration data illustrates that only two key biological processes (catabolism and cell division) were overrepresented exclusively at cytotoxic concentrations (800 and 1000 m) without being enriched in the noncytotoxic range (figure 6b and table s8, supporting information). go groups involved in catabolism of dna and proteins were overrepresented for the up- and down - regulated genes at cytotoxic concentrations. moreover, cell division associated genes were overrepresented for the down - regulated genes only at 800 and 1000 m vpa. the superordinate biological processes representing best the known mechanism of action of vpa, protein acetylation and epigenetic processes, were found (as expected) to start at noncytotoxic concentrations (figure 6b and table s8, supporting information). another process clearly activated at noncytotoxic concentrations is migration and adhesion (figure 6b and table s8, supporting information). other biological processes that are of interest for the mechanism of action of vpa are development and differentiation, metabolism, signal transduction, and response to external compound. go groups belonging to these processes were overrepresented in the noncytotoxic but also the cytotoxic concentration range. response behavior of the regulation of genes vs go and superordinate cell biological processes suggested that these features may be used to develop a quantitative measure of teratogenic activity. for this purpose, the effect of each drug concentration was defined by two measures, the gene regulation index and the go overrepresentation index. when these values were plotted onto a coordinate system formed by the two indices, it became evident that the distance from the origin was a useful measure of teratogenicity (figure 7a). this way of data presentation also clearly revealed that vpa concentrations between 125 and 450 m resulted in a progressive deviation of normal differentiation (increasing numbers of ogo among deregulated ps). at higher concentrations, the extent of gene deregulation increased, but ogos remained fairly constant. the concentrations marking the distinct increase of teratogenicity according to this presentation correlate well with the vpa plasma concentrations associated with human or animal birth defects. the curve formed by the teratogenicity index data (figure 7a) differed fundamentally from the cytotoxicity curve (figure 1b). the latter showed strong and progressive changes at high drug concentrations, while the former did not change at high vpa levels but rather at medium levels. thus, it seems feasible to define a specific teratogenicity measure that yields clearly different information from plain cytotoxicity in the same assay. (a) transcriptome data were obtained for multiple drug (vpa) concentrations as in figure 1. to obtain a measure of the deviation of the transcriptome from normal (teratogenicity measure), two indices were calculated and used to define the two dimensions of a developmental toxicity plane. the index is the sum of the negative logarithms of the p - values of the 100 most regulated genes. the second dimension reflects the extent of coordinated changes in biological processes reflected by gos. the index is proportional to the number of overrepresented gos in the gene sets. (b) summary of overall findings on concentration - dependent transcriptome deviations : drug concentrations were chosen in a way to allow either normal neuroectodermal differentiation of human embryonic stem cells (hesc) or disturbed differentiation (teratogenic concentration range) or cytotoxicity. over this large concentration range (251000 m), the number of deregulated genes increased continuously, once a certain threshold concentration was reached (125 m). in contrast to this, superordinate biological regulations, as indicated by enriched gos (gene ontologies) or tfbs (transcription factor binding sites), increased steeply in the teratogenic range and then more or less reached a plateau. at cytotoxic concentrations, thus, cytotoxicity, overall gene regulation, and coordinate regulation of biological processes showed largely different concentration dependencies. there were clear lower thresholds, and the extent of transcriptome regulation as such, without further bioinformatic analysis, did not appear to be a good measure for teratogenicity. in this study, we used a stem cell based test system that recapitulates neural differentiation of hesc. in order to elucidate the optimal concentration for toxicogenomics, we challenged this test system with increasing concentration of the well - known neurodevelopmental toxicants vpa. we found that the number of differentially regulated ps continuously increased but that up - targets like tfbs and functional gene ontologies reach saturation already at the lower border of intermediate concentrations. in addition, we show that with clearly cytotoxic concentrations only few more superordinate biological processes occur. therefore, we conclude that the most sensitive concentration for dnt toxicogenomic testing would be the highest nontoxic concentration of a compound. however, small deviations from this concentration will not disrupt the results on the basis of ogo and tfbs. we present here the development of the transcriptomics - based teratogenicity index that exactly reflects this behavior for the comparison of deregulated ps and ogos (figure 7a). although transcriptomics is frequently applied in toxicology, it has remained unclear how it is best used for toxicological statements and predictions. basic issues, such as the question of appropriate concentrations, timing of exposure, and timing of sampling, have not been addressed in a systematic and quantitative manner. only very few studies, mainly in the field of carcinogenesis, have attempted to correlate the extent or type of overall transcriptome changes with toxicological predictions in a quantitative manner. for instance, thomas and colleagues have correlated benchmark doses based on go terms and classical pathology with cancer development. we are not aware of any such study in developmental toxicology, and our study is a first attempt in this direction, even though only a single model compound, vpa, has been studied. given the astonishing dearth of data in the field, we feel that our study is an important beginning but should not be overinterpreted. further data are required to see whether the response features observed here are representative of a larger group of developmental toxicants. not every cell system is equally suited for studies on design principles of gene regulation. our test system provided the required homogeneity and synchronicity to perform such analysis. previously others and we have shown that the differentiation protocol delivers a > 90% cell population of the same cell type. moreover, genome wide mrna analysis demonstrated a monotonic progression model of deregulated genes. a very high fraction of genes deregulated at a lower concentration were also deregulated at the next higher concentration. moreover, the next higher concentration usually yielded additional genes that have not yet been deregulated at the lower concentration. these are good conditions to study the control mechanisms and principles of the cellular response to increasing concentrations. unsupervised clustering indicated that there is a smaller subfraction of ps that behaved differently. to follow up on this, we selected the ps that were regulated by an intermediate drug concentration (450 m) and determined their average fold change (fc). then, we determined the fc of the same set of ps at lower and higher concentrations. at the lowest concentration (25 m) the linear middle part supports the suggestion that the selected ps were regulated increasingly more with increasing concentration, and this may have affected the number that was detected after filtering for significance and fc. the flattening of the curve on the lower and upper ends suggests that most likely additional mechanisms are involved, i.e., regulation of different genes at different concentrations, as observed here by other methods. as a complementary approach, we selected the ps that were significantly regulated at 450 m (p < 0.05) and calculated the p - values for the same ps at low concentrations. most of the ps lost significance at 150 m and nearly all at 25 m. the situation was somewhat different, when the initial selection of ps included a fc cutoff of 2. under this condition, all ps selected at 450 m still reached a p < 0.05 significance level at 350 m, and most of them still did so at 150 m. at 25 m, still about 10% of the ps were significant. this suggests, that some ps that we considered here as regulated only at high drug concentrations but not at low drug exposure were indeed already affected at low concentrations but that the change was too small to be picked up as significant. this feature may have to be considered for future systems biology based quantitative models of gene regulation. comprehensive biostatistical analyses including the establishment of a novel gene ontology activation profiler (goap) suggest the following concept of three concentration ranges. a range of tolerance is observed up to 25 m vpa. at 25 m, not a single up- or down - regulated gene with p < 0.05 and a fold change higher than two was obtained. this observation is in agreement with the general concept that toxicity based on, e.g., enzyme inhibition or induction, or receptor activation, acts by threshold mechanisms. in the cytotoxic concentration range (800 m and 1000 m), we expected that an apoptosis signature may occur, but we observed the induction of apoptosis, death, and stress associated ogo groups already at the intermediate concentration range. also, go analysis of the genes that are exclusively up- or down - regulated with the cytotoxic concentrations revealed no additional death related ogos. in addition, goap analysis revealed that go that are related to catabolism and metabolism are induced with cytotoxic concentrations. among the down - regulated ps, cell division analysis of gos overrepresented among ps in this range gave evidence for developmental disturbances, cell migration, and the down - regulation of neuronal pathways. therefore, we defined the range from 150 m to 550 m vpa as the deregulated / teratogenic concentration range (figure 7b). these findings are in good agreement with human data that indicate that vpa plasma concentrations above 500 m are associated with strongly increasing risk for malformations. the newly established goap method revealed additional and more sensitive answers for this range of teratogenic concentrations. between 150 and 550 m, a number of go groups became overrepresented that reflect the specific mode of action of vpa, namely, protein acetylation and epigenetic processes. down - regulated ps comprises genes involved in all kind of epigenetic processes like several histone acetyl transferases (e.g., kat2b, kat6a, kat5), polycomb proteins (e.g., suz12), lysine methyl transferases (e.g., ehmt2), and hdacs themselves (e.g., hdac 2, 5, and 9). regarding go regulation patterns over the concentration range, we also identified go groups that showed, e.g., a 00+++00 nonmonotonic pattern.. we could verify the main monotonic regulation pattern by another analysis targeting upstream regulators of transcriptional changes. we found that most tfbs are already induced with teratogenic concentrations, and only few additional tfbs were induced with cytotoxic concentrations (figure 7b). these comprised ap-2 and pax5 for up - regulated and ipf1 and pbx for down - regulated ps. on the basis of differentially expressed ps and altered functional processes, we developed a teratogenicity index that could distinguish between dnt - relevant (the teratogenic range) and cytotoxic concentrations. for this purpose, the extent of transcriptome deregulation was captured by measures for deregulation of individual genes and a measure for biological processes (ogo). although cytotoxicity only starts at 800 m vpa, the functional processes were significantly changed already with 350 m and the teratogenicity index only slightly changed with 800 m and 1000 m. therefore, we present here an index that distinguishes between noncytotoxic, teratogenic, and cytotoxic concentrations and could help in the future to improve the experimental design of toxicogenomic studies. in particular, our data support the use of the highest noncytotoxic concentration of toxicogenomics studies, if no other information on the test compounds is available. at this concentration, a maximum power is reached (number of deregulated ps) without compromising the biological information obtained (e.g., altered ogo or tfbs). accidental use of slightly too high concentrations would be expected to have only minor effects on the overall outcome. in conclusion, the data from this concentration progression study suggest a steady increase of deregulated genes. however, they mostly belong to the same biological processes and seem to be controlled by the same tf that are already deregulated at the intermediate concentrations of 350 and 450 m vpa (figure 7b). superenhancers are unusual enhancers, which are found at genes responsible for cell type identity and occupied by key transcription factors for this cell type. in esc, e.g., these dna sequences are mainly occupied by the key stemness factors oct4, nanog, and sox2. it was also shown that these superenhancers play crucial roles in the development of many diseases. therefore, it is very likely that they are also disturbed or differentially occupied by a toxic compound and play a crucial role in the interpretation of our upstream target analysis. in the future, it will be interesting to investigate whether deviations from the normal development on the level of tfbs and superordinate cell biological processes will be shared by diverse toxicants and whether the time of toxicant exposure has an effect on such findings. | information on design principles governing transcriptome changes upon transition from safe to hazardous drug concentrations or from tolerated to cytotoxic drug levels are important for the application of toxicogenomics data in developmental toxicology. here, we tested the effect of eight concentrations of valproic acid (vpa ; 251000 m) in an assay that recapitulates the development of human embryonic stem cells to neuroectoderm. cells were exposed to the drug during the entire differentiation process, and the number of differentially regulated genes increased continuously over the concentration range from zero to about 3000. we identified overrepresented transcription factor binding sites (tfbs) as well as superordinate cell biological processes, and we developed a gene ontology (go) activation profiler, as well as a two - dimensional teratogenicity index. analysis of the transcriptome data set by the above biostatistical and systems biology approaches yielded the following insights : (i) tolerated (25 m), deregulated / teratogenic (150550 m), and cytotoxic (800 m) concentrations could be differentiated. (ii) biological signatures related to the mode of action of vpa, such as protein acetylation, developmental changes, and cell migration, emerged from the teratogenic concentrations range. (iii) cytotoxicity was not accompanied by signatures of newly emerging canonical cell death / stress indicators, but by catabolism and decreased expression of cell cycle associated genes. (iv) most, but not all of the go groups and tfbs seen at the highest concentrations were already overrepresented at 350450 m. (v) the teratogenicity index reflected this behavior, and thus differed strongly from cytotoxicity. our findings suggest the use of the highest noncytotoxic drug concentration for gene array toxicogenomics studies, as higher concentrations possibly yield wrong information on the mode of action, and lower drug levels result in decreased gene expression changes and thus a reduced power of the study. |
chronic hepatitis c virus (hcv) infection has a detrimental effect on the health of persons with chronic kidney disease. it leads to higher mortality in maintenance hemodialysis patients compared to noninfected patients and reduces the survival rates of patients undergoing kidney transplantation as well as their grafts. it renders patients with a higher risk of developing diabetes mellitus, de novo or recurrent membranoproliferative glomerulonephritis, lymphoproliferative disorders, and fibrosing cholestatic hepatitis after kidney transplantation. until recently, in the absence of any efficient treatment for hcv infection after kidney transplantation, treating all anti - hcv - positive rna - positive patients that were candidates for kidney transplantation has been recommended. for several years, standard reduced interferon- (ifn-) alpha or pegylated- (peg-) ifn--2a, given as a monotherapy, has been the main treatment given to hemodialysis patients with hcv replication. because ribavirin has been found to be responsible for hemolytic anemia in patients with impaired kidney function as well as in hemodialysis patients, it was first prohibited and then used at markedly reduced daily doses with careful monitoring for anemia and other adverse effects. hcv - positive dialysis patients that received standard ifn- or peg - ifn- achieved 50% efficacy. first - generation direct - acting antiviral agents (daas), such as the protease inhibitors telaprevir and boceprevir, have been developed over the past few years. they have been introduced as an adjunctive therapy for patients with chronic hcv but normal kidney function and have significantly improved the svr. however, scarce data regarding their use in hemodialysis patients have been published [810 ]. in addition, no data regarding the use of new - generation daas, such as sofosbuvir, daclatasvir, simeprevir, or ledipasvir, have been reported in this setting. the aim of this study was to assess the efficacy and safety of a combined therapy of peg - ifn, ribavirin, and boceprevir to treat anti - hcv - positive rna - positive hemodialysis patients who were candidates for kidney transplantation. between february 2013 and september 2014, six patients who were chronically infected by genotype-1 hcv and were receiving hemodialysis three times weekly, and who were candidates for kidney transplantation, were treated with peg - ifn, ribavirin, and boceprevir as a triple therapy, after having given their written informed consent. there were three men and three women, ranging in age from 39 to 72 years (median : 49.5). five of the six patients had previously received interferon for hcv infection : one had a relapse and the other four patients were partial responders. ribavirin was given at the dose of 200 mg / d, three times a week, after each dialysis session. a sustained virological response was defined as negative hcv rna six months after the end of therapy. a virological breakthrough was defined as hcv replication during therapy and after a period of nonviral replication. patients were followed up every 15 days during the first month and then at three - month intervals for 6 months after therapy was completed. hcv rna was assessed using the quantitative cobas amplicor hcv monitor assay (limit of detection 15 log iu / ml). at the initiation of antiviral therapy, median viral concentration was 5.68 (4.36.55) log iu / ml. the evolution of hcv concentration is presented in figure 1. a rapid virological response, that is, undetectable hcv rna at week 4, was observed in four of the six patients (66.6%). all patients had at least once undetectable hcv rna during therapy, and hcv rna was undetectable in all patients at week 24. however, a breakthrough was observed in two patients (p3 and p4) between weeks 24 and 48, and a third patient (p2) had to stop antiviral therapy between weeks 24 and 48 because of severe peripheral neuropathy. at week 48, overall, when therapy was scheduled to finish, hcv rna was undetectable in three patients. however, of these, two patients relapsed within the month after antiviral therapy had finished. hence, overall, only one patient (16.7%) had a sustained virological response : he had been a previous partial responder. as is usually observed in hemodialysis patients, liver - enzyme levels were within the normal ranges at the beginning of therapy and also at the end of therapy (data not shown). because of fatigue and a flu - like syndrome, peg - ifn doses were decreased at week 4 from 135 to 90 g / week in three patients (p2, p3, and p4) and then decreased further at week 24 from 90 to 45 g / week in one patient (p4). one patient (p2) developed peripheral neuropathy that was attributed to the antiviral therapy, which was stopped at week 28 although the patient was nonviremic. overall, as expected, the main adverse effect was hematological tolerance, namely, anemia. median hemoglobin level decreased from 11.5 (range : 1013) g / dl at the initiation of antiviral therapy to 9.75 (range : 8.511.5) g / dl at week 4 and to 9.55 (range : 8.810.8) at week 12. it then remained at 9.55 (range : 8.110.5) g / dl until week 24, but then it decreased again to 8.75 (range : 8.410.7) g / dl by week 48. at the initiation of ribavirin therapy, three patients were given recombinant erythropoietin (repo) at the median dose of 12,000 (range : 8,00015,000) units / week. from week 4 and until the end of the therapy, repo was given to all patients at the median doses of 12,000 (8,00024,000), 12,000 (8,00024,000), 16,000 (12,00030,000), and 18,000 (12,00030,000) units / week at weeks 4, 12, 24, and 48, respectively. ribavirin dose was reduced at week 24 to 200 mg / week in one patient (p4) because of very severe anemia, despite receiving high doses of recombinant erythropoietin. boceprevir doses were reduced at week 24 to 1600 mg / d in patient 4 and to 800 mg / d in patient 2. within the last few years, the first - generation daa ns3 - 4a protease inhibitors, that is, boceprevir and telaprevir, have been developed and used in combination with peg - interferon and ribavirin to treat patients with chronic hcv infection. boceprevir- or telaprevir - based anti - hcv therapy was first used in immunocompetent patients that had preserved kidney function. it significantly improved the sustained virological rate in genotype-1 hcv infected patients, mainly for noncirrhotic patients. in hemodialysis patients, the recommended treatment for chronic hcv infection remains standard or pegylated - interferon. as pointed out in a meta - analysis by fabrizi., the svr response was 39% after standard ifn- therapy and 31% when peg - ifn- was used. in other studies, although ribavirin accumulates in hemodialysis patients and causes severe hemolytic anemia, low doses of ribavirin, that is, 200 mg / day or 200 mg every other day, when added to interferon, improved the svr. the svr ranged from 17 to 70%, and the dropout rate was up to 50%. boceprevir- or telaprevir - based anti - hcv therapy has been used in a small number of hemodialysis patients. treated four hemodialysis patients with a combined therapy of peg - ifn-, ribavirin, and telaprevir. three of their four patients achieved viral clearance at week 12 ; however, no further outcomes were reported, and the number of svrs is unknown. treated seven hemodialysis patients with peg - ifn-, ribavirin, and telaprevir : the duration of treatment ranged from 24 to 47 weeks. successfully treated a hemodialysis patient with peg - ifn-, ribavirin, and boceprevir for 48 weeks. in the present study, six patients were given peg - ifn-, ribavirin, and boceprevir for 48 weeks. antiviral therapy was stopped in one patient because of severe neuropathy, which was attributed to the interferon therapy. two breakthrough events were observed in two patients, which required doses of antiviral drugs to be reduced because of adverse events. however, two of these patients then relapsed one month and six months after treatment was finished. eight of the 14 hemodialysis patients that received antiviral triple therapy, who had a sufficiently long follow - up, and were included in either a previously published series or in the present study, had a sustained virological response (57%). the poor results observed in our study are probably related to poor tolerance to the antiviral therapy, which required dose reductions. similar to previous studies, the main side effect observed in our study was anemia, which required the introduction of repo, or an increased dose of repo plus blood transfusions. hence, this triple - therapy strategy did not effectively treat our hemodialysis patients with chronic hcv infection. very recently, the use of new - generation daas, that is, sofosbuvir combined with daclatasvir, simeprevir, or ledipasvir, has been shown to be highly efficient at treating hcv infection in cirrhotic and noncirrhotic immunocompetent patients [1216 ], in liver - transplant patients [1719 ] and in some kidney - transplant patients. individually, daclatasvir, simeprevir, and ledipasvir can be eliminated by the liver and so can be given to hemodialysis patients. however, no data regarding the use of sofosbuvir in patients with a glomerular - filtration rate < 30 ml / min exist : hence, a combination of daclatasvir, simeprevir, or ledipasvir is still not recommended in this setting. a phase - ii multicenter study has assessed the efficacy and safety of the combination of grazoprevir (mk-5172) and elbasvir (mk-8742) given to patients with chronic hepatitis and chronic kidney disease, including hemodialysis patients (clinicaltrials.gov : nct02092350). in summary, a triple antiviral therapy based on peg - ifn-, ribavirin, and either telaprevir or boceprevir did not optimally treat hemodialysis patients with chronic hcv infection. studies using new - generation drugs are required in this population as well as for kidney - transplant patients. | background. there are few data on the combination of (pegylated-) interferon- (peg - ifn-), ribavirin, and first - generation direct - acting antiviral agents (daas). our aim was to describe the efficacy and safety of peg - ifn-, ribavirin, and boceprevir in hemodialysis patients. patients. six hemodialysis patients, chronically infected by genotype-1 hcv, were given peg - ifn- (135 g / week), ribavirin (200 mg / d), and boceprevir (2400 mg / d) for 48 weeks. results. at initiation of antiviral therapy, median viral concentration was 5.68 (3.786.55) log iu / ml. hcv rna was undetectable in four of the six patients at week 4 and in all patients at week 24. a breakthrough was observed in two patients between weeks 24 and 48, and a third patient stopped antiviral therapy between weeks 24 and 48 because of severe peripheral neuropathy. at week 48, hcv rna was undetectable in three patients. of these, two patients relapsed within a month after antiviral therapy was stopped. hence, only one patient had a sustained virological response ; he was a previous partial responder. overall, anemia was the main side effect. conclusion. a triple antiviral therapy based on peg - ifn-, ribavirin, and boceprevir is not optimal at treating hemodialysis patients with chronic hcv infection. studies using new - generation drugs are required in this setting. |
arsenic is a toxic metalloid [1, 2 ] that exists throughout nature in organic and inorganic forms. it is commonly present in soils on average at several mg / kg, as well as in marine sediments, and is enriched in mineral deposits as oxides and sulfides. the basic element, arsenic, exists in either of three allotropic forms : yellow, black, or grey with the stable, semimetallic form having a silver / steely - grey colour as a brittle, crystalline solid. the semimetallic form oxidises rapidly in air, and at high temperatures produces a white cloud of arsenic trioxide (as2o3). arsenic, with its variety of chemical forms and oxidation states, is listed in table 1. the current iupac nomenclature is listed in as well as the more common names of the arsenic - based compounds which are mainly used throughout this review. when absorbed at toxic levels, arsenic causes severe health problems, including cancer. arsenic - containing compounds are applied in plant pesticides and insecticides and arsenic environmental contamination represents a global health problem, particularly from leaching into ground water. when the soluble levels exceed 50 g / l in drinking water as in many regions of bangladesh, arsenic becomes a particular health concern as it has recently been associated with increased cancer rates appearing after consumption with a lag time up to 1020 years. whilst the carcinogenic aspects of arsenic compounds are not the focus of this review, nevertheless this undesirable aspect needs to be raised. thus, arsenic and its methylated species are known carcinogens but this description is probably inaccurate as they act more as cocarcinogens by facilitating / promoting the induction of tumors of the skin, urinary bladder, and lung rather than directly inducing cell transformation and oncogenesis [2, 6 ]. as cocarcinogens, mechanisms include indirect effects such as dna damaging genotoxicity by altered dna methylation as well as inducing high levels of oxidative stress leading to altered cell proliferation and tumor promotion (detailed in). in terms of chronic toxicity, the 50% lethal dose of arsenic as arsenic trioxide in mice received by the oral route varies from 1548 mg / kg, whereas the acute lethal dose in humans varies from 13 mg / kg body weight. despite its toxicity, arsenic has been applied in chinese medicines for thousands of years as refined preparations of realgar (as4s4) or orpiment (as2s3) which are two rare mineralised forms. realgar, easily discerned by its bright red and orpiment with a browny yellow appearance are ores often occurring close to each other in hydrothermal veins of precious metal sulfide ores or hot spring deposits as volcanic sublimate products (crystallized from gases). hence, arsenic is a common waste product from the mining of metal ores and the name realgar is possibly derived from arabic words for powder of the mine (rahj al ghar). the long history of medical applications has included treating many diseases such as cancers administering micromolar levels in patients and, in particular, arsenic compounds have proven to be very effective against certain hematological malignancies (reviewed in [9, 10 ]). thus, arsenic oxides and derivatives have been established as effective treatments for acute promyelocytic leukemia (apl), and they are being tested as therapies for a range of other hematological cancers including myelodysplastic syndromes, multiple myeloma, and chronic myelogenous leukemia (cml). the results of clinical trails using arsenic - based drugs in cancer therapy have been extensively reviewed [812 ]. hence, this review mainly concerns those factors that explain the antineoplastic mechanism of action of arsenic - based drugs, distinguishing their selectivity for killing certain types of cancer cells from their potential for toxicity to normal cells in the body. the reason for their efficacy and selectivity in treating certain hematological malignancies is covered in the last section of this review. however, the mechanisms of action of arsenic - basedcompounds on cells must first be described in detail to provide sufficient understanding to enable their selective targeting of specific types of cancer cells to be duly evaluated. water distributes the majority of inorganic arsenic in the biosphere either as pentavalent arsenate (as, as(v)) or trivalent arsenic (as, as(iii)). in solution, the ph and redox conditions affect the chemical state of arsenic that predominates. thus, in highly oxidised environments, the arsenate (as) form predominates as one of four major species of arsenic acid ; h3aso4, h2aso4, haso4, and aso4. however, mildly reducing conditions such as those generally present inside all mammalian cells will favour the reduction of the pentavalent arsenate (as) to the trivalent arsenic (as). arsenous acid with the formula as(oh)3 results after the slow hydrolysis of arsenic trioxide in water. as the ph increases, arsenous acid is converted to the arsenic oxide ions [aso(oh)2 ], [aso2(oh) ], and [aso3 ]. arsenic combines readily with many elements ; and bacteria have evolved systems to detoxify inorganic arsenic to form organic arsenic - containing compounds such as methylated forms. plant and insect pesticides have been made using organic arsenic derivatives ; and monomethylarsonic acid (mma(v)) and dimethylarsinic acid (dma(v)) are used in products for weed control. also, mma(v) and dma(v) are metabolites of inorganic arsenic, formed intracellularly in mammals, primarily in the liver. the metabolic process of inorganic arsenic conversion is known as biotransformation and appears to enhance the excretion of arsenic from the body, involving formation of methylated compounds of trivalent arsenic as intermediates. the metabolism involves reduction to a trivalent state and oxidative methylation to a pentavalent state. in addition, reductases present in cells and other reactions facilitate the reduction of arsenic acid [as(v) ] to the arsenous [as(iii) ] form including methylation of the arsenous form, mainly via the liver, to produce mono-, di-, and trimethylated species. the main enzyme involved in methylation of as(iii) is arsenic methyltransferase (as3mt) that requires glutathione (gsh) to promote the reaction and a cycling redox system such as thioredoxin (reviewed in) to detoxify arsenic - containing compounds. many animal species convert inorganic arsenic - containing compounds into mono-, di- and tri - methylated arsenic species which are mostly then secreted in the urine. this is because the methylated forms are not as well absorbed by cells compared to the inorganic forms, although they have much greater cytotoxicity if they do enter cells [15, 17 ]. the trivalent arsenic - containing compounds, including the methylated organic forms have much greater potency than the pentavalent arsenic - containing compounds as cytotoxics and carcinogens [1823 ]. for example, in cytotoxicity assays, the ic50 values for cultures of primary hepatocytes, keratinocytes, and epithelial cells ranged from 3 m to well over 20 m for trihydroxidoarsenic salts whereas for monomethylarsonous acid [mma(iii) ], the values were consistently much lower at only several m for the equivalent normal cell types [2426 ]. organic arsenic - based ingredients are commonly used as feed additives in poultry farming to increase weight gain by preventing bacterial and parasitic infections, thereby increasing feed efficiency and improving pigmentation. the three major arsenic - containing compounds used in this manner are arsenilic acid (p - aminophenyl arsonic acid), roxarsone (4-hydroxy-3-nitrophenylarsonic acid), and nitarsone (4-nitro - phenylarsonic acid) [22, 23 ]. the metabolism of these arsenic - containing compounds and waste products produced by birds and mammals consuming them is still uncertain at present and what the global environmental impact might be. at the biochemical level, inorganic arsenic in the pentavalent state (as(v), arsenate, aso4) resembles a phosphate (po4) group in structure and it can replace phosphate in many reactions. the mitochondria is a major intracellular site where arsenate is metabolised, taken up as(v), rapidly reducing it, and exporting the as(iii) product back into the cytosol. the specific location of the site(s) for arsenic reduction in the mitochondria has not yet been defined. however, arsenate can affect oxidative phosphorylation by binding to the fo / f1 atp synthase. arsenate can be used by the atp synthase more efficiently than phosphate depending on the ca2 + levels, producing adp - arsenate which unlike atp becomes rapidly hydrolysed and unable to form stable high - energy compounds. it is suggested that the structure and charge similarities of po4, aso4, and so4 result in indiscriminate binding to at least two sites located in the mitochondrial matrix. at one site, occupation by any of these three anions results in protection against uncoupling of the mitochondrial proton gradient by k ; at the second site, in the fo / f1 atp synthase, aso4, and so4 compete for binding against po4, leading to the inhibition of atp production. intriguingly, as2o3, whilst shown to have no effect on oxidative phosphorylation levels in hela [10 m ] and as-30d [100 m ] hepatoma cancer cells, significantly inhibited glycolysis, particularly during the exponential growth phase of these cells when they were actively respiring and producing 70% of their atp from mitochondria. several other studies have also shown that arsenic compounds do not affect oxidative phosphorylation. thus, with submitochondrial particles in the presence of an atp regenerating system, 20 mm arsenate had no effect on nadh formation, atp hydrolysis, and pi h20 exchange. in a related study with isolated liver mitochondria, as2o3 was again shown to have no effect on oxygen consumption, or the respiratory control ratio at a concentration (10 m) found to be maximally effective in promoting apoptosis in whole cells. however, at higher concentrations (> 50 m), pyruvate / malate - supported respiration (via complex i) became blocked, but there was no effect on either complex ii or iv. the inhibitory effect on complex i was reversed by the addition of the reducing agent, dithiothreitol, indicating that direct oxidative damage was involved. in addition, it was shown that even with the block in complex i, the cells continued to maintain cellular atp levels through glycolysis, and hence, depletion of cellular atp was not the cause for the cytotoxicity of as2o3. probably the most definitive evidence for the importance of mitochondria in mediating as2o3 killing of cancer cells comes from studying cells lacking mitochondrial function. a subclone of mitochondrial respiration deficient cells was derived from the hl-60 human leukaemia cell line by growth in the presence of ethidium bromide to mutate the mitochondrial genome, and these cells are known as hl-60 cells. due to the lack of mitochondrial respiration, cells depend on glycolysis for their energy source and, as would be expected, produced substantially less superoxide radicals (20% of the control cells). when these cells were incubated with 10 m as2o3, they were resistant to the drug, revealing that mitochondrial respiratory function is required for the cytotoxic actions of as2o3. the inhibition of glycolysis by arsenic - based drugs appears unlikely to be a significant factor involved in the drug - induced killing of cancer cells. thus, incubating cells in glucose - deficient medium to block glycolysis had no significant effect on the as2o3 [30 m ] mediated levels of cell death in the jurkat cell line. however, when glycolysis was blocked and mitochondrial respiration inhibited using oligomycin a, the cells became very sensitive to as2o3 mediated cell death. in this regard, it is also worth noting that studies of individual glycolytic enzymes analysed in purified form in vitro have shown arsenite and arsenate to be relatively weak inhibitors. hence, for hexokinase (ic50 : 15 mm for arsenate [37, 38 ]), phosphofructokinase (ic50 > 5 mm for arsenite ;) and pyruvate dehydrogenase (pdh ic50 : 80120 m arsenite ;), relatively large concentrations were required to inhibit these enzymes. in fact, arsenate has been shown to stimulate the activities of the two important glycolytic enzymes, hexokinase and gapdh, by overcoming product inhibition in these reactions. in the case of gapdh, arsenate acts catalytically to promote the oxidation of phosphoglycerate and the reaction involved the formation of an arsenate analogue of the phosphate ester as an intermediate which rapidly hydrolysed, helping to drive the reaction forward [33, 43 ]. this process has been commonly described in relation to the effects of arsenate on numerous enzymatic reactions involving phosphate and has been termed arsenolysis. given the relative insensitivity to the direct effects of arsenic compounds shown by the glycolytic pathway, it follows that it is unlikely that glycolytic inhibition results from direct binding and modification of the enzymes in this pathway by arsenic - based drugs. more likely, the inhibition of glycolysis results from an indirect effect, caused by the actions of arsenic compounds in modifying mitochondrial respiration leading to production of ros which then acts to inhibit the glycolytic enzymes. additional support for the mitochondrial - mediated ros involvement in the action of arsenic to inhibit glycolysis comes from studies where as2o3 was found to be 38 times more potent in cells than in the pure preparation at inhibiting pyruvate dehydrogenase. also, inhibiting mitochondrial respiration suppressed the resulting inhibition of pyruvate dehydrogenase activity and h2o2 production by this drug. furthermore, the inhibition of pyruvate dehydrogenase by as2o3 was shown to require the fenton reaction occurring via hydroxyl radical intermediates. the mitochondrial effects of arsenic compounds are detailed later in this review and to reiterate at this point, the evidence indicates that the actions of arsenic compounds on glycolysis are not the main cause for the cytotoxic effects of these drugs at clinically relevant concentrations (16 m) required in plasma for the killing of cancer cells in apl patients [8, 44 ]. under conditions of high mitochondrial respiration inside cells, it is possible that trivalent arsenicals inducing significant production of ros as superoxide, peroxide, and hydroxyl radicals can also result in oxidation to produce arsenate (aso4) ionic species [45, 46 ]. consequently, the impact that arsenic compounds will have on any given cell will most likely depend on the state of cellular respiration and production of ros affecting the arsenic speciation and whether the cell is dependant on glycolysis versus mitochondrial respiration for its atp synthesis. glyceraldehyde-3-phosphate dehydrogenase (gapdh), the glycolytic enzyme abundantly found in all cells and especially blood cells and liver, is a major intracellular arsenate reductase requiring gsh, nad, and glycolytic substrate [48, 49 ]. given that the levels and specific activity of gapdh is much higher in malignant cells than in normal cells, this could contribute to the rapid reduction of as(v) species in their cytosol into more toxic as(iii) forms. in the gapdh reaction, as(v) reduction may take place during, or as a consequence of the arsenolytic cleavage of the thioester bond formed between the enzyme 's cys149 residue and the 3-phosphoglyceroyl moiety of the substrate. hydrolysis of 1-arseno-3-phosphoglycerate is at least 2000 times faster than hydrolysis of the normal substrate 1,3-diphosphoglycerate under the same conditions. hence, gapdh is proposed as one of the key cellular converting enzymes for reducing as(v) to as(iii). although purine nucleoside phosphorylase was proposed to be an arsenate reductase, this was later refuted. the other major class of as(v) reductases in cells are the glutathione s transferases and of these, the omega form or gsto1 appears to be most important. thus, gsto1 can reduce arsenate to arsenite, mma(v) to mma(iii), and dma(v) to dma(iii) and deletion of the gsto1 gene in mice reduced the extent of biotransformation by 3080% in most tissues examined. arsenic has a high affinity for sulfur and hence, reactive sulfur - containing molecules such as reduced thiols with an available sulfur atom have a significant propensity for binding to arsenic [55, 56 ]. as(iii)-containing compounds exist as trigonal pyramidal structures and this is also the structure formed upon binding of arsenic ions to cellular proteins in vivo where the sulphur atoms of thiolate groups act as coordinating ligands. the resulting arsenic - thiol linkages are mainly responsible for the ability of arsenic to modulate the function of various key molecules, enzymes, and ion transporters inside cells and this intracellular action of arsenic is discussed in detail in this section. arsenic - containing compounds react with mono- and dithiols, particularly the latter when two thiols are located in close proximity, acting to cross - link the thiols together. some debate exists about the structures and speciation of arsenic - containing compounds (both inorganic and organic forms) in solution. in the absence of sulfide, as(iii) hydroxide complexes are the major arsenic - containing species and these structures probably adopt a trigonal pyramidal structure with the arsenic atom at the apex [5759 ]. this trigonal pyramidal structure provides the potential for as(iii) to coordinate linkages with several proximal thiol groups. this is believed to be the case in bacterial enzyme systems such as the arsr repressor protein where it is likely to bind three cys atoms. thus, in the more toxic form as the trivalent state (as(iii)) inorganic and organic (methylated) arsenic reacts with critical thiols in proteins, inhibiting their function, as is the case with the bacterial arsr protein. as(iii) was shown to target the reactive sulfhydryl group at the active site of thiolase(s) involved in ketogenesis from acetyl coenzyme a. the pentavalent species of inorganic arsenate (aso4) favoured to exist in oxidised environments, as well as organic forms of as(v) have a different structure with a trigonal - bipyramidal shape where the as(v) atom is located at the centre, co - ordinating to three equatorial and two polar atoms [62, 63 ]. in comparing the two different structural states of as(iii) and as(v), it is not yet clear why the trivalent methylarsenic - containing compounds show a much higher toxicity than their pentavalent analogues [24, 64 ]. however, it could relate to cellular uptake as trivalent organoarsenic compounds are more membrane permeable than the pentavalent species. also, trivalent arsenic bonded at a phenyl ring is able to form much more stable covalent cross - links to cysteine residues compared to arsenic in small molecules such as arsenious acid or arsenite. furthermore, the organic trivalent arsenic - containing compound, phenylarsine oxide [0.10.5 m ], is much more potent than the simple arsenite [110 m ] in its cytotoxic activity in apl cells. one major drawback with phenylarsine oxide as a potential cancer therapy is its high toxicity in vivo and its nonselectivity for cancer versus normal cells, resulting in cytotoxicity in normal endothelial cells in the same concentration range (0.2 m). thus, phenylarsine oxide, is precluded from application in clinical cancer therapy, without being further modified as a drug. the greater reactivity of phenylarsene oxide and associated cytotoxicity is in agreement with the results outlined above where mass spectrometric analysis of different complexes of peptides and proteins with arsenic - containing species revealed that inorganic arsenite or arsenates did not interact well with cysteine or glutathione, whereas the organic phenylarsine (3 +) oxide did. in addition, three different phenyl arsenic acids and dimethylarsinic acid that all contained as(v) also formed complexes with glutathione. hence, the bulky hydrophobic groups with electron withdrawing orbitals (in the case of phenyl groups) may promote more stable bonds between the arsenic atom and sulfur groups inside cells, modulating a larger range of enzymes and proteins with important functions for maintaining cell viability. in cells, the most common reactive species that are available for interaction with arsenic are the abundant free thiol moieties in the tripeptide glutathione (glu - cys - gly, gsh) and the free amino acid, cysteine. thus, arsenic - based drugs can react by coordinating binding to free (reduced) thiol groups such as those on cysteine, particularly those of thioredoxin and glutathione as the major intracellular thiol species important in cellular redox regulation. it was observed early on that arsenite and phenylarsine oxide in particular, but not arsenate, reacted with vicinal thiol groups on proteins [69, 70 ]. since demonstrating that phenylarsine oxide was particularly effective at cross - linking vicinal thiols in the active site of tyrosine phosphatases, the range of proteins -containing vicinal cysteine residues with which phenylarsine oxide reacts is increasing. recent examples include the small gtp binding rho protein family and the mitochondrial carnitine / acylcarnitine transporter. phenylarsine oxide, as a strong inhibitor of tyrosine phosphatases would increase tyrosine phosphorylation levels of enzymes in cellular growth signalling pathways. whether the inhibition of tyrosine phosphatases and other enzymes contributes to the toxic effects of arsenic - containing compounds in normal cells is not clear, but is likely an important contributing factor to its general cytotoxicity making phenylarsine oxide unsuitable for cancer therapy. analysis of the interactions of as(iii) with glutathione or cysteine in vitro in aqueous solutions by equilibrium binding and use of biophysical techniques including nmr, electronic spectroscopy, and potentiometry revealed that as(iii) binds either of glutathione or cysteine with similar equilibrium constants. however, several analytical studies by mass spectroscopy have revealed that arsenate and arsenite do not complex readily with glutathione or cysteine, but prefer to react with the thiols on reduced thioredoxin molecules [reviewed in ]. this was confirmed by analysis of more biologically relevant samples from the intracellular environment of hela cells where cytosolic thioredoxin 1 (trx1) and, in particular thioredoxin 2 (trx2) in the mitochondria, was shown to be highly reactive with arsenite (10 m) whereas little reactivity was detected with cellular gsh / gssg. studies with thioredoxin reductase (txr) purified from mouse liver showed that arsenic - containing compounds with as(iii) and arsinothiols (complexes of as(iii) with gsh or l - cysteine) were extremely potent inhibitors of this enzyme. methylarsenic(iii)oxide was most potent with a ki100 nm, as an irreversible competitive inhibitor. the effects on purified glutathione reductase (gr) showed that the levels of inhibition were not as marked with inorganic as(iii) and as(v) oxides showing ic50s in the 1050 mm range, whereas for methylarsinic(iii)oxide it was 9 m. studies on this enzyme in whole cells as hepatocytes showed the ic50 to be reduced to 3 m for methylarsinic(iii) oxide and for as2o3 > 100 m. hence, these observations strongly support a role for the components thioredoxins and the thioredoxin reductase system as providing cellular targets that are very sensitive to inhibition by arsenic - based drugs in the low micromolar range. it also explains the importance of studying the chemistry of arsenic - containing compounds in the context of both purified enzymes as well as whole cells as biological systems in order to obtain meaningful results. thus, although the gsh / glutathione transferase system undoubtedly plays an important role in arsenic sensitivity of cells (see below in section 4 for details), it would appear that the thioredoxin system might represent the most immediate point of sensitive reactivity in relation to cytotoxicity. thioredoxin (trx), nadph, and thioredoxin reductase (txr) comprise the thioredoxin system that has multiple functions in cells including in redox signalling via interactions with other proteins, in transcriptional regulation, control of the reduced intracellular redox environment, cell growth, defense against oxidative stress and control of apoptosis (reviewed in). as outlined in the previous section, the thioredoxin system is very sensitive to arsenic - based drugs and may well be the basis for one of the important mechanisms for their actions in inducing cancer cell death. the trx system operates as a thiol - disulfide exchange reaction (see figure 1). trx1 and trx2 are key regulatory isozymes that catalyse the reduction of protein disulfide bonds. they are cofactors of the apoptosis signal - regulating kinase 1 (ask1) that mediates tnf cytokine and oxidative stress - induced apoptosis via the mitochondrial dependent pathway. in their reduced forms, cytosolic trx1 and mitochondrial trx2 each contain two vicinal thiol groups in their active site sequence as c g p c. trx 1 in the cytosol and trx2 in mitochondria bind to cys 250 and cys 30, respectively, in the regulatory n - terminal domain of ask1 and can cooperatively maintain the enzyme in the inhibited state. however, activation by tnf resulting in increased production of ros and leads to the oxidation of the trx dithiol group to a disulfide. under these conditions, the thioredoxins no longer bind to ask1 and loss of trx2 binding to mitochondrial - located ask1 can lead to apoptosis in a jnk - independent manner, whereas cytosolic ask1 upon loss of trx1 binding then becomes activated as a mapkkk resulting in jnk activation, bid cleavage and bax translocation to the mitochondria. since it is known that the thioredoxins are major targets of arsenic - containing compounds (see above and), it can be predicted that arsenite - mediated oxidative binding to thioredoxins will induce a similar outcome as tnf signalling, leading to the release and activation of ask1 and induction of apoptosis. another thioredoxin - associated protein of importance in thiol - mediated redox regulation in mitochondria is thioredoxin peroxidase ii (tpx - ii, also known as peroxiredoxin iii, prx - iii), an enzyme abundantly expressed in the mitochondria of cancer cells that protects the cells from oxidative stress [79, 80 ]. prxiii is an important antioxidant that acts in conjunction with trx2/txr (figure 1) in the mitochondria to remove peroxides such as h2o2 and offset the apoptosis inducing effects of increased levels of h2o2. however, prxiii contains three cys residues, two of which are involved as redox - active sites in the formation of a stable intersubunit disulfide - bonded dimer, which is then reduced by thioredoxin to the monomer. prxiii was a more abundantly expressed arsenic - binding protein when comparing arsenic resistant cells to normal cells by phenylarsine oxide affinity chromatography. hence, prxiii is very likely to be another protein whose function is inhibited by arsenic - containing compounds leading to the promotion of apoptosis. increasingly, it is becoming apparent that dithiols - containing redox proteins, particularly those present in the mitochondria, act as controlling sensors during responses to changes in cellular redox. many thiol redox proteins contain a vicinal pair or more of reactive thiol groups [82, 83 ] capable of binding with arsenic - containing compounds in a similar manner to those in the thioredoxin system. the most important of these are located in the mitochondria, a point of extreme sensitivity to arsenic - containing compounds whose actions culminate in triggering the apoptotic pathways via the induction of reactive oxygen species, leading to the killing of the cancer cells (figures 1, 2). for example, two members of the glutaredoxin (grx) family, including grx2 located primarily in the mitochondria, catalyse gsh - dependent trx - disulfide redox and protein thiol - disulfide redox reactions, particularly reversible glutathionylation of protein sulfhydryl groups. y c and c s y c active sites ; have three and two additional structural cys residues, respectively ; and are therefore likely to react with arsenic - containing compounds, although no reports of this could be found. another mitochondrial protein targeted by arsenic - containing compounds with a vicinal dithiol group is regulatory protein factor b. addition of recombinant factor b back to bovine submitochondrial particles depleted of this protein restored energy coupling activity. thus, reverse electron transfer from succinate to complex i enabling nad+ reduction, electron transport chain function and oxidative phosphorylation / pi - atp exchange of the atp synthetase complex were reactivated as was increased exchange activity of complex v. thus, the f0-f1 atpase activity requires factor b coupled to it for full activation. however, factor b contains six thiols and cys 92 and cys 94 in the bovine form were shown to bind phenylarsine oxide and phenylarsine oxide or arsenite inhibit factor b coupling activity. from all of these studies, it is becoming clear that redox changes to vicinal thiols affect the regulation of mitochondrial function and that these thiols are also major targets for inhibition by the arsenic - containing compounds (figures 1, 2). a channel formed by the association of two proteins, the voltage dependent anion channel (vdac) in the outer mitochondrial membrane and the adenine nucleotide transporter (ant) in the inner mitochondrial membrane (figure 1), is a complex involved in the induction of apoptosis activated via the mitochondrial pathway (see, figure 3). the two components of this complex form part of the mitochondrial permeability transition pore (mptp), a megachannel mediating release of molecules from the mitochondria activating apoptosis. a rapidly increased permeability of the inner mitochondrial membrane (mitochondrial permeability transition) leads to apoptosis that is mediated by the mptp. arsenite induces apoptosis by a direct effect on the mptp [90, 91 ] and vdac has been shown to play an essential role in opening of the permeability pore and cytochrome c release induced by arsenic trioxide, which also caused vdac to homodimerise. in addition, the thiol - reactive compound 4,4-diisothiocyanostilbene-2,2-disulfonate (dids) has been shown to block the vdac channel and inhibit ros - mediated cytochrome c release by vdac. hence, the data indicates that vdac contains critical cys residues that can undergo intermolecular cross - links mediated by reaction with arsenic. analysis of ion channel activity of purified ant - containing lipid bilayers also revealed that as2o3 treatment [30 m ] altered the ant channel electrophysiological properties. interestingly, glutathione depletion leading to increased ros may play an important role in the action of arsenic trioxide. whereas in both normal and cancer cells, glutathione s transferase (gst) is found to interact with ant, during the induction phase of apoptosis, gst dissociates from ant suggesting that gst / gsh may act as a repressor of mptp and ant pore opening [91, 95 ]. this is supported by the observation that increasing the expression of the enzyme gstp1 in jurkat and raji leukemic cells renders them more resistant to arsenic trioxide - induced apoptosis at clinically relevant levels [1 - 2 m ]. gstp1 expression in these cells is also accompanied by accumulation of lower levels of h2o2 production. both of the mammalian proteins, vdac and ant, contain two or more cys residues in their structure thereby providing reactive thiol groups whose modification affects their function. it has been established that the redox state of thiol reactive groups are important for activation of the mitochondrial permeability transition [94, 96, 97 ]. consequently, thiol cross - linkers such as dids, diamide, and phenylarsine oxide [20100 m ] affect vdac and ant channel function and activation of mitochondrial permeability transition [93, 94, 9698 ]. many published results, such as cross - linking experiments, protein / inhibitor stoichiometry, chimeric dimers, analytical ultracentrifugation, or neutron scattering, indicate that the ant carrier acts as a dimer and this or higher oligomers are involved in membrane permeability transition [99, 100 ]. facing out into the mitochondrial matrix, ant has three exposed loop regions containing a conserved repeat structure with one cys residue in each loop. these cys residues are important to the process of ant dimerisation, but it is not clear how this operates and whether the cys residues form intermolecular disulfide bonds or not. nevertheless, copper - o - phenanthroline is able to dimerise ant by intermolecular cross - linking of cys 56 (in the first matrix loop). in addition, phenylarsine oxide, eosin 5-maleimide, and diamide form intramolecular cross - links between cys 160 and cys 257 on the other two matrix loops, restricting ant in the open conformation, promoting mitochondrial permeability transition. arsenic trioxide is much weaker than phenylarsine oxide at binding to the ant cys residues [96, 97 ] and this may explain the greater sensitivity exhibited by apl cells to phenylarsine oxide [ic50 : 0.1 m ] than to as2o3 [ic50 : 4 m ]. single thiol interacting compounds such as n - ethylmaleimide (nem) can inhibit the mitochondrial permeability transition and this could be either the result of direct interaction with the key cys residues on the matrix loops of ant or indirectly via reaction with gsh and thereby preventing gsh from being oxidized and catalysing disulfide bridging between the adjacent thiol groups in the ant loops. nem or monobromobimane, in the 2550 m range, preferentially react with gsh, leading to its modification in mitochondria and thereby prevents gsh from being oxidised. as a result, nem inhibits mitochondrial permeability transition activation by the thiol reactive compounds, diamide or t - butylhydroperoxide, implying a role for gssg in the action of these agents on the permeability transition [96, 97 ]. arsenites, albeit that much higher concentrations would be required given their lower affinity for glutathione interaction, could have a similar action. thus, high levels of arsenites could modify and inhibit glutathione redox control such that glutathione - based enzymes are unable to function, as well as directly mediating disulfide cross - linking of ant, leading to increases in cellular ros production, mptp, and apoptosis. however, given their low reactivity with glutathione systems, this appears to be unlikely as opposed to the indirect action via the mitochondrial effects leading to increased ros production which then reduces cellular gsh levels. the multidrug resistance (mdr) protein mrp1/abcc1 has been shown to transport asiii out of cells as a tri - gsh conjugate (as-(gsh)3), and glutathione s - transferase (gst) probably facilitates the process. this is likely to be part of the normal cell and cancer cell resistance mechanisms against the cytotoxic effects of arsenic - based compounds. gsh - depleted cells are more sensitive to killing by arsenic - containing compounds and transfection of cells to express glutathione s transferase protects them from arsenite inducing death by promoting arsenite transport from the cells and decreasing ros levels [104, 105 ]. in support of this proposal, the long - term exposure of cells to arsenic - containing compounds induced increased expression of glutathione s transferase and mrps. arsenic levels do not attain very high levels in blood plasma of patients, rapidly becoming eliminated [8, 44, 107 ]. this removal probably results from efficient uptake of as-(gsh)3 via mrp2 in the proximal tubules of the kidneys as part of the detoxification process during the excretion of arsenic - based drugs predominantly into the urine [108, 109 ]. the remainder is mostly removed via uptake in the liver and secretion as bile [110112 ]. as-(gsh)3 may be an important part of the metabolic process for converting inorganic as(iii) to methylated species during detoxification in the liver by asmt1/cyt19. arsenic - containing compounds substituted with organic groups such as modified phenylarsine oxides have been synthesized and examined for their cytotoxic effect on human leukemic cells and breast cancer cells in culture. some of these compounds were found to exhibit potent cytotoxic anticancer activity, particularly against human breast cancer and leukemic cell lines, including primary leukemia cells, at micromolar concentrations. one of these compounds, the novel glutathionyl peptide trivalent arsenic - containing compound para 4-[n-(s - glutathionylacetyl)amino]phenylarsenoxide (p - gsao) shows promise as a novel antineoplastic drug and is now in clinical trials. p - gsao, like phenylarsine oxide, inactivates ant - mediated atp / adp transport and triggers ca - dependent mptp opening by cross - linking the critical cys residues of ant. this leads to increased production of cellular ros, atp depletion, mitochondrial depolarization, and apoptosis of angiogenic endothelial cells and inhibition of tumor growth in mice with no apparent toxicity. however, the action of p - gsao was indirect, and did not appear to be as a result of selective tumor cell toxicity. rather, p - gsao inhibited the proliferating, but not growth - quiescent endothelial cells in vitro and angiogenesis in vivo and thus acted to eliminate tumors by blocking their blood supply [114, 115 ]. the trivalent arsenic - containing moiety of p - gsao was shown to cross - link the matrix facing cys160 and cys257 thiols of ant and effectively locks ant into the open configuration. inactivation of ant by p - gsao causes an increase in superoxide levels, proliferation arrest, atp depletion, mitochondrial depolarization, and apoptosis in the dividing endothelial cells. it is likely that the arsenic - containing moiety of p - gsao reacts similarly as does arsenite (see above) with one or two molecules of glutathione before it is removed from the cell by mrps. tumor cells export p - gsao much more efficiently than endothelial cells because they have higher mrp1 or mrp2 activity and cellular glutathione levels and this may explain why p - gsao is not highly effective at inhibiting tumor cell growth in vivo. in addition, the greater water soluble properties of p - gsao than other arsenic - containing compounds, particularly organic species should help to retain p - gsao in the intravascular system where it is more likely to affect endothelial cells and inhibit tumor angiogenesis. interestingly, although the para form of gsao revealed no apparent toxicity in treated animals and inhibited tumor growth leading to phase i clinical trials as an anticancer agent, the ortho form (o - gsao) was toxic and this was proposed to result from increased accumulation of the drug in cells, including normal cells due to loss of multidrug resistance efflux. consequently, o - gsao is unlikely to be of much further interest as an antineoplastic agent, whereas the clinical efficacy of p - gsao is eagerly awaited. as(iii) as the anhydrous form of as(oh)3 (trisenox, cell therapeutics, seattle, wash, usa) received fda approval in 2000 as a chemotherapeutic agent for the treatment of apl. acute promyelocytic leukemia (apl) is associated with reciprocal and balanced chromosomal translocations always involving the retinoic acid receptor alpha (raralpha) gene on chromosome 17 and variable partner genes on distinct chromosomes. raralpha fuses to the promyeloctyic leukemia (pml) gene in the majority of apl cases (reviewed in). arsenic trioxide is particularly effective at killing apl cells and this was proposed to be the direct result of its ability to induce the relocalization and degradation of the nuclear body protein pml, as well as the degradation of pml - raralpha in apl cells [119122 ]. however, this seems unlikely to be the main mechanism of action for arsenic trioxide given that no differences in sensitivity to growth inhibition and killing by apoptosis have been observed between wild - type and pml cells. arsenic trioxide as a single agent has provided 86% complete hematologic remission with minimal toxicity in apl patients, equal to any of the current standards of care for treating apl, including the combination of all - trans retinoic acid (atra) plus chemotherapy. this raises the question why apl cells are very sensitive to arsenic - containing compounds like arsenic trioxide. it would appear that the reason is because apl cells express the transmembrane transporter protein, aquaglyceroporin 9 (aqp9) involved in arsenic uptake at much higher levels in apl cells than in other leukemic cell types and that correlates with arsenite sensitivity. in this regard, it is worth noting that aquaglyceroporins aqp7 and aqp9 are present in normal cell types. interestingly, aqp9 is primarily expressed in human lung, liver, and leukocytes and this may help explain arsenic toxicity, given that liver is one of the main organs affected. the fact that aqp9 provides apl cancer cell specificity with high response rates suggests that if arsenic - containing compounds could be targeted for specific delivery into cancer cells, then they would represent outstanding agents for killing these cells. however, further modifications will be required to provide suitable drug targeting for improved delivery of arsenic - containing compounds to cancer cells. vicinal thiols located in key enzymes and proteins provide targets for reaction with arsenic - containing compounds, particularly organic derivatives such as phenylarsenic - containing compounds that favour intramolecular cross - linking between adjacent thiols. intriguingly, most of the key intracellular targets for this reaction have been identified to include the main redox regulatory systems in the mitochondria, including thioredoxin and peroxiredoxin systems and the adenine nucleotide transporter, all of whose function is adversely affected. the net result is the activation of several independent pathways including ros production to facilitate the induction of apoptosis. one main pathway operates via the opening of the mptp, the other via activation of ask1 kinase, and the jnk / bid / bax pathway of channel formation in mom. in the case of apl, cell selectivity for sensitive responses to these drugs low mdr levels present in dividing endothelial cells also provides selective targeting by specially substituted phenylarsenic - containing compounds like p - gsao, leading to decreased blood supply into tumors, with some toxicity to cancer cells, but little toxicity on normal cells. hence, a combination of selective delivery and retention provides the necessary targeting of arsenic - containing compounds to tumors and provides scope for additional modifications to be made to enhance the antineoplastic activity of arsenic - containing compounds, given their range of actions and efficiency in killing cancer cells. | arsenic - based compounds have become accepted agents for cancer therapy providing high rates of remission of some cancers such as acute promyelocytic leukemia (apl). the mechanisms by which arsenic - containing compounds kill cells and reasons for selective killing of only certain types of cancer cells such as apls have recently been delineated. this knowledge was gained in parallel with increasing understanding and awareness of the importance of intracellular redox systems and regulation of the production of reactive oxygen species (ros) by controlling mitochondrial function. many of the targets for the arsenic - containing compounds are mitochondrial proteins involved in regulating the production of ros. inhibition of these proteins by disulfide linkage of vicinal thiol groups often leads to increased production of ros and induction of apoptotic signalling pathways. sensitivity or resistance to the actions of arsenic - containing compounds on cancer cells and normal cells depends on the levels of transport systems for their uptake or efflux from the cells as well as their redox defence mechanisms. the exact mechanisms of arsenic toxicity as well as its anticancer properties are likely to be related and these aspects of arsenic metabolism are covered in this review. greater understanding of the mechanisms of action of arsenic will help determine the risks of human exposure to this chemical. novel organic arsenic - containing compounds and the lessons learned from studying their selective sensitivity in targeting dividing endothelial cells to inhibit angiogenesis raise the future possibility for designing better targeted antineoplastic arsenic - containing compounds with less toxicity to normal cells. |
in july 2007, an outbreak of ulceroglandular tularemia occurred in utah among visitors to the southwest shore of utah lake ; an epidemiologic investigation implicated deer fly bites as the source of infection (8). molecular subtyping of isolates was performed by using pmei pulsed - field gel electrophoresis (pfge) as previously described (2). pfge gels were normalized by comparison to the salmonella enterica serotype braenderup (h9812) reference strain by using bionumerics software (v. 4.0, applied maths bvba, sint - martens - latem, belgium) (2). a dendrogram was constructed by comparison with pmei pfge patterns for a1 (schu s4, ma002972) and a2 (atcc 6223, wy963418) control strains (1,2,47,9) (figure 1). the 5 clinical isolates fell into the 2 major type a clades ; 2 isolates were identified as a2 (ut074632, ut074633), and 3 were identified as a1 (ut074262, ut074263, ut074265) (figure 1). pfge patterns for the 3 a1 isolates were indistinguishable from each other, as were patterns for the 2 a2 isolates (figure 1). dendrogram based on pmei pulsed - field gel electrophoresis (pfge) patterns of francisella tularensis type a isolates. the dendrogram was constructed by using dice similarity coefficients (1.5% optimization and 1.5% tolerance) and unweighted pair group method with averages. strains wy963418, atcc 6223, schu s4, and ma002972 were included as known a1 and a2 controls for creation of the dendrogram. control strains were previously identified as either a1 or a2 by multiple methods including multilocus variable number tandem repeat analysis, pfge, housekeeping gene sequence analysis, whole genome sequencing, and indel analysis (1,2,47,9). a brief search of the exposure area yielded desiccated carcasses of 10 black - tailed jackrabbits (lepus californicus) and 2 desert cottontail rabbits (sylvilagus audubonii). the carcasses were found within a few hundred meters of each other, in an overall area 1,200 m. this finding is supported by identification of an additional case of human tularemia in utah caused by an a1 strain in 1998 (centers for disease control and prevention, unpub our results indicate that a1, a2, and type b strains can coexist naturally within the same ecosystem, a paradox when compared with the segregation that appears to exist on a larger scale. overall, these observations underscore the need for future studies to define the ecologic and evolutionary factors underlying the distributions of f. tularensis strains in north america. although the role of deer flies as vectors of f. tularensis is well established, the dynamics of deer fly associated outbreaks have not been well researched. transmission of f. tularensis by deer flies is believed to be entirely mechanical, through contamination of the mouthparts. long - term maintenance of f. tularensis has not been shown to occur in deer flies, and it is therefore not surprising that the deer flies we collected 3 weeks after the outbreak tested negative for this organism. our findings suggest that deer flies nonselectively acquire and transmit whatever strains are circulating in enzootic hosts. we postulate that, in this instance, an abundance of deer flies led to extensive feeding on many hosts, resulting in the simultaneous transmission of multiple strains. high mortality rates among lagomorphs may have forced deer flies to seek alternate hosts, specifically muskrats, which are associated with type b strains and have been linked to outbreaks among trappers at utah lake (3). the co - occurrence of multiple subspecies and clades may be unique to arthropod - associated outbreaks of tularemia and not characteristic of outbreaks resulting from other modes of f. tularensis transmission, such as contaminated water. further work is needed to determine whether our findings will apply to other deer fly associated outbreaks or for outbreaks of tularemia associated with ticks, which are known to maintain as well as transmit f. tularensis. notably, while investigating a tick - borne outbreak of presumed type b infections in south dakota, markowitz and colleagues found evidence of both type a and type b strains in dermacentor variabilis ticks collected from dogs (14). outbreaks involving multiple serotypes have been observed with other vector - borne pathogens, including dengue virus (15), which suggests that amplification and transmission of multiple strains in a focal area may represent a general feature of some vector - borne diseases. | in july 2007, a deer fly associated outbreak of tularemia occurred in utah. human infections were caused by 2 clades (a1 and a2) of francisella tularensis subsp. tularensis. lagomorph carcasses from the area yielded evidence of infection with a1 and a2, as well as f. tularensis subsp. holarctica. these findings indicate that multiple subspecies and clades can cause disease in a localized outbreak of tularemia. |
in recent years, growth in the aging population has been observed in many countries and is progressing rapidly in japan in particular. because of this, the incidence of dementia in particular, alzheimer s disease (ad)is rising rapidly, so there is a pressing need to provide effective treatment options for individuals with ad. in > 80 countries worldwide, memantine has been used to treat patients with ad (predominantly moderate - to - severe ad) for over 10 years, and its efficacy and safety have been reported in clinical trials and meta - analyses [1 - 3 ]. memantine was approved for the treatment of moderate - to - severe ad in japan in 2011. a late phase ii dose - finding study in japan demonstrated dose - responsiveness at 24 weeks in the japanese version of the severe impairment battery (sib - j). a phase iii study, also conducted in japan, showed a statistically significant change in sib - j score compared with placebo. regarding the variable the clinician s interview - based impression of change plus - japanese version (cibic plus - j), the memantine group showed a lesser degree of worsening at week 24 compared with those receiving placebo, although the difference was not statistically significant. studies in the us and europe have shown memantine to be effective in language improvement based on the sib - language (sib - l) scale and in behavioral improvement based on the 12-item neuropsychiatric inventory (npi). however, there are no data on language improvements in japanese patients treated with memantine and, given the differences in lifestyle and ad prevalence between japan and western countries, it remains unknown whether the results of clinical studies conducted outside japan can be extrapolated to japanese patients with ad. taking into consideration the heterogeneity of ad, analysis of a large population could reveal information about the clinical effects of memantine on language ability in japanese patients. thus far, no analysis has been performed with a large population of japanese subjects to evaluate the effects of memantine on behavioral improvement. the objective of our study, therefore, was to clarify the efficacy in terms of cognition, language, communication, and behavior and safety of memantine in ad patients. to achieve this objective, we performed a pooled analysis of two previously published, multicenter randomized double - blind, placebo - controlled trials (phase ii and phase iii) conducted in japanese outpatients. we assessed the behavioral pathology in alzheimer s disease rating scale (behave - ad), a subscale of cibic plus - j that was used in the phase ii and iii studies, to analyze the effects of memantine on behavioral improvement. we also assessed the sib - j to evaluate cognitive function, and the sib - l to evaluate language. the rationale for performing a pooled analysis was that it provided greater statistical power for detecting significant differences in these end points between memantine and placebo, providing confirmation of the results presented in the original reports. the data for our pooled analysis were derived from a phase ii dose - finding study and a phase iii study of memantine in japanese outpatients with moderate - to - severe ad. because the studies had a similar design, unified analysis was possible. table 1 provides an overview of each study, and figure 1 provides the patient flow from the two studies combined. both studies were conducted in accordance with good clinical practice. written voluntary consent regarding participation in the study was obtained from the patient and his or her legal representative. in instances where the patient was not capable of giving consent, or where consent was obtained orally and not in writing, written consent the t test was used for age, body weight, mmse, fast and sib - j. according to the dsm - iv criteria, patients should exhibit memory impairments plus at least one of aphasia, apraxia, agnosia and executive dysfunction. these cognitive deficits must progress slowly, persist, and be characterized by social / occupational dysfunction. these deficits must not be caused by other central nervous system diseases, systemic diseases known to cause dementia, induced psychotic disorder, delirium, or other major diseases. the nincds - adrda diagnostic criteria for probable ad include dementia identified by clinical / neuropsychological tests, deficits in at least two cognitive regions, a progressive decline in memory and/or other cognitive functions, no disturbances in consciousness, onset of symptoms between 40 and 90 years of age, and the absence of systemic diseases or other brain diseases known to cause progressive memory / cognitive disorders. probable diagnosis of ad may be supported by the presence of progressive aphasia, apraxia, or agnosia ; impaired activities of daily living ; family history of similar disorders ; and clinical tests (e.g., spinal fluid tests, electroencephalography and computed tomography). fast : 6a = 1, 6b = 2, 6c = 3, 6d = 4, 6e = 5, 7a = 6. ad : alzheimer s disease ; adcs - adl - j : alzheimer s disease cooperative study - activities of daily living inventory ; cibic plus - j : clinician s interview - based impression of change plus - japanese version ; dsm - iv : diagnostic and statistical manual of mental disorders, fourth edition ; fast : functional assessment staging of alzheimer s disease ; mmse : mini - mental state examination ; modified his : modified hachinski ischemic score ; nincds - adrda : national institute of neurological and communicative disorders and stroke - alzheimer s disease and related disorders association ; sib - j : severe impairment battery - japanese version. seven patients were excluded from the full analysis set because of a lack of post - baseline efficacy data. of these seven patients, three patients in each memantine group did not undergo post - baseline assessments because of eligibility violations or data for the primary efficacy endpoints (severe impairment battery - language - japanese and clinician s interview - based impression of change plus - japanese) were missing, and one patient in the placebo group was suspected of having creutzfeldt jacob disease, which was verified by genetic analysis, and was withdrawn from the study before the postbaseline evaluations. fifty - three japanese institutions participated in the phase ii study and 74 participated in the phase iii study. both studies in our pooled analysis used a multicenter, double - blind, placebo - controlled, parallel - group design. the studies included a 4-week baseline observation period, during which patients received placebo once daily after breakfast. the double - blind period was 24 weeks in both studies, during which patients received memantine hydrochloride or placebo once daily after breakfast. the initial dose of memantine was 5 mg / day for 1 week, and the dose was then increased by 5 mg per week. the maintenance dose was 10 mg / day or 20 mg / day for the phase ii study, and 20 mg / day for the phase iii study. a total of 747 patients participated in the phase ii and phase iii studies (315 patients and 432 patients, respectively). patients treated with memantine 10 mg / day in the phase ii study were excluded from the pooled analysis. therefore, 321 patients treated with memantine 20 mg / day and 319 patients administered placebo were included in this pooled analysis. patients and their caregivers visited the outpatient clinic once every 4 weeks and were evaluated for efficacy at the start of the double - blind period and at weeks 4, 12 and 24. safety assessments took place seven times in total (at the predosing visit and weeks 4, 8, 12, 16, 20 and 24). patients were followed up for 4 weeks after completion of the double - blind period or discontinuation of treatment to monitor adverse events (aes). concomitant use of any investigational drugs other than memantine, cholinesterase inhibitors (e.g., donepezil hydrochloride), nmda receptor antagonists (e.g., ketamine), antiepileptic drugs, antiparkinsonian drugs, thiazide diuretics, or centrally acting muscle relaxants was prohibited. concomitant use of hypnotics, sedatives, tranquilizers, or antipsychotics was prohibited in principle, but the use of brotizolam, rilmazafone, or lormetazepam was permitted only when necessary. the use of tiapride was allowed only when necessary or in a constant dosage regimen and within the normal dosage range (150 mg / day). regarding short - term in - hospital stays, patients were not allowed to receive short - term stays within 3 weeks of every efficacy evaluation (i.e., at the start of the double - blind period and weeks 4, 12 and 24) in the phase ii study. in the phase iii study, patients were not allowed to receive short - term stays at the start of the double - blind period and within the 3 weeks before the efficacy evaluation at week 24. the duration of short - term stays during the 4-week periods between the visits to the outpatient clinic for evaluation was not allowed to exceed six nights. when patients were already receiving rehabilitation such as long - term care services, this remained unchanged throughout the study period. patient eligibility criteria included the following : ad diagnosis according to the diagnostic and statistical manual of mental disorders iv, or probable ad according to national institute of neurological and communicative disorders and stroke - alzheimer s disease and related disorders association criteria magnetic resonance imaging or computed tomography findings that were compatible with a diagnosis of ad and ruled out structural causes of dementia such as normal pressure hydrocephalus mini - mental state examination (mmse) score of 5 14 at the start of treatment with placebo before the double - blind period (i.e., the observation period) and at the start of the double - blind period moderate - to - severe ad according to the functional assessment staging of alzheimer s disease (fast), that is, stages 6a and 7a, at the start of treatment with placebo in the observation period all participants must have been cared for by the same caregiver for > 3 days in a week throughout the study period. during the efficacy evaluation, major exclusion criteria were as follows : cases complicated with dementia other than ad, a serious neurological disease or severe psychiatric disorder other than ad, and a history of treatment with memantine. individuals who were planning to move into a nursing home or other care facility during the study period were also excluded. efficacy measures used in this pooled analysis were as follows : sib - j (cognitive function), cibic plus - j (global assessment), and the behave - ad (behavioral and psychological symptoms). in addition, we examined the sib - l - j (a subscale of the sib - j) in this analysis. the sib - j consists of 40 items and has scores ranging from 0 to 100 points. the sib - l consists of 21 items related to the broca s area in the frontal lobe of the brain (relating to naming, reading, writing and repetition) among a total of 51 sib items and has a maximum score of 41 points. a lower score indicates greater severity in language impairment. consistent with the high variance of sib - l scores within the three mmse severity groups, the pearson correlation coefficients between sib - l and mmse scores were low for the group with mmse scores 3 days in a week throughout the study period. during the efficacy evaluation major exclusion criteria were as follows : cases complicated with dementia other than ad, a serious neurological disease or severe psychiatric disorder other than ad, and a history of treatment with memantine. individuals who were planning to move into a nursing home or other care facility during the study period were also excluded. efficacy measures used in this pooled analysis were as follows : sib - j (cognitive function), cibic plus - j (global assessment), and the behave - ad (behavioral and psychological symptoms). in addition, we examined the sib - l - j (a subscale of the sib - j) in this analysis. the sib - j consists of 40 items and has scores ranging from 0 to 100 points. the sib - l consists of 21 items related to the broca s area in the frontal lobe of the brain (relating to naming, reading, writing and repetition) among a total of 51 sib items and has a maximum score of 41 points. consistent with the high variance of sib - l scores within the three mmse severity groups, the pearson correlation coefficients between sib - l and mmse scores were low for the group with mmse scores 20). we assumed that the sib - l - j score was worsened if the score was decreased by 3.7, a cut - off value used previously. as a result, the sib - l - j score was worsened in 33.3% of patients in the placebo group and 10.5% of patients in the memantine group. among patients with baseline sib - l - j scores 20 at week 24 (locf analysis), significantly fewer patients in the memantine group than in the placebo group showed worsening of sib - l - j scores (p = 0.0173). among patients with baseline sib - l - j scores > 20, the sib - l - j score was worsened in 28.4% of patients in the placebo group and 19.6% in the memantine group, again indicating a significantly lower incidence of score worsening in patients treated with memantine (p = 0.0168) (figure 5a). at week 24 (locf analysis), the nnt for patients with at least no worsening in language performance was 3.6 patients (those with baseline sib - l - j 20) and 14.0 patients (those with baseline sib - l - j > 20) (figure 5b). a. proportion of patients showing worsening of severe impairment battery - language - japanese version (sib - j) scores at week 24 (full analysis set, last observation carried forward analysis) stratified by sib - l - j baseline score (20 or > 20). b. time course of changes in the proportion of patients with worsening in sib - j score stratified by sib - l - j baseline score (20 or > 20). memantine produced statistically significantly less worsening compared with placebo in terms of the cibic plus - j scores at week 24 in the locf analysis (mean values for memantine vs placebo 4.45 vs 4.64 ; p = 0.0474). in the oc analysis, the comparison was in favor of memantine, but did not reach the level of statistical significance (mean values for memantine vs placebo 3.96 vs 4.04, p = 0.2810 ; 4.13 vs 4.27, p = 0.1202 ; and 4.44 vs 4.62, p = 0.0843, at weeks 4, 12 and 24, respectively) (figure 6). time course of global assessment score based on the clinician s interview - based impression of change plus - japanese (cibic plus - j) for oc and change from baseline to week 24 with locf. the difference between the fas (633 patients ; memantine, n = 618 ; placebo, n = 615) and locf (632 patients) is due to a lack of baseline data in one patient. fas : full analysis set ; locf : last observation carried forward ; oc : observed cases ; se : standard error. fas : full analysis set ; locf : last observation carried forward ; oc : observed cases ; se : standard error. in the analysis of changes in behave - ad scores, memantine showed statistically significant improvements compared with placebo at weeks 12 and 24 in the oc analysis, and in the locf analysis. mean change from baseline for memantine versus placebo was -1.06 versus -0.07 (p = 0.0005), and -0.73 versus 0.21 (p = 0.0133), at weeks 12 and 24 in the oc analysis, respectively. in the locf analysis, the changes in score in the memantine and placebo groups were -0.52 and 0.52, respectively (p = 0. time course of change in total behavioral pathology in alzheimer s disease rating scale score for oc and change from baseline to week 24 with locf. the difference between the fas (633 patients ; memantine, n = 618 ; placebo, n = 615) and locf (632 patients) is due to a lack of baseline data in one patient. fas : full analysis set ; locf : last observation carried forward ; oc : observed cases ; se : standard error. fas : full analysis set ; locf : last observation carried forward ; oc : observed cases ; se : standard error. using the week 24 behave - ad data, further analysis was carried out to stratify results according to the seven subdomains of behave - ad scale. for both the oc and the locf analyses, the differences were found to be statistically significant for the domains activity disturbances and aggressiveness. the mean differences from baseline for activity disturbances and aggressiveness were p = 0.0248 and p = 0.0227, respectively, in the oc analysis, and p = 0.0067 and p = 0.0103, respectively, in the locf analysis (wilcoxon test) (figure 8). summary statistics of domain - specific score changes in behavioral pathology in alzheimer s disease rating scale from baseline to week 24 (last observation carried forward analysis). efficacy data were also classified in the behave - ad domains according to the presence / absence of symptoms at study initiation. memantine treatment exhibited a significantly better suppressing effect on the occurrence of new aggressiveness compared with placebo in patients without aggressiveness at study initiation (oc analysis p = 0.0063 ; locf analysis p = 0.0018 (test) (figure 9). the overall incidence of aes was similar between the memantine and placebo groups (78.5 vs 76.8%). aes with an incidence 5% in the memantine and placebo groups, respectively, were constipation (11.5 vs 10.3%), nasopharyngitis (14.3 vs 16.9%), fall (9.7 vs 10.3%), contusion (5.6 vs 6.3%), and insomnia (5.6 vs 5.0%) (table 3). adverse events with an incidence 5% in either treatment group. adverse events were coded according to preferred term using the japanese version of the medical dictionary for regulatory activities version 11.1 of the 640 patients in this pooled analysis (safety analysis set for the pooled analysis), 321 were receiving memantine 20 mg / day and 319 were receiving placebo. there were no statistically significant differences between treatment groups in this pooled analysis in terms of baseline demographics (table 2). of the 640 patients enrolled in the double - blind period, the fas comprised 633 patients (315 receiving placebo and 318 receiving memantine 20 mg / day) because of the exclusion of 7 patients who lacked postbaseline efficacy measurements. of these seven patients, three patients in each memantine group did not undergo postbaseline assessments because of eligibility violations or data for the primary efficacy end points (sib - j and cibic plus - j) were missing, and one patient in the placebo group was suspected of having creutzfeldt jacob disease, which was verified by genetic analysis, and the patient was withdrawn from the study before the postbaseline evaluations. no patient was excluded for the reason of failure to take at least one dose of the trial medication (figure 1). the t - test was used for age, body weight, mmse, fast and sib - j. fast : functional assessment staging of alzheimer s disease ; mmse : mini - mental state examination ; s.d. : standard deviation ; sib - j : severe impairment battery - japanese version. memantine produced statistically significantly better outcomes in sib - j compared with placebo at each postbaseline evaluation (i.e., weeks 4, 12 and 24) in the oc analysis and at week 24 in the locf analysis. the mean differences in sib - j score from baseline for the memantine and placebo groups in the oc analyses were 1.95 versus -0.45 (p 20). we assumed that the sib - l - j score was worsened if the score was decreased by 3.7, a cut - off value used previously. as a result, the sib - l - j score was worsened in 33.3% of patients in the placebo group and 10.5% of patients in the memantine group. among patients with baseline sib - l - j scores 20 at week 24 (locf analysis), significantly fewer patients in the memantine group than in the placebo group showed worsening of sib - l - j scores (p = 0.0173). among patients with baseline sib - l - j scores > 20, the sib - l - j score was worsened in 28.4% of patients in the placebo group and 19.6% in the memantine group, again indicating a significantly lower incidence of score worsening in patients treated with memantine (p = 0.0168) (figure 5a). at week 24 (locf analysis), the nnt for patients with at least no worsening in language performance was 3.6 patients (those with baseline sib - l - j 20) and 14.0 patients (those with baseline sib - l - j > 20) (figure 5b). a. proportion of patients showing worsening of severe impairment battery - language - japanese version (sib - j) scores at week 24 (full analysis set, last observation carried forward analysis) stratified by sib - l - j baseline score (20 or > 20). b. time course of changes in the proportion of patients with worsening in sib - j score stratified by sib - l - j baseline score (20 or > 20). memantine produced statistically significantly less worsening compared with placebo in terms of the cibic plus - j scores at week 24 in the locf analysis (mean values for memantine vs placebo 4.45 vs 4.64 ; p = 0.0474). in the oc analysis, the comparison was in favor of memantine, but did not reach the level of statistical significance (mean values for memantine vs placebo 3.96 vs 4.04, p = 0.2810 ; 4.13 vs 4.27, p = 0.1202 ; and 4.44 vs 4.62, p = 0.0843, at weeks 4, 12 and 24, respectively) (figure 6). time course of global assessment score based on the clinician s interview - based impression of change plus - japanese (cibic plus - j) for oc and change from baseline to week 24 with locf. the difference between the fas (633 patients ; memantine, n = 618 ; placebo, n = 615) and locf (632 patients) is due to a lack of baseline data in one patient. fas : full analysis set ; locf : last observation carried forward ; oc : observed cases ; se : standard error. fas : full analysis set ; locf : last observation carried forward ; oc : observed cases ; se : standard error. in the analysis of changes in behave - ad scores, memantine showed statistically significant improvements compared with placebo at weeks 12 and 24 in the oc analysis, and in the locf analysis. mean change from baseline for memantine versus placebo was -1.06 versus -0.07 (p = 0.0005), and -0.73 versus 0.21 (p = 0.0133), at weeks 12 and 24 in the oc analysis, respectively. in the locf analysis, the changes in score in the memantine and placebo groups were -0.52 and 0.52, respectively (p = 0. time course of change in total behavioral pathology in alzheimer s disease rating scale score for oc and change from baseline to week 24 with locf. the difference between the fas (633 patients ; memantine, n = 618 ; placebo, n = 615) and locf (632 patients) is due to a lack of baseline data in one patient. fas : full analysis set ; locf : last observation carried forward ; oc : observed cases ; se : standard error. fas : full analysis set ; locf : last observation carried forward ; oc : observed cases ; se : standard error. using the week 24 behave - ad data, further analysis was carried out to stratify results according to the seven subdomains of behave - ad scale. for both the oc and the locf analyses, the differences were found to be statistically significant for the domains activity disturbances and aggressiveness. the mean differences from baseline for activity disturbances and aggressiveness were p = 0.0248 and p = 0.0227, respectively, in the oc analysis, and p = 0.0067 and p = 0.0103, respectively, in the locf analysis (wilcoxon test) (figure 8). summary statistics of domain - specific score changes in behavioral pathology in alzheimer s disease rating scale from baseline to week 24 (last observation carried forward analysis). efficacy data were also classified in the behave - ad domains according to the presence / absence of symptoms at study initiation. memantine treatment exhibited a significantly better suppressing effect on the occurrence of new aggressiveness compared with placebo in patients without aggressiveness at study initiation (oc analysis p = 0.0063 ; locf analysis p = 0.0018 (test) (figure 9). the overall incidence of aes was similar between the memantine and placebo groups (78.5 vs 76.8%). aes with an incidence 5% in the memantine and placebo groups, respectively, were constipation (11.5 vs 10.3%), nasopharyngitis (14.3 vs 16.9%), fall (9.7 vs 10.3%), contusion (5.6 vs 6.3%), and insomnia (5.6 vs 5.0%) (table 3). adverse events with an incidence 5% in either treatment group. adverse events were coded according to preferred term using the japanese version of the medical dictionary for regulatory activities version 11.1 this pooled analysis demonstrated that memantine was statistically significantly superior to placebo as assessed by cibic plus - j scores in japanese ad patients, similar to the findings of studies conducted in other countries. furthermore, the pooled analysis using the behave - ad a subscale of the cibic plus - j showed that memantine was also associated with less worsening of behavioral symptoms in japanese ad patients compared with placebo. this pooled analysis also examined the subscales of the sib - j, finding that memantine was associated with less worsening of language ability, visuospatial cognition, attention and praxis compared with placebo, again similar to the results of studies conducted overseas. the sib - l is a fast and easily administered scale that can be used for assessing language impairment and the effects of treatment on the language performance of patients with moderate - to - severe ad. the removal of three items from the sib language subscale yielded the sib - l scale, an efficient and reliable tool for language assessment in moderate - to - severe ad patients. the sib - l scale seems ideal for the assessment of basic language abilities and the evaluation of effects of treatment on language abilities in patients with moderate - to - severe ad. analysis of the sib - l - j in this study revealed that memantine was associated with less worsening of language function throughout the treatment period compared with placebo. the sib - l scale is an index for language performance, and ferris. recently conducted a meta - analysis that included the results of the japanese phase ii study and the study by ferris.. taken together, the results appear to indicate that memantine is effective in the reduction of worsening of language ability in japanese patients. a post hoc analysis of the effect of memantine on behavior in three large randomized studies has been reported. the study found a significant improvement in agitation / aggression in the npi subitem cluster. agitation / aggression in the npi corresponds to aggressiveness in the behave - ad subitem cluster, which was analyzed in this pooled analysis. our analysis showed that memantine significantly improved aggression, consistent with the results of studies conducted in western countries. a potential limitation of our study relates to the information obtained from the caregivers on the status of the patient. in the two studies included in our analysis, the number of people using long - term care services is reported to be increasing every year along with the changes in the long - term care insurance environment. this was reflected in our study, whereby the number of subjects using long - term care services in the phase iii study was approximately 1.3 times higher than in the phase ii study. according to a report on recent nursing care services in japan, ad patients tend to use long - term care services, leading to decreased observation of the patients by their family caregivers. the report also states that information on the functional status of the patient from each caregiver may be insufficient because the burden of long - term care is often shared among family members in japan. considering these points, for those patients in our study who used long - term care services, information from only one caregiver might have been insufficient to reflect actual changes in clinical symptoms for the evaluation of cibic plus - j. regarding the statistical analysis performed in this study, because this pooled analysis is regarded as exploratory in nature, no adjustments were made for multiple observations. therefore, further studies are needed to confirm the findings. because the observation period in this study was 24 weeks, any longer - term effect is unknown. while the effect of memantine on mmse scores in a long - term study (mean duration 798 days) in japanese patients has been demonstrated, the long - term effect on other functions in patients with ad needs to be clarified in further studies. the results of our pooled analysis show that memantine is potentially effective and is well tolerated in patients with moderate - to - severe ad, consistent with findings of studies from other countries. in particular, the findings suggest that memantine may be beneficial in terms of cognition, including attention, praxis, visuospatial ability and language. memantine also demonstrated a beneficial effect on behavioral and psychological symptoms, including activity disturbances and aggressiveness. these symptoms are known to be associated with rapid disease progression, increased caregiver burden, early institutionalization, and increased cost of care, so strategies to manage these symptoms, particularly in light of the growth in the aging population, are of great importance. these findings will be useful for physicians, patients, and their caregivers, adding to knowledge about the use of memantine in the japanese setting. because the mechanism of action of memantine differs from that of acheis thus, memantine may be used as initial monotherapy and in patients with inadequate or progressively deteriorating responses to acheis. therefore, memantine hydrochloride is a new treatment option for ad and is expected to expand the therapeutic options for patients with ad. further studies of a larger scale and with a clearly prespecified primary end point are required to confirm the present findings. | background with the increase in the aging population, there is a pressing need to provide effective treatment options for individuals with alzheimer s disease (ad). memantine is an n - methyl - d - aspartate receptor antagonist used to treat ad in > 80 countries worldwide, and studies in the usa and europe have shown it to be effective in improving language deficits ; however, there are currently no data on language improvements in japanese patients treated with memantine.objectives to clarify the efficacy and safety of memantine in japanese outpatients with moderate to severe ad, using a pooled analysis of two multicenter randomized placebo - controlled trials, a phase 2 dose - finding study and a phase 3 study.results the final analysis comprised 633 patients (318 receiving memantine and 315 placebo). memantine produced better outcomes in terms of severe impairment battery - japanese version, clinician s interview - based impression of change plus - japanese version, behavioral pathology in ad rating scale, and language scores, versus placebo. the overall incidence of adverse events and adverse reactions was similar between groups.conclusion in this pooled analysis of japanese patients, memantine achieved better outcomes than placebo in terms of cognition, including attention, praxis, visuospatial ability and language, and behavioral and psychological symptoms, including activity disturbances and aggressiveness. |
in human, nkg2d ligands consist of two families ; the mhc - class - i- chain - related proteins (mica and micb) [1, 2 ] and the cytomegalovirus ul16-binding protein family (ulbp16) or retinoic acid early transcript 1 (raet1e, g, h, i, n, and raet1l) [3, 4 ] which are polymorphic [57 ]. the signaling through nkg2d engagement to its ligands requires the adaptor protein dap10 in human or dap10/12 in mice, forming a hexameric complex on the cell membrane [8, 9 ]. the nkg2d ligands are mostly not expressed on normal cells or expressed at very low levels on particular cells at particular conditions but are upregulated on cells under stress such as malignant cells or bacterial / viral infected cells and have been linked with autoimmune diseases [1013 ]. thus, the expression of nkg2d ligands is important in immune responses [14, 15 ]. at present, monoclonal antibodies (mabs) are breakthrough in medicine and are effective products for diagnostic, monitoring, and therapeutic of cancers, infections, and other diseases. in case of cancer, many kinds of cancer cells are over expressing nkg2d ligands, but they can escape from recognition and destruction by t cells or nk cells of the immune system by shedding the ligands as a soluble form such as soluble mic. the mic shedding in cancer renders a reduced or low expression of mic on cell surface. therefore, the high affinity antibodies are required for prognostics and therapeutics in cancer patients. previously, we have generated several monoclonal antibodies against mica. in order to improve the binding activities against mica in addition, affinity maturation of antibodies expressed on phages was performed by pcr - random mutagenesis at complementarity determining regions (cdrs) on the v domain of the heavy chain cdr3 (hcdr3). this process has produced clones with high anti - mica activities which have been characterized. these clones would have high potential to develop targeted therapy against cancer cells expressing mica. the escherichia coli strain xl1-blue mrf ((mcra)183 (mcrcb - hsdsmr - mrr)173 enda1 supe44 thi-1 reca1 gyra96 rela1 lac [fproab lacizm15 tn10 (tet) ] (stratagene, usa) was used as the host for the preparation of phagemids, pcomb3h - ss, kindly provided by dr barbas iii and as host for the helper bacteriophage, vcsm13 (ge healthcare biosciences, nj, usa). the pgem - t easy vector (promega, usa) was used for cloning of pcr products, and the pcomb3h - ss phagemid vector was used for the fab displayed filamentous bacteriophage system. total rna and cdna were extracted and synthesized by oligo dt and random hexamer primers according to manufacturer 's instructions using rna extraction and cdna synthesis kits (promega, usa). these cdna samples were used as templates for further pcr amplifications and cloning of heavy and light chains to phagemid, pcomb3h - ss. in order to construct anti - mic fab, the vh and vl genes were amplified by pcr from cdna of anti - mic monoclones (ww2g8, ww6b7, and ww9b8). the heavy chain reverse primer ; 5aggcttactagtacaatccctgggcacaat-3 (spei site is underlined) and the 3 heavy - chain variable forward primers ; 5aggtccagctgctcga g tctgg-3, 5aggtccaactgctcgagtctgg-3, and 5agg tccaactgctcgagtcagg-3 with xhoi sites underlined were used to amplify vh. the kappa light - chain reverse primer ; 5gcgccgtctagaattaacactcattcctgttgaa-3(xbai site is underlined) and the 5 light - chain variable forward primers ; 5ccagttccgagctcgtgctcacccagtctcca-3, 5ccagttccgagctccagatgacccagtctcca-3, 5ccagatgtgagctcgtgatgacccagactcca-3, 5ccagatgtgagctcgtcatgacccagtctcca-3, and 5ccagttccgagctcgtgatgacacagtctcca-3 with saci sites underlined were used to amplify the vl gene. the resulting pcr products were first cloned into pgem - t easy vector and then into pcomb3h - ss phagemid vector with heavy chain as a fusion molecule with piii. after cloning and phage rescue, all clones were tested for binding with mica by biopanning and indirect elisa (described below). direct sequencing of the phage clones to obtained heavy and light chain sequences was performed by 1st base laboratories sdn bhd., malaysia, using pcomb3h - ss specific forward primer : pc3hss2575s (vl) : 5aagacagctatcgcgattgcag3, pelseq (vh) : 5acctattgcctacggcagccg 3, and pcomb3h - ss - specific reverse primer : kpel (vl) : 5cggctgccgtaggcaataggt 3, gback (vh) : 5gcccccttattagcgtttgccatc as sequencing primers. the sequences were analyzed using blast (imgt, the international immunogenetics information system http://www.imgt.org/). pcr - random mutagenesis was performed to modify the complementarity determining regions (cdrs) on the v domain of the heavy chain cdr3 (hcdr3) of the clones using mutagenic primers (table 1) as previously described, and mutated fab displayed phages were reconstructed. these primers were designed from the clones validated by direct sequencing to randomize the 12 amino acid residues of hcdr3 region of anti - mica antibodies by avoiding stop codons. to produce fab displayed phages, xl-1blue cells harboring phagemids were grown to an od of 600 in 50 ml lb broth medium containing 50 g / ml carbenicillin (carb) and 10 g / ml tetracycline (tet) and incubated at 37c overnight on shaker. following, 10 plaque forming units (pfu) of helper phages, vcsm13, were added to the culture and incubated for 2 hr at 37c. after that 70 g / ml kanamycin was added to the culture and incubated on a shaker overnight at 37c. after centrifugation at 4,000 rpm for 15 min, the supernatant carrying phages was transferred to a clean bottle and 4% (w / v) peg-8000 and 3% (w / v) nacl were added, then, placed on shaker for 5 min to dissolve and precipitated phage on ice for 30 min. the phage particles were isolated by centrifugation at 9,000 rpm for 20 min at 4c by discarding supernatant and allowing the bottle to drain on paper towel for 10 min to remove as much peg solution as possible. the pellet, then, was resuspended in tbs/1% bsa, and the solution was centrifuged at 14,000 rpm for 5 min. after centrifugation, the resulting supernatant containing the anti - mic fab displayed phages was stored at 4c until used. an elisa plate was coated with mica antigens prepared as previously described using 10 g, 5 g, and 0.5 g for the first, second, and third panning, respectively, in coating buffer (bicarbonate ph 9.6) overnight at 4c. then, the plate was washed 2 times with tbs/0.5% tween (tbst) and blocked by filling the wells completely with 5% skim milk in tbs for 1 hr at room temperature (rt). following, phage - displayed fab suspension containing 10 pfu in a total of 100 l was added to each well and incubated for 2 hr at rt, then unbound phages were removed, and the plate was washed with tbs/0.5% tween (tbst) by vigorously pipetting up and down and waited for 5 min before removing tbst. in the first round, after unbound phages were removed, then the plate was washed once with tbst. the plate was washed 5 times in the 2nd round and ten times in the 3rd and subsequent rounds. for affinity maturation, biopanning of up to ten rounds bound phages were eluted by adding 50 l of elution buffer (0.1 m hcl adjusted with glycine to ph 2.2 with bsa 1 mg / ml) per well and incubated for 10 min at rt, followed by pipetting up and down vigorously. the eluate was removed and neutralized with 3 l of 2 m tris - base per 50 l of eluate. elisa wells coated with soluble mica antigens (5 g) were incubated with 10 or 10 pfu phage - display anti - mica fab suspension in a total of 100 l for 2 hr at rt. following three washes with tbst, bound phages were stained with a 1 : 5000 diluted horseradish peroxidase - conjugated mouse anti - m13 monoclonal antibody (ge healthcare biosciences, nj, usa) for 1 hr at rt followed by three washes. bound phages were detected using 3,3,5,5-tetramethylbenzidine (tmb) (kpl, gaithersburg, md) and measured as optical density absorbance (od), which was determined at 450 nm. 293 t cells (2 10 cells) expressing mica were incubated with 100 l of phage - display anti - mica fab suspension (10 pfu) for 1 hr on ice. the cells were washed with 1% bovine serum albumin in 1xpbs and stained with 5 l of fluorescein isothiocyanate (fitc) labeled anti - m13 bacteriophage g8p capsid antibody (abin125966 lot # 109131 antibodies - online gmbh, usa) for 1 hr on ice, followed by 1x wash with 1% bovine serum albumin in 1xpbs. cells bound phage - displayed anti - mica fab was analyzed by bd facs canto ii (bd, usa). 293 t cells (2 10 cells) were incubated with vcsm13 as negative control. vh and vl of anti - mica monoclones (ww2g8, ww6b7, and ww9b8) were amplified by pcr and cloned into pcomb3h - ss. the heavy and light chain fragments were approximately 660 bp (figure 1). these clones were transformed into e. coli (xl-1blue) by the standard heat shock method, rescued by m13 helper phages and isolated by biopanning against mica antigens. these clones were validated by elisa to ensure that they were carrying fab binding to mica. sequences of cdr3 derived from ww2g8, ww6b7, and ww9b8 are shown in figure 2. mutagenesis primers of cdr3 (table 1) were designed based on these sequences. finally, these clones were used as templates for mutagenesis of hcdr3. ten rounds of biopanning were performed to select the positive phages with increased binding activities against mica. antigen - binding activities of the phages from the third to ten rounds of panning were analyzed by indirect elisa, which showed the enrichment of binding activities indicated by greater od during the panning cycle. positive clones with high activities markedly predominated at the 7th round of selection (figure 3). sixty one clones of phages displaying mutated anti - mica antibodies (ww9b8, ww6b7, and ww2g8) were randomly picked from the pool phages of the 7th round selection and tested for their mica binding activities by indirect elisa. among them, we obtained five clones that exhibited 37-folds higher antigen - binding activities indicated by od (phage - display mutant fab ww2g8.2, phage - display mutant fab ww2g8.13, phage - display mutant fab ww6b7.12, phage - display mutant fab ww9b8.1, and phage - display mutant fab ww9b8.21) (figure 4). the comparative activities of phage - display fab ww9b8, phage - display mutant fab ww9b8.1, and phage - display mutant fab ww9b8.21 were also determined by flow cytometry using 293 t cells expressing mica. the phage - display mutant fab ww9b8.1 and phage - display mutant fab ww9b8.21 had higher activities against mica proteins than the original phage - display fab ww9b8 (figure 5) corresponding to their activities determined by indirect elisa. anticancer drugs conjugated directly to antibodies are not efficient, and only a limited number of drug molecules could be conjugated leading to low drug carrier. in order to produce mica - targeted anticancer drug, monoclonal antibodies against mica were cloned and displayed on filamentous bacteriophages. unlike drug conjugated to an antibody, a large amount of anticancer drug can be easily conjugated by chemical linking to pviii which exists 2,700 copies as major - phage - coated proteins per a phage particle. anticancer - drug - conjugated bacteriophages have been used successfully with a potentiator factor of over 1,000 compared to free drug. the studies of phages as targeted drug carriers were mostly in vitro. the in vivo study was only in a murine model. immunogenicity of bacteriophages in drug administration would be challenging and required further in vivo studies, especially in human. the role of nkg2d receptor and ligands in immune responses against cancer is well established and has been exploited as approaches for cancer immunotherapy. these include the induction of anti - mica to stimulate antitumor cytotoxicity, therapeutic dna - based vaccine of nkg2d ligands and tumor antigens, and the generation of t cells with chimeric nkg2d receptors directly activated by ligand engagement [26, 27 ]. however, the approaches employing drug conjugated to anti - nkg2d ligands have not been reported. apparently, the original anti - mica displayed phages had less activities to detect mica compared to monoclonal antibodies (figure 5). it has been shown that mutations of hcdr3 of antibodies could allow antibodies to improve binding activity and specificity. thus, we performed in vitro affinity maturation by randomly mutating cdr3 which is one of the antigen - binding domains and selected for phages with higher activities by several rounds of biopanning. according to our data, at least seven rounds of selections would be needed for maximal enhancement. normally, in other studies the panning was performed for only 35 rounds [18, 28 ] resulting in a few positive antibody clones. additional rounds of panning of up to ten rounds did not increase the collective od. among 61 individual clones of mutants, we obtained only fives clones (8.19%) that had high binding activities. two mutant clones with highest activities were characterized by flow cytometry (figure 5) and sequencing (data not show). these phage clones were able to recognize mica in a native form according to positive results obtained by both indirect elisa and flow cytometry. to further characterize the high activities clones, competitive elisa will be performed as well as testing against allelic mica proteins to determine whether these clones have any limitation in detecting diverse mica alleles. in conclusion, phage display technology is an effective method to generate and isolate high affinity monoclonal antibodies against specific antigens. phages displaying anti - mica with high binding activities have been established. by conjugation with anticancer drug such as doxorubicin or 5-fu, these reagents would have high potential to develop targeted therapy against cancer cells expressing mica proteins. | major histocompatibility complex class i chain - related gene a (mica) is an nkg2d ligand that is over - expressed under cellular stress including cancer transformation and viral infection. high expression of mica in cancer tissues or patients ' sera is useful for prognostic or follow - up markers in cancer patients. in this study, phage display technology was employed to improve antigen - binding activities of anti - mica monoclonal antibodies (ww2g8, ww6b7, and ww9b8). the 12 amino acid residues in the complementarity determining regions (cdrs) on the v domain of the heavy chain cdr3 (hcdr3) of these anti - mica antibodies were modified by pcr - random mutagenesis, and phages displaying mutated anti - mica fab were constructed. after seven rounds of panning, five clones of phages displaying mutant anti - mica fab which exhibited 37-folds higher antigen - binding activities were isolated. two clones of the mutants (phage - displayed mutant fab ww9b8.1 and phage - displayed mutant fab ww9b8.21) were confirmed to have antigen - binding specificity for cell surface mica proteins by flow cytometry. these phage clones are able to recognize mica in a native form according to positive results obtained by indirect elisa and flow cytometry. thus, these phage particles could be potentially used for further development of nanomedicine specifically targeting cancer cells expressing mica proteins. |
the american college of sports medicine (acsm) recommends that healthy adults should participate in moderately intense aerobic exercise, defined as 64 76% of one s maximal heart rate, for at least thirty minutes, five days per week. this is considered the minimum threshold of aerobic exercise for one to maintain health and reduce risk for chronic disease. this exercise may be attained through any number of different means, such as walking, jogging, swimming, or cycling. these activities are likely the most popular and preferred methods of exercise as one can perform them for various durations, depending upon one s chosen exercise intensity. another form of aerobic exercise in which people may participate to improve their health is repetitive jumping. most people are likely familiar with repetitive jumping, as rope skipping or jumping rope is an activity often observed in elementary school children. repetitive jumping is an intense activity where the heart rate will often rise quickly after as little as two minutes of jumping. previous research has demonstrated that this type of activity can contribute to a substantial caloric expenditure as it elicits a high metabolic demand from both aerobic and anaerobic sources, and that regardless of jumping cadence there appears to be no difference in physiological stress. however, as these early studies were conducted with subjects turning and skipping a rope, the present study employed the use of a new exercise device specifically designed for repetitive jumping. an innovative device (the digi - jump) has been developed which allows one to use jumping as a training technique without some of the limitations of jumping rope. this device allows one to jump at a predetermined rate (jumps per minute) and at a pre - determined height per jump, while not having to utilize one s hands and arms, thus possibly reducing localized fatigue and enabling one to continue exercising longer and more consistently. also, as the jumping rate is governed by a series of lights and audible beeps, one may continue to exercise even if the person has an error. in traditional rope jumping, when the rope catches the foot, one must stop exercising and then start again. this device has only recently been developed and is patent pending (patent application # 10/464,373). the only previously published research employing this device was a 2008 study by sivley,., which examined the test - retest reliability of this device. (2008) demonstrated that the digi - jump has test - retest reliability coefficients that are comparable to other commonly used exercise modalities (absolute vo2 : 0.95 ; relative vo2 : 0.71 ; hr : 0.89 ; rpe : 0.75). early research on rope skipping revealed no differences in metabolic demand between jumping at different cadences, nor did these studies employ a jumping cadence lower than 120 jumps per minute (jpms). however, those studies used a rope while the present study allowed the subjects arms to swing freely, and the present study also required subjects to jump at a lower cadence of 100 jpms. therefore, the purpose of this study was to investigate the difference in metabolic stress between repetitive jumping at 100 vs. 120 jpms on the digi - jump machine. twenty - eight subjects (18 males and 10 females) between the ages of 18 and 25 years voluntarily completed this study. subjects were recruited from the local university and city community, and consisted of individuals who were already participating in at least 30 minutes of moderate recreational physical activity on most days of the week. each subject completed a physical activity readiness questionnaire (par - q) and a health status questionnaire to screen for any health risk, and acsm guidelines were employed to eliminate any potential subjects with known risk factors. subjects also understood and signed a written informed consent consistent with the requirements of the western kentucky university human subjects review board. all jumping trials were conducted on a digi - jump machine. during both exercise trials, metabolic measurements were obtained using a two - way low - resistance breathing valve and a respiratory mask, which covered the mouth and nose. expired gases were analyzed using a vacumed vista mini - cpx (vacumed, ventura, ca). a heart rate monitor was also worn during testing (polar vantage xl, port washington, ny), and hr was monitored using telemetry. carbon dioxide and oxygen analyzers were calibrated before each test, using calibration gases of known concentration. the flowmeter was calibrated using a hans rudolph (series 4900) 3.0 l calibration syringe (kansas city, mo). rating of perceived exertion (rpe) was determined at the end of each minute during each test, using borg s 15-point scale. they were instructed to report for testing after refraining from strenuous activity for a minimum of 48 hours, and from caffeine, nicotine, and alcohol for a minimum of 24 hours. during the initial visit a thorough explanation of the study was given, along with completion of initial screening procedures and instructions regarding subsequent lab sessions. percent body fat was measured based on age, gender and the sum of three skinfold sites (males : chest, abdomen, and thigh ; females : triceps, suprailiac, and thigh) using lange skinfold calipers. subjects were instructed to jump at the defined cadence until volitional exhaustion, or for a maximum of fifteen minutes. the second visit consisted only of the remaining exercise trial (120 or 100 jpms). jumping trials were performed on separate days in a counterbalanced order with a minimum of 48 hours rest between each. statistical package for the social sciences (spss) software was used to perform all analyses. all data is reported as mean (m) + standard deviation (sd). analysis of variance (anova) was used to test for differences among subjects responses from the two exercise protocols. twenty - eight subjects (18 males and 10 females) between the ages of 18 and 25 years voluntarily completed this study. subjects were recruited from the local university and city community, and consisted of individuals who were already participating in at least 30 minutes of moderate recreational physical activity on most days of the week. each subject completed a physical activity readiness questionnaire (par - q) and a health status questionnaire to screen for any health risk, and acsm guidelines were employed to eliminate any potential subjects with known risk factors. subjects also understood and signed a written informed consent consistent with the requirements of the western kentucky university human subjects review board. all jumping trials were conducted on a digi - jump machine. during both exercise trials, metabolic measurements were obtained using a two - way low - resistance breathing valve and a respiratory mask, which covered the mouth and nose. expired gases were analyzed using a vacumed vista mini - cpx (vacumed, ventura, ca). a heart rate monitor was also worn during testing (polar vantage xl, port washington, ny), and hr was monitored using telemetry. carbon dioxide and oxygen analyzers were calibrated before each test, using calibration gases of known concentration. the flowmeter was calibrated using a hans rudolph (series 4900) 3.0 l calibration syringe (kansas city, mo). rating of perceived exertion (rpe) was determined at the end of each minute during each test, using borg s 15-point scale. they were instructed to report for testing after refraining from strenuous activity for a minimum of 48 hours, and from caffeine, nicotine, and alcohol for a minimum of 24 hours. during the initial visit a thorough explanation of the study was given, along with completion of initial screening procedures and instructions regarding subsequent lab sessions. percent body fat was measured based on age, gender and the sum of three skinfold sites (males : chest, abdomen, and thigh ; females : triceps, suprailiac, and thigh) using lange skinfold calipers. subjects were instructed to jump at the defined cadence until volitional exhaustion, or for a maximum of fifteen minutes. the second visit consisted only of the remaining exercise trial (120 or 100 jpms). jumping trials were performed on separate days in a counterbalanced order with a minimum of 48 hours rest between each. statistical package for the social sciences (spss) software was used to perform all analyses. all data is reported as mean (m) + standard deviation (sd). analysis of variance (anova) was used to test for differences among subjects responses from the two exercise protocols. subjects were lean (body fat 13.6 + 5.6%) and reported being recreationally active, but none were competitive athletes nor had any participated in a structured aerobic exercise or training program for a minimum of six months prior to the study. tables 2 and 3 depict subjects metabolic responses to each jump cadence (120 jpm vs. 100 jpm) used for this study. table 2 reflects peak metabolic values for each trial, while table 3 displays average values for each trial. differences in both peak and average rer (1.08.087 vs. 1.17.1 p0.001 ; 0.99.076 vs. 1.04.098 p=0.002, respectively) were observed across the trials. though rer values indicated that these protocols were both primarily anaerobic, the slower cadence (100 jpm) appeared to be a significantly more strenuous activity. differentiated rpe was collected each minute, and though total body rpe was not different for either peak or average analysis, differences were observed in peak rpe for the upper - leg (15.29 3.89 vs. 16.75 2.52 p=0.022) and in average rpe for the lower leg (15.04 2.55 vs. 13.94 2.02 p=0.019). subjects were able to exercise for a longer duration at 120 jpms compared to 100 jpms (12.4 3.42 mins vs. 9.68 4.31 mins p=.000). seventeen of the twenty - eight subjects completed the full fifteen minutes on the 120 jpm trial, while on seven of the twenty - eight completed fifteen minutes on the 100 jpm trial. there were no differences observed in vo2, hr, or total body rpe across trials. the present study examined the differences in metabolic stress between jumping at 120 jpms compared to 100 jpms on the digi - jump machine. statistics revealed that for both peak and mean values, subjects had similar vo2, hr, and total body rpe values during the two trials. however, for both peak and mean values, subjects showed a significantly different rer, with the 100 jpm trial being the more anaerobic of the two trials. the 100 jpm trial also resulted in a significantly greater upper - leg rpe when considering only peak values. lower - leg rpe was significantly higher for the 120 jpm trial when considering average values. there was also a significant difference in trial duration, as subjects were able to sustain the 120 jpm trial longer than the 100 jpm trial. considering the differences in rer and the fact that subjects were able to sustain longer the 120 jpm cadence, the similarities in vo2 and hr are intriguing. while the subjects were not tested prior to the jumping trials for maximal oxygen uptake, it can be assumed that, based on age - predicted max heart rate and the average hr observed during the trials, that subjects exercised at approximately 80% of their max. however, that might be an overestimation considering the peak and average vo2 values observed during the trials. the subjects were college - aged, recreationally active college students, and if they reached 80% of max, then that would infer that their max vo2 would only average around 50 mlkgmin, based on peak vo2 observed. previous research on rope skipping reported exercise intensities of between 8 12 metabolic equivalents (mets) [3, 5, 6, 11 ], and these digi - jump trials, where jumping was done without a rope, elicited similar levels of exertion. the significantly greater rer found with the 100 jpm trial is consistent with subjective comments provided by subjects following the trials. all subjects commented that the 100 jpm trial was more difficult and resulted in more upper - leg fatigue, due probably to the difficulty in maintaining the slower cadence. though contact time with the jumping platform was not measured, the subjects appeared to experience a protracted eccentric contraction, particularly in the quadriceps and hamstrings, due to the added deceleration required between jumps to follow the slower cadence. a rope skipping study by quirk and sinning (1979) did not measure rer, but did measure lactate, and their results revealed higher lactate values elicited from slower cadences. our results are consistent with this finding in that the lower cadence (100 jpm) had a greater anaerobic contribution as reflected through the rer measurement. subjects were able to exercise approximately 25% longer during the 120 jpm trial compared to the 100 jpm trial. however, subjects did report a significantly greater average lower - leg rpe from the faster 120 jpm cadence. subjects comments seemed to suggest that this was due to fatigue in the anterior tibialis region and primarily the result of being able to exercise for a longer duration, thus greater localized fatigue. post - trial comments were consistent in that while the faster, 120 jpm trial was preferred, it did result in more localized lower - leg fatigue and foot fatigue. a possible explanation for this observed phenomenon is both an increased duration compared with the 100 jpm trial in combination with a greater volume of jumps at the faster rate. this study examined repetitive jumping at two different cadences on the digi - jump machine. consistent with previous research on rope skipping, repetitive jumping without a rope is also a strenuous activity, regardless of jumping cadence. however, it does appear that jumping at more rapid cadences is preferred and will allow for a more protracted exercise session. future research in this area should focus on the effects of jumping on different surfaces and the role of repetitive jumping in bone and joint health. | the american college of sports medicine (acsm) recommends that healthy adults achieve a minimum of thirty minutes of moderate intensity aerobic exercise five days per week. while cycling, walking, and jogging are commonly observed methods of achieving these recommendations, another option may be repetitive jumping. the purpose of this study was to examine the metabolic responses between repetitive jumping at a cadence of 120 jumps per minute (jpms) vs. 100 jpms when utilizing the digi - jump machine. twenty - eight subjects completed two jumping trials, one at 120 jpms and one at 100 jpms. subjects jumped until volitional exhaustion, or for a maximum of fifteen minutes. oxygen uptake (vo2), heart rate (hr), respiratory exchange ratio (rer), and rating of perceived exertion (rpe) were assessed each minute of each exercise trial. rpe was differentiated, in that subjects reported perceived exertion of their total body, their upper - leg, and their lower leg. results of this study indicated that there was no significant difference between the two trials for vo2, hr, or total body rpe. differences were reported between trials for peak and average rer, with the 120 jpm trial eliciting a lower rer for both (peak : 1.08.087 vs. 1.17.1 p=.000 ; average :.99.076 vs. 1.04.098 p=.002), peak upper leg rpe (120 : 15.29 3.89 vs. 100 : 16.75 2.52 p=.022), and average lower leg rpe (120 : 15.04 2.55 vs. 100 : 13.94 2.02 p=.019). also, there was a significant difference in exercise duration between the trials, with subjects able to exercise longer during the 120 jpm trial (12.4 3.42 mins vs. 9.68 4.31 mins p=.000). these data indicate that while the physiological stress may not be different between the two trials as indicated by vo2 and hr, the 120 jpm trial appears less strenuous as evidenced by rer values and by subjects ability to exercise longer at that cadence. |
the ludwigshafen risk and cardiovascular health (luric) study is a prospective cohort study designed to evaluate determinants of cardiovascular health (1517). between july 1997 and january 2000, 3,316 caucasian subjects referred for coronary angiography were recruited at the herzzentrum (cardiac center) ludwigshafen in southwest germany. exclusion criteria were any acute illness other than acute coronary syndrome, any predominant noncardiac chronic disease, and a history of malignant neoplasm(s) within the past 5 years. written informed consent was obtained from each participant, and the study was approved by the institutional review board at the rztekammer rheinland - pfalz (medical association of rheinland - pfalz). a detailed questionnaire was used to collect a range of demographic characteristics, including lifestyle factors such as alcohol consumption, smoking, and physical activity. daily physical activity was recorded using a nonvalidated 11-point scale ranging from bedridden to extremely active. key points on the scale were 1, bed rest ; 2, mostly supine, 3, not very active, 6, usual office work ; 9, heavy work or sports ; and 11, extremely sportive. a fasting venous blood sample was obtained in the morning before coronary angiography from supine subjects. a summary of analytic methods relevant to this study has been previously reported (15). serum levels of 25(oh)d were assayed weekly using a radioimmunoassay (diasorin sa, antony, france) with intra - assay and interassay coefficients of variation of 8.6% and 9.2%, respectively (15,16). we have also validated this radioimmune assay using liquid chromatography coupled to tandem mass spectrometry, which correlated significantly (r = 0.88, p 50 nmol / l (20). metabolic syndrome in adults was defined using the consensus statement from the international diabetes federation task force on epidemiology and prevention ; the national heart, lung, and blood institute ; the american heart association ; the world heart federation ; the international atherosclerosis society ; and the international association for the study of obesity (21). specifically, it was identified in those having 3 or more of the following (1) : blood pressure 130/85 mmhg or receiving antihypertensive medication (2) ; fasting glucose 5.6 mmol / l or receiving drug treatment for diabetes (3) ; triglycerides 1.7 mmol / l or receiving specific drug treatment (4) ; hdl cholesterol 102 cm in men or > 88 cm in women (21). follow - up procedures (median 7.7 years) have been described in detail elsewhere (1517). we used death certificates to classify the deceased into those who died of cardiovascular versus noncardiovascular causes. this classification was done independently by two experienced clinicians who were blinded to the study participants, except for information that was required to classify the cause of death. in the event of disagreement or uncertainty, a classification decision was made by one of the luric study principal investigators (w.m.). subjects were stratified according to widely used cutoffs for the definition of vitamin d status based on 25(oh)d levels (18). baseline demographics of the subjects categorized by vitamin d status are described as percentages for categoric data and as, depending on their distribution, continuous data are presented as means sd or as geometric means with 95% cis. comparisons between groups were performed using the test for categoric data and anova for continuous data. kaplan - meier curves, followed by the log - rank test, were used to evaluate differences in overall and cardiovascular mortality for the 25(oh)d groups. hazard ratios (hr) with 95% cis for the mortality categories were calculated using cox proportional hazards regression models, which enabled adjustment for potential confounding parameters. in these analyses, model 1 describes the crude association ; model 2 was adjusted for age, sex, smoking, alcohol and physical activity ; and model 3 was further adjusted for bmi, waist circumference, diastolic blood pressure, type 2 diabetes, total cholesterol, cystatin c, c - reactive protein, the new york heart association (nyha) functional classification, cardiovascular medication, and month of blood sampling (seasonality). hrs for 25(oh)d categories were calculated using the severe vitamin d deficiency group as the reference. assumptions underlying the cox proportional hazards regression model were evaluated by log minus log survival and partial (schnfeld) residuals versus survival time plots, and were found valid. all statistical tests were two - sided, and statistical significance was defined as p 50 nmol / l (20). metabolic syndrome in adults was defined using the consensus statement from the international diabetes federation task force on epidemiology and prevention ; the national heart, lung, and blood institute ; the american heart association ; the world heart federation ; the international atherosclerosis society ; and the international association for the study of obesity (21). specifically, it was identified in those having 3 or more of the following (1) : blood pressure 130/85 mmhg or receiving antihypertensive medication (2) ; fasting glucose 5.6 mmol / l or receiving drug treatment for diabetes (3) ; triglycerides 1.7 mmol / l or receiving specific drug treatment (4) ; hdl cholesterol 102 cm in men or > 88 cm in women (21). follow - up procedures (median 7.7 years) have been described in detail elsewhere (1517). we used death certificates to classify the deceased into those who died of cardiovascular versus noncardiovascular causes. this classification was done independently by two experienced clinicians who were blinded to the study participants, except for information that was required to classify the cause of death. in the event of disagreement or uncertainty, a classification decision was made by one of the luric study principal investigators (w.m.). subjects were stratified according to widely used cutoffs for the definition of vitamin d status based on 25(oh)d levels (18). baseline demographics of the subjects categorized by vitamin d status are described as percentages for categoric data and as, depending on their distribution, continuous data are presented as means sd or as geometric means with 95% cis. comparisons between groups were performed using the test for categoric data and anova for continuous data. kaplan - meier curves, followed by the log - rank test, were used to evaluate differences in overall and cardiovascular mortality for the 25(oh)d groups. hazard ratios (hr) with 95% cis for the mortality categories were calculated using cox proportional hazards regression models, which enabled adjustment for potential confounding parameters. in these analyses, model 1 describes the crude association ; model 2 was adjusted for age, sex, smoking, alcohol and physical activity ; and model 3 was further adjusted for bmi, waist circumference, diastolic blood pressure, type 2 diabetes, total cholesterol, cystatin c, c - reactive protein, the new york heart association (nyha) functional classification, cardiovascular medication, and month of blood sampling (seasonality). hrs for 25(oh)d categories were calculated using the severe vitamin d deficiency group as the reference. assumptions underlying the cox proportional hazards regression model were evaluated by log minus log survival and partial (schnfeld) residuals versus survival time plots, and were found valid. all statistical tests were two - sided, and statistical significance was defined as p < 0.05. all data were analyzed using spss 18.0 software (spss inc, chicago, il). the metabolic syndrome was identified in 1,811 subjects (54.6%) referred for coronary angiography, for whom serum levels of 25(oh)d were available in 1,801 (99.4%). in the 1,801 subjects with the metabolic syndrome and complete 25(oh)d data, 92% had suboptimal (< 75 nmol / l), and 22.2% severe deficiency (< 25 nmol / l). as reported in table 1, 25(oh)d levels had an inverse relationship with fasting glucose and the prevalence of diabetes, whereas hdl cholesterol levels increased with increasing 25(oh)d levels. surprisingly, there was also a small positive association with diastolic blood pressure, but no association was observed with systolic blood pressure or prevalence of hypertension, although pulse pressure did decrease with increasing 25(oh)d levels. the decrease in the proportion of subjects at nyha functional classes iii and iv suggested lower rates of heart failure in those with increased 25(oh)d levels (table 1). a number of lifestyle factors were positively associated with 25(oh)d levels, including alcohol consumption and physical activity (table 1). baseline characteristics in those with the metabolic syndrome according to 25(oh)d concentrations across the 12,514 person - years of follow - up, 462 deaths were recorded, of which 267 (57.8%) were cardiovascular in origin (table 2). figure 1 presents the kaplan - meier plots for all - cause and cardiovascular mortality according to the four 25(oh)d groups. there was a clear dose - dependent reduction in all - cause mortality (p < 0.001 for trend ; table 2), showing a 75% reduction (hr 0.25 [95% ci 0.130.46 ]) in those with optimal 25(oh)d levels, relative to those with severe deficiency, after full adjustment. for cardiovascular disease, a comparable reduction in mortality hrs for all - cause and cardiovascular mortality in those with the metabolic syndrome according to 25(oh)d concentrations kaplan - meier plots for all - cause (left) and cardiovascular mortality (right) according to 25(oh)d groups in those with the metabolic syndrome. log - rank analysis indicated a significant difference between all 25(oh)d groups (p < 0.001). diabetes is associated with a strong reduction in 25(oh)d levels and is a major predictor of mortality. however, the removal of 965 subjects with type 2 diabetes from this analysis only modestly reduced the observed effect sizes. for example, after removal of those with type 2 diabetes, we found a 64% reduction for all - cause mortality in subjects with optimal 25(oh)d levels (hr 0.36 [95% ci 0.200.64), relative to those with severe deficiency (p < 0.001 for trend). we also performed a sensitivity analysis to rule out that 25(oh)d is a marker of end - stage disease in this population by excluding subjects who died within 2 years of follow - up, leaving 1,561 subjects. the results remained essentially unaltered : comparing optimal versus severe deficiency yielded hrs of 0.16 (95% ci 0.060.39) for all - cause mortality and 0.24 (0.090.67) for cardiovascular disease specific mortality. we further removed 268 subjects with a glomerular filtration rate of < 60 ml / min/1.73 m, which represents a loss of more than half the adult level of normal kidney function (22). likewise, we found the current study results remained essentially unchanged (data not shown). a total of 35 subjects (2.0%) reported regularly taking vitamin supplements, which usually contained b complex vitamins or vitamin d3. because mean 25(oh)d levels were only modestly higher in users of vitamin d preparations (51.4 31.2 nmol / l) compared with the remaining cohort (40.7 24.7 nmol / l ; p = 0.048), while 1,25-dihydroxyvitamin d levels, as well age and parathyroid hormone levels, did not differ significantly (data not shown), these subjects were included in the present analysis. sensitivity analyses excluding those subjects did not affect the risk estimates (data not shown). despite a limited number of subjects available for analyses of cause - specific mortality, we observed a 85% reduced sudden death in those with optimal 25(oh)d levels (hr 0.15 [95% ci 0.040.63 ]) contrasted with severe deficiency (p = 0.004 for trend, table 2). mortality due to congestive heart failure similarly showed a significant trend (p = 0.001). risk of fatal strokes was also not significantly related to 25(oh)d levels, but interpretation of this analysis is limited by the very low number of events (n = 25). because exposure to sunlight is a major potential confounder, although all analyses were adjusted for seasonality, we also performed a sensitivity analysis stratifying the study into those measured during the summer (may to october) and winter the associations were similar to those from the overall analysis, with hrs in the summer of 0.62 (95% ci 0.450.87), 0.62 (0.410.93), and 0.32 (0.150.68) for moderate deficiency, insufficient, and optimal, respectively, compared with those with severe deficiency. likewise, for the winter period, the hrs were 0.63 (0.460.87), 0.56 (0.340.91), and 0.17 (0.040.69), respectively. the observations also remained similar for all - cardiovascular disease mortality (data not shown). to the best of our knowledge, this is the first study to show that optimal levels of 25(oh)d substantially reduce the risk of all - cause and cardiovascular mortality in subjects with the metabolic syndrome, a population well - known to exhibit excess mortality (14). we observed a 75% and 69% reduction in all - cause and cardiovascular disease mortality, respectively, in those with optimal levels compared with those with severe 25(oh)d deficiency. the analyses further showed that these associations were not driven by diabetes, a factor known to be associated with reduced 25(oh)d levels. the findings presented here strengthen a limited longitudinal literature describing the association between vitamin d and mortality (1012,16) and extend our prior observations derived from the luric cohort (17). although answers regarding the causal role of vitamin d need to come from randomized controlled trials, it is promising to note that most criteria usually taken as support for causality were met : these include temporality, strength, consistency, biologic gradient, coherence, and plausibility. indeed, numerous mechanisms have been identified by which vitamin d metabolites may affect metabolic homeostasis and atherogenesis. for example, vitamin d effects include regulation of glycemic homeostasis, as observed in the current study ; whereby reduced vitamin d levels are associated with lower glucose levels and/or reduced insulin secretion and increased insulin resistance (18,2326). not all studies have identified the association with vitamin d and insulin action, including in subjects with the metabolic syndrome (27). however, vitamin d can also influence the effects of glycemia independently of these mechanisms by blunting the effect of advanced glycation end products on endothelial cells (28), which may contribute to the increased arterial stiffness and endothelial dysfunction observed in individuals deficient in vitamin d (29). vitamin d can also exert protective effects on the vessel walls by inhibition of macrophage to foam cell formation (30) and via its anti - inflammatory effects (31,32). the latter is likewise consistent with the current data, which showed an inverse association of 25(oh)d levels with c - reactive protein. vitamin d suppresses atherosclerotic disease and attenuates thrombogenesis (32,33). in the current study, however, we did not find an association with acute myocardial infarction or stroke ; the latter might have resulted from the limited number of events. vitamin d sufficiency has been associated with an downregulation of the renin - angiotensin - aldosterone system, thus potentially attenuating the development of hypertension (18), although only pulse pressure was inversely associated with 25(oh)d levels in the current study. the action of vitamin d on the renin - angiotensin - aldosterone system (18), along with its suppression of cardiac hypertrophy (34) and hypercontractility (35,36), likely contributes to the reduction in sudden cardiac death and heart failure mortality. surprisingly, 25(oh)d levels were not associated with the measures of adiposity, namely waist circumference and bmi (37). however, this may be an artifact of selecting those with the metabolic syndrome, for which central adiposity is a component and who are thus overall generally more obese. likewise, in these more ill subjects (e.g., those with heart failure), issues of wasting may also potentially be present that interfere with the association. in the overall population of 3,316 subjects, when including those with and without the metabolic syndrome, we did observe a significant inverse association between bmi and 25(oh)d levels (16). short - term studies have suggested that alcohol intake does not affect vitamin d metabolism (38) ; however, consumption at moderate levels might have assisted in the reduction in cardiovascular disease mortality (39). overall alcohol consumption per se is usually associated with an overall excess of deaths (39), so is unlikely to be a significant determinant of the apparent protective effect on mortality associated with the 25(oh)d levels, particularly given that we adjusted for alcohol consumption in the analyses. we assessed 25(oh)d only at one time point, and this may not reflect long - term vitamin d status. however, despite significant seasonal variation, 25(oh)d levels are reported to track over time in a comparable manner similar to other established risk factors such as blood pressure and lipids (40). however, we adjusted the analyses for seasonality by incorporating the timing of the sampling, which should partly address this issue. we also performed sensitivity analyses stratified by season, for which the results consistently showed a clear protective effect for all - cause and all - cardiovascular mortality. significantly, momentary 25(oh)d was found to be a powerful long - term predictor : the kaplan - meier plots showed a consistent linear relationship with mortality, continuing for more than 8 years after a single assessment of 25(oh)d. inclusion of only caucasian subjects limits the generalizability of the study but does help to minimize potential confounding resulting from the use of an ethnically diverse population ; for example, skin pigmentation and cultural aspects, such as style of dress, could differentially influence the magnitude of photosynthesis at different times of the year (8). likewise, because these subjects with the metabolic syndrome had undergone elective angiography due to cardiovascular symptoms or events, they are thus not representative of the general population with the metabolic syndrome and are likely to display an elevated mortality risk. although, we performed multivariable adjustments, we can not rule out that unmeasured or unknown confounders could have influenced our results. a possible alternative explanation of our results is that those with the highest risk for mortality had limited sunlight exposure due to existing health - related issues, thereby confounding the association between increased risk and reduced vitamin d levels. related, those with greater physical activity levels would likely be healthier, and if the activities were performed outdoors, would also have increased ultraviolet b exposure. moreover, increased physical activity may also be associated with other beneficial lifestyle practices that reduce morbidity and mortality. we addressed these potential confounding issues in several ways : we adjusted our cox regression analyses for parameters that are related to outdoor activities and sun light exposure, including nyha functional class, physical activity, cardiovascular medication, renal function, and month of blood sampling. sensitivity analyses that excluded those who died within the first 2 years of follow - up only minimally attenuated the observed effects. considering the magnitude of the observed benefit of higher 25(oh)d levels and the very modest effect - size attenuation seen after comprehensive statistical and sample adjustments, it seems fair to conclude that residual confounding is a unlikely hypothesis. in summary, 25(oh)d levels were dose - dependently associated with a robust reduction in all - cause and cardiovascular mortality in subjects with the metabolic syndrome. we hope these findings will spur interventional randomized, controlled trials to confirm the effects of vitamin d on mortality and, if positive, help establish recommendations for supplementation in these subjects. | objectiveoptimal vitamin d levels are associated with reduced cardiovascular and all - cause mortality. we investigated whether optimal 25-hydroxyvitamin d (25[oh]d) is protective in individuals with the metabolic syndrome.research design and methodsthe ludwigshafen risk and cardiovascular health (luric) study is a cohort study of subjects referred for coronary angiography between 1997 and 2000, from which 1,801 with the metabolic syndrome were investigated. mortality was tracked for a median of 7.7 years. multivariable survival analysis was used to estimate the association between 25(oh)d levels and mortality.resultsmost subjects (92%) had suboptimal levels of 25(oh)d (< 75 nmol / l), with 22.2% being severely deficient (< 25 nmol / l). during follow - up, 462 deaths were recorded, 267 (57.8%) of which were cardiovascular in origin. after full adjustment, including the metabolic syndrome components, those with optimal 25(oh)d levels showed a substantial reduction in all - cause (hazard ratio [hr ] 0.25 [95% ci 0.130.46 ]) and cardiovascular disease mortality (0.33 [0.160.66 ]) compared with those with severe vitamin d deficiency. for specific cardiovascular disease mortality, there was a strong reduction for sudden death (0.15 [0.040.63 ]) and congestive heart failure (0.24 [0.061.04 ]), but not for myocardial infarction. the reduction in mortality was dose - dependent for each of these causes.conclusionsoptimal 25(oh)d levels substantially lowered all - cause and cardiovascular disease mortality in subjects with the metabolic syndrome. these observations call for interventional studies that test whether vitamin d supplementation provides a useful adjunct in reducing mortality in these subjects. |
the use of autogenous bone grafts with osseointegrated implants was originally discussed by breine and branemark in 1980. since then, numerous papers have been published that have presented a variety of procedures involving different types of implants, bone grafts, and other graft materials for oral and craniofacial reconstructions,. the ideal materials to use as biocompatible bone grafts ideally must be absorbed after the formation of new bone, must provide structure for bone regeneration, and physiologically allow mechanical stability, as well as having osteogenic, osteoconductive and osteoinductive properties. the best grafting material isautogenous bone, since it is the only material to adhere to all of the abovementioned biological properties and is unlikely to be rejected by the body. studies have shown that there are many advantages to using the tunnel technique for bone grafting. the fact that the periosteum is kept intact, when using the tunnel technique, is a crucial element for the survival and viability of the graft block. furthermore, there is no need to use a membrane, since the periosteum is intact. this procedure presents minimal complications. with the technical and scientific developments in implant surgery, the search for surgical procedures with lower morbidity, and an ability to create satisfactory conditions for implant placement is necessary. the aim of our work is to describe the appositional (i.e., onlay) bone graft technique using a the tunnel technique, with the implant system bionnovation, providing stability to the graft, without the need for fixing screws, through a description of technical notes through case reports. their average age was 35 years, 4 males (50%) and 4 women (50%), with 6 cases in the anterior maxillary region (75%) and 2 case in the anterior mandibular region (25%). inclusion criteria of the cases : the patients involved must have presented alveolar ridge resorption in thickness (deficiency of the bucco - lingual width or diameter) (figs. 1 a and 6 a) in the mandible or maxilla anterior region and aesthetic and functional concerns. the tunnel technique is used to place an appositional bone graft in the anterior mandible and maxilla with bone defects corresponding to a dental unit, using the mandibular branch as the donor area. first, locally infiltrative anesthesia should be applied to the graft recipient bed, an incision is made to expose the bone defect. the incision is made with a scalpel blade n 15 in the alveolar crest of the edentulous area, slightly toward the palatal and in the middle of the mandible. the incision should extend to the mesial and distal tooth intrasulcularly. by carefully using a molt periosteal elevator, a total subperiosteal detachment is carried out to promote tunnelization to the edge of the bone defect (fig., the receiving area is prepared, and the exposed buccal bone plate is completely cleaned of small adhesions of fibrous tissue resulting from the bone defect. at this time, small holes are carried out in the cortical wall, with a round bur (), with the aim of obtaining maximum vascularization between the receiver bed and the graft. the third step is to expose the donor area (i.e., mandibular arch) : the inferior alveolar, lingual, and buccal branches next to the infiltration are anesthetized in order to stop any bleeding. the subperiosteal detachment must be done carefully, exposing part of the mandibular arch and body. using a # 701 or # 702 frusto - conical bur in a dental handpiece, piercing markings that are linked to the bur also the lateral osteotomies are carried out initially. in an apical osteotomy, along with the vertical osteotomy, are performed with the aid of a round bur (number) for the dental handpiece. the graft is extracted with the aid of a straight chisel, removed with forceps, and kept in a saline solution. its edges are regularized, watered thoroughly with saline solution, and then the suture is carried out. then the removed bone graft is prepared and adapted to the anatomy of the recipient bed with the aid of a delicate rongeur or even a milling bur, at low speed and under deep irrigation with saline. then, the receiving area must be sutured to assure full coverage of the graft and an absolutely airtight suture of the region is essential. the sutures are completed with nonabsorbable materials, such as mononylon 4 - 0, and they are removed after a minimal period of 14 days. whenever possible, a provisional fixed prosthesis should be used for aesthetic issues. however, this should be far from the buccal face, thus, avoiding pressure on the operated area and allowing access to the incision line. after this, a second surgery time for the placement of the implant should be scheduled. it is performed after a period of 68 months and it consists of an incision identical to the incision made when the bone graft was completed. the bone graft is clinically assessed, and the implant is placed following the original protocol described by branemark (fig., we clinically observed the osseointegrated bone graft in the recipient bed, the installed implant (fig. 4), and its final positioning (fig. 5). all reported cases underwent cone beam computed tomography before and after the surgical procedure to observe osseointegration bone graft to the recipient bed, gain in bone thickness (figs. 1 b, 6 a and b) and the final positioning of the well adapted implant to the bone graft (fig. we had no implant loss with the tunnel technique in the onlay bone graft (fig. the tunnel technique is used to place an appositional bone graft in the anterior mandible and maxilla with bone defects corresponding to a dental unit, using the mandibular branch as the donor area. first, locally infiltrative anesthesia should be applied to the graft recipient bed, an incision is made to expose the bone defect. the incision is made with a scalpel blade n 15 in the alveolar crest of the edentulous area, slightly toward the palatal and in the middle of the mandible. the incision should extend to the mesial and distal tooth intrasulcularly. by carefully using a molt periosteal elevator, a total subperiosteal detachment is carried out to promote tunnelization to the edge of the bone defect (fig. 2). then, the receiving area is prepared, and the exposed buccal bone plate is completely cleaned of small adhesions of fibrous tissue resulting from the bone defect. at this time, small holes are carried out in the cortical wall, with a round bur (), with the aim of obtaining maximum vascularization between the receiver bed and the graft. the third step is to expose the donor area (i.e., mandibular arch) : the inferior alveolar, lingual, and buccal branches next to the infiltration are anesthetized in order to stop any bleeding. the subperiosteal detachment must be done carefully, exposing part of the mandibular arch and body. using a # 701 or # 702 frusto - conical bur in a dental handpiece, piercing markings that are linked to the bur also the lateral osteotomies are carried out initially. in an apical osteotomy, along with the vertical osteotomy, are performed with the aid of a round bur (number) for the dental handpiece. the graft is extracted with the aid of a straight chisel, removed with forceps, and kept in a saline solution. its edges are regularized, watered thoroughly with saline solution, and then the suture is carried out. then the removed bone graft is prepared and adapted to the anatomy of the recipient bed with the aid of a delicate rongeur or even a milling bur, at low speed and under deep irrigation with saline. then, the receiving area must be sutured to assure full coverage of the graft and an absolutely airtight suture of the region is essential. the sutures are completed with nonabsorbable materials, such as mononylon 4 - 0, and they are removed after a minimal period of 14 days. whenever possible, a provisional fixed prosthesis should be used for aesthetic issues. however, this should be far from the buccal face, thus, avoiding pressure on the operated area and allowing access to the incision line. after this, a second surgery time for the placement of the implant should be scheduled. it is performed after a period of 68 months and it consists of an incision identical to the incision made when the bone graft was completed. the bone graft is clinically assessed, and the implant is placed following the original protocol described by branemark (fig., we clinically observed the osseointegrated bone graft in the recipient bed, the installed implant (fig. 4), and its final positioning (fig. 5). all reported cases underwent cone beam computed tomography before and after the surgical procedure to observe osseointegration bone graft to the recipient bed, gain in bone thickness (figs. 1 b, 6 a and b) and the final positioning of the well adapted implant to the bone graft (fig. we had no implant loss with the tunnel technique in the onlay bone graft (fig. the modeling of the graft by the surgeon is an important step, and it demands considerable surgery time. we consider this principle of modeling of the graft one of the major requirements for the success of the tunnel technique for grafts, since a good adjustment of the graft into the recipient bed promotes greater stability to the graft. currently, most of the appositional (i.e., onlay) bone grafts are stabilized to the receptor through rigid fixation with titanium screws. however, the use of this type of screw requires its removal in a second surgical procedure before the placement of dental implants. this need makes the surgical procedure more morbid by causing a more painful experience for the patient during the removal of the fixing screws. another drawback associated with the removal of the screws is that it takes a long relaxing incision to access them, often in a high - demand aesthetic region. during accession to remove the titanium fixing screws, we believe that preservation of the periosteum on the bone graft provided by the surgical technique described in this work is one of the factors contributing to the successful integration of the graft to the receptor bed. despite the fact that fixing screws are generally made of a poorer titanium alloy, it is possible that these screws osseointegrate to the graft, which can hinder their removal and even cause damages that compromise the bone graft. the substitution of screws to stabilize the bone graft using the tunnel technique allowed the surgery to be performed in a shorter time. in addition to the disadvantages in common with the use of non - resorbable screws, the use of resorbable materials brings different drawbacks, such as greater tissue reaction to the material, increased risk of fracture of the screws during fixation, and the presence of polymer (i.e., waste) after 9 months, which may interfere with the sequence of implant treatment. the suture of the incision edges, especially in the receiving area, should have no tension in order to avoid dehiscence, which is a frequent complication of graft surgeries. we believe that in the tunnel technique, the incisions in the periosteum must be conservative and only completed when extremely necessary to close with tension, as the stability of the graft in this technique is due to the support promoted by the periosteum and suture tension. autogenous bone is considered to be the best grafting material, since it is the only material to show all the previously mentioned biological properties, in addition to the absence of rejection,. currently, autogenous bone is the gold standard for the reconstruction of alveolar ridge atrophy. the biggest advantage of an intraoral donor area is the proximity of the donor site and the receptor site, which can reduce surgery time and the amount of anesthesia needed, making ideal for outpatient implant surgery. the tunnel technique for onlay bone grafting is a simple and easy to perform technique, which is completed in less surgical time and at lower cost and has presented highly predictable results and high success rates. nonetheless, more studies are necessary to consolidate and disseminate the technique more thoroughly in - academic and professional environments. the study was fully approved by the ethic committee of the federal university of bahia. written informed consent was obtained from the patient for publication of this case report and accompanying images. all authors contributed to either the writing, reviewing, submission and surgical procedure of this case reports. | highlightsthe tunnel technique for onlay bone grafting is a simple and easy to perform technique.we had no implant loss with the tunnel technique in the onlay bone graft.the fact that the periosteum is kept intact, is a crucial element for the survival and viability of the graft block. |
congenital hypothyroidism (ch) is a condition of insufficient production of a thyroid hormone, which is due to thyroid dysgenesis or thyroid dyshormonogenesis. it results in irreversible damage of the central nervous system (porterfield, 1994), presenting serious mental and motor retardation (simic., 2009). neonatal ch screening and early replacement therapy of thyroxine has been highly effective in preventing retardation (maitusong., 2012). by raising the intelligent quotient (iq) to within normal range in subjects with ch, the individuals gain a higher quality of life and better cognitive functions. however, accumulating evidence suggests that, even though their performance is definitely improved by earlier initiation of thyroxine supplementation, children with ch still have some subtle cognitive and motor deficits (fuggle., 1991 ; bargagna., 2000 ; rovet and ehrlich, 2000), such as attention deficit and inhibitory control problems. rovet (1999) reported that adolescents with ch had poorer attention compared with matched controls. other studies found similar results in children, adolescents, and young adults (kooistra. alvarez and colleagues (2010) also showed that inhibitory control was significantly lower in children with ch than in controls. all the results indicate that subjects with ch have a higher possibility of attention deficit hyperactivity disorder (adhd) symptoms. adhd is characterized by age - inappropriate inattention, hyperactivity - impulsivity, or both, which play an important role in the impairment of academic and social function for school - aged children. however, the multiplicity of the both conditions make the treatment challenging. to the best of our knowledge, there is no clinical trial to explore the treatment of children with both adhd and ch. atomoxetine is a selective norepinephrine reuptake inhibitor approved for the treatment of adhd. in the present pilot study, our aim was to evaluate the efficacy and tolerability of atomoxetine on adhd symptoms and cognitive functions in children with ch. in this pilot study, we evaluate the effects of 6-month atomoxetine treatment on adhd symptoms and cognitive functions in children with ch. the participants were recruited from an outpatient clinic. those children with ch who were suspected of having adhd symptoms were administered structured interviews in order to assess adhd symptomatology. children included in this study met adhd criteria according to the diagnostic and statistical manual of mental disorders, fourth edition, under the following three subtypes : adhd inattentive type, adhd hyperactive - impulsive type, and adhd combined type. all the patients were evaluated with the swanson, nolan and pelham teacher and parent rating scale, version iv (snap - iv) and clinical global impression - severity scale (cgi - s), both scales of adhd symptoms, at baseline and at 6 weeks, 12 weeks, and/or 6 months after starting atomoxetine treatment. tests of cognitive functions, including the wechsler intelligence scale for chinese children (wisc - r),, digit span, wisconsin card sorting test (wcst), and stroop color - word test, were evaluated at baseline and endpoint. thirteen gender- and age - matched children (11 boys and 2 girls) without adhd from a primary school voluntarily took part into the study as normal controls. exclusion criteria for the study were : (a) iq under 70 ; (b) a psychiatric diagnosis with significant symptoms (psychosis, autism, depression, anxiety, mood disorder) or taking psychoactive medications ; (c) a history of significant traumatic brain injury ; (d) sensorimotor handicaps (paralysis, deafness, blindness) ; or (e) serious somatic disorders, such as cardiovascular diseases, serious gastrointestinal stenosis, dysphagia, etc. the study procedures were explained to children and parents, and consents were obtained from the children and their families. the study protocol was approved by the institutional review board of the children s hospital, zhejiang university school of medicine. the children were assessed by a trained multidisciplinary adhd diagnostic team with a comprehensive assessment process, including physical examination, electroencephalogram and electrocardiograph (ecg). adhd symptoms were assessed with the snap - iv (18 item) and cgi - s (wu, 1984). the cgi - s is a 7-point scale (1 = not at all ill, 7 = maximal impairment). we employed the wisc - r, digit span, wcst, and stroop color - word test to evaluate the cognitive functions. the wisc - r is one of the most - used standardized tests of iq. the test consists of 12 subtests, and three iq scores can be yielded : full scale (fiq), verbal (viq), and performance (piq). the chinese version of the wisc - r has good reliability and validity (lin and zhang, 1986 ; zhang., 2011), which was employed to assess the cognitive abilities in the present study. the digit span is used to evaluate verbal working memory, immediate recall, and the ability to hold, retain, and manipulate new verbal information (groth - marnat and baker, 2003), which is a subtest of wisc - r (lin and zhang, 1986). participants are read a string of numbers and asked to repeat them in the same order and backward. the wcst (tsuchiya., 2005) measures the ability to form abstract concepts, to sustain attention, and to shift cognitive set flexibility in response to changing conceptual rules while inhibiting inappropriate responses. it is one of the most common tests for executive function in the school - aged population (ozonoff, 1995 ; schmitz., 2002). children were requested to match those cards with additional cards under changing rules (including matching the shapes, different colors, quantity, and designs). the number of right and wrong matches and the time children took to learn new rules, as well as the mistakes, were measured. the stroop color - word test (stroop, 1935 ; ji and jiao, 1987 ; golden and golden, 2002) has been widely used to assess the executive functions of cognitive inhibition and selective attention. it includes four tasks : word reading, color reading, word reading of colored words, and color naming of colored words (hong., 2010). the completion times and the number of errors made during each task / test were recorded. the patients received atomoxetine (strattera, eli lilly and company) at 0.5mg / kg / day for the first week, and then doses increased to 1.2mg / kg / day. atomoxetine was given orally once daily as 10, 25, and 40 mg capsules, with the doses adjusted to achieve the body - weight target dose. clinical safety was indicated by means of the child s and parents reports of adverse events, the ecg, and laboratory tests of thyroid and liver functions. data were entered into excel software and analyzed in the spss (version 13.0) software package. analyses were conducted using one - way analyses of variance (anovas) with repeated measures to compare mean scores at baseline to scores at different time of post treatment. the t - test was used to compare the cognitive functions between the time of baseline and that of the endpoint (month 6). a p - value of less than 0.05 was regarded as statistically significant for all statistical tests. in this pilot study, we evaluate the effects of 6-month atomoxetine treatment on adhd symptoms and cognitive functions in children with ch. the participants were recruited from an outpatient clinic. those children with ch who were suspected of having adhd symptoms were administered structured interviews in order to assess adhd symptomatology. children included in this study met adhd criteria according to the diagnostic and statistical manual of mental disorders, fourth edition, under the following three subtypes : adhd inattentive type, adhd hyperactive - impulsive type, and adhd combined type. all the patients were evaluated with the swanson, nolan and pelham teacher and parent rating scale, version iv (snap - iv) and clinical global impression - severity scale (cgi - s), both scales of adhd symptoms, at baseline and at 6 weeks, 12 weeks, and/or 6 months after starting atomoxetine treatment. tests of cognitive functions, including the wechsler intelligence scale for chinese children (wisc - r),, digit span, wisconsin card sorting test (wcst), and stroop color - word test, were evaluated at baseline and endpoint. thirteen gender- and age - matched children (11 boys and 2 girls) without adhd from a primary school voluntarily took part into the study as normal controls. exclusion criteria for the study were : (a) iq under 70 ; (b) a psychiatric diagnosis with significant symptoms (psychosis, autism, depression, anxiety, mood disorder) or taking psychoactive medications ; (c) a history of significant traumatic brain injury ; (d) sensorimotor handicaps (paralysis, deafness, blindness) ; or (e) serious somatic disorders, such as cardiovascular diseases, serious gastrointestinal stenosis, dysphagia, etc. the study procedures were explained to children and parents, and consents were obtained from the children and their families. the study protocol was approved by the institutional review board of the children s hospital, zhejiang university school of medicine. the children were assessed by a trained multidisciplinary adhd diagnostic team with a comprehensive assessment process, including physical examination, electroencephalogram and electrocardiograph (ecg). adhd symptoms were assessed with the snap - iv (18 item) and cgi - s (wu, 1984). the cgi - s is a 7-point scale (1 = not at all ill, 7 = maximal impairment). we employed the wisc - r, digit span, wcst, and stroop color - word test to evaluate the cognitive functions. the wisc - r is one of the most - used standardized tests of iq. the test consists of 12 subtests, and three iq scores can be yielded : full scale (fiq), verbal (viq), and performance (piq). the chinese version of the wisc - r has good reliability and validity (lin and zhang, 1986 ; zhang., 2011), which was employed to assess the cognitive abilities in the present study. the digit span is used to evaluate verbal working memory, immediate recall, and the ability to hold, retain, and manipulate new verbal information (groth - marnat and baker, 2003), which is a subtest of wisc - r (lin and zhang, 1986). participants are read a string of numbers and asked to repeat them in the same order and backward. the wcst (tsuchiya., 2005) measures the ability to form abstract concepts, to sustain attention, and to shift cognitive set flexibility in response to changing conceptual rules while inhibiting inappropriate responses. it is one of the most common tests for executive function in the school - aged population (ozonoff, 1995 ; schmitz., children were requested to match those cards with additional cards under changing rules (including matching the shapes, different colors, quantity, and designs). the number of right and wrong matches and the time children took to learn new rules, as well as the mistakes, were measured. the stroop color - word test (stroop, 1935 ; ji and jiao, 1987 ; golden and golden, 2002) has been widely used to assess the executive functions of cognitive inhibition and selective attention. it includes four tasks : word reading, color reading, word reading of colored words, and color naming of colored words (hong., 2010). the completion times and the number of errors made during each task / test were recorded. the patients received atomoxetine (strattera, eli lilly and company) at 0.5mg / kg / day for the first week, and then doses increased to 1.2mg / kg / day. atomoxetine was given orally once daily as 10, 25, and 40 mg capsules, with the doses adjusted to achieve the body - weight target dose. clinical safety was indicated by means of the child s and parents reports of adverse events, the ecg, and laboratory tests of thyroid and liver functions. data were entered into excel software and analyzed in the spss (version 13.0) software package. analyses were conducted using one - way analyses of variance (anovas) with repeated measures to compare mean scores at baseline to scores at different time of post treatment. the t - test was used to compare the cognitive functions between the time of baseline and that of the endpoint (month 6). we used last observation carried forward in our analyses of missing data. a p - value of less than 0.05 was regarded as statistically significant for all statistical tests. of the 26 children initially assessed, 12 did not meet adhd criteria and 2 children and their parents refused to participate the study. of them, 10 were males (83.3%) and 2 were females (16.7%). the mean age was 8.7 years old, with a standard deviation of 2.1 (6.511 years). among these children, 11 of them were diagnosed with ch by neonatal screening before they were 1 month old, and one was diagnosed with ch when he had developmental delay symptoms at 18 months of age. all were administered with levothyroxine (euthyrox, merck kgaa) replacement, presently with a dosage of 6.92.7 g / kg / day. ultrasound scanning suggested dysgenesis of thyroid tissue (six cases), ectopic thyroid tissue (two cases), and normal locations with generally normal sizes of thyroid glands (four cases). this group of samples consisted of two children with an inattentive subtype, four children with a hyperactive - impulsive subtype, and six children with the combined subtype. thirteen children of normal controls were recruited from a local school with similar demographic characteristics to the ch group. all of them were in primary school with a mean age of 8.3 years (standard deviation [sd ] = 1.6). there were no statistical differences found for mean age and gender proportion between these two groups (t = 0.348, p = 0.731 for mean age, and x = 0.008, p = 0.93 for gender proportion). all the patients reached the target dose range with an average of 1.1mg / kg / day (0.81.3) of atomoxetine in 24 weeks. thyroid functions and liver function were detected along with the evaluation of snap - iv, and were all in normal ranges (table 1). scores of adhd symptoms and thyroid functions at baseline and different time points of post - treatment cgi - s, clinical global impression - severity scale ; snap - iv, swanson, nolan and pelham (snap) questionnaire. three patients reported adverse events (25%) with the administration of atomoxetine, including a decrease in appetite (n = 2) and abdominal pain (n = 1). the blood tests of thyroid functions and liver function were in normal range after atomoxetine treatment. the mean baseline score of the parents version of snap - iv was 33.8 (sd = 4.9). post - treatment scores at week 6, week 12, and month 6 reduced to 27.3 (sd = 4.7), 22.4 (sd = 4.3), and 17.5 (sd = 3.7), respectively (table 1). the mean baseline score of the teacher version of snap - iv was 34.3 (sd = 5.5). post - treatment scores at week 6, week 12, and month 6 reduced to 27.8 (sd = 4.9), 21.0 (sd = 3.1), and 17.2 (sd = 3.1), respectively (table 1). significant decreases of snap - iv scores were observed for both parent and teacher versions over baseline to month 6. repeated measures anovas revealed these statistical differences : f = 131.5, p < 0.01 for parent ratings, and f = 98.7, p < 0.01 for teacher ratings. changes of cognitive functions after 6 months of atomoxetine treatment, children with ch and adhd showed significant improvement in fiq (p = 0.002) and piq (p = 0.011), and a non - significant improvement trend in viq (from 97.5 to 99.5 ; p = 0.239). on the other hand, there were no significant changes found for wisc - r over 6 months in normal controls (table 2). cognitive functions between atx treatment group and controls at baseline and month 6 atx, atomoxetine ; piq, performance intelligent quotient ; viq, verbal intelligent quotient ; wcst, wisconsin card sorting test ; wisc - r, wechsler intelligence scale for chinese children - revised p < 0.05 versus atx treated group at the baseline ; p < 0.05 versus atx treated group at month 6 (using t - test) for the digit span, t - tests revealed that children treated with atomoxetine performed better at month 6 than at baseline. improvement in a subtest of a backward task was found, but was not significant (p = 0.067). compared with baseline, the improvement of wcst for children treated with atomoxetine at month 6 was significant in 12 of the 13 items. a decreasing trend for the parameter of failure to maintain set was found, but was not significant (p = 0.305). significant decreases in the completion time in word reading, color reading, word reading in the incongruent condition, and color reading in the incongruent condition were observed in the ch group at month 6 compared with baseline. furthermore, atomoxetine seemed to improve the cognitive functions of children with the inattentive subtype more than those with the other two subtypes according to the wisc - r and stroop tests. for the other tests, the results did not show any predominant trends in the three groups of subtypes. but because of the small sample size (n = 2, 4, and 6) of the subtypes, it was difficult to do further statistical analyses, and we were unable to draw any definite conclusions. in addition, the medication also benefited the cognitive functions of girls more than those of boys for the wisc - r and stroop tests. similarly, because of the small sample size of girls (n = 2), further statistical analyses were not done. all the patients reached the target dose range with an average of 1.1mg / kg / day (0.81.3) of atomoxetine in 24 weeks. thyroid functions and liver function were detected along with the evaluation of snap - iv, and were all in normal ranges (table 1). scores of adhd symptoms and thyroid functions at baseline and different time points of post - treatment cgi - s, clinical global impression - severity scale ; snap - iv, swanson, nolan and pelham (snap) questionnaire. three patients reported adverse events (25%) with the administration of atomoxetine, including a decrease in appetite (n = 2) and abdominal pain (n = 1). the blood tests of thyroid functions and liver function were in normal range after atomoxetine treatment. the mean baseline score of the parents version of snap - iv was 33.8 (sd = 4.9). post - treatment scores at week 6, week 12, and month 6 reduced to 27.3 (sd = 4.7), 22.4 (sd = 4.3), and 17.5 (sd = 3.7), respectively (table 1). the mean baseline score of the teacher version of snap - iv was 34.3 (sd = 5.5). post - treatment scores at week 6, week 12, and month 6 reduced to 27.8 (sd = 4.9), 21.0 (sd = 3.1), and 17.2 (sd = 3.1), respectively (table 1). significant decreases of snap - iv scores were observed for both parent and teacher versions over baseline to month 6. repeated measures anovas revealed these statistical differences : f = 131.5, p < 0.01 for parent ratings, and f = 98.7, p < 0.01 for teacher ratings. changes of cognitive functions after 6 months of atomoxetine treatment, children with ch and adhd showed significant improvement in fiq (p = 0.002) and piq (p = 0.011), and a non - significant improvement trend in viq (from 97.5 to 99.5 ; p = 0.239). on the other hand, there were no significant changes found for wisc - r over 6 months in normal controls (table 2). cognitive functions between atx treatment group and controls at baseline and month 6 atx, atomoxetine ; piq, performance intelligent quotient ; viq, verbal intelligent quotient ; wcst, wisconsin card sorting test ; wisc - r, wechsler intelligence scale for chinese children - revised p < 0.05 versus atx treated group at the baseline ; p < 0.05 versus atx treated group at month 6 (using t - test) for the digit span, t - tests revealed that children treated with atomoxetine performed better at month 6 than at baseline. improvement in a subtest of a backward task was found, but was not significant (p = 0.067). compared with baseline, the improvement of wcst for children treated with atomoxetine at month 6 was significant in 12 of the 13 items. a decreasing trend for the parameter of failure to maintain set was found, but was not significant (p = 0.305). significant decreases in the completion time in word reading, color reading, word reading in the incongruent condition, and color reading in the incongruent condition were observed in the ch group at month 6 compared with baseline. furthermore, atomoxetine seemed to improve the cognitive functions of children with the inattentive subtype more than those with the other two subtypes according to the wisc - r and stroop tests. for the other tests, the results did not show any predominant trends in the three groups of subtypes. but because of the small sample size (n = 2, 4, and 6) of the subtypes, it was difficult to do further statistical analyses, and we were unable to draw any definite conclusions. in addition, the medication also benefited the cognitive functions of girls more than those of boys for the wisc - r and stroop tests. similarly, because of the small sample size of girls (n = 2), further statistical analyses were not done. thyroxine deficiency results in damage to brain development, which may contribute to poor attention and self - inhibition. the extent of the damage may depend on the severity and duration of the hypothyroidism (klein., 1972). it is not clear that the occurrence of adhd in these patients has either a coincidental or causative relationship to ch. definitely, there are more severe impairments of academic and social functions and quality of life in those with both conditions of ch and adhd. taking these impairments into consideration, children with both ch and adhd should be treated promptly and properly. however, when ch is combined with adhd the treatment is more challenging. safety should be the first consideration, ensuring that the treatment does not affect thyroid functions and has good tolerability. atomoxetine is a new compound that has been used in treatment for adhd on the basis of its pharmacologic property of blocking the presynaptic norepinephrine transporter. the efficacy and safety of atomoxetine have been indicated in multiple double - blind, placebo - controlled studies. to our knowledge, this is the first trial concerning the efficacy and tolerability of the medication on the cognitive functions in children with ch, diagnosed and treated early, and with adhd symptoms. the snap - iv and cgi - s scores decreased greatly, which meant the adhd core symptoms were improved. we also found that this medication was effective on cognitive functions during the 6-month follow - up. the results of cognitive functions, evaluated with the digit span, wcst, and stroop test, which were impaired before treatment, were also showing improvements after atomoxetine administration. these results were consistent with the treatment outcomes of atomoxetine on children with only adhd symptoms (vaughan., 2009). we explored but found no significant improvement of cognitive functions and score changes of adhd symptoms. this was inconsistent with a previous report (zhang., 2011). in addition, we found that atomoxetine seemed to improve the cognitive functions of children with the inattentive subtype based on the wisc - r and stroop tests. similar results revealed that the medication benefited the cognitive functions of girls more than boys for the wisc - r and stroop tests. in clinical trials of atomoxetine treatment for children with adhd, there were no findings showing these trends, but the small sample size in the present study did not allow us to do further statistical analyses and we could not draw definite conclusions. clinical safety was indicated by means of the child s and parents reports of adverse events, ecgs, and laboratory tests of thyroid functions, which we did before treatment and at week 6, week 12, and month 6 (table 1). three children reported mild adverse events, but none discontinued treatment because of side effects. interestingly, atomoxetine was also effective on one boy in the treatment group who was diagnosed with ch at 18 months. as is well known, thyroxine is crucial for the development of brain, even in utero. the 18-month age was too late for levothyroxine replacement and the damage had already occurred. fortunately, atomoxetine was effective for improvement of cognitive functions, including iq (from 78 to 85). in other words, atomoxetine benefited a child who was developmentally delayed, which was consistent with a previous study (fernandez - jaen. this was a pilot trial to explore the treatment strategy for children with both diseases. but it was a pilot study, and further larger sample - sized trials should be designed to replicate the results. the scale scores rated by observers would be distorted to some extent in the open - labeled pattern. moreover, we did not include a control group of children who were affected with ch but without adhd. if there had been this group, the improvement of the atomoxetine - treated group could be examined for the effect of medication and we could exclude the effect of levothyroxine on cognition. thirdly, the follow - up of 6 months might be relatively short, and longer treatment times would provide more data. but it was a pilot study, and further larger sample - sized trials should be designed to replicate the results. the scale scores rated by observers would be distorted to some extent in the open - labeled pattern. moreover, we did not include a control group of children who were affected with ch but without adhd. if there had been this group, the improvement of the atomoxetine - treated group could be examined for the effect of medication and we could exclude the effect of levothyroxine on cognition. thirdly, the follow - up of 6 months might be relatively short, and longer treatment times would provide more data. those children with ch still have poor attention and self - inhibitory (adhd symptoms) even with early levothyroxine replacement. atomoxetine was effective and safe in cases with ch and adhd, and produced remarkable improvement on adhd symptoms as well as cognitive functions within 6 months of follow - up. long - term, randomized, placebo - controlled clinical trials with larger sample sizes are required. | background : with early initiation of thyroxine supplementation, children with congenital hypothyroidism (ch) retain some subtle deficits, such as attention and inhibitory control problems. this study assessed the effects of atomoxetine on cognitive functions in treatment of attention deficit hyperactivity disorder (adhd) symptoms in children with ch.methods:in a 6-month, open - labeled pilot study, 12 children were recruited and received atomoxetine. the measures of efficacy were scores on the swanson, nolan and pelham teacher and parent rating scale, version iv (snap - iv) and clinical global impression - severity scale (cgi - s). the cognitive functions were evaluated with the wechsler intelligence scale for chinese children, digit span, wisconsin card sorting test, and stroop test.results:a statistically significant difference was found between the mean cgi - s and snap - iv scores before and after treatment (p < 0.01). all the indicators of cognitive functions at the endpoint were improved compared with those at baseline. no serious adverse events were reported.conclusion:atomoxetine appears to be useful in improving adhd symptoms, as well as cognitive functions, in children with ch. larger, randomized, double - blinded, clinical trials are required to replicate these results. |
because the functional and morphological diversities of an organism represent the value of the organism itself, the traditional biological techniques used to characterize these properties provide indispensable information. conventional biology techniques face difficulties, however, such as classifying characterless organisms like microbes and analyzing communities composed of huge numbers of various organisms, owing to both the instability of phenotypes, which are easily affected by environmental factors, and an insufficient number of experts. a potential solution to these problems has been to characterize an organism according to the sequence of the small subunit ribosomal rna (16s/18s rrna), an approach that has been applied to various organisms [57 ]. similarly, cytochrome oxygenase subunit 1 (cod1), gyrase, and other genes have been used for this purpose. the superiority of these approaches is that they are based on popular and well - established sequencing technology and can provide the determinate result of nucleotide sequence, which can be further computer - analyzed and can fuel the activity of bioinformatics. nevertheless, this approach can not be said to be a readily usable method for classifying species because (i) it is rather costly and time - consuming for application to a large number of species (e.g., > 100), especially for scientists in general all over the world, and (ii) it often results in an insufficient amount of information for identifying and classifying species. the latter problem can be overcome by sequencing additional genes [810 ] ; however, this makes the approach more complicated and less accessible. here, we present a solution for the universal classification of species together with a demonstration of its effectiveness, which has been tested by applying it to taxonomically well - established organisms such as plants, fish, and insects. genome profiling (gp) has already been established as a method for the identification of species, and has sometimes been applied to clustering of organisms. due to the nature of the samples used in gp (mostly, bacteria, fungi, and protozoa, which taxonomically can sometimes be subject to debate), it has not been possible to establish gp as a technique for classification up till now. however, here we show for the first time that gp [13, 14 ] is successfully applied to the purpose of classification. owing to its convenience and its highly informative nature, this technique of classification by gp can be widely applied to biological research, including botanical research. the plant, insect, and fish species used in this study are listed in table 1. all samples were well washed with distilled water prior to dna extraction. in particular, the legs of insects were vigorously washed with sds detergent to remove contaminating microbes. dnas of plants were prepared according to the conventional alkaline extraction method, whereas those of fish and insects were extracted by the phenol - chloroform - proteinase k - method using a tiny portion (0.05 mg) of caudal fins or legs. for convenience, here we define genomic dna as the whole set of dnas contained in cell. gp is a well - established method comprising the three following major steps : random pcr, temperature gradient gel electrophoresis (tgge), and data - normalization by computer - processing. random pcr has the ability to pick up, for example, the top ten dna fragments that are generated by more stable hybridization of the primer dna. the random pcr solution (50 l) contained 200 m dntps (n = g, a, t, c), 0.5 m primer, 10 mm tris - hcl (ph 9.0), 50 mm kcl, 2.5 mm mgcl2, 0.02 unit/l taq dna polymerase (takara bio, japan) and template dna (arbitrary amount). random pcr was carried out with 30 cycles of denaturation (94c, 30 s), annealing (28c, 2 min) and extension (47c, 2 min) using a ptc-100tm pcr machine (mj research, inc, usa). dna samples, together with the internal reference dna, were subjected to tgge (micro - temperature gradient gel electrophoresis) (one inch square size) using a -tg apparatus (taitec, japan) with a linear temperature gradient of 15c to 60c. the gel used was 6% acrylamide (acrylamide : bis = 19 : 1) containing 90 mm tris - hcl, 90 mm boric acid, 2 mm edta (ph 8.0), and 8 m urea. detection of dna bands was carried out either by monitoring fluorescence with a fluorescence imager, molecular imager fx (biorad, usa), or by staining with silver. from the resulting band patterns, which were rather complicated, characteristic or featuring points (e.g., kinked points) were extracted and then processed with the aid of computer to generate spiddos (species identification dots) [11, 18 ]. sets of spiddos are able to provide a sufficient amount of information for provisionally identifying species, which is usually done by calculating the pattern similarity score (pass) between two genomes. using spiddos, we can define pass of the genomes between two species as follows : (1)pass=11ni=1n|pipi||pi|+|pi|, 0 pass 1, where pi and pi correspond to the normalized positional vectors (composed of two elements, mobility, and temperature) for spiddos pi and pi collected from two genome profiles (discriminated with or without a prime), respectively, and i denotes the serial number of spiddos. gp needs to be carried out with the following specific precautions to get successful results. (i) during random pcr, contamination by other organisms should be carefully avoided. in particular, the entire random pcr solution without the template dna should be uv - irradiated prior to the pcr reaction in order to inactivate any contaminating dnas that could act as the template. (ii) the random pcr reaction should be terminated before the primer molecules are consumed in order to attain a double - strand stop, which means that the major pcr products are in a double - stranded state and are suitable for tgge analysis (i.e., the melting transition of double stranded dna to single stranded one can be detected). (iii) the gp pattern should be strictly checked from the viewpoint of quality score in order to rule out false positives : the number of bands (usually more than eight are required) and the clearness of bands and background should be sufficient (note that random pcr generates dna products at different molecular ratios (eventually, the sum of them is equivalent to that of the input primer) and, sometimes, overexpression of highly expressed dnas (where the primer binds strongly for forward and reverse extension) suppresses the appearance of lower expressed ones, leading to less than eight observable bands). gp patterns that are sufficient in both the number and the clarity of bands are categorized quality a and used for the further analysis ; those that are sufficient in only one of the two (but the other is still permissible) are categorized quality b and can be used with caution (note that quality b patterns were not used in this study) ; and the remaining patterns (quality c) should be discarded and the whole experiment should be retried. we developed a clustering and displaying program termed free lighter on the basis of ward 's method [22, 23 ], which is a type of nearest neighbor method with an objective function of minimizing the error sum of squares. we also tested other derivative methods such as the group average method, median method, furthest neighbor method, as well as ward 's method, thereby confirming the well - known phenomenon of occasional minor changes in phylodendrons. these methods are based on the distance defined in (2) which implies that clusters a and b are to be merged into c, and x is an arbitrary cluster : (2)dc = adxa + adxb + dxb + |dxadxb|, where a, b, a, and are weighing parameters, dc, dxa, dxb, and dab represent distances between relevant clusters such as cluster x and cluster a for dxa. the parametric differences among these methods are a = na / nc, b = nb / nc, b = 0, = 0 for the group average method ; a = 0.5, b = 0.5, = 0.25, = 0 for the median method ; a = 0.5, b = 0.5, = 0, = 0.5 for the furthest neighbor method ; and a = (nx + na)/(nx + nc), b = (nx + nb)/(nx + nc), = nx/(nx + nc), = 0 for ward 's method. in this experiment, the clustering results were found to be rather robust against changes in the above parameters, although there was a slight change in the order of neighbor joining in several cases. the first step is to extract dna fragments specifically from the genomic dna of an organism through random pcr, resulting in the specific reduction of the amount of dna to be analyzed. the second step is tgge to obtain the sequence - related information (i.e., a property related to the melting temperature of dna). the final step is to computer - process the experimental raw data (i.e., the band patterns in the gel) to obtain a normalized digital pattern (spiddos) that can be used for further analyses such as species identification and clustering [12, 18 ]. figure 1 outlines the whole procedure used in this study to classify species by gp. random pcr is a process in which dna fragments are sampled at random from genomic dna through the hybridization of a mismatch - containing primer to the template dna during pcr. in other words, this process is equivalent to the statistical approach used in random - sampling in a public opinion poll, from which an unbiased image of the whole can be grasped. tgge is used to get information related to the melting temperature (tm) of the sampled dnas which is sequence - dependent. importantly, an internal reference dna should be co - migrated on the gels in order to obtain experimental fluctuation - free (or normalized) data by the subtraction method. those featuring points that appear in electrophoretic band patterns (i.e., start of the melting transition ; see figure 2) are marked and converted to provide the coordinates of spiddos (species identification dots). by calculating a pattern similarity score (pass) between two genomes using spiddos as defined in materials and methods, we can get the information on how closely the two relevant genomes (organisms) are related (0 pass 1 ; pass = unity for a complete match). the pass value is known to be strongly correlated with the relatedness between two genomes although pass itself is based on a stochastic process. this means that the random - sampling method can not rule out the possibility of selecting a biased subpopulation ; thus, the larger the sampling number of sampling becomes, the closer to the true image the sampled one will be. this is also the case with the gp approach ; however, the sampling number of sampling can be increased by carrying out another random pcr using a different primer, resulting in the accumulation of information on a genome. as far as the experiments that we have done are concerned (several hundreds of species and strains), a strong correlation between the pass value and the relatedness of two genomes has been observed [12, 18, 26 ], which can be theoretically rationalized and is also experimentally verified in this paper (taking into consideration all of these facts, the pass value can be assumed to be semiquantitative as discussed later). here, to test our method, we collected and used three domains of organisms namely, plants, fish, and insects that are taxonomically well established (table 1). figures figure 3(a)figure 3(c) shows the species that we tested here and the pass values obtained among them, respectively. to illustrate the technique, some of the results of gp and spiddos representations for plant and fish are shown in figure 2, where the pairs of panels a / b (a1 : typha orientalis, a9 : viola xwittrockiana) and panels e / f (c1 : oncorhynchus masou, c4 : salmo trutta) apparently represent closer relationships than do the pairs of panels c / d (a11 : davidia involucrata, a12 : hydrangea macrophylla) and g / h (c8 : osmerus eperlanus mordax, c12 : barbatula barbatula), as expected. the results obtained here for plants, fish, and insects were clustered (nearest neighbor method) to determine intra - domains. on the basis of taxonomical knowledge, which has been established according to phenotypic traits, and the clustering results, two phylogenetic trees were constructed as shown in figure 4. all of the organisms examined were classified topologically to the same position in both the phenotype- and the genotype - based trees (note that, throughout this study, no arbitrary selection of data was made except for ruling out a few low - quality data samples, meaning that the correspondence between the phenotype - based and the genotype - based classifications was perfect so far as tested). it is surprising that such a limited amount of information (gp obtained with only a single oligonucleotide probe) can provide such perfect results for all organisms tested. although it had been believed that gp should be able to classify species, it was considered that it would be better to use three or more probes per genome. of course, another surprise is the strong correspondence between the results obtained by two quite different approaches : the traditional phenotype - based taxonomy (which by its nature is based on the well - considered but rather arbitrarily selected traits) and a genome sequence - based one (which is not directly based on sequence information itself). theoretically, some ranks of hierarchy must be interconvertible in phenotype - based taxonomy so that such a correspondence is not a matter of course. apart from the rrna and the other sequencing approaches described above, this is the first report describing the procedure of making phylogenetic trees of mutually - distant organisms based on the same criterion. because the rrna approach needs different pairs of primers to analyze a wide range of organisms, our simple approach is advantageous and can be used to complement the rrna one. notably, the length of branches in the phenotype - based tree is arbitrary and mainly implies topological meaning, whereas those in the genotype - based tree have a quantitative meaning : the longer the tree is, the more distantly related the organisms are. the results obtained here indicate that the quantitative expression of pass is very effective to some extent, even though the accuracy of the measure given by pass is thought to be limited, a priori, due to its stochastic nature (i.e., there are some steps that are stochastic in nature and can influence determination of the pass value : for example, random pcr may or may not select a dna fragment containing mutations, and the degree of displacement caused by a point mutation depends on the type of mutation such as a to g or a to c substitution, among others ; further consideration will lead to the conclusion that this is the case not only with the gp approach but also with other approaches that depend on the comparison of a particular gene sequence). in other words, even though the clustering of the organisms considered here was done, for the sake of simplicity, on the basis of a single experimental result obtained with a common oligonucleotide probe (dagaacgcgcctg, pfm12), the results were taxonomically consistent. at the current level of data (i.e., relatively small - scale sampling), we may be able to suggest conservatively that fish are widely classified on the basis of a more limited number of genes than are other organisms such as plants and insects, as can be seen in figures 2 and 4, where relatively small differences in the genome sequence (measured by pass) are observed among species of fish, although the possibility of biased sampling can not be completely ruled out. evidently, by using more kinds of probes, taxonomically more reliable results can be obtained, as we have demonstrated experimentally for other organisms such as fungi and rice (to be published elsewhere). an excellent feature of this methodology is that the amount of information used for classification can be increased on demand without limitation, simply by repeatedly performing an additional random pcr with a different oligonucleotide probe and thus obtaining additional spiddos (which can be expressed as information - scalable). thus, this methodology has the potential to become a highly accurate classification tool, as well as a convenient, universal one. moreover, it has been already demonstrated that dnas that provide spiddos can be collected and sequenced if necessary [26, 30 ]. as mentioned above, gp has proved to be useful for identifying species [12, 14 ], in addition to classifying species as shown here. it could therefore be said that the ability of gp to classify species was indirectly supported by the earlier studies, but it had not been explicitly demonstrated. we can not but feel the splendor of the correspondence between the phenotypic world and the genotypic one, although its meaning needs to be considered more deeply hereafter. | traditionally, organisms have been classified on the basis of their phenotype. recently, genotype - based classification has become possible through the development of sequencing technology. however, it is still difficult to apply sequencing approaches to the analysis of a large number of species due to the cost and labor. in most biological fields, the analysis of complex systems comprising various species has become an important theme, demanding an effective method for handling a vast number of species. in this paper, we have demonstrated, using plants, fish, and insects, that genome profiling, a compact technology for genome analysis, can classify organisms universally. surprisingly, in all three of the domains of organisms tested, the phylogenetic trees generated from the phenotype topologically matched completely those generated from the genotype. furthermore, a single probe was sufficient for the genome profiling, thereby demonstrating that this methodology is universal and compact. |
in 2009, the world faced the emergence of a new strain of influenza virus (1). the influenza a (h1n1) virus spread rapidly, causing the first pandemic of the 21st century (2). in brazil, the first confirmed case of infection with the new virus was reported on may 7th, 2009 by the brazilian health minister (3). on july 16th, 2009, the sustained human transmission of the virus in brazil was declared, and the mandatory reporting of each patient diagnosed with acute respiratory distress syndrome caused by the influenza a (h1n1) virus was established (4). several actions were taken to control the epidemic in brazil, including the establishment of hospital admission criteria for suspected cases. beginning in march 2010, the pandemic influenza vaccine was available in brazil for the population groups who presented with higher morbidity and mortality after h1n1 infection in 2009 and for healthcare professionals and native indians (5)-(7). in the pediatric age group, first children aged six months to two years were vaccinated ; vaccinations were subsequently extended to all children under age five. in the literature, studies have discussed the characteristics of the pediatric patients who were admitted to the hospital with influenza a (h1n1) infection. however, to our knowledge, no published study has compared the 2009 and 2010 hospitalizations. in this study, we describe the clinical and epidemiological characteristics of patients under age 19 who were hospitalized with confirmed influenza a (h1n1) infection in 2009 and 2010, the year that the vaccination campaign against pandemic influenza began in brazil. this study was conducted at so paulo hospital, a tertiary university hospital in so paulo, brazil, with pediatric wards, semi - intensive, and intensive care units (icu). this is a retrospective study of suspected cases of influenza a (h1n1) infection reported to the disease control surveillance system of our hospital. we selected patients under 19 years and separated them into confirmed cases admitted and confirmed cases not admitted to hospital. we considered confirmed cases of influenza a (h1n1) those with virus detection in nasopharyngeal and pharyngeal swabs. briefly, viral rna was extracted using qiaamp viral rna extraction kit (qiagen, germany) according to manufacturer 's instructions. influenza a (h1n1) detection was performed at adolfo lutz institute, a brazilian government laboratory, or at the clinical virology laboratory at the federal university of so paulo using the real time protocol published by the cdc on april 28, 2009 (8). data on gender, age, and comorbidities were collected from all of the patients who were not admitted to the hospital. patients who were hospitalized for longer than 24 hours were assessed for demographic data, including a review of clinical data described in the medical chart, such as the unit to which the patient was admitted, early symptoms, complications, major medical procedures, and treatment. vaccination records on influenza a (h1n1) were also collected from the patients who were admitted in 2010. we defined respiratory failure as dyspnea with hypoxemia (oximetry less than 95% in ambient air) (9). acute respiratory distress syndrome was defined as fever, cough, and dyspnea (4,7). a suspected case of influenza a (h1n1) was defined as febrile acute disease with cough or sore throat in the absence of other diagnoses (5). in the beginning of the pandemic, this rule was modified on july 16, 2009 (28th epidemiological week), when priority reporting for laboratorial diagnosis and treatment was established for patients presenting with severe acute respiratory distress syndrome and those with associated risk factors (4). the statistical analysis was performed with bioestat 5.0 (published by the institute for sustainable development of mamirau, brazil). the mann - whitney u - test was used for continuous variables, and the chi - squared test was used for categorical variables. this study was approved by the ethics committee at the federal university of so paulo, brazil. there were 282 suspected cases of pandemic influenza a (h1n1) in children and adolescents under age 19 in our hospital, and 37 patients were hospitalized with confirmed infection. the majority of admissions occurred in the 30 epidemiological week (figure 1). among those patients with confirmed pandemic influenza a (h1n1), the hospital - admitted group had more chronic diseases (29/37 versus 13/41 ; chi - squared test, p<0.001) and a lower median age (4.9 y versus 10.4 y ; mann - whitney u - test, p<0.001) than the non - admitted group. also, 65% of the admitted children versus 95% of the non - admitted were over age 2 (chi - squared test, p<0.001). table 1 shows the results. of the patients with confirmed influenza a (h1n1), 36 were admitted to the hospital on the same day they arrived in the emergency room. the median time between the first symptoms and the hospital admission was four days (range, 1 to 10). four days was also the median time between the first symptoms and the collection of a nasopharynx swab (range, 1 to 10). 34/37 (91.9%) patients received oseltamivir, and 24/34 (70.6%) started oseltamivir within 48 hours of the first symptoms. the major signs and symptoms presented at admission were fever (97%), cough (76%), dyspnea (59%), decreased food intake (35%), rhinorrhea (32%), and hypoactivity (32%). a total of 29 of the 37 hospitalized patients (78%) had at least one underlying medical condition. pneumopathy was the most commonly observed condition (14/29 ; 48%), followed by neuropathy (8/29 ; 28%), hemoglobinopathy (5/29 ; 17%), immunosuppression (4/29 ; 14%), and heart disease (3/29 ; 10%). complications occurred in 81% (30/37) of the patients, respiratory failure in 51%, pneumonia in 49%, and sepsis in 16%. two (5.4%) patients had reversed cardiopulmonary arrest ; one (2.7%) had rejection of a transplanted kidney ; one (2.7%) had acute metabolic acidosis at the onset of diabetes mellitus type 1, and two (5.4%) died. furthermore, 73% of patients required oxygen supplementation, 19% required mechanical ventilation, and 62% received antibiotics. of the 37 patients hospitalized with confirmed infection, ten were admitted to the icu. the median age in this group was 5.1 years ; 50% were male, and 90% had some underlying condition. all of the patients presented with complications (nine had acute respiratory failure, nine had pneumonia, one had hypoxia), and 70% required mechanical ventilation. two children died in 2009 from influenza a (h1n1) infection in our hospital ; one child was a 4-year - old female who had intermittent asthma. the symptoms had started three days prior to her hospital admission with cough, fever, diarrhea, and sore throat. the child was admitted to the icu with acute respiratory failure on the day she arrived at the hospital, and mechanical ventilation was required. she developed pneumonia, septic shock, and pulmonary hemorrhage and died on the second day of hospitalization. the other deceased patient was a 16-year - old girl with down 's syndrome, heart disease, diabetes mellitus, hypothyroidism, and hypertension. the symptoms had started four days prior to admission with fever, dyspnea, diarrhea, vomiting, and abdominal pain. the patient was admitted to the icu on the second day of hospitalization and developed acute respiratory failure, pneumonia, hepatitis, heart failure, acute renal failure and shock ; she died 14 days after hospital admission. in 2010, there were 69 reported cases and only two confirmed cases of influenza a (h1n1) infections at so paulo hospital. both of the confirmed infections required hospitalization. the first case was a 9-month - old, previously healthy boy with coughing and rhinorrhea two weeks prior to his hospitalization ; the symptoms had worsened five days prior to admission ; he developed fever, hypoactivity, and dyspnea. the boy had received one previous h1n1 vaccine dose 13 days before the first symptoms appeared. oral antibiotics, oral corticosteroids and inhalation with saline solution had already been administered for four days before the hospital admission. acute respiratory failure and bilateral pneumonia were diagnosed in the emergency room, and the child was placed on mechanical ventilation for 13 days and treated with broad - spectrum antibiotics and two cycles of oseltamivir. he developed subglottic stenosis and was discharged with a tracheostomy after 47 days of hospitalization. the other patient was a 2-month - old boy with encephalocele and sepsis ; he was admitted to the same icu as the other child diagnosed with influenza a (h1n1) and was treated with oseltamivir and noninvasive oxygen therapy. there were 282 suspected cases of pandemic influenza a (h1n1) in children and adolescents under age 19 in our hospital, and 37 patients were hospitalized with confirmed infection. the majority of admissions occurred in the 30 epidemiological week (figure 1). among those patients with confirmed pandemic influenza a (h1n1), the hospital - admitted group had more chronic diseases (29/37 versus 13/41 ; chi - squared test, p<0.001) and a lower median age (4.9 y versus 10.4 y ; mann - whitney u - test, p<0.001) than the non - admitted group. also, 65% of the admitted children versus 95% of the non - admitted were over age 2 (chi - squared test, p<0.001). table 1 shows the results. of the patients with confirmed influenza a (h1n1), 36 were admitted to the hospital on the same day they arrived in the emergency room. the median time between the first symptoms and the hospital admission was four days (range, 1 to 10). four days was also the median time between the first symptoms and the collection of a nasopharynx swab (range, 1 to 10). 34/37 (91.9%) patients received oseltamivir, and 24/34 (70.6%) started oseltamivir within 48 hours of the first symptoms. the major signs and symptoms presented at admission were fever (97%), cough (76%), dyspnea (59%), decreased food intake (35%), rhinorrhea (32%), and hypoactivity (32%). a total of 29 of the 37 hospitalized patients (78%) had at least one underlying medical condition. pneumopathy was the most commonly observed condition (14/29 ; 48%), followed by neuropathy (8/29 ; 28%), hemoglobinopathy (5/29 ; 17%), immunosuppression (4/29 ; 14%), and heart disease (3/29 ; 10%). complications occurred in 81% (30/37) of the patients, respiratory failure in 51%, pneumonia in 49%, and sepsis in 16%. two (5.4%) patients had reversed cardiopulmonary arrest ; one (2.7%) had rejection of a transplanted kidney ; one (2.7%) had acute metabolic acidosis at the onset of diabetes mellitus type 1, and two (5.4%) died. furthermore, 73% of patients required oxygen supplementation, 19% required mechanical ventilation, and 62% received antibiotics. of the 37 patients hospitalized with confirmed infection, ten were admitted to the icu. the median age in this group was 5.1 years ; 50% were male, and 90% had some underlying condition. all of the patients presented with complications (nine had acute respiratory failure, nine had pneumonia, one had hypoxia), and 70% required mechanical ventilation. two children died in 2009 from influenza a (h1n1) infection in our hospital ; one child was a 4-year - old female who had intermittent asthma. the symptoms had started three days prior to her hospital admission with cough, fever, diarrhea, and sore throat. the child was admitted to the icu with acute respiratory failure on the day she arrived at the hospital, and mechanical ventilation was required. she developed pneumonia, septic shock, and pulmonary hemorrhage and died on the second day of hospitalization. the other deceased patient was a 16-year - old girl with down 's syndrome, heart disease, diabetes mellitus, hypothyroidism, and hypertension. the symptoms had started four days prior to admission with fever, dyspnea, diarrhea, vomiting, and abdominal pain. the patient was admitted to the icu on the second day of hospitalization and developed acute respiratory failure, pneumonia, hepatitis, heart failure, acute renal failure and shock ; she died 14 days after hospital admission. in 2010, there were 69 reported cases and only two confirmed cases of influenza a (h1n1) infections at so paulo hospital. both of the confirmed infections required hospitalization. the first case was a 9-month - old, previously healthy boy with coughing and rhinorrhea two weeks prior to his hospitalization ; the symptoms had worsened five days prior to admission ; he developed fever, hypoactivity, and dyspnea. the boy had received one previous h1n1 vaccine dose 13 days before the first symptoms appeared. oral antibiotics, oral corticosteroids and inhalation with saline solution had already been administered for four days before the hospital admission. acute respiratory failure and bilateral pneumonia were diagnosed in the emergency room, and the child was placed on mechanical ventilation for 13 days and treated with broad - spectrum antibiotics and two cycles of oseltamivir. he developed subglottic stenosis and was discharged with a tracheostomy after 47 days of hospitalization. the other patient was a 2-month - old boy with encephalocele and sepsis ; he was admitted to the same icu as the other child diagnosed with influenza a (h1n1) and was treated with oseltamivir and noninvasive oxygen therapy. in 2009, we witnessed a pandemic of the previously unknown subtype influenza a (h1n1) virus (10). the first confirmed cases in our hospital were in the 22 epidemiological week, and the majority of the admissions and confirmed cases occurred during the 30 epidemiological week. in brazil, the peak confirmation rate of cases was seen in the 31 epidemiological week (7). during the pandemic, changes were made to the reporting and selection criteria for laboratorial diagnosis. in the 28 epidemiological week, reporting was required only for the cases with severe acute respiratory distress syndrome or those with risk factors for worse outcomes (4). at our hospital, the majority of hospitalizations occurred after this date. in our study, the admitted children were younger than the non - admitted children. in brazil, the age groups that had more frequent acute respiratory distress syndrome were children under age 2 and adults between the ages of 20 and 29 years (7,11). in concordance with other studies, the children who were admitted to our hospital with influenza a (h1n1) infection had a high prevalence of chronic disease, with a predominance of pneumopathy (5), however, we must consider that the high percentage found here might represent a bias because so paulo hospital is a tertiary hospital. in this study, there were two deaths, two reversed cardiopulmonary arrests, one rejection of a transplanted kidney and an acute metabolic acidosis at the onset of diabetes mellitus type 1, all of which were critical cases. a recent brazilian study demonstrated a more severe course of the disease in children infected with the h1n1 virus than in children with flu - like symptoms who received negative rapid tests for h1n1 (18). as observed in the united states (12), argentina (15), canada (17), and in another brazilian study (18), most patients who were hospitalized with influenza a (h1n1) had complications, and many needed intensive care, despite immediate hospitalization from the emergency room and prompt oseltamivir initiation. seventy - one percent of the hospitalized patients in our study started this medication more than 48 hours after the symptoms began. this delay could have contributed to a worsening of their clinical condition. in this study, 27% of the 37 children who were hospitalized were admitted to the icu, and 78% had some underlying disease. likewise, among the first 272 patients hospitalized with influenza a (h1n1) reported in the united states, 25% were admitted to an icu, and 73% had at least one underlying medical condition (12). during annual outbreaks of seasonal influenza, there are also a greater number of hospitalizations in patients with chronic diseases, such as diabetes, cardiovascular disease, neurological disease, and pulmonary disease (including asthma) (12,19,20). a significant number of hospitalizations are caused by influenza every year (19)-(21). despite a stable total number of hospital admissions in all pediatric units at our hospital in 2009 and 2010, there was a reduction in the hospital admissions of confirmed pediatric influenza a (h1n1) patients after the vaccination campaign in 2010. this result is in accordance with other data from our country (22). the total number of influenza a (h1n1) vaccine doses administered in brazil was 89,580,203. the vaccination coverage for children under age 2 was 100% (5,580,671 vaccine doses) and 60% for the 2 to 4 year - old age group, with 5,202,438 vaccine doses given (23). here, we have described influenza a (h1n1) pediatric cases admitted to a tertiary hospital in so paulo, brazil over two consecutive years. the striking decrease in the number of cases from 2009 to 2010 is likely an effect of the massive influenza a (h1n1) vaccination campaign in brazil in 2010, along with the immunity acquired by the population because of the intense viral circulation. | in 2009, the influenza a (h1n1) virus spread rapidly around the world, causing the first pandemic of the 21st century. in 2010, there was a vaccination campaign against this new virus subtype to reduce the morbidity and mortality of the disease in some countries, including brazil. herein, we describe the clinical and epidemiological characteristics of patients under 19 years of age who were hospitalized with confirmed influenza a (h1n1) infection in 2009 and 2010. we retrospectively reviewed files from the pediatric patients who were admitted to a university hospital with real - time polymerase chain reaction (rt - pcr) confirmed influenza a (h1n1) infection in 2009 and 2010. there were 37 hospitalized patients with influenza a (h1n1) in 2009 and 2 in 2010. in 2009, many of the hospitalized children had an underlying chronic disease and a lower median age than those not hospitalized. of the hospitalized patients, 78% had a chronic disease, primarily pneumopathy (48%). the main signs and symptoms of influenza were fever (97%), cough (76%), and dyspnea (59%). complications occurred in 81% of the patients. the median length of hospitalization was five days ; 27% of the patients required intensive care, and two died. in 2010, two patients were hospitalized with influenza a (h1n1) : one infant with adenovirus co - infection who had received one previous h1n1 vaccine dose and presented with respiratory sequelae and a 2-month - old infant who had a hospital - acquired infection. an impressive reduction in hospital admissions was observed in 2010 when the vaccination campaign took place in brazil. |
cadmium (cd) is often the result of environmental pollution caused by industrial and agricultural activities and it is widely dispersed into the environment ; hence, humans are exposed to it ubiquitously. an earlier study showed that cd acts as a stressor and leads to metabolic alterations. humans always come into contact with cd by occupational exposure, smoking, or diet. however, diet is the primary way cd enters the bodies of those without occupational exposure and who do not live in cd - polluted regions. it has been reported that dietary cd exposure is mainly from the relatively high cd content of agricultural crops and their products, such as rice, bread, potatoes, and vegetables. after entering the human body, the long - time biological effect of cd is that it may be a carcinogen. in 2008, a population - based cohort study suggested that chronic dietary cd intake could increase risk of hormone - related cancers. similarly, another population - based prospective cohort study reported that dietary cd intake played an important role in prostate cancer development. thus, dietary cd intake may be associated with hormone - related cancers. for women, bc is an estrogen - related cancer, and a laboratory study indicated that cd could malignantly transform breast cells, stimulate breast cell proliferation, and inhibit apoptosis. the relationship between dietary cd exposure and bc risk has been supported by some observational studies, but the results of these studies were inconsistent [1013 ], hence, a meta - analysis was conducted by cho. to clarify these inconsistent results, and this study found that there was a significant positive relationship between dietary cd intake and bc risk. recently, 2 recent prospective cohort studies have observed a relationship between dietary cd intake and bc risk ; however, neither of these studies found that dietary cd intake was a risk for bc. thus, we performed a meta - analysis to update and quantitatively re - assess the association between dietary cd exposure and the risk of bc by summarizing the inconsistent results of all published studies. thus, we intended to provide the best available evidence as to whether dietary cd exposure is a risk of bc. we searched pubmed, medline, and embase to identify studies on the relationship between dietary cd exposure and risk of bc, published through september 2014. the following search terms were used in the searching strategy : cadmium combined with breast cancer and breast carcinoma. in addition, references cited within relevant reviews were retrieved, and we contacted the authors for useful information. we included studies that met the following criteria : 1) study designed as case - control or cohort study ; 2) the exposure of interest was dietary cd exposure ; 3) the outcome was bc incidence ; and 4) rr and corresponding 95% ci for the highest compared with the lowest of dietary cd exposure were reported. initially, we reviewed the titles and abstracts to ascertain reports of interest ; if uncertain, a subsequent full - text assessment was conducted. we extracted the following contents : the first author s surname, publication year, geographic area, age of the participants, number of cases and participants or controls, study design, range of cd exposure ; rr (95% ci) for the highest vs. the lowest dietary cd exposure and variables used in a multivariate model. the key components of designs (e.g., selection of study populations, ascertainment of exposure and outcome, duration of follow - up) were used to estimate the quality of primary studies, rather than reporting the aggregate scores. rr and the 95% ci were used to measure the association of dietary cd exposure and the risk of bc. homogeneity test was performed with the use of q statistic and i statistic, and subgroups analysis was used to identify the source of heterogeneity. sensitivity analysis was used to assess the influence of a single study on the overall risk estimate. publication bias was detected by begg s and egger s test, if the p - value was less than 0.05, it was considered as statistically significant. we searched pubmed, medline, and embase to identify studies on the relationship between dietary cd exposure and risk of bc, published through september 2014. the following search terms were used in the searching strategy : cadmium combined with breast cancer and breast carcinoma. in addition, references cited within relevant reviews were retrieved, and we contacted the authors for useful information. we included studies that met the following criteria : 1) study designed as case - control or cohort study ; 2) the exposure of interest was dietary cd exposure ; 3) the outcome was bc incidence ; and 4) rr and corresponding 95% ci for the highest compared with the lowest of dietary cd exposure were reported. initially, we reviewed the titles and abstracts to ascertain reports of interest ; if uncertain, a subsequent full - text assessment was conducted. we extracted the following contents : the first author s surname, publication year, geographic area, age of the participants, number of cases and participants or controls, study design, range of cd exposure ; rr (95% ci) for the highest vs. the lowest dietary cd exposure and variables used in a multivariate model. the key components of designs (e.g., selection of study populations, ascertainment of exposure and outcome, duration of follow - up) were used to estimate the quality of primary studies, rather than reporting the aggregate scores. rr and the 95% ci were used to measure the association of dietary cd exposure and the risk of bc. homogeneity test was performed with the use of q statistic and i statistic, and subgroups analysis was used to identify the source of heterogeneity. sensitivity analysis was used to assess the influence of a single study on the overall risk estimate. publication bias was detected by begg s and egger s test, if the p - value was less than 0.05, it was considered as statistically significant. we initially identified 224 potential articles from the databases. after screening the abstracts and titles, most of these were excluded because they were reviews, the exposure or outcome did not relate to our analysis, or they were laboratory studies. overall, we identified 6 studies involving 321 315 participants and 11 978 cases [1013,15,16 ]. 2 were performed in europe, 2 in the usa, and 2 in japan. in addition, 5 studies were cohort studies [1012,15,16 ] and one was designed as case - control study. five results of these studies were reported by menopausal status in 4 studies, 4 results were conducted in postmenopausal women, and only 1 in premenopausal women. data of these 6 studies were analyzed in a random - effects model to estimate the relationship between dietary ca exposure and bc risk. in our study, there was no statistically significant positive association between dietary cd exposure and bc, and the combined rr and corresponding 95% ci was 1.01 [0.88, 1.14 ]. figure 2 presents the results of our meta - analysis. according to menopause status, geographic area, and study design, we conducted subgroup - analysis to identify the source of heterogeneity. evidence of heterogeneity was also found across the 2 european studies and the cohort design studies. however, among these 3 subgroups, no significant positive correlation between dietary cd exposure and bc risk was found. sensitivity analysis was conducted to estimate the influence of each individual study on combined rr by removing 1 study at a time. the combined rrs were similar with one another, and no single study significantly changed the combined result, which indicated that the result was statistically stable and reliable. publication bias was detected based in the shape of funnel plots and by begg s and egger s tests. begg s funnel plot and egger s regression test showed a low probability of publication bias (p=0.909). we initially identified 224 potential articles from the databases. after screening the abstracts and titles, most of these were excluded because they were reviews, the exposure or outcome did not relate to our analysis, or they were laboratory studies. overall, we identified 6 studies involving 321 315 participants and 11 978 cases [1013,15,16 ]. 2 were performed in europe, 2 in the usa, and 2 in japan. in addition, 5 studies were cohort studies [1012,15,16 ] and one was designed as case - control study. five results of these studies were reported by menopausal status in 4 studies, 4 results were conducted in postmenopausal women, and only 1 in premenopausal women. data of these 6 studies were analyzed in a random - effects model to estimate the relationship between dietary ca exposure and bc risk. in our study, there was no statistically significant positive association between dietary cd exposure and bc, and the combined rr and corresponding 95% ci was 1.01 [0.88, 1.14 ]. according to menopause status, geographic area, and study design, we conducted subgroup - analysis to identify the source of heterogeneity. evidence of heterogeneity was also found across the 2 european studies and the cohort design studies. however, among these 3 subgroups, no significant positive correlation between dietary cd exposure and bc risk was found. sensitivity analysis was conducted to estimate the influence of each individual study on combined rr by removing 1 study at a time. the combined rrs were similar with one another, and no single study significantly changed the combined result, which indicated that the result was statistically stable and reliable. publication bias was detected based in the shape of funnel plots and by begg s and egger s tests. begg s funnel plot and egger s regression test showed a low probability of publication bias (p=0.909). our study did not show a statistically significant positive association between dietary cd exposure and bc risk for the highest compared with the lowest category of dietary cd exposure, and the combined rr(95% ci) of bc was 1.01 [0.88, 1.14 ]. heterogeneity appears in a meta - analysis when the included studies have inconsistent conditions. in our study, evidence of heterogeneity was observed ; thus, we conducted subgroup - analysis to identify the source of heterogeneity. table 2 shows that the 2 european studies were the main source of heterogeneity. julin. adjusted for a wide range of potential confounders for bc : age, height, bmi, education, use of oral contraceptives and postmenopausal hormones, age at menarche, age at first birth, alcohol consumption, glycemic load, total energy intake, and dietary intake of whole vegetables and grains ; however, the danish study of postmenopausal women adjusted for a relatively narrow range, not including age, total energy intake, or dietary intake of whole vegetables and grains. the relationship between cd exposure and bc risk has been investigated to assess whether cd has any modifying effects on the etiology and process of bc. these studies investigated women who were exposed to cd occupationally and who lived in cd - polluted areas ; a significant increase in frequencies of bc in cd - exposed women was found by a meta - analysis and systematic review. however, diet is the primary way cd enters the human body among populations without occupational exposure and who do not live in cd - polluted areas. the relationship between dietary cd exposure and bc risk also was considered in recent years. in our meta - analysis, 6 studies on this topic were identified, but the results were inconsistent. in 2012, adams. conducted a cohort study to examine whether dietary cd exposure increased risk of bc, and the result showed no significant association. however, a swedish population - based prospective cohort study including 55 987 participants and 2112 patients showed that dietary cd intake increased risk of postmenopausal bc. the 2 japanese studies reported no significant positive relationships between dietary cd exposure and bc risk, but the case - control study found a statistically significant association for estrogen receptor - positive tumors among postmenopausal women. in 2013, a meta - analysis of the relationship between dietary cd intake and cancer risk was conducted by cho., who reported a significant association between dietary cd exposure and bc risk, and found that dietary cd intake increased risk of bc the rr (95% ci) was 1.15 [1.041.28 ]. however, in 2014, a prospective cohort study in danish postmenopausal women did not support the above result and reported that dietary cd intake was not linked to the risk of bc or other hormone - related cancers. similarly, another cohort study indicated dietary cd intake had no statistical association with cancer risk. thus, we performed a meta - analysis to update and quantitatively re - assess this relationship and we did not find a statistically significant positive association between dietary cd exposure and bc risk. the subgroup - analysis of our study was conducted at the same time and no significant positive association between dietary cd exposure and bc risk was found in any subgroups. cd acts as a metallo - estrogen and may play an important role in the estrogenic signaling pathway ; it can malignantly transform breast cells, stimulate breast cell proliferation, and inhibit apoptosis. in addition, cd also can induce bc by a non - estrogen - related mechanism. it can change normal breast epithelial cells into a basal - like breast carcinoma characterized by negativity of the er - a and the epidermal growth factor receptor 2 (her2), leading to reduced expression of bc susceptibility gene 1, and increasing the expression of cytokeratin 5 and p63. although our study did not find a statistically significant positive association between dietary cd exposure and bc risk, many factors that may influence this association should be considered. reported that iron deficiency led to increased absorption of cd in animal and human studies. in addition, zinc can limit absorption of cd by decreasing in the intracellular cd accumulation and by the sequestration of cd by cd - induced metallothionein. second, different types of diet may influence the bioavailability and/or kinetics of dietary cd. for example, the swedish prospective cohort study showed that the low cd and high whole grain and vegetables intake groups had the lowest risk, but they had the highest risk of bc in relation to diets high in cd and low in whole grains and vegetables, which is why these food have a conflicting roles in the development of bc because whole grains and vegetables are relatively cd - rich foods. for example, average urine cd concentration in never - smokers was lower than that in smokers. in our study, only 2 investigations reported a relationship between dietary cd exposure and bc risk in smokers and never - smokers, but no study showed a positive association. our meta - analysis of 6 studies involving 321 315 participants and 11 978 cases improved the statistical power and found a more reliable result of the association between dietary cd exposure and bc risk. first, other factors may influence this association and the effect of dietary cd exposure on the development of bc. although most included studies adjusted for a wide range of factors, some studies did not exclude the potential factors. second, in all included studies, cd exposure was assessed with a food frequency questionnaire (ffq), so measurement error in individual studies might have led to incorrect classification of cd exposure. third, none of the included studies reported whether the participants lived in a polluted area and, if so, for how long before the primary studies were started. fourth, the inclusion criteria might induce selection bias and potential publication bias still existed. fourth, all of our included studies were conducted in developed countries, and other studies in less - developed countries are warranted. our study did not find a statistically significant positive association between dietary cd exposure and bc risk. it is necessary to investigate this potential relationship among high - risk groups and more cohort studies based on diverse populations are needed. | backgrounddiet is the primary way cadmium (cd) enters the body in those without occupational exposure and who do not inhabit cd - polluted regions. findings on the relationship between dietary cd exposure and breast cancer (bc) risk have been inconsistent ; a meta - analysis has supported this association but 2 recent cohort studies showed inconsistent results. hence, we performed an updated meta - analysis to re - evaluate the association between dietary cd exposure and bc risk.material/methodswe searched pubmed, medline, and embase to identify relevant studies published through september 2014. combined relative risks (rrs) and the corresponding 95% confidence intervals (cis) were used to assess the association between dietary cd exposure and bc risk.resultswe identified 6 studies involving 321 315 participants and 11 978 cases. our study suggested there was no statistically significant positive association between dietary cd exposure and bc risk, the combined rr and corresponding 95% ci was 1.01 [0.88, 1.14 ]. the result was not modified by menopause status, geographic area, or study design.conclusionsour study did not find a statistically significant positive association between dietary cd exposure and bc risk. it is necessary to investigate this relationship among the high - risk groups and more cohort studies based on diverse populations are needed. |
pregnancy is associated with an increased risk of thrombosis among women with mechanical prosthetic heart valves. an anticoagulation management is important for both, mother and fetus.1) an increased thrombogenicity in pregnancy may be associated with several factors such as inherited coagulation defects, which may result in recurrent pregnancy loss and other thromboembolic complications.2) herein, we present a pregnant patient who had a history of recurrent pregnancy loss and developed recurrent prosthetic heart valve thrombosis (phvt) despite optimal anticoagulation. a 23-year - old pregnant woman (10 weeks of gestation) with mechanical mitral prosthetic valve (operated 5 years ago) was due to an exertional dyspnea admitted to our hospital. she did not notify her medical doctor about her pregnancy and had continued to intake 7.5 mg of warfarin on her own. the international normalized ratio (inr) was 2.4 on admission and the blood pressure was 130/80 mm hg. transthoracic echocardiography on admission revealed increased doppler gradients (maximum / mean gradient : 17/10 mm hg) and decreased mitral valve area (mva) of 1.5 cm indicating a prosthetic valve obstruction. transesophageal echocardiography delineated a thrombus area of 1.5 cm on the mitral prosthesis (fig. thrombolytic therapy (tt) with low dose (25 mg) and slow infusion (6 hours) of tissue - plasminogen activator (tpa) was administered as described recently.3) after tt, the mva increased to 2.8 cm and the transmitral gradient decreased (maximum / mean gradient : 11/5 mm hg) with a complete lysis of the thrombus (fig. an elective curettage was performed to avoid a potential embryopathy due to the relatively high dose warfarin consumption. two years later, the patient suffered from two pregnancy losses at the 18th and 20th week respectively. anticardiolipin immunoglobulin (ig) g and igm, lupus anticoagulant and toxoplasma antibodies were studied and showed all negative results. genetic testing was performed using cvd strip assay kit (viennalab diagnostic gmbh) and no mutations were observed in the factor v leiden, factor v h1299r, prothrombin g20210a, factor xiii v34l, methylenetetrahydrofolate re ductase (mthfr) c677 t, plasminogen activator - inhibitor 1 4g-5 g, gpiiia l33p, ace, apob r3500q and apoe. however, homozygous mutations of mthfr a 1298c, and heterozygous mutations of -fibrinogen 455 g - a were detected. one year ago, the patient became pregnant again and suffered another episode of obstructive phvt in the 33rd week of her gestation despite strict anticoagulation (low molecular weight heparin with effective antifactor xa levels in the first trimester and inr between 2.5 and 4 in the second and third trimester). she delivered by cesarean section an alive and healthy newborn at the end of the 37th week of gestation. methylenetetrahydrofolate reductase a 1298c homozygous and -fibrinogen 455 g - a heterozygous mutations were detected in a pregnant patient with a history of recurrent pregnancy loss and a recurrent prosthetic valve thrombosis despite optimal anticoagulation. the pathogenesis of phvt is multifactorial and pregnancy is one of the risk factors that may enhance thrombosis.4)5) there is a 4-fold to 10-fold increased thrombotic risk throughout gestation and postpartum period.6) on the other hand, some women affected by thrombophilia show an increasing hypercoaguable state during their pregnancy and may suffer obstetrical complications such as recurrent pregnancy loss.2) approximately 20% of the thromboembolic events in pregnancy are arterial and the other 80% are venous.7) the relationship between genetic mutations and phvt and/or miscarriage in pregnancy is unknown. a reduction in mthfr level or an activity by specific gene mutations induces hyperhomocysteinemia, characterized by mild to moderate increased plasma homocysteine levels, that has been shown to be a risk factor for arterial or vascular thrombotic events, including myocardial infarction, stroke, deep vein thrombosis and recurrent spontaneous abortus.8)9) to our knowledge, mthfr a 1298 c mutation related with recurrent phvt was not reported previously. beta - fibrinogen 455 g / a polymorphism is a gene mutation that may lead to alterations in the activity of fibrinogen which plays an active role in the coagulation cascade.10) in several publications, it has been shown to be associated with an increased erythrocyte aggregation and to predispose the development of stasis in coronary arteries and the left atrium.10)11) this gene mutation may also contribute to a thrombus formation on surfaces such as prosthetic valves that is already prone to stasis. however this potential relationship has not been reported also. in the presented case was the mutation heterozygous for the fibrinogen 455g / a allele and it remains unclear whether this may be especially related to recurrent phvt and/or miscarriages in the presence of additional homozygous mthfr a 1298 c mutation. since surgical treatment carries a high mortality risk not only for the mother but also for the fetus during a pregnancy with phvt, tt may be a reasonable option and seems effective and safe with low doses and slow infusion rates.3)4)5) | an effective anticoagulation is critical in pregnant patients with prosthetic heart valves. inherited disorders may interfere with the coagulation cascade and may be associated with obstetrical complications as well as with prosthetic valve - derived complications. the patient in the present case had a history of recurrent prosthetic heart valve thrombosis (phvt) despite an effective anticoagulation. she underwent a thrombolysis with low - dose prolonged infusion of tissue - type plasminogen activator for the management of her recurrrent prosthetic valve thrombosis. the genetic testing showed homozygous mutations of methylenetetrahydrofolate reductase (mthfr) a 1298 c and heterozygous mutations of -fibrinogen 455 g - a. inherited disorders such as mthfr a 1298 c and fibrinogen 455g / a polymorphisms may be involved in the pathogenesis of recurrent phvt and/or pregnancy loss. |
gastric cancer is one of the most common fatal cancers, and patients are particularly prone to lymph node metastasis.1 the incidence for gastric carcinoma has had a recent increase, likely due to both environmental and social factors.1 effective methods for early diagnosis, monitoring metastasis, and prognosis are currently unavailable for gastric cancer. currently, molecular targeted therapy has shown to be effective in her-2-positive patients with gastric cancer,2,3 but its clinical application is limited due to the rare occurrence of her-2 mutation. immunotherapy has shown bright promise in the treatment of gastric cancer.4,5 unfortunately, it was reported that gastric cancer cells can escape immune surveillance by a variety of mechanisms which prevent the immune system from producing effective antitumor immune responses.6 moreover, the body s antitumor immunity is mainly mediated by t lymphocytes, but the majority of tumor antigen - specific t - cells are often in a state of immune tolerance. therefore, elucidating the relationship between the tumor immune escape mechanism and prognosis of gastric cancer will be of high importance for both cancer biology and translational cancer research. programmed death ligand-1 (pd - l1) is a member of the b7 superfamily of costimulating molecules expressed by antigen - presenting cells that functions as a t lymphocyte inhibitory molecule. pd - l1 has been shown to induce t lymphocyte anergy and/or apoptosis through binding to its receptor, pd-1.711 pd - l1 increases apoptosis of antigen - specific human t - cell clones and inhibits the activation of cd4 and cd8 t - cells in vitro.7,12 pd - l1 expression has been described in several malignancies, including colon cancer, ovary cancer, melanoma, lung carcinoma, breast cancer, non - small - cell lung carcinoma, gliomas, squamous cell carcinoma of head and neck, renal cell carcinoma, and esophageal carcinoma.9,1217 high expression of pd - l1 has been demonstrated to be closely associated with the clinicopathological status of patients with non - small - cell lung cancer, renal cell carcinoma, or human esophageal cancer.13,16,17 several studies have shown that pd-1 or pd - l1 antibodies could relieve the inhibitory effects of pd - l1 on cytotoxic t - cells and hence accelerate the removal of tumor cells by cytotoxic t - cells.18,19 pd - l1 inhibitors have also been shown to be effective in the immunotherapy of melanoma.20 most recently, ansen have reported that pd - l1 expression was associated with distinct genotypes of egfr, kras, and stk11 in the two most common histological non - small - cell lung cancer subtypes (adenocarcinoma and squamous cell carcinoma) in the 2014 asco annual meeting.21 this novel finding will facilitate the identification of patients most suitable for anti - pd-1 and anti - pd - l1 therapies. in addition, pd - l1 was found to promote cell proliferation in breast cancer.12 taken together, these data demonstrate that the pd-1/pd - l1 pathway plays an important role in tumor immunity and tumor cell proliferation and suggest that interrupting the pd1/pd - l1 signal pathway is a promising therapeutic strategy for cancer. apurinic / apyrimidinic endonuclease 1 (ape1) plays an important role in multiple biological processes. ape1, as a redox - active protein, also activates many transcription factors including nf-b and ap-1 to stimulate their dna binding activities through keeping the cysteine residues of the highly conserved dna binding domains of these transcription factors in the reduction state.22 overexpression and distribution in subcellular localization of ape1 have been found in a number of cancers and are correlated with invasion, metastasis, and chemo- or radio - resistance.23,24 however, deregulation of ape1 is not a consistent feature in all tumors, therefore the role of ape1 in tumorigenesis is currently under debate. one previous study suggested that inhibiting the redox function of ape1 could hinder prostate cancer cell proliferation by reducing the nf-b and dna binding activity.25 in contrast, another study found that inhibiting the expression of ape1 and vegf proteins decreased cell proliferation and angiogenesis in osteosarcoma.26 similarly, it was proposed that ape1 overexpression enhanced the tumorigenesis of gastric cancer.27 but the relationship between ape1 and the tumorigenesis in gastric cancer is still unclear. a number of studies have shown that the expressions of pd - l1 and ape1 are related to tumor cell proliferation, indicating that both pd - l1 and ape1 can potentially play an important role in the pathogenesis of gastric cancer.28,29 however, the relationship of ape1 and pd - l1 coexpression in tissue type, metastasis, and prognosis of gastric cancers has not yet been reported. in this study, we examined the association between pd - l1 and ape1, especially pd - l1, and tumor immunity in gastric cancer. we analyzed pd - l1 and ape1 gene expression in 107 gastric cancer samples and their relationship with clinical pathological characteristics. the study group consisted of 107 gastric cancer patients (71 male and 36 female, aged between 30 and 82 years old, mean age 60.5 years). patients were consecutively enrolled from january 2009 to december 2013 in daping hospital, third military medical university (chongqing, people s republic of china) without restriction of age, gender, histology, or stage. all patients were newly diagnosed with gastric carcinoma based on pathological examination and underwent surgical treatment in daping hospital. no patient received chemotherapy or radiotherapy before surgery. at recruitment, informed consent was obtained from each subject, and each participant was then interviewed to solicit detailed information on demographic characteristics. polyclonal anti - human pd - l1/cd274 antibody was purchased from genetex (san diego, ca, usa) ; mouse monoclonal antibody against ape1 (1:3,000) was purchased from santa cruz biotechnology inc. immunohistochemistry was performed using the dako elivision plus two - step system (dako denmark a / s, glostrup, denmark) according to the manufacturer s instructions. in brief, tissues were fixed with formalin, processed and embedded in paraffin wax, and cut into 3 mm - thick sections by microtome. the sections were dewaxed and incubated with 3% h2o2 for 10 minutes to block endogenous peroxidase activity, followed by washing twice with phosphate - buffered saline (ph 7.4). then, the sections were incubated with anti - human pd - l1 (1:100) or anti - human ape1 (1:3,000) antibody at 4c overnight. after washing twice with phosphate - buffered saline, the sections were further processed using immuno - bridge + immunohistochemical staining system (gbi, bothell, wa, usa) according to the instructions provided by the manufacturer. reactivity was detected using dab reagent sets (sino - american biotechnology, beijing, people s republic of china), and the cells were counterstained with hematoxylin. random count 10 hpf of 1,000 tumor cells were counted and graded as follows : negative () : positive cells rate 0.05). meier analysis demonstrated that ape1 positive expression was a marker of poor prognosis in gastric cancer patients (p=0.035) (figure 3). these results show that ape1 expression is upregulated in gastric cancer and is a marker of poor prognosis in patients with gastric cancer. we next analyzed the relationship between coexpression of ape1 and pd - l1 and the clinical features and prognosis in gastric cancer patients. we found that 49.5% (53/107) of gastric cancer tissues demonstrated both ape1 and pd - l1 positive expression. spearman s rank correlation analysis showed that ape1 and pd - l1 expression in gastric cancer were positively correlated (r=0.336, p0.05). meier analysis demonstrated that ape1 positive expression was a marker of poor prognosis in gastric cancer patients (p=0.035) (figure 3). these results show that ape1 expression is upregulated in gastric cancer and is a marker of poor prognosis in patients with gastric cancer. we next analyzed the relationship between coexpression of ape1 and pd - l1 and the clinical features and prognosis in gastric cancer patients. we found that 49.5% (53/107) of gastric cancer tissues demonstrated both ape1 and pd - l1 positive expression. spearman s rank correlation analysis showed that ape1 and pd - l1 expression in gastric cancer were positively correlated (r=0.336, p 2 years patients (73.3%). high expression of ape1 suggested that there might be significant direct dna damage. taken together, we speculate that ape1 is involved in the invasion and metastasis of gastric cancer and ape1 expression may have utility in the prognostication of gastric cancer. interestingly, we found that pd - l1 and ape1 were coexpressed in 49.5% of gastric cancer patients and this was associated with the extent of tumor invasion (p<0.05). in kaplan meier analysis, pd - l1 and ape1 coexpression was significantly related to a poor prognosis (p=0.003). further spearman s rank correlation analysis showed that the expression of ape1 and pd - l1 in gastric cancer was positively correlated (r=0.336, p<0.336). these results suggest that pd - l1 and ape1 might have some correlation with tumor proliferation and infiltration. recently, it was found that stat3 controls ape1 gene expression in the liver.44 conversely, it has also been shown that ape1 directly regulates stat3 expression through its redox (oxidation reduction) function in pancreatic cancer.45 these facts suggest that ape1 might indirectly control pd - l1 expression through the regulation of stat3 and inhibition of ape1 may decrease stat3 and eventually lead to downregulation of pd - l1. multivariate analysis using the cox regression model showed that the depth of invasion could be considered as a significant prognostic factor (risk ratio 19.91 ; p=0.000). however, there was no significant relationship of pd - l1 and ape1 with other characteristics and prognosis, probably due to the close mutual relationships between ape1, pd - l1, and proliferation or infiltration of tumors. therefore, depth of infiltration may be an independent factor affecting gastric cancer survival, which has important clinical significance. the correlation analysis of clinical data characteristics and os using the kaplan meier method demonstrated that there was no significant correlation between age, sex, and os of patients. however, the tumor location (p=0.008), depth of invasion (p=0.000), lymph node metastasis (p=0.000), tumor differentiation (p=0.013), and pathological type (p=0.002) were significantly correlated to os (p<0.05). the median survival time of cardia cancer (222.42 months) was lower than that of gastric body (453.86 months) in the analysis of tumor location and os (p=0.003). the median survival time of tubular adenocarcinoma was the longest (41.0 months), while the median survival time of poorly differentiated carcinoma was the shortest (202.24 months, p=0.004). therefore, the high expression of pd - l1 and ape1 is a risk factor of gastric cancer and a new biomarker to predict the prognosis of gastric cancer, further indicating the potential therapeutic targeting value of the combination of pd - l1 and ape1 signaling pathways in advanced gastric cancer patients. to our knowledge, this is the first study to focus on the association between pd - l1, ape1, and gastric cancer. our findings suggest that the high expression of pd - l1 and ape1 is a risk factor of gastric cancer and a new biomarker to predict the prognosis of gastric cancer. | introductiongastric cancer is a fatal malignancy with a rising incidence rate. effective methods for early diagnosis, monitoring metastasis, and prognosis are currently unavailable for gastric cancer. in this study, we examined the association of programmed death ligand-1 (pd - l1) and apurinic / apyrimidinic endonuclease 1 (ape1) expression with the prognosis of gastric cancer.methodsthe expressions of pd - l1 and ape1 were detected by immunohistochemistry in 107 cases of human gastric carcinoma. the correlation of pd - l1 and ape1 expression with the clinicopathologic features of gastric carcinoma was analyzed by spss version 19.0.resultsthe positive expression rates of pd - l1 and ape1 in gastric cancer tissues were 50.5% (54/107) and 86.9% (93/107), respectively. pd - l1 and ape1 positive expressions were significantly associated with depth of invasion, lymph node metastasis, pathological type, overall survival, and higher t stage. furthermore, the expression of pd - l1 in highly differentiated gastric cancers was higher than that in poorly differentiated cancers (p=0.008). moreover, the expression of ape1 and pd - l1 in gastric cancers was positively correlated (r=0.336, p<0.01). multivariate analysis showed that the depth of invasion was a significant prognostic factor (risk ratio 19.91 ; p=0.000), but there was no significant relationship with pd - l1, ape1, prognosis, and other characteristics.conclusionthe deregulation of pd - l1 and ape1 might contribute to the development and the poor prognosis of gastric cancer. our findings suggest that high expression of pd - l1 and ape1 is a risk factor of gastric cancer and a new biomarker to predict the prognosis of gastric cancer. furthermore, our findings suggest that targeting the pd - l1 and ape1 signaling pathways may be a new strategy for cancer immune therapy and targeted therapy for gastric cancer, especially in patients with deep invasion and lymph node metastasis. |
chemicals : all chemicals were purchased from sigma - aldrich corporation (st. louis, mo, u.s.a.) unless stated otherwise. plant material, preparation and isolation of trans--viniferin : the leaf and stem of v. amurensis were gathered on keryong mountain in daejeon, korea. botanical identification and isolation of trans--viniferin were performed by professor ki - hwan bae at the herbarium of the college of pharmacy, chungnam national university, korea. dried leaf and stem of v. amurensis (4.6 kg) were extracted using methanol (meoh) (15 l 24 hr 3 times) at room temperature, filtered and concentrated to yield an meoh extract (658 g). trans--viniferin (1,148 mg) was obtained from an meoh extract after purification by silica gel column chromatography. ovary collection, recover and in vitro oocyte maturation : ovaries of prepubertal gilts were collected from a commercial abattoir and transported to the laboratory within 2 hr in 0.9% (w / v) nacl solution supplemented with penicillin - g (100 iu / ml) and streptomycin sulfate (100 mg / l) at 30 to 35c. the follicular fluid with oocytes was aspirated from 3- to 6-mm antral follicles with a 10-ml disposable syringe and 18-gauge needle and collected in a 15-ml centrifuge tube. cumulus - oocyte complexes (coc) were recovered under a stereomicroscope ; those with at least three layers of compact cumulus cells and homogenous cytoplasm were selected for ivm. the selected cocs were washed three times in a hepes - buffered tyrode s medium containing 0.05% (w / v) polyvinyl alcohol (tlh - pva) and transferred into 500 l of tissue culture medium 199 (life technologies, rockville, md, u.s.a.) supplemented with 26 mm sodium bicarbonate, 0.91 mm sodium pyruvate, 0.57 mm cysteine, 10 ng / ml epidermal growth factor, 0.5 iu / ml porcine luteinizing hormone, 0.5 iu / ml porcine follicle stimulating hormone, 10% (v / v) porcine follicular fluid (pff), 75 g / ml penicillin - g and 50 g / ml streptomycin. after centrifugation at 1,600 g for 30 min, the supernatants were collected and filtered sequentially through 1.2- and 0.45-m syringe filters (gelman sciences, ann arbor, mi, u.s.a.). the selected cocs were washed three times in oocyte maturation medium containing hormone supplements, and approximately 5060 oocytes were transferred into each well of a 4-well nunc dish (nunc, roskilde, denmark) containing 500 l of culture medium and equilibrated at least 2 hr with 5% co2 at 39c in a humidified atmosphere. after 22 hr of maturation with hormones, the oocytes were washed twice in a maturation medium without hormone supplements and then cultured for 22 hr without hormone supplements at 39c under 5% co2 in air. assessment of nuclear maturation : after 44 hr of culture, oocytes were stained with 10 g / ml hoechst 33342 in absolute alcohol, visualized under epifluorescence microscopy (330385 nm ; at a magnification of 400) and assessed for nuclear progression. oocyte nuclear maturation status was classified as germinal vesicle (gv), metaphase i, anaphase - telophase i and metaphase ii (mii) according to meiotic maturation stage. measurement of ros and intracellular gsh levels : the ivm oocytes were sampled 44 hr after ivm to determine intracellular ros and gsh levels. ros and gsh levels were measured by methods previously described [37, 41 ]. briefly, h2dcfda (2,7-dichlorodihydrofluorescein diacetate ; invitrogen) and celltracker blue cmf2hc (4-chloromethyl-6.8-difluoro-7-hydroxycoumarin ; invitrogen) were used to detect intracellular ros as green fluorescence and gsh level as blue fluorescence, respectively. ten oocytes from each treatment group were incubated (in the dark) for 30 min in tlh - pva supplemented with 10 m h2dcfda and 10 m celltracker. after incubation, oocytes were washed with d - pbs (invitrogen, carlsbad, ca, u.s.a.) containing 0.1% (w / v) pva and placed into 10 l microdrops, and fluorescence was observed under an epifluorescence microscope (te300 ; nikon, tokyo, japan) with uv filters (460 nm for ros and 370 nm for gsh). the fluorescence intensities of oocytes were analyzed with the image j software (version 1.41o ; national institutes of health, bethesda, md, u.s.a.) and normalized to the control. we performed another gsh measurement method for more accurate determination of each oocyte s gsh value. after ivm (4244 hr), the oocytes were stripped of surrounding cumulus cells by repeated pipetting, and matured oocytes (defined as oocytes in which the first pb was visualized under a stereomicroscope) were selected for gsh measurement. briefly, mii oocytes from each group were washed three times in 0.2 m sodium phosphate buffer (na2hpo4, nah2po4 and 10 mm edta-2na, ph 7.2), and groups of 5060 oocytes (per sample) in 10 l sodium phosphate buffer were transferred to 1.7-ml microfuge tubes ; 10 l of 1.25 mm phosphoric acid (final concentration of 0.625 m h3po4) in distilled water was added to each sample. gsh concentrations in the oocytes were determined using a 5,5-dithio - bis-(2-nitrobenzoic acid) (dtnb)-gsh reductase (gssg) recycling assay. before the assay, the frozen samples were thawed at room temperature, vortexed, centrifuged and microscopically evaluated to ensure complete lysis of the oocytes. the supernatants were transferred to a 96-well microtiter plate, and for each sample, 700 l of 0.33 mg / ml nadph in 0.2 m assay buffer containing 10 mm edta (stock buffer, ph 7.2), 100 l of 6 mm dtnb in the stock buffer and 180 l of distilled water and 1 u per sample of gssg (sigma g3664, 441 u / ml) were added in a conical tube, mixed and immediately added to the sample. the plate was immediately placed in a microtiter plate reader, and optical density was measured with a 405-nm filter (emax, molecular devices, sunnyvale, ca, u.s.a.). standard curves were prepared for each assay, and gsh content per sample was determined using the standard curve. the gsh concentrations (pm / oocyte) were calculated by dividing the total concentration per sample by the total number of oocytes present in the sample. gene expression analysis by real - time polymerase chain reaction (rt - pcr) : rt - pcr was performed with 120 matured cocs at a time. after ivm, cocs were denuded by gently pipetting with 0.1% hyaluronidase, and oocytes were washed three times in tlh - pva. isolated cumulus cells and cumulus - free (or denuded) matured oocytes were separately selected under a stereomicroscope for the gene expression study. total rna was extracted using the trizol reagent (invitrogen), according to the manufacturer s protocol, and the total rna concentration was determined by measuring the absorbance at 260 nm. first - strand complementary dna (cdna) was prepared by subjecting 1 g of total rna to reverse transcription using moloney murine leukemia virus (mmlv) reverse transcriptase (invitrogen). to determine the conditions for logarithmic - phase pcr amplification of target mrna, 1-g aliquots were amplified using differing numbers of cycles. the housekeeping gene, cytochrome oxidase subunit 1 (1a), was pcr amplified to rule out the possibility of rna degradation and to control for the variation in mrna concentrations in the rt reaction. a linear relationship between the pcr product band visibility and the number of amplification cycles was observed for the target mrnas. the cdna was amplified in a 20-l pcr reaction, which contained 1 u taq polymerase (intron bio technologies, co., ltd., seongnam, korea), 2 mm dntp mix and 10 pm of each gene - specific primer. quantitative real - time pcr was performed with 1 l cdna template added to 10 l 2 x sybr premix ex taq (takara bio inc., otsu, japan) containing specific primers at a concentration of 10 pm each. the reactions were carried out for 32 cycles, and the cycling parameters were as follows : denaturation at 95c for 30 sec, annealing at 55c for 30 sec and extension at 72c for 30 sec. all oligonucleotide primer sequences are presented in table 1table 1.sequences of the oligonucleotide primers and probe used in rt - pcrgeneprimer sequencesproduct size (bp)gene bank accession numberpcnaf : 5-cctgtgcaaaagatggagtg-3187xm_003359883r : 5-ggagagagtggagtggctttt-3bakf : 5-gcggaaaacgcctatgagta-3189xm_001928147r : 5-gcagtgatgcagcatgaagt-3baxf : 5-tgcctcaggatgcatctacc-3199xm_003127290r : 5-aagtagaaaagcgcgaccac-3dnmt1f : 5-cctctatggacggcttgagt-3185nm_001032355r : 5-ggtgcttgtccaggatgttg-3oct4f : 5-gcggacaagtatcgagaacc-3200nm_001113060r : 5-cctcaaaatcctctcgttgc-3bcl2f : 5-agggcattcagtgacctgac-3193nm_214285r : 5-cgatccgactcaccaatacc-3caspase-3f : 5-cgtgcttctaagccatggtg-3186nm_214131r : 5-gtcccactgtccgtctcaat-31-af : 5-caccgtaggaggtctaacg-3293ap_003428r : 5-gtatcgtcgaggtattccg-3. the fluorescence intensity was measured at the end of the extension phase of each cycle. the reaction cycle at which the pcr products exceeded this fluorescence intensity threshold was deemed the threshold cycle (ct) in the exponential phase of the pcr amplification. the expression of target gene was quantified relative to that of the internal control gene. the relative quantification was based on a comparison of cts at constant fluorescence intensity. the amount of transcript present was inversely related to the observed ct, and for every two - fold dilution in the amount of transcript, ct was expected to increase by 1. the relative expression (r) was calculated using the equation r=2[ct samplect control ]. to determine a normalized arbitrary value for each gene, every data point was normalized to the control gene as well as to its respective control. parthenogenesis : for parthenogenesis (pa), oocytes that reached the mii stage at 44 hr of ivm were activated with two pulses of 120 v / mm dc for 60 sec in 280 mm mannitol solution containing 0.01 mm cacl2 and 0.05 mm mgcl2. following electrical activation, pa embryos were treated with 0.4 g / ml demecolcine and 5 g / ml cytochalasin b in in vitro culture (ivc) medium for 4 hr, respectively. the pa embryos were washed three times with embryo culture medium and cultured in 25 l microdrops (10 gametes / microdrop) of porcine zygote medium 3 (pzm3). the embryos with cultured microdrops were covered with pre - warmed mineral oil and incubated at 39c for 168 hr under a humidified atmosphere of 5% o2, 5% co2 and 90% n2. in all experiments, the culture media were renewed at 48 hr (day 2) and 96 hr (day 4) after pa. in vitro fertilization : the ivf procedure performed was that reported by kwak.. for ivf, liquid semen was supplied weekly by the veterinary service laboratory (department of livestock research, yong - in city, gyeonggi - do, republic of korea) and kept at 17c for 5 days before use. the semen sample was washed twice by centrifugation with dulbecco s phosphate - buffered saline (dpbs) supplemented with 0.1% bsa at 2,000 g for 2 min. after washing, the sperm pellet was resuspended in modified tris - buffered medium (mtbm) that had been pre - equilibrated for 18 hr at 39c under 5% co2. after 44 hr of ivm, the cocs were denuded by gently pipetting with 0.1% hyaluronidase and washed three times in tlh - pva. groups of 15 oocytes were randomly placed into 40 l microdrops of mtbm in a 35 10 mm petri dish (falcon ; bd labware, franklin lakes, nj, u.s.a.) covered with pre - warmed mineral oil. after appropriate dilution, 5 l of the sperm suspension was added to a 40 l microdrop of fertilization medium (mtbm) to yield a final sperm concentration of 1 10 sperm / ml. just before fertilization, sperm motility was assessed, and more than 80% motile sperms were used in every experiment. to use stored liquid semen, the oocytes were co - incubated with sperms for 20 min at 39c in a humidified atmosphere of 5% co2 and 95% air. after 20 min co - incubation with sperm, the loosely attached sperms were removed from the zona pellucida (zp) by gentle pipetting. the oocytes were then washed three times in mtbm and incubated in mtbm without sperm for 56 hr at 39c in a humidified atmosphere of 5% co2 and 95% air. thereafter, gametes were washed three times with embryo culture medium and cultured in 25 l microdrops (10 gametes / microdrop) of pzm3. the embryos with cultured microdrops hr under a humidified atmosphere of 5% o2, 5% co2 and 90% n2. in all experiments, the culture media were renewed at 48 hr (day 2) and 96 hr (day 4) after ivf. experimental design : in experiment 1, the effect of trans--viniferin treatment during ivm on oocyte nuclear maturation was examined. oocytes were randomly allocated and cultured in ivm media supplemented with different concentrations of trans--viniferin (0, 0.1, 0.5, 1.0 and 5.0 m) for the whole culture period (44 hr). after ivm, nuclear maturation was evaluated by hoechst 33342 staining. in experiment 2, the effect of trans--viniferin treatment during ivm on the intracellular levels of gsh and ros was examined. oocytes were randomly allocated and cultured in ivm media supplemented with different concentrations of trans--viniferin (0, 0.5 and 5.0 m) for the whole culture period (44 hr). after ivm, the intracellular levels of gsh and ros were evaluated. in experiment 3, the effect of trans--viniferin treatment during ivm on the expression of proliferating cell nuclear antigen (pcna), octamer - binding transcription factor 4 (oct4), dnmt1, caspase-3, bcl-2 homologous antagonist killer (bak) and bcl-2associated x protein (bax) mrna in matured oocytes and bak, bax, caspase-3 and b - cell lymphoma 2 (bcl2) mrna in cumulus cells were analyzed. the mrna expression was compared in the control group and a treated (0.5 m) group. in experiment 4, the effect of trans--viniferin treatment during ivm on subsequent developmental competence in pa and ivf embryos was examined. a one - way analysis of variance with duncan s multiple - range test was used to assess nuclear maturation rate, gsh and ros levels, cleavage rate, developmental rate of blastocysts and total cell numbers. trans--viniferin treatment during ivm did not improve the nuclear maturation of oocytes in the treated groups compared with the control group (table 2table 2.effect of trans--viniferin treatment during porcine ivm on nuclear maturationtrans--viniferinconcentration (m)no. of oocytes culturedfor maturation% of oocytes at the stage ofgerminalvesiclemetaphase lanaphase andtelophase lmetaphase ll0 (control)1205.0 1.78.3 1.02.5 1.684.2 0.80.11204.1 2.18.3 1.00.8 0.886.6 1.40.51145.1 2.16.9 1.42.6 0.985.5 0.81.01205.8 3.78.3 2.22.5 1.683.3 1.95.01204.1 2.513.3 2.43.3 1.479.2 a, b) within a column, means without a common superscript differ (p<0.05).). the control group and treated groups had similar proportions of matured oocytes (mii, anaphase and telophase i stage rates : 84.2, 86.6, 85.5, 83.3 and 79.2% ; 2.5, 0.8, 2.6, 2.5 and 3.3% ; and 0, 0.1, 0.5, 1.0 and 5.0 m, respectively). there were significantly more immature oocytes in the 5.0 m treatment group than in the 0.5 m treatment group. the 5.0 m treatment group (13.3%) had an increased (p<0.05) number of mi stage oocytes as compared with the 0.5 m treatment group (6.9%). there were significantly fewer mature oocytes in the 5.0 m treatment group than 0.1 than in the 0.5 m treatment groups. the 5.0 m treatment groups (79.2%) had a decreased (p<0.05) number of mii stage oocytes as compared with the 0.1 and 0.5 m treatment groups (86.6 and 85.5%). a, b) within a column, means without a common superscript differ (p<0.05). trans--viniferin treatment increased (p<0.05) intracellular gsh levels and decreased (p<0.05) ros generation in mii oocytes after ivm (figs. 2 and 3fig. oocytes were stained with celltracker blue (a c) and h2dcfda (d f) to detect intracellular levels of glutathione and reactive oxygen species, respectively. metaphase ii (mii) oocytes derived from the maturation medium supplemented with 0.5 m trans--viniferin (b and e), 5.0 m trans--viniferin (c and f) or without trans--viniferin (a and d).fig. 3.effect of trans--viniferin in maturation medium on intracellular glutathione (gsh) and reactive oxygen species (ros) levels in in vitro matured porcine oocytes. a, b values with different superscripts are significantly different (p<0.05).). the 0.5 and 5.0 m trans--viniferin treatment groups showed significantly higher gsh levels as compared with the control group (0.5 and 5.0 m vs. control : 1.12 and 1.19 vs. 1.0 pixel / oocyte). additionally, the trans--viniferin treatment groups showed significantly reduced ros levels as compared with the control group (0.5 and 5.0 m vs. control : 0.14 and 0.13 vs. 1.0 pixel / oocyte). the gsh reductase recycling assay results revealed that the 5.0 m treatment group (16.11 pm / oocyte) had similar gsh levels as compared with the control group (14.57 pm / oocyte) (table 3table 3.effect of trans--viniferin in maturation medium on intracellular glutathione (gsh) concentration in in vitro - matured porcine oocytestrans--viniferin concentration (m)0 (control)0.55.0gsh concentration (pm / oocyte)(no. of oocytes examined)14.57 0.25(151)16.77 0.18(129)16.11 a, b) values with different superscripts are significantly different (p<0.05).). only the 0.5 m treatment group (16.77 pm / oocyte) showed significantly higher gsh levels as compared with the control group. oocytes were stained with celltracker blue (a c) and h2dcfda (d f) to detect intracellular levels of glutathione and reactive oxygen species, respectively. metaphase ii (mii) oocytes derived from the maturation medium supplemented with 0.5 m trans--viniferin (b and e), 5.0 m trans--viniferin (c and f) or without trans--viniferin (a and d). effect of trans--viniferin in maturation medium on intracellular glutathione (gsh) and reactive oxygen species (ros) levels in in vitro matured porcine oocytes. a, b) values with different superscripts are significantly different (p<0.05). the effects of trans--viniferin treatment during ivm on the expression of transcription factors and genes involved in apoptosis and cell proliferation in mature oocytes are shown in fig. sem expression of pcna, oct4, dnmt1, caspase-3, bak and bax mrna in matured oocytes treated with trans--viniferin during in vitro maturation. p<0.05 vs. control.. trans--viniferin treatment during ivm promoted higher (p<0.05) dnmt1 mrna expression in the 0.5 m treatment group as compared with the control. however, the expression of other genes (pcna, oct4, caspase-3, bak and bax) did not significantly differ from the control. mean sem expression of pcna, oct4, dnmt1, caspase-3, bak and bax mrna in matured oocytes treated with trans--viniferin during in vitro maturation. the effects of trans--viniferin treatment during ivm on the expression of apoptosis - related genes in cumulus cells are shown in fig. 5fig. 5.mean sem expression of bak, bax, caspase-3 and bcl2 mrna in cumulus cell treated with trans--viniferin during in vitro maturation. p<0.05 vs. control.. trans--viniferin treatment during ivm significantly reduced (p<0.05) bax mrna expression of cumulus cells in the 0.5 m treatment group as compared with the control. mean sem expression of bak, bax, caspase-3 and bcl2 mrna in cumulus cell treated with trans--viniferin during in vitro maturation. no significant differences in cleavage rates among the groups were observed for both pa and ivf embryos on day 2 (table 4table 4.effect of trans--viniferin treatment during ivm on embryonic development in porcine pa embryostrans--viniferinconcentration (m)no. of embryosculturedembryos developed to (%) total cell numberin blastocyst2cellblastocyst0 (control)9976.7 3.750.0 5.843.1 2.10.510675.8 1.152.3 1.759.6 4.25.09881.4 2.950.3 a, b) within a column, means without a common superscript differ (p<0.05).). about 7580% of pa embryos and 60% of ivf embryos cleaved in all groups (table 5table 5.effect of trans--viniferin treatment during ivm on embryonic development in porcine ivf oocytestrans--viniferinconcentration (m)no. of embryosculturedembryos developed to (%) total cell numberin blastocyst2cellblastocyst0 (control)14058.1 4.220.1 1.636.4 2.20.513759.6 3.126.3 3.753.6 4.05.013157.3 1.128.4 a, b) within a column, means without a common superscript differ (p < 0.05).). no significant differences in blastocyst formation were observed in pa and ivf embryos among the groups at day 7 (tables 4 and 5). approximately 50% of pa embryos and 2025% of ivf embryos developed to the blastocyst stage in all groups. the numbers of cells in the blastocysts of pa and ivf embryos increased (p<0.05) in the trans--viniferin treatment groups as compared with the control. total cell numbers of pa embryos increased significantly in the 0.5 and 5.0 m treatment groups (59.6 4.2 and 60.8 4.6) as compared with the control group (43.1 2.1) (table 4). ivf embryos showed similar results ; total cell number increased significantly in the 0.5 and 5.0 m treatment groups (53.6 4.0 and 47.9 3.1) as compared with the control group (36.4 2.2) (table 5). a, b) within a column, means without a common superscript differ (p<0.05). a, b) within a column, means without a common superscript differ (p < 0.05). in vitro swine embryo production systems are inefficient as compared with in vivo systems. incomplete cytoplasmic maturation is believed to result in abnormal fertilization, including polyspermy and asynchronous pronuclear formation, which are thought to be the major reasons for poor developmental competence of in vitro matured / fertilized embryos. the addition of various antioxidants has been examined in an attempt to improve the quality of in vitro produced embryos due to their protective effects during culture [1, 6, 35, 51 ]. no previous reports are available regarding the influence of trans--viniferin. we demonstrated that trans--viniferin treatment during ivm had beneficial effects on oocyte maturation, increasing intracellular gsh synthesis, reducing ros levels and increasing dnmt1 gene expression of oocytes ; reduced bax gene expression of cumulus cells ; and increased the total cell number of blastocysts in subsequent embryonic development of pa and ivf embryos. some differences were observed among the treatment groups, but there were no significant differences between the treatment groups and control group. resveratrol derivatives, including trans - resveratrol-4-o--d - glucoside, transresveratrol, (+) -ampelopsin a, trans--viniferin, cis--viniferin, -2-viniferin, gnetin h and suffruticosol a and b, have been isolated from more than 70 plant species including grapes, plums and peanuts [24, 39 ]. among these plants, trans--viniferin may have antioxidant effects as a hydroxyl radical scavenger in vivo [25, 29 ]. furthermore, trans--viniferin may inhibit glutamate - induced increases in intracellular calcium ion concentrations, ros generation, changes in apoptosis - related proteins and hypoxia - induced neuronal cell death in cultured neurons. jeong. reported that trans--viniferin protected against glutamate - induced neurotoxicity in cultured cortical neurons ; pretreatment of mouse cortical neurons with 5 m of trans--viniferin reduced the neuronal death induced by 500 m glutamate, and glutamate - induced neuronal death is usually associated with the elevation of intracellular calcium ion concentrations following nmda receptor activation. they also demonstrated that trans--viniferin at concentrations of 5.0 m showed significant inhibition of elevation of glutamate - induced intracellular calcium ion concentrations in cultured cerebral cortical neurons, the involvement of oxidative stress toxicity could be investigated by measurement of ros accumulation and trans--viniferin (0.5, 1.0 and 5.0 m) showed concentration - dependent inhibition of the glutamate - induced ros generation in cultured cerebral cortical neurons. similar antioxidative effects of trans--viniferin on porcine oocytes were observed in the present study. the 0.5 and 5.0 m trans--viniferin treatment during ivm effectively reduced ros levels and increased gsh levels, but did not show a concentration - dependent effect. it is estimated because of the difference between cell types and whether or not artificial induction of ros. this finding was most likely due to the antioxidative activity of intracellular gsh, which was increased by trans--viniferin treatment. we inferred that trans--viniferin was involved in cytoplasmic maturation rather than nuclear maturation and increased intracellular gsh levels in ivm oocytes, which contributed to improve oocyte quality. however, no beneficial effect of trans--viniferin treatment was found during blastocyst formation, even though trans--viniferin effectively reduced ros levels and increased gsh levels. many antioxidant compounds have been used to avoid oxidative stress during in vitro culture. transferrin, penicillamine, hypotaurine and taurine are often added to culture media, because positive effects of these compounds on embryo development have been observed [2, 4, 36, 38 ]. the positive effects of some plant extracts, such as anthocyanin and resveratrol, have also been reported [29, 51 ]. however, avoiding oxidative stress during oocyte and embryo culture is a complex problem. simply adding the necessary ros scavengers is insufficient, as the choice of antioxidant compounds to be used and their concentrations are difficult to ascertain. some compounds, such as thiols and vitamins, must be used with care, as they too can have a negative impact on the embryo [32, 43 ]. further, an excess of antioxidant compounds may have deleterious effects on the embryo. most studies have shown that prolonged experimentally induced ros production severely inhibits embryonic development. ros concentrations increase during the two four - cell transition period in mice, indicating that an increase in ros may be associated with the arrest of development at the two - cell stage. however, excessive reduction of ros after treatment with a high level of antioxidants has toxic effects on bovine embryonic development and the viability of human cultured cells [12, 41 ]. thus, ros may play a pivotal role in the regulation of cell proliferation and embryonic development. furthermore, an appropriate level of ros may be necessary for embryonic development and cell proliferation. in this study, trans--viniferin effectively reduced ros, but the level of ros was not appropriate ros for embryonic development. the blastocyst formation rate did not change, and only total cell number increased, which is a meaningful result. increased total cell number in mouse embryos is associated with improved embryo quality and postimplantation developmental potential. when koo. compared the total cell numbers of in vivo derived blastocysts to in vitro derived blastocysts and blastocysts derived from somatic cell nuclear transfer, total cell numbers varied from a mean of 122.5 for in vivo blastocysts (highest developmental potential) to 108.2 cells for in vitro derived blastocysts and 98.0 cells for nuclear transfer blastocysts (lowest developmental potential) in cattle. hence, the increased total cell numbers of blastocysts derived from cocs exposed to trans--viniferin could reflect improved embryo quality. gene expression patterns can indicate oocyte status and can be influenced by the culture environment.. pcna is an essential component of the dna replication and repair machinery, oct4 is essential for early development of mouse and human embryos [5, 22 ], dnmt1 is involved in dna methylation and cell proliferation and caspase-3, bak, bax and bcl2 are associated with apoptosis [15, 21 ]. activated caspase-3 cleaves numerous proteins, triggering biochemical cascades that lead to cell death. trans--viniferin (5.0 m) significantly blocked the glutamate - induced decrease in bcl-2 and increase in bax expression in cultured cerebral cortical neurons. in the current study, apoptosis - related gene (caspase-3, bak and bax) expression in oocytes was not altered. in cumulus cells, bax gene expression was significantly decreased in the treatment groups (p<0.05). during oocyte maturation, cumulus cells support oocytes via small molecule transport. reducing apoptosis of cumulus cells dnmt1 accumulates in oocytes during the growth phase and is in the cytoplasm of mature mii oocytes, where it maintains dna methylation and might also be involved in maintaining imprints. dna methylation gradually increases during germ cell development before fertilization [9, 53 ]. epigenetic markers, such as genomic methylation, regulate gene expression and development [19, 30 ]. interfering with the proper establishment of methylation can result in tumorigenesis and death [11, 16, 31 ]. therefore, maintaining appropriate methylation levels are important for embryonic development. increased dnmt1 expression in mii oocytes maintains high dna methylation before fertilization. in other words, trans--viniferin treatment improved cytoplasm quality by increasing dnmt1 expression. supplementation with trans--viniferin during ivm of porcine oocytes could help cytoplasmic maturation by increasing intracellular gsh concentrations and decreasing ros levels, leading to appropriate gene expression. but, trans--viniferin did not affect nuclear maturation, and it even showed adverse effects at a high concentration. improvement of oocyte cytoplasmic quality might cause an increase of total cell number of blastocysts during subsequent in vitro development. however, trans--viniferin treatment during ivm did not improve the subsequent blastocyst formation rate, and it was unclear how trans--viniferin affected the oocyte cytoplasm. the mechanism underlying the effects of trans--viniferin during ivm should be determined to identify ways to improve developmental competence during ivp. | abstracttrans--viniferin is a naturally occurring polyphenol belonging to the stilbenoid family that has been isolated from vitis amurensis, one of the most common wild grapes in asia. we investigated the effects of trans--viniferin on in vitro maturation (ivm) and developmental competence after in vitro fertilization (ivf) or parthenogenesis (pa). we observed that trans--viniferin treatment during ivm did not improve nuclear maturation rates of oocytes in any group, but significantly increased (p<0.05) intracellular glutathione (gsh) levels and reduced reactive oxygen species (ros) levels in the 0.5 m treatment group. trans--viniferin treatment during ivm of recipient oocytes promoted higher (p<0.05) expression of dna methyltransferase-1 (dnmt1) mrna in the 0.5 m treatment group as compared with the control group. however, the expression of essential transcriptional and apoptosis - related genes did not significantly differ from that of the control. in cumulus cells, pro - apoptosis gene expressions were changed as apoptosis decreased. oocytes treated with trans--viniferin during ivm did not have significantly different cleavage rates or blastocyst formation rates after pa, but total cell numbers were significantly higher (p<0.05) in the 0.5 and 5.0 m treatment groups compared with those in the control group. ivf embryos showed similar results. in conclusion, these results indicate that trans--viniferin treatment during porcine ivm increased the total cell number of blastocysts, possibly by increasing intracellular gsh synthesis, reducing ros levels, increasing dnmt1 gene expression of oocytes and decreasing pro - apoptosis gene expressions of cumulus cells. |
the following primary antibodies were used : mouse anti - wingless (1:1000 for standard protocol and 1:300 for extracellular staining ; dshb 4d4), rabbit anti - ha (1:1000, cell signalling), rat anti - ollas (1:10, abnova), chicken anti - gfp (1:1000, abcam), mouse anti - integrin (1:100, dshb cf.6g11), mouse anti - dlp (1:50, dshb 13g8), guinea pig anti - senseless (1:1000, gift from h. bellen), mouse anti - v5 (1:500, invitrogen), goat anti - gmap (1:100, gift from s. munro, mrc - lmb cambridge) guinea pig anti - godzilla (1:1500 ;). secondary antibodies used were alexa 488 and alexa 555 (1:500 for standard protocol and 1:250 for extracellular staining, molecular probes). imaginal discs were mounted in vectashield with dapi (vector laboratories) and imaged using either a leica sp5 or lsm710 confocal microscope. confocal images were processed with imagej (n.i.h), volocity (perkinelmer), zen2.0 (zeiss) and photoshop cs5.1 (adobe). all xy confocal images show a single confocal section, xz and yz projections were created using volocity. adult wings were mounted in euparal (fisher scientific) and imaged with a zeiss axiophot2 microscope with an axiocam hrc camera. l3 larvae were dissected and fixed in 4% formaldehyde - pbs, washed and quenched with 3% h2o2. discs were then post - fixed in 5% formaldehyde - pbtween and transferred to hybridisation buffer containing the wingless probe overnight. discs were washed and incubated with anti - dig (roche), then biotinylated anti - sheep (1:200, jackson laboratories) and the reaction was visualised with a tyramide signal amplification kit (perkin elmer). fly stocks were kept at 18c, 25c or 29c on a standard medium consisting of agar, cornmeal and yeast. crosses were performed at 25c unless they involved tub - gal80, in which case they were kept at 18c and moved to 29c when required (as indicated in the relevant figure). to inhibit endocytosis temporarily, shibire wandering l3 larvae were placed on a grape juice plate in a 34c water bath for the required time period and fixed afterwards. 2), larvae were heat shocked 48hr ael for 45 min at 37c and fixed 48hr later, at the wandering l3 stage. to generate godzilla mutant clones, ms1096-gal4 ; frt82b, godzilla / tm6 was crossed to uas - flp ; frt82b, ubi - gfp(s65t)nls, rps3 /tm6. to generate syb clones, frt42d, ubi - gfp / cyo was crossed to kr / cyo ; hh - gal4, uas - flp / tm3ser, generating frt42d, ubi - gfp(s65t)nls / cyo ; hh - gal4, uas - flp/+, which were subsequently crossed to frt42d, syb / cyo. to generate wg[f - wg - f - wg ], dnas encoding ollas and ha tagged wingless were synthesised (genewiz) and ligated in front of 1200bp of 3utr. the tags were inserted in triplicate, separated by a gly - gly spacer, between s and g. wingless-3utr and wingless-3utr were inserted sequentially in mcs and mcs3 of riv. the resulting construct, riv - f - wg - f - wg was inserted into the attp site of the wg. to generate flies allowing conditional expression of dominant negative godzilla, the godzilla cdna was mutated such that two conserved his of the ring domain (his255 and his258) reported to be involved in the coordination of zn ions would be substituted to arg. the resulting dna was ligated to dna encoding egfp to generate godzilla.ld.gfp and transferred between the ecori and xhoi sites of puast before p - element mediated transformation by bestgene (ca). to obtain animals expressing a gfp - frizzled2 fusion protein at endogenous level, dna encoding gfp followed by a loxp.pax-cherry.loxp cassette was inserted in the frizzled2 locus such that, after cre - mediated excision of the cassette, the endogenous gene product would contain gfp (green below), the peptide encoded by a single loxp site (blue below), and a gly - ser linker (red below), all inserted between a29 and d30 of frizzled2 (i.e. downstream of signal sequence). the engineered allele was confirmed by sequencing the junction between the dna sequences encoding gfp and frizzled2. a29vskgeel --- mdelykitsynvcytklcgssgssgssgsd30 shibire (a gift from cahir okane, cambridge university) frt82b, ubi - gfp(s65t)nls, rps3/tm6sb (bl 5627) frt42d, ubi - gfp(s65t)nls / cyo (bl 5626) frt2a, ubi - gfp (bl 1626) uas-yfp.rab5.q88l (bl 9774) uas - dcr2 ; en2.4-gal4, uas - egfp (bl 25752) uas - gzl (vdrc 109001kk) uas - syb (vdrc 102922kk) frt82b, godzilla / tm3sb frt42d, syb / cyo (a gift from cahir okane, cambridge university) hedgehog - gal4 and hedgehog - gal4, uas - flp / tb hedgehog - gal4, tub - gal80/tb, generated with tub - gal80 (bl7017) figure 2 a - j : wg[f - wg - f - wg]/uas - flp ; hedgehog - gal4, tub - gal80/+ figure 2 k - r : shibire figure 3 a - d : uas - gzlrnai/+ ; hedgehog - gal4/uas - mcd8.gfp figure 3 e, f : ms1096-gal4/+ ; uas - flp/+ ; frt82b, godzilla/ frt82b, ubi - gfp(s65t)nls, rps3 figure 3 g : (left ; control) frt42d/ frt42d, ubi - gfp(s65t)nls ; hedgehog - gal4, uas - flp/+, (right ; experimental) frt42d, syb/ frt42d, ubi - gfp(s65t)nls ; hh - gal4, uas - flp/+ figure 3 h : uas - sybrnai/+ ; hedgehog - gal4/uas - mcd8.gfp figure 3 i, j : frt42d, syb /frt42d, ubi - gfp(s65t)nls ; hedgehog -gal4, uas - flp/+ figure 4 a - c : uas - dcr2/+ ; en2.4-gal4, uas - egfp / uas - gzlrnai figure 4 e - g : uas - gzl.ld.gfp/+ ; hedgehog - gal4/+ figure 5 a : uas - notum - v5/cyo ; tub - gal80/+ @ 29c for 15 hrs before fixation figure 5 b : cg - gal4/uas - notum - v5 ; tub - gal80 @ 29c for 15 hrs before fixation figure 5 c : frizzled2 supplementary figure 1 : w supplementary figure 1 b : wg[f - wg - f - wg]/wg supplementary figure 1 c : wg[f - wg - f - wg]/+ ; hedgehog - gal4, uas - flp/+ supplementary figure 1 d - k : shibire supplementary figure 2 : yw hsflp/+ ; ; frt2a ubi - gfp / frt2a dally dlp supplementary figure 3 a, b : uas - gzlrnai/+ ; hedgehog - gal4/uas - mcd8.gfp supplementary figure 3 c : uas - gzlrnai / cyowglacz ; hedgehog - gal4/uas - mcd8.gfp supplementary figure 3 d : uas - sybrnai / cyowglacz ; hedgehog - gal4/uas - mcd8.gfp supplementary figure 4 a, b : ms10960-gal4/+ ; uas - yfp.rab5.q88l/+ supplementary figure 4 c : ms10960-gal4/+ ; uas - gzl.wt.gfp/+ supplementary figure 4 d - e : uas - gzl.ld.gfp/+ ; hedgehog - gal4/+ supplementary figure 5 : frizzled2 /frizzled2 the following primary antibodies were used : mouse anti - wingless (1:1000 for standard protocol and 1:300 for extracellular staining ; dshb 4d4), rabbit anti - ha (1:1000, cell signalling), rat anti - ollas (1:10, abnova), chicken anti - gfp (1:1000, abcam), mouse anti - integrin (1:100, dshb cf.6g11), mouse anti - dlp (1:50, dshb 13g8), guinea pig anti - senseless (1:1000, gift from h. bellen), mouse anti - v5 (1:500, invitrogen), goat anti - gmap (1:100, gift from s. munro, mrc - lmb cambridge) guinea pig anti - godzilla (1:1500 ;). secondary antibodies used were alexa 488 and alexa 555 (1:500 for standard protocol and 1:250 for extracellular staining, molecular probes). imaginal discs were mounted in vectashield with dapi (vector laboratories) and imaged using either a leica sp5 or lsm710 confocal microscope. confocal images were processed with imagej (n.i.h), volocity (perkinelmer), zen2.0 (zeiss) and photoshop cs5.1 (adobe). all xy confocal images show a single confocal section, xz and yz projections were created using volocity. adult wings were mounted in euparal (fisher scientific) and imaged with a zeiss axiophot2 microscope with an axiocam hrc camera. l3 larvae were dissected and fixed in 4% formaldehyde - pbs, washed and quenched with 3% h2o2. discs were then post - fixed in 5% formaldehyde - pbtween and transferred to hybridisation buffer containing the wingless probe overnight. discs were washed and incubated with anti - dig (roche), then biotinylated anti - sheep (1:200, jackson laboratories) and the reaction was visualised with a tyramide signal amplification kit (perkin elmer). fly stocks were kept at 18c, 25c or 29c on a standard medium consisting of agar, cornmeal and yeast. crosses were performed at 25c unless they involved tub - gal80, in which case they were kept at 18c and moved to 29c when required (as indicated in the relevant figure). to inhibit endocytosis temporarily, shibire wandering l3 larvae were placed on a grape juice plate in a 34c water bath for the required time period and fixed afterwards. endocytosis was restored by returning to 18c for the relevant time period before fixation. for the production of dally 2), larvae were heat shocked 48hr ael for 45 min at 37c and fixed 48hr later, at the wandering l3 stage. to generate godzilla mutant clones, ms1096-gal4 ; frt82b, godzilla / tm6 was crossed to uas - flp ; frt82b, ubi - gfp(s65t)nls, rps3 /tm6. to generate syb clones, frt42d, ubi - gfp / cyo was crossed to kr / cyo ; hh - gal4, uas - flp / tm3ser, generating frt42d, ubi - gfp(s65t)nls / cyo ; hh - gal4, uas - flp/+, which were subsequently crossed to frt42d, syb / cyo. to generate wg[f - wg - f - wg ], dnas encoding ollas and ha tagged wingless were synthesised (genewiz) and ligated in front of 1200bp of 3utr. the tags were inserted in triplicate, separated by a gly - gly spacer, between s and g. wingless-3utr and wingless-3utr were inserted sequentially in mcs and mcs3 of riv. the resulting construct, riv - f - wg - f - wg was inserted into the attp site of the wg. to generate flies allowing conditional expression of dominant negative godzilla, the godzilla cdna was mutated such that two conserved his of the ring domain (his255 and his258) reported to be involved in the coordination of zn ions would be substituted to arg. the resulting dna was ligated to dna encoding egfp to generate godzilla.ld.gfp and transferred between the ecori and xhoi sites of puast before p - element mediated transformation by bestgene (ca). to obtain animals expressing a gfp - frizzled2 fusion protein at endogenous level, dna encoding gfp followed by a loxp.pax-cherry.loxp cassette was inserted in the frizzled2 locus such that, after cre - mediated excision of the cassette, the endogenous gene product would contain gfp (green below), the peptide encoded by a single loxp site (blue below), and a gly - ser linker (red below), all inserted between a29 and d30 of frizzled2 (i.e. downstream of signal sequence). the engineered allele was confirmed by sequencing the junction between the dna sequences encoding gfp and frizzled2. shibire (a gift from cahir okane, cambridge university) frt82b, ubi - gfp(s65t)nls, rps3/tm6sb (bl 5627) frt42d, ubi - gfp(s65t)nls / cyo (bl 5626) frt2a, ubi - gfp (bl 1626) uas-yfp.rab5.q88l (bl 9774) uas - dcr2 ; en2.4-gal4, uas - egfp (bl 25752) uas - gzl (vdrc 109001kk) uas - syb (vdrc 102922kk) frt82b, godzilla / tm3sb frt42d, syb / cyo (a gift from cahir okane, cambridge university) hedgehog - gal4 and hedgehog - gal4, uas - flp / tb hedgehog - gal4, tub - gal80/tb, generated with tub - gal80 (bl7017) figure 2 a - j : wg[f - wg - f - wg]/uas - flp ; hedgehog - gal4, tub - gal80/+ figure 2 k - r : shibire figure 3 a - d : uas - gzlrnai/+ ; hedgehog - gal4/uas - mcd8.gfp figure 3 e, f : ms1096-gal4/+ ; uas - flp/+ ; frt82b, godzilla/ frt82b, ubi - gfp(s65t)nls, rps3 figure 3 g : (left ; control) frt42d/ frt42d, ubi - gfp(s65t)nls ; hedgehog - gal4, uas - flp/+, (right ; experimental) frt42d, syb/ frt42d, ubi - gfp(s65t)nls ; hh - gal4, uas - flp/+ figure 3 h : uas - sybrnai/+ ; hedgehog - gal4/uas - mcd8.gfp figure 3 i, j : frt42d, syb /frt42d, ubi - gfp(s65t)nls ; hedgehog -gal4, uas - flp/+ figure 4 a - c : uas - dcr2/+ ; en2.4-gal4, uas - egfp / uas - gzlrnai figure 4 e - g : uas - gzl.ld.gfp/+ ; hedgehog - gal4/+ figure 5 a : uas - notum - v5/cyo ; tub - gal80/+ @ 29c for 15 hrs before fixation figure 5 b : cg - gal4/uas - notum - v5 ; tub - gal80 @ 29c for 15 hrs before fixation figure 5 c : frizzled2 supplementary figure 1 : w supplementary figure 1 b : wg[f - wg - f - wg]/wg supplementary figure 1 c : wg[f - wg - f - wg]/+ ; hedgehog - gal4, uas - flp/+ supplementary figure 1 d - k : shibire supplementary figure 2 : yw hsflp/+ ; ; frt2a ubi - gfp / frt2a dally dlp supplementary figure 3 a, b : uas - gzlrnai/+ ; hedgehog - gal4/uas - mcd8.gfp supplementary figure 3 c : uas - gzlrnai / cyowglacz ; hedgehog - gal4/uas - mcd8.gfp supplementary figure 3 d : uas - sybrnai / cyowglacz ; hedgehog - gal4/uas - mcd8.gfp supplementary figure 4 a, b : ms10960-gal4/+ ; uas - yfp.rab5.q88l/+ supplementary figure 4 c : ms10960-gal4/+ ; uas - gzl.wt.gfp/+ supplementary figure 4 d - e : uas - gzl.ld.gfp/+ ; hedgehog - gal4/+ supplementary figure 5 : frizzled2 /frizzled2 | the apical and basolateral membranes of epithelia are insulated from each other, preventing the transfer of extracellular proteins from one side to the other1. thus, a signalling protein produced apically is not expected to reach basolateral receptors. evidence suggests that wingless, the main drosophila wnt is secreted apically in the embryonic epidermis2, 3. however, in the wing imaginal disc epithelium, wingless is mostly seen on the basolateral membrane where it spreads from secreting to receiving cells 4, 5. here we examine the apico - basal movement of wingless in wingless - producing cells of wing imaginal discs. we find that it is presented first on the apical surface before making its way to the basolateral surface, where it is released and allowed to interact with signalling receptors. we show that wingless transcytosis involves dynamin - dependent endocytosis from the apical surface. subsequent trafficking from early apical endosomes to the basolateral surface requires godzilla, a member of the rnf family of membrane - anchored e3 ubiquitin ligases. without such transport, wingless signalling is strongly reduced in this tissue. |
the aim of this report is to describe a single case of vitiligo induced by carbamazepine. the case was a patient with bipolar i disorder whose medications were changed from valproate to carbamazepine and who developed vitiligo after a short while. when depigmentation occurred, we immediately discontinued carbamazepine after which the depigmented areas improved gradually. about three years later, he received carbamazepine again, but depigmentation did not recur. carbamazepine - induced vitiligo is not an absolute contraindication for the prescription of carbamazepine if other choices fail to respond or are not tolerated. the patient was a 34 -year -old male with a diagnosis of bipolar i disorder who was admitted to iran psychiatric hospital with a manic episode with psychotic features in september 2007, and this was his first manic episode. he received sodium valproate as well as antipsychotic medications for the active phase treatment and was stabilized on 600 mg of valproate. in the post - discharge follow up, the tremor was mainly of a postural type and was so severe that made eating, drinking and shaving very difficult for the patient. propranolol was added and titrated up to 120 mg, but was not successful in controlling the tremor. therefore, valproate was tapered and replaced with carbamazepine to a total dose of 800 mg / d. nearly one month later, areas of depigmentation appeared on the patient s face (figure 1). although depigmentation decreased gradually in the next two months, it could still be observed in an attenuated form in a close inspection. then, lithium was tapered to discontinuation and a combination of lamotrigine (up to 100 mg / d) and olanzapine (10 mg / d) was the next treatment choice. despite a mild tremor, the patient remained well for the following 18 months when he was admitted for one week in march 2011 for an episode of methamphetamine- induced psychotic disorder. after discharge, the patient was visited by a physician unaware of his history of vitiligo who decided to change the medications from lamotrigine and olanzapine to carbamazepine and aripiprazole. it seemed that the decision had been made to decrease the side effects of the drugs (weakness, dryness of mouth, and tremor). the patient continued to improve and vitiligo did not recur (or was not aggravated) after re - challenging the patient with carbamazepine for the following 6 months. currently, the patient is receiving carbamazepine (800 mg / d) and aripiprazole (20 mg / d) and remains in remission and is trying to get a job (figure 2). few case reports of medication - induced vitiligo have reported the following mechanisms for this condition : activation of t cd8 + cells against melanocytes, apoptosis of melanocytes as a direct effect of the drugs, and damage to sympathetic nerves(3). although a single case can not prove or rule out any of the proposed mechanisms, reviewing the history of this case could be informative. the reversibility of vitiligo in this case shows that the involved mechanism should not be a totally irreversible cellular change like apoptosis of melanocytes or permanent damage in sympathetic nerves at least in the early stages of medication - induced vitiligo. on the other hand, non - recurrence of vitiligo with re - challenge of carbamazepine suggests that some kind of immunity or desensitization has developed. the latter point is against the direct cytotoxic effects of medications on induction of vitiligo. we would like to emphasize that the patient also used other medications when the skin condition appeared. therefore, it is theoretically possible that these medications (such as propranolol or antipsychotic drugs) would be related to vitiligo. however, the temporal relationship of vitiligo appearance and the used medication suggests that carbamazepine is the most probable culprit for inducing vitiligo. the other limitation of the current report is that we did not use additional methods to confirm the diagnosis, like skin biopsy or wood s lamp examination. because the patient did not show any other signs or symptoms of other autoimmune diseases finally, we would like to suggest that the appearance of carbamazepine - induced vitiligo is not an absolute contraindication for the prescription of carbamazepine if other choices fail to respond or are not tolerated. | objectivevitiligo is a rare side effect of carbamazepine whose exact mechanism is unknown. the aim of this report is to describe a single case of vitiligo induced by carbamazepine.methodsthe case was a patient with bipolar i disorder whose medications were changed from valproate to carbamazepine and who developed vitiligo after a short while. we followed the case for about four years when he was rechallenged with carbamazepine.resultswhen depigmentation occurred, we immediately discontinued carbamazepine after which the depigmented areas improved gradually. about three years later, he received carbamazepine again, but depigmentation did not recur.conclusioncarbamazepine-induced vitiligo is not an absolute contraindication for the prescription of carbamazepine if other choices fail to respond or are not tolerated. the case has implications for the mechanism of medication induced vitiligo. |
tubulointerstitial fibrosis (tif) is the final manifestation of end stage renal disease (esrd) and renal injury is correlated to the degree of renal interstitial fibrosis. one of the major pathological characteristics of tif is the activated tubulointerstitial fibroblasts transdifferentiating into myofibroblasts. furthermore, extracellular matrix (ecm) secreted by fibroblasts deposits in the tubular interstitium and results in interstitial fibrosis. transforming growth factor- (tgf-). connective tissue growth factor (ctgf) has been receiving more and more attention for being one of the major downstream mediators of tgf-. peroxisome proliferator - activated receptor (ppar-) is a member of the ligand - activated nuclear transcriptional superfamily and is expressed in several tissues which includes kidney [25 ]. ppar- is activated by its ligand, 15-deoxy--prostaglandin j2 (15d - pgj2), or activators (synthetic thiazolidinedione ppar- agonists) and then participates in the regulation of cellular function. apart from maintaining glucose homeostasis studies have shown that ppar- could control glomerular inflammation, modulate vasodilator substances like prostaglandins and no [6, 7 ], antagonize glomerulosclerosis of diabetic nephropathy, and improve renal function. in a rat remnant kidney model of renal fibrosis, administration of the ppar- agonist troglitazone ppar- agonists could exert antifibrotic effects on human ptc in high glucose levels by attenuating the production of ap-1, tgf-1, and the downstream production of the extracellular matrix protein fibronectin [8, 9 ]. ppar- activation also decreases glomerular cell proliferation and suppresses plasminogen activator inhibitor-1 (pai-1) and tgf- expression. furthermore, it down - regulated tgf-1-induced fibronectin expression in mouse glomerular mesangial cells by inhibiting activator protein-1 (ap-1) [1113 ] ; but the relationship between ppar- and tubulointerstitial fibrosis is not clear yet. by studying the effects of ppar- activation on tgf--induced fibrosis and its mechanism, our study demonstrates the potential perspective for the antifibrotic property of ppar- agonists. nrk-49f, the immortalized rat kidney interstitial fibroblast cells were obtained from the chinese academy of sciences. cells were maintained in dmem / f-12 medium supplemented with 10% heat - inactivated fetal calf serum (gibco / brl) in a humidified atmosphere of 5% co2/95% air at 37c. the cells were passaged every 4 days and then harvested onto six - well culture plates to 6070% confluence in the complete medium for 16 hours followed by changing to serum - free medium. tgf-1, 15d - pgj2, troglitazone, and ciglitazone (biomol research laboratories, inc., plymouth meeting, pa) were freshly dissolved in culture media and added to the cultures at the indicated concentrations and for the indicated time periods. total rna from nrk/49f cells was isolated by using a trizol extraction kit (gibco / brl) according to the manufacturer s directions. first - strand cdna was synthesized using 2 g of rna in 20 l of reaction buffer by reverse transcription using moloney murine leukemia virus - derived reverse transcriptase (promega). complementary dna was amplified in 100 l total volume which contained 50 mmol / l kcl, 20 mmol / l tris - hcl (ph 8.0), 10 mmol / l deoxynucleoside triphosphate (dntp), 1.5 mmol / l mgcl2, 1u taq polymerase, and 10 pmol of specific pcr primers. beta - actin was amplified and yielded a 202 bp pcr product as the internal standard. the number of cycles used allowed quantification without saturation. amplification products were separated by electrophoresis on 1.2% agarose gel, followed by ethidium bromide staining, and then photographed. semiquantitation was done by serial dilution of the input cdna to measure the mrna. the proportion of specific gene product to -actin product was used for semiquantitive analysis. extracted protein was loaded on a 10% sds - page gel and transferred onto nitrocellulose membranes. then proteins were then blocked and incubated with specific antibodies : -actin (sigma - aldrich), fibronectin (gibco), type iii collagen (sigma), smad2/3, or p - smad2/3 (santa cruz biotechnology, calif, usa). membranes were subsequently washed, incubated with specific secondary horseradish peroxidase conjugated antibodies, and revealed with the enhanced chemiluminescence (ecl) kit (life science products, boston, mass, usa). all experiments were repeated at least three times, and the results are presented as mean standard deviation (sd). tgf-1-induced ctgf, fn, and col iii mrna expression in a dose - dependent and time - dependent manner in nrk/49f cells. the induction of ctgf and ecm expression is a hallmark of renal fibrosis in many types of primary glomerular disease. therefore, we first examined the effect of tgf-1 on ctgf and ecm expression in cultured nrk/49f cells. as shown in figures 1and 2, nrk/49f cells had basal expression of ctgf, fn, and col iii mrna. after stimulating with different concentration of tgf-1, the expression of ctgf, fn, and col iii mrna increased significantly in a dose - dependent manner (see figure 1). after stimulating at 1 ng / ml tgf-1 for 1 hour, the expression of ctgf, fn, and col iii mrna began to increase (p after stimulating by tgf-1 for 15 minutes, p - smad2/3 protein expression began to increase, peaked at 1 hour, then began to decrease at 2 hours. there was no difference of total smad2/3 protein expression. to explore the molecular mechanism by which ppar- agonists inhibit tgf-1-mediated renal fibroblast activation, we studied the effect of 15d - pgj2, troglitazone, and ciglitazone on smad signalling pathway. as shown in figure 7, pretreatment of nrk/49f fibroblasts with 15d - pgj2, troglitazone, and ciglitazone was able to block smad phosphorylation. there was no difference in each interfering group (p >.05). tubulointerstitial fibrosis (tif) is the final manifestation of end stage renal disease (esrd). the major pathological changes of tif are the proliferation of interstitial fibroblasts, transdifferentiation of fibroblast into myofibroblasts (the major characteristic of which is the increase of -smooth muscular actin expression), and overdepositing of extracellular matrix (ecm) such as fibronectin and collagen type i, type ii, and type iv. of all the cytokines and growth factors involved, tgf-1 plays the most important role. anti - tgf-1 antibody and anti - tgf- receptor antibody could reduce the production of ecm. as tgf-1 has many biological effects, suppression of tgf-1 expression / activation or blocking tgf-1 at its receptors could result in many biological side effects. therefore, targeting the downstream mediators of the over - activated signaling pathway is a good way to antagonize the progression of esrd and thus become the prime focus of current studies. connective tissue growth factor (ctgf) is one of the downstream mediators of tgf-1-induced fibrosis and it participates in fibroblast proliferation and adhesion and in inducing ecm production. our study shows that nrk/49f had basal expression of -sma mrna until it is stimulated by tgf-1, whereupon its expression increased significantly, demonstrating that tgf-1 could induce tubulointerstitial fibroblasts to transdifferentiate into myofibroblasts. tgf-1 could increase the mrna expression of the downstream mediator ctgf and major constituents of ecm (collagen type iii and fibronectin) in a time - dependent and dose - dependent manner. our study demonstrates that tgf- is one of the major fibrosis - inducing mediators which could induce transdifferentiation of renal fibroblasts and production of ecm. recently, study by lin. showed that activation of smad3/4 was essential for tgf-1induced ctgf transcription and that pentoxifylline (ptx), a potent inhibitor of ctgf, could inhibit ctgf expression by interfering with smad3/4-dependent ctgf transcription through protein kinase a and block the profibrogenic effects of ctgf on renal cells. ppar- has now become the therapeutic target of research on kidney diseases like diabetic nephropathy, glomerulosclerosis, glomerulonephritis, and hypertensive nephropathy. 15d - pgj2 is the natural ligand of ppar-, and thiazolidinediones (tzds) such as troglitazone, and rosiglitazone are its agonists. it has been proven in animal models (streptozotocin - induced diabetic nephropathy models and 5/6 nephrectomized models) that tzds could reduce the expression of extraglomerular matrix and ameliorate renal injury. tzds and 15d - pgj2 could reduce production of collagen type i and fibronectin in rats [15, 16 ], and inhibit production of proinflammatory cytokines and chemotactic factors (e.g., no, cox-2, mcp-1, etc.) [17, 18 ]. tubulointerstitial fibroblasts could express basal amounts of ppar-. our unpublished study showed that ppar- could inhibit proliferation of human tubulointerstitial fibroblasts and trigger their apoptosis. our study found that 15d - pgj2, troglitazone, and rosiglitazone could reduce tgf--induced production of -sma and ecm (collagen type iii and fibronectin) and inhibit expression of ctgf mrna. these results show that ppar- agonists have an antifibrotic effect through inhibition of tgf--induced renal fibroblast transdifferentiation and ecm production. such results are similar to those results of studies on glomerulosclerosis and arteriosclerosis [1921 ]. exposure of human cortical fibroblasts to pioglitazone causes an antiproliferative effect and reduces ecm production through mechanisms that include reducing timp activity independent of tgf-1. different ppar- ligands or agonists may have different mechanisms in different cells and there are also ppar- independent pathways involved. baoling found that pioglitazone, and 15d - pgj2 could inhibit expression of fibronectin induced by tgf- in rats and the effects of pioglitazone are due to activation of ppar-. however, there were ppar--independent pathways involved in the mechanism of 15d - pgj2 action. whether ppar- inhibits tgf-1-induced fibrosis by activating intracellular ppar--receptors requires further study. sawano s study shows that 15d - pgj2 could downregulate il-1-induced cox-2 expression and troglitazone / rosiglitazone could not reduce the expression of cox-2. panzer found that in experimental glomerulonephritis induced by ats (antithymus antibody), troglitazone, and ciglitazone could upregulate mcp-1 expression and increase monocyte / macrophage infiltration and adhesion, however, 15d - pgj2 has no effect on mcp-1 expression. our study shows that troglitazone, and ciglitazone have a more inhibitory effect on -sma expression than 15d - pgj2. comparing the intervention of different reagents, the expression of ctgf, collagen type iii, and fibronectin shows no difference. phosphorylated smad2/smad3 (p - smad2/3) is the main signaling pathway of tgf-1 and it participates in the biological effects of tgf- which include cell proliferation, inflammation reaction, and fibrosis [24, 25 ]. they are essential mediators of tgf--induced endothelial cell transdifferentiation and ecm and ctgf expression. studies have shown that the tgf-/smads signaling pathway participates in many pathophysiological processes related to kidney diseases like diabetic nephropathy, glomerulonephritis and glomerulosclerosis. our study shows that tgf-1 induces smad2/3 phosphorylation in a time - dependent manner, which suggests that tgf- could induce smad2/3 phosphorylation in renal fibroblasts. 15d - pgj2, troglitazone, and ciglitazone could reduce tgf--induced p - smad2/3 protein expression while the total amount of smad2/3 protein did not change. such results suggest ppar- agonists could inhibit the fibrotic effect of tgf- by interfering in the phosphorylation of smad2/3. moreover, all three reagents show no significant difference in inhibiting phosphorylation of smad2/3. our study suggests that smad 2/3 signaling pathway is essential in antifibrotic effects of ppar- agonists. while in the study by yang., smad 2/3 phosphorylation was not inhibited by hepatocyte growth factor (hgf), which acts as a potent inhibitor of the tgf-1-mediated myofibroblastic activation therefore, further study is required to investigate role of smad signaling pathway in different inhibitors of tgf-1-mediated myofibroblastic activation. in conclusion such results suggest a perspective for the antifibrotic effects of ppar- and such effects may become the therapeutic target of esrd. | background. studies have shown that peroxisome proliferator - activated receptor- (ppar-) agonists could ameliorate renal fibrotic lesions in both diabetic nephropathy and nondiabetic chronic kidney diseases. in order to elucidate the antifibrotic mechanism of ppar- agonists, we investigated the effects of ppar- activation on tgf-1-induced renal interstitial fibroblasts. methods. in rat renal interstitial fibroblasts (nrk/49f), the mrna expression of tgf-1-induced -smooth muscle actin (-sma), connective tissue growth factor (ctgf), fibronectin (fn) and collagen type iii (col iii) were observed by reverse transcriptase - polymerase chain reaction (rt - pcr). the protein expressions of fn and smads were observed by western blot. results. in nrk/49f, tgf-1 enhanced ctgf, fn and col iii mrna expression in a dose- and time - dependent manner. -sma, ctgf, fn and col iii mrna and fn protein expression in 15-deoxy-12,14-prostaglandin j2 (15d - pgj2)-troglitazone- and ciglitazone - pretreated groups, respectively, were significantly decreased compared with the tgf-1-stimulated group. tgf-1 (5 ng / ml) enhanced p - smad2/3 protein expression in a time - dependent manner. compared with the tgf-1-stimulated group, p - smad2/3 protein induced by tgf-1 in ppar- agonists - pretreated groups significantly decreased with no statistical difference amongst the three pretreated groups. conclusion. ppar- agonists could inhibit tgf-1-induced renal fibroblast activation, ctgf expression and ecm synthesis through abrogating the tgf-1/smads signaling pathway. |
participants were recruited from two prospective studies : the prospective research in memory (prime) clinics study and the australian imaging, biomarkers and lifestyle (aibl) study of aging. only data and biochemical measurements pertaining to baseline visits were included in this analysis. the prime study recruited 970 participants from 9 sites in australia, including 3 each in victoria and new south wales and 1 each in queensland, western australia, and south australia. the aibl study of aging recruited 1,112 participants in victoria (60%) and western australia (40%). the study cohorts and methods of the prime and aibl studies are described elsewhere (26,27). a further 862 participants who resided in the barwon region of southeastern australia between 2001 and 2011 also were recruited through the cognitive, dementia and memory services clinic at the mckellar centre, a rehabilitation and aged - care facility. patients with ad who were seen at a geriatrician s private practice during the same period also were recruited (n = 935). the mini - mental state examination (mmse) was used to assess cognitive ability. subjects were assessed at scheduled visits during the prime and aibl studies or ad hoc during routine patient care. all participants with serum vitamin b12 measurements taken within 6 months of cognitive assessment were included. participants without serum measurements taken within 6 months of cognitive assessment (n = 1,015) were excluded. the data from records pertaining to subjects who were recruited from more than one source (n = 566) were merged. of the remaining participants, there were 121 with stroke and 566 with diagnoses other than ad, such as frontotemporal dementia, parkinson disease, dementia with lewy bodies, or mixed dementias. a further 291 participants were excluded because they had incomplete medical histories ; information that was missing included dates of birth, medication use, and comorbid conditions. a subgroup analysis was performed with participants who had diabetes (n = 104) or impaired glucose tolerance (n = 22). patients with type 1 diabetes were not specifically excluded, but there were none with serum vitamin b12 measurements taken within 6 months of cognitive assessment. reviewing committees included the barwon health human research ethics committee (hrec) (victoria), austin health hrec (victoria), st. vincent s hospital governance review unit (victoria), hunter new england hrec (new south wales), northern hospital network hrec (new south wales), northern sydney central coast hrec (new south wales), metro north health service district hrec (queensland), south metropolitan area health service hrec (western australia), and the queen elizabeth hospital ethics of human research committee (south australia). an ordinal logistic regression model was formed with categories of cognitive performance as the response variable and diabetes as a predictor. (mmse < 18 ; n = 137), mildly impaired (mmse 1823 ; n = 240), minimally impaired (mmse 2427 ; n = 295), and not impaired (mmse 2830 ; n = 682). the model was adjusted for age, sex, level of education, and depression because these factors were previously reported to affect mmse testing (28,29). (mmse < 18 ; n = 39), mildly impaired (mmse 1823 ; n = 40), minimally impaired (mmse 2427 ; n = 32), and not impaired (mmse 2830 ; n = 15). the effect of metformin on the cognitive performance of patients with diabetes was investigated in this model, which then was adjusted for serum vitamin b12 measurements and use of calcium supplements to investigate any possible interactions. there was insufficient information on use of other antidiabetic drugs, the duration of metformin use, and markers for socioeconomic status, diet, or exercise to investigate these variables. participants were recruited from two prospective studies : the prospective research in memory (prime) clinics study and the australian imaging, biomarkers and lifestyle (aibl) study of aging. only data and biochemical measurements pertaining to baseline visits were included in this analysis. the prime study recruited 970 participants from 9 sites in australia, including 3 each in victoria and new south wales and 1 each in queensland, western australia, and south australia. the aibl study of aging recruited 1,112 participants in victoria (60%) and western australia (40%). the study cohorts and methods of the prime and aibl studies are described elsewhere (26,27). a further 862 participants who resided in the barwon region of southeastern australia between 2001 and 2011 also were recruited through the cognitive, dementia and memory services clinic at the mckellar centre, a rehabilitation and aged - care facility. patients with ad who were seen at a geriatrician s private practice during the same period also were recruited (n = 935). aibl participants volunteered after an advertisement on television in late 2006. the mini - mental state examination (mmse) subjects were assessed at scheduled visits during the prime and aibl studies or ad hoc during routine patient care. all participants with serum vitamin b12 measurements taken within 6 months of cognitive assessment were included. participants without serum measurements taken within 6 months of cognitive assessment (n = 1,015) were excluded. the data from records pertaining to subjects who were recruited from more than one source (n = 566) were merged. of the remaining participants, there were 121 with stroke and 566 with diagnoses other than ad, such as frontotemporal dementia, parkinson disease, dementia with lewy bodies, or mixed dementias. a further 291 participants were excluded because they had incomplete medical histories ; information that was missing included dates of birth, medication use, and comorbid conditions. a subgroup analysis was performed with participants who had diabetes (n = 104) or impaired glucose tolerance (n = 22). patients with type 1 diabetes were not specifically excluded, but there were none with serum vitamin b12 measurements taken within 6 months of cognitive assessment. institutional review was performed at each study host site. reviewing committees included the barwon health human research ethics committee (hrec) (victoria), austin health hrec (victoria), st. vincent s hospital governance review unit (victoria), hunter new england hrec (new south wales), northern hospital network hrec (new south wales), northern sydney central coast hrec (new south wales), metro north health service district hrec (queensland), south metropolitan area health service hrec (western australia), and the queen elizabeth hospital ethics of human research committee (south australia). an ordinal logistic regression model was formed with categories of cognitive performance as the response variable and diabetes as a predictor. (mmse < 18 ; n = 137), mildly impaired (mmse 1823 ; n = 240), minimally impaired (mmse 2427 ; n = 295), and not impaired (mmse 2830 ; n = 682). the model was adjusted for age, sex, level of education, and depression because these factors were previously reported to affect mmse testing (28,29). categories were most impaired (mmse < 18 ; n = 39), mildly impaired (mmse 1823 ; n = 40), minimally impaired (mmse 2427 ; n = 32), and not impaired (mmse 2830 ; n = 15). the effect of metformin on the cognitive performance of patients with diabetes was investigated in this model, which then was adjusted for serum vitamin b12 measurements and use of calcium supplements to investigate any possible interactions. there was insufficient information on use of other antidiabetic drugs, the duration of metformin use, and markers for socioeconomic status, diet, or exercise to investigate these variables. participants were 5199 years old (mean age sd 73.8 8.3 years) ; females outnumbered males (59.5 vs. 40.5%). just more than half of the participants (50.4%) scored 2830 on the mmse and so were considered not impaired ; 21.8% were minimally impaired (mmse 2427), 17.7% were mildly impaired (mmse 1823), and 10.1% scored less than 18 on the mmse (most impaired). participants with diabetes were marginally older than participants without diabetes (75.5 vs. 73.6 years ; p = 0.013). the number of males was proportionally larger among participants with diabetes (46.8 vs. 39.9%), but this difference was not statistically significant. prevalence of depression was similar between participants with diabetes and those without diabetes (31.7 vs. 27.3% ; p = 1.000). the proportion of participants with a tertiary level of education was higher among participants without diabetes than participants with diabetes (39.3 vs. 22.2% ; p < 0.001). the number of participants who scored below 28 on the mmse was proportionally higher among participants with diabetes than those without diabetes (69.0 vs. 47.6% ; p = 1.000). after adjusting for age, sex, education, and depression, participants with type 2 diabetes had worse cognitive performance than participants without diabetes (adjusted or 1.51 [95% ci 1.032.21 ]). cognitive performance was better in younger participants, those without depression, and those with a higher level of education. the adjusted ors for each predictor are shown in table 1. cognitive performance in 1,354 participants who had ad or mci or were cognitively intact among participants with diabetes, cognitive performance was worse in patients who were taking metformin (adjusted or 2.23 [95% ci 1.054.75 ]). mmse scores were lower in participants with diabetes who used metformin (mean score sd 22.8 5.5) than in those who did not use metformin (24.7 4.4). participants with diabetes who had vitamin b12 levels < 250 mol / l also had worse cognitive performance (2.29 [1.124.66 ]). < 250 mol / l (22.9 4.7) than those with higher levels (25.0 4.7). each 1-year increase in age was associated with an 8% increased risk of impaired cognitive performance (or 1.08 [95% ci 1.031.13 ]). a secondary or tertiary level of education was the strongest predictor of better cognitive performance in patients with diabetes. the adjusted ors for each variable are shown in table 2. cognitive performance in 126 patients with either type 2 diabetes or impaired glucose tolerance in our series, patients with diabetes who were taking metformin had worse cognitive performance than participants who were not taking metformin. our observations agree with those previously reported by imfeld and colleagues (22), in particular that patients who are taking metformin may be at an increased risk for cognitive impairment. this association was weakened after adjusting for serum vitamin b12 levels ; thus any effect metformin has on cognitive performance may be at least partially mediated by altering serum vitamin b12 levels. alternatively, patients who are prescribed metformin may have worse glycemic control or diabetes - related complications than patients with diabetes who are not prescribed metformin, so there remains the potential for confounding, despite restricting the analysis to only patients with diabetes. however, because metformin is a first - line pharmacotherapy for the treatment of type 2 diabetes, this would seem unlikely (30). there was insufficient information regarding the duration of metformin use, the severity of diabetes (e.g., hba1c levels), duration of diabetes, or use of other antidiabetic drugs to enable us to investigate these effects in our study, particularly because these findings were based on a small sample. we recommend a larger study to examine the effect of dose and duration of metformin use, and the effects of other antidiabetic agents using a battery of cognitive assessments and following participants over a number of years. calcium supplements have previously been reported to reverse vitamin b12 deficiency induced by metformin. in this study, patients with diabetes who used calcium supplements were less likely to be cognitively impaired. however, calcium supplements have been reported to be associated with an increased risk for myocardial infarction in postmenopausal women and in patients with chronic kidney disease (3134). in contrast, a recent meta - analysis indicates that supplementation with both vitamin d and calcium is associated with a reduction in mortality compared with vitamin d supplementation alone (35). because this population already has increased cardiovascular risk (36), the safety of calcium supplementation in patients with diabetes treated with metformin would need to be established before such interventions could be recommended. patients with diabetes are at an increased risk for ad (10). in diabetes, amylin aggregation destroys the -cells of the pancreas (37). by the same mechanism metformin is a widely prescribed first - line monotherapy for type 2 diabetes but is associated with vitamin b12 deficiency and peripheral neuropathy. a case - control study of more than 14,000 patients reported that long - term metformin use was associated with an increased risk for ad in those 65 years old (22). metformin at pharmacological doses was reported to increase the expression of -secretase in cell culture ; this may be a possible disease mechanism (21). alternatively, metformin also impairs absorption of vitamin b12 via a drug interaction that occurs at the distal ileum. low serum vitamin b12 levels are associated with ad and other neurodegenerative diseases (38). the mmse may be inadequate for detecting differences between higher functioning adults (39). the mmse is sensitive to age, depression, and level of education, so all models were adjusted for these factors. most of our subjects were assessed during routine clinical care by clinicians who use the mmse as part of their standard assessment. in australia, documentation of cognitive impairment using an mmse score and improvement while receiving therapy is required to obtain subsidized antidementia therapies (40). more comprehensive assessment tools may be preferable for use in future investigations of cognitive impairment in at - risk populations such as those we have studied. increased monitoring of cognitive ability in patients with diabetes who use metformin is warranted, particularly among older adults (aged older than 50 years). vitamin b12 supplements are inexpensive and may improve the cognitive outcomes of patients with diabetes. adequately powered, prospective, controlled trials are warranted to investigate further the association between diabetes, cognitive decline, and the effect of metformin therapy, as well as the possible amelioration using vitamin b12 and/or calcium supplementation. | objectiveto investigate the associations of metformin, serum vitamin b12, calcium supplements, and cognitive impairment in patients with diabetes.research design and methodsparticipants were recruited from the primary research in memory (prime) clinics study, the australian imaging, biomarkers and lifestyle (aibl) study of aging, and the barwon region of southeastern australia. patients with alzheimer disease (ad) (n = 480) or mild cognitive impairment (n = 187) and those who were cognitively intact (n = 687) were included ; patients with stroke or with neurodegenerative diseases other than ad were excluded. subgroup analyses were performed for participants who had either type 2 diabetes (n = 104) or impaired glucose tolerance (n = 22).resultsparticipants with diabetes (n = 126) had worse cognitive performance than participants who did not have diabetes (n = 1,228 ; adjusted odds ratio 1.51 [95% ci 1.032.21 ]). among participants with diabetes, worse cognitive performance was associated with metformin use (2.23 [1.054.75 ]). after adjusting for age, sex, level of education, history of depression, serum vitamin b12, and metformin use, participants with diabetes who were taking calcium supplements had better cognitive performance (0.41 [0.190.92]).conclusionsmetformin use was associated with impaired cognitive performance. vitamin b12 and calcium supplements may alleviate metformin - induced vitamin b12 deficiency and were associated with better cognitive outcomes. prospective trials are warranted to assess the beneficial effects of vitamin b12 and calcium use on cognition in older people with diabetes who are taking metformin. |
the most prevalent fracture that trauma surgeons manage are those involving the distal radius, accounting for 16% of all fractures. nonoperative management is generally employed for stable nondisplaced fractures of the distal radius with the expectation of a good functional outcome [35 ]. although some authors suggest that functional outcome correlates with the anatomical reduction of the fracture [4, 68 ] others suggest that this may not be the case [911 ]. this disparity may be due to the heterogeneity of the reported cohorts, which vary in size, have a lack of standardised reporting, and often combine both intra- and extra - articular fractures within the reported series. in addition, multiple studies have reported cohorts with a wide age range ; in one series, the age difference between the youngest and oldest patients was 80 years [3, 1315 ]. however, age has been demonstrated to influence outcome and therefore may have skewed the results of these studies. it is predicted that there will be an increase in the elderly population over the next decade which is due to the 1950 's baby boomers, and currently the fastest growing age group in the western world is the it is anticipated that there will be an 81% increase in the scottish population who are aged 75 years or more by 2031. the term super - elderly has been used in orthopaedics to describe those patients greater than 80 years of age [18, 19 ]. these superelderly patients account for approximately 20% of all distal radial fractures, which will likely increase in the future due to their growing population and will form a greater proportion of the orthopaedic workload. the effect of a malunion upon the outcome of a distal radial fracture has been demonstrated to diminish with the increasing age. most studies reporting the outcome of distal radial fractures in the elderly, being defined as greater than 60 or 65 years of age, include low demand patients only [10, 21, 22 ]. the question remains as to whether a malunion results in an inferior outcome in superelderly patients due to their lower functional demands. furthermore, the reduction of distal radial fractures has been shown to be of minimal benefit in frail elderly patients [10, 21, 22 ], and same could be asked of surgical intervention. the primary aim of this study was to compare the functional outcome, both subjective and objective, of superelderly patients with and without malunion after a distal radial fracture. the secondary aim was to assess whether the final radiographic assessment of the distal radius correlated with range of motion and or function. a prospective database of 4024 distal radial fractures was compiled over a 67-month period at the study centre, which recorded the following : demographic, radiographic, management, and outcome of all patients. fifty - one patients who aged 80 years or older sustaining a displaced distal radial fracture with outcome data at one year and lived independently were retrospectively identified from this database and were defined as the study population. there were 50 females and one male with a mean age of 83.1 (80 to 93) years. fractures deemed to be in an acceptable position were managed with a dorsal plaster slab. if the fracture position was thought to be unacceptable, the emergency room staff, prior to application of a dorsal plaster slab, performed closed reduction using intravenous regional anaesthesia. the patients were evaluated clinically and radiographically at approximately one and six weeks after the injury as per the protocol of the study unit, which included radiographs of the normal, uninjured wrist performed at one week. at approximately one week following the injury, the patients were reviewed by the senior author in a dedicated research clinic. the clinical, demographic, and radiographic data were recorded and entered into a database either by the senior author or a research nurse. the premorbid normal level of function of the patients was categorised as independent if they were able to go shopping without assistance or as dependent if assistance was needed. the patients with a fracture that had maintained a good position had the dorsal slab completed to a below - the - elbow forearm cast with the wrist in slight flexion and ulnar deviation. patients with a fracture that had been displaced were admitted to the orthopaedic trauma unit for further intervention, unless the patient had low functional demands and operative intervention was deemed inappropriate. radiographs were repeated for the assessment of displacement. if surgical intervention had occurred, which was recorded, all radiographic measurements subsequent to surgery were used. all radiographs (presentation, time of reduction, one week, six weeks, and if preformed at one year) were measured manually with the use of a protractor and a ruler to provide values for the dorsal angle, and radial shortening. the dorsal angle and radial shortening were expressed as the difference between the injured side and the normal uninjured side. if the normal values were unavailable or the patient had a prior fracture of the uninjured side (n = 2), the mean values for the normal side were used. the type of metaphyseal comminution was recorded, according to the location, as absent or as involving the dorsal metaphysis, volar metaphysis, or both the dorsal and volar metaphysis. malunion was defined as a dorsal angle of > 10 degrees and or > 3 mm of radial shortening. functional assessment was carried out by a single dedicated research physiotherapist at approximately one year after the index fracture. objective measures assessed were range of movement (rom) and grip strength and subjective measures assessed included the presence of pain at the wrist, if the wrist had regained its normal functional status for them, and whether they could perform a number of activities of daily living (see below). rom measured at the wrist and distal radioulnar joints were performed using a standard full circle goniometer [29, 30 ]. intraobserver bias was minimised by careful technique and recordings were made in triplicate, and the mean of these measurements was recorded. the observer measured flexion, extension, pronation, supination, and radial and ulnar deviation for both the injured and uninjured sides. grip strength was measured using a jamar deluxe hand dynamometer, model 0030j4 (therapeutic equipment corporation, clifton, new jersey) [3133 ]. in accordance with the guidelines for the use of this device, issued by the american society for surgery of the hand, each patient was examined at a similar time of the day at each assessment in order to minimise the effects of diurnal variation. the grip strength of the nondominant hand was increased by 10% for comparative analysis with the dominant side. the presence or absence of pain was recorded for the injured wrist and whether they required analgesia because of their injury. patients were also asked whether they felt their wrist had returned to the preinjury functional state. in addition, they were asked whether they could carry out a number of daily tasks : carry a plate, hold a glass, hold a pan, turn a key, bolt a door, and write and whether they could use scissors, a knife, a needle, and a hammer. each of these ten tasks were assigned a score, one if they could not perform the task and two if they could ; these scores were combined to give a total score for each patient, which is a validated assessment tool. fisher 's exact test was used to compare the dichotomous variables (activities of daily living, presence of wrist pain, and return to normal use) and an unpaired t - test was used to compare differences of liner variables (grip strength and rom) between patients with and without malunion. pearson 's correlation coefficient was used to assess the relationship between dorsal angulation and radial shortening and rom at the wrist. a p value of 0.05 determined statistical significance. twenty - seven patients (52.9%) sustained a fracture of the right wrist and 24 patients (47.1%) sustained a fracture of the left wrist. the predominant mechanism was a fall from standing height (n = 48, 94.1%), and three patients (5.9%) fell down stairs. forty - three patients (84.3%) were independent, with eight needing help to carry out their shopping. tables 1 and 2 illustrate the distribution according to the ota and frykman classifications, respectively. the normal dorsal angle and ulna variance, of the uninjured side, were 8.3 degrees (sd 9.9 degrees) and + 1.2 mm (sd 1.7 mm), respectively. the mean dorsal angulation was 16.1 degrees (0 to 44 degrees, sd 14.9) and radial shortening was 2.2 mm (3 to 10 degrees, sd 2.6) for the injured side. thirty - five patients (68.6%) underwent manipulation within the emergency room setting, prior to application of a dorsal plaster slab. however, 16 of these 35 (45.7%) lost their satisfactory position and underwent surgery. the final radiographic measurements for the 19 who did not undergo surgery are included in table 3. two (10.5%) of the 19 patients who underwent manipulation only, without a later surgical intervention, went on to malunion. eighteen (35.2%) patients underwent surgery of which 7 had open reduction internal fixation, 10 had an external fixator, and one patient had manipulation with insertion of kirschner wires. four (22.2%) patients suffered minor pin tract infections, which resolved after oral antibiotics. the outcomes of the independent patients with and without malunion are compared in table 4 at a mean follow - up of 15 (6 to 20) months. no statistically significant difference was observed in activities of daily living, wrist pain, whether the wrist had returned to its normal level of function, grip strength, or rom. figure 2 illustrates no significant difference in the total loss in rom for those patients with and without malunion (p = 0.41). only one (12.5%) of the eight dependent patients suffered a malunion (odds ratio (or) 0.24, p = 0.24). if the dependent group was also included in the outcome analysis, the only statistically significant difference was observed for the ability to lift a pan of water (or 4.9, p = 0.03). the final dorsal angle correlated significantly (r = 0.3, p = 0.038) with the rom at the wrist (figure 3), with diminished rom being associated with increasing dorsal angulation. this correlation was not observed with radial shortening in isolation (r = 0.1, p = 0.46). in addition, there was no correlation between activities of daily living and dorsal angulation (r = 0.25, p = 0.10) or diminished rom (r = 0.01 ; p = 0.95). this study has demonstrated that a malunion of the distal radius does not influence the functional outcome of independent superelderly patients. more than two - thirds of these patients were deemed to require manipulation of their displaced distal radial fracture, of which half went on to have surgery due to loss of reduction. a third of all patients underwent surgical intervention, which was associated with complications. despite manipulation and surgical intervention, the degree of malunion was illustrated to correlate with a reduced rom, but neither the degree of malunion nor the associated diminished rom influenced the functional outcome of the superelderly patients. one consolidation only remains, that the limb at some remote period again enjoy perfect freedom in all its motions, and be completely exempt from pain : the deformity, however, will remain undiminished through life. this statement may not have been fully supported by our results, as we observed a diminished rom and some residual pain and dysfunction after a distal radial fracture in our superelderly cohort. although the freedom of motion that colles described may not relate to the absolute degree of movement, but to the freedom of motion would allow functional use of the limb. if this was his intention, our superelderly group supports his statement as it would seem that malunion, the persistent deformity he describes, does not hinder activities of daily living in this low functional demand group. the correlation between malunion and functional outcome in elderly patients has been described ; with no association being demonstrated for low demand patients with malunion union after a distal radial fracture and their functional outcome [10, 21, 22 ]. beumer and mcqueen questioned whether reduction of displaced distal radial fractures should be attempted in very elderly, frail, dependent, or demented patients after finding that the majority (53/60) lost reduction and went on to malunion. young and rayan and chang. illustrated that malunion did not correlate with poor functional outcome. however, these studies only included elderly patients, being 60 years or more, with low physical demands. more recently, grewal and macdermid included all patients, with no exclusions according to physical demands and found no difference in the outcome of extra - articular fractures of the distal radius after malunion in patients greater than 65 years old. they did however demonstrate an increased risk of a poor functional outcome, defined as disabilities of arm shoulder and hand (dash) score of greater than 20, with a malunion regardless of age, but this risk diminished with advancing age. however, the dash score is not validated for patients at the extremes of age, and to state that a dash score of 20 points or more is a poor outcome for very elderly patients is difficult to support as this score may be normal for them. in fact, one study found the mean dash score to be 22 points for a group of patients with a mean age of 78 years after sustaining a distal radial fracture. this supports our results for the superelderly population, with malunion having no influence upon functional outcome. if the predicted increase of the superelderly population is correct, then they will form an increasing percentage of the orthopaedic trauma workload. this will have associated cost implications for both the management of their fracture and the need for increased social support while recovering from their fracture. the management of distal radial fractures, being the most prevalent fracture of the superelderly, will form the greatest proportion of the emergency room and orthopaedic trauma workload. if the results of our study are acknowledged, superelderly patients with a displaced distal radial fracture could be managed conservatively, without the need to reduce their fracture or to surgically intervene. these patients would not have to suffer the further discomfort of manipulation of their fracture or surgical measures with associated risks and still achieve a satisfactory functional outcome. this would also have cost saving implications, avoiding the need for primary reduction within the emergency room and the costs of surgery and reducing the number of clinic appointments and radiographs performed. this management protocol would also benefit the superelderly population, who would therefore endure less medical consultations and interventions but achieve an adequate functional outcome. if a conservative protocol was followed for all distal radial fractures in the superelderly group, a potential risk would be the development of a symptomatic malunion in some patients. a distal radial osteotomy is indicated in fit patients with symptomatic malunion interfering with function irrespective of age [3841 ]. patients generally achieve a good functional outcome, but the rate of metalwork removal is high, from 25% to 54%, when plates are used to stabilise the osteotomy [3841 ]. however, more recently, the use of a nonbridging external fixator has been described to stabilise the osteotomy, offering a minimally invasive technique and good functional results without the subsequent need to remove the metalwork. this technique could be offered to those superelderly patients who develop a symptomatic malunion, if conservative methods fail to provide a satisfactory functional outcome. the major limitation is the retrospective nature of this study and the small cohort analysed. however, the prospective data capture was of high quality, with only a single data point being absent (rom of opposite wrist) for a single patient. in addition, this is the only case series reporting the outcome for superelderly (80 years) patients in the current literature. we also included both extra- and intra - articular fractures which may have skewed our results. however, on post hoc analysis, no statistical difference was observed between extra - articular (ao / ota type a) and intra - articular (ao / ota type b and c) fractures for rate of malunion, rom, or functional outcome. a prospective randomised controlled trial comparing conservative versus interventional (manipulation or surgery) management would need to be performed to confirm our results before our proposed treatment protocol could be confidently recommended. the limited functional demand of the superelderly population needs to be acknowledged before they are offered reduction of their distal radial fracture. malunion of the distal radius, despite our best efforts to restore normal anatomical alignment, often occurs, but there would seem to be no functional deficit if it does occur for independent superelderly patients. this questions whether we should intervene after a displaced distal radial fracture in this population and suggests that we could manage these patients conservatively with the option of radial osteotomy in the small numbers of patients whose malunion may become symptomatic. this would have major repercussions in how superelderly patients with displaced distal radial fractures are managed, potentially avoiding the risks associated with fracture manipulation and surgical intervention but achieving the same functional outcome. | purpose. the management of unstable distal radial fractures in the superelderly (80 years old) remains controversial. the aim of this study was to compare the functional outcome of super - elderly patients with and without malunion after a distal radial fracture. methods. we identified 51 superelderly patients living independently with displaced fractures from a prospective database of 4024 patients with distal radial fractures. activities of daily living, presence of wrist pain, whether the wrist had returned to its normal level function, grip strength and rom were recorded. the dorsal angulation was measured radiographically. results. there were 17 (33.3%) patients defined to have a malunion. the outcomes of the independent patients with and without malunion were compared at a mean follow - up of 15 months. no difference was observed in activities of daily living (p = 0.28), wrist pain (p = 0.14), whether the wrist had returned to its normal level function (p = 0.25), grip strength (p = 0.31), or rom (p = 0.41). an increasing degree of dorsal angulation correlated with diminished rom (p = 0.038), but did not correlate with activities of daily living (p = 0.10). conclusions. malunion of the distal radius does not influence the functional outcome of independent superelderly patients. |
interdigitating dendritic cell sarcoma (idcs) is a very rare neoplasm arising from interdigitating reticular cells, which participate in the immune response as antigen presenting cells that stimulate t lymphocytes [1, 2 ]. tumor occurrence is usually seen at t - cell rich areas of lymph nodes in the cervical, mediastinal, and axillary regions ; however, the involvement of extra - nodal sites such as the spleen, testis, urinary bladder, and pleura have also been reported [3 - 6 ]. although various treatment modalities, including surgery, radiation therapy, chemotherapy, and combinations of these, have been tried, to date there is no consensus on the preferred treatment. among chemotherapeutic regimens such as chop (cyclophosphamide, doxorubicin, vincristine, and prednisone), abvd (doxorubicin, bleomycin, vinblastine, and dacarbazine), dhap (dexamethasone, cisplatin, and high - dose cytarabine), epoch (etoposide, prednisone, vincristine, cyclophosphamide, and doxorubicin), ice (ifosfamide, carboplatin, and etoposide), and cisplatin / epirubicin [1, 2, 7 ], only abvd, currently used for the treatment of hodgkin 's lymphoma, has been successful for the treatment of disseminated idcs. until now, 2 cases of idcs have been reported in korea [3, 9 ] ; 1 patient with localized idcs showed a nearly complete response to a combination of chop chemotherapy and adjuvant radiation therapy ; however, the other patient, who presented with extra - nodal involvement of the pleura, died of progressive disease after 2 cycles of chop and 1 cycle of imep (ifosfamide, methotrexate, etoposide, and prednisolone). we report the first case in korea of successful disseminated idcs treatment using only abvd chemotherapy. a 64-year - old man presented to the primary care physician with a 1-year history of nasal congestion. he was referred to our hospital because of abnormal physical findings in the nasal cavity. rhinoscopic examination showed an ulcerative lesion in the inferior concha, and physical examination indicated multiple lymphadenopathies in both axillae and subcutaneous nodules in the left back. except for thrombocytosis (47210/l), laboratory tests did not show abnormal findings. after obtaining written informed consent, an excisional biopsy of the inferior concha the lesion showed diffuse infiltration of spindle cells, large pleomorphic cells, foamy histiocytes, lymphocytes, and plasma cells (fig. the distinction between inflammatory conditions, such as rhinoscleroma, and neoplastic lesions, such as rosai - dorfman disease, idcs, langerhans cell histiocytosis (lch), and follicular dendritic cell sarcoma (fdcs), was difficult ; therefore, various immunohistochemical studies were performed. on the basis of the immunohistochemical results, i.e., a strong positive reaction for cd68, lysozyme, lca, and s-100 protein but a negative reaction for cd34, cd1a, smooth muscle actin, and cd21 (fig. computed tomography (ct) scans of the chest, abdomen, and pelvis showed multiple enhancing nodules in the subcutaneous layer of the back, with lymphadenopathies in both axillae (fig. 2a). a head and neck ct scan showed a soft tissue attenuating lesion in the right anterior ethmoid and nasal cavities and multiple lymphadenopathies on both sides of the neck level ii (fig. further to the previously reported successful treatment of idcs with abvd chemotherapy, the same abvd doses (25 mg / m adriamycin, 10 mg / m bleomycin, 6 mg / m vinblastine, and 375 mg / m dacarbazine) were infused on days 1 and 15 every 4 weeks. during chemotherapy, no significant complications were observed. after 8 cycles, ct scans of the chest, abdomen, pelvis, and neck showed complete resolution in the lymph nodes of both axillae and the subcutaneous nodules (fig. 3b). ct and pet scans showed no evidence of relapse after 1 year. dendritic cell neoplasms are rare tumors, but they are being diagnosed with increasing frequency. the world health organization (who) classifies dendritic cell neoplasms into 5 groups : lch, langerhans cell sarcoma, idcs, fdcs, and not specified otherwise. among the tumors arising from reticular cells, idcs is difficult to diagnose because of histopathologic features that are similar to other tumor types ; therefore, a high index of suspicion is required, particularly in cases with extra - nodal involvement, considering its rarity. histological findings of an excisional biopsy specimen from the nasal concha showed diffuse infiltration of spindle - shaped cells and pleomorphic cells, in addition to foamy cells with various inflammatory cells. tumor cells in lch are positive for cd1a and s-100 protein, whereas tumor cells in fdcs are positive for cd21, cd35, and clusterin. in this case, the tumor cells were positive for cd68, lysozyme, lca, and s-100 protein but were negative for cd21 and cd1a ; these findings were consistent with the idcs immunophenotype [1, 2, 11 - 14 ]. wide dissemination of tumors, as in this patient, has been described in most cases of idcs. the age range in reported cases of idcs is 61 - 88 years with a mean age of 71.2 years. because of its rarity, data regarding the clinical behavior of idcs and treatment outcomes are relatively scarce. in patients with localized disease, surgical resection has been reported to be the mainstay of treatment ; however, a recurrence rate of up to 40% has been reported. the role of chemotherapy and radiotherapy in idcs treatment has not been established. to date, chemotherapy for idcs includes the use of chemotherapeutic regimens for non - hodgkin 's disease or hodgkin 's disease ; however, results of these combination chemotherapies have been very disappointing. the duration of remission was usually short with frequent recurrences. because of a lack of clinical data, high - dose chemotherapy and autologous bone marrow transplantation have also not been recommended [1, 2, 11, 15 ]. the abvd regimen is the only treatment known to have resulted in complete remission for disseminated idcs to date. here, we report the first case in korea of the successful treatment of disseminated idcs with 8 cycles of chemotherapy using the abvd regimen. further studies are warranted to arrive at a consensus for the successful treatment of idcs. however, the case reported here highlighted the efficacy of the abvd regimen, and we recommend abvd chemotherapy as a feasible treatment option for disseminated idcs in the future. | interdigitating dendritic cell sarcoma (idcs) is a very rare and aggressive neoplasm that arises from antigen presenting cells. idcs usually involves lymph nodes ; however, extra - nodal involvement has also been reported. because a consistent standard therapy for idcs has not been established to date, we report a case of the successful treatment of disseminated idcs using abvd chemotherapy (doxorubicin, bleomycin, vinblastine, and dacarbazine). a 64-year - old man was diagnosed with idcs on the basis of immunohistochemical findings of a biopsy specimen of the inferior nasal concha. immunohistochemical staining showed a positive reaction for cd68, leukocyte common antigen, and s-100 protein, but a negative reaction for cd34, cd1a, and cd21. imaging studies showed cervical and axillary lymphadenopathies, subcutaneous nodules, and a soft tissue lesion in the nasal cavity. treatment with the abvd regimen resulted in complete remission after 8 cycles of chemotherapy. |
chikungunya virus (chikv) is a positive - strand rna virus belonging to the genus alphavirus (1, 2). transmitted by the aedes mosquito, while chikungunya fever (chikf) outbreaks were previously restricted to tropical regions, the range of chikv has since expanded to temperate countries such as italy (6) and france (7). more recently, outbreaks of chikf have been reported in the caribbean islands (8, 9). since the first autochthonous case reported in december 2013, a total of 1,155,354 cases have been recorded as of 30 january 2015 (810), with more than 300 imported cases in the united states (11). the hallmark feature in chikf patients is incapacitating arthralgia affecting multiple joints during the acute phase of disease (12). however, it is not uncommon for chikf patients to experience persistent joint pain that can last up to several months or years after the initial infection (13, 14). previous studies have suggested that the pathogenesis of chikf is an immediate result of excessive immune attacks (13, 15). although reports have shown the involvement of t cells in chikv immunopathology (1620), the fine mechanism remains undefined. regulatory t cells (tregs) are a distinct subset of cd4 t cells that prevent exacerbated proinflammatory responses (21, 22) by maintaining tolerance and restoring immune homeostasis during an inflammatory response (23). in various infection models, tregs have been reported to dampen excessive immune responses triggered by pathogens and minimize damage to the host (2426). therefore, elucidating the intriguing role of tregs would no doubt allow a further understanding of chikv immunopathogenesis. studies in the chikv adult mouse model (27) have shown that cd4 mice experienced a reduced chikv - induced joint pathology, despite no differences in viremia throughout the course of disease (16), demonstrating a role for cd4 effector t (teff) cells. since these cells are a prime target for tregs, it is crucial to further define how these cells could influence the course of disease by inhibiting pathology (16, 23, 28). in this study, we took advantage of the observation that mouse tregs can be selectively expanded in vivo through the use of interleukin 2 (il-2) in complex with the anti - il-2 antibody jes6 - 1 (il-2 ab cx) (29) to demonstrate the importance of tregs in regulating chikv pathogenesis. all animals were handled in strict accordance with good animal practice as defined by the national advisory committee for laboratory animal research (naclar) guidelines under in facilities licensed by the agri - food and veterinary authority of singapore (ava). three - week - old c57/bl6j mice were housed in the absl3 facility at the biological resource center (brc) at biopolis, singapore. animals are fed daily and monitored closely by technical officers in charge of the animal facilities. all studies were reviewed and approved by the institutional animal care and use committee (iacuc approval no. chikv isolate (chikv - sgp011) used for in vitro and in vivo infections in mouse studies was isolated from an outbreak in singapore in 2008 at the national university hospital and propagated in c6/36 (30, 31). the titer of sgp011 was determined using standard plaque assays with vero - e6 cells (30, 31). three - week - old wild - type (wt) c57/bl6 female mice were inoculated subcutaneously (s.c.) in the ventral side of the right hind footpad with 10 pfu chikv in 30 l phosphate - buffered saline (pbs). footpad joint swelling was determined daily by the measurement of the height and the breadth of the footpad using a caliper and quantified as height times breadth. the degree of inflammation was expressed as the increase relative to the preinfection measurement (day 0), obtained with the following formula : [(x day 0)/day 0 ], where x is the footpad size measurement for a given day postinfection (dpi) (16, 3133). viral rna was extracted using a qiaamp viral rna minikit (qiagen) and quantified using quantitect probe rt - pcr (qiagen) with conditions as previously described (16, 3134). all reactions were performed using a 7900ht fast real - time pcr system machine (applied biosciences) with thermal cycling conditions as described previously (16, 3133). for total rna extraction from tissues, mice were anesthetized with ketamine (150 mg / kg)-xylazine (10 mg / kg) and perfused with pbs (33). joint footpads (the ankle joint and footpad) were obtained and stored in trizol (invitrogen) at 80c. tissues were homogenized using a rotor - stator homogenizer (xiril dispomix) at 4,000 rpm for 15 s. homogenized tissues were mixed with 230 l of chloroform and centrifuged at 12,000 rpm for 10 min at 4c. the aqueous phase was collected and isolated for total rna using an rneasy minikit (qiagen) according to the manufacturer 's instructions. quantification of extracted total mrna was measured by nanodrop 1000 spectrophotometer (thermo scientific). qualitative real - time pcr (qrt - pcr) was performed using a kapa sybr fast one - step qrt - pcr kit (kapa biosystems) according to the manufacturer 's recommendations in a 10-l reaction volume. all reactions were performed using a 7900ht fast real - time pcr system machine (applied biosciences). thermal cycling conditions were as follows : 95c for 5 min followed by 40 cycles of 95c for 5 s, 60c for 30 s, and 95c for 15 min. the fold change for each gene was calculated relative to the value for noninfected (ni) mice and presented as 2. pbs, 1.5 g murine il-2 (peprotech), 50 g anti - mouse il-2 (jes6 - 1) (ebioscience), or 1.5 g murine il-2 complexed with 50 g anti - mouse il-2 were injected intrperitoneally (i.p.) fifteen microliters of blood were collected from the tail vein to check for treg expansion. briefly, blood was lysed and fixed using bd fluorescence - activated cell sorting (facs) lysing buffer (bd biosciences) and washed twice with pbs. cells were stained with anti - cd4 (bd biosciences) and anti - cd25 (ebioscience). intracellular staining of foxp3 was done using a foxp3 staining buffer set (ebioscience) and anti - foxp3 following the manufacturer 's instructions. dead cells and duplets were excluded in all analyses using forward and side scatter gating. results were analyzed with flowjo version x software (tree star, inc.). mice were anesthetized with ketamine (150 mg / kg)-xylazine (10 mg / kg) and perfused by intracardiac injection with pbs followed by 4% paraformaldehyde. tissues were stored in 4% paraformaldehyde, decalcified, and embedded in paraffin wax before 5-m - thick sections were cut. hematoxylin and eosin (h&e) staining was done using established protocols as previously described (16, 33). imagej software (national institutes of health) was used for binary image conversion of histological images and for particle analysis (average number of particles per 30,000 square pixels of area selected) to determine the number of cellular infiltrates (35). depletion of regulatory t cell (dereg) (36) mice were treated with il-2 ab cx for 3 days, following which 0.5 g of diphtheria toxin (dt) was administered daily to each mouse for 2 days. treg depletion was checked by taking 10 l of blood from the tail vein, staining it with antibodies against cd4, cd25, and foxp3, and analyzing the result with flow cytometry. mice were then infected with chikv - sgp011 s.c., and depletion of tregs was maintained by dt administration every other day. spleens, popliteal lymph nodes (pln), and joint footpads of chikv - infected mice were harvested at 6 dpi. isolation of splenocytes and joint footpad cells was carried out as previously described (16). pln cells were isolated by first incubating pln in digestion medium containing 2 u / ml dispase (invitrogen), 20 mg / ml collagenase iv (sigma - aldrich) and 50 mg / ml dnase i (roche applied science) mix in complete rpmi for 30 min. cells were then released from the digested pln into the medium by gentle pipetting motions. cell suspensions were then passed through a 70-m nylon cloth (sefar), washed, and resuspended in complete rpmi. isolated cells from spleens, joint footpads, and pln were first stained with a live / dead fixable aqua dead cell staining kit (1:400) (life technologies) for 20 min. cell were then washed and resuspended in 50 l blocking buffer (1% rat and hamster serum in pbs). staining was performed using anti - cd45 (bd pharmingen), anti - cd4 (bd pharmingen), anti - cd8 (ebioscience), anti - cd25 (ebioscience), anti - cd11b (ebioscience), anti - ly6c (ebioscience), and anti - ly6 g (biolegend) antibodies for 20 min. stained cells were then washed with pbs and fixed using ic fixation buffer (ebioscience). intracellular staining of anti - foxp3 (ebioscience) was done according to the manufacturer 's instructions. polyvinylidene difluoride (pvdf) membrane plates (millipore) were humidified with 35% ethanol and washed with water. wells were coated with anti - gamma interferon (ifn-) capture antibody (clone an18 ; mabtech) overnight at 4c. mice were sacrificed at 6 dpi, and joint footpad and pln cells were isolated as described above. splenocytes, joint footpad cells, and pln cells were added at 2 10, 2.5 10, and 5 10 cells per well, respectively. ex vivo cd4 enrichment was performed using a mouse cd4 t cell isolation kit ii (miltenyi biotec) according to the manufacturer 's instructions. stimulation of chikv - specific t cells was done in complete rpmi containing 30 u / ml il-2 and 1.5 10 veroe6-derived sgp011 virions per well. for all wells containing joint footpad cells, 1.5 10 splenocytes from ni mice were added to serve as antigen - presenting cells (apcs). the plates were incubated at 37c and 5% co2 for 18 h. after incubation, cells were removed and wells were washed six times using pbs. spot detection was done using a mouse ifn- enzyme - linked immunospot (elispot) kit with alkaline phosphatase (alp) (mabtech) following the manufacturer 's instructions. ex vivo cd4 enrichment was performed using an easysep mouse cd4 cell enrichment kit (stemcell) according to the manufacturer 's instructions. enriched cd4 t cells were then labeled with 2.5 m carboxyfluorescein succinimidyl ester (cfse for 10 min at 37c in the dark. labeled cells were plated at 1 10 cells / well and stimulated with either anti - cd3/cd28 dynabeads (life technologies) or cd4-depleted splenocytes from naive mice pulsed with 1.5 10 sgp011 virions per well. all analyses between the pbs - chikv, il-2-chikv, jes6 - 1-chikv, and il-2 ab cx - chikv groups were done using one - way analysis of variance (anova) followed by dunnett 's multiple - comparison test comparing all other groups to the pbs - chikv group. comparison between il-2 ab cx with treg depletion and il-2 ab cx without depletion were done using an unpaired t test. comparison between particle analysis of the pbs - chikv and il-2 ab cx - chikv groups was done using a mann - whitney u test. in order to assess if tregs have a role in chikv - induced pathology, we made use of an in vivo method that allows the selective expansion of tregs by administering il-2 to form a complex with the anti - il-2 antibody jes6 - 1, termed il-2 ab cx (29). pbs, il-2 only, or jes6 - 1 only was administered to mice prior to chikv infection as an experimental control (referred to as infected control groups). a significant increase in the proportion of circulating tregs was observed only with il-2 ab cx treatment (fig. this treatment was highly effective, as it increased the average frequency of tregs in the blood from less than 10% to nearly 70% (fig. furthermore, the expanded tregs were also activated, as indicated by high cd25 expression (fig. the impact of treg expansion on chikv infection was next explored in mice pretreated with pbs (control), il-2, jes6 - 1, or il-2 ab cx for 3 days followed by virus inoculation into the footpad of the hind limb (27). compared to noninfected (ni) mice, chikv infection resulted in substantial swelling of the joint that peaked at 6 days postinfection (dpi) (fig. differences were not observed within the control groups of chikv - infected mice (fig. however, a marked reduction in swelling of the joint footpad was observed in mice pretreated with il-2 ab cx, especially at 6 dpi (fig. notably, these mice also recovered faster, with undetectable levels of swelling by 8 dpi, than the other control groups, where swelling subsided only after 14 dpi (fig. pretreatment with il-2 ab cx reduces joint swelling in chikv - infected mice. wt mice (n = 5 per group) were i.p. injected with pbs, il-2 only, jes6 - 1 only, or il-2 ab cx daily for 3 days. (a) representative scatter plots (left) and bar chart of the foxp3 cd25 peripheral treg population in mice. numbers indicate the frequency of foxp3 cd25 tregs in total peripheral cd4 cells. following pbs, il-2 only, jes6 - 1 only, or il-2 ab cx treatment, the mice were infected s.c. with 10 pfu chikv - sgp011. (b) representative images showing joint footpad swelling at 6 dpi in chikv - infected mice. (d) viremia was determined from blood collected from tail vein from 1 to 14 dpi. (e) viral load of the infected joint footpad was measured at 6 dpi. all data are means and standard deviations (sd) and are representative of three independent experiments. statistical analysis was done across all chikv - infected groups using one - way anova, followed by dunnett 's posttest comparing each group to the pbs - chikv group. (f) histological analysis of chikv - infected footpad samples from 6 dpi pretreated with either pbs or il-2 ab cx and stained with h&e., edema ; arrows, infiltrates ; b, bone ; m, muscle ; t, tendon. statistical analysis was carried out using the mann - whitney two - tailed test., p = 0.0017 (2 dpi joint swelling) or 0.0059 (4 dpi joint swelling) ;, p < 0.0001 (3, 5, 7, 8, 9, 10, 11, 12, 14, and 15 dpi joint swelling and il-2 ab cx treg expansion) or 0.0004 (6 dpi joint swelling). the action of tregs on reducing joint pathology did not have any effect on virus clearance, as differences in viral load were not observed between il-2 ab cx - treated mice and chikv - infected control groups (fig. 1d and e). tissue sections of infected joint footpad were obtained for histological assessments, where pbs - treated chikv - infected mice exhibited typical necrotizing myositis with massive immune infiltrates as well as extensive edema (18, 37) in the loose connective tissue layer of the dermis layer (fig. however, treatment with il-2 ab cx markedly reduced edema within the dermis layer (fig. to ascertain that the reduced pathology observed in the il-2 ab cx - treated mice was caused by the suppressive activity of tregs and not due to a direct impact of the il-2 ab cx on the effector cells, dereg mice were explored (36). these mice express diphtheria toxin receptor (dtr) under the control of foxp3 promoter, which allows the specific ablation of tregs with dt administration (fig. treatment with il-2 ab cx protected the chikv - infected dereg mice from pronounced joint swelling (fig. however, this protection was completely lost upon depletion of tregs with dt (fig. joint swelling was comparable in dt - treated wt chikv - infected mice and in dt - treated dereg mice with il-2 ab cx treatment (fig. 2b), verifying that the protection against chikv - induced swelling is mediated primarily by tregs (fig. treg depletion in il-2 ab cx - treated mice results in a loss of protection against chikv - induced pathology. wt or dereg mice (n = 4 per group) were treated with il-2 ab cx for 3 days (5, 4, and 3 dpi) followed by dt administration for 2 days to deplete tregs. following depletion, mice were infected s.c. with 10 pfu chikv - sgp011. (a) representative scatter plot showing peripheral treg population from dereg animals with or without il-2 ab cx treatment, followed by dt or no dt treatment. numbers in scatter plots indicate the treg population percentage within total cd4 t cells. data are means and sd. statistical analysis was done using one - tailed unpaired t test., p = 0.001 (wt+dt versus dereg+il-2 ab cx+dt) ;, p < 0.0001 (dereg+il-2 ab cx+dt versus dereg+il-2 ab cx). (b) joint swelling of mice was measured from 0 to 12 dpi following chikv infection after il-2 ab cx and dt treatment. statistical analysis was done using a two - tailed unpaired t test comparing dereg+il-2 ab cx+dt and dereg+il-2 ab cx., p = 0.0007 (6 dpi), < 0.0001 (7 dpi), < 0.0001 (8 dpi), 0.0004 (9 dpi), 0.0003 (10 dpi), < 0.0001 (11 dpi), or 0.0001 (12 dpi). in order to decipher how il-2 ab cx ameliorates chikv - induced joint swelling, immune infiltrates at the site of infection were analyzed from harvested joint footpad samples isolated during the peak of inflammation at 6 dpi. a significant increase in the cd45 leukocyte population was observed across all groups of chikv - infected mice (fig. flow cytometry analysis revealed that the infiltrates consisted mainly of cd11b myeloid cells that include macrophages and neutrophils (fig. 3b). while chikv infection had no effect on the number of neutrophils (cd11b ly6 g) (fig. 3c) increased dramatically. while the expansion of tregs did not impact the infiltration of macrophages induced by chikv infection, a striking selective effect was observed for cd4 t cells infiltration on 6 dpi. while il-2 and jes6 - 1 did not affect the influx of cd4 t cells into the infected footpad, their infiltration was significantly reduced with il-2 ab cx treatment (fig. wt mice (n = 5 per group) were infected s.c. with 10 pfu chikv - sgp011 after treatment with pbs, il-2 only, jes6 - 1 only, or il-2 ab cx. joint footpad cells from these treated animals were isolated at 6 dpi, enriched by percoll, and analyzed by flow cytometry. cells were stained with live / dead aqua and with antibodies to cd3, cd4, cd11b, ly6c, and ly6 g. (a) representative scatter plots showing cd45 and cd4 expression, gated on live cells. bar charts show average numbers of total leukocytes (left) and cd4 t cell infiltrates (right). (b) representative scatter plots showing cd11b and ly6 g expression gated on live cd45 cells. numbers in scatter plots indicate the percentages of cells in respective quadrants of total live cd45 cells. bar charts show average numbers of total myeloid cells (left) and neutrophil infiltrates (right). (c) representative scatter plots showing cd11b and ly6c expression gated on live cd45 cells. numbers in scatter plots indicate the percentages of cells in respective quadrants of total live cd45 cells. bar charts show average number of ly6c macrophage (left) and ly6c macrophage (right) infiltrates. all data are means and sd from 3 independent experiments. statistical analysis was performed using one - way anova across all chikv - infected groups, followed by dunnett 's posttest comparing to the pbs - chikv group., p < 0.0001 (il-2 ab cx cd4 t cells). ifn- elispot analysis on cells isolated from chikv - infected joint footpad samples further revealed that the reduced infiltrating cd4 t cells correlated with a reduction of the antigen - specific cd4 t cell response (fig. transcript analysis performed on total mrna isolated from joint footpad cells indicated that although chikv infection induced high expression of proinflammatory genes, such as those encoding il-6, il-10, entpd1, ifn-, stat1, and cxcl10, addition of il-2 ab cx reversed this effect (fig. 4c). a plausible explanation for this protective effect could be the interference by expanded tregs on the priming of chikv - specific cd4 teff cells. to verify this, ifn- elispot and flow cytometry analyses were carried out on cells isolated from the draining pln. flow cytometry detected only minor differences in the absolute number of pln cells (fig. in contrast, ifn- elispot showed that chikv - specific stimulation yielded a high frequency of antigen - specific responses from total pln and isolated cd4 t cells in all chikv - infected groups except for the il-2 ab cx - treated group (fig. this suggests that generation of chikv - specific cd4 teff cells is likely to be perturbed in the presence of expanded tregs. pretreatment with il-2 ab cx reduces production of proinflammatory cytokines in joint footpads of chikv - infected mice. wt mice (n = 5 per group) were infected s.c. with 10 pfu chikv - sgp011 after treatment with pbs, il-2 only, jes6 - 1 only, or il-2 ab cx. (a and b) representative images of elispot wells depicting the number of ifn--producing cells in total cells (a) and enriched cd4 t cells (b) from joint footpads. bar charts show average numbers of ifn--producing cells per infected joint footpad after subtraction of the background of the il-2-only stimulation control. (c) mrna was extracted from joint footpads, and qrt - pcr was performed to detect the expression of il-6, il-10, entpd1, ifn-, stat1, and cxcl10. statistical analysis was done using one - way anova across all chikv - infected groups, followed by dunnett 's posttest comparing to the pbs - chikv group. data are means and sd from three independent experiments., p = 0.0127 (il-2 ab cx il-6) or 0.0113 (il-2 ab cx il-10) ;, p = 0.0037 (il-2 ab cx entpd1), 0.0036 (il-2 ab cx ifn-), 0.0032 (il-2 ab cx stat1), or 0.0067 (il-2 ab cx cxcl10) ;, p = 0.0008 (il-2 ab cx ifn--producing cells per joint footpad) or 0.0126 (il-2 ab cx ifn--producing cd4 t cells per joint footpad). pretreatment with il-2 wt mice (n = 5 per group) were infected s.c. with 10 pfu chikv - sgp011 after treatment with pbs, il-2 only, jes6 - 1 only, or il-2 ab cx. (a through d) the bar charts show cd45 t cells (a), cd4 t cells (b), cd4 teff cells (c), and cd4 tregs (d) per pln. (e and f) representative images of elispot wells depicting the number of ifn--producing cells in total cells (e) and enriched cd4 t cells (f) from pln. the bar charts show the average numbers of ifn--producing cells per pln after subtraction of the background of the il-2-only stimulation control. statistical analysis was done using one - way anova across all chikv - infected groups, followed by dunnett 's posttest comparing to the pbs - chikv group. data are means and sd from three independent experiments., p < 0.0001 (il-2 ab cx tregs per pln), 0.0008 (il-2 ab cx ifn--producing cells per pln), or 0.0007 (il-2 ab cx ifn--producing cd4 t cells per pln). to further address how tregs suppress the initial priming of cd4 teff cells in the pln, bromodeoxyuridine (brdu) was administered before the peak of joint swelling at 4 dpi and 5 dpi to detect in vivo proliferation of cd4 teff cells. about 10% of cd4 teff cells from chikv - infected pbs - treated control mice were brdu (fig. 6a), suggesting that these cells were actively proliferating in response to virus infection. on the other hand, teff cells from il-2 ab cx - treated mice had significantly lower detectable levels of brdu cells (fig. if the lack of brdu uptake was due to a disruption in the proliferation of cd4 teff cells, ki-67 staining was performed to assess cell cycle advancement (38). draining pln from chikv - infected control mice revealed that approximately 30% of cd4 teff cells expressed ki-67, indicating active proliferation of these lymphocytes (fig. however, only 20% of cd4 teff cells from il-2 ab cx - treated mice expressed ki-67 (fig. more importantly, teff cells from the il-2 ab cx - treated group showed significantly reduced ki-67 detection compared to the chikv - infected control groups (fig. 6b). taken together, these findings suggest that cd4 teff cells with il-2 ab cx treatment did proliferate but did not enter s phase (fig. wt mice (n = 5 per group) were infected s.c. with 10 pfu chikv - sgp011 after treatment with pbs, il-2 only, jes6 - 1 only, or il-2 ab cx. (a) representative scatterplot of cd25 expression and brdu staining of teff cells. brdu was injected i.p. into mice daily for 2 days before euthanasia to detect proliferating cells. cells isolated from draining pln at 6 dpi were isolated for flow cytometry and gated on cd4 teff cells for analysis. (b) histogram showing ki-67 expression on cd4 teff cells (left) and bar charts showing mean fluorescence intensity (mfi) of ki-67 on teff cells (middle) and average percentage of ki-67 teff cells (right). statistical analysis was done using one - way anova across all chikv - infected groups, followed by dunnett 's posttest comparing to the pbs - chikv group. p = 0.0324 (il-2 ab cx percentage brdu teff cells) ;, p < 0.0001 (il-2 ab cx ki-67 mfi and il-2 ab cx percentage ki-67 teff cells). finally, to address proliferation arrest (3941), cd4 teff cells were isolated from pln of chikv - infected mice on 6 dpi and challenged with either chikv - pulsed apcs or anti - cd3/cd28 dynabeads. tregs were depleted using anti - cd25 positive selection, as they are known to exhibit suppressive effects during mixed lymphocyte reactions (42). to monitor proliferation, isolated cd4 teff cells were labeled with carboxyfluorescein succinimidyl ester (cfse), a tracking dye for proliferation (43). cd4 teff cells from all groups responded to nonspecific anti - cd3/cd28 stimulation (fig. 7). while cd4 teff cells from il-2 ab cx showed a weaker proliferation that was comparable to that in the ni group (fig. proliferation was observed only in the chikv - infected control groups, not in the il-2 ab cx - treated mice (fig. this demonstrates that anergy induction is specific to chikv - specific cd4 teff cells and not due to a global shutdown of t cell responses. pretreatment with il-2 ab cx prevents proliferation of activated chikv - specific cd4 t cells in draining lymph nodes. wt mice (n = 5 per group) were infected s.c. with 10 pfu chikv - sgp011 after treatment with pbs, il-2 only, jes6 - 1 only, or il-2 ab cx. splenocytes from ni mice were depleted of cd4 t cells and used as antigen - presenting cells (apcs). enriched cd4 t cells were depleted of tregs, labeled with cfse, and stimulated for 4 days with medium only, anti - cd3/cd28 dynabeads, apcs only, or chikv - pulsed apcs. (b) representative scatter plot (right) showing major histocompatibility complex class ii (mhcii) and cd11c expression gated on total live cd45 leukocytes from pln. the boxed area corresponds to inflammatory dcs, which were further analyzed for cd80 expression, as shown in the histogram plot (middle). statistical analysis was done using one - way anova across all chikv - infected groups, followed by dunnett 's posttest comparing to the pbs - chikv group. data are means and sd from two independent experiments., p = 0.0007 (il-2 ab cx cd80). flow cytometry was further performed to assess if the induction of anergy was due to a lack of costimulation on the apcs during t cell activation (3941, 4447). although migratory dendritic cells (dcs) (cd11b cd11c mhcii) (48) isolated from the draining pln of chikv - infected control groups revealed a typical increased in cd80 (fig. 7b), treatment with il-2 ab cx resulted in a significant reduction of cd80 (fig. these observations further substantiate the idea that tregs disrupted the response of chikv - specific cd4 teff cells by altering the priming capacity of apcs (4952). arboviral infections have illustrated the importance of t cells in regulating disease pathology (5355). cd8 t cells were demonstrated to mediate encephalitis during murray valley encephalitis virus (mve) infection (54). cross - reactive cd4 t cells were found to exacerbate dengue hemorrhagic fever (dhf) during secondary infections (55), while cd8 t cells have an ambivalent role, as they exhibit both protective and pathogenic affects in wnv - infected mice (56). more recently, cd4 t cells were showed to be responsible in mediating chikv - induced pathology (16). while t cell - mediated immunopathology in arbovirus infections has been extensively reported (54, 55, 57, 58), information on the role of tregs remains limited. here, aberrant immune responses responsible for the development of chikv - induced immunopathology were controlled by selectively expanding tregs in vivo through administering il-2 ab cx prior to virus infection (29). the expansion and activation of tregs led to the effective amelioration of the characteristic chikv - induced joint swelling. the reduced inflamed joint pathology was similar to that observed in chikv - infected cd4 mice, where a decline in viremia was not affected by the absence of cd4 t cells (16). further characterization of the action of these expanded tregs during chikv infection established that tregs selectively inhibit cd4 teff cells. ifn- elispot performed on splenocytes and cells from draining pln isolated from il-2 ab cx - treated chikv - infected mice resulted in a sharp reduction in the frequency of chikv - specific cd4 t cells. consequently, only a low number of chikv - specific cd4 t cells could migrate into infected tissues to maintain inflammation and inflict further damage. notably, the influx of other immune subsets, such as macrophages and cd8 t cells, was not affected, indicating no impairment in the overall immune response. brdu and ki-67 analysis suggested cell cycle arrest in cd4 teff cells, a hallmark feature of anergic t cells (5961). in line with this, a reduction in the level of cd80 in migratory dcs further suggested the indirect immunosuppressive effect of tregs on teff cells via the effect of tregs on apcs (4952). during virus infection, viral antigens are picked up by tissue - resident dcs that mature into migratory dcs and are transported to the draining ln to prime virus - specific t cells (62). these activated t cells then migrate back to the site of infection and exacerbate the proinflammatory microenvironment. findings in this study suggest that tregs expansion perturbs this inflammatory cycle by interacting with the apcs to inhibit the upregulation of costimulatory molecules that cause induction of anergy due to incomplete t cell activation in the primed cells (fig. proposed mechanism for reduction of chikv - induced pathology by il-2 ab cx. upon chikv infection in the joint footpad, resident sentinels such as macrophages and dcs sense the virus. virus stimulation induces activation of macrophages, which secrete proinflammatory cytokines and chemokines to attract other immune cell populations. meanwhile, dcs phagocytose viral particles and differentiate into mature migratory dcs to upregulate mhcii and costimulatory molecules. the matured dcs migrate to the draining pln and present viral antigen to naive t cells. upon interaction with their cognate antigen, naive t cells are activated into teff cells and enter the cell cycle to expand clonally. these expanded chikv - specific teff cells migrate toward the site of infection in response to secreted t cell chemokines. the presence of chikv - specific teff cells exacerbates the proinflammatory milieu and gives rise to the inflamed joint pathology observed. in the event of il-2 ab cx pretreatment, expanded tregs will be present in large number in all the secondary lymphoid organs. as the mature dcs carrying chikv antigen arrive at the draining ln, tregs compete with naive t cells to interact with these dcs. treg - dc interaction then causes mature dcs to downregulate their costimulatory molecules and results in the dcs presenting chikv antigens to naive t cells in the absence of costimulatory signals. activation of t cells without costimulation is likely to drive the t cells into g1 arrest, resulting in anergy. anergic t cells are not able to migrate to the site of infection in response to chemoattractants. abrogation of chikv - specific teff cells infiltration in the site of infection prevents exacerbation of proinflammatory environment, thus preventing the inflamed - joint pathology. the protective role of tregs in reducing immunopathology seen in this study could be further extended to other clinically important arboviruses such as o'nyong - nyong virus (onnv), ross river virus (rrv), and dengue virus (denv) (6365) as a means to prevent or reduce pathology (53, 66). nonetheless, observations in this study imply that pharmaceutical immunosuppressants blocking t cell activation and/or proliferation have a wealth of therapeutic potential (67) and could represent an alternative way to control virus - induced pathology during the acute phase of infection. | abstractchikungunya virus (chikv) infection is a reemerging pandemic human arboviral disease. cd4 + t cells were previously shown to contribute to joint inflammation in the course of chikv infection in mice. the jes6 - 1 anti - il-2 antibody selectively expands mouse regulatory t cells (tregs) by forming a complex with il-2. in this study, we show that the il-2 jes6 - 1-mediated expansion of tregs ameliorates chikv - induced joint pathology. it does so by inhibiting the infiltration of cd4 + t cells due to the induction of anergy in chikv - specific cd4 + effector t cells. these findings suggest that activation of tregs could also become an alternative approach to control chikv - mediated disease. importance chikungunya virus (chikv) has reemerged as a pathogen of global significance. patients infected with chikv suffer from incapacitating joint pain that severely affects their daily functioning. despite the best efforts, treatment is still inadequate. while t cell - mediated immunopathology in chikv infections has been reported, the role of regulatory t cells (tregs) has not been explored. the jes6 - 1 anti - interleukin 2 (il-2) antibody has been demonstrated to selectively expand mouse tregs by forming a complex with il-2. we reveal here that il-2 jes6 - 1-mediated expansion of tregs ameliorates chikv - induced joint pathology in mice by neutralizing virus - specific cd4 + effector t (teff) cells. we show that this treatment abrogates the infiltration of pathogenic cd4 + t cells through induction of anergy in chikv - specific cd4 + teff cells. this is the first evidence where the role of tregs is demonstrated in chikv pathogenesis, and its expansion could control virus - mediated immunopathology. |
as people age, age - related changes of physical function affect their ability to walk1. as the ability to walk in the elderly decreases, there is an associated decrease in balance ability2, 3 and independent daily living activities4 and increased risk of falling5. therefore, it is necessary for the elderly to maintain the ability to walk. the ability to walk in the elderly is often represented by the walking speed. the elderly have low vertical and antero - posterior ground reaction force for support and propulsion related to slower walking speed, with a shorter stride length6. thus, these forces can be considered to be factors affecting walking speed in elderly people. murray and kory7 and finley.8 reported that the elderly demonstrate decreased joint angles of the hip, knee, and ankle. through kinetic analysis, it has been reported that the hip and knee joint moments of the elderly were significantly lower than those of young people9. in addition, decline in plantar flexor moment and power in the elderly is related to slower walking speed10, 11. moreover, there are also age - related changes in walking strategy in the elderly. devita and hortobagyi12 reported that elderly people showed different distributions of joint moment and power as compared with young people. toda.13 reported differences in joint moment, which were related to the profiles of ground reaction force between the elderly and young people. these results indicate that the biomechanical impact of aging is not solely represented as a reduction in motor function but also involves a change in control strategy for walking. local muscle movements are regulated by pools of motor neurons in the spinal cord, which are part of the dispersed locomotor central pattern generator (cpg) network14. this network in the central nervous system control motor behavior by modulating the appropriate amount, timing, and combination of muscle activation. muscle activation patterns of the lower extremity during various motor tasks are produced by muscle modules. with regard to walking, each muscle module corresponds to a key phase of the walking cycle consistent with biomechanical subtasks in walking15. previous studies reported that there are age - related changes in muscle modules used in the sit to stand movement17 and in preparation to make a step18. regarding walking, muscle activation patterns of the elderly change with age8, and differences in muscle synergy might be caused by aging19. therefore, aging might be associated with the alternation of neural control in muscle activation in various movements. the targeted neuromotor and biomechanical function, including the timing function, can only be activated by performance of appropriate actions20. in order to develop optimal exercise regimens to prevent reduction of the ability to walk in the elderly, it is necessary to understand the differences in the timing and combinations of muscle activation during walking. the purpose of this study was to examine age - related differences in muscle modules and to examine the role taken by these muscle modules during walking in both males and females. we hypothesized that there are age - related alterations of the muscle coordination during walking and that the support and propulsive force corresponding to these muscle modules are reduced with age. twenty elderly people, 65 years old or older and 20 younger people, aged 20 to 29 years, participated in this study. the exclusion criteria included neurologic disorders, osteoarthritis, rheumatic arthritis, joint pain affecting walking, and history of surgery in the lower extremities or spine. all procedures were approved by the hiroshima international university human research ethics committee and all participants gave their written, informed consent prior to enrollment. in the walking trials, all participants walked while barefoot to the end of a 7 m walkway at a self - selected preferred walking speed. a 3d motion analysis system with 8 infrared cameras (vicon mx ; vicon motion systems, oxford, uk) and 8 force plates (amti, watertown, ma, usa) was used to record kinematic and kinetic data at sampling frequencies of 100 and 1,000 hz, respectively. the force plate layout was designed so as to measure the ground reaction force of each limb using four force plates arranged in the longitudinal direction. participants were instructed to walk such that in each step they placed a foot on the left or right force plate, avoiding stepping on two force plates simultaneously. infrared - reflecting markers were attached to 30 landmarks according to our previous study13. walking speed (m / s) was calculated from the position of the center of gravity (cog) of the whole body. stride length (m) was measured as the antero - posterior distance of the position of the left calcaneal tuberosity marker at a heel contact and the next heel contact. initial contact was assumed to occur when the vertical reaction force exceeded 10 n, and toe off was assumed to occur in the first frame following the initial contact where the vertical reaction force was 0.70) in all modules in both males and females, and the activation timing profiles of the elderly and young people were highly similar (table 3table 3.similarity of activation patterns of muscle modules between the elderly and the youngmodule 1module 2module 3module 4module 5males0.97 0.97 0.79 0.94 0.78females0.95 0.97 0.79 0.97 0.75values are cross - correlation coefficients of activation profiles. the correlation coefficient (r) values are cross - correlation coefficients of activation profiles. the correlation coefficient (r) is interpreted as large (r > 0.7).p < 0.05 the ground reaction force profiles corresponding to each muscle module are presented in table 4table 4.comparison of vertical and antero - posterior ground reaction force profiles corresponding to each muscle moduleground reaction force (n / kg)moduleelderlyyoungmales (n = 10)females (n = 10)males (n = 10)females (n = 10)vertical18.41 (1.79)8.67 (1.63)9.68 (1.76)10.26 (0.86) 28.93 (0.72) 9.36 (0.43) 9.49 (0.98)8.81 (0.70)37.95 (2.21) 7.85 (2.09) 8.38 (3.18)9.40 (0.78)4 0.08 (0.08) 0.06 (0.09) 0.04 (0.06) 0.08 (0.06) 53.74 (3.86) 5.20 (3.15) 5.45 (1.00)5.92 (2.56) antero - posterior11.49 (0.55)1.56 (0.36)1.85 (0.37)1.93 (0.28)20.24 (0.13)0.61 (0.41) 0.61 (0.37) 0.42 (0.25)31.61 (0.30)1.57 (0.37)1.92 (0.73)2.32 (0.35)40.00 (0.01) 0.00 (0.04) 0.00 (0.03)0.03 (0.03)50.54 (0.69) 0.54 (0.46) 0.86 (0.46)0.80 (0.44)value are shown as the mean (standard deviation : sd). positive and negative values of antero - posterior ground reaction force indicate anterior and posterior components, respectively. significant difference from the young males at p < 0.05.. both the vertical and antero - posterior components corresponding to module 1 were significantly lower in the elderly as compared with younger people. antero - posterior component corresponding to module 3 of the elderly was significantly lower than that of the young. in addition, the antero - posterior component corresponding to module 2 was significantly lower in the elderly males than that in the young males. value are shown as the mean (standard deviation : sd). positive and negative values of antero - posterior ground reaction force indicate anterior and posterior components, respectively. this study investigated age - related differences in the muscle control for support and propulsion during walking in both males and females. this study revealed that, in the elderly, there were age - related changes in the coordination of muscles around the ankle and that muscles of the lower extremity exhibited co - contraction in late stance. in addition, these age - related alterations of muscle control might be associated with support and propulsive forces during walking. these findings support our hypothesis that there are age - related alterations in muscle coordination during walking, and that the support and propulsive force corresponding to these muscle modules are reduced in the elderly. the timing and composition of each module obtained in this study corresponded to key phases of the gait cycle, consistent with the biomechanical subtasks of walking. in this study the activation pattern in each module was approximately consistent with previous studies16, 26. moreover, the timing and shape of these modules were similar between the elderly and young people in both males and females. ivanenko.16 reported that there were common basic patterns, even when walking conditions were changed. the age - related change of the underlying activation timing profile might be small too. on the other hand, there were age - related alternations in the contribution of muscles to each module. the pattern and combination of muscle activation are regulated by interneurons in the spinal cord that are part of the dispersed cpg14. elderly people had changed the combinations of muscles rather than the activation pattern in order to achieve the walking subtasks. these muscles generate vertical and backward accelerations of the center of gravity and contribute to support and braking of the body27. moreover, the contribution of the ta significantly increased in the elderly. the ta also generates vertical and backward accelerations of the center of gravity in early stance27. elderly people have muscle weakness of the lower extremity, especially in the leg extensors28. consequently, muscles of the ankle joint as well as the hip and knee joints also participate in weight acceptance. in addition, the contribution of the sol was large only in young females and significantly decreased in elderly females. the sol also generates only a small amount of vertical and backward accelerations of the center of gravity in early stance27 and may assist support and braking of the body in young females. especially in females, there are age - related changes in the muscle coordination of the ankle in early stance. both the vertical and antero - posterior components corresponding to this module were significantly lower in the elderly as compared to the younger people. the age - related alteration of ankle control in early stance may affect the support and braking force. the gas and sol contributed in late stance to generate vertical and forward accelerations of the center of gravity, and they contribute to support and propulsion on the body27. moreover both elderly males and females had significantly high muscle weightings of the gmax, rf, and ta. this result suggested that many muscles in the lower extremity in late stance were co - contracting in the elderly. co - contraction of lower extremity muscles can be predictive of performance in a dynamic balance test29 and risk of falling during walking30 in the elderly. co - contraction of lower extremity muscles in late stance in the elderly may compensate for low balance ability. only elderly males had a significantly lower anterior component of ground reaction force corresponding to this module compared with young males. therefore, co - contraction in late stance may lead to low propulsive force with a slow walking speed in elderly males. on the other hand, there was no difference in this force between the elderly and young females. the elderly females may have generated propulsive force using various muscles, and there was a gender difference in the effect of co - contraction in late stance on propulsive force. the rf and il contributed to support, braking, and propulsion of the body in early and late stance. neptune.31 found that the hip flexors, il, and rf made larger contributions to swing initiation and trunk propulsion, respectively. the muscle weighting of the il in the elderly significantly decreased for this module, and the antero - posterior component corresponding to this module in the elderly was significantly lower than that in the young. therefore, functional decline of the il in the elderly affected propulsion in late stance, and the elderly depended on the rf in performance of the stance - to - swing transition. moreover, only elderly females had a large muscle weighting of the gas. support, braking, and propulsion due to this module was performed by co - contraction between the hip flexor and the ankle plantar flexor in the elderly females. the ground reaction force corresponding to this module was very small, and this module was not directly involved in the generation of ground reaction force. the ham is activated to decelerate the leg during the swing phase in preparation for foot contact27. moreover, both elderly males and females had significantly high muscle weightings of the ta. the ta generates vertical and backward accelerations of the center of gravity in early stance30. the ta in module 1 of the elderly also had significantly high muscle weightings. it follows that the ta of the elderly greatly contributed to preparation of foot contact from late stance to early stance. the ta contributes to weight acceptance at initial contact through co - activation of the gmax. the ankle of the elderly accepted their body weight by co - contraction between dorsiflexors and plantar flexor at initial contact. the weightings of muscles in the ankle were significantly different between the elderly and the young in all modules. de vita and hortobagyi12 reported that the elderly showed a redistribution of joint moments and powers, which emphasized proximal extensors and de - emphasized distal extensors compared with the young. 32, reported that peak ankle joint power generation at pre - swing decreased in the elderly. it is necessary for improvement of the elderly s ability to walk to inprove ankle control in addition to muscle strengthening, because the influence of functional decline with age is readily apparent in the ankle joint during walking. in this study, generally, surface electromyography (semg) is often used for the analysis of muscle activity during motion. however, the results of semg are affected by not only the amount of muscle activity but also the thickness and conductivity of the skin and subcutaneous fat. basmajian.33 reported that the integrated value of muscle activity potentials and the muscle force during isometric contraction have a linear or curvilinear relationship. on the other hand, the muscle tension force determined by musculoskeletal simulation in the present study was calculated from kinematics data, kinetic data, and physical parameters obtained by the three - dimensional motion analysis system, with the uncertainties inherent to the used model. as estimated muscle tension forces were analyzed, it is necessary to confirm the reliability of the estimated data. the waveform of the muscle force obtained in this study is similar to the waveform of the muscle activity of the lower limbs reported by winter34. therefore, the reliability for estimated data of the muscle tension force used in this study was assumed to be good. first, the model used in this study was identical of the young and the elderly. the influence of muscle mass difference between the young and the elderly can be removed by normalization according to the subject s body weight, and the dimensions of the segments can be scaled to match the subject in opensim. however, viscoelastic changes in muscles and deformation of the spine could not be incorporated into the model. in the future, in order to perform musculoskeletal simulation with higher accuracy, it is necessary to develop a model and simulation system incorporating the physical features of the subject, such as age, gender, and joint deformity. second, this study showed that muscle modules during walking changed with age, but we were unable to identify the causative factor of the difference in muscle modules between the elderly and young people. elderly people experience a functional decline in the musculoskeletal system and nervous system with aging. further studies are required to determine the relationship between muscle control during walking and physical function in the elderly. | [purpose ] this study examined age - related differences in muscle control for support and propulsion during walking in both males and females in order to develop optimal exercise regimens for muscle control. [subjects and methods ] twenty elderly people and 20 young people participated in this study. coordinates of anatomical landmarks and ground reaction force during walking were obtained using a 3d motion analysis system and force plates. muscle forces during walking were estimated using opensim. muscle modules were obtained by using non - negative matrix factorization analysis. a two - way analysis of covariance was performed to examine the difference between the elderly and the young in muscle weightings using walking speed as a covariate. the similarities in activation timing profiles between the elderly and the young were analyzed by cross - correlation analysis in males and females. [results ] in the elderly, there was a change in the coordination of muscles around the ankle, and muscles of the lower extremity exhibited co - contraction in late stance. timing and shape of these modules were similar between elderly and young people. [conclusion ] our results suggested that age - related alteration of muscle control was associated with support and propulsion during walking. |
lifestyle interventions and behavioral therapies, which may be combined with antimuscarinic treatment, are recommended in international guidelines as first - line therapy for patients with overactive bladder (oab) [1, 2 ]. failure to respond to conservative and pharmacological treatment of oab has previously been described, but there is considerable heterogeneity in the definitions of both treatment response and nonresponse in trials involving patients with oab. over the last few years several clinical studies have been published which investigated different pharmacological principles (e.g., other antimuscarinic drugs, beta-3 agonists, botulinum toxin) and strategies (increasing anticholinergic doses, additional treatment with other anticholinergic drugs, or beta-3 agonists) in the treatment of patients with refractory oab [510 ]. the vast majority of these studies report significant improvement of oab symptoms following a change in treatment. in this review we discuss published data concerning factors which may be behind refractory oab in order to aid in understanding different treatment results in oab patients. computerized library systems such as medline, biosis, and embase were analyzed regarding articles on refractory oab published between 2000 and 2014. antimuscarinic and non - responder, or refractory, or furthermore, reviews of pharmacological and physiological aspects were carried out using the same first two search terms combined with terms such as muscarinic, nicotinic, m - receptor, adrenergic, and transporters. in addition, unpublished pharmacological and clinical data were included. refractory oab patients most likely represent a minority of the total oab population, but the epidemiology is unknown. as shown by goldman., a wide variety of symptom - based definitions and patient - reported outcomes with inconsistent thresholds are used in the published literature to decide whether or not patients respond to conservative and/or antimuscarinic treatment. moreover, patients individual evaluation of treatment success is characterized by different expectations and perceptions. accordingly a large - scale study involving 5,392 patients showed that 46.2 % of those who reported discontinuing one or more antimuscarinic oab medications gave the reason for this that the treatment did not work as expected, in 25.1 % medication was switched, 23.3 % learned to get by without medication, and 21.1 % discontinued due to side effects. the current american urological association (aua) and european association of urology (eau) guidelines on urinary incontinence contain recommendations for the treatment of refractory oab [1, 2 ], but no definitions of criteria and/or thresholds to assess unsatisfactory outcomes of therapy were described. current clinical studies in patients with refractory oab whose behavioral and/or antimuscarinic treatment was stopped due to lack of efficacy or side effects and replaced by alternative medication (e.g., botulinum toxin a, other antimuscarinics, beta-3 agonists) are summarized in table 1. when assessing the results of these studies concurrently, it becomes clear that definitions of antimuscarinic failure are based on inconsistent criteria ranging from the somewhat subjective evaluation lack of benefit or intolerable side effects to the strict prerequisite of this corresponds with the observations made by goldman. in their systematic review. if the criteria for diagnosis of refractory oab used in these studies are compared with those defined for success in the changed treatment studies (table 1), it becomes obvious that the latter criteria often seem to be less strict [6, 1315 ]. if the same strict criteria of > 1 uui day, as was chosen for inclusion into the study by kanagarajah. and kuo, had been defined as the response following secondary therapy, practically no patients could be classified as a responder in the described clinical studies with botulinum toxin a. this demonstrates that the physician s individual expectations may be highly relevant in differentiating between responders and nonresponders to primary oab treatment. in practice, complete cure of oab symptoms under first - line treatment is rare, and even after second - line treatment with botulinum toxin and neuromodulation the proportion of patients showing improvement of symptoms rather than total cure is greater [17, 18].table 1clinical studies in patients with refractory oab investigating efficacy of changed pharmacological therapystudy designpretreatmentdiagnosis of refractory oabtreatment / sample sizecriteria for treatment successstudy results after treatment (change from baseline)referencesingle - blind, actively controlledbehavioral modification + antimuscarinicsurodynamic overactive detrusor, plus at least 1 episode of urgency / day or 1 uui / dayonabotulinumtoxina/105>2 scale changes in ppbcis : uui episodes : bb : 7.07 (9.23)bb / trigone : 5.28 (7.62)bbase / trigone 15.8 (6.24)kuo double - blind, placebo - controlledantimuscarinicas per investigator opinion : qmax > 12 ml / sipss > 12ipss qol > 3onabotulinumtoxina/28 (15 vs 13 placebo)reduction in urinary frequencyfrequency (day 90):placebo : 13 (+ 2.5)botulinum toxin : 8 (3)chughtai. open uncontrolledantimuscarinic1 uui/ day and/or > 9 voids / daybotulinum toxin a/32>50 % reduction in urinary frequency / dayuui episodes : (50 %) kanagarajah. open uncontrolledantimuscariniclack of benefit or intolerable side effectssolifenacin/9daytime frequency, nocturia, micturition volume, and uui / dayuui episodes : 1.9 (3.0)nocturia / day : 0.9 (1.9)daytime micturitions / day : 7.3 (4.1)wong & duggan open cohort studyantimuscarinicno improvement of symptoms (not specified)mirabegron alone or in combination with antimuscarinicpgi - ipgi - i : very much better : 9 % much better : 25 % balachandran. double - blind, placebo - controlledantimuscarinicsuboptimal response (50 % reduction in uui episodes during 2 weeks run - in)fesoterodine/536decrease of uui episodesuui episodesfesoterodine : (2.37)placebo : (1.87)kaplan. ppbc patient s perception of bladder condition, is injection site, uui urge urinary incontinence episodes, bb bladder body, ipss international prostate symptom score, qol quality of life, pgi - i patient global impression of improvement clinical studies in patients with refractory oab investigating efficacy of changed pharmacological therapy ppbc patient s perception of bladder condition, is injection site, uui urge urinary incontinence episodes, bb bladder body, ipss international prostate symptom score, qol quality of life, pgi - i patient global impression of improvement essential for treatment response to oab treatment is adherence to the prescribed therapy. although it seems mundane, during both conservative and antimuscarinic treatment, realistic information provided to the patient on possible treatment efficacy, and on side effects, and additionally the quality of the course for lifestyle modification and behavioral bladder retraining, are essential to reach adherence to the prescribed treatment [1, 16 ]. lifestyle modification should include stopping smoking and limiting the intake of caffeine, alcohol, and carbonated and citrus beverages, which may lead to an increase in oab symptoms [16, 19 ]. indeed, inadequate follow - up after initiation of therapy (poor motivation) and unmet or unrealistic expectations (poor communication between patients and the physician) have been identified as contributory factors to nonadherence, in addition to adverse events and insufficient beneficial effects. jundt. demonstrated in their survey that 10 % of patients with oab had not started with the medication 12 months after prescription because of their fear of side effects or did not want to take pills. in this study, most patients stopped taking the medication without discussing the issue with their doctor. swartz and vasavada assume that many patients may be prematurely labeled as having refractory oab after only a modest attempt at medical or behavioral treatment. consequently, regular follow - ups to monitor treatment effects and adherence may be useful as well as providing realistic information on symptom improvements as expected treatment success and on any side effects which may occur. lack of efficacy of treatment with antimuscarinics as well as with behavioral bladder retraining, may be associated with underlying causes for lower urinary tract dysfunction which may have been overlooked in previous examinations. in order to exclude any other causes, repeated examinations of bacterial cystitis, painful bladder, voiding dysfunction, bladder or pelvic tumors, calculus, atrophic vaginitis, vaginal prolapse, medication side effects, neurological reasons, polyuria (polydipsia, diabetes mellitus / insipidus, chronic renal failure, and hyperthyroidism) should be considered [1, 22, 23 ]. the patients had undergone conservative management (lifestyle change, bladder retraining, and physiotherapy) and previous treatment with two or more antimuscarinics. among the patients, histopathology showed chronic cystitis in 94, follicular cystitis in 3, acute and chronic cystitis in 2, transitional cell carcinoma in 6, and no abnormality in 1, suggesting that oab refractory to antimuscarinics may be caused by chronic inflammation. evidence that inflammatory processes are involved in the pathogenesis of refractory oab emerged from the investigations by the research group of kuo who found that the inflammatory markers serum nerve growth factor (ngf), c - reactive protein, and adipokines including interleukins and tumor necrosis factor are increased in patients with refractory oab [13, 25, 26 ]. interestingly, elevated urinary ngf levels decreased significantly in 39 women with refractory oab after antibiotic therapy, while the oab symptoms daytime frequency, nocturia, and urgency simultaneously improved significantly. seventy four percent of these women also reported improvement in perception of their bladder condition. after oral administration, bioavailability of the tertiary antimuscarinic drugs darifenacin, oxybutynin, fesoterodine, and tolterodine as well as of the quaternary drug trospium chloride is characterized by a high intersubject variability (table 2) ([2830 ], data on file 2013, dr. r. pfleger gmbh, bamberg, germany). in the case of the tertiary antimuscarinics, individual pharmacokinetics may vary due to genetic differences resulting in dissimilar metabolic degradation by enzymes of the cytochrome p450 system [29, 31 ]. in contrast, variability of bioavailability of trospium chloride is primarily based on the relatively low rate of intestinal absorption, and excretion via bile and urine, where different drug carriers seem to be involved [33, 34].table 2intersubject variability of maximum plasma concentration (cmax) and area under the curve (auc) values of different antimuscarinic drugs under steady - state conditionsreferencevariability of cmax in % fesoterodine er3348malhotra. % (em)skerjanec 2061 % (pm) er extended release, ir immediate release, pm poor metabolizers, em extensive metabolizers intersubject variability of maximum plasma concentration (cmax) and area under the curve (auc) values of different antimuscarinic drugs under steady - state conditions er extended release, ir immediate release, pm poor metabolizers, em extensive metabolizers furthermore, the pharmacokinetics of some antimuscarinic drugs are influenced by food intake. increased cmax values of the active drug were observed when oxybutynin, darifenacin, and fesoterodine extended release were coadministered with a high - fat meal [29, 31, 35 ], whereas decreased cmax and auc values were calculated after ingestion of a high - fat meal together with trospium chloride. further factors which can influence the pharmacokinetics of antimuscarinics include age, gender, and race (table 3) as well as hepatic and renal impairment. since drug excretion via the kidneys declines with age, turnheim recommends treating the elderly in general as renally insufficient patients.table 3influences of age, gender, and race on pharmacokinetics of different antimuscarinics used for oabfactor influencing pkantimuscarinic druginfluencereferenceagedarifenacinyesskerjanec fesoterodinenomalhotra. oxybutyninincreased tolterodinenoguay trospium chloridenodata on file 2013, dr r. pfleger gmbhracedarifenacinjapanese : lower baskerjanec fesoterodinejapanesemalhotra. tolterodinewhites : auc + 10 % guay pk pharmacokinetics, ba bioavailability, cl clearance influences of age, gender, and race on pharmacokinetics of different antimuscarinics used for oab pk pharmacokinetics, ba bioavailability, cl clearance in addition to the described variations of the pharmacokinetics of antimuscarinics, interactions with other simultaneously taken drugs may lead to decreased or increased effects, thereby possibly limiting treatment efficacy or tolerability. it should be taken into account that pharmacokinetic interactions may occur by competition in absorption, metabolic processes, and excretion. pharmacodynamic interactions may be caused in particular by concomitant medication which can also have additional anticholinergic potency. as shown by sumukadas., the proportion of older people with a very high anticholinergic exposure increased from 7.3 % in 1995 to 9.9 % in 2010. it is known that a greater anticholinergic burden can lead to significant deficits in cognitive function. age - related decrease of muscarinic receptors in the urinary bladder has been shown in rats, but there were only minor, if any, alterations in receptor responsiveness. in humans, a shift of m3 muscarinic receptor subtypes to m2 was observed in correlation with age and in patients with neurogenic bladder overactivity. a decrease of the daily dose may be an option especially in elderly patients when side effects become problematic, as physiological changes connected with aging may result in reduced metabolism, alterations in distribution, declined excretion, and a decline in counter - regulatory mechanisms. generally, flexible dosing with antimuscarinics provides the opportunity to increase or decrease the dose to meet the body habitus and the pharmacokinetic and clinical needs of the individual patients, thereby balancing efficacy against tolerability. in connection with this, discussion and exchange of information between the physician and patient are a definite requirement to define the individual dose. data collected from non - interventional studies show that flexible dosing of trospium chloride adjusted to the patient s individual needs is commonly used in urological practices in germany (fig 1different daily doses of trospium chloride immediate release tablets prescribed by german urologists in 9,366 patients with oab symptoms in medical practices. pooled data from three non - interventional studies carried out in germany (data on file, 2014, dr. r. pfleger gmbh, bamberg, germany) different daily doses of trospium chloride immediate release tablets prescribed by german urologists in 9,366 patients with oab symptoms in medical practices. pooled data from three non - interventional studies carried out in germany (data on file, 2014, dr. r. pfleger gmbh, bamberg, germany) in patients who failed to respond, or showed suboptimal response to antimuscarinic drugs but tolerated the treatment well, it was shown that an increase of the daily dose may lead to a significant improvement of the oab symptoms. a significant decrease of incontinence episodes was observed after doubling the recommended daily doses of trospium chloride and tolterodine to 90 and 8 mg, respectively, in patients with persistent neurogenic detrusor overactivity (ndo). an alternative approach is the combination of two different antimuscarinic drugs, which has been demonstrated as effective and safe in several clinical studies including patients with either oab or ndo [7, 5053 ]. combination of an antimuscarinic with a beta-3 agonist has previously been investigated in clinical studies (table 4) [6, 54].table 4clinical studies using increased or combined antimuscarinic treatment in patients with unsatisfactory benefit of previous / initial therapymedication at start of therapyadjustment and dose / daypatients (n)efficacy resultsreferencetolterodine 1 4 mg / day (n = 11)trospium 3 15 mg / day (n = 10)tolterodine 2 4 mg / day (n = 11)trospium 3 30 mg / day (n = 10)ndo (21)in total ui episodes decreased from 812 to 02horstmann. oxybutynin 30 mg / daytolterodine 2 8 mg / daytrospium 3 30 mgplus trospium 4590 mgplus oxybutynin 1530 mgplus tolterodine 48 mgndo (27)ui episodes decreased : from 8.6 2.7 to 1.3 0.9from 7.0 1.5 to 0.6 0.7from 7.5 2.7 to 2.0 1.5amend. tolterodine 4 mgplus solifenacin 5 mgplus solifenacin 10 mgndo (19)/oab (14)ui episodes decreased : by 100 % in 17 patientsby > 90 % in 14 patientsby 5089 % in 2 patientsbolduc. oxybutynin 15 mg / dayoxybutynin 15 mg / dayplus trospium 80 mgplus solifenacin 10 mgndo (12)decrease of ui episodes : from 5.3 sd to 0.8 sdfrom 4.5 sd to 1.0 sdnardulli. oxybutynin ortolterodineplus tolterodine er 4 mg orplus solifenacin 5 mg or 10 mgndo / oab (31/25)decrease of ui episodes : by 100 % in 23 patientsby > 90 % in 18 patientsby 5089 % in 15 patientsnadeau. trospium 60 mg plus solifenacin 20 mg (198) orplacebo (115)oab (313)significant decrease in ui episodes compared to placebokosilov. solifenacin 2.5, 5, or 10 mg ormirabegron 25 or 50 mg orsolifenacin + mirabegron, orplacebooab (1306)dose response relationship for mvv in all combination groupsno significant changes in ui episodes compared to placeboabrams. ui urinary incontinence, ndo neurogenic detrusor overactivity, oab overactive bladder (number of patients in parentheses), er extended release, mvv volume voided per micturition clinical studies using increased or combined antimuscarinic treatment in patients with unsatisfactory benefit of previous / initial therapy ui urinary incontinence, ndo neurogenic detrusor overactivity, oab overactive bladder (number of patients in parentheses), er extended release, mvv volume voided per micturition when assessing these study results in patients with refractory oab, after doubling the recommended dose, or after combination treatment with a second drug, or after replacement by another antimuscarinic, one should consider that the situation of the unsatisfactory response to behavioral and antimuscarinic therapy is observed during daily routine medical practice. patients with oab who are included in clinical trials receive more intensive monitoring of their treatment. motivation of patients with oab may be increased by a defined regular follow - up appointment during clinical studies, and specified selection criteria could lead to a relatively homogeneous patient population. consequently, symptom improvement in such clinical trials may not be reproducible during clinical practice, when antimuscarinic treatment is not accompanied by close patient guidance. this also applies to trials involving patients with refractory oab, where treatment with an antimuscarinic drug was replaced by another antimuscarinic or a beta-3 agonist, such as mirabegron [6, 9 ]. however, dose adjustment, the combination of two different antimuscarinic drugs, and replacement by another antimuscarinic or a beta-3 agonist are options in order to improve treatment success in individual patients with oab. selection of the best tolerated drug is of great importance to avoid unnecessary side effects. especially in older patients where co - medication can have its own anticholinergic effects and/or compete in metabolism in the cytochrome p450 system, impairment of cognitive function as a side effect, and metabolic interactions, can largely be avoided by choosing an appropriate antimuscarinic such as the quaternary molecule trospium chloride, which does not seem to contribute to such effects [5558 ] and enables flexible dosing. in patients in whom critical reassessment of diagnosis leads to an exclusion of underlying causes for lower urinary tract dysfunction and who do not respond to intensive first - line therapy including adjusted antimuscarinic treatment, the use of transcutaneous electrical nerve stimulation, the intravesical administration of onabotulinumtoxina injections, or augmentation cystoplasty may be further treatment options. refractory oab patients most likely represent a minority of the total oab population, but the epidemiology is unknown. as shown by goldman., a wide variety of symptom - based definitions and patient - reported outcomes with inconsistent thresholds are used in the published literature to decide whether or not patients respond to conservative and/or antimuscarinic treatment. moreover, patients individual evaluation of treatment success is characterized by different expectations and perceptions. accordingly a large - scale study involving 5,392 patients showed that 46.2 % of those who reported discontinuing one or more antimuscarinic oab medications gave the reason for this that the treatment did not work as expected, in 25.1 % medication was switched, 23.3 % learned to get by without medication, and 21.1 % discontinued due to side effects. the current american urological association (aua) and european association of urology (eau) guidelines on urinary incontinence contain recommendations for the treatment of refractory oab [1, 2 ], but no definitions of criteria and/or thresholds to assess unsatisfactory outcomes of therapy were described. current clinical studies in patients with refractory oab whose behavioral and/or antimuscarinic treatment was stopped due to lack of efficacy or side effects and replaced by alternative medication (e.g., botulinum toxin a, other antimuscarinics, beta-3 agonists) are summarized in table 1. when assessing the results of these studies concurrently, it becomes clear that definitions of antimuscarinic failure are based on inconsistent criteria ranging from the somewhat subjective evaluation lack of benefit or intolerable side effects to the strict prerequisite of this corresponds with the observations made by goldman. in their systematic review. if the criteria for diagnosis of refractory oab used in these studies are compared with those defined for success in the changed treatment studies (table 1), it becomes obvious that the latter criteria often seem to be less strict [6, 1315 ]. if the same strict criteria of > 1 uui day, as was chosen for inclusion into the study by kanagarajah. and kuo, had been defined as the response following secondary therapy, practically no patients could be classified as a responder in the described clinical studies with botulinum toxin a. this demonstrates that the physician s individual expectations may be highly relevant in differentiating between responders and nonresponders to primary oab treatment. in practice, complete cure of oab symptoms under first - line treatment is rare, and even after second - line treatment with botulinum toxin and neuromodulation the proportion of patients showing improvement of symptoms rather than total cure is greater [17, 18].table 1clinical studies in patients with refractory oab investigating efficacy of changed pharmacological therapystudy designpretreatmentdiagnosis of refractory oabtreatment / sample sizecriteria for treatment successstudy results after treatment (change from baseline)referencesingle - blind, actively controlledbehavioral modification + antimuscarinicsurodynamic overactive detrusor, plus at least 1 episode of urgency / day or 1 uui / dayonabotulinumtoxina/105>2 scale changes in ppbcis : uui episodes : bb : 7.07 (9.23)bb / trigone : 5.28 (7.62)bbase / trigone 15.8 (6.24)kuo double - blind, placebo - controlledantimuscarinicas per investigator opinion : qmax > 12 ml / sipss > 12ipss qol > 3onabotulinumtoxina/28 (15 vs 13 placebo)reduction in urinary frequencyfrequency (day 90):placebo : 13 (+ 2.5)botulinum toxin : 8 (3)chughtai. open uncontrolledantimuscarinic1 uui/ day and/or > 9 voids / daybotulinum toxin a/32>50 % reduction in urinary frequency / dayuui episodes : (50 %) kanagarajah. open uncontrolledantimuscariniclack of benefit or intolerable side effectssolifenacin/9daytime frequency, nocturia, micturition volume, and uui / dayuui episodes : 1.9 (3.0)nocturia / day : 0.9 (1.9)daytime micturitions / day : 7.3 (4.1)wong & duggan open cohort studyantimuscarinicno improvement of symptoms (not specified)mirabegron alone or in combination with antimuscarinicpgi - ipgi - i : very much better : 9 % much better : 25 % balachandran. double - blind, placebo - controlledantimuscarinicsuboptimal response (50 % reduction in uui episodes during 2 weeks run - in)fesoterodine/536decrease of uui episodesuui episodesfesoterodine : (2.37)placebo : (1.87)kaplan. ppbc patient s perception of bladder condition, is injection site, uui urge urinary incontinence episodes, bb bladder body, ipss international prostate symptom score, qol quality of life, pgi - i patient global impression of improvement clinical studies in patients with refractory oab investigating efficacy of changed pharmacological therapy ppbc patient s perception of bladder condition, is injection site, uui urge urinary incontinence episodes, bb bladder body, ipss international prostate symptom score, qol quality of life, pgi - i patient global impression of improvement although it seems mundane, during both conservative and antimuscarinic treatment, realistic information provided to the patient on possible treatment efficacy, and on side effects, and additionally the quality of the course for lifestyle modification and behavioral bladder retraining, are essential to reach adherence to the prescribed treatment [1, 16 ]. lifestyle modification should include stopping smoking and limiting the intake of caffeine, alcohol, and carbonated and citrus beverages, which may lead to an increase in oab symptoms [16, 19 ]. indeed, inadequate follow - up after initiation of therapy (poor motivation) and unmet or unrealistic expectations (poor communication between patients and the physician) have been identified as contributory factors to nonadherence, in addition to adverse events and insufficient beneficial effects. demonstrated in their survey that 10 % of patients with oab had not started with the medication 12 months after prescription because of their fear of side effects or did not want to take pills. in this study, most patients stopped taking the medication without discussing the issue with their doctor. swartz and vasavada assume that many patients may be prematurely labeled as having refractory oab after only a modest attempt at medical or behavioral treatment. consequently, regular follow - ups to monitor treatment effects and adherence may be useful as well as providing realistic information on symptom improvements as expected treatment success and on any side effects which may occur. lack of efficacy of treatment with antimuscarinics as well as with behavioral bladder retraining, may be associated with underlying causes for lower urinary tract dysfunction which may have been overlooked in previous examinations. in order to exclude any other causes, repeated examinations of bacterial cystitis, painful bladder, voiding dysfunction, bladder or pelvic tumors, calculus, atrophic vaginitis, vaginal prolapse, medication side effects, neurological reasons, polyuria (polydipsia, diabetes mellitus / insipidus, chronic renal failure, and hyperthyroidism) should be considered [1, 22, 23 ]. the patients had undergone conservative management (lifestyle change, bladder retraining, and physiotherapy) and previous treatment with two or more antimuscarinics. among the patients, histopathology showed chronic cystitis in 94, follicular cystitis in 3, acute and chronic cystitis in 2, transitional cell carcinoma in 6, and no abnormality in 1, suggesting that oab refractory to antimuscarinics may be caused by chronic inflammation. evidence that inflammatory processes are involved in the pathogenesis of refractory oab emerged from the investigations by the research group of kuo who found that the inflammatory markers serum nerve growth factor (ngf), c - reactive protein, and adipokines including interleukins and tumor necrosis factor are increased in patients with refractory oab [13, 25, 26 ]. interestingly, elevated urinary ngf levels decreased significantly in 39 women with refractory oab after antibiotic therapy, while the oab symptoms daytime frequency, nocturia, and urgency simultaneously improved significantly. seventy four percent of these women also reported improvement in perception of their bladder condition. after oral administration, bioavailability of the tertiary antimuscarinic drugs darifenacin, oxybutynin, fesoterodine, and tolterodine as well as of the quaternary drug trospium chloride is characterized by a high intersubject variability (table 2) ([2830 ], data on file 2013, dr. r. pfleger gmbh, bamberg, germany). in the case of the tertiary antimuscarinics, individual pharmacokinetics may vary due to genetic differences resulting in dissimilar metabolic degradation by enzymes of the cytochrome p450 system [29, 31 ]. in contrast, variability of bioavailability of trospium chloride is primarily based on the relatively low rate of intestinal absorption, and excretion via bile and urine, where different drug carriers seem to be involved [33, 34].table 2intersubject variability of maximum plasma concentration (cmax) and area under the curve (auc) values of different antimuscarinic drugs under steady - state conditionsreferencevariability of cmax in % fesoterodine er3348malhotra. r. pfleger gmbh, bambergvariability of auc in % darifenacin er4871 % (em)skerjanec 2061 % (pm) er extended release, ir immediate release, pm poor metabolizers, em extensive metabolizers intersubject variability of maximum plasma concentration (cmax) and area under the curve (auc) values of different antimuscarinic drugs under steady - state conditions er extended release, ir immediate release, pm poor metabolizers, em extensive metabolizers furthermore, the pharmacokinetics of some antimuscarinic drugs are influenced by food intake. increased cmax values of the active drug were observed when oxybutynin, darifenacin, and fesoterodine extended release were coadministered with a high - fat meal [29, 31, 35 ], whereas decreased cmax and auc values were calculated after ingestion of a high - fat meal together with trospium chloride. further factors which can influence the pharmacokinetics of antimuscarinics include age, gender, and race (table 3) as well as hepatic and renal impairment. since drug excretion via the kidneys declines with age, turnheim recommends treating the elderly in general as renally insufficient patients.table 3influences of age, gender, and race on pharmacokinetics of different antimuscarinics used for oabfactor influencing pkantimuscarinic druginfluencereferenceagedarifenacinyesskerjanec fesoterodinenomalhotra. oxybutyninincreased tolterodinenoguay trospium chloridenodata on file 2013, dr r. pfleger gmbhracedarifenacinjapanese : lower baskerjanec fesoterodinejapanesemalhotra. tolterodinewhites : auc + 10 % guay pk pharmacokinetics, ba bioavailability, cl clearance influences of age, gender, and race on pharmacokinetics of different antimuscarinics used for oab pk pharmacokinetics, ba bioavailability, cl clearance in addition to the described variations of the pharmacokinetics of antimuscarinics, interactions with other simultaneously taken drugs may lead to decreased or increased effects, thereby possibly limiting treatment efficacy or tolerability. it should be taken into account that pharmacokinetic interactions may occur by competition in absorption, metabolic processes, and excretion. pharmacodynamic interactions may be caused in particular by concomitant medication which can also have additional anticholinergic potency. as shown by sumukadas., the proportion of older people with a very high anticholinergic exposure increased from 7.3 % in 1995 to 9.9 % in 2010. it is known that a greater anticholinergic burden can lead to significant deficits in cognitive function. age - related decrease of muscarinic receptors in the urinary bladder has been shown in rats, but there were only minor, if any, alterations in receptor responsiveness. in humans, a shift of m3 muscarinic receptor subtypes to m2 was observed in correlation with age and in patients with neurogenic bladder overactivity. a decrease of the daily dose may be an option especially in elderly patients when side effects become problematic, as physiological changes connected with aging may result in reduced metabolism, alterations in distribution, declined excretion, and a decline in counter - regulatory mechanisms. after oral administration, bioavailability of the tertiary antimuscarinic drugs darifenacin, oxybutynin, fesoterodine, and tolterodine as well as of the quaternary drug trospium chloride is characterized by a high intersubject variability (table 2) ([2830 ], data on file 2013, dr. r. pfleger gmbh, bamberg, germany). in the case of the tertiary antimuscarinics, individual pharmacokinetics may vary due to genetic differences resulting in dissimilar metabolic degradation by enzymes of the cytochrome p450 system [29, 31 ]. in contrast, variability of bioavailability of trospium chloride is primarily based on the relatively low rate of intestinal absorption, and excretion via bile and urine, where different drug carriers seem to be involved [33, 34].table 2intersubject variability of maximum plasma concentration (cmax) and area under the curve (auc) values of different antimuscarinic drugs under steady - state conditionsreferencevariability of cmax in % fesoterodine er3348malhotra. r. pfleger gmbh, bambergvariability of auc in % darifenacin er4871 % (em)skerjanec 2061 % (pm) er extended release, ir immediate release, pm poor metabolizers, em extensive metabolizers intersubject variability of maximum plasma concentration (cmax) and area under the curve (auc) values of different antimuscarinic drugs under steady - state conditions er extended release, ir immediate release, pm poor metabolizers, em extensive metabolizers furthermore, the pharmacokinetics of some antimuscarinic drugs are influenced by food intake. increased cmax values of the active drug were observed when oxybutynin, darifenacin, and fesoterodine extended release were coadministered with a high - fat meal [29, 31, 35 ], whereas decreased cmax and auc values were calculated after ingestion of a high - fat meal together with trospium chloride. further factors which can influence the pharmacokinetics of antimuscarinics include age, gender, and race (table 3) as well as hepatic and renal impairment. since drug excretion via the kidneys declines with age, turnheim recommends treating the elderly in general as renally insufficient patients.table 3influences of age, gender, and race on pharmacokinetics of different antimuscarinics used for oabfactor influencing pkantimuscarinic druginfluencereferenceagedarifenacinyesskerjanec fesoterodinenomalhotra. oxybutyninincreased tolterodinenoguay trospium chloridenodata on file 2013, dr r. pfleger gmbhracedarifenacinjapanese : lower baskerjanec fesoterodinejapanesemalhotra. tolterodinewhites : auc + 10 % guay pk pharmacokinetics, ba bioavailability, cl clearance influences of age, gender, and race on pharmacokinetics of different antimuscarinics used for oab pk pharmacokinetics, ba bioavailability, cl clearance in addition to the described variations of the pharmacokinetics of antimuscarinics, interactions with other simultaneously taken drugs may lead to decreased or increased effects, thereby possibly limiting treatment efficacy or tolerability. it should be taken into account that pharmacokinetic interactions may occur by competition in absorption, metabolic processes, and excretion. pharmacodynamic interactions may be caused in particular by concomitant medication which can also have additional anticholinergic potency. as shown by sumukadas., the proportion of older people with a very high anticholinergic exposure increased from 7.3 % in 1995 to 9.9 % in 2010. it is known that a greater anticholinergic burden can lead to significant deficits in cognitive function. age - related decrease of muscarinic receptors in the urinary bladder has been shown in rats, but there were only minor, if any, alterations in receptor responsiveness. in humans, a shift of m3 muscarinic receptor subtypes to m2 was observed in correlation with age and in patients with neurogenic bladder overactivity. whether such changes are of clinical relevance still remains to be clarified. a decrease of the daily dose may be an option especially in elderly patients when side effects become problematic, as physiological changes connected with aging may result in reduced metabolism, alterations in distribution, declined excretion, and a decline in counter - regulatory mechanisms. generally, flexible dosing with antimuscarinics provides the opportunity to increase or decrease the dose to meet the body habitus and the pharmacokinetic and clinical needs of the individual patients, thereby balancing efficacy against tolerability. in connection with this, discussion and exchange of information between the physician and patient are a definite requirement to define the individual dose. data collected from non - interventional studies show that flexible dosing of trospium chloride adjusted to the patient s individual needs is commonly used in urological practices in germany (fig. 1) (data on file, 2014 dr. 1different daily doses of trospium chloride immediate release tablets prescribed by german urologists in 9,366 patients with oab symptoms in medical practices. pooled data from three non - interventional studies carried out in germany (data on file, 2014, dr. r. pfleger gmbh, bamberg, germany) different daily doses of trospium chloride immediate release tablets prescribed by german urologists in 9,366 patients with oab symptoms in medical practices. pooled data from three non - interventional studies carried out in germany (data on file, 2014, dr. r. pfleger gmbh, bamberg, germany) in patients who failed to respond, or showed suboptimal response to antimuscarinic drugs but tolerated the treatment well, it was shown that an increase of the daily dose may lead to a significant improvement of the oab symptoms. a significant decrease of incontinence episodes was observed after doubling the recommended daily doses of trospium chloride and tolterodine to 90 and 8 mg, respectively, in patients with persistent neurogenic detrusor overactivity (ndo). an alternative approach is the combination of two different antimuscarinic drugs, which has been demonstrated as effective and safe in several clinical studies including patients with either oab or ndo [7, 5053 ]. combination of an antimuscarinic with a beta-3 agonist has previously been investigated in clinical studies (table 4) [6, 54].table 4clinical studies using increased or combined antimuscarinic treatment in patients with unsatisfactory benefit of previous / initial therapymedication at start of therapyadjustment and dose / daypatients (n)efficacy resultsreferencetolterodine 1 4 mg / day (n = 11)trospium 3 15 mg / day (n = 10)tolterodine 2 4 mg / day (n = 11)trospium 3 30 mg / day (n = 10)ndo (21)in total ui episodes decreased from 812 to 02horstmann. oxybutynin 30 mg / daytolterodine 2 8 mg / daytrospium 3 30 mgplus trospium 4590 mgplus oxybutynin 1530 mgplus tolterodine 48 mgndo (27)ui episodes decreased : from 8.6 2.7 to 1.3 0.9from 7.0 1.5 to 0.6 0.7from 7.5 2.7 to 2.0 1.5amend. tolterodine 4 mgplus solifenacin 5 mgplus solifenacin 10 mgndo (19)/oab (14)ui episodes decreased : by 100 % in 17 patientsby > 90 % in 14 patientsby 5089 % in 2 patientsbolduc. oxybutynin 15 mg / dayoxybutynin 15 mg / dayplus trospium 80 mgplus solifenacin 10 mgndo (12)decrease of ui episodes : from 5.3 sd to 0.8 sdfrom 4.5 sd to 1.0 sdnardulli. oxybutynin ortolterodineplus tolterodine er 4 mg orplus solifenacin 5 mg or 10 mgndo / oab (31/25)decrease of ui episodes : by 100 % in 23 patientsby > 90 % in 18 patientsby 5089 % in 15 patientsnadeau. trospium 60 mg plus solifenacin 20 mg (198) orplacebo (115)oab (313)significant decrease in ui episodes compared to placebokosilov. solifenacin 2.5, 5, or 10 mg ormirabegron 25 or 50 mg orsolifenacin + mirabegron, orplacebooab (1306)dose response relationship for mvv in all combination groupsno significant changes in ui episodes compared to placeboabrams. ui urinary incontinence, ndo neurogenic detrusor overactivity, oab overactive bladder (number of patients in parentheses), er extended release, mvv volume voided per micturition clinical studies using increased or combined antimuscarinic treatment in patients with unsatisfactory benefit of previous / initial therapy ui urinary incontinence, ndo neurogenic detrusor overactivity, oab overactive bladder (number of patients in parentheses), er extended release, mvv volume voided per micturition when assessing these study results in patients with refractory oab, after doubling the recommended dose, or after combination treatment with a second drug, or after replacement by another antimuscarinic, one should consider that the situation of the unsatisfactory response to behavioral and antimuscarinic therapy is observed during daily routine medical practice. patients with oab who are included in clinical trials receive more intensive monitoring of their treatment. motivation of patients with oab may be increased by a defined regular follow - up appointment during clinical studies, and specified selection criteria could lead to a relatively homogeneous patient population. consequently, symptom improvement in such clinical trials may not be reproducible during clinical practice, when antimuscarinic treatment is not accompanied by close patient guidance. this also applies to trials involving patients with refractory oab, where treatment with an antimuscarinic drug was replaced by another antimuscarinic or a beta-3 agonist, such as mirabegron [6, 9 ]. however, dose adjustment, the combination of two different antimuscarinic drugs, and replacement by another antimuscarinic or a beta-3 agonist are options in order to improve treatment success in individual patients with oab. selection of the best tolerated drug is of great importance to avoid unnecessary side effects. especially in older patients where co - medication can have its own anticholinergic effects and/or compete in metabolism in the cytochrome p450 system, impairment of cognitive function as a side effect, and metabolic interactions, can largely be avoided by choosing an appropriate antimuscarinic such as the quaternary molecule trospium chloride, which does not seem to contribute to such effects [5558 ] and enables flexible dosing. in patients in whom critical reassessment of diagnosis leads to an exclusion of underlying causes for lower urinary tract dysfunction and who do not respond to intensive first - line therapy including adjusted antimuscarinic treatment, the use of transcutaneous electrical nerve stimulation, the intravesical administration of onabotulinumtoxina injections, or augmentation cystoplasty may be further treatment options. an unsatisfactory improvement of symptoms in the first - line treatment option of patients with oab may depend on various factors. realistic estimation of treatment outcomes and side effects by the patient and/or the physician, individual patient guidance to improve the patient s motivation to adhere to treatment, review of the oab diagnosis, and exclusion of other underlying causes as well as individual antimuscarinic dose adjustment are procedures which can improve the success of oab therapy in daily medical practice. the authors suggest using the term refractory oab only in such cases when the aforementioned steps have confirmed the patient s nonresponse to first - line treatment including antimuscarinic therapy. joachim grosse and andreas wiedemann contributed to the article by critical revision of the manuscript. | introduction and hypothesisunsatisfactory treatment outcome sometimes is described as frequently occurring in patients treated with first - line therapy for overactive bladder (oab). the present article reviews the different circumstances which may result in failure to respond to lifestyle interventions, behavioral therapy, and/or antimuscarinic treatment.methodsan extensive literature search was conducted to identify relevant articles on pathophysiological, clinical, and pharmacological aspects of refractory oab.resultsmissing definition, unrealistic individual expectation of treatment outcomes, lack of communication between physician and patient as well as pathophysiological and pharmacological processes were identified as relevant for failure to respond to first - line oab treatment. increase of patient s motivation to adhere to the prescribed treatment, critical examination of the patient in regard to the initial diagnosis, and individual adjustment of antimuscarinic therapy may be appropriate tools to improve treatment outcome in oab patients.conclusionsoverall, the incidence of refractory oab seems to be overestimated. there are several approaches to improve therapy results. |
during the past two decades there have been major advances in the pharmacological treatment of chronic heart failure. despite this, severe heart failure remains a syndrome associated with very high mortality, profound reduction in quality of life, and frequent hospitalisation. cardiac transplantation can be an extremely effective therapy in such cases, but its provision is severely rationed by the lack of available donor organs. other cardiac surgical interventions including revascularisation, dynamic cardiomyoplasty and myocardial reduction surgery have been employed, but are currently of unproven value. it is in this context that pacemaker therapy is currently being intensively evaluated as a therapy for such patients. initial interest in the role of pacing as a potential treatment for congestive heart failure (chf) focused on prolonging diastolic filling time by reducing or abolishing presystolic av valve regurgitation. rutishauser first reported the phenomenon of presystolic av valve regurgitation in patients with chf and complete heart block. it became apparent with the advent of doppler echocardiography that such presystolic regurgitation of the mitral and/or tricuspid valves is common in patients with first - degree av or complete heart block. presystolic regurgitation has also been reported in chf patients with normal av conduction times if left ventricular end diastolic pressure (lvedp) is markedly increased. the av pressure gradient, when lvedp is high and the conduction time is prolonged, is thought to reverse before the onset of ventricular systole. although this promotes valve closure, there is incomplete closure, resulting in valvular regurgitation and reduced ventricular filling time. in the context of a ventricle that is abnormally stiff (and therefore highly dependent on filling time, especially on exercise), this can have considerable adverse haemodynamic consequences. the presence of interventricular conduction prolongation (wide qrs complex) further shortens the left ventricular filling period. hochleitner first reported beneficial effects from dual - chamber short av delay (100 ms) pacing in patients on a transplantation waiting list, but did not establish the mechanism of benefit. brecker subsequently reported improved exercise capacity and haemodynamics in 12 chf patients with short av delay pacing. pacing with a short av interval eliminated the presystolic component of av valve regurgitation and increased ventricular diastolic filling times. these observations were supported by smaller uncontrolled studies. since then, further reports of unselected patients have shown no overall short- or medium - term benefits ; while individual patients have improved, others have deteriorated. these mixed results may be explained by the fact that benefits from the reduction in presystolic av valve regurgitation may be offset by the electromechanical dyssynchrony of right ventricular (rv) pacing. right - sided pacing results in paradoxical motion of the interventricular septum (as seen in left bundle branch block [lbbb ]). this may adversely affect lv performance as it may reduce lv diastolic filling time, result in dyssynchronous (and inefficient) lv contraction and reverse the normal base - apex activation sequence. in a study of patients with coronary heart disease but without chf, betocchi demonstrated that right - sided av sequential pacing caused an upward shift in the lv diastolic pressure - volume relation. there was also a reduction in lv peak filling rate, an increase in the time constant of isovolumic relaxation (tau), and a reduction in cardiac index. rosenqvist used radionuclide ventriculography to assess exercise responses in 12 patients without chf. cardiac output measured on exercise (with similar heart rates) was higher during atria pacing than during either dual chamber pacing or ventricular pacing. paradoxical septal motion was apparent during ventricular pacing and dual chamber pacing, with a 25% impairment of regional septal ejection fraction. there is, therefore, clear evidence that rv pacing impairs both systolic and diastolic function of the lv in patients without chf. several studies in normal dogs and in patients without chf have suggested that pacing from the rv outflow tract or inter - ventricular septum may be superior to rv apical pacing. both acute haemodynamic and long - term studies in patients with chf, however, have not shown any benefit. further evidence against rv pacing for chf comes from the observation that it results in an increase in plasma nor - epinephrine levels (a powerful adverse prognostic marker in chf). the response to right - sided av sequential pacing in chf may depend on a balance between beneficial alleviation of presystolic mitral regurgitation (mr) and tricuspid regurgitation (tr) (in those patients with av conduction delay and elevated lvedp), and adverse consequences of dyssynchrony of left ventricular contraction and filling. consistent with this, nishimura reported that benefit was confined to those patients with presystolic mr and prolonged av conduction, whereas other patients showed a worsening of haemodynamics. it has been suggested, on this basis, that the decision to implant such a pacemaker should be based on the haemodynamic response to an acute pacing study. however, enthusiasm for right - sided short av delay pacing as a treatment for chf has waned. in much the same way that rv pacing induces lv dysfunction, a similar dysfunction may arise from lbbb in patients with chf. this conduction abnormality is present in 10 - 53% of patients with chf and, when present, is associated with a worse prognosis. ' resynchronisation ' of rv and lv contraction, by simultaneous (biventricular) pacing, would therefore appear logical. the technical feasibility of such an approach was reported by two groups in 1994 ; in these reports, lead implantation was performed at thoracotomy. cazeau subsequently reported acute haemodynamic benefit from temporary av sequential biventricular pacing in eight patients with severe chf. the first of these was from blanc, in which chf patients with first - degree av block and/or lbbb, and a pulmonary capillary wedge pressure > 15 mmhg were paced with a short av delay and either biventricular, lv or rv pacing. leclercq, in a similar patient group, also observed an equal magnitude of benefit from lv and biventricular pacing, comparing biventricular pacing with baseline or rv pacing (dual chamber pacing) in this study. the long - term results of the ' resynchronisation for heart failure ' (in sync) trial were recently reported. this was an open study of biventricular pacing in patients with medically refractory nyha iii / iv heart failure with qrs duration > 150 ms and left ventricular ejection fraction 120 ms and indications for icd implantation will undergo implantation of a biventricular pacemaker / icd. the end points of the two studies are the same except that antitachycardia and defibrillator efficacy and safety are included as additional secondary end points. the feasibility of combined trans - venous biventricular pacing / automatic implantable cardioverter defibrillator implantation has recently been reported, leading to the addition of an icd / pacing limb to the mustic study. there are several studies in the ' design and recruitment ' stage, some of which now address the issue of mortality and healthcare cost issues ; for example, cardiac resynchronisation in heart failure (care - hf). this study aims to assess mortality in a controlled patient group by randomising patients to biventricular pacing and optimal therapy, or optimal therapy alone. all - cause mortality and hospital admissions for decompensated chf will be evaluated together with an assessment of a 6 minute walk distance and vo2 max. the second end points of this study will be nyha status, mortality, quality of life, neurohormone levels and echocardiographic indices. table 2 summarises the design of other important studies planned or in the early phases, including pacman, miracle, companion and relevant. we are at a crucial point with this series of large clinical trials in the adoption or otherwise of pacing for the treatment of severe chf. current philosophy on the use of pacing in chf assumes that the mechanism of benefit arises from resynchronisation of ventricular contraction in patients with lbbb. if the mechanism of benefit was due to a resynchronisation of both ventricles, then biventricular pacing (in which synchronous depolarisation occurs together with a narrowing of the qrs complex) would be expected to be superior to lv pacing (which is associated with a much broader qrs complex). in acute haemodynamic studies, however, lv pacing has been shown to be either equal to or superior to biventricular pacing. kass reported that patients with the greatest qrs prolongation showed the greatest acute haemodynamic benefit, but there was no relationship between qrs narrowing associated with pacing and acute haemodynamic improvement. lv pacing was specifically superior to biventricular pacing despite a much broader paced qrs complex. it is certainly true that analysis of pressure - volume loops suggested that the mechanism of benefit was an improvement in lv contractile function, with no significant change in lv diastolic compliance. varma, in a recent study, assessed the impact of different pacing sites on lv coordination using lv pressure - dimension loops in patients with chf and lbbb. dyssynchrony of intraventricular conduction results in a low ' cycle efficiency ', yet there was no consistency regarding the optimal pacing chamber or site to improve cycle efficiency. this group conversely observed that lv pacing provided greater overall acute haemodynamic benefit than biventricular pacing. kerwin recently showed that biventricular pacing did not improve intraventricular dyssynchrony, but did improve interventricular dyssynchrony. although kass did not find evidence to support it, the possibility of an improvement in diastolic filling can not be excluded. right ventricular pacing clearly worsens diastolic filling, so the converse with lv pacing is certainly possible. chf patients with high lvedps have marked diastolic ventricular interaction ; that is, the filling of the lv is constrained by the rv and by the pericardium. our preliminary data suggests that, by permitting the lv to fill before the rv, lv pacing may improve filling in these patients with diastolic ventricular interaction, whether or not they have underlying lbbb. all of these factors serve to emphasise the need to understand the effects of pacing on pathophysiology, in order to design optimally larger clinical trials. it is unlikely, given the non - uniform nature of the pathophysiology and the multiple potential effects of pacing (reduction in presystolic mr, recoordination of intraventricular versus interventricular contraction sequence with improvement in both contractile and diastolic function), that a ' one size fits all ' strategy is optimal. it is possible that benefit may not be confined to patients with lbbb, nor necessarily that all such patients will benefit. previous experience of a dichotomy between symptomatic and prognostic effects with positive inotropic agents in chf should sound a note of caution. encouraging preliminary data in this regard suggest that the improvement in myocardial contractile performance with biventricular pacing is associated with a fall in myocardial o2 consumption. furthermore, whereas rv pacing increases plasma norepinephrine, biventricular pacing is associated with a reduction. we must, however, remember that simply by virtue of their size, large ' clinical trials ' will not always provide the answers for individual patients. unless such studies are directed by a sound understanding of pathophysiology, of its non - uniformity, and of the effects of therapy on this pathophysiology, this may lead to inappropriate therapy for some patients and missed therapeutic opportunities for others. | despite the major advances in medical drug therapy, heart failure remains a syndrome associated with high mortality and morbidity. biventricular or left ventricular (lv) short atrioventricular (av) delay pacing is being tested in congestive heart failure patients with left bundle branch block. the aim is to resynchronise the dyscoordinate lv contraction. a number of studies are underway, but it is clear that while some patients respond remarkably, this is highly variable. accurate identification of patients likely to benefit will be crucial. the mechanism of benefit is unclear. a greater understanding of the physiological consequences of pacing will be necessary to accurately identify these patients. |
retinal angiomatous proliferation (rap) is a form of retinal - choroidal neovascularisation within the wet age - related macular degeneration (amd) category, characterised by intraretinal capillary proliferation, subretinal neovascularisation and a serous / vascularised pigment epithelial detachment including a retinal - choroidal anastomosis. rap has been proved to be notoriously difficult to treat, with very few case reports and published articles on successful treatment. we describe the case of a 67-year - old male with rap undergoing successful treatment with stabilised visual acuity. rap is a distinct form of choroidal neovascularisation first recognised as a separate entity in 1992 as a deep retinal vascular anomalous complex. rap was first used, describing a complex pathology of retinal choroidal anastomoses with / without pigment epithelial detachments. this neovascularisation extends posteriorly, leading to subretinal neovascularization, which may lead to a neurosensory retinal detachment as well as to an associated serous pigment epithelial detachment. stage 3 occurs when neovascularisation extends into the choroidal circulation, sometimes in association with a vascularised pigment epithelial detachment. during this process, a connection between the retinal and choroidal circulation may develop, leading to a retinal - choroidal anastomosis. reports have shown that between 8 and 22% of cases previously diagnosed as exudative amd are rap. there is a distinct correlation between age and the development of rap, with a median patient age of 80 years. females are at a higher risk of developing rap, with one report claiming a 90% tendency towards the female gender. unfortunately, due to the nature of the disease, rates of second - eye rap are high. up to 80% of fellow eyes develop neovascularisation after 1 year, and 100% of patients will have developed some form of neovascularisation before 3 years since first eye diagnosis. while most published data have focused on intravitreal ranibizumab injections as the mainstay of treatment, we discuss the case of a patient with rap undergoing successful treatment with intravitreal ranibizumab and intravitreal triamcinolone acetonide (ivta). a 67-year - old male presented to the eye casualty department in december 2008 with a 1-week history of distorted vision in his left eye. his past ocular history was significant in that he had a disciform scar in his right eye leaving him with hand movement vision. he has also been under the care of the medical retinal consultant since january 2008 with a left occult choroidal neovascular membrane for which he had received 5 intravitreal injections of bevacizumab. his past medical history included peripheral vascular disease, essential hypertension, impaired glucose tolerance, early dementia and depression. on examination at the casualty department, his visual acuity was 6/38 + 2 in the left eye with microaneurysms at the fovea with minimal oedema. a fundus fluorescein angiogram (ffa) and optical coherence tomography (oct) a decision was made with the patient to start intravitreal ranibizumab due to the presence of only one functioning eye. the patient showed significant improvement after the first 3 injections, and his vision remained stable. the patient received a total of 10 intravitreal ranibizumab injections within the first year, with stable vision at 6/24 (40 letters). however, in may 2010, during routine follow - up, the patient presented to the age - related macular degeneration (armd) clinic complaining of reduced vision. visual acuity was 6/120 + 4 (8 letters), and his oct scans are shown in fig. the decision was made to treat the patient with ivta, and the patient was given a single ivta injection. the patient was given the ivta injection in the first week of june 2010. during the subsequent visits, an immediate improvement in vision his visual acuity improved to 6/48 (25 letters) at the first visit and remained stable for the following 2 months. he required no further intravitreal triamcinolone injections, and ranibizumab injections were continued based on oct appearances on a monthly basis. since the intravitreal triamcinolone injection, he has received a total of 7 intravitreal ranibizumab injections to the left eye over a 4-year period based on his oct appearances, with the last injection in october 2013. his vision fluctuates on a monthly basis but it has remained between 6/48 + 3 (28 letters) and 6/30 1 (34 letters). oct images at the 1-, 2-, 3- and 4-year follow - up are shown in fig. his right eye shows no signs of rap and is being monitored with oct imaging. as the patient had an almost immediate improvement with ivta injection based on vision and intra - retinal fluid, we are able to confirm the inflammatory nature of rap and the effects of ivta. while there has been little research into rap as a separate entity (often treated similar to other types of proliferative amd), the mainstay of treatment in most published articles was intravitreal ranibizumab injections. although there have been some favourable results using ranibizumab alone, as shown by the study of inoue., there has also been evidence indicating that ivta can be beneficial in treating rap. due to the inflammatory nature of rap, ivta was used by the consultant after previous studies had proved the efficacy of ivta in combination with other therapies. the majority of published studies have combined ivta treatment with photodynamic therapy (pdt), including some mixed results. in 2012, the study of rouvas. showed an anatomical improvement (geographic atrophy) in patients with ivta and pdt treatment, suggesting, along with the study of mendis., that ivta and pdt can be considered as treatment for rap. however, this was contradicted by the study of saito., highlighting anti - vascular endothelial growth factor and pdt therapy as a more favourable option. to our knowledge, there has been no evidence to suggest using a combination of ivta and ranibizumab injections for the treatment of rap. while most studies have focused on using either treatment in combination with pdt, there have been no published data on the combined use of anti - vascular endothelial growth factor and ivta treatments. as this case report demonstrates, 1 dose of ivta with top - up injections of ranibizumab including a comprehensive follow - up can not only stabilise and improve vision, but also improve the geographic appearance of the macula. we have successfully demonstrated a positive outcome in combined intravitreal treatment for this difficult condition. | a 67-year - old male who presented to the eye casualty department with deterioration in his vision was diagnosed with retinal angiomatous proliferation. after initial deterioration with ranibizumab intravitreal injections, we have demonstrated successful treatment and stabilised vision with ranibizumab and a single intravitreal triamcinolone injection. stringent follow - up and top - up ranibizumab injections have stabilised his vision and have shown foveal improvement on optical coherence tomography imaging. |
encapsulating peritoneal sclerosis (eps) is a rare but devastating complication of peritoneal dialysis (pd). herein, we report a case of a patient undergoing 12 years of pd who developed eps and calciphylaxis simultaneously. we also provide a comprehensive discussion about the association between eps and calciphylaxis. moreover, although tamoxifen is used in eps due to its inhibition of fibroblast - transforming growth factor beta (tgf) production, it may worsen the calciphylaxis due to a hypercoagulable state. encapsulating peritoneal sclerosis (eps) is a rare but devastating complication of peritoneal dialysis (pd). in this condition, the peritoneum is covered with fibrotic encapsulations, which leads to bowel obstruction (1). the risk factors for eps include a history of more than 8 years of peritoneal dialysis (pd), repeated peritonitis, and higher concentrations of glucose in the dialysate. unfortunately, there are no reliable markers for this disease, nor any clear pathogenesis or curative treatments (2). according to ridvan yavuz (3), calciphylaxis is a severe vascular complication in patients with end - stage renal disease (esrd). one - year survival is reported to be 45% - 80% (4). to the best of our knowledge, the association between eps and calciphylaxis has not been discussed, nor has the use of tamoxifen in this context. herein, we report a case of a patient undergoing 12 years of pd, who developed eps and calciphylaxis simultaneously our patient was a 65-year - old man who received pd for 12 years due to a 20-year history of type 2 diabetes mellitus (dm). he was under long - term follow - up at taichung veterans general hospital in taichung, taiwan. he presented with poor appetite and a weight loss of 3 kg in 6 months, starting in january 2015. his pd regimen was 1.5%2l2 + 2.5%2l2 + icodextrin2l1 and the amount of daily ultrafiltration was 1000 ml. blood urea nitrogen was 91 u / l and serum creatinine was 13.1 mg / dl. even while taking three tablets of calcium acetate (667 mg) with each meal, his calcium level was 8.8 mg / dl, phosphate was 7.7 mg / dl, and intact parathyroid hormone was up to 675 pg / ml. he experienced peritonitis three times during the pd period (all cultures grew staphylococcus aureus). due to no apparent cause for his poor nutrition and poor appetite, we performed abdominal computed tomography (ct) to rule out eps. unsurprisingly, ct disclosed diffuse thin calcifications of the serosal surface of the small intestinal loops (arrow, figure 1c). we reviewed the patient s kidney, ureter, and bladder (kub) x - ray from three months before the ct, and noted eps in the wall of small intestine (arrow, figure 1a). therefore, eps was diagnosed by the radiologists due to cachexia, very low serum albumin, low clearance of the peritoneum, and diffuse calcifications of the intestinal serosal surface. moreover, there was abdominal dissection with diffuse calciphylaxis (arrowhead in figure 1a, arrow in figure 1b), as well as skin ulcers over the lower extremities. for the diffuse calciphylaxis, we changed to sevelamer, two tablets per meal. for the eps, the pd was changed to hemodialysis with low - calcium dialysate and exchange of 2 l of dialysate every two weeks. however, questions were raised about the use of tamoxifen for eps, as this seems to be contraindicated in a patient in a state of calciphylaxis. this patient had many risk factors for eps, including high - concentration glucose in the dialysate, a long period of pd (8 months), and repeated peritonitis. he also had risk factors for calciphylaxis (4), such as a severely dysregulated calcium - phosphorus metabolism, a 32-year history of dm (5), type a dissection, a dialysis period of more than 6 - 7 years (6), hypoalbuminemia (7), and long - term prescription of high - dose calcium - based phosphate binders (8). (9), this is the second study mentioning a relationship between eps and calciphylaxis. fetuin - a and matrix gla protein (mgp) can both inhibit calcification, but they are stabilized by serum albumin (10). in other words, eps - related hypoalbuminemia will cause lower levels of fetuin - a and mgp, causing further vascular calcification. in addition to identify the similar pathogeneses of eps and calciphylaxis, we also questioned and opposed the use of tamoxifen for eps in patients with calciphylaxis because tamoxifen produces estrogenic - like effects, which could cause venous thromboembolism (11). experience with the use of tamoxifen in eps due to its inhibition of the production of fibroblast - transforming growth factor beta (tgf) has grown, and such use is widely considered suitable. the side effects are generally well - tolerated, such as nausea or hot flushes in women. however, we believe it is another story when it comes to the use of tamoxifen in eps patients with superimposed calciphylaxis. calciphylaxis is mostly due to an imbalance between calcium and phosphate. according to harris. (12), a hypercoagulable state indeed plays an important role in the pathogenesis of calciphylaxis ; for example, 38% of calciphylaxis patients had decreased protein c levels and 43% had decreased levels of protein s (12). first, it increases the influx of calcium into platelets, leading to platelet activation, and it acts synergistically with other platelet agonists (13). second, it increases factor viii, factor ix, and von willebrand s factor, while it decreases antithrombin, total protein s, protein c, and plasminogen activator inhibitor-1 (14). its pro - coagulation character superimposed on pre - existing calciphylaxis will worsen tissue ischemia and necrosis. eps will exacerbate calciphylaxis, and the use of tamoxifen in patients with eps and calciphylaxis should be reconsidered. in the absence of evidence from randomized controlled trials for the use of tamoxifen in eps, along with its known adverse effects on calciphylaxis, we suggest that tamoxifen should not be used in patients with both eps and calciphylaxis. eps will exacerbate calciphylaxis, and the use of tamoxifen in patients with eps and calciphylaxis should be reconsidered. in the absence of evidence from randomized controlled trials for the use of tamoxifen in eps, along with its known adverse effects on calciphylaxis, we suggest that tamoxifen should not be used in patients with both eps and calciphylaxis. | introductionencapsulating peritoneal sclerosis (eps) is a rare but devastating complication of peritoneal dialysis (pd). tamoxifen has been generally well - tolerated, even without randomized controlled trials.case presentationherein, we report a case of a patient undergoing 12 years of pd who developed eps and calciphylaxis simultaneously. we also provide a comprehensive discussion about the association between eps and calciphylaxis. moreover, although tamoxifen is used in eps due to its inhibition of fibroblast - transforming growth factor beta (tgf) production, it may worsen the calciphylaxis due to a hypercoagulable state.conclusionswe suggest avoiding the use of tamoxifen for eps in patients with superimposed calciphylaxis. |
the success of a dental restoration depends upon a number of factors such as the material chosen, its mechanical properties, anatomical form, surface texture, translucency and colour. the most common aesthetic restorative material used in day to day practice for crown and bridge work is porcelain fused to metal (pfm) because of its excellent mechanical properties.1 however, the much superior aesthetic outcome of metal - free ceramic restorations has led to their increasing popularity, especially in the anterior regions of the mouth.2 the major drawbacks of porcelain fused to metal restorations are lack of aesthetics, the possibility of metal allergies and the delamination of the veneering porcelain. in order to overcome the unaesthetic metallic hue seen in pfm restorations, dental research began to be directed towards metal - free ceramic restorations to improve the aesthetic outcome. research and development led to the development of many metal - free ceramic systems, wherein ceramic substructures were introduced which were subsequently veneered with porcelain providing relatively superior aesthetics.1 however ; these newer ceramics are prone to failures owing to their poor mechanical properties.3,4 glass ceramics with leucite and lithium disilicate reinforced crystals have proven to be successful aesthetic options in the anterior aesthetically demanding regions of the jaw.5 however, these restorations can not withstand the mechanical load of more than one pontic in the anterior region and are contraindicated in the load bearing posterior regions because of their poor flexural strength.6 the search for a material with mechanical properties similar to pfm, superior biocompatibility and aesthetics similar to glass ceramics has led to the rapid evolution of dental zirconia. 3 mol% yttrium stabilized tetragonal zirconia polycrystalline (3y - tzp) ceramics have gained tremendous popularity as restorative materials as a result of their excellent mechanical properties,3,4,7 good biocompatibility, and relatively good aesthetic properties.7 however, the conventionally available 3y - tzp restorations are quite opaque owing to the large grain size and the presence of porosity which is evident at the microstructural level of these materials.8,9 the esthetic outcomes with these restorations are not as superior to lithium disilicate and leucite reinforced ceramics.7 newer translucent varieties of zirconia have been developed recently, with the objective of improving their transmittance, so that they can be used in esthetically demanding clinical situations. studies done on these newer materials have shown that they are more translucent than conventional zirconia and demonstrated approximately two thirds more flexural strength than lithium disilicate.10 use of translucent zirconia has the potential to eliminate delamination of the veneering ceramic, which has been known to be a common clinical problem and also reduce the amount of tooth preparation required.11 this study was undertaken to evaluate the light transmittance of this translucent variety of 3y - tzps at different wavelengths and compare it to lithium disilicate. group 1- conventional zirconia (metoxit dental pre - sintered zirconia blocks, high tech ceramics, liechtenstein lot no. 0019481), group 2- high translucency zirconia (metoxit dental pre - sintered zirconia blocks, high tech ceramics, liechtenstein lot no. 0019832), group 3- conventional lithium disilicate (ips e.max lt shade a2, ivoclar vivadent, liechtenstein lot no. p83594.) and group 4- high translucency lithium disilicate (ips e.max ht shade a2, ivoclar vivadent, liechtenstein lot no. 12 circular discs of 1 millimeter thickness and 1 centimeter diameter were fabricated for each group. the linear sintering shrinkage for the batch of conventional pre - sintered zirconia batch was 21%. the pre - sintered zirconia was milled using diamond discs and sintered diamonds attached to a mandrel into discs of 1.28 mm height and 1.2 cm diameter. the thickness of the pre - sintered samples and samples post sintering were verified using a digital vernier calliper (0 - 200 mm, aerospace, china). following finishing and polishing, the dimensions of all the samples were maintained at 1 mm thickness and 1 cm diameter, with a variation up to + /- a similar procedure was followed for fabrication of samples of the high translucency zirconia using a pre - sintered high translucency zirconia block. a cobalt chromium mould having height of 1 mm and diameter 1 cm was used for fabrication of wax patterns for the lithium disilicate samples. the mould was cad - cam milled from a block of cobalt chromium (cobalt - chromium alloy-d.sign, ivoclar vivadent, asia). after the pressing was completed the ring was divested and cleaned using 1% hydrofluoric acid in an ultrasonic cleaner. transmittance is a measure of the fraction of incident light at a specified wavelength that passes through a sample. the translucency of dental porcelains can be studied by measuring direct transmission (when light goes through without a change in direction or quality), total transmission (combination of direct and diffuse light transmission) and spectral reflectance (fraction of incident light that is reflected at an interface such as porosity). the transmittance of the samples was measured using a dual beam uvspectrophotometer equipped with an integrating sphere (beckman acta c iii uv - visible spectrophotometer, beckman instruments, inc., a black cardboard sample holder (1.25 cm 1.25 cm 4.5 cm) with a central orifice of 8.5 mm diameter was used to position the specimens in front of the sphere holder (fig. data was recorded with a computer connected to the spectrophotometer, and a graph of light transmittance percentage per nanometer was obtained by using origin 6.1 software (microcal software inc., northampton, ma, usa) for each ceramic specimen. one way analysis of variance (anova) test was used for multiple group comparisons followed by tukey - post hoc test for group wise comparisons. field emission scanning election microscope (fe - sem) (jeol jsm 7600f field emission scanning election microscope) was used to study the microstructure of both the zirconia and lithium disilicate material. the transmittance values for the samples from all groups and their comparisons are presented in table 1. transmittance values were highest for group 4 (high translucency lithium disilicate) showing mean transmittance values of 0.207759. group 3 (conventional lithium disilicate) had mean transmittance value of 0.158738 which was marginally higher than group 2 (high translucency zirconia samples) whose mean value was 0.143969. high translucency lithium disilicate showed highest direct transmittance values which were statistically highly significant (p=.000)(table 2). conventional lithium disilicate showed transmittance (p=.000) values higher than highly translucent zirconia which was statistically significant (p=.000). scanning electron microscopy (sem) of the high translucency zirconia samples showed nano sized crystals, with the external outline of the crystals depicting a polyhedral structure. the grain sizes varied ranging from 50 nm to 400 nm for the high translucency zirconia samples (fig. 4) as compared to the conventional zirconia which showed diffuse porosity ranging from 200 nano microns to 1.5 microns (fig. 5). the lithium disilicate samples on scanning electron microscopy showed that the crystals were well merged with the matrix (fig. the translucency of the core is one of the most important determinants of the aesthetic properties of metal - free ceramic restorations.12,13 the zirconia core is not as translucent as other dental metal - free ceramic materials such as glass - ceramics.14,15 therefore, by increasing the translucency of the zirconia core, the aesthetic properties of a dental restoration can be improved. the ultimate aim is to eliminate the use of veneering porcelain, thereby eliminating the problem of porcelain delamination16 and enabling the clinician to employ more conservative tooth preparation designs. the translucency of dental ceramics can be evaluated through direct transmission, total transmission and via spectral reflectance. total transmission increases with increasing wavelength of light as mentioned by the rayleigh scattering equation. the transmittance of all the samples were studied at a wavelength of 525 in accordance with brodbelt 's methodology of studying translucency of dental porcelains.17 translucency of dental porcelains is known to be affected by various factors such as grain boundaries, pores, second- phase of component, and light scattering from rough surfaces.18 the translucency of glass ceramics depends largely on the amount of crystals within the glassy matrix14,19 and the size of the particles compared with the incident light wavelength.20 another factor that interferes with light transmission is the difference in the refractive index between the crystals and the glassy matrix. the refractive index is measured as the amount of reduction in the speed of light when passing through a medium. leucite (1.51) and lithium (1.55) have similar refractive indices to the glassy matrix (1.50).15 presence of porosity in these glass ceramics tends to have a higher influence on the light transmission than the crystals themselves. the mismatch between the refractive indices of the air porosity (1.00) and that of the glassy matrix may lead to a significant light scattering effect.15 high translucency lithium disilicate showed the highest transmittance values (0.207759). this could be attributed to the refractive index of the lithium disilicate glass crystals matching to that of the glassy matrix. a linear well - organized crystalline structure was seen with the high transmittance glass ceramics. the significantly lower transmittance values for the conventional lithium disilicate may be attributed to the irregular arrangement of the crystals leading to increased scattering and reflectance. the significantly superior mechanical and biological properties of 3 mol% yttrium stabilized zirconia along with its biocompatible features have resulted in its increasing popularity amongst clinicians and researchers. polycrystalline materials are known to show high transmittance when the grain sizes are small and uniform in size with minimal porosity.18 dopants such as alumina are added to improve the phase stability and to reduce ageing. however the presence of alumina because of its different refractive index to zirconia increases the scattering of light and reduces the translucency. this is attributed to the presence of porosities larger than 50 nano microns which affect transmittance21 (fig. the high translucency zirconia showed a significant increase in transmittance values (0.143969) over that of conventional zirconia. this is due to the significantly reduced frequency and size of the porosity seen with this newer material (fig. the material also showed a more uniform grain size and configuration than the conventional zirconia. conventional lithium disilicate showed higher transmittance values (0.158738) than the high translucency zirconia (0.143969). lithium disilicate restorations with opaque cores are currently used for cases wherein the tooth to be restored is non - vital or discoloured to mask the hue of the prepared stump.22,23 zirconia having similar optical properties can be a better substitute for glass ceramic restorations because of its superior mechanical properties. the aesthetic demands of clinicians and patients have led manufacturers to improve upon the translucency of zirconia and lithium disilicate ceramics. this study clearly demonstrates that the high translucency zirconia and lithium disilicate have significantly more transmittance than the conventional variants. some of the methods documented in the literature for obtaining more dense, less porous, more translucent zirconia are hot isostatic pressing, microwave sintering, spark plasma sintering etc.9,18,24 however despite the significant improvement in transmittance, high translucency zirconia is still below par when compared with today 's aesthetic gold standard material, lithium disilicate. one of the greatest drawbacks of zirconia restorations compared to lithium disilicate is the tendency for delamination of veneering ceramic from the core.16 the ability of bonding lithium disilicate to tooth structure is also an advantage over zirconia restorations. monolithic restorations used popularly today are not as esthetic as core veneered zirconia restorations or lithium disilicate restorations. the authors believe that if the translucency of zirconia could be increased, thereby favorably reducing its refractive index values from 2.2 to that of the aesthetic glass ceramics whose refractive index is 1.5, the need for using veneering ceramic can potentially be eliminated.9 this would permit life like restorations with larger spans providing aesthetics similar to glass ceramics. this would also reduce the amount of tooth preparation required, thus help conserve more tooth structure. within the limitations of the study, it can be concluded that high translucency lithium disilicate is the most translucent material amongst the materials studied. however, the increase in transmittance achieved with high translucency zirconia is significantly less compared to even conventional lithium disilicate. further research is needed on improving the microstructural features of zirconia materials in order to enhance their translucency. | purposetranslucency and colour stability are two most important aspects for an aesthetic dental restoration. glass ceramic restorations are popular amongst clinicians because of their superior aesthetic properties. in the last decade, zirconia has generated tremendous interest due to its favorable mechanical and biological properties. however, zirconia lacks the translucency that lithium disilicate materials possess and therefore has limitations in its use, especially in esthetically demanding situations. there has been a great thrust in research towards developing translucent zirconia materials for dental restorations. the objective of the study was to evaluate and compare the transmittance of a translucent variant of zirconia to lithium disilicate.materials and methodstwo commercially available zirconia materials (conventional and high translucency) and 2 lithium disilicate materials (conventional and high translucency) with standardized dimensions were fabricated. transmittance values were measured for all samples followed by a microstructural analysis using a finite element scanning electron microscope. one way analysis of variance combined with a tukey - post hoc test was used to analyze the data obtained (p=.05).resultshigh translucency lithium disilicate showed highest transmittance of all materials studied, followed by conventional lithium disilicate, high translucency zirconia and conventional zirconia. the difference between all groups of materials was statistically significant. the transmittance of the different materials correlated to their microstructure analysis.conclusiondespite manufacturers ' efforts to make zirconia significantly more translucent, the transmittance values of these materials still do not match conventional lithium disilicate. more research is required on zirconia towards making the material more translucent for its potential use as esthetic monolithic restoration. |
burning mouth syndrome (bms) is a burning or itching sensation in the normal oral mucosa. the pain is persistent, ranges from moderate to severe, and occurs particularly often in postmenopausal women. the international association for the study of pain defines bms, which is also called stomatodynia, glossodynia, oral dysesthesia, and persistent idiopathic orofacial pain, as any form of burning or stinging sensation in the mouth in association with a normal mucosa in the absence of local or systemic disease.1 in the literature, antidepressants and benzodiazepines have shown beneficial effects in the treatment of patients with bms.2,3 however, there has been no report on treatment with a dopamine partial agonist for bms. herein, we report a case of treatment - resistant bms successfully treated with low - dose aripiprazole. a 66-year - old female with no systemic disease or trauma history visited our clinic after being referred by her family physician. she complained of a chronic burning sensation in her tongue without taste alteration and dry mouth, which had lasted for 13 months. at first, she went to her family physician and was evaluated by laboratory screening tests. though antibiotics, topical dexamethasone, and kampo were administered at various clinics, the burning sensation was not ameliorated. based on the medication effects, a candidal infection was excluded. at the first examination, she came to our clinic by herself. no orientation disturbance or any verbal fluency problem was observed. no abnormality associated with the burning sensation based on the clinical, laboratory, and anamnestic data, we established a diagnosis of bms. because she was anxious about several side effects of antidepressants, she was started on escitalopram at 5 mg / d. however, the burning sensation was not reduced, even at 10 mg / d. therefore, duloxetine was administered instead of escitalopram. though duloxetine was initiated at 20 mg / d and gradually increased to 40 mg / d, her burning sensation was aggravated. the burning sensation was partially reduced at 7.5 mg / d, but dose escalation was not effective. therefore, low - dose aripiprazole powder (1.0 mg / d) was added to her treatment regimen. a month later, she said that she almost always forgot about the burning sensation during the day. six months later, the mirtazapine was stopped and there was no change for the worse. two months later, the aripiprazole was also stopped, which resulted in recurrence of the burning sensation. aripiprazole was restarted at 1.0 mg / d, and the burning sensation disappeared within a few days. with low - dose aripiprazole, she continued to live a healthy life without experiencing any side effect. we report a case of bms that barely responded to antidepressants and was successfully treated with aripiprazole. low - dose antidepressants, anticonvulsants, and benzodiazepines have been investigated and are the most accepted options for bms. tricyclic antidepressants are the most commonly prescribed drugs for bms.4 additionally, it has been reported that serotonin norepinephrine reuptake inhibitor5,6 and selective serotonin reuptake inhibitor7 are effective recently, the effectiveness of atypical antipsychotics was reported in these patients.8,9 to our knowledge, there is no report on the effectiveness of aripiprazole for bms. aripiprazole is an atypical antipsychotic that bears the properties of d2 and 5-ht1a partial agonists and is a potent antagonist of the 5-ht2a receptor.10 unlike other atypical antipsychotics that are dopamine d2 antagonists, aripiprazole has a unique effect on the dopamine system. because of its d2 partial agonist activity, some studies have mentioned that aripiprazole has a role as a dopamine system stabilizer. recently, neurotransmitter positron emission tomography data indicated that hypofunction of the dopaminergic system within the basal ganglia was related to bms.11 one possible explanation is that the efficacy of aripiprazole in treating bms is partly caused by stabilization of these dopamine receptors within the basal ganglia. especially as this case did not have any response to a selective serotonin reuptake inhibitor (escitalopram) or a serotonin norepinephrine reuptake inhibitor (duloxetine), it is strongly suggested that the efficacy of aripiprazole is caused by dopamine stabilization. considering this dopaminergic hypothesis, other treatments including other antipsychotic drugs and electroconvulsive therapy might be options of treatment for bms. recently, the role played by the dopamine system of the brain in pain control has garnered attention. kasahara reported four cases of refractory chronic pain that improved with a low dose of aripiprazole. in their paper it is also believed that the dopamine and opioid systems interact in complex ways in the treatment of chronic pain. this report suggests that low - dose aripiprazole may be effective for patients with treatment - resistant bms. | we report a case of refractory burning mouth syndrome (bms) ameliorated with low dose of aripiprazole. the patient was a 66-year - old female who had suffered from chronic burning pain in her tongue for 13 months. no abnormality associated with the burning sensation was detected in the laboratory tests and the oral findings. considering the clinical feature and the history together, we diagnosed the burning sensation as bms. the bms pain was decreased by aripiprazole (powder) 1.0 mg / d, though no other antidepressants had satisfying pain relief. it could be supposed that the efficacy of aripiprazole is caused by dopamine stabilization in this case, and bms might have a subtype that is reactive to aripiprazole. further studies are needed to confirm the efficacy of aripiprazole for bms. |
angiogenesis is the formation of new capillaries by the budding of endothelial cells resident in the surrounding preexisting vessels. it is a complex process that involves endothelial cell division, selective degradation of vascular basement membranes and of surrounding extracellular matrix and endothelial cell migration. periodontitis is an infection of highly vascularised supporting tissues of the teeth characterized by active and quiescent periods. dm contribute to periodontitis by mechanisms such as vascular changes, neutrophil dysfunction, altered collagen synthesis and genetic predisposition. vascular endothelial growth factor (vegf) it has been a primary initiator and potential mediator of proliferative and nonproliferative diabetic retinopathy, neuropathy and nephropathy. vascular endothelial growth factor interacts with humoral factors that regulate bone homeostasis and bone development such as the recruitment of osteoblasts and osteoclasts. bone formation and regeneration process are also linked to angiogenesis, a process in which vegf is a major stimulant. nevertheless, in periodontal tissues, angiogenesis seems to be important for the maintenance of tissue health and in periodontal diseases, vegf is an important factor in the initiation and progression of gingivitis to periodontitis, promoting the expansion of the vascular network. the periodontal vasculature is profoundly affected during progression of periodontal disease. early in the progression, the perivascular connective tissue become disrupted, the collagenous fibers are destroyed, creating spaces within the tissue which are quickly filled by inflammatory cells and loose connective tissue. vegf expression may be induced by several inflammatory mediators including prostaglandin e2, interleukin 6 and interleukin 1. in addition vegf expression is reported to be regulated by the oxygen concentration of tissues, with hypoxia inducing its expression. the ki-67 antigen specific antibody is used in probes to detect cells undergoing division, which is a typical part of the inflammation. ki-67 antigen expression has been detected in the nuclei of proliferation cells in the g1, s, g2 and m phases of the cell cycle, but it is absent in inactive cells. the aim of the study was to detect the presence of vegf and ki-67 in gingival biopsy of periodontally healthy patients, periodontitis patients without any systemic disease and periodontitis patients with controlled type ii dm. the study included 50 patients who reported to the outpatient department of periodontics, m s ramaiah dental college and hospital, bangalore, karnataka, with age ranging between 18 and 65 years. group 1 included periodontally healthy patients (10 gingival samples) with no sites with pocket depth and clinical attachment levels > 3 mm and they exhibited 5 mm, > 30% of sites with probing depth and clinical attachment loss > 4 m and presence of bleeding on probing. while subjects who were pregnant and lactating, on antibiotic therapy, smokers, on long term administration of anti - inflammatory medication, on localized radiation therapy of the oral cavity and on antineoplastic chemotherapy were excluded. gingival biopsies were performed with number 15 bp blades around the teeth and the gingival biopsy dimensions were 1.5 mm thick and 23 mm high. in patients with periodontitis without any systemic disease and periodontitis with controlled type ii dm, gingival biopsies were performed during periodontal surgery after completion of phase i therapy (scaling and root planning). in periodontally healthy patients, gingival biopsies were taken during crown lengthening, operculectomy and esthetic surgical procedures. after retrieval biopsies were immediately fixed in 10% buffered formalin, processed and stored as paraffin blocks. from each biopsy, two sections about 3 m thick sections were prepared and mounted on silane coated slides. paraffin sections were dewaxed using xylene, rehydrated and washed in phosphate buffered saline (ph 7.4) for 10 min. to unmask the antigens a microwave oven and a 2.1% citric acid solution slides were rinsed in buffer, and immunoreactions were completed with the anti - mouse / rabbit igg poly horse radish peroxidase method using a kit (novocrasta uk) and a multilink as a secondary biotinylated antibody. after incubation with d - amino benzidine chromogen, the specimens were counterstained with hematoxylin and coverslipped. the intensity of positivity was estimated as : negative () : fewer than 5% positive cells or no staining ; grade (+) : mild - 524% positive cells ; grade (+ +) : moderate - 25% to 50% positive cells and grade (+ + +) : severe - > 50% positive. the student 's t - test was used to determine whether there was a statistical difference between study groups in the parameters measured. data analysis was carried out using statistical package for social science (spss, version 10.5, ibm chicago, il, usa) package. from each biopsy, two sections about 3 m thick sections were prepared and mounted on silane coated slides. paraffin sections were dewaxed using xylene, rehydrated and washed in phosphate buffered saline (ph 7.4) for 10 min. to unmask the antigens a microwave oven and a 2.1% citric acid solution slides were rinsed in buffer, and immunoreactions were completed with the anti - mouse / rabbit igg poly horse radish peroxidase method using a kit (novocrasta uk) and a multilink as a secondary biotinylated antibody. after incubation with d - amino benzidine chromogen, the specimens were counterstained with hematoxylin and coverslipped. the intensity of positivity was estimated as : negative () : fewer than 5% positive cells or no staining ; grade (+) : mild - 524% positive cells ; grade (+ +) : moderate - 25% to 50% positive cells and grade (+ + +) : severe - > 50% positive. proportions were compared using chi - square test of significance. the student 's t - test was used to determine whether there was a statistical difference between study groups in the parameters measured. data analysis was carried out using statistical package for social science (spss, version 10.5, ibm chicago, il, usa) package. the intensity of vegf staining in 10 patients with periodontally healthy gingival showed mild staining (grade +) [figure 1 ]. in patients with periodontally diseased gingiva without any systemic disease, 20% of gingival biopsies showed mild staining (grade +) and 80% of then showed moderate staining (grade + +) [figure 2 ]. in patients with periodontally diseased gingiva with controlled type ii dm, 100% of gingival biopsies showed moderate staining (grade + +) [figure 3 ]. in 50 gingival biopsy samples, 72% of them showed moderate staining (grade + +) for vegf and 28% of them showed mild staining (grade +) for vegf. p value obtained was < 0.001 and the intensity of vegf staining between three groups were found to be statistically significant. in patients with periodontally diseased gingiva without any systemic disease, 20% of gingival biopsies showed mild staining (grade +) and 80% of gingival biopsies showed moderate staining (grade + +) for vegf. in patients with periodontally diseased gingiva with controlled type ii dm, all the gingival biopsies showed moderate staining (grade + +) for vegf. the p value obtained was 0.035 and the intensity of staining was found to be statistically significant on comparison of vegf staining between periodontitis group and periodontitis with controlled type ii dm group [graph 1 ]. vascular endothelial growth factor - mild (grade +) staining in group 1 vascular endothelial growth factor - moderate (grade + +) staining in group 2 vascular endothelial growth factor - moderate (grade + +) staining in group 3 intensity of vegf staining in study groups on comparing the intensity of ki-67 staining in patients with periodontally healthy gingiva, all the 10 gingival biopsies stained negative [figure 4 ]. in patients with periodontally 90% of then showed mild staining (grade +) [figure 5 ]. in patients with periodontally diseased gingiva with controlled type ii dm, 100% of gingival biopsies showed mild staining (grade +) [figure 6 ]. in a total of 50 gingival biopsy samples, 24% of them showed negative staining for ki-67 and 76% of them showed mild staining (grade +) for ki-67. p value obtained was < 0.001 and the intensity of ki-67 staining between three groups were found to be statistically significant. the intensity of ki-67 staining in patients with periodontally diseased gingiva without any systemic disease showed negative staining in 10% of gingival biopsies and 90% of gingival biopsies showed mild staining (grade +). in patients with periodontally diseased gingiva with controlled type ii dm, all the gingival biopsies showed mild staining (grade +) for ki-67. the p value obtained was 0.147 and the intensity of staining was not found to be statistically significant on comparison of ki-67 staining between periodontitis group and periodontitis with controlled type ii dm group [graph 2 ]. ki-67 - negative staining in group 1 ki-67 - mild (grade +) staining in group 2 ki-67 - mild staining (grade +) in group 3 intensity of ki-67 staining in study groups angiogenesis is regulated through a complex interplay of molecular signals mediated by growth factors involving extracellular matrix remodelling, endothelial cell migration and proliferation, capillary differentiation and anastomosis. as demonstrated in this study, immunostaining of vegf is localized in the cytoplasms of macrophages and fibroblasts and this is consistent with previous studies by fukumura., which demonstrated that macrophages and fibroblasts were the major source of synthesis and secretion of vegf. unl., conducted a study and observed no expression of vegf in negative healthy controls (patients without any systemic or periodontal diseases or in the healthy periodontal tissues of periodontal patients without dm). however vegf was detected in diseased periodontal tissues both in diabetic and nondiabetic patients, and in healthy tissues of diabetic patients., have suggested that vegf was generally unregulated even in relatively healthy sites, probably either reflecting subclinical levels of inflammation / healing after the microbial assault, or revealing the presence of vegf as a component of physiological angiogenesis in the gingival / periodontal environment. in our study, we observed positive vegf staining mostly in monocytes, macrophages and to a lesser degree in endothelial cells. this observation was in concordance with previous reports by nakagwa that have reported the presence of vegf within these cells. waltennberger has shown the impairment of monocytic migration towards a gradient of vegf in diabetics, whereas our results indicated the contrary ; presence of vegf staining in the monocytes in dm. it has been demonstrated that dm may have an inductive effect on the vegf levels of the periodontium during periodontal disease. therefore, vegf is related to important diabetic microvascular complications such as tissue ischemia, angiogenesis, permeability in many organs, and alterations in blood glucose levels. an increased epithelial vegf expression in patients with type i dm and type ii dm compared to controls was observed in study done by asprielloo. and this result further confirmed that dm has an inductive effect on periodontal vegf. in patients with diabetes, vegf overexpression plays a primary role in promoting the extravasation of inflammatory cells, suggesting a useful antiangiogenic strategy for periodontitis treatment. periodontitis may exacerbate diabetes by decreasing glycemic control, indicating a degree of synergism between the two diseases. this was also observed in our study, revealing higher presence of vegf in diabetics with periodontal disease compared to healthy gingival tissues from nondiabetic periodontal patients. in the present study moderate (grade ii) expression of vegf was seen in gingival samples of patients with controlled type ii dm and patients with periodontitis than periodontally healthy patients. in this it may because gingival biopsies were taken after scaling and root planning which has led to the reduction in intensity of inflammation. a study done by unl. showed that vegf is increased in gingival tissues of diabetic patients, especially those with periodontitis. it can be used as a marker to estimate tissue growth. a study done by sagun compared gingival biopsies from hereditary gingival fibromatosis patients and healthy gingival biopsies and found that the number of ki-67 antigen positive cells nuclei was observed to be low in the basal cell layers of hyperplastic epithelia and it was similar to the observation seen in gingival samples from healthy control group. nagarakanti., found a significant increase in the proliferative marker (ki-67) in periodontitis tissue samples versus healthy gingiva. they reported that the oral gingival epithelium should be the main source of this proliferation and differentiation., found that mean rates of ki-67 positive cells in the nifedipine and phenytoin were significantly higher than in healthy tissues. the continuous renewing of gingival tissues, the kinetics, cytodifferentiation and the importance of keratinisation increases especially in diabetic patients. aikgoz. found no significant difference in manner of keratinocyte proliferation between diabetic and healthy group. he also concluded that type ii diabetes is not associated with the severe disease of gingival tissue and the diabetes does not have an additional effect on the mitotic activity of gingival keratinocytes. in this study intensity of ki-67 staining was found to be negative in gingival biopsy samples from periodontally healthy patients and mild staining (grade +) was noticed in periodontitis and periodontitis with type ii dm. the conclusion drawn from this study are the intensity of vegf staining between three groups was found to be statistically significant. the intensity of vegf staining was found to be mild (grade +) in group 1 and moderate (grade + +) in group 2 and group 3 and the intensity of vegf staining was found to be statistically significant on comparison of vegf staining between periodontitis group and periodontitis with controlled type ii dm group. the intensity of ki-67 staining between three groups was also found to be statistically significant. the intensity of ki-67 staining in group 1 was found to be negative but in group 2 and group 3, ki-67 staining was found to be mild (grade +) and the intensity of ki-67 staining was not found to be statistically significant on comparison of ki-67 staining between periodontitis group and periodontitis with controlled type ii dm group. when angiogenesis is stimulated and the vascular network grows, this leads to odema and results in decrease in blood flow. investigations in large population need to be conducted to identify how vegf and ki-67 are involved in the tissue inflammation associated processes and the relationship between vegf and ki-67 in progression of periodontitis. vascular endothelial growth factor acts as a potent and pleiotropic inflammatory agent in periodontitis, especially when further aggravated by diabetes, suggesting a useful anti angiogenic strategy for periodontitis treatment. a key area of ongoing research will be the role of vegf in gingival disease. it is likely that new insights into the importance of vegfs for disease will continue to be generated. consequently, the scope for using anti - vegf approaches therapeutically will grow, and the challenge will be to develop more effective and economic ways to prevent vegf - driven pathophysiological angiogenesis. | aim : to evaluate immunohistochemically vascular endothelial growth factor (vegf) and ki-67 in human gingival samples and to compare these factors between healthy and diabetic patients.materials and methods : a total of 50 subjects were included in the study. they were categorized into three groups : periodontally healthy group, periodontally diseased gingiva without any systemic disease group and periodontally diseased gingiva with controlled type ii diabetes mellitus (dm) group. gingival biopsies were performed and immunohistochemical analysis were done for vegf and ki-67 staining in gingival samples.results:the present study found moderate intensity staining for vegf in periodontitis group and periodontitis with controlled type ii dm group and mild intensity staining for vegf in periodontally healthy group. with regard to ki-67, negative staining was observed in periodontally healthy group and mild staining in periodontitis group and periodontitis with controlled type ii dm group.conclusion:further investigation needs to be conducted to identify how vegf and ki-67 are involved in the tissue inflammation associated processes and the relationship between vegf and ki-67 in progression of periodontitis. |
kidney (renal) cancer, which includes renal cell carcinomas and transitional cell carcinomas of the renal pelvis, is estimated to have caused 13 680 deaths (8780 men and 4900 women) in 2013. clear cell renal cell carcinoma (ccrcc) is the most common subtype of kidney cancer, contributing approximately 80% of all reported cases, whereas the papillary and chromophobe subtypes contribute 15 and 5%, respectively. currently, there are no biomarkers for ccrcc early diagnosis, and the standard method of treatment (i.e., surgery) is unsatisfactory. this is because patients undergoing surgery are likely to relapse at a rate of 2050% and have a higher chance of developing metastatic tumor, which is incurable. therefore, there is the urgent need to identify biomarkers for early detection and to predict or monitor the recurrence of ccrcc after surgery. the complexity (dynamic range of approximately 10) of the plasma proteome is of great concern in biomarker discovery studies. this is because tissue and secreted cell surface protein products, which are indicators of a disease and/or healthy state, are of low abundance in blood plasma. for example, current clinical biomarkers including prostate specific antigen (psa) and her2/neu are present at low nanograms per milliliter concentration in plasma, and the ability to identify such molecular markers requires a comprehensive multi - dimensional analytical approach. this approach is sensitive and specific because it involves the characterization of a subpopulation of proteins whose alterations are associated with many diseases, including cancer. protein glycosylation is one of the most diverse and frequently occurring post - translational modifications involved in a number of cell processes, and aberrant changes in glycosylation profile during the development and progression of cancer is known. another method is immuno - affinity depletion, which targets the removal of high - abundance proteins, enabling a deeper mining of low - level proteins. these strategies have been used either alone or in combination to enhance protein biomarker discovery studies. a number of groups have reported the use of high - abundance proteins depletion and enrichment of target glycoproteins and have observed differential protein expression and alterations in protein glycosylation in cancer samples. these observations suggest that the integration of protein depletion and enrichment of target glycoproteins enhance proteomics and glycoproteomics studies, leading to the identification of potential candidate markers. ccrcc plasma biomarker discovery is lagging behind other disease studies, although early diagnosis of ccrcc can lead to a cure by surgery. to date, only a handful of ccrcc plasma proteomics biomarker discovery studies have been reported, and there are not yet any reports on n - glycan profiles in the literature to the best of our knowledge. therefore, we attempted to use a comprehensive comparative omics approach, namely, proteomics, glycoproteomics, and n - glycomics, to study ccrcc plasma before (disease) and after (non - disease) curative nephrectomy, and we evaluated the alterations associated with histological status. our goal was to identify potential candidate markers of biological interest in ccrcc development and their potential utility to monitor ccrcc recurrence after curative nephrectomy. our laboratory previously developed an automated high - throughput multi - lectin affinity chromatography (hp - m - lac) platform that combines two high - abundance proteins (albumin and igg) depletion and multi - lectins (con a, wga, and jac) fractionation. in the current study, we have expanded the hp - m - lac approach to incorporate 12 high - abundance proteins depletion (12p) and multi - lectins (sambucus nigra (sna), aleuria aurantia (aal), and phytohemagglutinin - l (pha - l)) enrichment with the overall goal of improving the proteomic and/or glycoproteomic depth. aal, sna, and pha - l lectins have specificities toward core (1,6) fucose, sialic acid, and n - acetyl glucosamine as well as highly branched glycans of terminal galactose and mannose oligosaccharides. these lectins were selected to capture the population of glycan structures frequently implicated in cancer progression and metastasis. ms / ms analysis of trypsin - digested, 12p - depleted plasma and m - lac fractions (bound and unbound) enabled relative quantification via spectral counting. furthermore, n - glycans released from m - lac fractions were profiled, and detailed structural annotation was conducted. we identified several low - abundance proteins and glycoproteins with significant differential abundance levels in ccrcc cancer samples. glycosylation alterations in cancer plasma (before) compared to noncancer plasma (after) were evident on the basis of glycoproteins differential binding to the m - lac column and n - glycan profiles. capture select 12p depletion resin and peek columns were purchased from life technology (milford, ma). gravity omnifit glass column was provided by biochem fluidics (boonton, nj). poros r1 50 m bulk media (reversed - phase packing) and hplc self - packing device were purchased from applied biosystems (framingham, ma). bis - tris sodium dodecyl sulfate polyacrylamide gel electrophoresis (sds - page) gels (412%) and nupage mes sds running buffer (10) were purchased from invitrogen (carlsbad, ca). hplc - ms grade water, formic acid, acetonitrile, and other buffer reagents were all purchased from thermo fisher scientific (waltham, ma). clear cell renal cell carcinoma (ccrcc) patients enrolled in this study gave their consent via protocols 01 - 130 approved by the institutional review board at massachusetts general hospital and provided to us by dr. twenty ccrcc plasma samples before nephrectomy and 20 ccrcc plasma samples after nephrectomy were pooled to give one disease (rcc (+)) and one non - disease (rcc ()) sample. pooling was necessary for this discovery study due to the limited amount of samples and also to reduce variability among patients. pooled plasma samples were stored in 80 c and did not undergo more than two freeze / thaw cycles. an automated hplc platform used for high - abundance protein depletion and glycoprotein fractionation has been described previously, and we have applied this fractionation platform with moderate changes. briefly, pooled plasma samples were depleted using a 12 (albumin, igg, igm, iga, free light chains, fibrinogen, transferrin, 1 antitrypsin, apolipoprotein a1, 2 macroglobulin, haptoglobin, and 1 acid glycoprotein) abundance protein depletion column packed in - house into a peek column (4.6 mm 100 mm) followed by glycoprotein fractionation with a multi - lectin affinity column (m - lac) containing equal mixtures of lectins : aleuria aurantia lectin (aal), sambucus nigra lectin (sna), and phaseolus vulgaris leucoagglutinin (pha - l). three columns (12p, m - lac, and r1 reversed phase), each attached to a separate valve, were connected in series on a two - dimensional hplc system (shimadzu, columbia, md) equipped with an on / off switch to control the valves. during sample fractionation, the columns were first equilibrated with a binding buffer (25 mm tris, 0.5 m sodium chloride, 1 mm mncl2, 1 mm cacl2, and 0.05% sodium azide, ph 7.4) at a flow rate of 2.0 ml / min for 15 min followed by plasma loading at a flow rate of 0.5 ml / min for 25 min. depleted plasma (12p unbound), m - lac bound, and m - lac unbound fractions were eluted separately via valve switching and desalted on an r1 reversed - phase column using a 70% solvent b (0.1% trifluoroacetic acid in acetonitrile) and 30% solvent a (0.1% trifluoroacetic acid in milli - q water) gradient. elution buffers for 12p depletion and m - lac fractions were 0.1 m glycine (ph 2.5) and 0.1 m acetic acid (ph 2.5), respectively. total protein concentration measurements of all collected fractions were performed using qubit fluorescence assay (life technologies, inc., briefly, 20 g of total protein per sample (2 analytical replicates of each fraction) was brought to 100 l volume with ultrapure water and 9 volumes of acetone added followed by overnight precipitation at 20 c. precipitated proteins were centrifuged briefly, acetone was removed, and the samples were speed vacuumed to dryness followed by resolubilization of the protein pellet in 10 l urea (8 m). the protein solution was dot blotted onto a 100% (v / v) methanol - activated pvdf membrane (millipore) surface and dried at room temperature. protein spots were visualized using direct blue 71 (sigma - aldrich) and destained with 40% (v / v) ethanol and 10% (v / v) acetic acid. the membrane was then blocked with 1% (w / v) pvp40 solution followed by 3 washes of 5 min each with water. pngase f (2.5 u ; flavobacterium meningospeticum, roche) was added, and the mixture was incubated at 37 c for 15 min and further incubated at 37 c overnight after an additional 10 l of water was added. n - glycans were extracted in the following fashion : 5 min sonication of the 96-well plate containing glycans and three washes with 20 l of water. samples were acidified with 10 l of 100 mm ammonium acetate (ph 5) and incubated at room temperature for 1 h. samples were subsequently dried via speed vacuum and reduced with 20 l of 1 m nabh4 in 50 mm koh at 50 c for 3 h. the reaction was stopped by addition of 2 l of acetic acid and desalted using ag 50w x8 cation exchange resin (bio - rad). methanol was added to remove any residual borate and allowed to evaporate in the vacuum centrifuge. separation of the n - glycan alditols was performed using a hypercarb pgc (5 m hypercarb, 180 100 mm ; thermo fisher scientific) connected on the hplc system (agilent 1100) over an 85 min gradient from 0 to 45% acetonitrile in 10 mm ammonium bicarbonate, and eluted ms / ms on a agilent msd three - dimensional ion - trap xct plus mass spectrometer. settings for the ms / ms were as follows : drying gas flow, 7 l / min ; drying gas temperature, 325 c ; nebulizer gas, 18 psi ; skimmer, 40.0 v ; trap drive, 99.1 v ; and capillary exit, 166 v. smart fragmentation was used with starting and ending amplitudes of 30 and 200, respectively. ions were detected in ion charge control targeted at 100 000 ions with a maximum accumulation time of 200 ms. ms spectra were obtained in negative ion mode with two scan events : a full scan range between m / z 100 and 2200 at a scan speed of 8100 m / z / s and a dependent ms / ms scan after cid of the top two most intense precursor ions with threshold 30 000 and relative threshold of 5% base peak. mass accuracy calibration of instrument was performed using tuning mix (agilent), and n - glycans released from bovine fetuin served as positive controls before each data set run. twenty micrograms of total protein from the depleted plasma and m - lac fractions was resolved on a 412% bis - tris sds - page gel (novex nupage, life technologies) followed by trypsin (promega, madison, wi) digestion of the excised gel pieces as previously described. briefly, lanes were cut into four bands, and each band was cut into 1 1 mm pieces. gel pieces were trypsin (0.04 g/l) digested following destaining with 50 mm ammonium bicarbonate buffer at ph 8.0 and acetonitrile, reduction (25 mm dithiothreitol) at 56 c for 30 min, and alkylation (50 mm iodoacetamide) at room temperature for 30 min in darkness. trypsin digests were extracted with 100 l of 50% (v / v) acetonitrile/0.1% (v / v) formic acid in hplc grade water three times and speed vacuumed to dryness. mass spectrometry analysis of depleted plasma and m - lac fractions was performed on an ltq - orbitrap elite instrument (thermo fisher scientific, waltham, ma) equipped with an ultimate 3000 hplc (lc packings - dionex, marlton, nj) and nano - esi source. a reversed - phase c18 column packed in - house with a 75 m metal spray tip (peptides were separated at a flow rate of 200 nl / min on the c18 column using the following 100 min gradient : 540% buffer b for 80 min, 4090% buffer b for 15 min, and 902% buffer b for 5 min. mobile phase a consisted of 0.1% v / v formic acid in hplc grade water, and mobile phase b consisted of 0.1% v / v formic acid in acetonitrile. the mass spectrometer was operated in a data - dependent mode, with the 8 most abundant precursor ions selected for collision induced dissociation (cid) ms / ms fragmentation in a full ms scan range of m / z 4002000 with a mass resolution of 120 000. dynamic exclusion parameters were set to 1 repeat count (repeat duration, 30 s ; exclusion list size, 100 ; exclusion duration, 45 s ; and exclusion mass width, 1.0 m / z low and 1.50 m / z high). analysis of n - glycan data was performed using esi - compass 1.3 (bruker daltonics). monoisotopic masses obtained were searched against glycomod (http://web.expasy.org/glycomod/) for possible glycan compositions and subsequently verified by their corresponding ms / ms spectra. the relative abundance of each glycan in a sample was determined using the peak area of each glycan against the sum of peak areas of all glycans from extracted ion chromatograms, which has been shown to be a reasonably accurate method for relative n - glycan quantitation. lc ms / ms proteomic and glycoproteomic data were searched against an annotated human database (release 2013_1 ; 34 157 entries) using the sequest algorithm (thermo electron corp, san jose, ca) in the thermo fisher proteome discoverer 1.4 suite. peptide identification was based on the hupo criteria, which included cn 0.1, peptide probability < 0.001, and xcorr 1.9, 2.5, and 3.8 for singly, doubly, and triply charged ions, respectively. confidence in identification was further increased by applying the reverse database with a false discovery rate (fdr) targeted at 1% at the peptide level. other search parameters included a maximum of 2 missed cleavages, full trypsin as enzyme, carbamidomethylation on cysteine as a static modification, and deamidation of asparagine as a dynamic modification ; precursor ion mass tolerance and fragment ion mass tolerance were set at 5 ppm and 0.8 da, respectively. panther (protein analysis through evolutionary relationships) database (http://pantherdb.org/) was used for gene ontology classification. a label free semiquantitative method using spectral count was applied to select proteins of interest with abundance changes and was used to evaluate m - lac differential binding in rcc samples as previously described. briefly, ratios of spectral count in disease to spectral count in non - disease allowed us to select proteins with potential abundance level changes after normalization with a reference ratio calculated from total spectral counts. glycoprotein candidates with m - lac differential binding were selected on the basis of the ratios of the spectral count of the m - lac bound fraction considered theoretical (non - disease_bound measured (disease_unbound measured / non - disease_unbound measured)) to the spectral counts of the experimental m - lac bound fraction (disease_bound). in instances where no peptides (0) were observed for a particular protein under consideration, 1 was added for meaningful ratio calculations. proteins or glycoproteins with a fold change 3 or 3 were identified as differentially expressed. excel software (microsoft office 2010) was used to generate p - values by calculating standard student s t - test and to investigate n - glycome and n - glycoproteome differential expression by considering p - values 0.05 as statistically significant. the global profiles of the proteome, glycoproteome, and n - glycome of ccrcc plasma were achieved by designing an analytical strategy that focused on deeper mining of low - abundance disease - associated nonglycoproteins, glycoproteins, and n - glycans (figure 1). in our previous publications, we have shown that a multi - dimensional platform is a valuable approach to comprehensively characterize the proteome and glycoproteome of biological samples to enhance the identification of potential biomarker candidates present at low amounts. in the current study, plasma samples were initially purified to reduce the large dynamic range of plasma concentration by depleting the top 12 high - abundance proteins (12p). furthermore, a semitargeted approach was used as a second fractionation strategy, in which equal mixtures of three lectins, aleuria aurantia (aal), sambucus nigra (sna), and phaseolus vulgaris leucoagglutinin (pha - l), were packed into an hplc peek column to enrich the subglycoproteome. lectins have previously been used to target glycan structures commonly altered in carcinogenesis. in a serum breast cancer proteomic study, zeng. observed that differential protein affinities toward selected lectins was indicative of changes in glycan expression level in cancer versus control samples. used pha - l lectin to capture potential breast carcinoma biomarkers elevated in breast carcinoma tissues at different stages. experimental workflow showing the process used in the characterization of clear cell renal cell carcinoma plasma (ccrcc). ccrcc plasma samples were depleted of the top 12 most highly abundant proteins followed by glycoproteins enrichment and lc ms / ms analysis of depleted plasma and m - lac of bound and unbound fractions. in this study, we focused on 40 plasma samples obtained from 20 patients diagnosed with clear cell renal cell carcinoma (supporting information table s1). plasma samples taken before (rcc (+)) and after (rcc ()) curative nephrectomy were pooled into two groups : disease (before nephrectomy, n = 20) and non - disease (after nephrectomy, n = 20). pooling was necessary to reduce patient variability and to improve the effective depletion of plasma while increasing protein detection coverage as previously established. also, pooling allowed for a sufficient amount of samples to be available for two analytical replicates of each omic analysis. 12p - depleted plasma and m - lac fractions were subjected to proteomics, glycoproteomics, and n - glycomic analysis using analytical platforms described in the materials and methods. advances in proteomic analysis have pointed out the importance of minimizing interference from high - abundance proteins that may mask and/or prevent the detection of low - level proteins in disease samples. therefore, an analytical technology that improves the identification of low - level proteins and increases the depth of proteomic data is desirable. in the current study, we utilized a developed 12p - m - lac fractionation platform and evaluated its performance in replicate analysis using reference plasma (bioreclamation, jericho, ny). first, the loading capacity of the platform was investigated to ensure minimal run - to - run carry over and sample losses, and 25 l of reference plasma volume was determined to be the optimal loading amount. we then used the optimized loading amount to assess the platform based on total protein recoveries, reproducibility, and efficiency. the total protein recovery measurements using bca assay (thermo scientific) showed an average of 92% of the starting material (data not shown), which agrees with an earlier report. similarly, coomassie blue stained gels for three analytical replicates of 12p column target (bound) proteins and m - lac fractions revealed an identical band pattern and band intensity in replicate samples, indicating good reproducibility of analytical replicates (supporting information figure 1). furthermore, we observed gel band differences in the m - lac bound and unbound fractions, suggesting that the m - lac column fractionates the glycoproteome into subpopulations. 12p - depleted plasma fractions were analyzed to evaluate protein abundance changes in proteomics analysis using 1d sds - page and nano - lc similarly, glycoproteomics of 12p - m - lac bound and unbound fractions enabled the evaluation of proteins with potential glycosylation changes. overall, 215 and 248 unique proteins were identified from two analytical replicates in the proteomic and glycoproteomic analyses, respectively. all proteins reported were identified with 99% confidence (1% fdr) and 2 unique peptides (supporting information table s2). details of the distribution of proteins and peptides are presented in supporting information table s3. low - abundance glycoproteins and non - glycoproteins identified fell into one of the following functional classification : proteases, lipid associated proteins, cytoskeletal associated proteins, and complement factors ; these functional categories have recently been reported to correlate with disease states. a label - free semiquantitation method based on spectral counts was utilized to quantify proteins expressed at different amounts in ccrcc plasma samples as previously described. briefly, 1d gel - nano - lc ms / ms analysis was performed on equal amounts of 12p - depleted plasma samples followed by data normalization using a reference ratio factor (total peptide hits of disease / total peptide hits of control), as detailed in section 2.6. in addition, spectral counts were validated by measurements of peak areas of extracted ion chromatograms and manual inspection of ms / ms spectra in random selected cases, as shown in earlier published work. differentially expressed proteins were selected on the basis of ratios of spectral count fold changes observed between rcc (+) and rcc () after normalization. potential candidate markers were selected if they were detected in two analytical replicates and exhibited 3 or 3 fold changes, p 0.05. as shown in table 1, the majority (approximately 74%) of potential candidate markers were upregulated in the disease proteome. these include lipid transport and metabolic process proteins (e.g., cholesteryl ester transfer protein, apolipoprotein f, apolipoprotein l1, and phospholipid transfer protein), immune system process proteins (e.g., basement membrane - specific heparan sulfate proteoglycan core protein, coagulation factor xi, and prostaglandin d2 synthase (21kd) brain), and signal transduction proteins (e.g., cell surface glycoprotein muc18, pantetheinase, and junction plakoglobin). we used the gene ontology (go) classification system to characterize both the biological process and molecular function of selected potential candidate markers (figure 2a, b). (a) molecular function classification, and (b) biological process classification. the abundance of both molecular function and biological process is represented by their relative percentage. average spectral count of two technical replicates. for meaningful ratio calculations, proteins with no spectral counts, downregulation ;, upregulation ; n / a, not identified upon further exploration, we established disease associations and glycosylation status of potential candidate markers using novoseek, a data mining tool resident in the genecards repository (www.genecards.org). the novoseek score, which defines the relevance of the disease to the gene / protein, is based on their literature text - mining algorithms. disease associations were established on the basis of their scores : the higher the score, the more significant the protein is to the disease. two unique observations were made : (1) a strong correlation among potential candidate markers and various kidney and cancer diseases was found and (2) the majority of potential candidate markers are glycosylated (table 1). proteins such as basement membrane - specific heparan sulfate proteoglycan core protein (hspg2), cell surface glycoprotein muc18 (cd146), l - selectin (sell), vascular cell adhesion protein 1 (vcam1), and protein z - dependent protease inhibitor (serpina10) have been implicated in several disease states, including clear cell renal cell carcinoma, renal failure, gastric cancer, hepatocellular cancer, prostate cancer, lung cancer, ovarian cancer, breast cancer, and skin cancer. cd146, a novel cell adhesion molecule, was recently reported to be a potential marker for clear cell renal cell carcinoma recurrence. observed significantly higher levels of cd146 gene expression in patients with metastatic ccrcc compared to that in patients with localized ccrcc and concluded that the recurrence of ccrcc is directly related to the levels of cd146 gene expression. in another publication, the presence of cd146 and elevated levels of adiponectin in patients with chronic renal failure were associated with potential indication of endothelial damage and increased cardiovascular risk. these findings further strengthen our current data wherein a 16-fold abundance increase of cd146 was observed in rcc (+) plasma compared to that in rcc () plasma. future structural studies of cd146 may provide more information in our understanding of the presence of high amounts of cd146 protein and its role in ccrcc plasma. it is established that changes in m - lac binding affinities (low or high) of glycoproteins maybe indicative of the response of glycan structural changes in disease samples. hence, glycoproteins in m - lac fractions (bound and unbound) with glycan alterations were evaluated on the basis of differential m - lac binding. relative quantification was performed (see materials and methods) using spectral counts obtained from ccrcc glycoproteome data. in table 2, we show a list of glycoproteins with significant differential m - lac binding (3 or 3 fold changes, significance level p 0.05) and their potential sites of glycosylation based on literature information (www.uniprot.org). the association between glycan alterations and cancer is well - known, and our current observation of altered glycoproteins is consistent with earlier reports. average spectral count of two technical replicates. for meaningful ratio calculations, proteins with zero (0) spectral counts, downregulation ;, upregulation ; n / a, not identified for instance, clusterin, a heavily glycosylated protein with seven potential asparagine - linked glycan sites showed increased differential m - lac binding in disease samples vs controls. clusterin is associated with tumor advancement and carcinogenesis, and recent reports have indicated the presence of clusterin glycan alterations in cancer vs noncancer samples. in stomach cancer studies, bones. showed the linearity between decreased levels of clusterin glycans and the progression of cancer. in addition, clear cell renal cell carcinoma plasma studies revealed significant glycoform changes between rcc (+) and rcc () samples of released clusterin glycans. more recently, we have observed a significant site - specific glycoform alteration of biantennary digalactosylated disialylated (a2g2s2) and core fucosylated biantennary digalactosylated disialylated (fa2g2s2) glycans in disease vs non - diseased ccrcc plasma (manuscript in preparation). similarly, vitamin d - binding protein (dbp) showed increased binding to the m - lac column in ccrcc disease samples. the relationship between the glycosylation status and function of dbp in cancer patients is still unclear. earlier data suggested that there is a direct correlation between decreased levels of oligosaccharides present on dbp and inactivity of gc macrophage activating factor (gcmaf) in cancer patients. recently however, rehder. investigated dbp glycans levels and observed a high abundance of oligosaccharides in cancer patients, which is in contrast to earlier suggestions. the current study showed an increase in m - lac binding of dbp in disease compared to non - disease ccrcc samples, suggesting potential glycosylation alterations. however, the focus of this study was not to investigate the function of dbp ; therefore, further studies are required to provide information on the association of dbp s glycosylation with ccrcc. while gelc ms identified interesting proteins based on differential expression, it did not provide information about post - translational modifications (ptm) such as glycosylation alterations, and because many biological functions are mediated through glycans, altered glycosylation is a now an established feature of cancer. therefore, the advantage of m - lac is that it is able to capture some of these subtle changes in order to identify potential biomarkers. in this discovery - based study, our goal is to understand the global profile of n - glycans released from low - abundance glycoproteins enriched through depletion of 12 proteins followed by lectin fractionation. changes in these low - level glycans may be of potential utility in understanding the presence, progression, and disease recurrence of ccrcc. to this end, total n - glycans of depleted m - lac fractions of pooled disease rcc (+) and non - disease rcc () samples were characterized. n - glycans were released by pngase f via dot - blotting, online - separated on a porous graphitized carbon (pgc) column, and analyzed using lc esi tandem mass spectrometry in negative ion mode. utilizing ms retention times, charge states, and ms / ms fragmentation pattern, thirty six structurally different n - glycans corresponding to 23 n - glycan monosaccharide compositions were identified from two analytical replicates with minimum variation (average % cv < 2.5) (figure 3). neutral, sialylated (monosialo, disialo, trisialo, and tetrasialo), fucosylated, and high mannose n - glycans were observed. the identification of n - glycans with various degrees of isomerization was consistent with previous studies of pgc chromatography. yellow circle, galactose ; blue square, n - acetylglucosamine ; green circle, mannose ; purple diamond, sialic acid ; red triangle, fucose ; core = (glcnac)2(man)3. even though the n - glycan profiles of rcc (+) and rcc () m - lac fractions were similar in overall appearance (supporting information figure s2), a detailed analysis revealed significant differences between disease and non - disease m - lac fractions. first, the mean of the relative intensities of the two analytical replicates was calculated, and the data was normalized as previously described. briefly, the relative intensities of each glycan in a sample was determined using the ratio of the extracted ion chromatography (eic) peak area of each n - glycan over the sum of the eic peak areas of all n - glycans in the sample. total glycan structures were expressed as a percentage after normalization, and relative intensities were established on the basis of relative quantification, not absolute measurements. the resulting relative abundance of individual n - glycans was compared across different samples. a detailed list showing the composition, type, isoforms, observed m / z, theoretical mass, and relative intensities (%) of n - glycans identified is presented in supporting information table s4. following normalization, a comparative qualitative approach was taken to evaluate the 36 observed and normalized n - glycans from rcc (+) and rcc () m - lac (bound and unbound) fractions. three unique observations were made (see supporting information table s4) : (1) sialylated n - glycans were expressed in high levels, and afucosylated disialo - n - glycan, m / z 1111.4, was observed to be the most abundant glycan structure in all analyzed fractions. in a recent report that involved tissue samples, fucosylated glycans were observed to be the most abundant form, indicating differences in glycan profiles of different disease models. afucosylated disialo - n - glycans are a frequently observed occurrence in many cancer glycomic studies. in the present data, we observed two structural isomers for afucosylated disialo - n - glycan with different levels of expression : structure no. 15a with both terminal sialic acid residues in 2,6-linkages eluting prior to structure no. (2) n - glycan expression levels in m - lac bound fractions were higher compared to that in m - lac unbound fractions, which is consistent with our aim of enriching target glycans using the m - lac column. in addition, this observation correlates with m - lac s ability to segregate glycan variations into bound and unbound fractions. (3) the majority of n - glycans were expressed with different amounts when comparing rcc (+) and rcc (), and some n - glycan structures (nos. 13b, 18a, 18b, 21b, and 21c) were observed to be either missing or expressed at extremely low levels in m - lac fractions and therefore were difficult to quantitate. however, this unique observation may point to a potential glycan - specific molecular feature to differentiate disease and non - disease clear cell renal cell carcinoma plasma samples. after establishing qualitative differences between disease and non - disease fractions, relative quantification and statistical analysis were performed to identify differentially expressed n - glycans. for n - glycans with zero (0) relative abundance standard student s t - test revealed that 44% of identified n - glycans (16 structures) differ significantly (average p < 0.011), with an observation of over- or underexpression of n - glycans in rcc (+) m - lac fractions. a notable feature from the differentially expressed glycans was the upregulation of high degree sialylated and high mannose glycans. 18a, 18b, 21b, and 23b, to be upregulated in disease m - lac fractions (bound and unbound). the observation of upregulation of sialylated glycans was recently reported in a study involving tissues of renal cell carcinoma, and our data is in agreement with this report. elevated levels of highly branched sialylated glycans are associated with increased activity of sialyltransferases, an enzyme that regulates biosynthesis of sialic acid residues. several studies have reported an effect of alterations of sialic acids composition on cell adhesion, a factor implicated in metastasis. in breast cancer, for example, lin. reported that increased amounts of sialic acid correlate with a decrease in cell m - lac bound and unbound ; core = (glcnac)2(man)3 ;, downregulation ;, upregulation. for meaningful ratio calculations, glycans with zero (0) relative abundance an increased level of high mannose structures (glycans nos. 1, 9, and 4) was another distinct feature in this study. elevation of high mannose type glycans have been indicated in various cancer types. high levels of high mannose glycans were reported to correlate with breast cancer progression, and a similar trend was reported in head and neck tumor studies. higher or lower levels of glycans are a hallmark of cancer progression, and their alterations may be related to changes in the expression levels of enzymes involved in the glycan biosynthesis pathway. therefore, the goal of these studies was to assess the potential of n - glycans as biomarker candidates for clear cell renal cell carcinoma. extracted ion chromatograms (eics) of some selected n - glycans were used to validate different amounts of n - glycan expression in m - lac fractions. in figure 4a, 1 [core + (hex)3 ] m / z (698.2), n - glycan no. 9 [core + (hex)6 ] m / z (941.3), n - glycan no. 18a (isomer a) [core + (hexnac)4(hex)4(neuac)4 ] m / z (1178.1), and n - glycan no. 18b (isomer b) [core + (hexnac)4(hex)4(neuac)4 ] m / z (1178.1) highlights an elevation of high mannose and tetra - antennary sialo - type oligosaccharides in rcc (+) m - lac fractions. all n - glycan structural identifications were confirmed via ms / ms fragmentation (supporting information figure s3). in summary, our n - glycan data correlates with the glycoproteomics data in which m - lac differential binding suggests potential glycosylation (glycan - specific) changes in ccrcc cancer fractions, and our current article marks a novel mapping of glycans in ccrcc plasma. extracted ion chromatograms to illustrate differentially expressed glycans in m - lac bound and unbound fractions. 9 (right) show that both n - glycans are expressed at higher levels in m - lac bound before ccrcc surgery (upper panels) compared to those observed after ccrcc surgery (lower panels). 18b (b) show that both n - glycans are expressed at higher levels in mlac unbound and bound fractions before ccrcc surgery (1st and 3rd panels) compared to those observed after ccrcc surgery (2nd and 4th panels). yellow circle, galactose ; blue square, n - acetylglucosamine ; green circle, mannose ; purple diamond, sialic acid ; red triangle, fucose ; core = (glcnac)2(man)3. we have successfully performed fractionation of pooled plasma from 20 patients diagnosed with clear cell renal cell carcinoma (ccrcc) using the immuno - affinity depletion of 12 high - abundance proteins and a multi - lectin affinity chromatography (m - lac) platform. alterations in the plasma proteome, glycoproteome, and n - glycome of ccrcc patients were studied for the identification of low - level potential candidate markers that may be of interest for early diagnosis or used as a utility to monitor ccrcc recurrence. we report that low - abundance proteins with significant expression changes, such as cell surface glycoprotein muc18, basement membrane - specific heparan sulfate proteoglycan core protein, l - selectin, and vascular cell adhesion protein 1, may be potential candidates after further validation because of their observed association with various cancers and renal - related diseases. furthermore, proteins with glycan alterations with differential m - lac column binding confirm reports of the ability of lectins to target potential glyco - biomarker candidates. complex - type sialylated fucose glycans released from enriched glycoproteins were observed with alterations in ccrcc disease patients that could be related to alterations of glycosylation at the onset of clear cell renal cell carcinoma. this study was conducted as a first step in identifying potential candidate markers of interest in ccrcc plasma, and the current platform can be well - utilized in the analysis of candidate biomarkers. in the future, we plan to follow up by confirming observed protein abundance and glycan alterations in individual ccrcc patients and validate the observed changes in clinical assays such as elisa, mrm, and antibody lectin sandwich microarray in a larger cohort. | clear cell renal cell carcinoma is the most prevalent of all reported kidney cancer cases, and currently there are no markers for early diagnosis. this has stimulated great research interest recently because early detection of the disease can significantly improve the low survival rate. combining the proteome, glycoproteome, and n - glycome data from clear cell renal cell carcinoma plasma has the potential of identifying candidate markers for early diagnosis and prognosis and/or to monitor disease recurrence. here, we report on the utilization of a multi - dimensional fractionation approach (12p - m - lac) and lc ms / ms to comprehensively investigate clear cell renal cell carcinoma plasma collected before (disease) and after (non - disease) curative nephrectomy (n = 40). proteins detected in the subproteomes were investigated via label - free quantification. protein abundance analysis revealed a number of low - level proteins with significant differential expression levels in disease samples, including hspg2, cd146, ecm1, sell, syne1, and vcam1. importantly, we observed a strong correlation between differentially expressed proteins and clinical status of the patient. investigation of the glycoproteome returned 13 candidate glycoproteins with significant differential m - lac column binding. qualitative analysis indicated that 62% of selected candidate glycoproteins showed higher levels (upregulation) in m - lac bound fraction of disease samples. this observation was further confirmed by released n - glycans data in which 53% of identified n - glycans were present at different levels in plasma in the disease vs non - disease samples. this striking result demonstrates the potential for significant protein glycosylation alterations in clear cell renal cell carcinoma cancer plasma. with future validation in a larger cohort, information derived from this study may lead to the development of clear cell renal cell carcinoma candidate biomarkers. |
autism spectrum disorder (asd) is defined by persistent deficits in social communication and social interaction, and restricted, repetitive patterns of behavior, interests, or activities. there have been recent changes made to the diagnostic criteria, including modifications to the core features. although an asd diagnosis is defined by the american psychiatric association, other features, more physical or health related, are associated with an asd diagnosis. for example, children with asd are more likely to have headaches / migraines, respiratory and food allergies, gastrointestinal (gi) problems, and infections than typically developing children. another important aspect of those with any asd diagnosis is that a significant number of children diagnosed with an asd experience a developmental regression characterized by a loss of previously - acquired skills. many parents report that their child was developmentally normal until sometime after birth, typically 15 - 24 months, at which time the child began to regress or deteriorate. the reported incidence of regression in autism varies in different studies from 15 to 62% of the cases. for example, a study by goldberg., found that children who lost verbal skills did so at an average age of 20.69 months ; children who lost nonverbal skills did so at an average age of 18.58 months ; and children who lost both skills, lost verbal skills at an average age of 21.2 months and nonverbal skills at an average age of 18.9 months. malhi and singhi found that the mean age at regression was 22.43 months (standard deviation (sd) = 6.57) and that a large majority (66.7%) of the parents reported regression between 12 and 24 months of age., malhi and singhi said that most (75%) of the parents of the regression - autistic group reported regression in the language domain, particularly in the expressive language sector, usually between 18 and 24 months of age. another finding of malhi and singhi was that there were no significant differences between the two groups (children with asd who had r and children with asd who had not r) on the total childhood autism rating scale (cars) score (a measure of autism severity) and the total number of diagnostic and statistical manual - fourth edition (dsm iv) symptoms endorsed. ozonoff., conducted a retrospective study of 60 children with autism (between 3 and 9 years of age) using the early development questionnaire (edq), to collect specific, parent - reported information about their children 's development in the first 18 months. ozonoff and colleagues found that the children could be divided into three groups : an early onset group (n = 29), a definite regression group (n = 23), and a heterogeneous mixed group (delays - plus - regression, n = 8). several studies have sought to objectively evaluate the phenomenon of autistic regression early in life. for example, werner and dawson evaluated home videotapes of children with autism between their first and second birthday parties with and without a reported history of regression, as well as videotapes of typically developing children. analyses revealed that infants diagnosed with an asd with regression show similar use of joint attention and more frequent use of words and babble compared with typical infants at 12 months of age. in contrast, infants diagnosed with an asd characterized by early onset of symptoms and no regression displayed fewer joint attention and communicative behaviors at 12 months of age. by 24 months of age, both groups of toddlers diagnosed with an asd displayed fewer instances of word use, vocalizations, declarative pointing, social gaze, and orienting to name as compared with typically developing 24-month - olds., in a prospective longitudinal study, evaluated the emergence of the early behavioral signs of an asd diagnosis, including gaze to faces, social smiles, and directed vocalization coded from video and rated by examiners evaluating study subjects at 6, 12, 18, 24, and 36 months of age. these investigators observed that the frequency of gaze to faces, shared smiles, and vocalizations to others were highly comparable between groups at 6 months of age, but in the group later diagnosed with an asd, significantly declining trajectories were apparent over time. these investigators concluded that their results suggest that behavioral signs of asd are not present at birth, as once suggested by kanner, but rather emerge over time through a process of diminishment of key social communication behaviors, and more children may present with a regressive course than previously thought. two recent studies examined brain differences between children with autism who regress and those who do not show symptoms of regression. one examined brain volume and the other examined the activity and expression of protein kinase a (pka), a cyclic amp - dependent protein kinase. both studies found that children with autism who had r were different from both control subjects and individuals with non - regressive autism. many issues about regression in asd remain in question or under debate and a better understanding of regression in asd is needed. the purpose of the study was to examine the percentage of children who were considered to be d, r, or dr and to examine any relationship with autism severity, time of onset, gi symptoms, age, race, gender, and any factors associated with onset. the study was a review of developmental and medical information based on parental reports of 135 children with autism, pervasive developmental disorder (pdd), asd, or asperger syndrome (as) from data collected retrospectively and prospectively by the authors in previous studies. the current study examined whether the children were considered to be delayed (d), r, or delayed and later regressed (dr). d was defined as a significant lag in the appearance of normal developmental milestones or as any significant lag in a child 's physical, cognitive, behavioral, emotional, or social development. r was defined as having lost previously acquired skills (including loss of language and social skills) and abilities. dr was defined as a significant lag in the appearance of normal developmental milestones with a later loss of previously acquired skills. the study used a demographics and medical survey (dms) to collect specific, parent - reported information about their child 's developmental and medical history. the study also examined the percentage of children who were reported to have gi issues and the types of gi issues. the studies from which this information was retrieved received irb approval from the university of texas southwestern medical center irb (dallas, texas) ; liberty irb, inc. (deland, florida) ; or the timberlawn psychiatric research foundation, inc., irb (dallas, texas). all studies complied with the american psychological association ethical standards in the treatment of participants and in obtaining informed consent. all parents signed a consent and health insurance portability and accountability act (hipaa) form and all received a copy. the study was an exploratory analysis using data that was collected retrospectively and prospectively from multiple studies conducted by kern., from 2007 to 2012 using purposive sampling. children with a diagnosis of autism, asd, pdd, or as were prospectively (at the time of each study) recruited from the community by using flyers and word of mouth. for example, autism organizations in the area were notified of the study and flyers were posted in pediatric neurology offices. all of this research was conducted in the greater dallas metroplex area. after explaining the study and obtaining informed consent from the parent (s), each child was evaluated by the principal investigator (pi ; jkk) using the cars. for the two children in the study who were one year of age, the modified checklist for autism in toddlers (m - chat) was completed by the child 's parent. the questions in that survey were designed to address whether the child should be categorized as d, r, or dr and if there was any relationship between the d, r, or dr groups and the child 's age, gender, race, autism severity, or gi symptoms. a question regarding factors associated with onset, studies, previously mentioned, were diagnosed with autism, asd, pdd, or as and were prospectively (at the time of each study) recruited from the community. each child in the asd group had been previously diagnosed by a professional. in the state of texas, the only professionals who are allowed to diagnose asd are either licensed clinical psychologists or medical doctors. to further evaluate each child 's diagnostic accuracy, each child was observed by the pi (jkk), who has many years of experience in evaluating children with asd, to make sure that they met the dsm - iv criteria for an asd (this research was conducted prior to the adoption of dsm-5). in addition, the cars evaluation was completed on each child by the pi who observed the participants and interviewed the parent (s). although a total score of about 25 is considered to be the minimum cut off cars score for an asd diagnosis, a cut off of 22.5 was set to allow the children with a diagnosis of as to participate. the study was designed to exclude children who had a history of fragile x disorder, tuberous sclerosis, phenylketonuria (pku), lesch - nyhan syndrome, seizure disorder, cerebral palsy, fetal alcohol syndrome, or any history of maternal illicit drug use. detailed information was collected on each participant regarding age, race, gender, and year of birth. a summary of the participants dms : the dms asks basic demographic and medical questions. the demographic questions include queries about the child 's name, address, age, race, gender, date of birth, diagnosis, age of diagnosis, and any comorbid diagnosis. the medical questions include queries about the child 's allergies, medications, supplements, current, and past treatments, as well as whether the child was d, r, or dr, age of onset of symptoms, if anything preceded or was associated with the child 's regression, gi problems, and any other medical issues. after the questionnaire was completed by a parent, the pi reviewed the answers with the parent to make sure that the answers were complete and clear. study participants were evaluated using a cars test conducted only by a single study investigator (jkk) who observed the participants and interviewed the parent(s). the cars was used to confirm the child 's diagnosis and to determine the child 's severity score. the cars is a 15-item behavioral rating scale developed to identify autism as well as to quantitatively describe the severity of the disorder. taste, smell, and touch response and use ; x. fear or nervousness ; xi. nonverbal communication ; xiii. activity level ; xiv. level and consistency of intellectual response ; and xv. each item is scored from 1 (no pathology) to 4 (severe pathology) in 0.5 rating intervals. a total score of 15 - 29.5 is considered nonautistic ; a score of 30 - 36.5 is considered mild to moderate autism ; and a score from 37 to 60 is considered moderate to severe autism. for cars evaluation, a total score of about 25 the internal consistency reliability alpha coefficient is 0.94 ; the inter - rater reliability correlation coefficient is 0.71 ; and the test - retest correlation coefficient is 0.88. cars scores have high criterion - related validity when compared to clinical ratings during the same diagnostic sessions, with a correlation of 0.84 (p < 0.001). other comparisons, based on information from records, parent interviews, and nonstructured clinical interviews with the child, report a correlation coefficient of 0.80 (p < 0.001). many independent studies on the validity of the cars indicate that it has high validity. the m - chat consists of 23 yes / no items that assess the child 's attainment of developmental milestones. the items address issues important in autism such as social relatedness, communication, pretend play, imitation, interaction, eye contact, response to name, interests, basic skills, and behavior. criteria for failure of the checklist is failing either two or more critical items, or failing three or more items. the internal reliability for the m - chat is adequate for the checklist as a whole (a = 0.85) as well as for the critical items (a = 0.83). the m - chat has a sensitivity of 0.87, specificity of 0.99, positive predictive power of 0.80, and a negative predictive power of 0.99. this measure was completed by a parent or guardian for those children less than 2 years of age. the d, r, and dr groups were compared on continuous outcomes by analysis of variance. if the overall test was significant then pair - wise comparisons were tested using the tukey - kramer adjustment for multiple comparisons. a two - tailed p < 0.05 was considered statistically significant for all of the statistical tests in the present study. the study was a review of developmental and medical information based on parental reports of 135 children with autism, pervasive developmental disorder (pdd), asd, or asperger syndrome (as) from data collected retrospectively and prospectively by the authors in previous studies. the current study examined whether the children were considered to be delayed (d), r, or delayed and later regressed (dr). d was defined as a significant lag in the appearance of normal developmental milestones or as any significant lag in a child 's physical, cognitive, behavioral, emotional, or social development. r was defined as having lost previously acquired skills (including loss of language and social skills) and abilities. dr was defined as a significant lag in the appearance of normal developmental milestones with a later loss of previously acquired skills. the study used a demographics and medical survey (dms) to collect specific, parent - reported information about their child 's developmental and medical history. the study also examined the percentage of children who were reported to have gi issues and the types of gi issues. the studies from which this information was retrieved received irb approval from the university of texas southwestern medical center irb (dallas, texas) ; liberty irb, inc. (deland, florida) ; or the timberlawn psychiatric research foundation, inc., irb (dallas, texas). all studies complied with the american psychological association ethical standards in the treatment of participants and in obtaining informed consent. all parents signed a consent and health insurance portability and accountability act (hipaa) form and all received a copy. the study was an exploratory analysis using data that was collected retrospectively and prospectively from multiple studies conducted by kern., from 2007 to 2012 using purposive sampling. children with a diagnosis of autism, asd, pdd, or as were prospectively (at the time of each study) recruited from the community by using flyers and word of mouth. for example, autism organizations in the area were notified of the study and flyers were posted in pediatric neurology offices. all of this research was conducted in the greater dallas metroplex area. after explaining the study and obtaining informed consent from the parent (s), each child was evaluated by the principal investigator (pi ; jkk) using the cars. for the two children in the study who were one year of age, the modified checklist for autism in toddlers (m - chat) was completed by the child 's parent. the questions in that survey were designed to address whether the child should be categorized as d, r, or dr and if there was any relationship between the d, r, or dr groups and the child 's age, gender, race, autism severity, or gi symptoms. a question regarding factors associated with onset, studies, previously mentioned, were diagnosed with autism, asd, pdd, or as and were prospectively (at the time of each study) recruited from the community. each child in the asd group had been previously diagnosed by a professional. in the state of texas, the only professionals who are allowed to diagnose asd are either licensed clinical psychologists or medical doctors. to further evaluate each child 's diagnostic accuracy, each child was observed by the pi (jkk), who has many years of experience in evaluating children with asd, to make sure that they met the dsm - iv criteria for an asd (this research was conducted prior to the adoption of dsm-5). in addition, the cars evaluation was completed on each child by the pi who observed the participants and interviewed the parent (s). although a total score of about 25 is considered to be the minimum cut off cars score for an asd diagnosis, a cut off of 22.5 was set to allow the children with a diagnosis of as to participate. the study was designed to exclude children who had a history of fragile x disorder, tuberous sclerosis, phenylketonuria (pku), lesch - nyhan syndrome, seizure disorder, cerebral palsy, fetal alcohol syndrome, or any history of maternal illicit drug use. detailed information was collected on each participant regarding age, race, gender, and year of birth. the demographic questions include queries about the child 's name, address, age, race, gender, date of birth, diagnosis, age of diagnosis, and any comorbid diagnosis. the medical questions include queries about the child 's allergies, medications, supplements, current, and past treatments, as well as whether the child was d, r, or dr, age of onset of symptoms, if anything preceded or was associated with the child 's regression, gi problems, and any other medical issues. after the questionnaire was completed by a parent, the pi reviewed the answers with the parent to make sure that the answers were complete and clear. study participants were evaluated using a cars test conducted only by a single study investigator (jkk) who observed the participants and interviewed the parent(s). the cars was used to confirm the child 's diagnosis and to determine the child 's severity score. the cars is a 15-item behavioral rating scale developed to identify autism as well as to quantitatively describe the severity of the disorder. taste, smell, and touch response and use ; x. fear or nervousness ; xi. verbal communication ; xii. each item is scored from 1 (no pathology) to 4 (severe pathology) in 0.5 rating intervals. a total score of 15 - 29.5 is considered nonautistic ; a score of 30 - 36.5 is considered mild to moderate autism ; and a score from 37 to 60 is considered moderate to severe autism. for cars evaluation, a total score of about 25 is considered to be the minimum cut off cars score for an asd diagnosis. the internal consistency reliability alpha coefficient is 0.94 ; the inter - rater reliability correlation coefficient is 0.71 ; and the test - retest correlation coefficient is 0.88. cars scores have high criterion - related validity when compared to clinical ratings during the same diagnostic sessions, with a correlation of 0.84 (p < 0.001). other comparisons, based on information from records, parent interviews, and nonstructured clinical interviews with the child, report a correlation coefficient of 0.80 (p < 0.001). many independent studies on the validity of the cars indicate that it has high validity. the m - chat consists of 23 yes / no items that assess the child 's attainment of developmental milestones. the items address issues important in autism such as social relatedness, communication, pretend play, imitation, interaction, eye contact, response to name, interests, basic skills, and behavior. criteria for failure of the checklist is failing either two or more critical items, or failing three or more items. the internal reliability for the m - chat is adequate for the checklist as a whole (a = 0.85) as well as for the critical items (a = 0.83). the m - chat has a sensitivity of 0.87, specificity of 0.99, positive predictive power of 0.80, and a negative predictive power of 0.99. this measure was completed by a parent or guardian for those children less than 2 years of age. the d, r, and dr groups were compared on continuous outcomes by analysis of variance. if the overall test was significant then pair - wise comparisons were tested using the tukey - kramer adjustment for multiple comparisons. a two - tailed p < 0.05 was considered statistically significant for all of the statistical tests in the present study. the number of children in the d group was 53 (39.2%) with 19 (14.1%) in the dr group and 63 (46.7%) in the r group. thus, 82 children (60.7%) were reported to have r (lost previously acquired skills). in regard to the onset of symptoms, there was a significant difference between the d and r (p = 0.0003) groups and between the dr and r (p = 0.0334) groups. the mean age of onset of initial symptoms was 10.9 (sd = 10.6) months in the d group, 11.4 (sd = 5.3) months in the dr group, and 17.0 (sd = 6.2) months in the r group. the mean age of onset of regression was 20.9 (sd = 16.0) months in the dr group and 17.0 (sd = 6.2) months in the r group. however, when one outlier was excluded from the analysis (a child in the dr group who was d and was reported to have r at 7 years of age), the mean age of onset of regression in the dr group was reduced to 17.4 (sd = 4.9) months. thus, there was not a significant difference between the time of regression between the dr and r group when this anomalous child was excluded from the full dr group. for a summary of this information, see table 2. for the children in the d group, the age of onset of symptoms ranged from birth to 36 months. for the children in the dr group, the age of onset of initial symptoms ranged from 2 to 24 months, and the age of onset of regression ranged from 12 to 84 months. with the one outlier in the dr removed, the range for the age of onset was reduced to 12 to 24 months. in the children with r only, the age of onset of regression ranged from 2 to 48 months. for a summary of this information, see table 2. a summary of the regression information turning to the question of what event preceded or was associated with the regression, the questionnaire data consisted of responses in four categories : unknown (n = 26 ; 31.7%) ; vaccination (n = 47 ; 57.3%) ; infection (n = 6 ; 7.3%) ; or other (n = 3 ; 3.7%). in the group that reported regression after vaccination, the questionnaire responses fell into one of four categories : multiple vaccines (n = 23 ; 48.9%) ; measles, mumps, and rubella (mmr) (n = 19 ; 40.4%) ; influenza (n = 3 ; 6.4%) ; and diphtheria, pertussis, and tetanus (dpt) (n = 2 ; 4.3%). of those who listed vaccination as a factor, five (10.6%) stated that an infection was a cofactor. of those who listed the dpt vaccine, one was prior to 1996 and one was after 1996. the questionnaires for those children in the other category reported pesticide exposure (n = 1) and gi illness (n = 2) as the regression - associated factor. being r or dr was not significantly related to any factors associated with the onset of regression. for a summary of this information, constipation was reported in 28 (21.9%) of these children (10 severe, 12 moderate, and six mild constipation). diarrhea was reported in 23 (18.0%) of these children (five severe, six moderate, and 12 with chronic loose / soft stools). both chronic diarrhea and constipation was reported in three (2.3%). problems with gi yeast were reported in three of the children, discolored stool was reported in two of the children, and incontinence was reported in three of the children. about half, 65 (50.8%), were reported to have no gi problems. the skills most frequently reported to be lost were speech, eye contact, pointing, and socialization. other skills mentioned were nonverbal communication, responsiveness, interest in others, expression, ability to imitate, and, to a much lesser extent, motor skills. problems noted were tantrums, behavioral issues, apparent deafness, and sensory issues (oversensitivity and undersensitivity). analyses showed that there was no significant relationship between the children 's age, gender, race, severity, or gi symptoms, and their membership in the d, dr, or r groups. similar to the ozonoff., study of 60 children with autism that found that the children were divided into three groups : an early onset group, a definite regression group, and a heterogeneous mixed group (delays - plus - regression), the data from the current study also found three groups. the three groups found in the current study were children considered to be d, r, or dr. in the ozonoff study, 51.7% were reported to have r. in the current study, 60.7% of the children were found to have r. this finding is within the range of previous studies. even though previous studies have found brain differences in children who are d as compared to children who have r, the results from the current study suggest that there was no significant relationship between the children 's age, gender, race, severity, or gi symptoms and their subsequent membership in the d, dr, or r groups. as mentioned in the introduction, malhi and singhi also found that there were no significant differences between the two groups in regard to autism severity based on the cars., in a study of 152 children with autism, found that the regressive group scored significantly higher on the cars (p < 0.05) and had a relatively higher proportion of severely ill children (66.7 vs. 45.4% ; p < 0.05) compared with the non - regressive group. in the current study about half the children, 49.2%, were reported to have gi problems (21.9% constipation, 18.0% diarrhea, and 9.3% with both). wang., for example, as mentioned in the introduction, similarly reported that 20% of the children diagnosed with an asd had problems with constipation and 19% had chronic diarrhea. the finding that 57.3% of the parents reported that the regression was preceded by or was associated with vaccination / immunization is consistent with previous research by goldberg. in that study, goldberg., stated that the event mentioned by the majority of parents (67.6%) as concurrent with loss of skills was immunization. also, consistent with the goldberg study was that they found other medical events (e.g. various illnesses), were reported by about one - third of the parents., found that febrile seizures and family history of neuropsychiatric disorders are correlated with autistic regression. the results for the current study show that the probable mean age for the onset of regression was 17.4 months in the dr group and 17.0 months in the r group. these findings are consistent with previous studies that find the onset of regression resulting in an asd diagnosis is typically 15 - 24 months of age. the results of the current study suggest that the children commonly lose speech, socialization, eye contact, and nonverbal skills. in other studies, the loss of verbal, nonverbal, and social abilities is typically reported. significantly, two of the five children with a diagnosis of as were reported to have r. both the 2004 consensus report issued by the institute of medicine (iom) and some studies, including madsen., have failed to find an association between vaccines and autism. however, other studies have reported an association, including gallagher. the study limitations include issues with possible variability in parental and clinical recognition and reporting, and the possibility of some recall bias (a possible bias affected by respondent 's memory). in addition, the open - ended questions may be another limitation in that the information could have been more specific and/or quantitative by adding choices and time frames. however, a possible advantage to the open - ended questions could also be that they were not leading because providing choices may have been suggestive. another study limitation is that there was no verification of the parent report through medical records. however, many of the parents provided a vaccine record which did not conflict with their report. among the limitations of the present study is that participants examined were assumed to be on the autism spectrum based upon the fact that they were previously diagnosed with an asd and a subsequent professional cars evaluation. it is possible that other tests such as autism diagnostic observation schedule (ados) or autism diagnostic interview, revised (adi - r) could have influenced whether the study participants were considered to be on the autism spectrum. despite this potential limitation, the cars evaluations are a well - recognized metric of helping to establish an asd diagnosis and providing important quantitative measurements of asd severity. a strength of the present study was that the demographics of the cohort of participants diagnosed with an asd examined in the present study appear to be similar to the recognized demographics of the general population diagnosed with an asd, and therefore, the results observed should be expected to be extendible beyond the cohort of participants diagnosed with an asd examined in the present study. in addition, since the participants diagnosed with an asd examined in the present study were wide - ranging with respect to age, gender, racial composition, and severity, potential outlier skewing of the data should not have significantly impacted the results observed. the study limitations include issues with possible variability in parental and clinical recognition and reporting, and the possibility of some recall bias (a possible bias affected by respondent 's memory). in addition, the open - ended questions may be another limitation in that the information could have been more specific and/or quantitative by adding choices and time frames. however, a possible advantage to the open - ended questions could also be that they were not leading because providing choices may have been suggestive. another study limitation is that there was no verification of the parent report through medical records. however, many of the parents provided a vaccine record which did not conflict with their report. among the limitations of the present study is that participants examined were assumed to be on the autism spectrum based upon the fact that they were previously diagnosed with an asd and a subsequent professional cars evaluation. it is possible that other tests such as autism diagnostic observation schedule (ados) or autism diagnostic interview, revised (adi - r) could have influenced whether the study participants were considered to be on the autism spectrum. despite this potential limitation, the cars evaluations are a well - recognized metric of helping to establish an asd diagnosis and providing important quantitative measurements of asd severity. a strength of the present study was that the demographics of the cohort of participants diagnosed with an asd examined in the present study appear to be similar to the recognized demographics of the general population diagnosed with an asd, and therefore, the results observed should be expected to be extendible beyond the cohort of participants diagnosed with an asd examined in the present study. in addition, since the participants diagnosed with an asd examined in the present study were wide - ranging with respect to age, gender, racial composition, and severity, potential outlier skewing of the data should not have significantly impacted the results observed. the findings from this study are consistent with previous research and reinforce our understanding of regression in asd. the consistency of the findings on regression in asd that are based on parental reports suggest that the benefit of studying parental reports may outweigh the limitations. | background : research indicates that some children with autism spectrum disorder (asd) experience a developmental regression.aims:the study examined the percentage of children with autism, pervasive developmental disorder (pdd), asd, and asperger syndrome (as) who were considered to be delayed (d), regressed (r), or delayed and later regressed (dr) and examined any relationship with autism severity, time of onset, factors associated with onset, gastrointestinal (gi) symptoms, race, age, and gender.materials and methods : the study reviewed developmental and medical information based on parental reports of 135 children with a diagnosis of autism, pdd, asd, or as.results:the number of children in the d group was 53 (39.2%) with 19 (14.1%) in the dr group and 63 (46.7%) in the r group. thus, 82 children (60.7%) were reported to have r. in regard to onset of symptoms, there was a significant difference between the d and r groups as well as between the dr and r groups. the analyses showed that there was no significant relationship between age, gender, race, severity, or gi symptoms and membership in any group ; d, dr, or r. the majority of parents reported that the regression was preceded by or was associated with vaccinations (57.3%) or another medically related event (11.0%).conclusions : the findings are consistent with previous research and reinforce our understanding of regression in those children with an asd diagnosis. |
imaging modality is an important aspect of the image for medical retrieval [16 ]. in user studies, clinicians have indicated that modality is one of the most important filters that they would like to be able to limit their search by. many image retrieval websites (goldminer, yottalook) allow users to limit the search results to a particular modality. however, this modality is typically extracted from the caption and is often not correct or present. some works have shown that image modality can be extracted from the image itself using visual features [810 ]. therefore, in this paper, we propose to use both visual and textual features for medical image representation, and combine the different features using normalized kernel function in svm. in computer vision, studies have shown that the simple global features such as histogram of edge, gray or color intensity, can represent images, and give the acceptable performance in image retrieval or recognition research fields. based on the success of the above - mentioned visual features for general image recognition, we also use them as medical image representation for modality classification. recently, using local visual feature for image representation has become very popular, and been proved to be very effective for image categorization or retrieval. the most famous approach for image representation using local visual feature is bag of keypoints [12, 13 ]. the basic idea of bag of keypoints is that a set of local image patches is sampled using some method (e.g., densely, randomly, or using a keypoint detector) and a vector of visual descriptors is evaluated on each patch independently (e.g., sift descriptor, normalized pixel values). the resulting distribution of descriptors in descriptor space is then quantified in some way (e.g., by using vector quantization against a prespecified codebook to convert it to a histogram of votes for (i.e., patches assigned to codebook centres) and the resulting global descriptor vector is used as a characterization of the image (e.g., as feature vector on which to learn an image classification rule based on an svm classifier). furthermore, according to the visual properties of medical images, we also calculate a histogram of small - block variance as visual feature for image representation. for textual feature, we predefine 90 vocabulary words somewhat according to the statistical properties of training samples ' captions and our knowledge about medical modality, and calculate a binary histogram for any medical image using their captions. after obtaining the different features for image representation, we combine them together using kernel function for svm classifier. because different features maybe have deferent scale and dimension, in order to allow each individual feature to contribute equally for modality classification, we normalize the distance between two samples using mean distance of all training samples, and the final kernel for svm classification is the mean of individual kernel, which can be called joint kernel equal contribution (jkec). furthermore, for some easy misclassified modalities such as ct and mr or pet and nm, a global classifier, which deals with all modalities in the used database, may not be effective in distinguishing the local modalities from each other. therefore, after the global classification, a local classifier is used in the easy misclassified modality pairs to refine the classification results. finally, the proposed algorithm is evaluated on the modality dataset of imageclef 2010, and almost achieve the expected accuracy rate expected by the modality classification task of imageclef 2010, which is about 97% classification rate. in this section we describe how we extract a feature representation, which is somewhat robust to the high variability inherent in medical images and includes enough discriminative information for modality category. some previous studies showed that it is difficult to correctly classify image categorization with only one type of image feature [14, 15 ]. so in this paper, we represent images with different images features including gray and color intensity histogram, block - based edge and variance histogram, popular bag - of - words model as visual feature, and a binary histogram of the predefined vocabulary words from image captions as textual feature. they are easy to compute and tend to be robust against small changes of camera viewpoints. for gray intensity histogram, we can calculate the number of each intensity (0255) for all image pixel, and normalize it using pixel number. given an image i in some color space (e.g., red, green, and blue), to calculate color histogram the color channels are quantized into a coarser space with k bins for red, m bins for green, and l bins for blue. therefore the color histogram is a vector h = (h1,h2,,hn), where n = kml, and each element hi represents the number of pixels of the discretized color in the image. we assume that all images have been scaled to the same size. otherwise, we normalize histogram elements as (1)hj=yjj=0nyj. we firstly segment the image into several blocks, and calculate edge histogram weighted by gradient intensity in each block. in experiment, we grid - segment an image into 4-by-4 block, and calculate a 20-bin edge histogram in each block. so we have 320-(2016-)dimensional edge histogram feature for medical image representation. for each pixel in an image, a small patch centered by the specific pixel are used for calculating the local variation of the pixel. after obtaining the local variation of all pixels in the image, a histogram of variation intensity is calculated for the image representation. in computer vision, local descriptors (i.e., features computed over limited spatial support) have proved well - adapted to matching and recognition tasks, as they are robust to partial visibility and clutter. in this paper, we use grid - sampling patches, and then compute appearance - based descriptors on the patches. in contrast to the interest points from the detector, these points can also fall onto very homogeneous areas of the image. after the patches are extracted, the sift descriptor is applied to represent the local features. for each of 8 orientation planes, the gradient image is sampled over a 4-by-4 grid of locations, thus resulting in a 128-dimensional feature vector for each region. a gaussian window function is used to assign a weight to the magnitude of each sample point. this makes the descriptor less sensitive to small changes in the position of the support region and puts more emphasis on the gradients that are near the center of the region. to obtain robustness to illumination changes, the descriptors are made invariant to illumination transformations of the form ai(x) + b by scaling the norm of each descriptor to unity. these sift features are then clustered with a k - means algorithm using the euclidean distance. then we discard all information for each patch except its corresponding closest cluster center identifier. for the test data, this identifier is determined by evaluating the euclidean distance to all cluster centers for each patch. thus, the clustering assigns a cluster c(x)(c = 1, c) to each image patch x and allows us to create histograms of cluster frequencies by counting how many of the extracted patches belong to each of the clusters. the histogram representation h(x) with c bins is then determined by counting and normalization such that (2)hc(x)=1lxl=1lx(c, c(xl)), where denotes the kronecker delta function. figure 1 shows the procedure of bag - of - words (bow) feature extraction and the extracted histogram feature of an example image. furthermore, the geometrical relation between the extracted patches is completely neglected in the approach presented here. while this relation could be used to improve classification accuracy, it remains difficult to achieve an effective reduction of the error rate in various situations by doing so. according to the statistical properties of word occurrence in each training modality image 's captions and our prior knowledge about the classifying modalities, we select 90 key - words, such as ct, curve, mr, urethrogram, and pet, as the vocabulary for forming a binary histogram for each medical image. the binary histogram for image representation is 90-dimension vector, where each dimension is correspond to one selected keyword. if one keyword appeared one or more than one time in an image 's caption, the value of the corresponding dimension in its represented binary histogram will be 1, otherwise it will be 0.,n of n instances consisting of an image xi and a class label yi 1,2,, c, and given a set of f image features fm :, m = 1,2,, f, where dm denotes the dimensionality of the mth feature, the problem of learning a classification function y : 1,2,, c from the features and training set is called feature combination problem. in computer vision, the problem of learning a multiclass classifier from training data is often addressed by means of kernel methods. kernel methods make use of kernel functions defining a measure of similarity between pairs of instances. in the context of feature combination it is useful to associate a kernel to each image feature as the following equation (3), and combine the kernels of different features together. for a kernel function k of each feature between real vectors we define the short - hand notation : (3)km(ii, ij,)=k(fm(ii),fm(ij))=k(s(fm(ii),fm(ij))), where ii and ij are two samples, fm(ii) is the mth extracted feature from the sample ii, and s(fm(ii), fm(ij)) is the similarity measure between the mth features of the samples ii and ij. then the image kernel km : only considers similarity with respect to image feature fm. if the image feature is specific to a certain aspect, say, it only considers color information, then the kernel measures similarity only with regard to this aspect. the subscript m of the kernel can then be understood as indexing into the set of features. because different features maybe have different scale and dimension, in order to allow each individual feature to contribute equally for modality classification, we normalize the distance between two samples using mean distance of all training samples, and then, obtain the kernel function for each individual feature fm. the final kernel for svm classification is the mean of individual kernel, which can be called joint kernel equal contribution (jkec). for the feature similarity calculation of two samples, we use several distances : euclidean distance (l2 distance), l1 distance, and distance, for evaluating the classification performance. the distance for two samples can be calculated as follows : (4)smi, j = s(fm(ii),fm(ij))=1l(xlyl)2xl+yl, where x and y represent the mth features fm(ii), fm(ij) of samples i and j, respectively, and xl is the lth element of the vector x. sm is the similarity measure of the mth feature between the ith and jth training samples. then, the rbf function is used for calculating the kernel : (5)kmi, j = km(ii, ij,)=exp (s(fm(ii),fm(ij))m), where m is the normalized item for kernel function of the mth feature. here, we use the distance mean of all training samples as m = 1/n(iism) (n is the training sample number), which will lead to similar contribution of each feature to kernel. then the final combined kernel function can be obtained by (6)ki, j=1mimkmi, j, where m is the feature number for image representation. the proposed algorithm is evaluated on the modality training dataset of imageclef 2010, which expects about 97% classification rate on the released evaluated and test datasets. because the ground - truths of the evaluated and test dataset are not released, we cross - validate our proposed strategy with the released training dataset firstly. the classification rate with our experiment on training approximated the required goal of the modality classification task. in the released medical database by imageclef 2011, some modalities have a lot of visual similarity such as pet and nm modality. therefore, it is difficult to distinguish them in the global modality classification, which deals with all modalities in the database. in this section, after the global conventional classification, we design local classifiers to refine the classification results in easy - misclassified modalities. next, we firstly explain the used dataset, and then, introduce how to design the local classifier according to evaluation results. the database released for the imageclef-2010 medical modality classification in medical retrieval task includes 2390 annotated modality images (ct : 314 ; gx : 355 ; mr : 299 ; nm : 204 ; pet : 285 ; px : 330 ; us : 307 ; xr : 296) for training and a separate evaluated set consisting of 2620 images. the aim is to automatically classify the evaluated set using 8 different modality label sets including ct, mr, and pet. a more detailed explanation of the database and the tasks can be found in. for validating the discriminant properties of different modalities, we randomly select 180 samples from each medical modality in imageclef 2010 training dataset, and the remainder for testing. we combine all visual and textual features using the jkec fusion strategy introduced in section 3, for modality classification. the confusion matrix of one run is shown in table 1. from table 1, it can be seen that 92.537% ct sample images are correctly recognized as ct modality, and 3.9851% and 2.2388% are classified as mr and xr modalities, respectively. on the other hand, about 2 - 3% mr or xr sample images are also misrecognized as ct modality. at the same time, it is obvious that nm and pet or gx and px modalities are also easily misclassified from each other. therefore, we design three local classifiers for the limited easy - misclassified modalities, which are ct, mr, and xr group, nm and pet group, gx and px group, to refine the classification results in local regions. the compared experimental results with or without refinement procedure are shown in figure 5. from figure 5, it can be seen that the recognition rates for ct, mr, pet, px, and xr modalities with local classifier refinement can be improved more than 1% compared to those without refinement. in this section, we validate the recognition rates of different features with three types of similarity measures : euclidean distance (l2 distance), l1 distance and distance, and do the cross - validation experiments using the combined visual and textual features on imageclef 2010 training dataset. then, the submitted runs to medical modality classification of imageclef 2010 and the released results will be introduced. the recognition rates of different features with three types of similarity measures : in order to validate what kind of distance measure is adaptive to each extracted feature for image representation, we apply three types of similarity measures : euclidean distance (l2 distance), l1 distance, and distance, for calculating the kernel function as in (5) of svm classifier. in the experiments, with the imageclef 2010 training dataset, 180 images are randomly selected for training from each modality, the remainder are for test. the compared recognition rates are shown in figure 6, where kai2 means distance. from figure 6, it can be seen that l1 and distance can obtain much better performance than l2 distance for most features, and distance can achieve a little better than or similar results to l1 distance. then, in the next experiments, we utilize distance for a similarity measure of all features to calculate svm kernel functions. cross - validation experiments : in the experiments, we firstly divide the training dataset of imageclef 2010 into 5 groups, and use 4 groups as training and 1 group as test to cross - validate the performance of different features with distance as similarity measure. the recognition rates are shown, figure 7, where visual means with the combined features of all visual ones, visual + textual means with the combined features of all visual and textual ones, visual + textual + refine means using refinement procedure after classification with all combined features. from figure 7, it can be seen that the average recognition rate can be improved about 1% after the refinement procedure introduced in section 4. submitted runs : as medical image processing group (mipg) of our intelligent image processing laboratory (iipl) in ritsumeikan university, we prepared four runs for evaluation image set, which used combine visual feature, textual feature, both visual and textual features, and weighted visual and textual features. we submitted two runs using textual, combined textual and visual features by on - line - system, respectively. our results are ranked second among 6 participating teams, and the result of one run is also ranked second among about 50 runs. at the same time, the recognition rates (submitted run : 93.36%, unsubmitted run : 93.89%) of our methods using mixed feature (visual plus textual) are similar to the first ranking results 94% by xerox research centre europe. in this paper, we proposed to extract different visual and textual features for medical image representation, and use jkec strategy to fusion them for modality classification. to extract visual features from the images, we used histogram descriptor of edge, gray, or color intensity and block - based variation as global features and sift histogram as local feature, and the binary histogram of some predefined vocabulary words for image captions is used for textual feature. because different features maybe have different scale and dimension, in order to allow each individual feature to contribute equally for modality classification, we proposed to use joint kernel equal contribution (jkec) for kernel fusion of different features. furthermore, for some easy misclassified modality pairs such as ct and mr or pet and nm modalities, a local classifier is used for distinguishing samples in the pair modality to improve performance. | we describe an approach for the automatic modality classification in medical image retrieval task of the 2010 clef cross - language image retrieval campaign (imageclef). this paper is focused on the process of feature extraction from medical images and fuses the different extracted visual features and textual feature for modality classification. to extract visual features from the images, we used histogram descriptor of edge, gray, or color intensity and block - based variation as global features and sift histogram as local feature. for textual feature of image representation, the binary histogram of some predefined vocabulary words from image captions is used. then, we combine the different features using normalized kernel functions for svm classification. furthermore, for some easy misclassified modality pairs such as ct and mr or pet and nm modalities, a local classifier is used for distinguishing samples in the pair modality to improve performance. the proposed strategy is evaluated with the provided modality dataset by imageclef 2010. |
upon developing a rapid and efficient synthesis of 2,1-borazaronaphthalenes starting from simple, readily available starting materials, we subsequently developed the suzuki these studies demonstrated the stability of these azaborines to transition metal catalysis and allowed access to functionalized molecules that could have applications in medicinal chemistry and/or materials science. during the course of this latter study, we first developed conditions for the cross - coupling of n - h and n - alkyl 3-bromo - b - alkyl-2,1-borazaronaphthalenes (eq 1).1 at the same time, we investigated the cross - coupling of b - aryl 2,1-borazaronaphthalenes with potassium (hetero)aryltrifluoroborates (eq 1), which was perceived at the outset to present a challenge. in this cross - coupling, both the azaborine and the aryltrifluoroborate would appear to have the potential to serve as a nucleophilic component in cross - coupling reactions, unlike the cross - coupling of the b - alkyl 2,1-borazaronaphthalenes, where the aryltrifluoroborate was expected to react preferentially on the basis of a more facile, rate - determining transmetalation. thus, during cross - coupling events, aryltrifluoroborates are slowly converted to the corresponding tricoordinate boronic acids, which are believed to be the active transmetalation species and are capable of undergoing transmetalation by interacting with an oxo - palladium species to form a tetracoordinate ate complex. similarly, the boron of the 2,1-borazaronaphthalene is also formally tricoordinate, although in this instance contribution of electron density from the nitrogen lone - pair would render the boron less lewis acidic, in consonance with the aromaticity of the borazine substructure. in fact, attempts to cross - couple an n - substituted 3-bromo-2-aryl-2,1-borazaronaphthalene with potassium phenyltrifluoroborate resulted in complete conversion to a side product under the standard reaction conditions. upon lowering the reaction temperature to room temperature, a mixture of the desired product and the same unknown side product was observed. after removing the nucleophilic component of the reaction (i.e., the potassium phenyltrifluoroborate), unreacted starting material and the same unknown side product were evident after 24 h, demonstrating that the phenyltrifluoroborate was not directly involved in this reaction. paetzold previously reported that the aryl group of 2-pentafluorophenyl-2,1-borazaronaphthalene could be displaced upon heating in koh / meoh, forming the corresponding 2-methoxy-2,1-borazaronaphthalene. on the basis of the chemical shift in the b nmr of our cross - coupling reactions, formation of a 2,1-borazaronaphthalene product containing a b - or bond appeared possible ; however, stability tests, in addition to the successful cross - coupling of other brominated azaborines, demonstrated the inherent stability of the brominated 2,1-borazaronaphthalenes to the basic conditions of the cross - coupling. these results suggested that the process observed was palladium mediated. by realizing that the brominated 2,1-borazaronaphthalene can serve as both the nucleophile and electrophile in a cross - coupling reaction, after oxidative addition of the c br bond to the palladium catalyst, transmetalation of the aryl group on boron of the borazine would lead to c this self - arylation proceeded in low yield under the initial conditions, providing the product in only 13% yield (eq 2). on the basis of this initial result, we sought to determine if this transformation could be developed into a viable synthetic protocol for the construction of 3-aryl-2,1-borazaronaphthols2 optimization of the self - arylation of 1 was conducted with the aid of high - throughput experimentation (hte). a 24-well plate was designed to test the ligand, base, and ratio of solvent to water in the self - arylation. the product - to - internal standard (p / is) ratios were calculated to determine the relative amount of product formed in each microscale reaction (10 mol). reaction conditions : 1 mol % aminobiphenyl pd -cl dimer, 2 mol % ligand, 1.0 equiv of 1-allyl-3-bromo-2-phenyl-2,1-borazaronaphthalene, 3.0 equiv of base, rt, 18 h. during the transmetalation step of a cross - coupling involving organoborons, an oxo - palladium complex interacts with the vacant orbital on boron. because the lewis acidity of the boron center in 2,1-borazaronaphthalenes is attenuated by electron donation from nitrogen, transmetalation is more difficult. jutand and hartwig have both reported that hydroxide bases provide the best conversion to product for cross - couplings in which the rate - determining step is the transmetalation. hydroxide bases increase the formation of the more reactive arpd(oh)l complex, which undergoes transmetalation at a faster rate relative to the corresponding arpd(x)l complex. utilizing this information, csoh was employed as a base in the screen, providing the largest increase in conversion across the board when compared with results using cs2co3. of the ligands tested, sphos provided the highest p / is ratio with a solvent system of 9:1 cyclopentyl methyl ether (cpme)/h2o. further optimization showed that switching the solvent from cpme to thf resulted in higher conversion to the desired product, and switching the base from csoh to koh had no major effect on the reaction. the (sphos)(aminobiphenyl) palladium chloride precatalyst (commercially available sphos - pd - g2, figure 2) was employed as the palladium source when the self - arylation was scaled from the hte screen. varying the group on nitrogen does not affect the self - arylation as the corresponding products are obtained in yields up to 98% (table 1). the scalable nature of the coupling was illustrated by performing the reaction on 2.5 mmol, which afforded the self - arylated product in 96% yield while at the same time allowing half of the palladium loading (1 mol %) used in smaller scale reactions. reaction performed on a 2.5 mmol scale with 1 mol % sphos - pd - g2 reaction conditions (unless otherwise noted) : 1.0 equiv of 1-alkyl-3-bromo-2-phenyl-2,1-borazaronaphthalene, 2 mol % sphos - pd - g2, 3.0 equiv of base, 9:1 thf / h2o, rt, 18 h. the isolation of 2,1-borazaronaphthols has not been reported in the literature. in fact, until this study, 2,1-borazaronaphthol was only shown to exist in basic ethanol solution, forming the corresponding anhydride in the solid state (eq 3). in the current study, steric encumbrance provided by substitution of the azaborine at the 1 and 3 positions apparently inhibits anhydride formation, allowing the corresponding 2,1-borazaronaphthols to be isolated in high yield.3 although 2,1-borazaronaphthols were found to decompose on silica gel, surprisingly, they can be converted to their respective anhydrides (to various extents) upon column chromatography with florisil. the formation of the anhydride was confirmed by passing 2d through florisil and obtaining an x - ray structure of the product (figure 3). an array of 1-allyl-2-(hetero)aryl-3-bromo-2,1-borazaronaphthalenes was subsequently subjected to the standard conditions to ascertain the scope of this novel process (table 2). after purification with florisil, many of the products were isolated as mixtures of the anhydride and the monomer. fortunately, it was discovered that subjecting the anhydride to basic aqueous thf (3 equiv koh in thf / h2o) converted the anhydride to the corresponding 2,1-borazaronaphthol. aryl groups with both electron - donating (entries 1, 2, and 6) and electron - withdrawing groups (entries 35) underwent self - arylation in yields up to 90%. the aryl group can be substituted ortho- (entry 6), meta- (entries 23), and para- (entries 1, 45) to afford the desired products in high yield. the enhanced reactivity of the azaborinyl bromide relative to an aryl halide is evident through self - arylation of the 3-bromo-2,1-borazaronaphthalene that has an embedded aryl chloride (entry 3). further, heteroaryl groups, specifically thienyl and dibenzofuryl, can be transferred to the 3-position in yields of 85% and 63%, respectively (entries 89). reported as the ratio of anhydride : monomer reaction conditions (unless otherwise noted) : 1.0 equiv of 1-allyl-2-aryl-3-bromo-2,1-borazaronaphthalene, 2 mol % sphos - pd - g2, 3.0 equiv of base, 9:1 thf / h2o, rt, 18 h. to probe the mechanism of the self - arylation, a crossover experiment was conducted with two brominated azaborines possessing similar substitution patterns. subjecting both azaborines to the same reaction conditions resulted in complete conversion of both starting materials. hplc analysis showed formation of all four possible arylated products (self - arylated and cross - arylated) in approximately equal amounts, confirming that the self - arylation observed is an intermolecular process (eq 4).4 an n - substituted b - alkyl 3-bromo-2,1-borazaronaphthalene was subjected to the developed self - arylation conditions. because the calkyl b bond is stronger than the caryl b bond, transmetalation is more challenging. as expected, the azaborine did not undergo self - alkylation, and only unreacted starting material was observed after 18 h (eq 5).5 further, subjecting the free n - h 3-bromo-2-phenyl-2,1-borazaronaphthalene to the reaction conditions did not produce the self - arylated product (eq 6). the starting material was consumed in the reaction but an array of products was observed by crude nmr.6 this result suggested that substitution on nitrogen is required for the self - arylation to proceed smoothly, creating an environment suitable for self - arylation. several lines of investigation were carried out in an attempt to rationalize this phenomenon. one contributing factor in these systems was postulated to be the difference in strength of the b caryl bond in the n - h versus the n - substituted azaborines. to clarify this hypothesis, a series of calculations, conducted at the b3lyp/6 - 31g(d, p) level of theory, were completed to determine the relative bond order of the b caryl bond was weaker in the case of the n - allyl 2,1-borazaronaphthalene. thus, the substituent on nitrogen in this system causes the arene to rotate such that it is no longer in plane with the azaborine, thereby decreasing molecular orbital overlap between the empty p orbital on boron of the azaborine and the arene, weakening the b, the free n - h 2,1-borazaronaphthalene is nearly planar, resulting in better orbital overlap and a stronger b caryl bond. optimized geometry and bond orders for n - allyl and n - h 2,1-borazaronaphthalenes (calculated at the b3lyp/6 - 31g(d, p) level of theory). another factor postulated was the ability of the boron to interact with an oxo - palladium species to facilitate the transmetalation process. miyaura cross - coupling reaction has been postulated to proceed via the formation of a tetracoordinate ate complex, in which the vacant orbital on boron interacts with an oxo - palladium complex. formation of the ate complex can be viewed as an interaction between a lewis acidic boron source and the lewis basic oxo - palladium species. increasing the lewis acidity of the boron will favor formation of the ate the relative lewis acidities of the n - allyl and n - h 2,1-borazaronaphthalenes were therefore calculated as a means to determine the suitability of these entities to participate in the requisite lewis acid base complex formation. because substitution on nitrogen rotates the arene out of the plane of the 2,1-borazaronaphthalene, the loss in molecular orbital overlap results in a relative charge on the boron atom of the 1-allyl-2-phenyl-2,1-borazaronaphthalene of 0.652, which is significantly greater than that of the free n h 2-phenyl-2,1-borazaronaphthalene (0.568). in further calculations, the increased lewis acidity of the n - allyl 2,1-borazaronaphthalene was also determined to favor the required ate complex formation by 2 kcal / mol over that of the n h congener (figure 5). this series of calculations, conducted at the b3lyp / lanl2dz level of theory, used pme3 as a generic ligand on palladium and a vinyl group as a generic coupling partner. although the calculations do not provide information about the mechanism of the transmetalation, they do suggest that there is an increased stability of the ate complex for the n - allyl 2,1-borazaronaphthalene relative to that of the free n h 2,1-borazaronaphthalene. relative energies of formation of pd-ate complexes (calculated at the b3lyp / lanl2dz level of theory). given that the aryl group in n - alkyl - b - aryl-3-bromo-2,1-borazaronaphthalenes was subject to competitive reaction in suzuki - type reactions, investigations were carried out to determine how these systems could be otherwise manipulated in synthetically useful ways. although attempts to access 1,2,3-trisubstituted-2,1-borazaronaphthalenes via cross - coupling of 1 with an external trifluoroborate were unsuccessful because mixtures of cross - coupled and self - arylated products were observed, the product of the self - arylation could be reacted with a grignard reagent at elevated temperature to form the desired trisubstituted azaborine in low yield (eq 7).7 in more successful efforts, kumada coupling between an aryl grignard reagent and a brominated 2,1-borazaronaphthalene afforded the 1,2,3-trisubstituted-2,1-borazaronaphthalenes in high yield with 1 mol % of the (t - bu3p)(aminobiphenyl) palladium chloride precatalyst (commercially available t - bu3p - pd - g2, table 3). ortho-, meta-, and para - substituted aryl grignard reagents proved to be successful nucleophiles in the reaction, and the desired products were obtained in yields up to 89% (entries 24). further, the substituent on nitrogen could be changed without loss of yield (entry 5). reaction conditions (unless otherwise noted) : 1.0 equiv of 1-allyl-3-bromo-2-phenyl-2,1-borazaronaphthalene, 1.2 equiv of armgbr, 1 mol % t - bu3p - pd - g2, thf, 0 c to rt, 18 h. the next reaction investigated was the coupling of 1-benzyl-3,6-dibromo-2-phenyl-2,1-borazaronaphthalene with 1 equiv of phb(oh)2 under slightly modified conditions (eq 8). the dibrominated azaborine underwent self - arylation in addition to a second cross - coupling with the phenylboronic acid, affording the desired product in 92% yield. the product of this dual cross - coupling was a 1,3,6-trisubstituted-2,1-borazaronaphthol, building molecular complexity by functionalizing three different borazine positions through a single operation. attempts to employ arylboronic acids that were structurally different from the b - aryl group embedded within the borazaronaphthalene resulted in a mixture of cross - coupled products because no site - selectivity could be achieved in reactions of the two incorporated bromides.8 to confirm that the dibrominated azaborine underwent a dual cross - coupling, a crystal structure was obtained for 6 (figure 6). interestingly, the x - ray structure also reveals that looking at the molecule with a 90 rotation such that it is lying horizontal, the b n ring of the 2,1-borazaronaphthalene is not completely planar, with the boron atom being located approximately 0.15 or 3.5 out of plane. x - ray structure of 1-benzyl-3,6-diphenyl-2,1-borazaronaphthol (left). rotated to show the nonplanarity of the b n ring without substituents at 1, 3, and 6-positions (right). the self - arylation of n - substituted 3-bromo-2,1-borazaronaphthalenes has been reported to proceed in high yield under mild reaction conditions. the products of the self - arylation are air- and moisture - stable 2,1-borazaronaphthols, the first isolable examples of this class of azaborine. to the best of our knowledge, this self - arylation is the first report demonstrating the ability of brominated azaborines to serve as both the nucleophile and electrophile in cross - coupling reactions. the 2,1-borazaronaphthols are converted to their corresponding anhydrides upon purification with florisil, but they can be hydrolyzed back to the 2,1-borazaronaphthols by subjecting the anhydride to basic aqueous thf. the corresponding 1,2,3-trisubstituted-2,1-borazaronaphthalenes can be afforded by performing a kumada coupling with an aryl grignard reagent. the overall value of the synthetic method described herein can be highlighted by comparison with the synthesis of isosteric naphthalene derivatives. accessing 3-arylnaphth-2-ols through cross - coupling at the 3-position requires protection and deprotection of the alcohol, whereas the self - arylation alleviates the need for protecting group manipulation to afford the isosteric azaborine in a single step. t - bu3p - pd - g2 and sphos - pd - g2 were synthesized according to the literature. thf was dried using a j. c. meyer solvent system with passage through two columns of activated alumina. b nmr spectra were obtained on a spectrometer equipped with the appropriate decoupling accessories. all b nmr chemical shifts were referenced to external bf3oet2 (0.0 ppm) with a negative sign indicating an upfield shift. data are presented as follows : chemical shift (ppm), multiplicity (s = singlet, d = doublet, t = triplet, m = multiplet, br = broad), coupling constant j (hz) and integration. analytical thin - layer chromatography (tlc) was performed on tlc silica gel plates (0.25 mm) precoated with a fluorescent indicator. hrms data were obtained by either esi or ci using a tof mass spectrometer. for hrms of most anhydrides, ionization of the sample resulted in dissociation to the monomer, which was found within 5 ppm. the 1-alkyl-2-aryl-3-bromo-2,1-borazaronaphthalenes were prepared according to the literature. obtained as an off - white solid (0.4 mmol scale, 100 mg, 74%). h nmr (500 mhz, acetone - d6) 8.49 (s, 1h), 7.777.73 (m, 1h), 7.627.54 (m, 2h), 7.38 (d, j = 6.3 hz, 2h), 7.307.20 (m, 3h), 6.035.94 (m, 1h), 5.13 (d, j = 10.3 hz, 1h), 4.91 (d, j = 17.3 hz, 1h), 4.734.71 (m, 2h), 2.36 (s, 3h). c nmr (125.8 mhz, acetone - d6) 146.0, 140.1, 137.3, 135.2, 131.6, 129.6, 128.9, 128.1, 126.4, 121.8, 117.1, 115.2, 51.4, 20.6. ir (neat) 3013, 2920, 1607, 1367, 918, 764 cm. hrms (ci) m / z calc. for c18h18bbrn [m + h ] obtained as an off - white solid (0.74 mmol scale, 141 mg, 56%). h nmr (500 mhz, acetone - d6) 8.50 (s, 1h), 7.77 (d, j = 7.8 hz, 1h), 7.637.50 (m, 4h), 7.327.28 (m, 1h), 7.217.16 (m, 2h), 6.045.97 (m, 1h), 5.14 (dd, j = 10.5, 1.2 hz, 1h), 4.91 (dd, j = 17.4, 1.2 hz, 1h), 4.714.69 (m, 2h). c nmr (125.8 mhz, acetone - d6) 162.8 (d, j = 244 hz), 146.2, 140.0, 135.0, 133.7 (d, j = 8.8 hz), 129.7, 129.0, 126.4, 122.0, 117.1, 115.3, 114.3 (d, j = 20.1 hz), 51.4. ir (neat) 3066, 1595, 1370, 920, 764 cm. obtained as a yellow oil (1.7 mmol scale, 230 mg, 35%). h nmr (500 mhz, acetone - d6) 8.49 (s, 1h), 7.777.73 (m, 3h), 7.707.67 (m, 2h), 7.627.56 (m, 2h), 7.327.27 (m, 1h), 6.005.95 (m, 1h), 5.13 (d, j = 10.5 hz, 1h), 4.90 (d, j = 17.4 hz, 1h), 4.664.64 (m, 2h). c nmr (125.8 mhz, acetone - d6) 146.5, 139.8, 134.7, 132.1, 129.8, 129.4 (q, j = 32 hz), 129.2, 126.5, 124.6 (q, j = 271 hz), 124.0 (q, j = 3.8 hz), 122.2, 117.0, 115.6, 51.5. ir (neat) 2959, 1323, 1123, 1071, 832, 764 cm. hrms (ci) m / z calc. for c18h14bbrf3n [m ] 391.0355, found 391.0345. obtained as a yellow oil (1.7 mmol scale, 505 mg, 88%). h nmr (500 mhz, acetone - d6) 8.48 (s, 1h), 7.74 (d, j = 7.8 hz, 1h), 7.597.53 (m, 2h), 7.327.26 (m, 4h), 7.19 (d, j = 6.6 hz, 1h), 6.005.94 (m, 1h), 5.12 (dd, j = 10.5, 1.2 hz, 1h), 4.90 (dd, j = 17.4, 1.2 hz, 1h), 4.704.68 (m, 2h), 2.35 (s, 3h). c nmr (125.8 mhz, acetone - d6) 146.1, 140.0, 136.4, 135.1, 132.0, 129.6, 129.0, 128.5, 128.5, 127.4, 126.4, 121.8, 117.0, 115.3, 51.4, 20.9. ir (neat) 2980, 1546, 1367, 763, 744 cm. hrms (ci) m / z calc. for c18h17bbrn [m ] 337.0637, found 337.0636. obtained as a yellow oil (1.14 mmol scale, 300 mg, 74%). h nmr (500 mhz, acetone - d6) 8.51 (s, 1h), 7.78 (dd, j = 7.8, 1 hz, 1h), 7.637.56 (m, 2h), 7.50 (s, 1h), 7.427.39 (m, 3h), 7.337.29 (m, 1h), 6.035.98 (m, 1h), 5.15 (dd, j = 10.8, 1.2 hz, 1h), 4.91 (dd, j = 17.4, 1.2 hz, 1h), 4.704.67 (m, 2h). c nmr (125.8 mhz, acetone - d6) 146.4, 139.8, 134.8, 133.3, 131.0, 129.8, 129.7, 129.4, 129.2, 127.8, 126.5, 122.1, 117.1, 115.5, 51.5. hrms (ci) m / z calc. for c17h14bnclbr [m ] 357.0091, found 357.0098. obtained as a yellow oil (0.6 mmol scale, 142 mg, 67%). h nmr (500 mhz, acetone - d6) 8.45 (s, 1h), 7.75 (d, j = 7.6 hz, 1h), 7.637.60 (m, 1h), 7.577.53 (m, 1h), 7.397.34 (m, 1h), 7.297.25 (m, 2h), 7.026.98 (m, 2h), 5.955.89 (m, 1h), 5.09 (d, j = 10.5 hz, 1h), 4.96 (d, j = 17.4 hz, 1h), 4.774.69 (m, 1h), 4.654.58 (m, 1h), 3.72 (s, 3h). c nmr (125.8 mhz, acetone - d6) 160.8, 145.2, 140.0, 135.0, 132.0, 129.6, 129.5, 128.7, 126.5, 121.7, 120.3, 116.8, 115.4, 109.9, 54.7, 51.6. ir (neat) 2948, 1596, 1366, 1235, 762 cm. hrms (ci) m / z calc. for c18h17bbrno [m ] 353.0587, found 353.0598. obtained as a yellow oil (0.56 mmol scale, 86 mg, 41%). h nmr (500 mhz, acetone - d6) 8.55 (s, 1h), 8.02 (s, 1h), 7.947.89 (m, 3h), 7.8 (dd, j = 7.9, 1.3 hz, 1h), 7.657.57 (m, 3h), 7.537.49 (m, 2h), 7.347.30 (m, 1h), 6.045.97 (m, 1h), 5.15 (dd, j = 10.5, 1.2 hz, 1h), 4.94 (dd, j = 17.4, 1.2 hz, 1h), 4.754.73 (m, 2h). c nmr (125.8 mhz, acetone - d6) 146.2, 140.0, 135.1, 133.2. 133.0, 131.3, 129.7, 129.1, 128.9, 128.0, 127.6, 126.6, 126.5, 125.9, 125.8, 122.0, 117.1, 115.3, 51.5. ir (neat) 3054, 1545, 1370, 1226, 819, 764, 748 cm. hrms (ci) m / z calc. for c21h17bbrn [m ] 373.0637, found 373.0644. obtained as an off - white solid (1.7 mmol, 210 mg, 37%). h nmr (500 mhz, acetone - d6) 8.46 (s, 1h), 7.767.70 (m, 1h), 7.647.50 (m, 4h), 7.377.26 (m, 2h), 6.086.02 (m, 1h), 5.16 (d, j = 10.3 hz, 1h), 4.92 (d, j = 17.4 hz, 1h), 4.754.71 (m, 2h). c nmr (125.8 mhz, acetone - d6) 146.0, 140.2, 135.4, 131.2, 129.6, 129.5, 129.0, 126.3, 124.7, 121.9, 117.0, 115.3, 51.5. ir (neat) 3066, 1545, 1365, 1237, 763, 707 cm. hrms (esi) m / z calc. for c15h14bbrns [m + h ] 330.0123, found 330.0117. obtained as an off - white solid (0.64 mmol scale, 230 mg, 87%). h nmr (500 mhz, acetone - d6) 8.57 (s, 1h), 8.158.10 (m, 2h), 7.84 (d, j = 7.8 hz, 1h), 7.697.67 (m, 1h), 7.627.60 (m, 1h), 7.56 (d, j = 7.1 hz, 1h), 7.537.51 (m, 1h), 7.477.43 (m, 2h), 7.387.33 (m, 2h), 5.985.90 (m, 1h), 5.06 (dd, j = 10.5, 1.2 hz, 1h), 4.94 (dd, j = 17.4, 1.2 hz, 1h), 4.844.79 (m, 1h), 4.724.68 (m, 1h). c nmr (125.8 mhz, acetone - d6) 157.5, 156.0, 146.1, 140.0, 134.7, 130.3, 129.8, 129.1, 127.1, 126.7, 124.2, 122.9, 122.7, 122.7, 122.2, 120.8, 120.8, 117.0, 115.6, 111.4, 51.9. ir (neat) 3055, 2910, 1368, 1187, 757 cm. hrms (ci) m / z calc. for c23h17bbrno [m ] 413.0587, found 413.0570. obtained as an off - white solid (1 mmol scale, 242 mg, 71%,). h nmr (500 mhz, acetone - d6) 8.45 (s, 1h), 7.787.71 (m, 2h), 7.647.58 (m, 1h), 7.507.35 (m, 5h), 7.337.27 (m, 1h), 4.094.04 (m, 2h), 1.721.66 (m, 2h), 1.231.17 (m, 2h), 0.770.73 (m, 3h). c nmr (125.8 mhz, acetone - d6) 145.7, 139.9, 131.4, 129.9, 129.1, 127.5, 127.4, 126.6, 121.7, 116.0, 48.6, 31.9, 19.6, 12.9. ir (neat) 3066, 3032, 1596, 1223, 765 cm. hrms (ci) m / z calc. for c18h19brbn [m ] 339.0794, found 339.0807. obtained as an off - white solid (3 mmol scale, 371 mg, 37%). h nmr (500 mhz, acetone - d6) 8.45 (s, 1h), 7.87 (d, j = 8.8 hz, 1h), 7.787.75 (m, 1h), 7.657.61 (m, 1h), 7.487.30 (m, 6h), 4.05 (d, j = 6.4 hz, 2h), 1.241.20 (m, 1h), 0.370.33 (m, 2h), 0.02 - 0.05 (m, 2h). c nmr (125.8 mhz, acetone - d6) 145.8, 140.2, 132.0, 129.8, 129.1, 127.6, 127.4, 126.6, 121.8, 116.6, 52.4, 11.0, 4.0. ir (neat) 3008, 1546, 1363, 764, 704 cm. hrms (ci) m / z calc. for c18h18bbrn [m + h ] 338.0716, found 338.0714. obtained as an off - white solid (710 mg, 95%, 2 mmol scale). h nmr (500 mhz, cdcl3) 8.38 (s, 1h), 7.79 (s, 1h), 7.477.42 (m, 3h), 7.387.35 (m, 3h), 7.327.20 (m, 4h), 7.057.02 (m, 2h), 5.32 (s, 2h). c nmr (125.8 mhz, cdcl3) 145.1, 138.9, 137.8, 131.5, 131.4, 128.8, 128.2, 128.1, 127.6, 127.1, 125.5, 123.7, 119.1, 114.7, 53.6. ir (neat) 3065, 3029, 2920, 1536, 1367, 1355, 1242, 816 cm. hrms (ci) m / z calc. for c21h16bbr2n [m ] 450.9743, found 450.9748. to a biotage microwave vial equipped with a stir bar was successively introduced sphos - pd - g2 (7.2 mg, 10 mol, 2 mol %), koh (84 mg, 1.5 mmol, 3 equiv), and 3-bromo-2-aryl-2,1-borazaronaphthalene (0.50 mmol, 1 equiv). the vial was sealed with a cap lined with a disposable teflon septum, evacuated under vacuum, and purged with ar three times. degassed thf (0.9 ml) and degassed h2o (0.1 ml) were added under ar, and the vial was stirred at rt for 18 h. the reaction was diluted with h2o (2 ml), extracted with etoac (3 2 ml), and dried (mgso4). the solvent was removed in vacuo, and the product was purified by flash column chromatography on florisil using a 0 to 40% ch2cl2/hexane as the eluent to yield the anhydride. the column was flushed successively with 100% ch2cl2 and 100% etoac to yield the 2,1-borazaronaphthol. for reactions that went to completion without side - product formation, crude reaction mixtures were passed through a plug of florisil to afford the desired product. characterization of monomer and/or anhydride is provided for each self - arylated product. for those compounds in which complete separation was achieved, h nmr (500 mhz, acetone - d6) 7.80 (s, 1h), 7.61 (d, j = 7.8 hz, 1h), 7.497.45 (m, 2h), 7.427.33 (m, 4h), 7.307.26 (m, 1h), 7.087.04 (m, 1h), 6.64 (br s, 1h), 6.076.00 (m, 1h), 5.125.07 (m, 2h), 4.754.70 (m, 2h). c nmr (125.8 mhz, acetone - d6) 143.2, 142.7, 141.6, 135.4, 130.0, 128.4, 128.2, 127.7, 126.2, 124.3, 119.2, 114.6, 114.5, 44.7. hrms (esi) m / z calc. for c17h17bno [m + h ] 262.1403, found 262.1408. h nmr (500 mhz, acetone - d6) 7.78 (s, 1h), 7.637.60 (m, 1h), 7.497.38 (m, 6h), 7.297.25 (m, 1h), 7.107.05 (m, 1h), 6.54 (s, 1h), 4.114.05 (m, 2h), 1.741.70 (m, 2h), 1.531.43 (m, 2h), 1.000.93 (m, 3h). c nmr (125.8 mhz, acetone - d6) 143.0, 142.9, 141.6, 130.3, 128.5, 128.4, 127.8, 126.2, 124.4, 119.0, 113.8, 42.2, 31.2, 20.1, 13.4. ir (neat) 3635, 2957, 2870, 1387, 760 cm. hrms (ci) m / z calc. for c18h20bno [m ] 277.1638, found 277.1636. h nmr (500 mhz, acetone - d6) 7.78 (s, 1h), 7.647.55 (m, 2h), 7.487.45 (m, 3h), 7.427.37 (m, 2h), 7.307.26 (m, 1h), 7.097.06 (m, 1h), 6.48 (s, 1h), 4.023.98 (m, 2h), 1.381.32 (m, 1h), 0.510.45 (m, 4h).c nmr (125.8 mhz, acetone - d6) 143.2, 142.9, 141.9, 130.3, 128.5, 128.4, 127.7, 126.2, 124.3, 119.0, 114.2, 46.1, 10.8, 3.5. hrms (ci) m / z calc. for c18h18bno [m ] 275.1481, found 275.1493. h nmr (500 mhz, acetone - d6) 7.86 (s, 1h), 7.63 (d, j = 7.8 hz, 1h), 7.55 (d, j = 7.3 hz, 2h), 7.447.40 (m, 2h), 7.327.20 (m, 8h), 7.047.01 (m, 1h), 6.85 (s, 1h), 5.35 (s, 2h). c nmr (125.8 mhz, acetone - d6) 143.4, 142.7, 141.7, 139.4, 130.1, 128.6, 128.5, 128.4, 127.8, 126.5, 126.3, 126.3, 124.5, 119.4, 115.0, 46.3. ir (neat) 3632, 3030, 2924, 1387, 760 cm. obtained as a yellow oil (0.26 mmol scale, 62 mg, 87%, 62:38 monomer : anhydride). h nmr (500 mhz, acetone - d6) 7.77 (s, 1h), 7.617.58 (m, 1h), 7.417.33 (m, 4h), 7.227.18 (m, 2h), 7.087.03 (m, 1h), 6.56 (s, 1h), 6.076.00 (m, 1h), 5.125.06 (m, 2h), 4.724.70 (m, 2h), 2.35 (s, 3h). c nmr (125.8 mhz, acetone - d6) 142.8, 141.5, 139.8, 135.6, 135.4, 129.9, 129.1, 128.0, 127.6, 124.3, 119.1, 114.6, 114.5, 44.7, 20.1. ir (neat) 3607, 3062, 2979, 1384, 1353, 750 cm. hrms (ci) m / z calc. for c18h18bno [m ] 275.1481, found 275.1477. obtained as a yellow oil (0.26 mmol scale, 62 mg, 87%, 62:38 monomer : anhydride). h nmr (500 mhz, acetone - d6) 7.67 (s, 2h), 7.58 (d, j = 7.6 hz, 2h), 7.407.36 (m, 4h), 7.107.05 (m, 6h), 6.89 (d, j = 7.8 hz, 4h), 6.055.97 (m, 2h), 5.13 (dd, j = 10.4, 1.3 hz, 2h), 5.04 (dd, j = 17.5, 1.3 hz, 2h), 4.724.69 (m, 4h), 2.12 (s, 6h). c nmr (125.8 mhz, acetone - d6) 142.8, 141.1, 139.2, 135.2, 135.0, 129.8, 128.2, 127.9, 127.9, 124.7, 119.6, 115.0, 114.9, 45.6, 20.0. hrms (esi) m / z calc. for c18h18bno [m c18h16bno ] 275.1481, found 275.1478. hrms found for [monomer ]. obtained as a yellow oil (0.5 mmol scale, 98 mg, 71%, 77:23 monomer : h nmr (500 mhz, acetone - d6) 7.78 (s, 1h), 7.61 (d, j = 7.6 hz, 1h), 7.417.34 (m, 2h), 7.297.25 (m, 3h), 7.117.04 (m, 2h), 6.61 (s, 1h), 6.076.01 (m, 1h), 5.125.07 (m, 2h), 4.724.70 (m, 2h), 2.36 (s, 3h). c nmr (125.8 mhz, acetone - d6) 143.0, 142.6, 141.6, 137.8, 135.4, 130.5, 130.0, 128.4, 128.1, 127.0, 124.7, 124.3, 119.1, 114.6, 114.5, 44.7, 20.6. ir (neat) 3623, 2977, 2922, 1608, 1383, 761 cm. hrms (esi) m / z calc. for c18h17bno [m h ] 274.1403, found 274.1404. obtained as a yellow oil (0.5 mmol scale, 98 mg, 71%, 77:23 monomer : anhydride). h nmr (500 mhz, acetone - d6) 7.61 (s, 2h), 7.56 (d, j = 7.6 hz, 2h), 7.407.36 (m, 4h), 7.08 (d, j = 5.9 hz, 2h), 6.946.88 (m, 6h), 6.79 (d, j = 6.8 hz, 2h), 6.116.06 (m, 2h), 5.185.12 (m, 4h), 4.874.83 (m, 2h), 4.754.72 (m, 2h), 2.04 (s, 6h). c nmr (125.8 mhz, acetone - d6) 142.9, 141.8, 141.2, 136.8, 135.2, 129.9, 128.7, 128.1, 127.4, 126.5, 125.2, 124.6, 119.6, 115.1, 114.9, 45.7, 20.3. ir (neat) 3034, 2982, 1605, 1384, 1352, 760 cm. hrms (esi) m / z calc. for c18h17bno [m c18h17bno ] 274.1403, found 274.1410. hrms found for [monomer - h ]. obtained as a yellow oil (0.45 mmol scale, 76 mg, 59%, > 95:5 monomer : anhydride).h nmr (500 mhz, acetone - d6) 7.66 (s, 2h), 7.58 (d, j = 7.3 hz, 2h), 7.477.39 (m, 4h), 7.127.08 (m, 2h), 7.056.97 (m, 8h), 6.176.10 (m, 2h), 5.215.12 (m, 4h), 4.874.79 (m, 4h). c nmr (125.8 mhz, acetone - d6) 147.9, 141.4, 136.4, 134.8, 132.6, 131.4, 131.3, 131.2, 130.1, 130.7, 129.4, 128.0, 123.6, 118.6, 117.0, 51.5. ir (neat) 3063, 2974, 1384, 1352, 1187, 749 cm. hrms (esi) m / z calc. for c31h24b2cl2n2o [m c3h4 ] 532.1452, found 532.1424. hrms found for [m - allyl ]. obtained as an off - white solid (0.31 mmol scale, 71 mg, 82%, > 95:5 monomer : anhydride). h nmr (500 mhz, acetone - d6) 7.66 (s, 2h), 7.58 (d, j = 7.8 hz, 2h), 7.437.39 (m, 4h), 7.177.08 (m, 6h), 6.846.80 (m, 4h), 6.136.04 (m, 2h), 5.18 (d, j = 10.5 hz, 2h), 5.07 (d, j = 17.1 hz, 2h), 4.794.77 (m, 4h). c nmr (125.8 mhz, acetone - d6) 161.4 (d, j = 243 hz), 143.4, 141.1, 138.2 (d, j = 3.9 hz), 135.0, 130.0, 129.7, 129.7, 128.3, 124.4, 119.8, 115.0 (d, j = 5.0 hz), 114.2 (d, j = 22 hz), 45.6. ir (neat) 3063, 2926, 1384, 1352, 749 cm. hrms (ci) m / z calc. for c17h15bnof [m c17h13bnof ] hrms found for [monomer ]. obtained as an off - white solid (0.5 mmol scale, 110 mg, 67%, > 95:5 monomer : anhydride). h nmr (500 mhz, acetone - d6) 7.78 (s, 2h), 7.6 (d, j = 7.3 hz, 2h), 7.487.37 (m, 8h), 7.28 (d, j = 7.6 hz, 4h), 7.137.08 (m, 2h), 6.156.10 (m, 2h), 5.20 (d, j = 10.5 hz, 2h), 5.09 (d, j = 17.1 hz, 2h), 4.834.81 (m, 4h). c nmr (125.8 mhz, acetone - d6) 146.0, 144.5, 141.3, 134.9, 130.4, 128.9, 128.5, 127.5, 126.7 (q, j = 264 hz), 124.4 (q, j = 5.0 hz), 124.2, 120.0, 115.2, 115.1, 45.6. ir (neat) 3056, 3 + 36, 2384, 1324, 1110, 761 cm. hrms (ci) m / z calc. for c18h15bf3no [m c18h13bf3no ] 329.1199 hrms found for [monomer ]. obtained as a yellow oil (0.36 mmol scale, 94 mg, 90%, 15:85 monomer : anhydride). h nmr (500 mhz, acetone - d6) 7.70 (s, 1h), 7.58 (d, j = 7.6 hz, 1h), 7.407.34 (m, 2h), 7.307.25 (m, 2h), 7.056.99 (m, 3h), 6.34 (s, 1h), 6.045.98 (m, 1h), 5.10 (dd, j = 13.7, 1.7 hz, 2h), 4.724.70 (m, 2h), 3.83 (s, 3h). c nmr (125.8 mhz, acetone - d6) 156.4, 143.8, 141.7, 135.6, 132.0, 129.9, 129.9, 128.0, 128.0, 124.3, 120.9, 118.9, 114.5, 114.0, 110.9, 54.9, 44.6. ir (neat) 3628, 2980, 1386, 1352, 1187, 750 cm. obtained as an off - white solid (0.20 mmol scale, 35 mg, 56%, > 95:5 monomer : anhydride). h nmr (500 mhz, acetone - d6) 7.68 (d, j = 6.4 hz, 2h), 7.59 (s, 2h), 7.557.52 (m, 4h), 7.487.37 (m, 8h), 7.347.30 (m, 4h), 7.23 (d, j = 8.3 hz, 2h), 7.067.01 (m, 2h), 6.196.11 (m, 2h), 5.225.14 (m, 4h), 4.934.83 (m, 4h). c nmr (125.8 mhz, acetone - d6) 143.6, 141.2, 139.5, 135.2, 133.3, 132.0, 130.0, 128.2, 127.6, 127.2, 126.9, 126.8, 126.3, 125.4, 125.1, 124.5, 119.6, 115.2, 115.0, 45.7. ir (neat) 3057, 2923, 1390, 1354, 1215, 742 cm. hrms (ci) m / z calc. for c21h18bno [m c21h16bno ] 311.1481, found 311.1472. hrms found for [monomer ]. obtained as a yellow oil (0.5 mmol scale, 114 mg, 85%, 60:40 monomer : h nmr (500 mhz, acetone - d6) 7.99 (s, 1h), 7.637.58 (m, 2h), 7.497.46 (m, 1h), 7.457.42 (m, 1h), 7.397.32 (m, 2h), 7.087.04 (m, 1h), 6.70 (s, 1h), 6.075.97 (m, 1h), 5.115.04 (m, 2h), 4.724.70 (m, 2h). c nmr (125.8 mhz, acetone - d6) 142.1, 141.9, 141.4, 135.2, 129.9, 128.0, 127.2, 125.3, 124.3, 121.1, 119.3, 114.6, 114.4, 44.8. ir (neat) 3627, 3064, 2932, 1385, 1352, 1187, 750 cm. hrms (esi) m / z calc. for c15h15bnos [m + h ] 268.0967 obtained as a yellow oil (0.5 mmol scale, 111 mg, 63%, 36:64 monomer : anhydride). h nmr (500 mhz, acetone - d6) 8.138.10 (m, 1h), 8.06 (s, 1h), 8.048.00 (m, 1h), 7.717.67 (m, 1h), 7.667.62 (m, 1h), 7.567.39 (m, 6h), 7.157.11 (m, 1h), 7.02 (m, 1h), 6.146.02 (m, 1h), 5.225.15 (m, 2h), 4.844.82 (m, 2h). c nmr (125.8 mhz, acetone - d6) 157.0, 154.6, 146.3, 143.1, 136.6, 131.3, 129.7, 128.5, 128.5, 128.2, 125.4, 125.2, 125.0, 124.4, 123.8, 121.8, 120.2, 120.0, 115.8, 115.8, 112.7, 45.9. ir (neat) 3623, 3063, 2928, 1385, 1187, 750 cm. hrms (esi) m / z calc. for c23h19bno2 [m + h ] 352.1509, found 352.1523. to a biotage microwave vial equipped with stir bar was successively introduced koh (0.3 mmol, 3 equiv) and bis(1-allyl-3-(3-methylphenyl)-2,1-borazaro-2-naphthyl) ether (0.1 mmol, 1 equiv). the vial was sealed with a cap lined with a disposable teflon septum, evacuated under vacuum, and purged with ar three times. degassed thf (0.9 ml) and degassed h2o (0.1 ml) were added under ar, and the vial was stirred at rt for 18 h. the reaction was diluted with h2o (1 ml), extracted with etoac (3 1 ml), and dried (mgso4). the solvent was removed in vacuo to yield 1-allyl-3-(3-methylphenyl)-2,1-borazaronaphthol (3b - monomer). to a biotage microwave vial equipped with a stir bar was successively introduced t - bu3p - pd - g2 (2.3 mg, 5 mol, 2 mol %), cs2co3 (84 mg, 1.5 mmol, 3 equiv), phenylboronic acid (31 mg, 1.0 equiv) and 1-benzyl-3,6-dibromo-2-phenyl-2,1-borazaronaphthalene (0.25 mmol, 1 equiv). the vial was sealed with a cap lined with a disposable teflon septum, evacuated under vacuum, and purged with ar three times. anhydr degassed thf (0.6 ml) and degassed h2o (0.6 ml) were added under ar, and the vial was stirred at rt for 18 h. the reaction was diluted with h2o (2 ml), extracted with etoac (3 2 ml), and dried (mgso4). the solvent was removed in vacuo, and the product was purified by passing through a short plug of florisil. obtained as an off - white solid (89 mg, 92%). h nmr (500 mhz, acetone - d6) 7.987.94 (m, 2h), 7.67 (d, j = 7.3 hz, 2h), 7.617.55 (m, 3h), 7.457.40 (m, 4h), 7.357.27 (m, 7h), 7.247.20 (m, 1h), 6.97 (br s, 1h), 5.38 (s, 2h). c nmr (125.8 mhz, acetone - d6) 143.9, 142.9, 141.4, 140.7, 139.6, 132.3, 128.9, 128.7, 128.6, 128.3, 128.0, 127.0, 126.8, 126.7, 126.6, 126.6, 126.6, 125.0, 115.8, 45.6 b nmr (128.38 mhz, acetone - d6) 29.8. ir (neat) 3602, 3026, 1387, 763, 698 cm. hrms (esi) m / z calc. for c27h23bno [m + h ] equipped with a stir bar was successively introduced t - bu3p - pd - g2 (1.7 mg, 3.3 mol, 1 mol %), and 3-bromo-2-aryl-2,1-borazaronaphthalene (0.33 mmol, 1 equiv). the vial was sealed with a cap lined with a disposable teflon septum, evacuated under vacuum, and purged with ar three times. degassed thf (0.8 ml) was added under ar, and the vial was cooled to 0 c. phmgbr (1 m in thf, 0.4 ml diluted to 0.8 ml) was added dropwise over 15 min at 0 c. aq nh4cl (0.5 ml), extracted with etoac (3 2 ml), and dried (mgso4). the solvent was removed in vacuo, and the product was purified by flash column chromatography on silica gel using a 0 to 20% ch2cl2/hexane as the eluent. obtained as a yellow oil (89 mg, 84%). h nmr (500 mhz, acetone - d6) 8.09 (s, 1h), 7.85 (d, j = 7.8 hz, 1h), 7.667.62 (m, 1h), 7.577.52 (m, 1h), 7.337.23 (m, 6h), 7.147.05 (m, 5h), 6.086.01 (m, 1h), 5.15 (d, j = 10.5 hz, 1h), 4.98 (d, j = 17.4 hz, 1h), 4.764.74 (m, 2h). c nmr (125.8 mhz, acetone - d6) 144.4, 143.0, 140.3, 135.7, 131.7, 130.4, 128.6, 128.5, 127.4, 127.2, 127.0, 126.6, 125.4, 121.3, 116.6, 115.0, 50.1. hrms (ci) m / z calc. for c23h20bn [m ] 321.1689, found 321.1684. obtained as a yellow oil (101 mg, 89%). h nmr (500 mhz, acetone - d6) 8.08 (s, 1h), 7.84 (d, j = 7.6 hz, 1h), 7.657.62 (m, 1h), 7.577.52 (m, 1h), 7.337.25 (m, 6h), 7.157.10 (m, 2h), 6.916.85 (m, 2h), 6.076.01 (m, 1h), 5.15 (d, j = 10.5 hz, 1h), 4.97 (d, j = 17.2 hz, 1h), 4.744.72 (m, 2h). c nmr (125.8 mhz, acetone - d6) 161.5 (d, j = 243 hz), 143.3, 140.9 (d, j = 4 hz), 140.6, 135.9, 132.0, 130.7, 130.5 (d, j = 8 hz), 128.8, 127.5 (d, j = 20 hz), 126.7, 121.7, 116.9, 115.3, 114.4, 114.3, 51.0. ir (neat) 3068, 1506, 1370, 1220, 832, 766 cm. hrms (ci) m / z calc. for c23h19bfn [m ] 339.1595, found 339.1604. h nmr (500 mhz, acetone - d6) 7.91 (s, 1h), 7.78 (d, j = 7.9 hz, 1h), 7.63 (d, j = 8.5 hz, 1h), 7.547.50 (m, 1h), 7.297.25 (m, 3h), 7.167.12 (m, 4h), 7.107.06 (m, 1h), 6.866.83 (m, 1h), 6.65 (d, j = 8.2 hz, 1h), 6.106.03 (m, 1h), 5.17 (dd, j = 10.5, 1.4 hz, 1h), 5.01 (dd, j = 17.1, 1.5 hz, 1h), 4.764.74 (m, 2h), 3.33 (s, 3h). c nmr (125.8 mhz, acetone - d6) 156.3, 142.9, 140.5, 136.2, 134.4, 131.8, 130.3, 129.7, 128.3, 127.6, 127.0, 126.9, 126.7, 121.3, 120.2, 116.8, 115.2, 110.2, 54.3, 50.9. ir (neat) 3006, 2830, 1489, 1370, 1340, 748 cm. hrms (ci) m / z calc. for c24h22bno [m ] 351.1794, found 351.1800. h nmr (500 mhz, acetone - d6) 8.08 (s, 1h), 7.83 (d, j = 7.6 hz, 1h), 7.63 (d, j = 8.6 hz, 1h), 7.557.51 (m, 1h), 7.347.25 (m, 6h), 7.00 (d, j = 6.6 hz, 1h), 6.936.89 (m, 1h), 6.816.77 (m, 1h), 6.076.01 (m, 1h), 5.15 (d, j = 10.5 hz, 1h), 4.97 (d, j = 17.4 hz, 1h), 4.754.73 (m, 2h), 2.09 (s, 3h). c nmr (125.8 mhz, acetone - d6) 159.7 (d, j = 243 hz), 142.8, 140.3, 135.7, 131.8 (d, j = 5 hz), 131.7, 130.4, 128.5, 127.7 (d, j = 6 hz), 127.3, 127.1, 126.5, 123.3, 123.1, 121.4, 116.6, 115.1, 113.7 (d, j = 22 hz), 50.1, 13.5. ir (neat) 3046, 1498, 1367, 1223, 1118, 766, 704 cm. hrms (ci) m / z calc. for c24h21bfn [m ] 353.1751, found 353.1761. h nmr (500 mhz, acetone - d6) 8.16 (s, 1h), 7.86 (d, j = 7.6 hz, 1h), 7.64 (d, j = 7.3 hz, 1h), 7.477.43 (m, 2h), 7.397.35 (m, 1h), 7.317.25 (m, 5h), 7.217.11 (m, 9h), 5.42 (s, 2h). c nmr (125.8 mhz, acetone - d6) 144.4, 143.4, 140.3, 139.1, 131.2, 130.5, 128.8, 128.7, 128.5, 128.5, 127.5, 127.3, 126.8, 126.7, 125.6, 125.5, 121.5, 117.1, 52.3. ir (neat) 3064, 2922, 1547, 1376, 767, 702 cm. hrms (ci) m / z calc. for c27h22bn [m ] 371.1845, found 371.1840. the geometries were optimized at the b3lyp/6 - 311(d, p) level, and molecular orbitals and molecular energies were calculated at the same level. | unlike their b - alkyl counterparts, brominated n - alkyl b - aryl 2,1-borazaronaphthalenes undergo a self - arylation reaction in the presence of a catalytic amount of palladium and base, in which the azaborine serves as both the electrophile and the nucleophile. the products of the self - arylation are air- and moisture - stable 2,1-borazaronaphthols, previously only observed in basic alcoholic solvents. the steric encumbrance of the azaborine appears to prevent formation of the corresponding boron acid anhydride, allowing access to a family of 2,1-borazaronaphthol derivatives. |
healthy people 2020 recently identified the importance of sleep in the health and well - being of americans.1 one objective set forth in this initiative is to increase the proportion of adolescents and adults who get sufficient sleep. although sleep deprivation among adolescents is not a new phenomenon, in recent years sleep has garnered more mainstream, clinical, and academic attention. this comes at a time when there are increased demands on adolescentsa that conflict with getting a full night s sleep, which can negatively impact physical, social, and psychological health. physically, sleep deprivation can disrupt circadian rhythms resulting in dysregulated sleep patterns, as well as dysregulated metabolic, endocrine, and immune responses.2,3 examples include weight gain, insulin resistance, increased cortisol levels, systemic inflammation, hypertension, and decreased immune response.2,46 sleep deprivation is also correlated with behaviors that can have negative effects on the body, including increased alcohol and drug use, increased sexual behavior, and the overuse of prescribed and/or non - prescribed stimulants to counteract drowsiness.7,8 excessive daytime sleepiness can also make individuals particularly vulnerable to injury and death resulting from driving while sleep deprived, as sleep deprivation is associated with lapses in attention, delayed response time, and daytime drowsiness.7,912 psychologically, inadequate sleep can affect cognitive functioning and has been linked to reduced short - term memory, decreased learning ability, poor productivity, and decreased motor performance. mood is also significantly affected, with sleep deprivation associated with negative mood states, depressive symptoms, decreased stress management, family and peer conflict, impulsivity, and the loss of other forms of behavioral control.7,1315 according to guidelines recommended by the centers for disease control (2012), the average adolescent requires 8.59.25 hours of sleep per night, with thirteen year olds requiring approximately 10 hours and 19 year olds requiring approximately 8.5 hours per night.16,44 however, these are mere guidelines, with some individuals requiring more sleep and some requiring less sleep than the averages. despite these recommendations, researchers have consistently demonstrated that most adolescents do not get enough sleep, with most sleeping between 7.5 and 8.5 hours per night (e.g.,7,17). in a seminal article by wolfson & carskadon (1998), the researchers reported that 26% of adolescents in their sample received 6.5 hours of sleep or less on school nights.17 one explanation for these sleep patterns is that during this developmental stage, circadian rhythms shift causing teenagers to stay up later, which directly impacts sleep quantity.18 biological shift, however, is not the sole issue. modern society is not designed to allow adolescents the sleep they need during this developmental transition. while their bodies are commanding them to stay up later, high school start times are increasingly earlier and incongruent with this biological shift. factors also play an important role in sleep deprivation. napping for more than 45 minutes (e.g., after school) or too close to bedtime and sleeping in on weekends to catch up on sleep, rather than establishing set sleep and wake times, disrupts the sleep cycle.7,19 an abundance of academic demands, employment, or extra - curricular activities may also contribute to doing homework at night rather than earlier in the day, and studying late into the night can interfere with the ability to get a sufficient amount of sleep.11 socially, a fear of missing out, the transition to and through high school and college, and constant contact with peers often get in the way of going to bed at a healthy time.20 another contributing factor in adolescent sleep problems is technology use. the pew research center found that 45% of youth age 12 to 17 owned a cell phone.21 in a 2012 follow - up study, this number had risen to 78%.22 correspondingly, texting via these devices has quickly become the primary mode of communication for this group, with adolescents sending a modal average of 100 texts per day.23 while the ubiquity of cell phone ownership has changed the way youth communicate, rapidly rising ownership of the smartphone, which allows users to connect to the internet via their mobile device, is changing the way adolescents interact with online media. in 2012, 37% of adolescents surveyed by the pew research center owned a smartphone, an increase of 14% from the previous year.22 a study of college students placed smartphone ownership among this cohort even higher, at 62%.24 in addition, one in four adolescents reports using the cell phone as their primary mode of online connection.22 accordingly, today s youth have the potential to be connected at any location, twenty - four hours a day, which has clear implications for sleep. many teens are using technology within the hour before trying to fall asleep or using cell phones in bed, which interferes with the ability to fall asleep and stay asleep throughout the night.6 functionally, cellular phone use shortly before bed has been linked to a number of negative outcomes. van den bulck (2007) found that use of cell phones after lights out was related to increased tiredness, and munezawa and colleagues (2011) found a positive association between device use after lights out and four types of sleep disturbance.25,26 this trend is also evident among college students, a group already at high risk for sleep difficulties.27 adams and kisler found that college students who used cell phone technology after sleep onset reported being awake an extra 46 minutes per week.28 forty - seven percent of students awoke after sleep onset to answer text messages and 40% to answer cell phone calls. importantly, greater levels of tech use during sleep time predicted lower sleep quality, and lower sleep quality increased depressive / anxious symptomology. similarly, jenaro and colleagues (2007) concluded that pathological internet use and cellular phone use were associated with insomnia and sleep disturbance, particularly in female college students.29 interestingly, white and colleagues (2011) reported that college students may have a hyper vigilant attitude towards their phone, and may immediately awaken to the sound of their phone in the same way a mother awakens upon hearing her baby cry. college students that engaged in increased mobile phone use, pathological texting, and problem texting also experienced increased sleep disturbance and decreased sleep quality.30 emerging research points to the prevalence of patterns of problematic phone use among adolescents that are akin to behavioral addiction. this is a significant barrier when attempting to alter patterns of adolescent technology use by encouraging adolescents to place boundaries on their technology use.3134 those adolescents who are able to disconnect from their phones may have difficulty settling down to sleep. emerging research points to a connection between the backlit display common to many portable tech devices and disruption of circadian physiology and melatonin expression.35,36 many computers, televisions, and smartphones emit short - wavelength light. artificial, short - wavelength light exposure during evening hours a time when many adolescents are using technology can disrupt circadian rhythms, impacting sleep and neurobehavioral operation. chronic, ill - timed exposure to short - wavelength light can cause a misalignment of the circadian timing system, resulting in sleep issues and depressive symptomology.35 although several studies have identified the negative impact of other forms of technology (e.g., video games, television viewing and computers) on adolescent sleep, the need for well - designed studies examining mobile phone use and sleep remains an area of future study.37 several barriers exist in conducting research in this area, ranging from difficulty utilizing objective measurements of technology use after sleep onset, measuring the specific feature of mobile technology that impacts sleep (e.g., does actively texting with a peer lead to poorer outcomes when compared to passively listening to music),37 and/or the timeliness of publication. multiple devices to measure sleep habits and patterns exist, including apps such as sleep cycle and somnometer, tracking devices such as a fitbit and zeo, and actigraphy devices such as sleep - tracker.38 devices to track technology use, however, are more limited. in previous studies, researchers have relied on self - report frequencies of cellular phone use or self - reported amount of hours using social networking sites (e.g.,28,39). these methods are not able to assess for the complexity of technology use and are vulnerable to the reliability of self - report. 39,40 one strategy to collect data usage after sleep onset is to ask participants to review telephone logs and report the data on a daily basis. researchers could also review monthly telephone logs from the cellular phone carrier ; however, many adolescents are on their parent s cellular plans, which would create an additional barrier, and issues of confidentiality of information arise. there are many apps on the market that track cell phone and text messaging use ; however, most of these apps only produce a daily report of usage, which limits the ability to examine data usage trends during the nighttime hours. after an extensive search, it was determined that one app (mobile monitor) could effectively collect the necessary data. one caveat is that this app makes the content of the user s text messages and emails available to researchers, increasing concerns about the privacy of participants personal communications. lastly, researchers could collect accelerometer data from smartphones to assess if a phone was picked up during the night and for how long ; however, this would only be feasible with the development of a new app. another important consideration in sleep and technology research is the need for validation of apps for sleep tracking. given the lack of studies to validate the use of sleep tracking apps in research, it is unclear if these apps accurately and consistently measure constructs of interest. techniques, including actigraphy, as well as self - report measures of sleep disturbance and mobile phone use.30,41 researchers have yet to determine the most valid methodology for measuring technology use before or after sleep onset. for instance, using an actigraph combined with a self - report diary is an effective strategy to detect sleep disturbance ; and perhaps combining actigraphy data, a review of the phone log, and the use of self - report questionnaires (such as the mobile phone use questionnaire30) would provide valid data about usage throughout the night. additional barriers to consider include : 1) the cost of app development for both iphone and android platforms ; 2) the assumption that all participants would all have access to smartphones ; 3) the assumption that all participants are accessing technology using a phone rather than a tablet or other portable electronic device ; and 4) the cost of actigraphs for use in research. we also believe that future research would be strengthened by the development of clear theoretical models that attempt to explain the role of technology on sleep. one example is the model presented by cain and gradisar (2010) which combines social, familial, developmental, and biological factors to explain how media affects sleep.37 another methodological barrier to conducting sleep and technology research in adolescents is the rapid evolution of preferred technological platforms.42,43 therefore, it is imperative for sleep and technology researchers to maintain regular contact with adolescents to assess their patterns of use. researchers should conduct semi - annual focus groups with adolescents and/or informally discuss current technological trends. moreover, in terms of the process of executing research (i.e., initial conceptualization, irb approval, data collection, write up, and publication of findings), researchers must have time dedicated to focusing on expedient research. soon after data is collected it, must be promptly analyzed and written up for publication. researchers should also carefully choose peer - reviewed journals that have an expedited review time (i.e., 3 months or less). since technological trends change so quickly, the time from write - up to publication can be a major factor in the relevance of the study at the time of publication. lastly, researchers should consider disseminating their results directly to mainstream or clinical venues, such as community newsletters, service presentations at local health centers or schools, or annual conferences. the impact of technology on sleep is a topic of vast interest in popular press and should be made available to the public in a judicious manner to give individuals timely access to current trends. multiple devices to measure sleep habits and patterns exist, including apps such as sleep cycle and somnometer, tracking devices such as a fitbit and zeo, and actigraphy devices such as sleep - tracker.38 devices to track technology use, however, are more limited. in previous studies, researchers have relied on self - report frequencies of cellular phone use or self - reported amount of hours using social networking sites (e.g.,28,39). these methods are not able to assess for the complexity of technology use and are vulnerable to the reliability of self - report. 39,40 one strategy to collect data usage after sleep onset is to ask participants to review telephone logs and report the data on a daily basis. researchers could also review monthly telephone logs from the cellular phone carrier ; however, many adolescents are on their parent s cellular plans, which would create an additional barrier, and issues of confidentiality of information arise. there are many apps on the market that track cell phone and text messaging use ; however, most of these apps only produce a daily report of usage, which limits the ability to examine data usage trends during the nighttime hours. after an extensive search, it was determined that one app (mobile monitor) could effectively collect the necessary data. one caveat is that this app makes the content of the user s text messages and emails available to researchers, increasing concerns about the privacy of participants personal communications. lastly, researchers could collect accelerometer data from smartphones to assess if a phone was picked up during the night and for how long ; however, this would only be feasible with the development of a new app. another important consideration in sleep and technology research is the need for validation of apps for sleep tracking. given the lack of studies to validate the use of sleep tracking apps in research, it is unclear if these apps accurately and consistently measure constructs of interest. techniques, including actigraphy, as well as self - report measures of sleep disturbance and mobile phone use.30,41 researchers have yet to determine the most valid methodology for measuring technology use before or after sleep onset. for instance, using an actigraph combined with a self - report diary is an effective strategy to detect sleep disturbance ; and perhaps combining actigraphy data, a review of the phone log, and the use of self - report questionnaires (such as the mobile phone use questionnaire30) would provide valid data about usage throughout the night. additional barriers to consider include : 1) the cost of app development for both iphone and android platforms ; 2) the assumption that all participants would all have access to smartphones ; 3) the assumption that all participants are accessing technology using a phone rather than a tablet or other portable electronic device ; and 4) the cost of actigraphs for use in research. we also believe that future research would be strengthened by the development of clear theoretical models that attempt to explain the role of technology on sleep. one example is the model presented by cain and gradisar (2010) which combines social, familial, developmental, and biological factors to explain how media affects sleep.37 another methodological barrier to conducting sleep and technology research in adolescents is the rapid evolution of preferred technological platforms.42,43 therefore, it is imperative for sleep and technology researchers to maintain regular contact with adolescents to assess their patterns of use. researchers should conduct semi - annual focus groups with adolescents and/or informally discuss current technological trends. moreover, in terms of the process of executing research (i.e., initial conceptualization, irb approval, data collection, write up, and publication of findings), researchers must have time dedicated to focusing on expedient research. soon after data is collected it, must be promptly analyzed and written up for publication. researchers should also carefully choose peer - reviewed journals that have an expedited review time (i.e., 3 months or less). since technological trends change so quickly, the time from write - up to publication can be a major factor in the relevance of the study at the time of publication. lastly, researchers should consider disseminating their results directly to mainstream or clinical venues, such as community newsletters, service presentations at local health centers or schools, or annual conferences. the impact of technology on sleep is a topic of vast interest in popular press and should be made available to the public in a judicious manner to give individuals timely access to current trends. given that poor and disrupted sleep can cause problems with physical and psychological functioning, adolescents may present to pediatricians or mental health clinicians with depressive symptoms or increased illness presentation that are exacerbated by poor sleep. few healthcare providers, however, have received in - depth training in sleep and may not inquire about sleep as a contributor to larger health issues in their patients. therefore, we encourage practitioners to consider the following recommendations : 1) practitioners should regularly assess both the amount of sleep that adolescents receive as well as disruption caused by modifiable environmental factors (e.g., technology use) ; 2) parents should be provided with information about how to foster healthy sleep habits in adolescents, which include setting very clear boundaries around technology use in the home (e.g., all phones turned in to a centralized location at night) ; and 3) practitioners should remain attentive to the evolving technological platforms that adolescents are using and overtly ask their patients about the impact of technology on sleep. these inquiries could include questions such as do you go to bed later than you should because you get caught up on social media or texting, or do you wake up after falling asleep to answer texts ? adolescents are typically very candid about disclosing these behaviors, thus opening the door for practitioners to provide psychoeducation about the importance of sleep and technological boundaries. given the importance of sleep on growing minds and bodies, any efforts to improve adolescent sleep quantity and quality should be considered a worthwhile investment. | adolescent sleep needs range from 8.510 hours per night, with older adolescents requiring less sleep than younger adolescents. on average, however, american adolescents receive between 7.58.5 hours of sleep per night, with many sleeping fewer than 6.5 hours on school nights. cellular phone use is emerging as an important factor that interferes with both sleep quality and quantity, particularly as smartphones become more widely available to teens. this review paper has three objectives. first, we will describe adolescent sleep patterns and the effects of sleep deprivation on adolescent physical and mental health. second, we will describe current trends in technology use among adolescents, making associations to how technology impacts sleep. lastly, we will discuss some of the methodological barriers of conducting sleep and technology research with adolescents and young adults and offer suggestions for overcoming those barriers. we will also discuss implications for healthcare providers. |
trypsin (sequencing grade) was purchased from promega (madison, wi). isotope - labeled peptides were obtained from new england peptide (gardner, ma) with either u c6, u n2-lysine (+ 8 da) or u c6, u n4-arginine (+ 10 da) at the peptide c terminus. chemical purity was ranged from 95 to 99% and isotopic purity was greater than 99%. timp1, thbs2, comp, msln, eng, mmp9 antibodies and elisa kits were purchased from r&d systems (minneapolis, mn). timp1, eng and mmp9 recombinant proteins were purchase from sino biological (beijing, china). identities of all recombinant proteins were confirmed by sds - page (figure s1a [supporting information (si) ]) and tandem mass spectrometry (figure s2s7 [si ]) analysis of tryptic digests. all other chemical reagents were purchased from commercial sources and were used without further purification. human plasma samples were collected during surgery for either colon carcinoma or for inguinal hernia repair in accordance with the ayers institute protocol at vanderbilt university medical center (irb#110877). samples from colon cancer patients undergoing surgery at vanderbilt university between august 2011 and june 2012 with a successful collection were used in the study. control samples were chosen from a larger group of inguinal hernia repair patients who underwent surgery during the same time period. peripheral whole blood samples were collected preoperatively in edta lavender top vacutainer tubes (bd vacutainer, catalog number 366643) and gently mixed by inverting the tube 810 times. plasma was separated by centrifugation at 1500 g for 10 min at 4 c. aliquots (0.2 ml) were taken and stored at 80 c until needed. antibodies were immobilized on aldehyde beads (thermo scientific, catalog number 26148) according to the manufacturer s protocol with minor modifications. briefly, antibodies were dissolved in pbs buffer (0.01 m sodium phosphate, 0.15 sodium chloride, ph 7.2) and incubated with coupling resin and 75 m sodium cyanoborohydride at room temperature on a rotator. an aliquot was collected before and after binding for determination of binding efficiency by protein bicinchoninic acid assay. after immobilization, the active aldehyde sites on the resin were blocked with 1 m tris buffer and 75 m sodium cyanoborohydride followed by several washes with pbs to remove any nonbound antibody. after determining the binding efficiency, the immobilized resins for all antibodies were either combined or directly aliquoted such that 1 g of each immobilized antibody was used for each immunoprecipitation. plasma (50 l) was diluted 5-fold with ripa buffer containing a protease inhibitor cocktail (roche, catalog number 11873580001). diluted plasma was incubated with the immobilized antibody resin overnight at 4 c with gentle shaking. the resin was washed three times with 0.5 ml ripa buffer, and the bound proteins were eluted into 15 l of 2x nupage lithium dodecyl sulfate loading buffer (invitrogen, carsbad, ca) containing 50 mm dtt by incubation at 95 c for 5 min. the eluted proteins then were loaded and separated by sds - page on a nupage novex 10% bis tris mini gel (invitrogen np0301box). a protein molecular weight standard (precision plus protein kaleidoscope standard, bio - rad, hercules, ca) was loaded in one lane on each gel and used for estimation of relative mass determination of captured proteins. after electrophoresis at a constant 180 v for 20 min, gels were washed three times with deionized water, stained with simplyblue safestain (invitrogen) for 1 h, and destained with deionized water at 4 c overnight. from each gel lane, fractions were taken to enable targeted analysis of the target proteins. for timp1, a molecular weight fraction of 2537 kda was collected. for analysis of the remaining five proteins, a molecular weight range of 75200 kda thbs2, comp and mmp9 and another of 3775 kda for eng and msln were excised from the gel, cut into 1 mm cubes, and placed in 100 l of 100 mm ammonium bicarbonate. samples were reduced with 5 l of 100 mm dtt for 15 min at 50 c and alkylated with 15 l of 100 mm iodoacetamide for 30 min at room temperature in the dark. excess dye was removed from gel slices with two exchanges of 100 l 50% acetonitrile/50 mm ammonium bicarbonate and subsequently dehydrated with 100% acetonitrile. the residue was resuspended in 0.01 g/l ms grade trypsin (promega, madison, wi) in 25 mm ammonium bicarbonate containing a standard mixture of heavy isotope - labeled peptides for the analytes (20 fmol / peptide) and incubated at 37 c overnight. peptides were extracted with 60% acetonitrile containing 1% formic acid, and then each fraction was evaporated under vacuum. samples were redissolved for mrm analysis in 30 l of 5% acetonitrile containing 0.1% formic acid. mrm analyses were performed on a tsq vantage triple quadrupole mass spectrometer (thermofisher scientific, san jose, ca) equipped with an eksigent ultra nanolc solvent delivery system, microautosampler and a nanospray source. sample peptides (3 l injection volume) were loaded onto a 75 m 11 cm picofrit column (pf360 - 75 - 10-n-5, new objective, inc., woburn, ma) packed with 3 m, reprosil - pur c18-aq (dr. maisch, ammerbuch - entringen, germany). liquid chromatography was carried out at a flow rate of 300 nl / min with a mobile phase consisting of 0.1% formic acid in either hplc grade water (solvent a) or 90% acetonitrile (solvent b). an elution gradient was programmed from 97% a for 1 min, then increased to 7% b over 4 min, 25% b over 15 min, 40% b over 7 min, 90% b by 40 min, and then held at that composition for 10 min before returning to 97% solvent a over 1 min. mobile phase composition then was held at this initial condition for 29 min prior to the next analysis. instrument parameters included q2 gas 1.5 mtorr, scan width 0.005 th, scan time 10 ms, and both q1 and q3 resolution fwhm 0.7. proteotypic peptides and mrm transitions were selected with the skyline software utility and were further optimized by analyses of tryptic digests of recombinant proteins on the tsq vantage triple quadrupole mass spectrometer. we digested the recombinant proteins and determined the resultant peptides by monitoring all possible tryptic peptides between 8 and 22 amino acids in lc ms experiments using the product scan mode. where recombinant protein was not available, selection of peptides and transitions were selected on the basis of observations from previous discovery experiments, observed peptides in open proteomics databases, or computational predicted peptides through algorithms such as enhanced signature peptide (esp) predictor. peptides containing methionine residues as well as those containing post - translational modification sites such as glycosylation listed in the uniprot database (to minimize interference on digestion) were excluded. all peptides were run through blastp (uniprot) to ensure their uniqueness to the protein of interest. peptides and transitions selected for each protein are shown in table s1 (si). mrm data acquired on the tsq vantage triple quadrupole mass spectrometer were analyzed with skyline software. peak integrations were manually reviewed and transitions from peptides measured were confirmed by the same retention times and transition patterns of the light peptides and synthetic heavy, stable isotope - labeled peptides. peak areas for the four most intense mrm transitions were integrated and summed to generate a peptide peak area, which was divided by the peptide peak area for the internal standard heavy peptide. for each protein, the unique peptide that generated the highest summed peak area signal was used to quantify the protein of interest. six biomarker candidate proteins (timp1, eng, msln, thbs2, mmp9 and comp) were selected on the basis of literature reports, which suggest that they are overexpressed in colon cancers or because differential expression of these proteins in blood was associated with cancer. we also chose these candidates because well - characterized, commercially available elisas were available for each. moreover, the same capture antibodies used in the elisas were available to us for evaluation in ip - mrm assays. to analyze the biomarker candidates in plasma, we performed either single - protein or multiplexed immunoprecipitations and then resolved the target proteins into molecular weight fractions by sds - page (figure s1b [si ]). the gel bands were digested and the digests were spiked with isotope - labeled standards and analyzed by mrm. the mrm signals from each peptide were shown to be consistent with their corresponding isotope labeled peptides in both retention time and transient patterns (figure s8 [si ]). recombinant timp1 protein was spiked into a mock plasma matrix consisting 60 mg / ml bsa in pbs to mimic the human plasma environment and provide a defined analyte concentration for estimation of recovery. a 2-fold dilution series ranging from 640 to 10 ng / ml was constructed and a plot showing the theoretical timp1 concentration versus the calculated protein concentration is shown in figure 1a (the theoretical timp1 concentration versus the ratio l / h is also shown in figure s9a (si). the calculated protein concentration was calculated from the measured peak area ratio of the light to heavy peptides. the slope (0.329) indicated timp1 recovery after all process steps including immunoaffinity capture, trypsin digestion and peptide extraction. the limit of detection (lod) was 2.5 ng / ml (table 1). response curves for ip - mrm analyses of recombinant timp1, comp, mmp9, thbs2, msln and eng proteins. proteins were spiked at 10640 ng / ml in a background matrix of 60 mg / ml bsa in dpbs and analyzed by ip - mrm as described in experimental procedures. values are mean sd. the elisa lower limit of quantitation (lloq) was based on the lowest concentration for the manufacturer s specified calibration curve. next, ip - mrm was used to measure timp1 in 12 50 l plasma aliquots from patients with colon cancer and in 12 samples from noncancer controls. the same samples were also analyzed with a commercial elisa kit with the same capture antibody (figure s10a [si ]). the mean values in ip - mrm analyses in plasma samples from cancer patients and controls were 212 ng / ml and 141 ng / ml, respectively, which was a significant difference (unpaired t test, p = 0.0028) (table 1). in elisa analyses, the mean timp1 levels in plasma samples from cancer patients and controls were 120 ng / ml and 97 ng / ml, which were not significantly different (unpaired t test, p = 0.06). a key advantage of mrm - based methods is the capacity for multiplexed analyses, which can increase analysis throughput and minimize sample consumption. we performed a multiplexed ip - mrm analysis of the remaining proteins (eng, msln, thbs2, mmp9 and comp), which were spiked into a mock plasma matrix consisting of 60 mg / ml bsa in pbs to produce concentrations ranging from 640 to 10 ng / ml. antibodies for the five proteins (one antibody for each protein) were immobilized on the resin, mixed and aliquoted. the mixed antibody resin (1 g / antibody / analyte) was incubated with solutions of bsa matrix containing the spiked target proteins. plots of calculated protein concentration determined by the peak area ratio of the light peptide to heavy peptide (l / h) showed a linear increase in measured protein across the concentration range (figure 1b f) (the theoretical protein concentration versus the ratio l / h is also shown in figure s9b f [si ]). recoveries were determined for each of the five proteins based on the slope of the response curve and ranged from 13.5% (thbs2) to 55% (msln).. this could reflect less efficient capture or digestion for these proteins, or some combination of both effects. lod values were determined by comparing the variance of the blank samples (with no analyte spiked in) to the variance of the lowest level spiked sample (analyte at 10 ng / ml). the lod values were between 2 and 10 ng / ml (table 1). on the basis of triplicate measurements at the lowest spiked concentration (10 ng / ml) for each protein, cv values were all below 20% (table 1). all five proteins were analyzed individually by elisa in plasma samples from 12 cancer patients and from 12 controls (11 cancer plasma samples were analyzed for timp1 and mmp9). the mean concentrations of these five proteins determined by elisa in plasma samples from normal and cancer patients ranged from 3.9 ng / ml (eng) to 208 ng / ml (comp) (figure s10b f [si ]), table 1). for ip - mrm analyses, the mixed antibody resin (1 g antibody / analyte) was used to simultaneously capture all five protein targets. three aliquots of each colon cancer and normal plasma sample were analyzed by ip - mrm. the mean concentrations of these five proteins determined by ip - mrm ranged from 8.3 ng / ml (eng) to 221 ng / ml (comp) (figure s10b f [si ]), table 1). comparison of measured values between normal and cancer plasma samples with either elisa or ip - mrm yielded only two significant differences (p < 0.05, unpaired student t test) for timp1 and thbs2, but only when measured by ip - mrm (table 1). we asked how the ip - mrm and elisa methods compared for measurement of the six biomarker candidate proteins across individual samples. figure 2 shows paired comparisons of measurements with the two analysis methods for each sample. the data indicate that the concordance of measurements depends on both the analyte and the method. analysis of the average measured plasma concentrations for all analytes and all samples indicated that the ip - mrm measurements were higher by 8.6 ng / ml at (p = 0.005, paired t test ; 95% ci : 2.714.5), across all markers and that the two measurements were highly correlated (r = 0.93). comparison of the average difference in plasma concentrations measured by ip - mrm versus elisa for individual candidates indicated that differences were significant (p < 0.05, paired t test) for timp1 (67.1 ng / ml), thbs2 (13.4 ng / ml), msln (11.7 ng / ml) and eng (5.2 ng / ml), but not for comp (6.4 ng / ml), mmp9 (13.5 ng / ml). we also examined correlation of ip - mrm and elisa for the individual analytes (figure 3). correlation coefficients for the two methods were high for mmp9, comp and timp1 and moderate for thbs2 and msln. however there was no apparent correlation between the methods for eng, as elisa measurements all were approximately 5 ng / ml, whereas ip - mrm measurements varied from 5 to 20 ng / ml. quantitation of six biomarker candidate proteins in plasma samples from colon cancer patients and noncancer controls by ip - mrm and elisa. plasma levels of timp1, comp, mmp9, thbs2, msln and eng were measured in controls (circles) and colon cancer patients (squares). results are from the average of triplicate ip - mrm measurements and duplicate elisa measurements. correlation of protein expression levels measured by elisa and ip - mrm in plasma samples. mean concentrations from triplicate analyses of timp1, comp, mmp9, thbs2, msln and eng in plasma samples from 24 subjects (23 for timp1 and mmp9) by elisa and ip - mrm are plotted. the targeted analysis of protein biomarker candidates in plasma or serum requires highly sensitive and specific assays. although elisa provides the gold standard platform for such analyses, the selection of high - quality elisas is limited. configuration of a new elisa is often costly and time - consuming and may fail for lack of high - quality reagents. the rationale for hybrid immuno ms assays was first proposed by anderson and colleagues and has been developed through the peptide capture (siscapa) approach. the key advantages of an immuno ms approach are the ability to systematically configure mrm assays based on proteotypic peptides and the requirement for only one antibody for target capture. protein - capture - based immuno ms analysis has been reported, but has not been as thoroughly explored. a potential advantage of protein capture is that the antibodies might be employed to transition the ip - mrm assay to an elisa platform. with that consideration in mind, we asked how ip - mrm and elisa would compare when the same capture antibodies are used. our results indicate that the two methods offer equivalent performance with a few exceptions. a global comparison of the ip - mrm and elisa measurements in our study indicated a slight systematic bias in favor of higher measurement values for ip - mrm. however, this difference was not predictive for individual analytes, as absolute measurement differences between the methods varied in either direction by approximately 510 ng / ml. measurement variation (cv at lod) for ip - mrm ranged from 2.3 to 19%, which was similar to variation for elisas of the same samples (table 1). ip - mrm and elisa measurements were well - correlated, with coefficients for all of the analytes except eng =.017. poor correlation of ip - mrm and elisa for eng appears to be related to limited range of the elisa measurements, which were near the lod of the assay at the dilution used (figure s10f [si ]). because the same capture antibody was used for both assays, it appears unlikely that differential capture would explain the difference in eng measurement by the two methods. the difference may reflect selective recognition of a subset of eng proteins in plasma samples by the detection antibody, perhaps due to unanticipated modifications. such modifications may not have affected peptide - based quantitation in ip - mrm assays. we used plasma samples from individuals with colon cancers and from noncancer controls in our study, and the biomarker candidate proteins were selected on the basis of existing literature. however, these experiments were designed only to compare the performance of the assay platforms, not to validate biomarker candidates for colon cancer detection. although we can not draw any conclusions about the utility of the biomarker candidates, the data illustrate the importance of reliable, precise assays for biomarker validation studies. we observed a high degree of overlap in measurement distributions for all of the candidates in control and cancer plasma samples. this is expected for most biomarker candidates that, despite being overexpressed in tumors, also may be derived from other tissues. assays capable of validating cancer biomarkers will be expected to precisely measure small concentration differences for proteins present at ng / ml levels or lower. our study affirmed a key advantage of ip - mrm, which is the ability of the assay platform to perform multiplexed protein capture, as reported by nico. this advantage is particularly important when amounts of plasma or serum samples are limited. in our study, all proteins could be captured and quantified from a single aliquot of 50 l plasma, while input quantities for single elisa measurements were between 2 and 66 l. the capture antibody for ip - mrm approach should have a relatively high affinity for the targeted protein. our experiments represent a best case example, because the capture antibodies were of sufficiently high quality to support robust and sensitive elisa kits. we have done other ip - mrm experiments with antibodies found to be unsatisfactory for elisa, and the same antibodies also failed to provide significant protein enrichment for ip - mrm measurements (unpublished observations). ip - mrm might be used to analyze different isoforms or post - translational modifications of proteins if they are bound with similar affinity by the capture antibody. another potentially advantageous feature of ip - mrm is the detection of proteins via multiple peptides. while this offers flexibility in assay development and confirmation of measurements made on single peptides, previous work demonstrates that one peptide usually provides the greatest measurement sensitivity. for this reason, we chose not to explore comparison mrm measurements with multiple peptides and instead focused on analysis of peptides that generated the strongest signals. in addition, higher throughput ip - mrm assays can utilize magnetic beads for antibody capture in a 96-well - plate format. ip - mrm directed at intact proteins provides an effective approach to systematically configure targeted protein measurements. the protein - targeted capture compares favorably to both peptide - targeted ip - mrm and elisa. for novel targets, the choice of methods depends primarily on the availability of antibodies and their performance. protein - based ip - mrm assays offer a faster, less costly approach to targeted protein measurement than elisas and could dramatically expand the scope of targeted protein quantitation in biology and medicine. | quantitative analysis of protein biomarkers in plasma is typically done by elisa, but this method is limited by the availability of high - quality antibodies. an alternative approach is protein immunoprecipitation combined with multiple reaction monitoring mass spectrometry (ip - mrm). we compared ip - mrm to elisa for the analysis of six colon cancer biomarker candidates (metalloproteinase inhibitor 1 (timp1), cartilage oligomeric matrix protein (comp), thrombospondin-2 (thbs2), endoglin (eng), mesothelin (msln) and matrix metalloproteinase-9 (mmp9)) in plasma from colon cancer patients and noncancer controls. proteins were analyzed by multiplex immunoprecipitation from plasma with the elisa capture antibodies, further purified by sds - page, digested and analyzed by stable isotope dilution mrm. ip - mrm provided linear responses (r = 0.9780.995) between 10 and 640 ng / ml for the target proteins spiked into a mock plasma matrix consisting of 60 mg / ml bovine serum albumin. measurement variation (coefficient of variation at the limit of detection) for ip - mrm assays ranged from 2.3 to 19%, which was similar to variation for elisas of the same samples. ip - mrm and elisa measurements for all target proteins except eng were highly correlated (r = 0.670.97). ip - mrm with high - quality capture antibodies thus provides an effective alternative method to elisa for protein quantitation in biological fluids. |
all authors were involved in drafting the article or revising it critically for important intellectual content, and all authors approved the final version for publication. dr. fukui had full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis. acquisition of data : fukui. analysis and interpretation of data : fukui, kaneuji, matsumoto. | highlightsit is important to accurately diagnose the status of idiopathic osteonecrosis of the femoral head and to consider another possible pathogenesis when a patient with idiopathic osteonecrosis of the femoral head has hip pain even without femoral - head collapse.ignored or misdiagnosed concomitant femoroacetabular impingement in a patient with idiopathic osteonecrosis of the femoral head might leads to poor outcomes of surgical treatments such as bipolar hemiarthroplasty or osteotomies.in a patient with idiopathic osteonecrosis of the femoral head, it should be paid attention if concomitant femoroacetabular impingement exists or not. |
tuberculosis is a major public health problem worldwide. although tuberculosis is a treatable disease, there were 8.8 million cases of tuberculosis and 1.45 million deaths from tuberculosis in 2010. with an incidence of 2.3 million cases, india has the highest burden of tuberculosis in the world, and one out of every four cases of tuberculosis worldwide occurred in india in 2010. india is also the third country in the world in terms of number of people infected by hiv, and 9% of patients with tuberculosis who are tested of hiv are hiv - infected [1, 2 ]. hiv and tuberculosis form a deadly synergy. latent tuberculosis is common in developing countries, and the immunodeficiency produced by hiv increases the risk of developing active tuberculosis infection. patients with hiv infection have higher risk of extrapulmonary tuberculosis, tuberculosis relapse, and death than non - hiv - infected patients. treatment of tuberculosis in india has been implemented under the revised national control tuberculosis programme (rntcp). rntcp follows the standard direct observed treatment short - course (dots) strategy recommended by the world health organization (who) in 2003. although the dots strategy has achieved impressive results in india, dots was endorsed by who based on observational studies performed in non - hiv - infected patients. despite the high burden of hiv - related tuberculosis and the high mortality of tuberculosis in hivinfected patients, data about the effectiveness of dots programmes in hiv - infected people the aim of this study was to evaluate the natural history of hiv - infected patients who were treated of tuberculosis under dots in a large hiv cohort from india. rural development trust (rdt) is a nongovernmental organization that has three hospitals in anantapur. in these hospitals, medical care of hiv - infected people is provided free of cost, including medicines and consultation or admission charges. the vicente ferrer hiv cohort study (vfhcs) is an open cohort study of all hiv - infected patients visited in rdt hospitals. since september 2009 all antituberculosis treatment (att) episodes of patients from the vfhcs database from september 1st 2009, to september 1st 2011, were included in the analysis. all hiv - infected patients with suspicion of tuberculosis infection were admitted to the hospital for performing acid fast bacilli (afb) staining of sputum, chest radiograph, and, if clinically relevant, analysis of cerebrospinal fluid, pleural fluid, or ascitic fluid. cryptococcus antigen was performed in all cerebrospinal fluid specimens to rule out cryptococcal meningitis. in smear - negative patients referring important weight loss but no other clinical sign of tuberculosis infection, an abdominal ultrasound was performed for investigating signs of abdominal tuberculosis [12, 13 ]. following who recommendations for the definition of tuberculosis case, diagnosis of tuberculosis was based on the clinical judgment of the treating physician or a combination of the clinical judgment plus the presence of acid fast bacilli (afb) and/or caseating or necrotizing granuloma in clinical specimens, in addition to a clinical response to att. disseminated tuberculosis was defined when there were signs of tuberculosis infection in two different sites. initially, patients were initiated on att in the hospital, and, once they were stabilized, patients were referred to take att under rntcp, which provides antituberculosis drugs free of cost through a decentralized network of primary healthcare facilities. the rntcp follows the standard who dots strategy, which provides antituberculosis drugs three times a week during six months (category i) for patients who initiate att for the first time and during 8 months (category ii) for patients who had previous att for at least one month or patients who experienced category i failures. drugs were not given in fixed drug combinations as each drug was provided in a single formulation. for category i treatment, rifampicin, isoniazid, pyrazinamide, and ethambutol were given for two months, followed by rifampicin and isoniazid for four months. for category ii treatment, patients received streptomycin, rifampicin, isoniazid, pyrazinamide, and ethambutol for two months, rifampicin, isoniazid, pyrazinamide, and ethambutol for one month, and, finally, rifampicin, isoniazid and ethambutol for five months. scheduled caste community is the lowest caste in the traditional hindu caste hierarchy and, therefore, suffers social and economic exclusion and disadvantage. scheduled tribe community is generally geographically isolated with limited economic and social contact with the rest of the population. scheduled castes and scheduled tribes are considered a socially disadvantaged communities and are supported by positive discrimination schemes operated by the government of india. backward castes form a collection of intermediate castes that were considered low in the traditional caste hierarchy, but above scheduled castes. we used kaplan - meier survival curves and the log - rank test for comparing factors associated with mortality. time was measured from the date of the att initiation to death or the last visit date. multivariable analysis was performed with cox regression proportional hazard models. because cd4 + lymphocyte count was not available for 32 cases, missing values were imputed using the stratified hot deck imputation implemented for stata by martin schonlau (hotdeckvar command). the proportional hazard assumption was assessed performing log - log survival curves and statistical tests based on schoenfeld residuals. the goodness of fit of the models was assessed using the harrell 's c concordance statistic. because the proportional hazard assumption was violated with the initial global model, which included survival estimates from the initiation of att to the death or last visit date, we decided to build two different cox regression models, one for studying factors associated with death during the first three months after initiating att (early mortality) and another one for studying factors associated with death after completing three months of att (delayed mortality). two - way interactions for both early and delayed mortality models were checked. in both models, we found that gender had interactions with other variables, so finally we performed global and stratified by gender models of early and delayed mortality. during the study period, we identified 1000 att episodes. characteristics and median cd4 + lymphocyte count of patients at the moment of initiating att are presented in table 1. the median age was 35 years (interquartile range (iqr), 3041), and the median cd4 + lymphocyte count was 116 cells / mm (iqr, 61190). almost two thirds of the patients were male, more than a half were illiterate, 4.6% were homeless, and 31.2% belonged to a socially disadvantaged communities. one fourth of patients were smear positive, one fifth received category ii att, and 38% had started art before the initiation of att. of 590 patients who were alive after six months of att, 91 (15.4%) had not initiated art. the most common form of tuberculosis infection was pulmonary tuberculosis followed by meningitis, pleuritis, abdominal tuberculosis, lymphadenitis, and disseminated tuberculosis. the study involved 840 person - years with a mean followup of 10.1 months and 388 deaths. the cumulative incidence of mortality was 15.7% (95% confidence interval (ci), 13.518.1) at 1 month, 25.6% (95% ci, 22.928.5) at 3 months, 31.2% (95% ci, 28.334.3) at 6 months, 39.4% (95% ci, 36.242.7) at 12 months, and 46.3% (95% ci, 42.550.1) at 24 months. the kaplan - meier survival curve with number at risk is presented in figure 1. also in figure 1 patients with meningitis and disseminated tuberculosis had higher incidence of mortality during the first three months of att. the incidence of mortality was reduced after three months of att except in patients with smear - positive pulmonary tuberculosis, where the cumulative incidence of mortality remained more or less constant until approximately 14 months after the initiation of att. kaplan - meier survival curves with log - rank test for other covariates are presented in figure 2. intuitively, differences among the covariates age, being homeless, and cd4 + lymphocyte count were visible since the initiation of att, whereas differences among the covariates gender, literacy, community, and having afb positive sputum were more visible after three months of att. although there was not an important difference in the final survival, patients who were on art at the moment of initiating att had slightly higher mortality during the first three months of att and slightly lower mortality thereafter. multivariable analysis of factors associated with death during the first three months of att is presented in table 2. in descending order by hazard ratio, factors associated with increased risk of early mortality were being homeless, having low cd4 + lymphocyte count, having tuberculous meningitis, belonging to a socially disadvantaged caste, having more than 35 years, and being on art at the moment of initiating att. the main difference between men and women was that, in women, belonging to a disadvantaged caste was not a so strong factor for early mortality as in men. multivariable analysis of factors associated with death after three months of att is presented in table 3. in descending order by hazard ratio, factors associated with increased risk of delayed mortality were having low cd4 + lymphocyte count, belonging to a socially disadvantaged caste, receiving category ii att because of a previous episode of att, and having afb positive sputum. the main difference between men and women was that, in women, belonging to a disadvantaged caste was a less important factor for delayed mortality than being illiterate. although not statistically significant, being on art at the initiation of att was a protective factor for delayed mortality. this study describes the high mortality of hiv - infected patients who received att under dots strategy in this district of india. in pune, india, a 51% mortality after 30 months of followup in 121 hiv - infected patients who received att under rntcp was observed. these mortality rates are higher than the ones described in the observational studies from sub - saharan africa and other developing countries [2225 ] indicating that there is an urgent need to improve the treatment of tuberculosis for hiv - infected patients in india. although we did not collect information about adherence to att, previous studies in india have shown that a high number of patients under directly observed rntcp regimens are poor or nonadherent to treatment [26, 27 ]. besides interventions to support the completion and the adherence of att, there is a need to improve current guidelines for treating tuberculosis in hiv - infected patients according to recent evidence. current who guidelines strongly recommend daily att regimen for hiv - infected patients, especially during the intensive phase, because daily att regimens have higher cure rates and lower risk of relapse and treatment failure compared to intermittent att regimens. in a randomized trial performed with hiv - infected patients from india with a followup duration of 36 months, patients treated with intermittent category i treatment had 36% mortality, 15% bacteriological recurrence, and all patients who experienced treatment failure developed acquired rifampicin resistance. this mortality is lower than the mortality found in our study, but moribund patients were excluded from the study, whereas we included all patients admitted to the hospital. in this randomized trial, extending intermittent treatment for three extra months did not improve mortality nor acquired rifampicin resistance but reduced by half the number of bacteriological recurrences. also recommended by who, the use of fixed dose combinations could improve the adherence to att. new interventions for achieving early diagnosis of tuberculosis and hiv can have a dramatic impact in reducing the mortality of hiv - related tuberculosis. in india, still 4050% of hiv - infected patients are diagnosed of hiv when their cd4 + lymphocyte count is below 200 cells / mm, and, in many cases, tuberculosis is the first manifestation of hiv infection [30, 31 ]. in our study, the cd4 + lymphocyte count was less than 200 cells / mm in 77% of the cases. if patients could be diagnosed of hiv with higher cd4 + lymphocyte count, art could be started before the appearance of tuberculosis, averting the transmission of tuberculosis to others as well. in accordance with previous studies, the socioeconomic characteristics of the patients were important factors related to early and delayed mortality. in our study, homeless patients and people from disadvantaged communities had higher risk of death, especially men. as seen before in india, receiving category ii att because of previous treatment of tuberculosis was associated with delayed mortality. interestingly, the type of tuberculosis infection was an important factor for early mortality but not for delayed mortality, whereas having afb positive sputum was an important factor for delayed mortality but not for early mortality. among all types of tuberculosis, tuberculous meningitis had the highest incidence of death during the first three months of att and was an independent factor related to early mortality after adjusting by other variables. being on art at the moment of initiating att was associated with increased early mortality. it is probable that the immunity recovery after the initiation of art provokes an increased inflammatory response against the high mycobacterial organism load present in hiv - infected patients, unmasking the tuberculosis infection and increasing the risk of death due to the strong inflammatory reaction. in haiti, patients diagnosed of tuberculosis during the first three months of art were 3.25 times more likely to die than other hiv - infected patients with tuberculosis. according to these findings, patients who are going to initiate art should undergo a complete evaluation to rule out tuberculosis before the initiation of art. diagnosis of tuberculosis was performed according to the definition of tuberculosis case suggested by who, but it was not confirmed by culture of mycobacteria. however, in most resource - limited settings, mycobacterial culture is not available, so including only those patients with a positive culture for mycobacterium tuberculosis would not reflect the common clinical practice in the management of tuberculosis in developing countries. we did not perform drug sensitivity testing so it is possible that the presence of resistant tuberculosis could explain some of the deaths observed in the study. however, the proportion of patients having rifampicin resistance is only 2.2% in our area, so the possibility of a bias because of high prevalence of multidrug - resistant tuberculosis in unlikely. in addition, we did not have information about the adherence of patients to att or the proportion of patients who defaulted from treatment or were lost to followup, which are very important factors for the success of dots. the results of this study show the high mortality of hiv - infected patients treated of tuberculosis under dots in this area of india, confirming what was observed in previous studies from other parts of india. these patients are diagnosed of tuberculosis with low a cd4 + lymphocyte count and a high proportion of them present with extrapulmonary tuberculosis. when investigating factors associated with mortality, it is useful to differentiate between factors associated with early mortality and factors associated with delayed mortality. we found that tuberculous meningitis and being on art when initiating att are associated with early mortality. factors related to poor socioeconomical status such as being homeless or belonging to a disadvantaged community are also associated with an increased risk of death. patients who received att previously and patients having afb positive sputum have higher risk of delayed mortality. these findings indicate that there is an urgent need to improve the treatment of tuberculosis in hiv - infected patients in india. | despite the impressive global results of dots in india, the effectiveness of dots for the treatment of tuberculosis in hiv - infected patients is not well known. this is an observational prospective cohort study performed in anantapur district, andhra pradesh, india. the study included 1000 dots antituberculosis treatment (att) episodes and 840 person - years. cd4 lymphocyte count was below 200 cells / mm3 in 77% of the cases, and 21% were retreatments. two thirds were presented with extrapulmonary tuberculosis, and the most common form of extrapulmonary tuberculosis was tuberculous meningitis followed by pleuritis, abdominal tuberculosis, and lymphadenitis. cumulative incidence of mortality was 16%, 26%, 39%, and 46% at 1, 3, 12, and 24 months, respectively. factors associated with three - month (early) mortality were being homeless, having low cd4 + lymphocyte count, having tuberculous meningitis, belonging to a socially disadvantaged community, having more than 35 years, and being on an antiretroviral therapy at the moment of initiating the att. factors associated with delayed mortality were having low cd4 + lymphocyte count, belonging to a socially disadvantaged community, receiving a category ii att because of a previous episode of att and having acid fast bacilli in sputum before the att initiation. these findings indicate that there is an urgent need to improve the treatment of tuberculosis in hiv - infected patients in india. |
acupressure and massage therapy are effective non - pharmacologic therapies and can be effective in reducing menstrual pain. the body 's vital energy, called chi in chinese medicine, moves in the body pathways known as meridians. the increase or decrease of energy in each meridian can affect the health of specific organs. there are many points in meridians that are used to apply acupressure in traditional chinese medicine. acupressure relieves symptoms of dysmenorrhea, such as pain, depression, anxiety, and stress. but in another study, no significant relationship was found between painful menstruation and anxiety. one of the energy - consuming organs of the liver meridian is genitalia, and acupressure on the liv3 can treat dysmenorrhea. although no study has been conducted about any change in anxiety occurring after acupressure on liv3 point, anxiety is associated with pain and pain relief may lead to an anxiety reduction. some studies have reported that acupressure can reduce dysmenorrhea and the anxiety caused by dysmenorrhea. but there are studies reporting that anxiety did not decrease on applying acupressure by the research unit or the researcher. considering that each meridian can affect the health of specific organs, the insufficient data about the effectiveness of acupressure at liv3 on dysmenorrhea, the lack of reports about its effectiveness on anxiety caused by dysmenorrhea, contradictory reports about the relationship between acupressure and anxiety caused by dysmenorrhea, the importance of applying acupressure by the research unit, and the simplicity and accessibility of acupressure, this study intends to determine the effect of acupressure at the liv3 point on anxiety level in patients with primary dysmenorrhea. it has been approved by the ethics committee of kashan university of medical sciences (kaums) with the number /29/5/1/3613 and registered in iranian registry of clinical trials (irct) with the number irct201201308869n1. acupressure was performed on the treatment and placebo points. in the control group (group a), acupressure was given in placebo point that was located 2 cun above the distance between the third and fourth fingers (this point is not located on the path of meridians [figure 1 ]. in treatment group (group b), acupressure was given on the liv3 point located 2 cun (width of three fingers) above the distance between the first and second metatarsal bones. the study was performed at dormitory of kaums between march and june 2012 for three menstrual cycles. inclusion criteria were self - reported, including living at dormitory ; being single ; having regular menstrual periods ; pain starting with menstrual bleeding onset ; duration of bleeding between 3 and 8 days and menstrual interval between 21 and 35 days ; dysmenorrhea with pain intensity equal to or higher than 4 based on visual analog scale (vas) for pain intensity ; lack of anemia, high blood pressure, or known systemic or genital disease, and severe psychological stress in the past 6 months (students were asked whether or not they have had severe emotional stress such as the death of relatives, surgeries, marriage, or divorce of parents in the past 6 months). exclusion criteria were self - reported, including use of heat for pain relief ; use of oral contraceptives, non - steroidal anti - inflammatory drugs, analgesics, or prostaglandin synthesis inhibitors from 4 h before to 4 h after acupressure ; and not cooperating until the end of the third period of the menstrual cycle. sample size was estimated as 27 students per group based on a pilot study. considering 80% power and 95% confidence level, inclusion and exclusion criteria, and the possible loss of samples, public invitation was extended to 500 dormitory living students. liv3 and placebo points block randomization was done with 1:1 allocation ratio based on pain intensity. at first, the researcher learned the technique of acupressure from a traditional chinese medicine professor and applied it on the subjects. she was in constant contact with the students face to face, by telephone, or via post. also, spielberg (stai) anxiety questionnaire was completed by the students before and after intervention. on the first day of the first cycle, pain intensity was measured without intervention at the start of bleeding and after 0.5, 1, 2, 3, and 4 h. dysmenorrhea was assessed according to vas for pain intensity. subjects with pain score equal to or greater than 4 were selected. at this time students were taught to find the exact location of acupoints and to apply acupressure technique. at first, acupressure was applied by the researcher in a clockwise rotation. pressure was continued until the students reported de chi (feeling the symptoms of heat, cold, or tingling). students were asked to apply the same pressure and pay attention to their nail color change. in the second and third cycles, students applied pressure by themselves at the bleeding onset. it was stopped with feeling de chi ; otherwise, it was continued for 2 min and resumed on the other foot after a 2 min rest. pressure was applied twice on each leg and a total of four times (16 min) in clockwise rotation. pain was measured at the start of bleeding and after 0.5, 1, 2, 3, and 4 h. after the third menstrual cycle, anxiety questionnaire was completed by the participants for the second time. students were informed that they might be placed in control or intervention groups and they could discontinue cooperating in the study at any time they wanted. we used a digital glass scale (gs46) with 100 g accuracy that was made in germany for measuring the weight and a single non - elastic tape for measuring the height. pressure exerted by the fingers of the researcher and the student was determined by a force gauge device. vas pain scale is a ruler used by the research units to rate their pain. distance between the beginning of the ruler to the marked point will be the numerical pain score of the unit. spielberg anxiety questionnaire has 40 questions in two areas ; each area has 20 questions. each question has four options and a rating between 1 and 4. in apparent anxiety, a score of 4 indicates too high, 3 means high, 2 indicates low, and 1 means very low. in hidden anxiety, a score of 4 means almost always, 3 means often, 2 indicates almost never, and 1 means never. anxiety score from 40 up to 80 is considered as low, 81 - 120 as moderate, and 121 - 160 as high. additionally the internal consistency reliability of the measure has been supported in this study achieving an alpha value of.85. in this questionnaire, some phrases indicate absence of distress and are weighted inversely, including 1, 2, 5, 8, 10, 11, 15, 16, 19, 20 for apparent anxiety and 21, 23, 26, 27, 30, 33, 34, 36 39 for hidden anxiety. confounding variables were matched between groups, including painful menstrual history in first - degree relatives, age at menarche, interval between menarche and onset of dysmenorrhea, menstrual duration, and body mass index (bmi). results were reported as mean [standard deviation (sd) ] or frequency (%) for qualitative variables and mean (min.- max.) for quantitative variables. to check the consistency of underlying variables, t - test or chi - square test was used according to the nature of variables. mann - whitney was used to compare the pain intensity between groups in the first cycle. to compare the anxiety scores between groups in the first cycle, t - test was used. to compare the anxiety scores before and after intervention, paired sample t - test was used. also, in the third cycle, univariate analysis of variance with adjustment of the baseline values in the first cycle was used to compare the anxiety scores between groups., the researcher learned the technique of acupressure from a traditional chinese medicine professor and applied it on the subjects. she was in constant contact with the students face to face, by telephone, or via post. also, spielberg (stai) anxiety questionnaire was completed by the students before and after intervention. on the first day of the first cycle, pain intensity was measured without intervention at the start of bleeding and after 0.5, 1, 2, 3, and 4 h. dysmenorrhea was assessed according to vas for pain intensity. subjects with pain score equal to or greater than 4 were selected. at this time, 67 remaining students were randomly divided into two groups. students were taught to find the exact location of acupoints and to apply acupressure technique. at first, acupressure was applied by the researcher in a clockwise rotation. pressure was continued until the students reported de chi (feeling the symptoms of heat, cold, or tingling). students were asked to apply the same pressure and pay attention to their nail color change. in the second and third cycles, students applied pressure by themselves at the bleeding onset. it was stopped with feeling de chi ; otherwise, it was continued for 2 min and resumed on the other foot after a 2 min rest. pressure was applied twice on each leg and a total of four times (16 min) in clockwise rotation. pain was measured at the start of bleeding and after 0.5, 1, 2, 3, and 4 h. after the third menstrual cycle, anxiety questionnaire was completed by the participants for the second time. students were informed that they might be placed in control or intervention groups and they could discontinue cooperating in the study at any time they wanted. we used a digital glass scale (gs46) with 100 g accuracy that was made in germany for measuring the weight and a single non - elastic tape for measuring the height. pressure exerted by the fingers of the researcher and the student was determined by a force gauge device. vas pain scale is a ruler used by the research units to rate their pain. distance between the beginning of the ruler to the marked point will be the numerical pain score of the unit. spielberg anxiety questionnaire has 40 questions in two areas ; each area has 20 questions. each question has four options and a rating between 1 and 4. in apparent anxiety, a score of 4 indicates too high, 3 means high, 2 indicates low, and 1 means very low. in hidden anxiety, a score of 4 means almost always, 3 means often, 2 indicates almost never, and 1 means never. anxiety score from 40 up to 80 is considered as low, 81 - 120 as moderate, and 121 - 160 as high. reliability and validity of this questionnaire additionally the internal consistency reliability of the measure has been supported in this study achieving an alpha value of.85. in this questionnaire, some phrases indicate absence of distress and are weighted inversely, including 1, 2, 5, 8, 10, 11, 15, 16, 19, 20 for apparent anxiety and 21, 23, 26, 27, 30, 33, 34, 36 39 for hidden anxiety. confounding variables were matched between groups, including painful menstrual history in first - degree relatives, age at menarche, interval between menarche and onset of dysmenorrhea, menstrual duration, and body mass index (bmi). results were reported as mean [standard deviation (sd) ] or frequency (%) for qualitative variables and mean (min.- max.) for quantitative variables. to check the consistency of underlying variables, t - test or chi - square test was used according to the nature of variables. mann - whitney was used to compare the pain intensity between groups in the first cycle. to compare the anxiety scores between groups in the first cycle, t - test was used. to compare the anxiety scores before and after intervention, also, in the third cycle, univariate analysis of variance with adjustment of the baseline values in the first cycle was used to compare the anxiety scores between groups. in the liv3 group, 33 students and in the control group, 34 students were enrolled and included in the study. of these, 11 students in the liv3 group and 20 students in the control group were kept for analysis because of the possibility of losing the samples. the mean (sd) for age, bmi, menarche, bleeding duration, menstrual intervals, family history of dysmenorrhea, pain intensity, use of painkillers, heat, and massage did not have a significant difference between groups. also, anxiety level in the first cycle had no difference between groups. mean (sd) values for apparent anxiety in the control and liv3 groups are shown in table 1. this table indicates that acupressure on liv3 point caused decrease in apparent anxiety (p < 0.05). moreover, there was no significant difference for hidden anxiety in any of the groups. univariate analysis of variance did not show a significant difference for apparent (p = 0.337) and hidden anxiety (p = 0.438) between groups, when adjustment for baseline values in the first cycle was done. this study was done to determine the effect of acupressure at liv3 and placebo points on the anxiety level in patients with primary dysmenorrhea. in this study, this is the first report of the relationship between anxiety reduction and acupressure on liv3 acupoint. we did not find any study that evaluated the effect of acupressure at liv3 on anxiety. there are also some reports of reduction in dysmenorrhea on applying acupressure on sp6 acupoint. since pain is associated with anxiety, pain relief can decrease anxiety, and this issue can confirm our result. chen. (2004) studied the effect of acupressure at sp6 point on the level of anxiety. they showed a decrease in anxiety after acupressure ; but they used vas anxiety and studied persons with a pain score of 5 or more according to vas pain intensity, whereas we assessed anxiety with spielberg questionnaire and studied students with a pain score of 4 or more according to vas pain intensity. 's study is that the pressure was applied by the research units. in their study, acupressure on sp6 was firstly done by a researcher, which caused decrease in dysmenorrhea and anxiety. but when acupressure was done by the research units, it just caused decrease in dysmenorrhea and not anxiety. lee. (2003) reported that acupressure on the sp6 point can reduce anxiety during labor without having adverse effects on the mother and baby. also, in the study of charandabi (2011), reduction of menstrual symptoms severity scores after treatment was significantly more in the intervention group (acupressure on sp6 acupoint) as compared with the control group. (2012) did not show any decrease in anxiety on applying acupressure on the sp6 point. it may be due to applying pressure on more than one acupoint resulting in decrease in duration of pressure on each point.. showed decrease in hidden anxiety on applying pressure on p6 point. in this study, acupressure on the placebo point was not effective on the anxiety level. although some studies reported the effectiveness of acupressure on the placebo point, this effect was more in the intervention group. chen. 's (2004) study confirms our study. in their study, the intervention group received 20 min of pressure on sp6 point and the control group had 20 min break ; reduction of anxiety was not seen in the control group. but the control group in our study received the same acupressure in the placebo point. another important point to be noted in our study is that the researcher was not present when the pressure was applied, whereas the presence of a researcher along with the patient can reduce the anxiety level. this is the first report that has shown reduction of anxiety associated with dysmenorrhea after applying acupressure on the liv3 acupoint. also, successful self - treatment by the participants indicates that this approach can help women to reduce their anxiety without seeking any help from someone else. | background : primary dysmenorrhea may lead to severe anxiety and pain relief during menstruation may reduce the anxiety levels. this study was aimed to determine the effect of acupressure at third liver and placebo points on the anxiety level in patients with primary dysmenorrhea.materials and methods : this clinical trial was conducted in parallel in the control and treatment groups for three menstrual periods at the dormitory of kashan university of medical sciences between march and june 2012. students with pain score equal to or greater than 4 were selected and divided into groups based on severity of pain using a randomized block design with the allocation ratio of 1:1. acupressure was applied in two acupoints including third liver point (liv3) and placebo points. spielberg (stai) anxiety questionnaire was completed before and after intervention. randomization, subjects, and data analyzer were blinded to the analysis. chi - square tests, t - test, mann - whitney, paired sample t - test, and univariate analysis of variance were used for statistical analysis. p values < 0.05 were considered statistically significant.results:mean [standard deviation (sd) ] values of apparent anxiety levels before and after intervention for liv3 were 45.100 (9.769) and 38.100 (10.608), respectively. for the control group, they were 41.200 (9.795) and 38.900(10.140), respectively. difference was significant only in the intervention group (p < 0.001). hidden anxiety did not show a significant change before and after intervention. there was no difference between groups in apparent or hidden anxiety after intervention.conclusions:pressure on liv3 point reduces anxiety. as there are no previous studies on this topic, further studies with more samples are recommended. |
abdominal adipose tissue is composed of subcutaneous and visceral adipose tissue. visceral adipose tissue can be subdivided into omental, mesenteric, and retro- or extra - peritoneal depots. obesity is a known risk factor for various diseases, and measurements of adipose tissue are commonly used in obesity research. the amount and location of fat deposited are also indicators of optimal body composition for production traits. methods of measuring abdominal fat tissue are diverse and include (in order of accuracy and reproducibility) computed tomography (ct), magnetic resonance imaging (mri), dual energy x - ray absorptiometry (dexa), dual photon absorptiometry, ultrasonography, anthropometry and eye examination. in humans, accumulation of visceral adipose tissue poses a greater risk for developing obesity - related disorders, metabolic syndrome, hypertension, cardiovascular disease and increased frequency of total mortality than subcutaneous adipose tissue. therefore, studies of ct examinations in humans have focused on identifying an optimal technique for the accurate assessment of abdominal fat. based on the volumetric quantification of subcutaneous and visceral abdominal fat, multi - slice ct is highly reproducible. however, in veterinary medicine, there are a few reports available regarding the use of ct to quantify obesity. ishioka. investigated the use of ct in beagles for evaluation of canine obesity, while lambe. reported the use of cross - sectional ct images to estimate total internal fat in scottish blackface lambs, and mcevoy. evaluated the range of the hounsfield units (hu) as they relate to fat changes in growing pigs. this study was conducted to determine the distribution of abdominal fat using ct images based on the ct number and to measure the volume of the abdominal visceral and subcutaneous adipose tissue in minipigs. the procedures employed in this study were conducted according to guidelines of the institute of laboratory animal resources at the seoul national university. six 6-month - old male minipigs (pwg micro - pig ; medi kinetics korea, korea) weighing 23~25 kg were used for the experiments. all minipigs were clinically healthy based on physical examination and the results of hematological analysis. ct was conducted using a helical ct scanner with a single - detector ct (ge medical system, usa) beginning at the upper edge of the liver and continuing caudally to the l5 level. image acquisition parameters included a matrix of 512 512, a large - scan field of view, a 3 mm slice thickness, 120 kvp, 60 ma, and a pitch of 1.3. for the anthropometric method, we measured sagittal abdominal diameter (sad) and waist circumference (wc) in normal healthy minipigs and compared the ct - based fat volumes to anthropometric data following the ct examination. ct number ranges of visceral and subcutaneous abdominal adipose tissue were obtained by manually drawing the region of interests (rois) corresponding to each of the images obtained at the t11, t13, l1, l3, l5 levels by three radiologists. in this procedure, we defined the attenuation range of fat tissue as the mean hu values 2sd. by adjusting the fat ranges, we easily obtained the volume of total abdominal fat using the built - in software for the helical ct scanner (fig. we then compared the overall abdominal fat volume with the fat volumes calculated at the t11, t13, l3, and l5 levels by defining them as landmarks to measure the total abdominal fat distribution and to verify the critical level. to assess the volume of visceral adipose tissue, rois after measuring the volume of total and visceral adipose tissue, the volume of subcutaneous adipose tissue could be obtained by subtracting the visceral adipose tissue from the total abdominal adipose tissue. this method was applied at the t11, t13, l3 and l5 levels. the visceral / subcutaneous fat volume ratio (v / s ratio) was also calculated. to check the reliability and validity of the measurements, three radiologists analyzed all of the data separately and the intra - class and spearman rank correlations were assessed. the mean hu values of visceral fat at the t11, t13, l1, l3 and l5 levels (mean sd) were -112.77 11.61, -113.40 11.59, -118.57 6.10, -119.41 6.90, and -115.27 8.61, respectively (fig. 2). the mean hu of subcutaneous fat at the t11, t13, l1, l3 and l5 levels were -110.98 9.51, -112.67 8.88, -112.26 8.63, -111.77 8.56 and -108.80 5.77, respectively (fig. the hu value of visceral fat was significantly lower than that of subcutaneous fat at the l1 (p < 0.01), l3 (p < 0.01) and l5 (p < 0.05) levels. there was high agreement for the hu value among the three radiologists (intra - class coefficient = 0.9). the overall hu ranges (mean 2sd) of each visceral and subcutaneous fat were -147.47 to -83.46 and -131.62 to -90.97. although the six minipigs had a similar body weight, sad and wc, the total fat volumes of the entire abdomen were different, with the highest value of 3,051 ml being measured in minipig no. 1 and the lowest value of 492 ml being observed in minipig no. 6 (table 1). the visceral and subcutaneous fat volumes ranged from 131.49 ml to 1,127.32 ml and 360.17 ml to 1,923.71 ml, respectively. the v / s ratio ranged from 0.32 to 0.59. with regard to the correlations between adipose tissue volume for the entire abdomen, the adipose tissue volume at the t11, t13, l3 and l5 levels and the body weight and anthropometric measurements (table 2), we found that there was a poor correlation between the anthropometric method and ct based abdominal fat volume. the total abdominal fat volume correlated well with the fat volume at the t11, t13 and t3 levels for total abdominal fat, especially at the t13 level (r = 0.997, p < 0.0001). there are many techniques for the measurement of visceral adipose tissue, including cadaver analysis, ct, mri, ultrasound, dexa, anthropometry and eye examination of the subjects. body condition score based on subjective estimation is widely used to evaluate the nutritional condition of dogs and cats as obesity has become an increasing problem in pet animals. this method is known to be very simple and easy for evaluation of the fatty condition based on the eye examination, but the accuracy is low. in the present study, anthropometric measurements such as sad and wc were found to be poorly correlated with ct - based volume measurements for abdominal adipose tissue. accordingly, a more accurate method such as ct or other advanced techniques is needed in the veterinary fields. this study demonstrated the excellent intra - observer reproducibility of ct - based hu range determination of subcutaneous and visceral abdominal fat tissue. collectively, ct is known to be an accurate and reproducible technique for determination of body composition. evaluation of the hu value distribution for visceral and subcutaneous fat revealed that the overall hu ranges including visceral and subcutaneous fat were -147.47 to -83.46. the ct ranges in humans, beagle dogs, and growing pigs have been shown to be -190 to -30, -135 to -105, and -90 to -101, respectively. in the present study, we only examined minipigs that were six months of age. according to a study conducted by mcevoy. therefore, further study is required to investigate the relatioship between fat distribution and factors such as age, gender, and obesity. in this experiment, the mean hu of the visceral fat is lower than that of the subcutaneous fat on the lumbar levels. it is possible that subcutaneous fat contains a lot of adjacent fascia and connetive tissue when compared to visceral fat so that the subcutaneous fat hu is higher than the visceral fat. the other explanation is based on the location, which includes the air- or stool - filled colon and artifacts such as intestinal motility. these stuctural limitations have a potential to lead to overestimation of the hu value range and the volume of visceral fat. the ct number inaccuracy could also cause the observed data due to various reasons such as beam hardening and misregistration. in this study, we found that measurement of the fat volume at the t13 level was the best alternative to scanning the entire abdomen when evaluating total abdominal adipose tissue in minipigs. this result makes it possible to decrease the ct scan time and reduce the amount of radiation exposure. in humans, viseral obesity is more closely related to metablic disorders, hypertension, cardiovascular disease, and an increased frequency of total mortality than is subcutaneous obseity. the most widely used method used to diagnose visceral obesity in humans is the v / s ratio. patients with a v / s ratio of more than 0.4 are designated as having visceral fat obseity. the v / s ratio was 0.41 0.10 in this study ; however, further study using large numbers of normal and obsese minipigs is required to establish their values. ct is a reliable and convenient method for the measurement of abdominal fat, and has the advantage of distinguishing visceral and subcutaneous adipose tissue. therefore, ct examination is a beneficial method for determination of the volume of visceral and subcutaneous adipose tissue. these measurements can be of interest themselves or in the management of obesity related disease. we anticipate that measurement of body composition by ct may also be useful in the veterinary field for other purposes, such as meat evaluation and health prognosis. importantly, this study demonstrated that the volume of abdominal adipose tissue at the t13 level is a strong and reliable predictor of total abdominal adipose volume. | computed tomography (ct) exams were conducted to determine the distribution of abdominal fat identified based on the ct number measured in hounsfield units (hu) and to measure the volume of the abdominal visceral and subcutaneous fat in minipigs. the relationship between the ct - based fat volumes of several vertebral levels and the entire abdomen and anthropometric data including the sagittal abdominal diameter and waist circumference were evaluated. moreover, the total fat volumes at the t11, t13, l3, and l5 levels were compared with the total fat volume of the entire abdomen to define the landmark of abdominal fat distribution. using a single - detector ct, six 6-month - old male minipigs were scanned under general anesthesia. three radiologists then assessed the hu value of visceral and subcutaneous abdominal fat by drawing the region of interest manually at the t11, t13, l1, l3, and l5 levels. the ct number and abdominal fat determined in this way by the three radiologists was found to be correlated (intra - class coefficient = 0.9). the overall hu ranges for the visceral and subcutaneous fat depots were -147.47 to -83.46 and -131.62 to -90.97, respectively. the total fat volume of the entire abdomen was highly correlated with the volume of abdominal fat at the t13 level (r = 0.97, p < 0.0001). these findings demonstrate that the volume of abdominal adipose tissue measured at the t13 level using ct is a strong and reliable predictor of total abdominal adipose volume. |
multiple sclerosis (ms) is an inflammatory disorder of the central nervous system (cns) which causes progressive neurological disability over time. affecting more than two million people worldwide, ms is recognized as the leading cause of nontraumatic neurological disability in young adults. for many patients, clinical manifestations involve the motor, sensory, visual, and autonomic systems, but less - localizing symptoms and signs are also common, with fatigue being foremost among them. the diagnosis of relapsing remitting ms (rrms) can often be established on clinical grounds for patients who experience two or more neurological events consistent with multifocal cns inflammation. in the case of primary progressive ms (ppms), neurological decline progressing for over a year with supporting paraclinical evidence of cns inflammation is considered proof of the diagnosis [47 ]. since the publication of the original mcdonald criteria and subsequent iterations [57 ], radiological endpoints have been used to confirm the diagnosis of ms, in the absence of recurrent clinical events. the majority (85%) of ms patients initially present with episodes of neurological dysfunction in the relapsing - remitting phase (rrms) [1, 39 ], before transitioning to a secondary progressive course (spms) of the disease [1, 810 ]. during this time, they accumulate neurological disability with or without relapses. approximately 15% of patients experience a primary progressive course from onset, either without preceding relapses (ppms) or with superimposed neurological events in what is known as progressive relapsing ms [810 ]. while the acronyms rrms, spms, and ppms are embedded in the lexicon of neurologists, these labels are merely descriptors and tell us nothing about underlying differences in pathobiology that distinguish ms phenotypes. at best, they represent our clinical perceptions of different ages and stages of the disease. natural history data has shown that the progressive phase of ms in an age - dependent process [1, 9 ]. in the corticospinal tract, for example, chronic axonal loss, which is believed to represent the pathological substrate for disability progression, begins early in the disease course, before the expression of clinical symptoms [1, 9 ]. similarly, confavreux and vukusic have demonstrated that the time to reach disability milestones and the ages at which these landmarks are reached follow a predefined schedule that is unaffected by relapsing remitting episodes, or indeed, by the initial disease course in ms patients [1, 8 ]. hence, there is evidence to suggest that ms disease progression may be governed by factors independent of inflammatory activity in the cns. currently, the driving force behind progression and the variables that affect transition from the relapsing remitting phase to the treatment - resistant progressive course in ms remain obscure. the context of this uncertainty has important implications because approved ms treatments act predominantly by targeting inflammation within the brain and spinal cord with an implicit assumption that recurrent, chronic inflammatory disease activity exacts a toll on the structural integrity and functional eloquence of the cns over time. the purpose of this review is to discuss current perceptions regarding the pathogenesis of ms and highlight how key hypotheses might be explored using the afferent visual pathway (avp) as a clinical model of the disease. traditionally, the mechanistic underpinnings in ms have been viewed as a deranged immune - mediated response to an environmental exposure in a genetically susceptible host. the pathological signature of the disease is the sclerotic plaque, which is believed to represent the cumulative effects of several processes including inflammation, demyelination, remyelination, oligodendrocyte depletion, astrocytosis, axonal damage, and neuronal loss affecting white and grey matter cns structures [1, 11 ]. there is evidence to suggest that neurodegeneration within these plaques forms the basis for disabling aspects of the disease [1, 11 ]. yet, effector mechanisms that influence the relapsing (presumed inflammatory) and progressive (presumed neurodegenerative) phases of ms are considered to be different [1, 11 ]. not surprisingly, in a condition that has chronic and fulminant forms with a wide - ranging phenotypic expression, a myriad of pathogenic mechanisms and combinations thereof have been proposed including [1, 1113 ] (1) cns inflammation as the main pathogenic event ; (2) neurodegeneration as the primary event with cns inflammation as a secondary response ; (3) coexisting cns inflammation and neurodegeneration ; and (4) cns inflammation triggering an intrinsic neurodegenerative susceptibility in a given host. similarly, numerous factors have been linked to tissue injury in ms including t - cell infiltrates and macrophage influx ; antibody and complement - mediated immune reactions against oligodendrocytes and myelin ; hypoxic damage ; and a genetic defect or polymorphism resulting in primary susceptibility of the oligodendrocytes to immune injury [1, 1113 ]. originally, it was proposed that individuals with ms had only one type of pathological lesion, but it is now accepted that different patterns of tissue pathology can co - exist in the same patient. in fact, the interplay between these proposed mechanisms has been used to explain differences in the extent of demyelination, oligodendrocyte injury, remyelination, and axonal damage seen across the spectrum of ms. alternatively, it has been proposed that intrinsic to the disease may be t - cell - mediated brain inflammation, the manifestations of which are variably modified by different immunological effector mechanisms, resulting in what compston has elegantly described as a state of mechanistic complexity rather than true disease heterogeneity. while the debate about the pathogenesis of ms continues, there is at least some consensus that inflammation, neuronal loss, and axonal damage are common pathways contributing to disability in the disease. the integrity of the oligodendrocyte - myelin - axonal unit is integral to function in the cns. myelin increases the cross - sectional diameter of the nerve axon, which improves conduction velocity and contributes to its tropic support. cytokines, nitric oxide, proteases, superoxide, cd8 + t cells, and glutamate excitotoxicity have all been shown to contribute to axonal injury. while it has been known since the charcot era that axonal injury is a feature of the ms plaque, understanding regarding the role of axonal loss was obscured for a period of time when demyelination was considered the predominant mechanism of injury. interest in the impact of early axonal damage on neurological disability resurged after trapp and colleagues reported the findings from brain tissue obtained at autopsy in ms patients. axonal transection, characterized by the presence of terminal axonal ovoids, was a prominent feature in acute and chronic lesions ; the extent of axonal injury was related to the degree of inflammation. at that time, trapp. highlighted the need for non - invasive techniques that could be used to monitor axonal pathological changes in ms, which may be the pathological correlate of irreversible neurological impairment in the disease. hence, any clinical model of ms should ideally provide a means of quantifying axonal damage and correlating axonal deficits with clinically relevant manifestations of the disease. at this point, neurodegeneration within the cns may arise from retrograde axonal degeneration, which is viewed as a dying back phenomenon causing pathological changes in the cell body proximal to a point of injury along an axon. alternatively, anterograde or wallerian degeneration may precipitate a dying forward process affecting the part of the axon that is separated from the cell body, which degenerates distal to the injury. transsynaptic degeneration refers to neuronal damage caused by loss of synaptic input when fibers afferent to them are injured. when transsynaptic degeneration occurs, axonal atrophy is followed by neuronal cell loss and reactive gliosis. the phenomenon has been well documented in the afferent visual pathway, wherein cells of the lateral geniculate bodies are known to degenerate with lesions in the retina, optic nerve, and/or optic tract. transsynaptic degeneration may also occur in a retrograde fashion, such that lesions of the optic radiation or calcarine cortex may cause degeneration of retinal ganglion cells. recently, green and colleagues performed a large scale pathological analysis of retinal tissues in ms patients and showed that retinal involvement was extensive in the disease, with regions of retinal nuclear loss in both the ganglion and inner nuclear cell layers in ms eyes. these findings demonstrated that the retina represents an ideal substrate to determine whether neuronal pathology is related to humoral mechanisms or alternative processes. retinal ganglion cells (rgcs) are cns neurons located within the innermost cellular layer of the retina and represent the output neurons for the deeper retinal cells (photoreceptors, horizontal cells, bipolar cells, and amacrine cells) that perform the initial phases of visual processing. kanamori and others have shown that real - time confocal scanning laser ophthalmoscopy can be used to image rgc apoptosis, intracellular signaling, and intraretinal axonal degeneration in rodents in vivo. in a recent study they used these techniques to assess the time course of wallerian and retrograde degeneration of unmyelinated rgc axons in living rats for a month after intraretinal axotomy. it was noteworthy that the rate and magnitude of retrograde and wallerian degeneration in this model of transection of unmyelinated cns axons were synchronous, suggesting a common mechanism for bidirectional axonal loss after injury within the cns. these findings may be particularly germane in the setting of ms, because understanding mechanisms of axonal degeneration, both in terms of how they align and diverge with mechanisms of neurodegeneration, may be critical for developing new therapeutic interventions in this disease. remeylination is a prominent early feature in ms, and has been shown to be most active during the acute inflammatory process and coincide with phagocytic removal of myelin debris. oligodendrocyte precursors in the cns that migrate to evolving ms lesions have the potential to remyelinate naked axons [19, 20 ]. in 20% of ms patients, plaques are eventually remyelinated, whereas in other instances remyelination is less successful [19, 20 ]. remyelination restores saltatory conduction of nerve impulses and prolongs the survival of previously demyelinated axons, thereby enhancing axonal integrity [19, 20 ]. at the level of the cortex, remyelination is more likely to occur when there is an abundance of oligodendrocyte progenitor cells, a relative paucity of reactive astrocytes, and minimal expression of extracellular matrix molecules known to inhibit oligodendrocyte production and differentiation. in a recent report, postmortem brain tissue was examined to determine the capacity for cortical lesions to remyelinate relative to adjacent subcortical white matter. in demyelinated lesions, there was greater evidence of remyelination in the cortex relative to subcortical cns regions. cortical remyelination was evident regardless of disease duration or chronological age of the patient. because remyelination indicates capacity for cns repair, a surrogate marker for this process would be integral to any putative model of ms, particularly in clinical trials testing novel myelin repair strategies. dispute regarding whether ms is a primary inflammatory process with degenerative features versus a degenerative disease with inflammation occurring as an epiphenomenon has spawned ongoing debate. the outside - in model of ms advocates that the inciting pathogenic event in ms is inflammation, with migration of autoreactive t cells across the blood - brain barrier from the systemic circulation. this inflammatory influx has been viewed as a misguided immunological reaction to an instigating event perpetrated outside the cns. while the antigen specificity of the outside - in model of ms has remained unclear, myelin proteins have been regarded as the delivery of myelin - derived proteins in adjuvant to laboratory animals has been shown to induce experimental autoimmune encephalomyelitis (eae). furthermore, t cells specific for myelin antigens in ms patients have been identified as being qualitatively different from those in healthy individuals [1, 21 ]. according to the outside - in model, once an antigenic response has been triggered, there is a consequent accumulation of t and b lymphocytes, plasma cells, and macrophages and an amplification of proinflammatory cytokines through recruitment of naive microglia to create an inflammatory cascade. ultimately, when the blood - brain barrier has been breached, contact is established between activated microglia and components of the cns oligodendrocyte - myelin unit. the inflammatory influx is mediated by t - cell lymphocytes that secrete interleukins, disrupt the human blood - brain barrier, and allow efficient penetration of th17 cells into the brain, which in turn destroy neurons. integral to the outside - in model is the premise that ms patients have underlying regulatory defects in their immune system that allow circulating lymphocytes to set up an immune response within the cns. failure of regulatory mechanisms is felt to account for the sites sclerotic plaques commonly occupy in ms, which include the lateral ventricles, corpus callosum, cortex, subcortical white matter, optic nerves, brainstem, and spinal cord. like t cells, b cells are believed to have a role in perpetuating the cns inflammation in the outside - in model. this is inferred from the increased oligoclonal bands and immunoglobulin synthesis within the cerebrospinal fluid (csf) of ms patients and histopathological evidence of immunoglobulin deposition and complement activation in acute demyelinating lesions. until recently, however, direct proof of clinically relevant antibodies in ms had not been established, and the molecular targets for humoral responses in the disease were unknown. in 2012, srivastava and colleagues identified igg1 and igg3 antibodies that bind glial cells in human brain tissue in the serum of ms patients and demonstrated that the molecular target of these antibodies was the potassium channel kir4.1. this potassium channel is expressed on astrocytes and is important for maintaining water balance. antibodies directed against kir4.1 were detected in the serum of 186 of 397 (47%) of ms patients, relative to 1% of patients with other neurological diseases (n = 329). injection of anti - kir4.1 antibodies into the cisterna magna of mice was associated with reduced kir4.1 expression in the brain, and complement activation at sites of antibody binding [2, 22 ]. thus, kir4.1 potassium channels were interpreted to be the target of an autoantibody response in some ms patients. in contradistinction, the inside - out model views ms as a primarily progressive disease, which proceeds similarly to other neurodegenerative disorders, remaining relatively unaltered by excess inflammation. the inside - out model argues that cytodegeneration of the oligodendrocyte - myelin complex is the primary pathogenic event, with inflammation occurring as a secondary response. proponents of the inside - out model assert that what distinguishes ms from other primary degenerative processes such as parkinson 's disease and alzheimer 's disease is the host 's tendency, depending on phenotype, to react to the highly autoantigenic components that are released as a consequence of the cytodegenerative process. they view ms as a convolution between progressive cytodegeneration and a variably primed immune system. in the context of the inside - out model, degeneration of white and grey matter elements may proceed independently, and the extent of the secondary inflammatory reaction may be governed by the amount of released immunogenic myelin - derived material. as a cytodegenerative process, ms is felt to be most faithfully represented in the ppms form of the disease. attitudes continue to evolve from viewing ms as a demyelinating disease to a broader perspective in which the relative contributions inflammation, axonal loss, and neuronal degeneration are weighed in the balance. accordingly, there is a need for noninvasive methods that capture the interactions between different pathogenic mechanisms that contribute to progression and disability in ms. as a putative model of ms, the afferent visual pathway (avp) offers several potential advantages. eighty percent of ms patients present with an acute clinical episode affecting one or several neurological sites, which is known as the clinically isolated syndrome (cis) [1, 23 ]. as an inflammatory lesion of the optic nerve, optic neuritis (on) is the best characterized cis, representing the initial clinical event for 21% of ms patients. much of what we have come to understand about on has been derived from the long - term followup of the optic neuritis treatment trial (ontt) [2427 ], which demonstrated that most on patients are young (mean age 32 years) caucasian (85%) women (77%). ninety - two percent of ontt patients reported pain at the onset of vision loss [2426 ], which is often characterized as an the severity of vision loss in on may range from mild to no light perception initially, and dyschromatopsia or decreased color vision is common. in cases of retrobulbar on, the fundus examination is initially normal, whereas patients with anterior on or papillitis may manifest optic disc swelling acutely. the initial period of visual recovery occurs with a period of weeks, and further improvement in vision is seen up to a year after the acute episode [2427 ]. with on as its inflammatory relapse prototype, the avp model provides objective evidence of a sentinel lesion, which can be precisely localized in the cns. as foveating animals, humans are hard - wired to seek high resolution images in the world around them. thirty - eight percent fibers carrying information to and from the brain are contained within the optic nerves (an estimated sum of 2.5 million axons), and if the rods and cones within the retina are considered separately, the total of sensory units that forward afferent input into the brain is increased by a factor of eighty ! in light of the highly specialized nature of the avp, any perturbation in the system that interferes with visual perception, particularly central vision, will be noticed and often reported by affected individuals. moreover, the course of functional recovery after on can be monitored from a precise point of onset in the avp model of ms. the avp is a functionally eloquent cns system, and deficits can be captured with highly reproducible measures including high- and low - contrast visual acuity, automated perimetry, and color vision testing. moreover, paraclinical tests including optical coherence tomography, visual evoked potentials, and motion perception techniques can be used to explore both the functional and structural integrity of the avp. in this manner, a structural - functional paradigm can be devised to elucidate the temporal evolution and relative contributions of inflammation, axonal loss, neuronal damage, and cortical compensation in the avp model of ms. previous pathological studies have shown that tissue - specific injury in the avp mirrors global cns effects in ms patients. with an acute on event, cytokine release induces transient conduction block, probably caused by damage induced by nitric oxide. when myelination and axonal integrity are intact, recovery ensues with the removal of inflammatory mediators. during recovery from on, remyelination improves saltatory conduction through sodium channels, which are distributed along the demyelinated optic nerve segment. cortical plasticity is also believed to play a role in optimizing function in the more chronic phases of recovery, albeit the timeline and mechanisms involved therein are not well understood. the avp model can be used to identify tissue - specific and system - based factors that govern injury and repair in ms. form and function should be one, joined in a spiritual union. form and function should be one, joined in a spiritual union. frank lloyd wright was referring to architecture with this version of his iconic comment, but these principles apply equally well to the visual system, in which anatomical integrity and clinical function are tightly linked, allowing precise topographic localization of pathological lesions. the avp originates in the retina, where the first order neuron begins with the bipolar cells. the second order neuron extends from the retinal ganglion cells (rgcs) to the lateral geniculate nucleus (lgn) in the thalamus, and the third order neuron leaves the lgn en route for the visual cortex. to fully appreciate how form relates to function in the avp, one must first consider its integral parts including the retina, optic nerves, optic chiasm and tracts, lgn, optic radiations, and the visual cortex (figure 1). when visualized with ophthalmoscopy, the macula appears yellow relative to the surrounding retina and is located temporal to the optic disc (figures 2(a) and 2(b)). at the center of the macula lies the foveola, which is devoid of vessels and other neuronal elements, other than the tightly packed cones. visual discrimination is greatest in this region of the retina, as light reaches the photoreceptors by passing through the thinnest regions of the retina. on a microscopic level, the retina consists of several major layers through which light is transduced [32, 33 ]. photoreceptors connect to bipolar cells, which in turn relay messages to rgcs [32, 33 ]. in concert, bipolar cells then provide inputs to rgcs via direct excitatory glutamatergic synapses or indirect, inhibitory gabaergic connections. the process of converting light into sight begins in the outer retina, which is comprised of photoreceptor cells (rods and cones). retinal ganglion cells differ in type such that large magnocellular (m) cells make up approximately 510% of rgcs and are concerned with where visual targets are in space. these cells have large receptive fields and propagate action potentials quickly [31, 32 ]. the m cells are color ignorant and have high - contrast sensitivity, low spatial resolution, and high temporal resolution [31, 32 ]. in contrast, small parvocellular (p) cells represent approximately 90% of the rgc population. the p cells are predominant in the macula and are concerned with what is being seen [31, 32 ]. specifically, p cells facilitate low - contrast sensitivity and high spatial resolution vision [31, 32 ]. certain diseases are believed to preferentially affect m cells or p cells. in alzheimer`s disease, for example, there is a predominant loss of m cells in the retina, with consequent problems of determining depth and motion perception. in contrast, on has traditionally been viewed as a disorder of p cells more so than m cells, because conventional testing has shown these patients to have central vision loss, dyschromatopsia, and persistent contrast sensitivity abnormalities. there is emerging evidence to suggest that neuronal damage in both the outer and inner layers of the retina may occur as a primary process in ms. light information is transferred along the axons of the rgcs which reside in a transparent region of the inner retina, referred to as the retinal nerve fiber layer (rnfl). the rnfl has an intricate topographic arrangement, which readily allows identification of visual field defects that arise from an optic nerve injury (figure 3). the rnfl lacks myelin, and defects therein are interpreted to represent damage to the rgc axonal integrity. prior to the modern ocular imaging era, rnfl defects were visualized with direct ophthalmoscopy and red - free photography. with the advent of optical coherence tomography, it is now possible to quantify changes in rnfl thickness as a surrogate marker of axonal integrity in the avp, which typically progress for up to a year after acute on [35, 36 ]. the axons of the rfnl converge on the optic disc to exit the back of the eye through the optic nerve. the optic nerve acquires myelin behind the eye at the lamina cribrosa and is comprised of approximately 1.2 million rgc axons contained within the rnfl. the intraocular segment of the optic nerve head (the optic disc) is located 3 - 4 mm nasal to the fovea and is 1 mm thick. within the optic nerve, a strict topographical arrangement is maintained as visual fibers originating in the rgc make their way to the lgn : superior fibers run superiorly, inferior fibers reside below, and those from the temporal and nasal retina run in the corresponding parts of the nerve. the optic nerves consist of myelinated nerve fibers similar to those forming white matter tracts elsewhere in the brain, which makes them vulnerable to inflammatory demyelinating injury in ms. both optic nerves converge in the anterior compartment of the skull to form the optic chiasm, which lies over the sella turcica [31, 32 ]. within the optic chiasm, approximately 50% of the fibers originating from the rgcs of the nasal retina cross to reach the contralateral optic tract [31, 32 ]. uncrossed fibers, originating from the temporal retina, maintain their dorsal and central position in the chiasm [31, 32 ]. this arrangement allows for each side of the brain to see the opposite side of the world (figure 1). the postchiasmatic portion of the avp is comprised of the left and right optic tracts. within each optic tract, tract lesions which disrupt the rgc axons destined for the lgn cause retrograde degeneration, which can be viewed as band atrophy of the optic nerve. the lgn provides a relay station for the rgc axons and exerts dynamic control upon the amount and nature of information that is transmitted to the visual cortex [31, 32 ]. neurons from the lgn project by way of the optic radiations to the calcarine cortex of the occipital lobe. in addition to retinal afferents, the lgn receives modulating connections from the thalamic reticular nucleus and layer 6 of the visual cortex. it thus provides a bottleneck to information flow, filtering visual information for relevance to the present behavioural state. the third order neurons of the avp extend from the lgn to the visual calcarine cortex located in the occipital lobe. these neurons are grouped into the temporal radiations which take an anterior course through the temporal pole (meyer 's loop) before turning in a posterior direction, and the parietal radiations. a retinotopic arrangement is maintained at the level of the cortex, such that temporal radiations represent the contralateral superior visual field and parietal radiations represent the contralateral inferior field [31, 32 ]. cortical area 17 is located along the superior and inferior banks of the calcarine fissure in the medial aspect of the occipital lobe [31, 32 ]. the visual cortex receives axons from the neurons of the lgn projected via the optic radiations and represents the first link in the cortical processing of visual information. each occipital lobe receives projections from the nasal half of the opposite eye and from the temporal half of the ipsilateral retina. the superior and inferior retinal projections extend to the superior and inferior banks of the calcarine fissure, respectively. the macular area is represented in the posterior pole of the calcarine cortex, whereas the more peripheral retina is more represented more anteriorly. there is a 300400-fold increase in the number of neurons in the primary visual cortex compared to the retina or lgn, with with 350 million neurons housed at a density double that of other cortical areas. the macula representation is highly magnified in the visual cortex retinotopic map such that connections from 1 mm of the retina representing the central 10 degrees of visual field make up 60% of the striate cortex !. the peripheral parts of the visual field are served by more anterior portions of the striate cortex. in addition to its topographical organization, the visual cortex is divided in a columnar network. there are rich intercommunications between cortical cells in a vertical direction so that each column of cells can be viewed as a functional unit. monocular inputs to the cortex are arranged in ocular dominance columns. because our two eyes have different views of visual space, there is a slight displacement of their respective retinal images. at the binocular fixation point objects in front of or behind the binocular fixation point give rise to noncorresponding images. within the avp, there are the tissue - specific substrates that sustain visual function, including the retinal elements ; the myelinated components of the optic nerve, chiasm, tracts, and radiations ; and the higher order cortical processing centers. given the capacity for cns plasticity and functional adaptation, clinical recovery from an avp lesion might not simply result from structural repair within the primary lesion alone. restoration of function may be influenced to some extent by cortical reserve, which may vary with the age and stage of ms. furthermore, chronic inflammation and the capacity for remyelination may also play a role in recovery. high - contrast visual activity refers to spatial resolving ability of the eye and has long been the mainstay of standard visual testing. theoretically, hcva is a measure of macular function, a presumed parvocellular mediated pathway, but in reality it reflects the structural - functional integrity of the entire avp. gold standard for primary outcomes of clinical trials in ophthalmology, yet it is a relatively crude measure of afferent visual function in ms. many patients will report significant visual dysfunction even with snellen visual acuity equivalents of 20/20 vision. for all of its limitations, hcva testing has some predictive value in forecasting functional recovery after on. kupersmith and colleagues used the ontt database to evaluate various cutpoints for baseline and 1-month vision levels that predicted abnormal 6-month vision. failure to reach a 1-month hcva cut - off of 20/50 correlated with having moderate - to - severe loss in this domain of function after six months. thus, hcva measures can be used to identify patients with potentially poor visual recovery after on in future neuroprotective studies employing the avp model of ms. the most common hcva charts employed in routine clinical practice and clinical research studies include the snellen and early treatment diabetic retinopathy study (etdrs) charts (figure 4). the snellen chart has letters of different sizes arranged from largest at the top to smallest at the bottom, which are read, at a distance of 6 meters (20 feet). snellen visual acuity is usually expressed as a fraction with the numerator equal to the distance from the chart and the denominator being the size of the smallest line that can be read. the reciprocal of the fraction equals the angle, in min of arc, that the stroke of the letter subtends on the patient 's eye and is called the minimum angle of resolution (mar) [37, 40 ]. there are numerous disadvantages of snellen charts, which compromise the reliability of this testing modality in the clinical and research arenas. the etdrs charts are superior to snellen charts because interpatient differences are more accurately measured and longitudinal follow - up measurements have more consistent precision, regardless of whether the patients have high or low levels of visual acuity. the etdrs method allows visual acuity to be converted to logmar, which converts the geometric sequence of a traditional chart to a linear scale [37, 40 ]. in logmar notation, lower scores correspond to better vision, and as acuity becomes worse, the value of the logmar increases. while acuity is a visual measure determined under optimal circumstances of high contrast and high luminance, the real visual world is one of varying spatial and temporal frequencies, contrast, color, luminance, and glare [38, 4144 ]. in many respects, contrast acuity and low - contrast letter acuity (lcla) testing (figure 5) attempt to capture the many shades of grey that color our day to day lives. low - contrast testing identifies the minimum size at which letters of a particular contrast level can be perceived. low - contrast letter acuity charts have a standardized format based on the etdrs visual acuity charts and different contrast levels (100%, 5%, 2.5%, 1.25%) [4143 ]. visual improvement and loss by the low - contrast acuity chart has been defined as a 7-letter change in score [42, 43 ]. as defined, these lcla deficits have been shown to correlate with quality of life measures and neurological disability scores in ms patients. balcer and colleagues [4145 ] have spearheaded our understanding of how lcla can be used to measure functional integrity in the avp. in a substudy of the international multiple sclerosis secondary progressive avonex controlled trial (impact), mean letter scores were generally lower for patients with ms compared with healthy volunteers for all four contrast levels studied, with the greatest difference noted at the lowest contrast level [42, 43 ]. the discrepancies were observed despite similar median visual acuities based on the snellen visual acuity equivalent (100% contrast level). similarly, in patients from the multiple sclerosis vision prospective (mvp) cohort study, ms patients and healthy volunteers had similar letter scores at 100% contrast, whereas the former had lower letter acuity scores for sloan charts with contrast levels of 5%, 2.5%, and 1.25% [42, 43 ]. contrast can be defined as a measure of the difference between the luminance of the object and its surroundings. contrast sensitivity function is conventionally measured by finding the threshold contrast of sine wave gratings of varying spatial frequencies (sizes). visual acuity is almost constant for all high - contrast levels, whereas at lower contrasts, acuity becomes strongly dependent on contrast changes. fisher and colleagues showed that contrast sensitivity scores were worse among eyes of ms patients compared with disease - free controls. moreover, the on eyes of ms patients had significantly worse contrast sensitivity scores than ms eyes without a history of on. hence, together lcla and contrast sensitivity testing are more sensitive in detecting visual deficits in spatial frequency than hcla testing in ms, and inclusion of these functional outcomes in the avp model will better capture deficits that impact quality of life and day- to- day function in these patients. binocular viewing is superior to monocular vision when it comes to threshold tasks such as contrast detection, due to a phenomenon called binocular summation. in contrast, patients with binocular inhibition have worse binocular vision as compared to the monocular view they get with their better seeing eye [43, 45 ]. in a recent study of 1831 individuals, prevalence rates of binocular summation and inhibition were 21% and 2%, respectively. compared with participants less than 65 years old or those with equivalent interocular visual acuity, older participants (65 years) and those with interocular differences in visual acuity were more likely to demonstrate binocular inhibition. it was noteworthy that participants with binocular inhibition had greater self - reported problems with driving activities. the phenomena of binocular summation and inhibition are not well understood but may relate to neural interactions of input from both eyes within the post - geniculate visual pathway. given that binocular summation is likely mediated at the cortical level, ms patients may experience functional limitations due to interruptions in normal cortical signaling. a study of 1,007 patients with ms and 324 disease - free controls showed that binocular summation was substantial for low - contrast acuity at the 2.5% and 1.25% levels. with hcva, only 3.0%3.4% of patients showed similar degrees of summation [42, 45 ]. increasing age, greater interocular differences in acuity, and history of on were associated with lower magnitudes of binocular summation and worse binocular inhibition. hence, binocular summation may provide us insights about the day - to - day visual challenges of ms patients that are poorly captured with standard high - visual acuity testing. further exploration into the phenomena of binocular inhibition and summation could help us better understand the role of cortical adapation in visual recovery after a cns insult. critical flicker fusion frequency is defined as the lowest frequency at which a flickering light is perceived to be nonflickering or steady [4750 ]. as a test of visual function, cfff is a rapid and simple technique that can provide information about the responsiveness of the visual system by defining the upper limits of temporal resolution. studies have shown that cfff perception improves with increased target luminance, target size, and retinal eccentricity, whereas decreased cfff perception occurs with age [4750 ]. testing cfff is important not only in assessing the integrity of the retina but also reflects the capabilities and limitations of neural processing with respect to the speed and transmission of the neural response. previous reports have shown that the magnocellular system is primarily involved in the processing of rapid flicker and motion and that cfff is affected by optic nerve damage, especially demyelination. in a prior study of 25 on patients, there were also cfff abnormalities in the fellow (non - on) eyes of patients with unilateral on. there is therefore evidence to suggest that cfff could potentially be compared with other measures of spatial and temporal frequency to interrogate the integrity of myelination and neuroaxonal integrity in the avp model. in on patients, color vision various techniques have been used effectively to capture color vision deficits in ms patients [5154 ]. hardy - rand - rittler (hrr) pseudoisochromatic color plates have demonstrated an advantage over the ishihara method, because the former are more sensitive to red - green and blue - yellow deficits caused by neuroophthalmic disorders. recently villoslada studied 213 ms patients and 47 healthy controls to determine the relationship between hcva, lcla, color vision (hrr plates and lanthony d15 tests), and optical coherence tomography (oct). multiple sclerosis patients showed hcva and lcva deficits but exhibited even more profound abnormalities in color discrimination relative to controls. moura and colleagues assessed chromatic discrimination in 35 ms patients (with and without on) and 74 age - matched controls using the cambridge color test (cct) to determine the magnitude and chromatic axes of any color vision loss in both patient groups and to evaluate age - related changes in chromatic discrimination in both patient groups compared to normal control subjects. color thresholds for both on eyes and non - on eyes in ms patients were significantly higher than control eyes along the protan and tritan axes. in addition, ms patients manifested progressive color discrimination impairment with age (along the deutan and tritan axes) that was almost two times faster than controls, even in the absence of on. visual field testing has been described as the cornerstone of the sensory visual examination and provides invaluable information about the integrity of avp function from the retina to the visual cortex. perimetry has evolved through stages since original confrontation - based techniques to allow quantification and statistical analysis in its currently used computerized forms (figure 6). this provides critical information about visual function including both central and peripheral channels, and many of the perimetry machines in common use today are readily available in most cities around the developed world allowing for easier comparisons across offices over time. in the 15-year followup from the ontt, keltner and colleagues defined visual field characteristics and classifications for the entire cohort, from baseline through 15 years. at presentation, 100% of the visual fields from the on eyes and 75% of the visual fields from the fellow (non - on) eyes in patients were abnormal. after year one, the frequencies of abnormal and normal visual fields for the affected eye were evenly distributed at approximately 50% each, whereas the abnormal visual field frequency in the fellow eye ranged between 34% and 40%. diffuse and central visual field deficits were more prominent in on eyes than fellow eyes at baseline, and nerve fiber bundle defects (partial arcuate, paracentral, and arcuate) were the most prominent localized abnormalities in the affected and fellow eyes during the study. for all of the established advantages of automated perimetry, there are potential pitfalls in applying these techniques to a patient population that is subject to fatigue - related visual dysfunction. wall and colleagues followed 17 patients with on and 10 healthy control subjects with repeat intraday and interday automated perimetry testing (five humphrey 30 - 2 tests were administered during a 7-hour period on the same day and at the same period on 5 separate days). optic neuritis patients demonstrated variations in visual field sensitivity that were outside the entire range of variability for normal controls. these variations occurred for multiple tests performed on the same day, at specific times, and for tests performed at specific times on different days. thus, when using automated perimetry, distinguishing true change from variability remains a challenge. previously, barton and rizzo used motion perception techniques to study 13 patients with optic neuropathies and 19 healthy control subjects. double - dissociated meaning that eyes could have abnormalities in one or the other, without necessarily having correlating abnormalities in both. this finding refuted the notion that both motion perception and cfff were mediated exclusively by a common magnocellular pathway. the hypothesis that on can have prolonged effects on visual motion processing, which may persist after there has been an objective return to normal form perception, was further explored by raz and colleagues in a series of elegant papers [58, 59 ]. they prospectively followed 21 on patients over one year with tests of spatial and dynamic visual functions including visual acuity, perimetry, contrast sensitivity, color vision, visual evoked potentials, and oct testing. in addition the authors developed a novel set of motion perceptual tasks to test dynamic visual deficits as part of their study protocol. in on eyes, visual acuity, visual field, and colour vision deficits were apparent in the acute phase and subsequently improved after one month. as compared to tests of spatial visual function, motion (temporal) perception was impaired during the full follow - up period of one year. thus motion perception testing revealed the most significant and prolonged impairment after on, and motion perception problems were independent of contrast sensitivity levels. the investigators then endeavored to identify mechanisms underpinning the sustained deficit in dynamic visual function following on. they hypothesized that motion perception may be more vulnerable to slowed conduction in the optic nerve, which could be measured with visual evoked potential (vep) testing. to explore this theory further they performed motion perception and vep testing at presentation, 1 month, 4 months, and 12 months after on. the vep amplitudes in on eyes were significantly reduced compared to fellow eyes in the acute phase, but these differences resolved in later phases of recovery. in keeping with the aforementioned findings of kupersmith and colleagues visual performance 1 month after on was highly predictive of visual recovery, as determined with visual acuity, contrast sensitivity, and motion perception testing. intact vep amplitudes were associated with recovered visual acuity and contrast sensitivity after on, suggesting that these visual functions depend on a sufficient amount of visual information reaching the cortex. in contrast, motion perception was impaired even in patients with intact vep amplitudes, indicating that an intact amount of visual projection alone does not impact dynamic visual function. instead, while the magnitude of contrast sensitivity improvement related to the extent of vep amplitude restoration, the magnitude of motion perception improvement depended on the extent of vep latency reduction post - on. from these findings, it was inferred that there is a need for rapid transmission of visual input to perceive motion. moreover, motion perception testing in concert with vep may serve to assess the impact of demyelination / remyelination in the avp model of ms. the vep is a response of the brain to repeated visual stimulation and has traditionally been recorded when visual field is stimulated with a single checkerboard pattern [6065 ]. the vep is known to be generated at the level of striate cortex by the combined activity of postsynaptic potentials [6065 ]. the magnitude of the vep reflects the number of functional afferent fibers reaching the striate cortex [6064 ]. in on patients, diminished vep amplitudes indicate inflammation - induced conduction block, axonal atrophy, or a combination of both. subsequently, increased vep amplitudes which occur after on are a consequence of resumed conduction in previously blocked fibers due to resolution of inflammation and edema or possibly expansion of synaptic activity along the visual pathway up to the level of v1. delayed vep conduction is recognized as one of the earliest features of acute on, with the subsequent shortening of latency thought to represent the process of remyelination. because it is a summation of a large number of neuronal elements, the full - field vep is greatly dominated by the macular region due to its cortical overrepresentation [60, 61, 63, 64 ]. moreover, the waveform of the full - field vep is prone to cancellation and distortion, which sometimes leads to apparent, rather than real, latency delay [60, 61, 63, 64 ]. in contrast, the multifocal vep (mfvep) allows stimulation of small areas of the visual field [60, 6264 ]. the result is a detailed topographical assessment of small groups of axons within the optic nerve and visual cortex, which is resistant to waveform distortion [60, 6264 ] (figure 7). in a recent study, klistorner used mfvep and oct testing to prospectively study 25 subjects with acute unilateral on. while mfvep amplitude asymmetry at baseline varied significantly among the patients, it was, on average, very high, indicating considerable reduction of amplitude in on eyes there was an insignificant negative correlation between the inter - eye asymmetry of oct - measured rnfl thickness and that of mfvep amplitude at one month. this was consistent with vasogenic edema in the acute phase, causing an increase in rnfl thickness, with a corresponding reduction in mfvep amplitude. over the course of recovery, the correlation became more robust, suggesting the diminishing role of optic nerve edema in measured rnfl thickness and unmasking the association between rnfl atrophy and low mfvep amplitude. the potential correlation between oct - measured rnfl values and mfvep measures of anterior visual pathway damage was demonstrated by the same group, who evaluated 32 patients with unilateral on and 25 control subjects. the mean rnfl thickness in on eyes (85 m) was reduced by 19% compared with control eyes (104 m), and there was a 40% reduction in the amplitude of the mfvep in on eyes relative to control eyes. in addition to demonstrating the utility of mfvep in tracking optic nerve injury in on patients, this study further confirmed the significant correlations between structural and functional measures of optic nerve integrity and showed that demyelination contributes to axonal loss. it may therefore be feasible to pair mfvep and oct testing to capture the synergistic effects of acute demyelination and axonal loss over time in on / ms patients. furthermore, the putative relationship between the vep latency and axonal loss encourages the notion that therapeutic interventions aimed at reducing the effects of demyelination or enhancing remyelination may be trialed in the avp model. the electroretinogram (erg) provides an objective, quantitative measure of functional integrity in the photoreceptors (rod and cones) and ganglion cells in the retina. electrodes are placed on the cornea or adjacent to the orbit to monitor changes in the electrical potential of the eye in response to specific stimuli. the full - field erg is the most common form of erg testing, and prior reports employing this technology have shown that outer retinal dysfunction occurs in ms [67, 68 ]. forooghian. studied 34 ms patients and 37 healthy control subjects with standard erg testing and a novel bright flash erg protocol technique to detect evidence of rod photoreceptor function. patient and control sera were analyzed for the presence of antiretinal antibodies in this study, using western blot techniques. they observed significant differences between ms patients and controls in four erg parameters : in the ms group, implicit times of the rod - cone b - wave response, cone b - wave response, and rod photoreceptor response were increased, whereas the amplitudes of the photopic oscillatory potentials were reduced in the ms group relative to control subjects. interestingly, ms patients with the highest titres of retinal autoantibodies had delayed rod - cone b - wave implicit times and diminished photopic oscillatory potential amplitudes. anti - retinal antibody reactivity against retinal antigens including arrestin and -enolase has previously been described in ms suggesting that retinal autoimmunity may be the basis of retinal and specifically rod photoreceptor dysfunction in the disease. thus erg testing could potentially be used in the avp model to explore the role of autoimmune mechanisms underlying outer retinal dysfunction in ms patients. while the full - field erg enables the assessment of general retinal function, it can not provide specific information about individual sectors of the retina, which is needed in the setting of multifocal or regional disease. in contrast, the multifocal erg (mferg) measures the response in each of a large number of small sectors, thus providing a map that allows the clinician to locate specific areas of malfunction in the retina. the mferg is particularly valuable in cases in which the fundus appears normal, and attempts are being made to localize a disease process to the outer retina, retinal ganglion cells, or optic nerve. recently, merg testing was used to confirm the presence of retinal abnormalities in ms patients, described as manifesting the predominantly macular thinning phenotype (mtp). this phenotype was so - named to describe patients with deeper disruption of retinal architecture than would be expected due to retrograde degeneration from either typical clinical or subclinical optic neuropathy. functional corroboration of retinal dysfunction was provided through mferg testing which demonstrated diffuse abnormalities, indicating that ms may target the anterior visual pathway at multiple sites, including the optic nerve (with subsequent axonal and neuronal degeneration in the retina) and the retina itself (involving discrete pools of neurons). since the invention of the ophthalmoscope, the structural consequences of optic nerve injury have been visualized acutely as optic disc edema, followed by disc pallor and corresponding defects in the rnfl [34, 42, 71 ]. the rnfl represents a unique cns structure, because it lacks myelin, and changes therein have been interpreted to represent axonal loss caused by anterograde retinal damage or retrograde degeneration from a retrobulbar optic nerve injury. experimental models have shown that in eyes with total optic nerve transection, the disappearance of normal rnfl striations begins at one month and is completed by two months [71, 72 ]. yet, other reports have indicated that retrograde degeneration may take as long as 6 months to fully develop [71, 73 ]. given that the back of the eye represents the front of the brain, it is intuitive that structural damage in the retina occurs the setting of ms. in 1974, frisen and hoyt reported rnfl defects as evidence of axonal attrition in ms patients ; recent work by green. has provided postmortem evidence for retinal atrophy and inflammation in ms patients, even in late stages of the disease. in the modern ocular imaging era, oct has allowed us to acquire high - resolution, noninvasive imaging of retinal architecture (figure 8). changes in peripapillary rnfl thickness as measured by oct have been interpreted to represent axonal damage [10, 34, 36, 38, 52, 53, 58, 59, 63, 64, 71, 7483 ] whereas loss of macular volume [53, 74 ] and rgc layer thinning [84, 85 ] have been viewed as evidence of neuronal pathology in ms which may occur as a primary or secondary phenomenon in the disease. previous oct studies have shown that at the time of an acute inflammatory on event, when vision loss is at its nadir, patients manifest rnfl measurements that are either comparable to or increased in their affected eye (on eye) relative to their unaffected eyes. correspondingly, the optic nerve in the on eye tends to be mildly edematous or hyperemic secondary to axoplasmic flow stasis. after two to three months, optic disc pallor and rnfl thinning evolve, with earliest signs of significant rnfl atrophy manifesting in the temporal rnfl region. in on eyes, rnfl values continue to decrease for six to twelve months after symptom onset, plateauing thereafter. a year after an isolated on event, peripapillary rnfl measurements are reduced by approximately 20% relative to the fellow eye. in a recent meta - analysis of time domain oct studies (14 studies (2,063 eyes)) rnfl values were reduced from 5 to 40 m (averaging 10 to 20 m) in on eyes of ms patients. furthermore, comparing on eyes in ms patients with the eyes of healthy controls showed an estimated average rnfl loss of 20 m. lower rnfl values have been shown to correlate with reduced visual acuity [53, 71 ], visual field mean sensitivity [53, 71 ], and color vision testing scores. for patients selected without recruitment bias, an oct cut - off of 75 m has been shown to represent a threshold of rnfl integrity that can predict the extent of visual recovery after on. for any given ms patient, it is difficult to know whether retinal damage arises as a primary neuronopathy or whether damage to rgcs and deeper neuronal elements in the inner nuclear layer occur as a dying back consequence of retrograde axonal degeneration from a retrobulbar optic nerve injury. multiple sclerosis patients manifest retinal inflammatory changes including periphlebitis and pars planitis, in a region of the avp that lacks myelin. this finding challenges the premise that myelin debris is the only antigenic trigger in this disease. previous studies assessing retinal pathology in ms have demonstrated atrophy of the rnfl and rgc layers [15, 85 ]. green and colleagues observed shrunken neurons, dropout of rgcs (in 79% of ms eyes), and inner nuclear layer atrophy (in 40% of ms eyes). the finding of inner nuclear layer atrophy indicated that neuronal pathology is not restricted to the rgc layer in the eyes of ms patients and that retinal injury is more widespread than previously appreciated. in this study, the severity of retinal atrophy was significantly associated with postmortem brain weight, and there was an association with disease duration, suggesting that the observed retina pathology may reflect global changes occurring in the cns over time. with the exception of demyelination, virtually all manifestations of brain tissue injury in ms can be found in the retina. thus, using oct in the avp model may help us decipher different types of retinal pathology and enhance our understanding of the factors that drive both inflammation and tissue atrophy in ms. at this point, it is not known whether structural disruption occurs in retinal layers deeper than the inner nuclear layer in ms. if ms affects the outer retina directly, it could indicate that primary retinal neuronal pathology is pathogenic feature of the disease. arguably, rgc layer and inner nuclear layer damage may occur as a consequence of a direct immune - mediated process ; or in keeping with the tenants of the inside out model, rgcs and deeper neuronal structures may be targeted by a common neurodegenerative process. anterograde transsynaptic damage from an optic nerve injury leading to neuronal loss in the lgn has been described in ms,, glaucoma, and after chemical injury to the optic nerve. recently retrograde transsynaptic degeneration has been interpreted from oct manifestations of rnfl layer thinning in patients who suffered injury to the posterior visual pathways. further investigations are needed to validate the phenomenon of retrograde transsynaptic neuronal degeneration in the avp, which could inform our understanding of mechanisms underpinning diffuse axonal loss in ms (distal from remote or active sites of inflammation) and add a further element of discussion to the inside - out versus outside - in debate. interrogating the retina for evidence of ms - related pathology has prompted recent interest in the observation of microcystic macular edema (mmo) in the inner nuclear layer, which has been reported to occur in 5 to 6% of ms patients [84, 90 ]. first proposed by gelfand and colleagues, mmo refers to retinal microcysts, which are thought to be a sign of inflammation in the retina [84, 90 ]. a follow - up study with oct reported that increased inner nuclear layer thickness was associated with the development of mri - measured contrast - enhancing lesions, new t2 lesions, and disability progression in ms patients. thus, inner nuclear layer thickness may be a structure marker of retinal inflammation that can be correlated with global metrics of disease activity in ms patients. the avp model offers an exciting opportunity to explore disease mechanisms that contribute to neurological disability in ms patients. monitoring the acute and chronic consequences of clinically overt on may shed light on factors that govern injury and repair after an inflammatory relapse in the cns. furthermore, longitudinal studies of ms patients unaffected by clinical on events may help us determine whether axonal and neuronal damage occur independently of cns inflammation in the avp. because the avp model is amenable to multiple interrogation techniques, it may be possible to identify neuroprotective, remyelinating, and regenerative effects of emerging therapies being trialed in ms patients. sensitive and standardized tests of vision can be compared with high resolution imaging measures of structural integrity in the avp model to develop a structural - functional paradigm of cns injury. | multiple sclerosis (ms) is a disease of the central nervous system (cns) believed to arise from a dysfunctional immune - mediated response in a genetically susceptible host. the actual cause of ms is not known, and there is ongoing debate about whether this cns disorder is predominantly an inflammatory versus a degenerative condition. the afferent visual pathway (avp) is frequently involved in ms, such that one in every five individuals affected presents with acute optic neuritis (on). as a functionally eloquent system, the avp is amenable to interrogation with highly reliable and reproducible tests that can be used to define a structural - functional paradigm of cns injury. the avp has numerous unique advantages as a clinical model of ms. in this review, the parameters and merits of the avp model are highlighted. moreover, the roles the avp model may play in elucidating mechanisms of brain injury and repair in ms are described. |
transgender women (ie, male - to - female) have one of the highest incidence and prevalence of hiv infection in the united states and around the world. preexposure prophylaxis (prep) with tenofovir disoproxil fumarate (tdf)emtricitabine (ftc) is a promising modality to curb hiv incidence in this population, but prep studies have thus far focused on men who have sex with men (msm), heterosexual men and women, person who inject drugs, and cis - gender women (ie, born female). inclusion of transgender women has been limited, underscoring an urgent need to focus prep research on these individuals to increase uptake, facilitate access, and ensure safe and effective prep use. a significant question for the transgender community is whether prep interacts with transgender hormonal therapy, as no studies have assessed interactions to date. the medications used to achieve feminization fall into 3 broad categories : estrogens, antiandrogens, and the possible use of a progestin. the preferred delivery of estrogen is 17- estradiol (estradiol) or ester conjugates (eg, estradiol valerate), given sublingually, orally, transdermally, or intramuscularly. the world professional association for transgender health standards of care calls their use controversial, acknowledging that some clinicians consider that breast development is enhanced, but they cite a lack of data to support this claim. the following review will evaluate experimental and theoretical risk for drug interactions between tdf the most important information for potential drug interactions influencing prep efficacy in transgendered women comes from trials. the preexposure prophylaxis initiative (iprex), also known as the iprex trial, and its open - label extension (iprex - ole) have specifically reported enrollment and subanalysis of transgender women, although neither were designed to evaluate efficacy in this population. other trials excluded transgender women or did not provide any specific information on transgender enrollment or efficacy. iprex was a multinational (brazil, ecuador, peru, thailand, south africa, and the united states), randomized controlled trial, in which 2499 hiv - negative msm or transgender women were assigned to daily coformulated oral tdf / ftc or placebo. there was a 44% reduction in the incidence of hiv in the tdf / ftc arm, but a subanalysis based on drug concentrations estimated 96% efficacy for high - adherers (at least 4 or more doses per week). gender identity and the use of feminizing hormones in iprex were determined by self - report. the overall number of transgender women was 339 (14%), with 296 (12%) reporting being transgender women, 29 (1%) identifying as women, and 14 (1%) identified as men but used feminizing hormones. compared with msm, transgender women had significant vulnerabilities. they were younger, less educated, had more sexual partners and transactional sex, had higher incidence of sexually transmitted infections, and reported less frequent use of condoms for receptive anal intercourse. twenty percent of the transgender women reported any use of feminizing hormonal regimens, which included progestins (74%), synthetic or natural estrogens (72%), and antiandrogens (23%). regardless of hormone use, tenofovir diphosphate (tfv - dp) in viably cryopreserved peripheral blood mononuclear cells (pbmc) was detected less consistently in transgender women vs msm, suggesting less consistent adherence. importantly, drug detection was less consistent in transgender women who reported receptive anal intercourse without a condom. in contrast, drug detection was more consistent in msm who reported receptive anal intercourse without a condom. ftc arm vs the placebo group (11 vs 10 seroconversions) with a hazard ratio (hr) of 1.1 (95% ci : 0.5 to 2.7). in contrast, the hr in msm was 0.5 (95% ci : 0.34 to 0.75) ; this efficacy difference did not reach significance ; p = 0.09. no study drugs were detected in any of the 11 transgender women at the time seroconversion was documented. iprex - ole was also a multinational study conducted between 2011 and 2013 in which the uptake and the adherence to tdf / ftc based prep were evaluated in 1603 hiv - negative msm and transgender women who had previously participated in prep trials. in this study, 1225 (76%) participants received prep during any portion of the study, and the incidence of hiv infection was 1.8 vs 2.6 infections per 100 person - years in those receiving prep vs those who declined prep (hr 0.51, 95% ci : 0.26 to 1.01). the study population included 192 transgender women, of whom 151 (79%) elected to take prep. the study used tfv - dp in red blood cells measured with dried blood spots (dbs) as a marker of adherence. the study showed that protective dbs concentrations (ie, tfv - dp of 700 fmol / punch, commensurate with 4 or more doses per week) were less frequently observed in transgendered women compared with msm, particularly in those reporting hormone use. in total, there were 3 seroconversions among transgender women, 2 in those who received prep compared with 1 in the group who declined prep. no infections were documented in transgender individuals with dbs reflective of 4 or more tdf / ftc doses per week on average. taken together, these iprex subanalyses suggest that prep use may be lower in transgender vs msm (possibly because of drug interaction concerns), but when used, it seems to be effective. in addition to traditional plasma pharmacokinetics, tdf ftc requires adequate distribution to genital and lymph tissues, cellular uptake by target cells, phosphorylation and accumulation to effective intracellular tfv - dp / emtricitabine triphosphate (ftc - tp) concentrations, successful competition against endogenous deoxynucleoside triphosphates (dntps) for reverse transcriptase, potential immune contributions, followed by pharmacologic effect. each step in the continuum is governed by factors that could be influenced by hormones such as kinase or transporter expression / function, dntp levels, or immunity. the main kinases and transporters that influence tdf and ftc dispositions are shown in table 1. it should be noted that the pharmacologic relevance of transporters can be difficult to interpret, as transporters have overlapping activities, can be broadly distributed anatomically, and can influence multiple pk processes (absorption, clearance, and distribution). the pharmacologic continuum for tdf - ftc based prep. ftc disposition in vitro studies suggested that estrogens or progestins can increase or decrease tfv - dp and ftc - tp (or lamivudine triphosphate) depending on the dose and the cell type (genital immune cells, genital epithelial cells, pbmc, or cell lines). other studies show that transporter expression is differentially expressed in rectal vs female genital tissues, raising possibilities that hormones could influence transporter distribution. however, these kinds of in vitro findings do not reliably translate to clinical relevance. further studies in vivo are needed to explore hormone effects on intracellular tfv - dp and ftc - tp including transporter expression in tissues of relevance for hiv infection. given the difficulty in studying these issues in vivo, this is a well - suited setting for simulations and physiologically based pharmacokinetic modeling. tdf was studied with contraceptive ethinyl estradiol and norgestimate (a progestin) in women. the 90% ci for area of the concentration time curve auc, cmax, and ctrough ratios (with and without tdf) for ethinyl estradiol and deacetyl norgestimate (the active metabolite measured in the study) the mean tenofovir cmax and auc were 340 ng / ml and 2970 nghml, which were consistent with historical data. although the metabolism of ethinyl estradiol differs from estradiol, this study supports a low likelihood for plasma interactions between these medication classes. it is important to note that ftc has not been studied individually with hormone therapy to our knowledge. given the low interaction profile of ftc, and its renal clearance, there is also a low likelihood for plasma interactions between these medication classes. nevertheless, transgendered women are a different population than women using contraception, and estradiol, spironolactone and other progestins such as medroxyprogesterone are different medications (described below). controlled studies are needed to evaluate plasma and intracellular interactions for these specific medications in the transgender population. men normally produce low levels of estradiol in the testes and peripheral tissues, resulting in plasma estradiol concentrations of 2030 pg / ml. during transgender therapy, the proposed goal for estradiol concentrations is 100200 pg / ml (similar to estradiol concentrations during the midluteal phase in women). importantly, this concentration goal enables therapeutic drug monitoring to maintain target concentrations when faced with drug interaction concerns (commercial assays are readily available). estradiol metabolism is complex, occurring in intestinal mucosa, liver, kidney, and steroid - producing tissues. when taken orally, estradiol is significantly metabolized in the intestinal mucosa to estrone (a less active estrogen) by 17-hydroxysteroid dehydrogenase (17-hsd). further metabolism occurs on the first pass through the liver, resulting in numerous metabolites (as many as 100 have been identified), predominately sulfated and glucuronidated conjugates. similar bioavailability is observed for estradiol valerate, an ester conjugate of estradiol, because it undergoes rapid ester hydrolysis upon absorption and first pass in the liver, and simultaneously the same metabolism of estradiol occurs. when given intramuscularly or transdermally, the drug releases slowly, avoiding the first - pass effect of the liver and providing a more prolonged concentration time profile., no major transporter involvement has been reported for estradiol disposition, although multidrug resistance protein 2 (abcc2, mrp2) is involved with estradiol glucuronide clearance, and estradiol and estrone were reported as breast cancer resistance protein (abcg2, bcrp) inhibitors. the implication of bcrp inhibition on tfv disposition is uncertain, but unlikely to cause major pharmacokinetic changes given the numerous other transporters involved in its disposition (table 1). although controversial (and beyond the scope of this review), medroxyprogesterone has been implicated as increasing risk of hiv transmission in women, owing to thinning of vaginal mucus and the epithelial barrier, immunosuppression, and/or increased target cells in the endocervix. it is not evident whether these effects may extend systemically or into penile or rectal mucosa for transgender individuals, but clearly this is an area in need of study. ftc among medroxyprogesterone - treated humans (including women or their male partners) or a macaque model. like estradiol, progesterone and synthetic progestins such as medroxyprogesterone are highly metabolized in the gut and liver with approximately 5% bioavailability. progestins such as medroxyprogesterone are not implicated as major perpetrators of drug interactions. in vitro studies suggest mrp2 and p - glycoprotein (pgp) (abcb1, pgp) inhibition, which might raise tdf bioavailability and slow tfv renal clearance, but in vivo studies are needed for confirmation. in contrast to these effects, the mtn001 study reported lower (20%) tfv plasma concentrations and tfv - dp in pbmc among women receiving injectable or oral contraception, but adherence or other variables may have confounded this finding and follow - up pk modeling of the same study did not report the same finding. like estrogens and progestins several metabolites are pharmacologically active (eg, 7-alpha - thiomethyl spironolactone and canrenone). animal and in vitro studies suggested that spironolactone was an inducer of metabolism, possibly acting through pregnane x receptor, which would upregulate metabolic enzymes and transporters such as pgp and others. however, spironolactone is not implicated as a major perpetrator of drug interactions in vivo, suggesting a disconnect between in vitro / animal studies and the human profile. spironolactone does not influence furosemide (an organic anion transporter 1/3 substrate) pharmacokinetics in vivo, which is relevant for tfv, also an organic anion transporter 1/3 substrate (table 1). the product information for aldactone (spironolactone) lists drug interactions mainly involving hyperkalemia risk, (eg, concomitant angiotensin converting enzyme ace inhibitors), and a potential increase in digoxin concentrations (a pgp substrate). this profile is not consistent with major pregnane x receptor activation and enzyme / transporter induction in vivo, but human volunteer studies are needed to better define spironolactone drug interactions. men normally produce low levels of estradiol in the testes and peripheral tissues, resulting in plasma estradiol concentrations of 2030 pg / ml. during transgender therapy, the proposed goal for estradiol concentrations is 100200 pg / ml (similar to estradiol concentrations during the midluteal phase in women). importantly, this concentration goal enables therapeutic drug monitoring to maintain target concentrations when faced with drug interaction concerns (commercial assays are readily available). estradiol metabolism is complex, occurring in intestinal mucosa, liver, kidney, and steroid - producing tissues. when taken orally, estradiol is significantly metabolized in the intestinal mucosa to estrone (a less active estrogen) by 17-hydroxysteroid dehydrogenase (17-hsd). further metabolism occurs on the first pass through the liver, resulting in numerous metabolites (as many as 100 have been identified), predominately sulfated and glucuronidated conjugates. similar bioavailability is observed for estradiol valerate, an ester conjugate of estradiol, because it undergoes rapid ester hydrolysis upon absorption and first pass in the liver, and simultaneously the same metabolism of estradiol occurs. when given intramuscularly or transdermally, the drug releases slowly, avoiding the first - pass effect of the liver and providing a more prolonged concentration time profile., no major transporter involvement has been reported for estradiol disposition, although multidrug resistance protein 2 (abcc2, mrp2) is involved with estradiol glucuronide clearance, and estradiol and estrone were reported as breast cancer resistance protein (abcg2, bcrp) inhibitors. the implication of bcrp inhibition on tfv disposition is uncertain, but unlikely to cause major pharmacokinetic changes given the numerous other transporters involved in its disposition (table 1). although controversial (and beyond the scope of this review), medroxyprogesterone has been implicated as increasing risk of hiv transmission in women, owing to thinning of vaginal mucus and the epithelial barrier, immunosuppression, and/or increased target cells in the endocervix. it is not evident whether these effects may extend systemically or into penile or rectal mucosa for transgender individuals, but clearly this is an area in need of study. ftc among medroxyprogesterone - treated humans (including women or their male partners) or a macaque model. like estradiol, progesterone and synthetic progestins such as medroxyprogesterone are highly metabolized in the gut and liver with approximately 5% bioavailability. progestins such as medroxyprogesterone are not implicated as major perpetrators of drug interactions. in vitro studies suggest mrp2 and p - glycoprotein (pgp) (abcb1, pgp) inhibition, which might raise tdf bioavailability and slow tfv renal clearance, but in vivo studies are needed for confirmation. in contrast to these effects, the mtn001 study reported lower (20%) tfv plasma concentrations and tfv - dp in pbmc among women receiving injectable or oral contraception, but adherence or other variables may have confounded this finding and follow - up pk modeling of the same study did not report the same finding. like estrogens and progestins, spironolactone undergoes extensive hepatic metabolism including deacetylation by esterases followed by glucuronidation. several metabolites are pharmacologically active (eg, 7-alpha - thiomethyl spironolactone and canrenone). animal and in vitro studies suggested that spironolactone was an inducer of metabolism, possibly acting through pregnane x receptor, which would upregulate metabolic enzymes and transporters such as pgp and others. however, spironolactone is not implicated as a major perpetrator of drug interactions in vivo, suggesting a disconnect between in vitro / animal studies and the human profile. spironolactone does not influence furosemide (an organic anion transporter 1/3 substrate) pharmacokinetics in vivo, which is relevant for tfv, also an organic anion transporter 1/3 substrate (table 1). the product information for aldactone (spironolactone) lists drug interactions mainly involving hyperkalemia risk, (eg, concomitant angiotensin converting enzyme ace inhibitors), and a potential increase in digoxin concentrations (a pgp substrate). this profile is not consistent with major pregnane x receptor activation and enzyme / transporter induction in vivo, but human volunteer studies are needed to better define spironolactone drug interactions. this review did not identify conclusive experimental or theoretical evidence for drug interactions between tdf however, none of these medications are implicated as major perpetrators of drug interactions, and the classes use different metabolic pathways for clearance, suggesting a low theoretical likelihood for interactions in either direction (ie, effects on hormones or tdf ftc). thus, prep should continue to be offered to transgender women, even if additional research is planned or pending. nevertheless, several important research gaps were identified including the need for controlled drug interaction studies for these medications in transgendered women, including effects on renal clearances, intracellular tfv - dp and ftc - tp (and dntp) systemically or in relevant tissues, as well as hormone effects on hiv susceptibility and immunity. some of these are challenging questions, which could benefit from innovative strategies such as quantitative systems pharmacology modeling. in conclusion, despite low theoretical concerns for major interactions between tdf ftc and hormones, research is needed to provide informed guidance for prep use in transgendered women who are disproportionately impacted by hiv. | abstract : studies of tenofovir disoproxil fumarate (tdf)-emtricitabine (ftc)based preexposure prophylaxis (prep) have not focused on transgendered women who are at disproportionate risk of hiv acquisition. concerns exist for drug interactions between cross - sex therapy (estradiol, progestins, and spironolactone) with tenofovir disoproxil fumarate emtricitabine. this review assessed the experimental and theoretical risk for such drug interactions. it was found that none of these medications are implicated as major perpetrators of drug interactions, and the classes use different metabolic pathways for clearance, suggesting a low likelihood for interactions in either direction. subanalyses of transgender women in preexposure prophylaxis initiative suggested prep efficacy if adherence was high. nevertheless, several research gaps were identified, particularly the need for controlled interaction studies in transgendered women, including effects on renal clearance, intracellular tenofovir diphosphate and emtricitabine triphosphate in target cells, as well as hormone effects on hiv susceptibility and immunity. prep should continue to be offered to transgender women while additional research is planned or pending. |
this work was supported by the seed fund from the mechanobiology institute at the national university of singapore. | intracellular and extracellular mechanical environments have a significant impact on survival and proliferation of cells. while the extracellular signal - regulated kinase (erk) subfamily of map kinases plays critical roles in regulations of these cellular behaviors, activation of erk is affected by mechanical conditions of cells. we have recently found that erk is activated on contractile actomyosin bundles. erk activation on actomyosin bundles depends on tension in the bundles, which is generated by either myosin ii activity of external forces. in this addendum, we discuss a novel, potential role of actomyosin bundles in erk signaling and mechanical regulation of cell survival and proliferation. |
the site of capture of flounder in the mersey estuary (and in nearby liverpool bay), the method of capture, and the method of sample collection are described in previous articles (allen. data on vtg concentrations used in the present study were taken from these previous studies. however, the analysis of data by stage of maturation in the present article is new. the histological sections of gonads were also prepared during the course of the previous studies (allen. this determination was based upon the presence of the most advanced stage of gamete development that could be seen in histological sections of the gonads described below. ovaries : f1, primary oocytes only ; f2, cortical alveoli - stage oocytes as well as primary oocytes ; f3a, a mixture of cortical alveoli - stage and secondary (i.e., vitellogenic) oocytes ; f3b, predominantly secondary oocytes. testes : m1, spermatogonia only ; m2a, secondary spermatogonia ; m2b, primary spermatocytes through to spermatids ; m3a, some spermatozoa in addition to spermatocytes and spermatids ; m3a, spermatozoa only. to increase the numbers of fish in each grouping (for statistical purposes), we combined the subcategories (i.e., a and b) for the analyses of vtg, e2, and 11-kt concentrations. for steroid assay, plasma aliquots (100 l) were shaken vigorously with 50 l distilled water and 4 ml diethyl ether for 2 min. the solvent phase was poured into a glass tube (12 mm 75 mm), then evaporated in a water bath at 45c. the residue was redissolved in 400 l radioimmunoassay (ria) buffer and measured as described previously for e2 and 11-kt (scott. two 100-l aliquots were used for assay of e2, and an additional two 50-l aliquots were used for assay of 11-kt. a plasma sample spiked with 2 ng / ml sixty plasma samples from flounder collected in 1997 were also assayed twice (and by two different people) 4 years apart. the correlation coefficient between values generated by the two assays was 0.93, and the slope of the relationship was 1.03. data were statistically analyzed by analysis of variance followed by comparison of means using duncan s multiple range test at a significance level of 0.05. the numbers of fish caught at each maturation stage and at each sampling time in the mersey estuary between 1996 and 2003 are shown in table 1. for the purpose of analyzing steroid and vtg concentrations, we divided fish of both sexes into three groups that roughly equated to immature, on the borderline between immaturity and maturity, and mature. this last category encompassed the whole period of time from the first appearance of secondary oocytes and secondary spermatocytes up until the fish were ready to spawn. the histological and sex steroid data indicate that the secondary maturation phase in flounder lasts from september until march. mean concentrations of e2, 11-kt, and vtg in males and females, categorized by sampling date and stage of maturation, are summarized in tables 2 and 3. when only one or two fish were at a particular stage of maturation, the data were not included in the tables. the data in tables 2 and 3 were used to explore the relationship between sex, stage of maturation, and time of year versus vtg and sex steroid concentrations in flounder. mean e2 concentrations in males were low (between 0.08 and 0.22 ng / ml, table 2) and displayed no obvious relationship to the time of year or stage of sexual maturity. most important, there was no evidence that high vtg concentrations were caused by high e2 concentrations ; in fact, there was no relationship (r = 0.03 ; n = 158) between e2 and vtg concentrations in males (figure 1). we found no obvious trend in vtg concentrations of either mature or immature males throughout the year (figure 2) and no statistical difference between fish at different stages of maturation (table 2). in contrast, mean 11-kt concentrations in males showed a regular month - on - month increase between september and march (figure 3) and were also different between mature and immature fish (see statistics in table 2). mean e2 concentrations in females were strongly influenced by stage of maturation (table 3). e2 concentrations in immature females were never higher than those concentrations in either immature or mature males. in mature females, however, concomitant with the beginning of secondary oocyte development in september, e2 concentrations started to rise and reached a peak of 20 ng / ml at spawning time in march (figure 4). as with males, we saw no obvious trend or pattern in vtg concentrations between september and march (figure 5). values fluctuated between 2,800 and 18,000 g / ml. these concentrations were, nevertheless, in all cases higher than those found in immature females sampled at the same time (table 3). also, vtg concentrations in immature females were never at any sampling time significantly different from vtg concentrations in mature or immature males (analysis not shown). mature males caught in december 1996 had significantly lower mean 11-kt concentrations than mature males caught in december 2002 (table 4). however, there was no significant difference between mean 11-kt concentrations in males caught in february 2001 and those caught in february 2003 (table 4). mature females caught in december 1996 had significantly lower e2 concentrations than mature females caught in december 2002 (table 4). we also observed a significant difference between e2 concentrations in mature females caught in february 2001 and those caught in february 2003 (table 4). in all cases, the lower e2 concentrations were found in the years when vtg concentrations in males were higher, which suggests that the presence of edcs is associated with lower endogenous steroid synthesis. we firmly concluded from this study that the vtg found in the plasma of male flounder in the mersey estuary is not induced by endogenous e2. although this conclusion seems nave, substantial concentrations of e2 (> 1 ng / ml) have been found in blood plasma of reproductively mature males of a closely - related species, the north sea plaice (pleuronectes platessa) (scott. 2000 ; wingfield and grimm 1977). the concentrations of e2 in male flounder in the present study, however, were < 0.22 ng / ml, never higher than those found in immature females, and thus were unlikely to be a trigger for vtg synthesis. exogenous compound(s), acting directly on the estrogen receptor, are the more likely cause. the number of fish caught at each maturity stage, plus steroid concentration data, in each month clearly indicates that the maturity cycle in both males and females begins about september and culminates in spawning (in the open sea) in march and april. 2004a) of females caught in both the river mersey and the river dee estuaries between 1998 and 2000. unlike in those studies, vtg concentrations in mature females in the present study showed no relationship to month of capture. the reason for this finding is probably that our samples have been collected over a period of 7 years, during which the level of estrogenic contamination has varied dramatically from a high in 1996 to a relative low in 2003 (kirby. this high variability in contamination has probably obscured the cycle. a previous observation that estrogen - induced vtg concentrations in male flounder also have a seasonal cycle (kirby. 2004c) was also obscured by the high year - to - year variations in estrogenic edcs in the mersey. if, as seems likely, elevated vtg concentrations are mainly caused by estrogenic edcs, then one might hypothesize that these same edcs have a negative feedback effect on the secretion of gonadotropin from the pituitary and, hence, on 11-kt secretion by the testis in the males. the high dependence of 11-kt concentrations on stage of maturation and month of capture meant that, despite the large overall number of observations, it was only possible to examine this hypothesis via two pairs of data with the same month of capture and with a sufficient number of mature males for statistical analysis (table 4). in december 1996, when vtg concentrations were high, 11-kt concentrations were significantly lower than in december 2002, when vtg concentrations were 20 times lower. in february 2001 and 2003 though, when vtg concentrations were much closer together (although still significantly different), 11-kt concentrations were not significantly different from each other. in females in september, december, and february, mean e2 concentrations were significantly lower in the years when mean vtg concentrations were higher. although supported by statistical analysis, the finding that mean steroid concentrations are in most cases lower in the years when the effects of exogenous estrogens are higher must be interpreted with caution. at the moment, it is an association only and needs to be tested in a laboratory experiment. there are many other factors that could be the cause of 2- to 3-fold differences in steroid concentrations between years. the sampling in the present study covered 7 years ; therefore, another possible reason is that the differences were caused by deterioration of steroids during long - term storage. however, as indicated in materials and methods, there was no evidence of any deterioration of immunoreactivity of e2 in plasma samples that were stored for 4 years. bearing in mind that in no case is there necessarily a causal link, high plasma concentration of vtg in flounder have so far been associated with higher incidences of testicular malformation (gill. 1997, 1998), higher amounts of oocyte malformation (lye. 1998), more sperm abnormalities (gill. 2002), more pathological lesions in the liver and kidney (simpson. however, there has been no clear link with degree of intersex (allen. 1999a ; kirby. we stress the lack of a causal link because there are many other xenobiotics in estuaries (not just estrogens) that work through different mechanisms. these other compounds could cause the observed changes (without themselves affecting vtg concentrations). an important practical outcome of the present study was that vtg concentrations in immature females (i.e., those shown by histological examination to possess only primary oocytes) were not statistically different from those found in males. the importance of this finding is that, until now, estuary surveys (kirby. 2004a) have largely ignored data on vtg concentrations in females because of the uncertainty about the possible role of endogenous e2. however, our data suggest that, provided females can be proved immature by histological examination, their vtg concentrations can be pooled with those of males to increase the overall number of observations at each site. finally, an important lesson we have learned from the present study is that future field surveys should, if possible, be rigidly planned to catch flounder at the same places and at the same times each year. only by ensuring such consistency is there any point in measuring sex steroid concentrations in flounder. we have also already concluded that only with rigid scheduling of field surveys is it possible to obtain clear - cut data on long - term trends in estrogenic edc contamination in estuaries (kirby. few studies have been conducted on the population consequences of estrogenic edcs on marine species. in the present article, we show that high vtg concentrations in male and female flounder caught in the mersey estuary are not caused by endogenous e2. rather, evidence indicates that elevated vtg concentrations are associated with a reduction in the synthesis of e2 by females and of 11-kt by males. several mechanisms are possible, but the most likely is that the exogenous estrogenic edcs not only enhance the production of vtg by the liver but also lower sex steroid production by negative feedback on the hypothalamic pituitary axis. work on other species suggests that reductions of sex steroid levels may have an adverse effect on fecundity and fertility. | high concentrations of vitellogenin (vtg ; egg yolk protein) have previously been found in male flounder (platichthys flesus) from several uk estuaries ; these levels have been ascribed to the presence of estrogenic endocrine - disrupting compounds (edcs). gonadal abnormalities, including intersex, have also been recorded in these estuaries. however, there is no firm evidence to date that these two findings are causally linked or that the presence of estrogenic edcs has any adverse population effects. in the present study, we examined the relationship between concentrations of vtg and sex steroids (11-oxotestosterone in males and 17-estradiol in females) in specimens of flounder captured from the estuary of the river mersey. we first questioned whether the high concentrations of vtg in male and immature female flounder were indeed caused by a direct effect of exogenous edcs and not indirectly via the endogenous secretion of 17-estradiol. the data favored the direct involvement of estrogenic edcs. we then questioned whether the presence of estrogenic edcs not only stimulated inappropriate vtg synthesis but whether it might also have had a negative effect on endogenous steroid secretion. it should be noted that the predicted consequences of a drop in steroid secretion include smaller gonads, smaller oocytes, fewer numbers of sperm, and depressed spawning behavior. this question was more difficult to answer because of the strong effect of the seasonal reproductive cycle and stage of maturation on steroid concentrations. however, matched by month of capture and stage of maturation, both 17-estradiol in females and 11-keto - testosterone in males were in most cases significantly lower in those years when vtg concentrations were higher. |
a sensitive scalp is a frequent problem in daily clinical practice and often represents a major challenge for dermatologists. in particular, patients with hair loss or alopecia frequently also complain of scalp problems that must be taken into account for a successful treatment program. the main complaint of these patients relates to a sensitive scalp, for which various causes are taken into consideration : atopic disposition with tendency to sebostasis, irritation, and dermatitis ; type iv hypersensitivity to particular shampoo ingredients, such as cocamidopropyl betaine or preservatives ; age - related dryness of the skin (senile sebostasis) ; irritation from cosmetic hair treatments, such as changes of hair color or form ; and finally, some specific dermatological scalp conditions, such as seborrheic dermatitis, psoriasis, and their treatment sequels, especially those due to the prolonged use of topical corticosteroids. red scalp, red scalp syndrome, and diffuse red scalp disease are terms used synonymously for a condition, characterized by : persistent redness of the scalp, not explained by a specific dermatologic disease of the scalp, with or without sensation of itching or burning, refractory to topical corticosteroids and antiseborrheic agents, with aggravation in the sun, and the dermoscopic finding of teleangiectasia of the scalp [figure 1a and b ]. in some cases, symptoms of scalp sensitivity, itching, burning, and tension, are due to the drying out and irritating effect of alcohol - based topicals, and the propylene glycol contained as a solvent in these preparations. in others, the condition evolves in the vertex area, where the scalp is maximally exposed to ultraviolet radiation (uvr) and is the considered as a chronic uvr - related condition with analogies to rosacea. at the same time, there is increasing evidence that uvr exposure also exerts a negative effect on hair growth and alopecia, presumably by generating reactive oxygen species while hair papilla fibroblasts of the balding scalp have been shown to have an increased sensitivity of to oxidative stress. (a and b) red scalp syndrome, before and after 6 months treatment with a hamamelis - containing shampoo (erol energy shampoo) finally, scalp burn - out has been a term most recently coined for the condition of scalp sensitivity that seems not to tolerate any external stimuli anymore. in general, the burn - out syndrome is defined as a condition of emotional exhaustion with reduced capacity that is understood to represent a development line starting with enthusiastic idealism and leading through frustrating experiences to disillusionment, psychosomatic disorders, depression, and aggression. just as the syndrome is not recognized to represent a true medical condition by the scientific community, but is rather defined as a coping problem in icd-10, individuals are encountered in daily clinical practice with an analogous patient 's career about the condition of their scalp, which represents rather a question of problem - solving than a specific dermatologic condition. management of these conditions begins with protection of the scalp from further noxious environmental, medical, or cosmetic exposures, and acting toward its appeasement and restoration, while regaining the confidence of the patient. the first step consists in adapting the frequency of hair - washing to the condition of the scalp and hair. persons with greasy hair (seborrhea) should shampoo their hair often, sometimes even daily, whereas persons with dry hair (sebostasis) less often. a mild shampoo must be selected, avoiding ingredients with high irritation potential, or containing frequent contact allergens, such as cocamidopropyl betaine and parabens. of particular interest are herbal special care ingredients with an anti - irritant activity from traditional phytomedicine, such as chamomile (marticaria chamomilla), heart seed (cardiospermum halicacabum), peony (paeonia lactiflora), and the virginian witch hazel (hamamelis virginiana). when europeans originally encountered native americans, the american indian tribes dwelling in the northeastern regions utilized about 275 plants for medicinal purposes. the native northamerican virginian witch hazel h. virginiana [figure 2 ] was among the most important of those plants and was used for treatment of superficial skin wounds and inflammatory skin conditions. the native americans produced witch hazel extract by boiling the stems of the shrub and producing a decoction, which was used to treat inflammatory conditions. early puritan settlers in new england adopted this remedy from the natives. a missionary, dr. charles hawes, eventually learned of the preparation 's therapeutic properties and further determined that the product of the plant 's twigs was even more efficacious., who is credited with starting the commercial production of witch hazel extract in 1866 and establishing its wide use. from the middle of the 19 century the leaves (hamamelidis folium) as well as the bark (hamamelidis cortex) of the plant are used. the main constituents of the extract include : tannin, gallic acid, catechins, proanthocyanins, flavonoids (kaempferol, quercetin), essential oils (carvacrol, eugenol, hexenol), choline, and saponins. it is a strong anti - oxidant and astringent, which makes it useful as a natural remedy also for acne, psoriasis, eczema, aftershave applications, ingrown nails, cracked or blistered skin, and for treating insect bites. hamamelis twig (usable parts of the plant : bark and leaves) quality plays an important role. commonly used hamamelis distillate (hmm - water) elicits only low peaks for the active - principles. to achieve a rapid regeneration of the scalp and a positive course of the entire therapeutic process, the use of high - grade active principles from hamamelis obtained from wild stocks and sustainable production, is, therefore, essential. today, the following commercially used medicinal preparations are obtained from hamamelis, with the corresponding ingredients and applications, as listed in the table : erol energy hair care products,(apomedica, switzerland), based on virginian witch hazel, with the botanical name h. virginiana, have been specially developed for the care and treatment of the sensitive scalp. the shampoo is composed of extracts of h. virginiana and a shampoo base of mild tensidic character, free of cocamidopropyl betaine and parabens. originally, an observational study was carried out at the department of dermatology, university hospital of zurich, over a period of 6 months, from october 2009 to march 2010, during which the hamamelis - products erol energy shampoo and tonic were dispensed to patients complaining of scalp irritation, with or without clinical signs of inflammation. many patients had previously used various medicinal shampoos, mainly against seborrhea and dandruff, as well as topical corticosteroids without success. after a period of application of 4 weeks, the majority of patients reported an improvement of subjective manifestations of irritation, and rated the tolerance of both products as good to excellent. the main active principles are the flavonoids and tannins, as a natural source of antioxidants. furthermore, the additional herbals contained in erol energy hair tonic promote skin metabolism and blood flow (rosemary, field horsetail), act inhibitory on the proliferation of propionibacterium (rosemary), have anti - dandruff activity (rosemary), strengthen the connective tissue (field horsetail), and stimulate healthy hair growth (birch, stinging nettle). since then, in the period between august 2010 and december 2013, erol energy shampoo has been applied successfully in 1,373 patients (1,233 women and 140 men) at the center for dermatology and hair diseases professor treb to treat irritable scalp conditions or as concomitant treatment to minoxidil therapy for androgenetic alocepia. during this period, 369 (26.9%) experience shows that 2% and 5% topical minoxidil in an alcohol base for treatment of androgenetic often leads to irritation of the scalp, which can have a negative impact on the patience compliance. the complaints of patients and the redness of the scalp are often misinterpreted as seborrheic dermatitis and treated with anti - dandruff shampoos and alcohol - based topical corticosteroids (scalp applications), that only aggravate the problem through additional irritation. in shampoo form, witch hazel is particularly useful in the treatment of the red scalp syndrome and in preventing or soothing scalp irritation resulting from sustained use of ethanolic topical minoxidil solutions. the choice of appropriate hair - care products represents an important aspect in the management of the sensitive scalp and related conditions, such as the red scalp syndrome, and scalp burn - out. it should additionally be adapted to the specific requirements of different hair types, to age, washing habits, and most importantly, it should elicit a positive effect on problematic scalp conditions. with the erol energy hair - care products, the advantages of h. virginiana are available for successful treatment of the scalp, especially in the context of the problems associated with red scalp, scalp burn - out, and the use of topical minoxidil for androgenetic alopecia. | background : a sensitive scalp is a frequent problem in daily clinical practice and often represents a major challenge for dermatologists.objective:the objective was to evaluate the efficacy of a northamerican virginian witch hazel (hamamelis virginiana)-based shampoo and tonic (erol energy) for treatment of the sensitive scalp.methods:retrospective observational study of male and female patients given erol energy products in the period between august 2010 and december 2013 at the center for dermatology and hair diseases professor treb to treat irritable scalp conditions or as concomitant treatment to minoxidil therapy for androgenetic alocepia.results:shampoo was applied successfully in 1,373 patients (1,233 women and 140 men). patients reported improvement of subjective manifestations of irritation and rated tolerance of both products as good to excellent. during this period, 369 (26.9%) have received erol shampoo more than once.conclusions:the choice of appropriate hair - care products represents an important aspect in the management of the sensitive scalp and related conditions. with the erol energy hair - care products, the advantages of h. virginiana are available for successful treatment of the scalp, especially in the context of problems associated with red scalp, scalp burn - out, and the use of topical minoxidil for androgenetic alopecia. |
interferon tau (ifnt) is produced by trophectoderm cells of conceptuses of ruminant species and is the maternal recognition of the pregnancy signal. besides its critical roles in implantation and establishment of pregnancy in ruminants [1, 2 ], it has a plethora of physiological functions in various cell types such as macrophages, lymphocytes, and epithelial cells in humans and mice [35 ]. it is a type i interferon (ifn), which includes ifn alpha (ifna), ifn beta (ifnb), ifn delta (ifnd), and ifn omega (ifnw). after binding to a common receptor, ifna receptor 1 (ifnar1), and ifnar2, type i ifns affect the production of inflammatory cytokines such as interleukin- (il-) 1 and tumor necrosis factor (tnf-) [6, 7 ]. thus, type i ifns have widely recognized roles in inflammatory diseases, such as experimental allergic encephalomyelitis, multiple sclerosis, and spontaneous autoimmune diabetes [5, 810 ]. notably, unlike other members of type i ifn family, ifnt has few adverse effects and low cytotoxicity even at high dosages [11, 12 ], suggesting its therapeutic potential as an alternative to other type i ifns due to its anti - inflammatory effects. recent compelling findings about the anti - inflammatory effects of ifnt include lower nlrp3 (nucleotide - binding oligomerization domain - like receptor, pyrin domain - containing 3) inflammasome - driven il-1 secretion by human macrophages, mitigation of obesity - associated systemic tissue inflammation in mice, and promotion of th2 biased immune response in mice. the intestinal microbiota provides important benefits for the development of immune responses ; however, the disturbances in the intestinal microbiota are associated with numerous chronic inflammatory diseases [13, 14 ]. also, the effect of ifnt on expression of il-17 in the intestine is not known. the potential effect of ifnt on expression of il-17 is important as il-17 promotes local chemokine production to recruit monocytes and neutrophils to sites of inflammation that leads to development and pathogenesis of various autoimmune diseases, including rheumatoid arthritis, psoriasis vulgaris, multiple sclerosis, and inflammatory bowel diseases [15, 16 ]. in this study, the intestinal microbiota and expression of il-17 in the intestine were explored after two weeks of ifnt supplementation in a mouse model. the hypothesis is that ifnt supplementation alters intestinal microbiota and intestinal innate immunity in mouse model. this study used the escherichia coli f4-producing strain w25k (hereafter referred as etec ; o149:k91, k88ac ; lt, stb, east), which was originally isolated from a piglet with diarrhea. this study was conducted according to the guidelines of the laboratory animal ethical commission of the chinese academy of sciences. icr (institute for cancer research) mice (six weeks of age) were purchased from slac laboratory animal central (changsha, china). the mice were housed individually in a pathogen - free animal vivarium (temperature, 25c ; relative humidity, 53% ; 12 h dark/12 h light) and had free access to a standard rodent diet and drinking water. after three days of accommodation, mice were assigned randomly into two groups (ifnt and control ; n = 10/group). mice in the control group were fed the basal diet and normal water, while mice in ifnt group were fed the basal diet and water containing recombinant ifnt (40 g / l) for two weeks. the effective supplemental dosage of ifnt was established in previous study [5, 19 ]. at the end of the two weeks of experimental period, mice were sacrificed to collect contents of the lumens of the jejunum, ileum, and colon, as well as feces. after three days of accommodation to the conditions of the vivarium, icr mice were assigned randomly into two groups (etec and ifnt+etec ; n = 10/group). mice in ifnt+etec group were fed the basal diet and recombinant ifnt - supplemented water (40 g / l) for two weeks, while mice in etec group were fed the basal diet and had normal water. after two weeks of feeding, mice in both groups were inoculated with 10 cfus of etec w25k by oral gavage. at 6 hours after infection, all active mice were sacrificed to collect the jejunum, and the samples were stored at 80c until processed. dna was extracted from the luminal contents of the jejunum, ileum and colon, and feces using the qiagen qiaamp dna stool mini kit according to the protocol for isolation of dna. equal amounts of dna from six different mice were pooled to generate one common sample for each type of sample (i.e., control versus ifnt, intestinal source, and feces). the v4-v5 region of the bacterial 16s ribosomal rna gene was amplified by pcr using primers 515f 5-barcode - gtgccagcmgccgcgg-3 and 907r 5-ccgtcaattcmtttragttt-3, where barcode is an eight - base sequence unique to each sample. illumina miseq sequencing and general data analyses were performed by a commercial company (biotree, shanghai, china). miseq pe libraries, miseq sequencing, and further analyses were based on previous work. total rna was isolated from liquid nitrogen frozen and ground jejunum, ileum, and colon using trizol regent (invitrogen, usa) and then treated with dnase i (invitrogen, usa) according to the manufacturer 's instructions. synthesis of the first strand (cdna) was performed using oligo (dt) 20 and superscript ii reverse transcriptase (invitrogen, usa). the rt - pcr experiment was conducted according to previous studies [18, 21 ]. data shown are the means the standard error of the mean (sem). all statistical analyses for data were performed using spss 16.0 software (chicago, il, usa). to investigate the effect of ifnt supplementation on mouse growth performance, feed intake, water intake, and body weight were monitored in ifnt - supplemented mice and control mice. with two weeks of ifnt supplementation, the averages for feed intake and water intake for ifnt - supplemented mice were significant (p < 0.05) higher than for control mice (figures 1(a) and 1(b)). however, ifnt supplementation had no significant effect on body weight of mice (figure 1(c)). to explore the influence of ifnt supplementation on the intestinal microbiota, we analyzed the intestinal microbiota at end of two weeks of ifnt supplementation with 16s rdna sequencing (table 1). for microbiota in the jejunum, both shannon and simpson indices demonstrated that the diversity of microbiota in mice with ifnt supplementation was higher than the control mice, while the richness indices (ace and chao) suggested that the community richness in ifnt - supplemented and control mice was similar (table 1). for the microbiota in the ileum, the diversity of microbiota (shannon and simpson) and richness indices (ace) for mice with ifnt supplementation were higher than that of control mice (table 1). for the microbiota in the colon, the diversity of microbiota (shannon) and richness indices (ace and chao) were similar for ifnt - supplemented and control mice (table 1). for the fecal microbiota, microbial diversity (shannon and simpson) in mice with ifnt supplementation was lower than for control mice, while the community richness (ace and chao) for ifnt - supplemented mice was similar to that for control mice (table 1). collectively, ifnt supplementation increases the diversity of microbiota in small intestine, while decreasing the diversity of microbiota in the feces. the taxonomy of the intestinal microbiota was assessed using a taxon - dependent analysis and the rdp classifier. seven phyla, including one candidate division (tm7), were found in the microbiota of the jejunum for all samples, including six phyla in the control mice and seven phyla in mice with ifnt supplementation. eight phyla were found in the microbiota of the ileum of all samples, including six phyla in control mice and seven phyla in mice with ifnt supplementation. ten phyla were found in the microbiota of the colon of all samples, including ten phyla in control mice and eight phyla in mice with ifnt supplementation. ten phyla were found in the microbiota of the feces of all samples, including nine phyla in control mice and ten phyla in mice with ifnt supplementation. for the jejunum, the two most abundant phyla in ifnt - supplemented mice, accounting for approximately 99% of all assigned sequence readings, were firmicutes (94.5%) and bacteroidetes (4.4%) (figure 2(a)). in control mice, most abundant phyla were firmicutes (97.6%) and bacteroidetes (1.2%) (figure 2(a)). for the ileum, the three most abundant phyla in ifnt - supplemented mice were firmicutes (95.3%), candidate_division_tm7 (2.3%), and proteobacteria (1.1%) (figure 2(b)), while in control mice, they were firmicutes (97.7%), proteobacteria (1.5%), and bacteroidetes (0.5%) (figure 2(b)). for the microbiota in the colon, the three most abundant phyla in ifnt - supplemented mice were bacteroidetes (72.2%), firmicutes (23.0%), and proteobacteria (4.1%) (figure 2(c)), while they were bacteroidetes (75.8%), firmicutes (18.8%), and proteobacteria (4.3%) in control mice (figure 2(c)). for feces, the three most abundant phyla in ifnt - supplemented mice were bacteroidetes (43.6%), firmicutes (48.1%), and proteobacteria (5.9%) (figure 2(d)), while bacteroidetes (53.2%), firmicutes (39.2%), and proteobacteria (5.3%) were most abundant for control mice (figure 2(d)). for the microbiota of the jejunum, the two most abundant genera in ifnt - supplemented mice, accounting for approximately 99% of all assigned sequence readings, were lactobacillus (94.3%) and s24 - 7_norank (4.9%) (figure 3(a)). in control mice, they were lactobacillus (97.3%) and s24 - 7_norank (1.2%) (figure 3(a)). for the ileum, the five most abundant genera in ifnt - supplemented mice were lactobacillus (93.3%), candidatus - saccharimonas (2.3%), allobaculum (1.2%), desulfovibrio (1.1%), and enterorhabdus (0.6%), while they were lactobacillus (97.3%), candidatus - saccharimonas (0.3%), allobaculum (0.1%), desulfovibrio (1.5%), and enterorhabdus (0.07%) in control mice (figure 3(b)). for the microbiota in the colon, ifnt supplementation increased the percentages of blautia (7.0% versus 5.1%), bacteroides (6.4% versus 3.7%), alloprevotella (5.2% versus 1.3%), and lactobacillus (4.0% versus 2.5%), compared with control mice (figure 3(c)). for the fecal microbiota, ifnt supplementation increased the percentages of lactobacillus (30.0% versus 16.7%), bacteroides (3.3% versus 1.8%), and allobaculum (4.5% versus 0.4%), while decreasing the blautia (2.7% versus 6.5%) compared with control mice (figure 3(d)). collectively, ifnt supplementation affects the composition of intestinal microbiota in mice, especially those for the colon and feces. the effect of ifnt supplementation on activation of intestinal innate immunity in mice was further explored, focusing on the expression of polymeric immunoglobulin receptor (pigr), mucin-4, cryptidin-1, cryptidin-4, cryptidin-5, il-17, interferon gamma (ifn-), lysozyme (lyz), and j - chain in the jejunum, ileum, and colon [18, 21 ]. in the jejunum, ifnt supplementation significantly decreased the expression of cryptidin-5, il-17, ifn-, and lyz, while it had little effect on the expression of the other transcripts (figure 4(a)). ifnt supplementation had no significant effect on the expression of those transcripts in the ileum of mice (figure 4(b)). in the colon, ifnt supplementation significantly lowered the expression of cryptidin-1 and il-17 but had little effect on the expression of the other transcripts (figure 4(c)). as ifnt supplementation decreased the expression of il-17 in the jejunum and colon, we further validated the effect of ifnt to decrease expression of il-17 in etec infected mouse model. we found that etec infection promotes the il-17 expression in the mouse jejunum at 6 hours after infection (w. ren and y. yin, unpublished results). after two weeks of ifnt supplementation, expression of il-17 in the jejunum was significantly lower in ifnt - supplemented mice, compared to that of nonsupplemented mice during etec infection (figure 4(d)). thus, ifnt supplementation reduces the expression of the inflammatory cytokine, il-17, in the intestine of mice. in this study, although two weeks of ifnt supplementation increases the mouse feed and water intake but has little effect on body weight of mice. results of a previous study revealed that ifnt supplementation (8 g / kg bw / day) reduces body weight beginning at 3 weeks after ifnt supplementation in zucker diabetic fatty rats, while lower dose of ifnt supplementation (4 g / kg bw / day) has no significant effect on body weight during 8 weeks of ifnt treatment, indicating that the effect of ifnt on body weight depends on dosage and duration of ifnt treatment. however, in a mouse model with high - fat or low - fat diet, 12 weeks of ifnt treatment does not significantly affect body weight. however, ifnt supplementation has little effect on feed intake and water intake in those investigations [4, 5 ]. in the present study, ifnt supplementation increases the microbial diversity in the jejunum and ileum, while decreasing the microbial diversity in the feces of mice. the gut microbiota affects numerous biological functions [22, 23 ] and is linked to the pathogenesis of various diseases, such as obesity, cancer, and liver cirrhosis. the influence of the gut microbiome on host physiological functions and the pathogenesis of disease in hosts may result from the activities of the microbiome and its metabolic products. it is widely accepted that body weight is associated with the composition of intestinal microbiome and its metabolic capacity. an increase in the relative proportion of firmicutes is linked to obesity as firmicutes ferments plant polysaccharides to produce short - chain fatty acids (scfa), which provides additional energy for the host. in phyla, ifnt supplementation decreases the percentage of firmicutes, while increasing the bacteroidetes in the jejunum and ileum. however, ifnt supplementation increases the percentage of firmicutes, while decreasing the bacteroidetes in the colon and feces. thus, ifnt supplementation may regulate body weight and metabolism through effects on the intestinal microbiota. at the genus level, ifnt supplementation decreases the lactobacillus in the jejunum and ileum but increases the percentage of lactobacillus and bacteroides in the colon and feces. lactobacillus has critical roles in the intestine to combat gastrointestinal bacterial pathogens and rotaviruses through competitive metabolic interactions and the production of antimicrobial molecules. bacteroides are known for their capacity to metabolize a wide variety of oligosaccharides from the intestinal luminal, such as xylan, starch, and host - derived glycans. thus, results of the present study suggest that ifnt supplementation affects those functions of the intestinal microbiome in mice. ifnt supplementation inhibits intestinal expression of il-17, which suggests that ifnt reduces intestinal inflammation. il-17 is produced by inducible th17 (ith17) cells and natural th17 (nth17) cells and regarded as an intestinal proinflammatory cytokine. il-17 can activate nuclear factor b (nf-b) transcription factors, extracellular signal - regulated protein kinase (erk1 and erk2), c - jun n - terminal kinases (jnk-1 and jnk-2), and mitogen - activated protein kinases (p38 mapks) pathways, leading to upregulation of expression of inflammatory cytokines, such as il-6 and il-1. recent investigations have revealed that mammalian target of rapamycin (mtor) is a critical signaling pathway for th17 responses and il-17 expression [3337 ]. the mtor signaling regulates il-17 expression through hypoxia - inducible factor 1 (hif-1) and ribosomal protein s6 kinase (s6k : s6k1 and s6k2) [3740 ]. mtor signaling activates hif-1, which promotes il-17 expression by activating rort (a key transcriptional regulator of th17 cells) and mediating degradation of foxp3 (a key transcriptional regulator of treg cells). s6k1 promotes the expression of early growth response protein 2 (egr2), which then inhibits growth factor independent 1 transcription repressor (gfi1), which can negatively regulate expression of il-17 without affecting rorc expression [37, 38 ]. s6k2 (the nuclear - localized counterpart of s6k1) binds to rort to promote nuclear translocation of rort, which can complex with hif- and p300 in the nucleus to promote expression of il-17 [3739 ]. thus, the underlying mechanism by which ifnt supplementation reduces intestinal il-17 expression is of interest. the effect of ifnt supplementation to decrease expression of il-17 in the intestine indicates a potential therapeutic application of ifnt to mitigate intestinal inflammatory diseases associated with expression of il-17. in conclusion, ifnt supplementation affects the diversity and composition of the intestinal microbiota and decreases expression of il-17 in mice. the findings from this study are significant in understanding the physiological and immunological functions of ifnt in treatment of inflammatory diseases. | this study was conducted to explore the effects of interferon tau (ifnt) on the intestinal microbiota and expression of interleukin 17 (il-17) in the intestine of mice. ifnt supplementation increased microbial diversity in the jejunum and ileum but decreased microbial diversity in the feces. ifnt supplementation influenced the composition of the intestinal microbiota as follows : (1) decreasing the percentage of firmicutes and increasing bacteroidetes in the jejunum and ileum ; (2) enhancing the percentage of firmicutes but decreasing bacteroidetes in the colon and feces ; (3) decreasing lactobacillus in the jejunum and ileum ; (4) increasing the percentage of blautia, bacteroides, alloprevotella, and lactobacillus in the colon ; and (5) increasing the percentage of lactobacillus, bacteroides, and allobaculum, while decreasing blautia in the feces. also, ifnt supplementation decreased the expression of il-17 in the intestines of normal mice and of an intestinal pathogen infected mice. in conclusion, ifnt supplementation modulates the intestinal microbiota and intestinal il-17 expression, indicating the applicability of ifnt to treat the intestinal diseases involving il-17 expression and microbiota. |
opioid receptors in the periaqueductal gray (pag) contribute to a wide range of behaviors. these include nociceptive modulation, cardiovascular regulation, thermoregulation, and locomotor activity [15 ]. although mu - opioid receptors (mor) are known to contribute to pag mediated antinociception [6, 7 ], less is known about the contribution of delta - opioid receptors (dors). although antinociception has been produced by the administration of dor agonists into the pag, these effects are mild compared to the antinociception produced by mor agonists [810 ]. chronic treatment with morphine causes the spinal density of dors to shift from the cytoplasm to the plasma membrane [11, 12 ]. a similar shift in dors from the cytoplasm to the plasma membrane appears to occur in the pag. swim stress causes an increase in dor density in the plasma membrane of pag neurons. in vitro recordings show that dor agonists do not alter gabaergic synaptic transmission in pag neurons from drug - naive animals [1517 ], but inhibit gabaergic ipscs in mice treated chronically with morphine. the behavioral significance of enhanced dor expression in the pag has not been characterized. the increased expression of dor in the pag of morphine tolerant rats could be a compensatory mechanism for the loss of antinociception at the mu - opioid receptor. increased expression of dors in the spinal cord has been shown to enhance the antinociceptive effect of intrathecal administration of the dor agonist deltorphin ii. the objective of the present study was to determine the behavioral consequences of activating dors in the pag following induction of morphine tolerance. given the widespread effects mediated by the pag, mobilization of dors to the plasma membrane could contribute to a wide range of behaviors. the enhanced antinociceptive effects of dor agonists at the spinal level suggest that the administration of dor agonists into the vpag of morphine tolerant rats will produce antinociception. this hypothesis will be tested by examining the antinociceptive and locomotor effects of microinjecting the dor agonist deltorphin into the vpag of rats made tolerant to morphine. male sprague - dawley rats (240360 g) were anesthetized with pentobarbital and implanted with a guide cannula aimed at the ventrolateral pag using stereotaxic techniques (from lambda : ap = + 1.2 mm, ml = 0.6 mm, and dv = 4.6 mm). the guide cannula was 9 mm long and affixed to two screws in the skull with dental cement. all injections and testing were conducted during the dark phase of a 12-hour light / dark cycle in a dimly illuminated room. experiments were conducted in accordance with the national institutes of health guide for the care and use of laboratory animals. efforts were made to minimize the number and potential suffering of the experimental subjects. nociception was assessed using the hot plate, tail withdrawal, and formalin tests. the hot - plate test (iitc, woodland hills, calif, usa) consisted of measuring the latency for a rat to lick a hind paw when placed on a 52c plate. tail withdrawal measured the latency to move the tail when placed in 52c water. the formalin test consisted of rating pain behavior on a 03 scale following injection of formalin (2% in 50 ul) into the plantar surface of the hind paw. the values on this scale are 0 = normal behavior ; 1 = paw touches the ground without bearing weight ; 2 = paw does not touch the ground ; 3 = paw is above the ground and licked. four days after surgery, an injection cannula was inserted through the guide cannula, but no drug was injected. this process habituates rats to the injection procedure and diminishes behavioral effects produced by cell damage on the test day. testing began one week following surgery, deltorphin ii (1 g/0.5 l) or saline was microinjected into the vpag. an 11 mm injection cannula was inserted into the guide cannula while the rat was gently restrained by hand. drugs were injected at a rate of 0.1 ul/10 s. the injection cannula remained in place an additional 20 seconds to minimize drug flow up the cannula track. the stylet was reinserted into the guide cannula and the rat was returned to its home cage. morphine injectionsthe objective of this experiment was to determine the behavioral effects of microinjecting deltorphin into the vpag in rats made tolerant to repeated subcutaneous injections of morphine. morphine (5, 10, or 20 mg / kg) or saline (1 ml / kg) was administered twice a day (at 9:30 and 15:00) for 3.5 days. nociception was assessed with the hot plate and tail flick tests 30 minutes after the injection on trials 1 and 7, but not after injections on trials 26. this procedure limits changes in nociception from repeated testing [21, 22 ]. six hours after the last subcutaneous injection, all rats were injected with deltorphin (1 g/0.5 l) into the vpag. a subset of these rats was tested again on the hot plate 50 minutes after deltorphin administration (n = 9, 5, 10, and 8 for groups tested with saline, 5, 10, and 20 mg / kg of morphine, resp.). nociception was assessed using the formalin test in the other rats (n = 8, 6, and 9 for groups tested with saline, 10, and 20 mg / kg of morphine, resp.).locomotor activity was assessed for 30 minutes beginning immediately after the 20 minutes hot - plate test. activity was assessed by placing the rat into a chamber (25.1 47 cm) with 7 photobeams spaced 5.1 cm apart (san diego instruments, san diego, calif, usa). the average number of photobeams disrupted each minute was measured and averaged over 10 minute intervals for 30 minutes. the behavior of the rat was examined every 5 minutes during the locomotor test in an attempt to determine the reason for the changes in locomotion (e.g., grooming, sleeping, and freezing). the objective of this experiment was to determine the behavioral effects of microinjecting deltorphin into the vpag in rats made tolerant to repeated subcutaneous injections of morphine. morphine (5, 10, or 20 mg / kg) or saline (1 ml / kg) was administered twice a day (at 9:30 and 15:00) for 3.5 days. nociception was assessed with the hot plate and tail flick tests 30 minutes after the injection on trials 1 and 7, but not after injections on trials 26. this procedure limits changes in nociception from repeated testing [21, 22 ]. six hours after the last subcutaneous injection, all rats were injected with deltorphin (1 g/0.5 l) into the vpag. a subset of these rats was tested again on the hot plate 50 minutes after deltorphin administration (n = 9, 5, 10, and 8 for groups tested with saline, 5, 10, and 20 mg / kg of morphine, resp.). nociception was assessed using the formalin test in the other rats (n = 8, 6, and 9 for groups tested with saline, 10, and 20 mg / kg of morphine, resp.). locomotor activity was assessed for 30 minutes beginning immediately after the 20 minutes hot - plate test. activity was assessed by placing the rat into a chamber (25.1 47 cm) with 7 photobeams spaced 5.1 cm apart (san diego instruments, san diego, calif, usa). the average number of photobeams disrupted each minute was measured and averaged over 10 minute intervals for 30 minutes. the behavior of the rat was examined every 5 minutes during the locomotor test in an attempt to determine the reason for the changes in locomotion (e.g., grooming, sleeping, and freezing). continuous morphine administrationrats were surgically implanted with a guide cannula aimed at the vpag as described in experiment 1. one week later, tolerance was induced by implanting two 75 mg morphine pellets under the skin of the upper back while rats were briefly anesthetized with halothane. nociception was assessed using the hot - plate test 2 hours following pellet implantation.rats were returned to the test room 3 days after pellet implantation and allowed to habituate for 30 minutes. nociception was assessed at the end of this period using the hot - plate test to determine whether tolerance had developed. following this baseline test, both morphine and placebo - treated rats were injected with deltorphin (1 ug/0.5 ul) into the vpag. nociception was assessed using the hot - plate test 30 and 60 minutes after the deltorphin microinjection. rats were surgically implanted with a guide cannula aimed at the vpag as described in experiment 1. one week later, tolerance was induced by implanting two 75 mg morphine pellets under the skin of the upper back while rats were briefly anesthetized with halothane. nociception was assessed using the hot - plate test 2 hours following pellet implantation. rats were returned to the test room 3 days after pellet implantation and allowed to habituate for 30 minutes. nociception was assessed at the end of this period using the hot - plate test to determine whether tolerance had developed. following this baseline test, both morphine and placebo - treated rats were injected with deltorphin (1 ug/0.5 ul) into the vpag. nociception was assessed using the hot - plate test 30 and 60 minutes after the deltorphin microinjection. following testing, the microinjection site was marked by injecting cresyl violet (0.2 l) into the pag. the brain was removed, placed in formalin (10%), sectioned coronally (50 m), and viewed under a microscope to localize the injection site. only rats with injection sites in or immediately adjacent to the vpag were included in data analysis. the effects of morphine pretreatment were compared to saline or placebo - treated controls using a t - test or analysis of variance. experiment 1. repeated morphine injectionssystemic administration of high doses of morphine (5, 10, and 20 mg / kg) produced maximal antinociception on trial 1 (see figure 1). a significant decrease in antinociception was evident with repeated administration from trial 1 to 7 (f(1,56) = 53.446, p the difference between groups was caused by a slight increase in the hot - plate latency of rats pretreated with 20 mg / kg of morphine and a slight decrease in latency in rats pretreated with 10 mg / kg (see figure 2). although the difference between these groups was statistically significant (bonferroni, t = 2.420, p the difference between groups was caused by a slight increase in the hot - plate latency of rats pretreated with 20 mg / kg of morphine and a slight decrease in latency in rats pretreated with 10 mg / kg (see figure 2). although the difference between these groups was statistically significant (bonferroni, t = 2.420, p.05), suggesting that deltorphin administration did not increase antinociception beyond what was already present in rats with morphine pellets. implantation of morphine pellets produced an increase in hot - plate latency compared to placebo - treated rats when assessed at 1 hour (36.1 3.9 versus 20.5 2.4 seconds ; t(8) = 3.865, p.05), suggesting that deltorphin administration did not increase antinociception beyond what was already present in rats with morphine pellets. the present data demonstrate that repeated morphine administration alters the response of vpag neurons to the dor agonist deltorphin. although pag neurons contribute to a wide range of behaviors, the change in response to deltorphin microinjection was specific to locomotor activity. microinjection of deltorphin into the vpag produced a consistent decrease in activity in rats pretreated with morphine. this decrease in activity was caused by a drastic change in behavior from exploring and grooming to crouching and lying along the edge of the cage. in contrast, microinjection of deltorphin produced a mild antinociception that was not altered in a consistent manner by prior morphine administration. the descending modulatory system that runs from the pag to rostral ventromedial medulla (rvm) to spinal dorsal horn plays an important role in the antinociceptive effects of both mor and dor agonists [9, 2528 ]. the antinociception produced by microinjection of dor agonists into the pag is weak compared to morphine administration [9, 10 ]. however, dors are located in the pag and these receptors appear to move from the cytoplasm to the plasma membrane following stress. the density of dors on the membrane has also been shown to increase in spinal neurons following chronic exposure to morphine [11, 12 ]. the present data show that microinjection of deltorphin into the vpag had modest effects on nociception. rats pretreated with 10 mg / kg of morphine showed a slight hyperalgesia compared to saline - pretreated rats injected with deltorphin into the vpag. rats pretreated with 20 mg / kg of morphine showed a slight increase in hot - plate latency following deltorphin microinjection. the lack of effect of deltorphin in modulating nociception is surprising given that spinal administration of deltorphin following chronic morphine administration produces antinociception. the lack of a consistent change in nociception following deltorphin administration could be caused by an inability of the morphine administration procedure to mobilize dors to the plasma membrane. although possible, this explanation seems unlikely given that a decrease in activity was produced by microinjection of deltorphin into the pag. moreover, we used two different procedures to induce tolerance (repeated injections and continuous administration) that closely match previous studies reporting changes in dors [11, 12, 18 ]. finally, mobilization of dors to the plasma membrane is associated with morphine tolerance and the rats in the present study showed clear signs of tolerance to the antinociceptive effects of morphine. in vitro electrophysiological recordings reveal dor - mediated inhibition of gabaergic ipscs in tissue from mice pretreated with morphine, but no effect of dor agonists in pag slices from animals that have not been exposed to morphine [1517 ]. this inhibition of gaba input is similar to the effect produced by administration of mor agonists into the pag. these data suggest that microinjection of dor agonists into the pag of morphine tolerant rats should produce antinociception. however, the present data show no consistent antinociceptive effect following deltorphin microinjection into the pag of morphine tolerant rats. in contrast, microinjection of deltorphin into the vpag of morphine pretreated - rats caused a clear and consistent decrease in locomotor activity. thus, it appears that dors compensate for the locomotor, but not the antinociceptive effects associated with morphine tolerance in the vpag. the immobility produced by morphine microinjection into the vpag appears to be part of a defensive freezing response [3033 ]. however, the decrease in activity produced by microinjection of deltorphin into the vpag reported here does not appear to be caused by fear - induced freezing. microinjection of deltorphin caused rats to crouch and lay along the edge of the cage as if the rats were ill or dysphoric. this effect appears to be consistent with previous research showing that deep tissue pain sufficient to induce recuperative behavior activates vpag neurons. given that stress increases the density of dors on the plasma membrane, activation of these receptors may contribute to recuperative behavior. one hypothesis is that the recuperative behavior mediated by the vpag is part of a coordinated response triggered by severe hemorrhage that includes hypotension. severe blood loss has been shown to activate neurons in the vpag, and inactivation of the vpag [2, 36 ] or microinjection of the dor antagonist naltrindole into the pag blocks the hypotension produced by hemorrhage. future studies are needed to determine whether activation of dors in the pag alters blood pressure. the decrease in locomotor activity caused by microinjection of deltorphin into the vpag of morphine tolerant rats is consistent with previous data showing that dor density on the plasma membrane increases following chronic morphine administration. pag dors could contribute to morphine tolerance [3840 ], behavioral changes related to stress, or hypovolemic shock [35, 37 ], but do not appear to contribute to antinociception. that is microinjection of deltorphin into the pag did not produce antinociception regardless of how tolerance was induced (repeated injections or continuous administration), test used to assess nociception (hot plate, tail flick, and formalin tests), or test times (20 and 50 minutes). | chronic morphine administration shifts delta - opioid receptors (dors) from the cytoplasm to the plasma membrane. given that microinjection of morphine into the pag produces antinociception, it is hypothesized that the movement of dors to the membrane will allow antinociception to the dor agonist deltorphin ii as a way to compensate for morphine tolerance. tolerance was induced by twice daily injections of morphine (5, 10, or 20 mg / kg, subcutaneous) for 3.5 days. microinjection of deltorphin into the vpag 6 hours after the last morphine injection produced a mild antinociception that did not vary in a consistent manner across morphine pretreatment doses or nociceptive tests. in contrast, deltorphin caused a decrease in activity in morphine tolerant rats that was associated with lying in the cage. the decrease in activity and change in behavior indicate that chronic morphine administration alters dors in the vpag. however, activation of these receptors does not appear to compensate for the decrease in antinociception caused by morphine tolerance. |
selaginella doederleinii hieron, as a traditional chinese medicine, is a well - known perennial pteridophyte plant growing in south and southwestern china at the low altitude. it has the function of eliminating wind, scattering frigidity, detumescence, and treating cough. in the reported research, different types of compounds from selaginella doederleinii, including biflavonoid, alkaloid, xylogen, sterol, and organic acid, have been exhibited [26 ]. some researches have proposed that the potential antioxidants in selaginella doederleinii are biflavonoids, including amentoflavone, robustaflavone, heveaflavone, and robustaflavone 4, 4-o - dimethyl ether (see figure 1). most biflavonoids, just like apigenin and its methoxyl / hydroxyl substituents, have prominent antioxidant characteristics and show a wide range of biological activity, such as cancer chemopreventive properties, anti - inflammatory, antimicroorganism, and antioxidative effects [813 ]. traditional screening for antioxidant activity components from natural plants is a time - consuming, inefficient, and costly method, which can not meet the need of the development of modern scientific research. therefore, it is necessary to find out more new and efficient online techniques to search the active compounds from natural products. this study aimed to develop a rapid, efficient, and stable method to screen and identify the main antioxidative components in the extracts from selaginella doederleinii. the online 2,2-diphenyl-1-picrylhydrazyl - ultra - high performance liquid chromatography - q - time - of - flight mass spectrometry (dpph - uplc - q - tof / ms) technique was used for the first time to screen and identify antioxidants from ethyl acetate extract in this study. nine active biflavonoids were yielded and included amentoflavone (1), robustaflavone (2), bilobetin (3), 4-methoxy robustaflavone (4), podocarpusflavone a (5), hinokiflavone (6), ginkgetin (7), putraflavone (8), and heveaflavone (9). among them, compounds 3 and 8 in this study were first reported from selaginella doederleinii. herbal materials were identified as selaginella doederleinii by vice professor yang jianwen from the department of pharmacy in zunyi medical college. a voucher specimen (20120923) has been preserved in the key laboratory of natural pharmaceutical chemistry, zunyi medical college. 2,2-diphenyl-1-picrylhydrazyl (dpph) was purchased from sigma pure chemical industry (berlin, germany). butylated hydroxytoluene (bht), ascorbic acid, and quercetin were purchased from bdh company (poole, england). acetonitrile of hplc grade was provided by merck chemical industry (darmstadt, germany). 100.0 g of dried selaginella doederleinii was powdered and extracted three times (each for 2 h) with 95% ethanol (1.0 l). the extracting solution was filtrated, merged, and centrifuged at 4000 rpm under 5c. then 18.37 g extracts were finally obtained from selaginella doederleinii, which were then dissolved in warm water and used for liquid - liquid extraction with petroleum ether, ethyl acetate, and n - butyl alcohol successively. the three fractions were concentrated, dried, and obtained 0.52 g, 4.19 g, and 6.64 g, respectively. the dpph oxidative assay is widely used for quantitative determination of antioxidant capacity in biological samples and food. in short, each of polarity fractions was dissolved in methanol (4 mgml in methanol) and diluted different concentrations sample (0.08~0.14 mgml in methanol). 1.0 ml of the sample was mingled with 4.0 ml dpph solution (0.6 mgml in methanol). the mixture was completely shaken, reacted, and left at room temperature in the dark for 60 min. the absorbance was measured at 517 nm in an ultraviolet spectrophotometer (shimadzu uv - vis 160a, japan). the percentage of dpph inhibition was calculated by using the following equation : (1)i%=abasab100%, where i is the inhibition percentage, a b is the absorbance of the blank sample, and a s is the absorbance of the test sample. sample concentration providing 50% inhibition (ic50) was calculated by plotting the inhibition percentage against different concentrations sample. all samples of the test were run in triplicate and the average value was calculated. the extract from selaginella doederleinii was mingled with dpph solution of different concentrations (0.16, 0.32, and 0.48 mml) at the ratio of 1 : 1 (w / v). the mixture was completely shaken, produced reaction, and was left at room temperature in the dark for 60 min. then, the mixture was filtered through a 0.45 m pinhole - membrane filter and injected into the uplc system. for the control sample methanol the mixture and control samples were analyzed in an acquity uplc system (waters corp., milford, ma, usa) equipped with ultraviolet (uv) and a beh c18 (100 2.1 mm, 1.7 m). formic acid (0.1%) and acetonitrile were, respectively, used as the mobile phases a and b. the solvent gradient was used as follows : 3080% b between 0 and 25 min, 8095% b between 25 and 27 min, and 95100% b between 27 and 30 min. the flow rate was set at 0.6 ml / min at 30c and the injection volume of the sample was 5 l. in comparison to the uplc chromatographic profiles of the reaction samples and the control samples, the molecular weight and structure of the screened antioxidants were identified by q - tof / ms. high - purity nitrogen was utilized as a nebulizer, auxiliary gas was set at a 2500 l / h, and flow rate was set at 350 l / h. argon was used as the collision gas at a flow rate of 50 l / h under 1000 degrees. electrospray ionization (esi) capillary voltage was set at + 3.0 kv for positive ion mode. the sample cone voltage was set at 33 v and the collision energy (ce) was set at 2.5 ev. the mass scan was in the range of 2001500 m / z and sweeping time was 1 s. antioxidant activity of petroleum ether, ethyl acetate, and n - buoh fractions was then evaluated by dpph radical scavenging activity. as shown in table 1, compared with bht, ascorbic acid, and quercetin, ethyl acetate fraction has the very good antioxidant activity among different polarity fractions. therefore, the antioxidants were screened and identified from ethyl acetate fraction of selaginella doederleinii with the online dpph - uplc - q - tof / ms assay. according to the uplc conditions in section 2.4, the quick analysis results of the potential antioxidants from selaginella doederleinii are shown in figure 2. it was concluded that the peak areas (pas) of the antioxidant would obviously decrease in the uplc chromatogram after reaction with dpph. therefore, the untreated and dpph - treated ethyl acetate fraction from selaginella doederleinii were analyzed by the optimized uplc separation conditions as stated. through the comparison of the uplc chromatograms of untreated and dpph - treated samples, the pas of nine main peaks were all decreased significantly. and nine peaks were detected and isolated from the sample. their retention time was 5.25, 6.19, 7.28, 8.32, 8.81, 9.27, 10.92, 11.47, and 14.92 min, respectively (see figure 2). the results indicated that these nine peaks were all antioxidants existing in the ethyl acetate fraction. in order to estimate the radical scavenging capacity of the nine antioxidants, pas of nine peaks of untreated sample were set as 100% and the relative pas of the sample that were reacted with dpph of different concentrations were calculated. as the result, the pas of nine peaks all decreased with the increase of dpph concentration. at but with the increase of dpph concentration, peak 6 decreased the most among the nine peaks (see table 2). the results indicate that peak 6 has the strongest radical scavenging capacity and peaks 5, 3, 7, 8, 9, 1, 4, and 2 follow suit. the pure biflavonoid compounds were divided into the three types, which were the amentoflavone - type, robustaflavone - type, and hinokiflavone - type biflavonoids, respectively. the ionization of these compounds was included in both the positive and negative esi ion modes. the positive ion mode provided more rich, accurate, and specific signals than the negative ion mode. the characteristic fragment ion peaks observed by the cleavage of [m+h ] ions of the three types of biflavonoids were shown in table 3. the most useful fragmentation about compound 1 produces rda cleavage at position 1/3 of the c - ring on flavonoid part ii. the fragmentation pathway leads to the [m+h - c8h6o ] at m / z 421. at the same time, after [m+h ] can also lose a h2o molecule and undergo rda cleavage at the same 1/3 position, the fragmentation pathway leads to the [m+h - h2o - c8h6o ] at m / z 403. and then, it further loses a series of co molecules continuously and gives rise to the fragment ions at m / z 375 and 347. after undergoing the cleavage at position 0/4 of the c - ring on flavonoid part ii, another important pathway can lead to the [m+h - c9h6o3 ] at m / z 377, [m+h - c9h6o3-c2h2o ] at m / z 335, and [m+h - c9h6o3-c2h2o - co ] at m / z 307, continuously. so compound 1 was determined as amentoflavone on the basis of previous deduction and literature. moreover, the [c7h6o2 ] at m / z 121 and the [c7h4o4 ] at m / z 153 are important ions, because they provide information whether there is a substituent at b - ring c4 on flavonoid part ii and at a - ring c7 from flavonoid part i. compounds 3, 5, 7, 8, and 9 exhibited the quasimolecular ion [m+h ] at m / z 553.1110, 553.1086, 567.1273, 567.1283, and 581.1434, respectively. due to involving the cleavage of the c - ring at positions 1/3 and 0/4 on flavonoid part ii, observations of the five compounds fragmentations cleavage pathway indicate that compounds 3, 5, 7, 8, and 9 clearly belong to an amentoflavone - type biflavonoid (see figure 3 and table 3). a series of prominent ions at m / z 435, 403 (base peak), 347, 377, 335, and 307 were also found in compound 3 ion mass spectra of [m+h ]. what is more, other compound 3 characteristic ions were also found such as [m - c8h6-c2h2o - c3o2-co ] at m / z 283, [c7h4o4]at m / z 153, and [c8h7o2 ] at m / z 135. the analysis results indicate that no substituent is observed on flavonoid part ii. but a methoxy group at position c4 of the b - ring on flavonoid part i is observed. so compound 3 was considered a bilobetin. a series of prominent ions at m / z 421, 403 (base peak), 347, 377, 335, and 307 were observed in compound 5 ion mass spectra of [m+h ]. in addition, compound 5 ions were also found such as [m - c8h6-c2h2o - c3o2-co ] at m / z 283, [c7h4o4 ] at m / z 153, and [c8h7o2 ] at m / z 135. according to analysis results above, no substituent is found on flavonoid part i and a methoxy group is observed at position c4 of the b - ring on flavonoid part ii. so compound 3 was identified as a podocarpusflavone a. a series of prominent ions at m / z 549, 417 (base peak), 391, 361, and 311 were observed in compound 7 ion mass spectra of [m+h ]. moreover, other compound 7 ions were also observed such as [c8h6o4 ] at m / z 167 and [c7h6o2 ] at m / z 121. the results show that no substituent is found on flavonoid part ii. but a methoxy group at position c4 of the b - ring on flavonoid part i and a methoxy group at position c7 of a - ring on flavonoid part i are found. a series of prominent ions at m / z 435, 417 (base peak), 389, 361, and 321 were observed in compound 8 ion mass spectra of [m+h ]. furthermore, other compound 8 ions were also observed such as [m - c8h6-c2h2o - c3o2-co ] m / z 297, [c8h6o4 ] at m / z 167, and [c8h7o2 ] at m / z 135. according to analysis results above, it is indicated that this molecule has a methoxy group at position c4 of the b - ring on flavonoid part ii and a methoxy group at position c7 of a - ring on flavonoid part i. so compound 8 was identified as putraflavone. a series of prominent ions at m / z 549, 417 (base peak), 389, 361, and 335 were observed in compound 9 ion mass spectra of [m+h ]. what is more, other compound 9 ions were also observed such as [m - c8h6-c2h2o - c3o2-co ] at m / z 311, [c8h6o4 ] at m / z 167, and [c8h7o2 ] at m / z 135. the analysis results above indicate that a methoxy group is observed at position c4 of b - ring on flavonoid part ii, a methoxy group is observed at position c7 of the a - ring, and a methoxy group is found at position c4 of the b - ring on flavonoid part i. so compound 9 was considered heveaflavone. compound 2 exhibited the quasimolecular ion [m+h ] at m / z 539.0977. compared with that of amentoflavone - type biflavonoids, they are two important and different fragmentations cleavage pathway. one important fragmentation involves rda cleavage at position 1/3 of the c - ring on flavonoid part i. the fragmentation pathway gives rise to the [m+h - c7h4o4 ] at m / z 387. getting involved with the cleavage at position 1/4 of the c - ring on flavonoid part i, the other significant pathway arouses the [m+h - c6h4o3 ] at m / z 413. so compound 2 was determined as robustaflavone on the ground of previous deduction and literature. a series of main ions at m / z 427, 401, 309, and 283 were found in compound 4 ion mass spectra of [m+h ]. according to the [m - c6h4o4 ] at m / z 401 and [m - c5h4o3 ] at m / z 427 of compound 4 (see figure 4), because the typical fragmentation pathway of robustaflavone gets the cleavage at positions 1/4 and 1/3 of c - ring on flavonoid part i, other compound 4 characteristic ions are also found such as [c7h4o4 ] at m / z 153. the analysis results indicate that a methoxy group at position c4 of the b - ring on flavonoid part i is observed. the most main diagnostic ions are a sequence of ions at m / z 286, 270, 254, and 242, which root in the rupture of the c - o connection on flavonoid parts i and ii (see figure 5). furthermore, the predominant ion at m / z 257 is found by the quasimolecular ion losing flavonoid part i and co, continuously. so compound 6 was determined as hinokiflavone on the basis of previous deduction and literature. through the above analysis, the major fragmentation of the hinokiflavone - type biflavonoids shows great difference with the first two types of biflavonoids, because two flavonoid parts of the hinokiflavone type are not a c - c bond but a c - o bond. uplc - dpph radical spiking test combined with q - tof / ms, as a rapid, simple, and economical analysis method with which screening antioxidants from selaginella doederleinii successfully was carried out. the biflavonoids were structurally identified and divided into the three types, that is, amentoflavone, robustaflavone, and hinokiflavone. among them, the identified biflavonoids may contribute via their dpph free radical scavenging potential to the beneficial antioxidation effects of selaginella doederleinii. it demonstrates that uplc - q - tof / ms assay has a great possibility to become high - advanced method for antioxidants screening and identification of constituents in selaginella doederleinii, and it will be useful to the high - value application of the rich medicinal herbs in china. | 2,2-diphenyl-1-picrylhydrazyl - ultra - high performance liquid chromatography - q - time - of - flight mass spectrometry (dpph - uplc - q - tof / ms), as a rapid and efficient means, now was used for the first time to screen antioxidants from selaginella doederleinii. the nine biflavone compounds were screened as potential antioxidants. the biflavones were structurally identified and divided into the three types, that is, amentoflavone - type, robustaflavone - type, and hinokiflavone - type biflavonoids. among the compounds bilobetin (3) and putraflavone (8) were found from selaginella doederleinii for the first time and others including amentoflavone (1), robustaflavone (2), 4-methoxy robustaflavone (4), podocarpusflavone a (5), hinokiflavone (6), ginkgetin (7), and heveaflavone (9) were identified previously in the plant. moreover, nine biflavones possessed a good antioxidant activity via their dpph free radical scavenging. it demonstrates that dpph - uplc - q - tof / ms exhibits strong capacity in separation and identification for small molecule. the method is suitable for rapid screening of antioxidants without the need for complicated systems and additional instruments. |
the study of transcriptional mechanisms of addiction is based on the hypothesis that regulation of gene expression is one important mechanism by which chronic exposure to a drug of abuse causes long - lasting changes in the brain that underlie the behavioral abnormalities that define a state of addiction.1,2) a corollary of this hypothesis is that changes induced in the functioning of several neurotransmitter systems, and in the morphology of certain neuronal cell types in the brain, by chronic drug administration are mediated in part via changes in gene expression. of course, not all drug - induced neural and behavioral plasticity is mediated at the level of gene expression, as we know the crucial contributions of translational and posttranslational modifications and protein trafficking in addiction - related phenomena. on the other hand, regulation of gene expression is one central mechanism and likely to be particularly crucial for the life - long abnormalities that characterize addiction. indeed work over the past ~15 years has provided increasing evidence for a role of gene expression in drug addiction, as several transcription factors - proteins that bind to specific responses elements in the promoter regions of target genes and regulate those genes ' expression - have been implicated in drug action. according to this scheme, shown in fig. 1, drugs of abuse, via their initial actions at the synapse, produce changes within neurons that signal to the nucleus and regulate the activity of numerous transcription factors and many other types of transcriptional regulatory proteins.3) a these nuclear changes gradually and progressively build with repeated drug exposure and underlie stable changes in the expression of specific target genes which, in turn, contribute to the lasting changes in neural function that maintain a state of addiction.1,4) this review focuses on several transcription factors, which have been shown to play important roles in addiction. we focus further on drug - regulated transcription factors within the brain 's reward circuitry, areas of brain that normally regulate an individual 's responses to natural rewards (e.g., food, sex, social interaction), but are corrupted by chronic drug exposure to cause addiction. this brain reward circuitry includes dopaminergic neurons in the ventral tegmental area of the midbrain and the several regions of limbic forebrain they innervate, including nucleus accumbens (ventral striatum), prefrontal cortex, amygdala, and hippocampus, among others. as will be seen, the vast majority of research on transcriptional mechanisms of addiction to date has concentrated on the nucleus accumbens. fosb is encoded by the fosb gene and shares homology with other fos family transcription factors, which include c - fos, fosb, fra1, and fra2.5) these fos family proteins heterodimerize with jun family proteins (c - jun, junb, or jund) to form active activator protein-1 (ap1) transcription factors that bind to ap1 sites present in the promoters of certain genes to regulate their transcription. these fos family proteins are induced rapidly and transiently in specific brain regions after acute administration of many drugs of abuse (fig. 2).2) these responses are seen most prominently in nucleus accumbens and dorsal striatum, but also seen in several other brain areas.6) all of these fos family proteins, however, are highly unstable and return to basal levels within hours of drug administration. biochemically modified isoforms of fosb (mr 35 - 37 kd) accumulate within the same brain regions after repeated drug exposure, whereas all fos family members show tolerance (that is, reduced induction compared with initial drug exposures).7 - 9) such accumulation of fosb has been observed for virtually all drugs of abuse, although different drugs differ somewhat in the relative degree of induction seen in nucleus accumbens core vs. shell, dorsal striatum, and other brain regions.2,6) at least for some drugs of abuse, induction of fosb appears selective for the dynorphin - containing subset of medium spiny neurons - those that predominantly express d1 dopamine receptors - within striatal regions. the 35 - 37 kd isoforms of fosb dimerize predominantly with jund to form an active and long - lasting ap-1 complex within these brain regions,7,10) although there is some evidence from in vitro studies that fosb may form homodimers.11) drug induction of fosb in the nucleus accumbens seems to be a response to the pharmacological properties of the drug per se and not related to volitional drug intake, since animals that self - administer cocaine or receive yoked drug injections show equivalent induction of this transcription factor in this brain region.6) in contrast, fosb induction in certain other regions, for example, orbitofrontal cortex, requires volitional drug administration.12) the 35 - 37 kd fosb isoforms accumulate with chronic drug exposure due to their extraordinarily long half - lives.7 - 13) as a result of its stability, the fosb protein persists in neurons for at least several weeks after cessation of drug exposure. we now know that this stability is due to two factors : 1) the absence in fosb of two degron domains, which are present at the c - terminus of full length fosb and all other fos family proteins and target those proteins to rapid degradation, and 2) the phosphorylation of fosb at its n - terminus by casein kinase 2 and perhaps other protein kinases.14 - 16) the stability of the fosb isoforms provides a novel molecular mechanism by which drug - induced changes in gene expression can persist despite relatively long periods of drug withdrawal. we have, therefore, proposed that fosb functions as a sustained " molecular switch " that helps initiate and then maintain an addicted state.1,2) insight into the role of fosb in drug addiction has come largely from the study of bitransgenic mice in which fosb can be induced selectively within the nucleus accumbens and dorsal striatum of adult animals.17) importantly, these mice overexpress fosb selectively in the dynorphin - containing medium spiny neurons, where the drugs are believed to induce the protein. fosb - overexpressing mice show augmented locomotor responses to cocaine after acute and chronic administration.17) they also show enhanced sensitivity to the rewarding effects of cocaine and of morphine in place conditioning assays,17 - 19) and self - administer lower doses of cocaine, and work harder for cocaine, than littermates that do not overexpress fosb.20) additionally, fosb overexpression in nucleus accumbens exaggerates the development of opiate physical dependence and promotes opiate analgesic tolerance.19) in contrast, fosb expressing mice are normal in several other behavioral domains, including spatial learning as assessed in the morris water maze.17) specific targeting of fosb overexpression to the nucleus accumbens, by use of viral - mediated gene transfer, has yielded equivalent data.19) in contrast, targeting fosb expression to the enkepahlin - containing medium spiny neurons in nucleus accumbens and dorsal striatum (those that predominantly express d2 dopamine receptors) in different lines of bitransgenic mice fail to show most of these behavioral phenotypes.19) in contrast to overexpression of fosb, overexpression of a mutant jun protein (cjun or jund) - which functions as a dominant negative antagonist of ap1 mediated transcription - by use of bitransgenic mice or viral - mediated gene transfer, produces the opposite behavioral effects.18,19,21) these data indicate that induction of fosb in dynorphin - containing medium spiny neurons of the nucleus accumbens increases an animal 's sensitivity to cocaine and other drugs of abuse, and may represent a mechanism for relatively prolonged sensitization to the drugs. recent studies have shown that fosb induction in orbitofrontal cortex mediates tolerance to some of the cognitive - disrupting effects of acute cocaine exposure, which might serve to further promote drug intake.12,22) since fosb is a transcription factor, it presumably produces this interesting behavioral phenotype in nucleus accumbens by enhancing or repressing expression of other genes. using our inducible, bitransgenic mice that overexpress fosb or its dominant negative cjun, and analyzing gene expression on affymetrix chips, we demonstrated that - in the nucleus accumbens in vivo -fosb functions primarily as a transcriptional activator, while it serves as a repressor for a smaller subset of genes.18) this study also demonstrated the dominant role of fosb in mediating the genomic effects of cocaine : fosb is implicated in close to one - quarter of all genes influenced in nucleus accumbens by chronic cocaine. this genome - wide approach, along with studies of several candidate genes in parallel, have established several target genes of fosb that contribute to its behavioral phenotype. one candidate gene is glua2, an ampa glutamate receptor subunit, which is induced in nucleus accumbens by fosb.17) since glua2-containing ampa channels have a lower overall conductance compared to ampa channels that do not contain this subunit, the cocaine- and fosb - mediated upregulation of glua2 in nucleus accumbens could account, at least in part, for the reduced glutamatergic responses seen in these neurons after chronic drug exposure.23) another candidate target gene of fosb in nucleus accumbens is the opioid peptide, dynorphin. recall that fosb appears to be induced by drugs of abuse specifically in dynorphin - producing cells in this brain region. drugs of abuse have complex effects on dynorphin expression, with increases or decreases seen depending on the treatment conditions used. we have shown that induction of fosb represses dynorphin gene expression in nucleus accumbens.19) dynorphin is thought to activate opioid receptors on ventral tegment area (vta) dopamine neurons and inhibit dopaminergic transmission and thereby downregulate reward mechanisms.24,25) hence, fosb repression of dynorphin expression could contribute to the enhancement of reward mechanisms mediated by this transcription factor. there is now direct evidence supporting the involvement of dynorphin gene repression in fosb 's behavioral phenotype.19) still additional target genes have been identified. fosb represses the c - fos gene which helps create the molecular switch - from induction of several short - lived fos family proteins after acute drug exposure to the predominant accumulation of fosb after chronic drug exposure - cited earlier.9) in contrast, cyclin - dependent kinase-5 (cdk5) is induced in the nucleus accumbens by chronic cocaine, an effect that we have shown is mediated via fosb.18,21,26) cdk5 is an important target of fosb since its expression has been directly linked to increases in dendritic spine density of nucleus accumbens medium spiny neurons,27,28) in the nucleus accumbens that are associated with chronic cocaine administration.29,30) indeed, fosb induction has been shown more recently to be both necessary and sufficient for cocaine - induced dendritic spine growth.31) more recently, we have used chromatin immunoprecipitation (chip) followed by promoter chip (chip - chip) or by deep sequencing (chip - seq) to further identify fosb target genes.32) these studies, along with the dna expression arrays cited earlier, are providing a rich list of many additional genes that may be targeted - directly or indirectly - by fosb. among these genes are additional neurotransmitter receptors, proteins involved in pre- and postsynaptic function, many types of ion channels and intracellular signaling proteins, proteins that regulate the neuronal cytoskeleton and cell growth, and numerous proteins that regulate chromatin structure.18,32) further work is needed to confirm each of these numerous proteins as bona fide targets of cocaine acting through fosb and to establish the precise role that each protein plays in mediating the complex neural and behavioral aspects of cocaine action. insight into the role of fosb in drug addiction has come largely from the study of bitransgenic mice in which fosb can be induced selectively within the nucleus accumbens and dorsal striatum of adult animals.17) importantly, these mice overexpress fosb selectively in the dynorphin - containing medium spiny neurons, where the drugs are believed to induce the protein. fosb - overexpressing mice show augmented locomotor responses to cocaine after acute and chronic administration.17) they also show enhanced sensitivity to the rewarding effects of cocaine and of morphine in place conditioning assays,17 - 19) and self - administer lower doses of cocaine, and work harder for cocaine, than littermates that do not overexpress fosb.20) additionally, fosb overexpression in nucleus accumbens exaggerates the development of opiate physical dependence and promotes opiate analgesic tolerance.19) in contrast, fosb expressing mice are normal in several other behavioral domains, including spatial learning as assessed in the morris water maze.17) specific targeting of fosb overexpression to the nucleus accumbens, by use of viral - mediated gene transfer, has yielded equivalent data.19) in contrast, targeting fosb expression to the enkepahlin - containing medium spiny neurons in nucleus accumbens and dorsal striatum (those that predominantly express d2 dopamine receptors) in different lines of bitransgenic mice fail to show most of these behavioral phenotypes.19) in contrast to overexpression of fosb, overexpression of a mutant jun protein (cjun or jund) - which functions as a dominant negative antagonist of ap1 mediated transcription - by use of bitransgenic mice or viral - mediated gene transfer, produces the opposite behavioral effects.18,19,21) these data indicate that induction of fosb in dynorphin - containing medium spiny neurons of the nucleus accumbens increases an animal 's sensitivity to cocaine and other drugs of abuse, and may represent a mechanism for relatively prolonged sensitization to the drugs. recent studies have shown that fosb induction in orbitofrontal cortex mediates tolerance to some of the cognitive - disrupting effects of acute cocaine exposure, which might serve to further promote drug intake.12,22) since fosb is a transcription factor, it presumably produces this interesting behavioral phenotype in nucleus accumbens by enhancing or repressing expression of other genes. using our inducible, bitransgenic mice that overexpress fosb or its dominant negative cjun, and analyzing gene expression on affymetrix chips, we demonstrated that - in the nucleus accumbens in vivo -fosb functions primarily as a transcriptional activator, while it serves as a repressor for a smaller subset of genes.18) this study also demonstrated the dominant role of fosb in mediating the genomic effects of cocaine : fosb is implicated in close to one - quarter of all genes influenced in nucleus accumbens by chronic cocaine. this genome - wide approach, along with studies of several candidate genes in parallel, have established several target genes of fosb that contribute to its behavioral phenotype. one candidate gene is glua2, an ampa glutamate receptor subunit, which is induced in nucleus accumbens by fosb.17) since glua2-containing ampa channels have a lower overall conductance compared to ampa channels that do not contain this subunit, the cocaine- and fosb - mediated upregulation of glua2 in nucleus accumbens could account, at least in part, for the reduced glutamatergic responses seen in these neurons after chronic drug exposure.23) another candidate target gene of fosb in nucleus accumbens is the opioid peptide, dynorphin. recall that fosb appears to be induced by drugs of abuse specifically in dynorphin - producing cells in this brain region. drugs of abuse have complex effects on dynorphin expression, with increases or decreases seen depending on the treatment conditions used. we have shown that induction of fosb represses dynorphin gene expression in nucleus accumbens.19) dynorphin is thought to activate opioid receptors on ventral tegment area (vta) dopamine neurons and inhibit dopaminergic transmission and thereby downregulate reward mechanisms.24,25) hence, fosb repression of dynorphin expression could contribute to the enhancement of reward mechanisms mediated by this transcription factor. there is now direct evidence supporting the involvement of dynorphin gene repression in fosb 's behavioral phenotype.19) still additional target genes have been identified. fosb represses the c - fos gene which helps create the molecular switch - from induction of several short - lived fos family proteins after acute drug exposure to the predominant accumulation of fosb after chronic drug exposure - cited earlier.9) in contrast, cyclin - dependent kinase-5 (cdk5) is induced in the nucleus accumbens by chronic cocaine, an effect that we have shown is mediated via fosb.18,21,26) cdk5 is an important target of fosb since its expression has been directly linked to increases in dendritic spine density of nucleus accumbens medium spiny neurons,27,28) in the nucleus accumbens that are associated with chronic cocaine administration.29,30) indeed, fosb induction has been shown more recently to be both necessary and sufficient for cocaine - induced dendritic spine growth.31) more recently, we have used chromatin immunoprecipitation (chip) followed by promoter chip (chip - chip) or by deep sequencing (chip - seq) to further identify fosb target genes.32) these studies, along with the dna expression arrays cited earlier, are providing a rich list of many additional genes that may be targeted - directly or indirectly - by fosb. among these genes are additional neurotransmitter receptors, proteins involved in pre- and postsynaptic function, many types of ion channels and intracellular signaling proteins, proteins that regulate the neuronal cytoskeleton and cell growth, and numerous proteins that regulate chromatin structure.18,32) further work is needed to confirm each of these numerous proteins as bona fide targets of cocaine acting through fosb and to establish the precise role that each protein plays in mediating the complex neural and behavioral aspects of cocaine action. cyclic amp response element binding protein (creb) is one of the most studied transcription factors in neuroscience and has been implicated in diverse aspects of neural plasticity.33) it forms homodimers that can bind to genes at cyclic amp response elements (cres), but primarily activates transcription after it has been phosphorylated at ser133 (by any of several protein kinases), which allows recruitment of creb - binding protein (cbp) that then promotes transcription. the mechanism by which creb activation represses the expression of certain genes is less well understood. both psychostimulants (cocaine and amphetamine) and opiates increase creb activity, acutely and chronically - as measured by increased phospho - creb (pcreb) or reporter gene activity in cre - lacz transgenic mice - in multiple brain regions, including the nucleus accumbens and dorsal striatum.34 - 36) the time course of this activation is very different from that exhibited by fosb. as depicted in fig. 2, creb activation is highly transient in response to acute drug administration and reverts to normal levels within a day or two after withdrawal. in addition, creb activation occurs in both the dynorphin and enkephalin subtypes of medium spiny neurons.34) in contrast to cocaine and opiates, creb shows more complicated and varied responses to other drugs of abuse.4) experiments involving the inducible overexpression of creb or a dominant negative mutant in bitransgenic mice or with viral vectors have shown that activation of creb - in striking contrast to fosb - in the nucleus accumbens decreases the rewarding effects of cocaine and of opiates as assessed in place conditioning assays.37,38) nevertheless, creb activation, like fosb induction, promotes drug self - administration.39) importantly, effects with dominant negative creb have been validated with inducible knockdowns of endogenous creb activity.39 - 41) it is interesting that both transcription factors drive volitional drug intake ; presumably fosb does so via positive reinforcement, whereas creb induces this phenotype via negative reinforcement. the latter possibility is consistent with considerable evidence that creb activity in this brain region causes a negative emotional state.34,42) creb activity has been directly linked to the functional activity of nucleus accumbens medium spiny neurons. creb overexpression increases, whereas dominant - negative creb decreases, the electrical excitability of medium spiny neurons.43) possible differences between dynorphin and enkephalin neurons have not yet been explored. the observation that viral - mediated overexpression of a k channel subunit in the nucleus accumbens, which decreases medium spiny neuron excitability, enhances locomotor responses to cocaine suggests that creb acts as a break on behavioral sensitization to cocaine by upregulating neuron excitability.43) drugs of abuse activate creb in several brain regions beyond the nucleus accumbens. one example is the ventral tegmental area, where chronic administration of cocaine or opiates activates creb within dopaminergic and non - dopaminergic neurons. this effect seems to promote or attenuate the rewarding responses of drugs of abuse depending on the subregion of the ventral tegmental area affected. numerous target genes for creb have been identified, through both open - ended and candidate gene approaches, which mediate these and other effects on nucleus accumbens medium spiny neurons and the resulting creb behavioral phenotype.18,32,36) prominent examples include the opioid peptide dynorphin,37) which feeds back and suppresses dopaminergic signaling to the nucleus accumbens as stated earlier.24,25) also implicated are certain glutamate receptor subunits, such as the glua1 ampa subunit and glun2b nmda subunit, as well as k and na ion channel subunits, which together would be expected to control nucleus accumbens cell excitability.43,44) bdnf is still another target gene for creb in nucleus accumbens, and it too is implicated in mediating the creb behavioral phenotype.35) creb induction also has been shown to contribute to cocaine 's induction of dendritic spines on nucleus accumbens medium spiny neurons.45) creb is just one of several related proteins that bind cres and regulate transcription of target genes. several products of the cyclic amp response element modulator (crem) gene regulate cre - mediated transcription. some of the products (e.g., crem) are transcriptional activators, whereas others (e.g., icer or inducible cyclic amp repressor) function as endogenous dominant negative antagonists. in addition, several activating transcription factors (atfs) can influence gene expression in part by binding to cre sites. amphetamine induces icer expression in nucleus accumbens, and overexpression of icer in this region, by use of viral - mediated gene transfer, increases an animal 's sensitivity to the behavioral effects of the drug.46) this is consistent with findings, cited above, that local overexpression of dominant negative creb mutants or local knockdown of creb exerts similar effects. amphetamine also induces atf2, atf3, and atf4 in nucleus accumbens, while no effect is seen for atf1 or crem.47) atf2 overexpression in this region, like that of icer, increases behavioral responses to amphetamine, while atf3 or atf4 overexpression has the opposite effect. very little is known about the target genes for these various creb family proteins, an important direction for future research. nuclear factor-b (nfb), a transcription factor that is rapidly activated by diverse stimuli, is best studied for its role in inflammation and immune responses. it has more recently been shown to be important in synaptic plasticity and memory.48) nfb is induced in the nucleus accumbens by repeated cocaine administration,49,50) where it is required for cocaine 's induction of dendritic spines of nucleus accumbens medium spiny neurons. such induction of nfb contributes to sensitization to the rewarding effects of the drug.50) a major goal of current research is to identify the target genes through which nfb causes this cellular and behavioral plasticity. interestingly, cocaine induction of nfb is mediated via fosb : fosb overexpression in nucleus accumbens induces nfb, while overexpression of the cjun dominant negative blocks cocaine induction of the transcription factor.21,49) regulation of nfb by fosb illustrates the complex transcriptional cascades involved in drug action. as well, nfb has been implicated in some of the neurotoxic effects of methamphetamine in striatal regions.51) the role of nfb in medium spiny neuron spinogenesis has recently been extended to stress and depression models,52) a finding of particular importance considering the comorbidity of depression and addiction, and the well - studied phenomenon of stress - induced relapse to drug abuse. myocyte enhancing factor-2 (mef2) was discovered for its role in controlling cardiac myogenesis. more rerecently, mef2 has been implicated in brain function.53) multiple mef2 isoforms are expressed in brain, including in nucleus accumbens medium spiny neurons, where they form homo- and heterodimers that can activate or repress gene transcription depending on the nature of the proteins they recruit. recent work outlines a possible mechanism by which chronic cocaine suppresses mef2 activity in the nucleus accumbens in part through a d1 receptor - camp - dependent inhibition of calcineurin, a ca2-dependent protein phosphatase.28) cocaine regulation of cdk5, which is also a target for cocaine and fosb as stated earlier, may be involved as well. this reduction in mef2 activity is required for cocaine induction of dendritic spines on medium spiny neurons. an important focus of current work is to identify the target genes through mef2 produces this effect. the transcription factors discussed above are just a few of many that have been studied over the years in addiction models. others implicated in addiction include the glucocorticoid receptor, nucleus accumbens 1 transcription factor (nac1), early growth response factors (egrs), and signal transducers and activators of transcription (stats).1,2) as just one example, the glucocorticoid receptor is required in dopaminoceptive neurons for cocaine seeking.54) the goal of future research is to obtain a more complete view of the transcription factors induced in nucleus accumbens and other brain reward regions in response to chronic exposure to drugs of abuse and to define the range of target genes they influence to contribute to the behavioral phenotype of addiction. the other major goal of future research is to delineate the precise molecular steps by which these various transcription factors regulate their target genes. thus, we now know that transcription factors control gene expression by recruiting to their target genes a series of co - activator or co - repressor proteins which together regulate the structure of chromatin around the genes and the subsequent recruitment of the rna polymerase ii complex which catalyzes transcription.4) for example, recent research has demonstrated that the ability of fosb to induce the cdk5 gene occurs in concert with the recruitment of a histone acetyltransferase and related chromatin remodeling proteins to the gene.55) in contrast, the ability of fosb to repress the c - fos gene occurs in concert with the recruitment of a histone deacetylase and presumably several other repressive proteins such as a repressive histone methyltransferase (fig. 3).2,9,31) given that hundreds of chromatin regulatory proteins are likely recruited to a gene in concert with its activation or repression, this work is just the tip of the iceberg of vast amounts of information that need to be discovered in the years ahead. as progress is made in identifying target genes for drug - regulated transcription factors, this information will provide an increasingly complete template that can be used to guide drug discovery efforts. it is hoped that new medication treatments will be developed based on these dramatic advances in our understanding of transcription mechanisms that underlie addiction. | regulation of gene expression is considered a plausible mechanism of drug addiction given the stability of behavioral abnormalities that define an addicted state. numerous transcription factors, proteins that bind to regulatory regions of specific genes and thereby control levels of their expression, have been implicated in the addiction process over the past decade or two. here we review the growing evidence for the role played by several prominent transcription factors, including a fos family protein (fosb), camp response element binding protein (creb), and nuclear factor kappa b (nfb), among several others, in drug addiction. as will be seen, each factor displays very different regulation by drugs of abuse within the brain 's reward circuitry, and in turn mediates distinct aspects of the addiction phenotype. current efforts are geared toward understanding the range of target genes through which these transcription factors produce their functional effects and the underlying molecular mechanisms involved. this work promises to reveal fundamentally new insight into the molecular basis of addiction, which will contribute to improved diagnostic tests and therapeutics for addictive disorders. |
it is a chronic inflammatory disorder affecting both the hair follicles and the nail apparatus, with t - lymphocyte infiltration and chemokine expression being characteristic in involved tissue (1). the prevalence rates of aa is 0.1% in the world population (2) and 0.9 - 6.9% in korea (3). the association of aa with autoimmune diseases including thyroid disorders, pernicious anemia and vitiligo is well established and alopecia areata itself is conventionally regarded as an autoimmune disease (4). the importance of immune - mediated mechanism, but non necessarily autoimmunity, in the pathogenesis of alopecia areata is suggested by the therapeutic efficacy of immunosuppressive drugs such as cyclosporin a, tacrolimus and corticosteroids. it is well known that locally infiltrating lymphocytes have been implicated as effector cells being responsible for the reversible alteration of the hair follicles and the resulting hair loss (5, 6). in general, the directional recruitment of leukocytes is regulated by chemokines and their counteracting chemokine receptors (7). recently, in human models of aa it was shown that the increased expression of chemokines including monocyte chemoattractant protein-1 (mcp-1), monokine induced by interferon- (mig) might play a pivotal role in the attraction of monocytes around the hair bulb (1). mcp-1 is a -chemokine that is thought to be responsible for monocyte and lymphocytes t recruitment in acute inflammatory conditions and may be an important mediator in chronic inflammation. in fact, it has been proposed that mcp-1 may be responsible for tissue inflammation in autoimmune diseases because its tissue expression in human and experimental autoimmune models (8 - 11). thus, genetic polymorphism in the regulatory regions of the mcp-1 gene could be implicated in the susceptibility or progression of autoimmune disease. a biallelic a / g polymorphism at position -2518 of the mcp-1 gene has been described. the polymorphism proved functionally important, as peripheral blood mononuclear cells of individuals with g / g and a / g genotype produced significantly more mcp-1 after stimulation with il-1 than those with caucasian wild - type a / a (12, 13). an association of the presence of g at position -2518 with the presence of cutaneous vasculitis could be shown in patients with systemic lupus erythematosus (14) as well as an association with development of coronary artery aneurysms after acute kawasaki disease (13). furthermore, the g / g genotype was identified as a genetic risk factor for severe coronary artery disease (15) and a correlation between the incidence and severity of asthma and the g allele at position -2518 has been shown. these findings suggest an important role for the mcp-1 and the a / g polymorphism in its regulatory region in inflammatory processes. the mcp-1 gene polymorphism in aa patients has not been reported yet. in this study, we performed a case - control study in 145 alopecia areata patients and 246 matched korean controls to analyze the possible influence of the polymorphism (a / g) at position -2518 of the mcp-1 gene in the susceptibility of aa. a total of 145 korean patients with aa (70 men and 75 women) were examined at the dermatology clinic at the kyung hee university medical center. a total of 246 healthy subjects (80 men and 166 women), who had no clinical evidence of aa, were recruited as controls (table 1). this study was approved by the ethics review committee of the medical research institute, kyung hee university medical center. the clinical diagnosis of aa was based on the presence of initially patchy alopecia with exclamation mark hairs and the exclusion of other causes of alopecia. detailed clinical information was obtained from each patient, including age at onset of first episode, family history, type of disease (patchy alopecia, alopecia totalis [at ] and alopecia universalis [au ]), duration of disease, presence of other autoimmune disease, nail involvement, and other body sites hair loss. subgroup 1 contained patients with patchy disease (patchy aa) and subgroup 2 patients with more extensive hair loss (at and au) (16). patchy aa can involve the scalp or other body sites such as the beard area. in patchy aa (subgroup 1) there are well demarcated, mainly circular areas of hair loss typically 2 - 6 cm in diameter. in subgroup 2, hair loss progresses until all the hair on the scalp has been lost (at) ; or to complete loss of the entire body hair (au). we also divided the aa patients into two subgroups on the basis of age at onset of disease (17). the division of these subgroups with a boundary at age 30 yr was in keeping with the distribution of age at onset in our patients, which was bimodal with peaks at approximately age 20 - 30 and 30 - 40 yr. genomic dna was prepared from heparinized venous blood samples using a nucleospin dna isolation kit (mache - rey - nagel gmbh & co., duren, germany). the identification of the polymorphism was carried out using pcr, followed by a restriction fragment length polymorphism (rflp) assay, using a pvuii site, which is introduced by the presence of the g nucleotide. the regulatory region of the mcp-1 gene (from -2746 at -1817) was amplified by polymerase chain - reaction (pcr) using the forward primer 5'ccgagatgttcccagcacag3'and the reverse primer 5'ctgctttgcttgtgcctctt3 '. pcr was performed using buffer 10 (10 mm tris - hcl ph 9, 2.0 mm mgcl2, 50 mm kcl), 200 m dntps, 2.5 pmoles of each primer, 0.5 l of dna, 0.5 u taq polymerase (pharmacia) and ddh2o up to a final volume of 10 l. the following thermal profiles were run : 94 for 1 min, 55 for 1 min, and 72 for 1.5 min. after a final extension of 10 min at 72, 7 l of the pcr products were resolved in 2% agarose gels stained with ethidium bromide previous dilution in blue juice buffer to check the expected 930-bp band. after checking, 8 l of the pcr products were digested with 10 u of pvuii in 10 buffer and h2o up to a final volume of 20 l at 37 for 2 hr 30 min. the resulting products were separated by gel - electrophoresis in 1.5% agarose gels, containing ethidium bromide in a final concentration of 0.5 g / ml. samples showing only a 930 bp band were assigned as a / a, samples showing two bands of 708 and 222 bp were considered g / g and samples showing three bands at 930, 708 and 222 bp were typed a / g. the distribution of the mcp-1 a / g genotypes for patients and control subjects were compared by the chi - square () test. a total of 145 korean patients with aa (70 men and 75 women) were examined at the dermatology clinic at the kyung hee university medical center. a total of 246 healthy subjects (80 men and 166 women), who had no clinical evidence of aa, were recruited as controls (table 1). this study was approved by the ethics review committee of the medical research institute, kyung hee university medical center. the clinical diagnosis of aa was based on the presence of initially patchy alopecia with exclamation mark hairs and the exclusion of other causes of alopecia. detailed clinical information was obtained from each patient, including age at onset of first episode, family history, type of disease (patchy alopecia, alopecia totalis [at ] and alopecia universalis [au ]), duration of disease, presence of other autoimmune disease, nail involvement, and other body sites hair loss. subgroup 1 contained patients with patchy disease (patchy aa) and subgroup 2 patients with more extensive hair loss (at and au) (16). patchy aa can involve the scalp or other body sites such as the beard area. in patchy aa (subgroup 1) there are well demarcated, mainly circular areas of hair loss typically 2 - 6 cm in diameter. in subgroup 2, hair loss progresses until all the hair on the scalp has been lost (at) ; or to complete loss of the entire body hair (au). we also divided the aa patients into two subgroups on the basis of age at onset of disease (17). the division of these subgroups with a boundary at age 30 yr was in keeping with the distribution of age at onset in our patients, which was bimodal with peaks at approximately age 20 - 30 and 30 - 40 yr. genomic dna was prepared from heparinized venous blood samples using a nucleospin dna isolation kit (mache - rey - nagel gmbh & co., duren, germany). the identification of the polymorphism was carried out using pcr, followed by a restriction fragment length polymorphism (rflp) assay, using a pvuii site, which is introduced by the presence of the g nucleotide. the regulatory region of the mcp-1 gene (from -2746 at -1817) was amplified by polymerase chain - reaction (pcr) using the forward primer 5'ccgagatgttcccagcacag3'and the reverse primer 5'ctgctttgcttgtgcctctt3 '. pcr was performed using buffer 10 (10 mm tris - hcl ph 9, 2.0 mm mgcl2, 50 mm kcl), 200 m dntps, 2.5 pmoles of each primer, 0.5 l of dna, 0.5 u taq polymerase (pharmacia) and ddh2o up to a final volume of 10 l. the following thermal profiles were run : 94 for 1 min, 55 for 1 min, and 72 for 1.5 min. after a final extension of 10 min at 72, 7 l of the pcr products were resolved in 2% agarose gels stained with ethidium bromide previous dilution in blue juice buffer to check the expected 930-bp band. after checking, 8 l of the pcr products were digested with 10 u of pvuii in 10 buffer and h2o up to a final volume of 20 l at 37 for 2 hr 30 min. the resulting products were separated by gel - electrophoresis in 1.5% agarose gels, containing ethidium bromide in a final concentration of 0.5 g / ml. samples showing only a 930 bp band were assigned as a / a, samples showing two bands of 708 and 222 bp were considered g / g and samples showing three bands at 930, 708 and 222 bp were typed a / g. the distribution of the mcp-1 a / g genotypes for patients and control subjects were compared by the chi - square () test. in the case - control study, genotype distributions and allele frequencies of the mcp genetic marker in both aa and the control population was analyzed (table 2). in the aa patients the frequency of the a and g alleles was 40.3 and 59.7%, respectively and the distribution of the a / a, a / g and g / g genotypes was 19.3, 42.1 and 38.6%, respectively. amongst the controls the frequency of the a and g alleles was 39.8 and 60.2%, and the distribution of the a / a, a / g, g / g genotypes in the same group was 17.5, 44.7 and 37.8%, respectively. the observed genotype frequencies of the aa patient (p=0.129) and the control population (p=0.574) did not show significant difference predicted by the hardy - weinberg equation. when the observed control and patient genotype frequencies were compared with expected values using 32 contingency table in a standard chi - square test (table 2), there was no significant difference (p=0.848). also, there was no significant difference in the allele frequencies between the patients and the controls (p=0.889). we then divided the patients into two subgroups (subgroup 1 [patchy aa ] and subgroup 2 [alopecia totalis and alopecia universalis ]) according to disease severity and also into two further subgroups on age at onset of disease (subgroup a [onset age 30 ] and subgroup b [onset age > 30 ]). comparison of the genotype distributions and the allele frequencies between each subgroup and the control population revealed no significant difference (table 3a, b). although mcp-1 has been proposed as the main chemokine responsible for initiating autoimmune tissue damage (8, 11, 18, 19), the association of polymorphisms in the regulatory regions of the mcp-1 gene with alopecia areata has not been studied until now. recently, in human models of aa it was shown that the increased expression of mcp-1 might play a pivotal role in the attraction of monocytes around the hair bulb (1). in addition, the mcp-1 -2518 g allele was found to increase the mcp-1 expression (12). therefore, we initially hypothesized that the development of aa might have been related to g allele in the mcp-1 gene polymorphism in aa patients. the results of this study, however, did not support this assumption. in this case - control study, the genotype distribution and allelic frequencies showed no significant difference between the patients population and the controls (p=0.848, p=0.889, respectively). there are several potential reasons why there was no association between the -2518a / g polymorphism and alopecia areata. it is noteworthy that there are considerable differences in the frequencies of these polymorphisms among the different races. indeed, it is well known that ethnicity and population structure may strongly influence the role of genetic risk factors in chronic inflammatory diseases including various autoimmune diseases. the distribution of several gene variations may be greatly different between various countries, as well as among different area in the same countries. the dominance of the g - type allele in koreans, which were observed in this present study, is contrasting to what has been reported from caucasians and afroamericans, where the proportion of g allele was 29 and 22%, respectively (12). such reversed ratio was also observed in japanese (13), suggesting that the genotypic profile of mcp-1 -2518 polymorphism varies greatly among ethnic groups. and previously, it was shown that allelic frequency of -2518 polymorphism among patients with other autoimmune diseases with increased serum mcp-1 level, such as rheumatoid arthritis, systemic lupus erythematosus and adult - onset still 's disease, is also similar to that of normal controls (20). in addition, in study about the chemokine expression pattern of aa, benoit. have demonstrated that mcp-1 expression does not appear to be a particular feature of aa due to showing mcp-1 expression by keratinocytes of the inner root sheath but only weak expression around the hair follicles. and chemokine expression patterns did not appear to correlate with clinical severity such as extent of hair loss, number of aa episodes, or presence of associated diseases (1). these findings argue against a role of mcp-1 -2518a / g polymorphism for susceptibility to alopecia areata. in conclusion, this study found no association of -2518a / g polymorphism in the distal regulatory region of the mcp-1 with alopecia areata susceptibility or severity in a korean population. however, it is noteworthy that there are considerable differences in the frequencies of these polymorphisms among the different races. this variation may contribute to the pathogenesis of alopecia areata and must be considered in gene - association studies in different ethnic populations. | monocyte chemoattractant protein-1 (mcp-1) levels are increased in scalp lesions of patients with alopecia areata (aa), suggesting a role in the development of aa. recently, a biallelic a / g polymorphism in the mcp-1 promoter at position -2518 has been found, influencing the level of mcp-1 expression in response to an inflammatory stimulus. we investigated whether the presence of these polymorphisms were associated with aa in korean population. 145 korean patients with aa, 246 healthy subjects without clinical evidence of aa were screened for genotype with a pcr - based assay. in the aa patients the frequency of the a and g alleles was 40.3 and 59.7%, respectively and the distribution of the a / a, a / g and g / g genotypes was 19.3, 42.1 and 38.6%, respectively. amongst the controls the frequency of the a and g alleles was 39.8 and 60.2%, and the distribution of the a / a, a / g, g / g genotypes in the same group was 17.5, 44.7 and 37.8%, respectively. there was no significant difference in the allele frequencies and genotype distributions between the patients and the controls (p=0.889, p=0.848, respectively). our data indicates that no association exists between the -2518a / g polymorphism of the mcp-1 gene and susceptibility to alopecia areata. |
total hip arthroplasty (tha) is widely performed for the purpose of alleviating pain and improving activities of daily living (adls). it is important to repair the hip center and lever arm that cause decreased mechanical efficiency due to hip deformity and to improve mechanical efficiency when reconstructing hip joint function1, 2. hip abductor muscle strength after tha is known to be affected by the height of the hip center3,4,5, femoral offset (fo), and the gluteus medius lever arm1, 5. asayama and chamnnongkich5 examined osteoarthritis (oa) patients with at least 1.6 years of postoperative follow - up after tha, and they demonstrated that the ratio of hip abductor muscle strength of the reconstructed side to that of the unoperated side was strongly and positively correlated with the ratio of fo to body weight lever arm and negatively correlated with the height of the hip center. concerning tha and leg strength, it has been shown in patients scheduled for tha that preoperative hip abductor muscle strength is 31% less than that in healthy individuals, and that preoperative hip abductor muscle strength is not correlated with physical activity6. additionally, hip abductor muscle strength and total workload at 5 months after tha are 56% and 20% of the levels of community dwelling elderly people, respectively, indicating a marked difference between the patients with tha and elderly people7. moreover, patients who have undergone tha have residual muscle atrophy of the quadriceps and do not show recovery in quadriceps muscle strength8. furthermore, it has also been reported that the hip abductor muscle strength on the reconstructed side only recovers to about 80% of that on the unoperated side at both 6 months and 2 years postoperatively9. in patients with unilateral developmental dysplasia of the hip (ddh) scheduled to undergo tha, liu and wen10 reported that cross - sectional area of the gluteus medius was significantly smaller, and that the fo and gluteus medius lever arm were also significantly decreased on the reconstructed side vs. the unoperated side ; they speculated that a greater length of time may be required for postoperative muscle strength recovery when considering the changes in gluteus medius. clinically, even though the artificial joint placement site and the lever arm are properly configured, many patients have a prolonged decrease in muscle strength. previous studies6,7,8,9,10 have demonstrated that hip abductor muscle strength does not recover to the level of the unoperated side or of older people in the geographic region at 5 to 6 months after tha surgery, and it has therefore been postulated that multiple factors aside from mechanical factors are involved in the prolonged decrease of muscle strength. the purpose of this study was to compare the artificial joint lever arm, which is a mechanical factor related to postoperative hip abductor muscle strength, and other factors that are considered to potentially affect postoperative hip abductor muscle strength, including preoperative hip abductor muscle strength, the amount of subluxation of the hip, age11, 12, body mass index (bmi)11, 12, duration of disease13, physical activity6, 12, compliance rate with exercise, and mental state14, 16, and to elucidate the relative importance of factors affecting hip abductor muscle strength during the first 6 months after surgery. a total of 103 females with osteoarthritis scheduled for primary unilateral total hip arthroplasty were eligible. all surgeries were performed by, or under the supervision of, one co - author (kh). the procedure takes off 2025% of the gluteus medius and uses a shorter incision. after setting the femoral and acetabular components, the gluteus medius and the gluteus minimus were completely re - attached to the greater trochanter. exclusion criteria were as follows : patients with charnley classes b and c ; rheumatoid arthritis ; osteonecrosis ; previous surgery on the affected hip ; disorders of the nervous system and muscles ; depression ; or a schizophrenic disorder. recruitment was conducted at the shonan joint reconstruction center from may 3, 2013 to february 6, 2014. the follow - up was conducted 2 and 6 months after surgery from august 3, 2013 to september 6, 2014. the tokushukai group ethics committee approved the study protocol (i d : tge00304 - 115). the intervention procedures were fully explained to all participants, and their written, informed consent was obtained. there were not any financial and personal relationships with other people or organizations that could inappropriately influence or bias present work. the patients were permitted full - weight bearing on the day of surgery, but compound motion of the hip (combined hip flexion 90, hip adduction, and hip internal rotation) was contraindicated to prevent dislocation of the hip. the standard physical therapy pathway involved patients ambulating with a walker - cane on the morning after surgery, a single cane on postoperative day (pod) 3, and ascending and descending stairs on pod 5. patients who were able to walk with a single cane and ascend and descend stairs independently were discharged home. evaluations were conducted in the preoperative period and 2 and 6 months after surgery. investigators determined muscle strength (isometric hip abductor strength), radiographic analyses (crowe class, postoperative femoral offset (fo), height of the hip center (hc)), frenchay activities index (fai), compliance rate with home exercise, and the japanese orthopaedic association hip - disease evaluation questionnaire (jheq). demographic data were collected from clinical records and included : age, body mass index (bmi), diagnosis, disease duration, co - morbidity index, and the harris hip score. isometric hip abductor strength measurements were performed in all patients using a handheld dynamometer (microfet2, hoggan health industries, salt lake city, ut, usa) in the supine position. a handheld dynamometer was placed lateral to the fibula 2.5 cm proximal to the malleolus. the torque and body weight ratio (nm / kg) were measured using the spina malleolar distance and body weight. three trials at maximum effort were performed, and the highest value was used for the analysis. anteroposterior radiographs of the pelvis were taken on the day of examination preoperatively and 2 months after surgery. the amount of hip subluxation in the preoperative period was evaluated using the crowe class18, and quantitative assessment was also performed (crowe %). using the inferior margin of each tear drop as the reference line, the ratio of the distance from the reference line to the top of the femoral head on the unaffected side and the distance from the reference line to the head neck junction on the affected side was calculated (fig. 1.crowe class. using the inferior margin of each tear drop as the reference line, the ratio of the distance from the reference line to the top of the femoral head on the unaffected side (a : solid bar) and the distance from the reference line to the head neck junction on the affected side (b : stripe bar) was calculated (b / a100).). for convenience, crowe class. using the inferior margin of each tear drop as the reference line, the ratio of the distance from the reference line to the top of the femoral head on the unaffected side (a : solid bar) and the distance from the reference line to the head neck junction on the affected side (b : stripe bar) was calculated (b / a100). fo was defined as the length of a perpendicular line from the line of the axis of the femur to the center of the femoral head of the prosthesis. the body - weight lever arm (bwla) was defined as the distance from the center of the femoral head to the line of the center of gravity (fig. the ratio of fo (white bar) and bwla (solid bar) was calculated (fo %).). the ratio of fo (white bar) and bwla (solid bar) was calculated (fo %). hc was defined as the length of a perpendicular line from the center of the femoral head of the prosthesis to the reference line connecting the inferior margin of each tear drop. the definition of a high hip center was 2 cm or more above the anatomical hc19. physical activities were defined as regular activities in the adl setting 3 months before the onset of this study. the fai evaluates the frequency and intensity of physical activities in the adl setting. the fai score (045 points) ranges from 0 points for a sedentary life style to 45 points for a very active life style. patients were told to do home exercises and to complete the self - report sheet every day for 2 months after surgery. they were also asked to collect the self - report sheets at the end of the postoperative period (2 months after surgery). the compliance rate with exercises was calculated based on the performance of exercise sessions. home exercises consisted of a 3-exercise menu : clamshell exercise, hip raise exercise, and hip abduction exercise. each exercise session consisted of 1 set of 20 repetitions in the supine position. psychological status measurements of all patients were performed using the jheq mental score, a sub - scale of the jheq22, which is a self - administered questionnaire that can be useful in patients who frequently engage in deep flexion of the hip joint due to lifestyle and culture. the jheq mental score contains these question items : anxiety, irritation, dissatisfaction, and difficulty participating in activity or the local community. statistical analyses were conducted by a co - investigator (ja) who was independent from the recruitment, intervention, and data collection. the minimal sample size for the stepwise multiple regression analysis to examine significant factors (=0.05, power=0.95, effect size=0.4) was calculated. additionally, assuming a 1% dislocation rate after tha, a 1% dropout rate was set ; 66 participants were required. factors related to isometric hip abductor muscle strength 2 and 6 months after surgery were examined by stepwise multiple regression analysis. the dependent variable was isometric hip abductor muscle strength 2 and 6 months after surgery. independent variables were age, bmi, disease duration, fo, crowe %, isometric hip abductor muscle strength in the preoperative period, compliance rate with home exercise at 2 months after surgery, fai at 2 or 6 months after surgery, and the jheq mental score at 2 or 6 months after surgery. for all statistical tests, all data were analyzed using spss software (version 21, ibm, chicago, il, usa). six participants were unable to complete the study after surgery because of alteration of the surgical procedure (n=1), perioperative femoral fracture (n=1), other limb fracture after surgery (n=1), depression (n=2), and did not attend follow - up examinations (n=1) ; thus, 97 participants were included in the analysis (table 1table 1.demographic data of the patientsvariablemean sdnumber of patients97age (years)62.2 8.4body mass index at pre - operative period (kg / m)23.4 3.7diagnosis (secondly oa due to hip dysplasia : primary oa)94 : 3co - morbidity index (score)0.3 0.6disease duration (years)9.1 9.9crowe % (amount of subluxation of the hip)21.1 2.1crowe class (type i : ii : iii : iv)75 : 21 : 1 : 0oa : osteoarthritis). femoral prostheses used included the m / l taper with kinectiv stem (straight neck : 56, anteverted neck : 1, retroverted neck : 2) (zimmer warsaw, in, usa) in 59 patients, a trabecular metal primary hip prosthesis stem (zimmer) in 22 patients, and an sl - plus stem (smith & nephew andover, ma, usa) in 16 patients. femoral head diameter was 26 mm in 38 patients, 28 mm in 52 patients, 32 mm in 6 patients, and 36 mm in 1 patient. the height of the hip center was within 1.2 cm of the anatomical hip center in all patients. chronological changes are shown in table 2table 2.chronological changes in the pre- and postoperative periodsevaluated measurespreoperative periodpostoperatively2 months postoperatively6 monthsharris hip score (point)60.5 12.9 77.8 6.8 86.9 6.5hip abductor muscle strength (nm / kg) 0.61 0.18 0.72 0.19 0.83 0.26femoral offset % 43.9 7.2jheq mental score 10.4 6.2 16.9 6.6 20.0 6.1frenchay activities index 29.3 6.623.3 7.329.8 5.6compliance rate of home exercise86.8 18.9. significant factors related to isometric hip abductor muscle strength at 2 months after surgery were, in extraction order : 1. isometric hip abductor muscle strength in the preoperative period (=0.467, p<0.05) ; 2. jheq mental score at 2 months after surgery (=0.212, p<0.05) (table 3table 3.factors related to hip abductor muscle strength at 2 months and 6 months after surgeryindependent variablestandard partial regression coefficient ()rrincluded factors (2 months after surgery)hip abductor muscle strength at preoperative period0.4670.5500.303 bmi0.2910.6070.369 jheq mental score at postoperatively 2 months0.2120.6430.413 included factors (6 months after surgery)hip abductor muscle strength at preoperative period0.4430.5320.283 bmi0.2860.6040.364 jheq mental score at postoperatively 6 months0.1980.6350.403 p<0.05). significant factors related to isometric hip abductor muscle strength at 6 months after surgery were, in extraction order : 1. isometric hip abductor muscle strength in the preoperative period (=0.443, p<0.05) ; 2. jheq mental score at 6 months after surgery (=0.198, p<0.05) (table 3). in addition, delp and wixson19 reported that a 2-cm superior positioning of the hip center, without lateral placement, does not have major adverse effects on hip abductor muscle strength. accordingly, this study did not examine the effect of hc on hip abductor muscle strength. previous reports on predicting hip abductor muscle strength after tha can be roughly classified into two types : reports related to lever arm, which is at the core of reconstructing hip function1,2,3,4,5, and reports concerning preoperative physical function or demographic data6, 11,12,13,14,15,16. while there are many reports on factors involved in hip abductor muscle strength, there are no reports on the relationships among these factors, and in order to prevent the prolongation of decreased hip abductor muscle strength, it is necessary to elucidate which factors are involved in such prolongation and to preferentially address the issues pertaining to these factors. in the present study, the same factors were related to hip abductor muscle strength at 2 months and at 6 months after surgery, and the order in which they were extracted was also the same. preoperative hip abductor muscle strength was extracted as the most significant factor, while the postoperative compliance rate with exercise was not a significant factor. jan and hung23 conducted a 3-month study concerning postoperative voluntary training primarily involving antigravity exercise and walking, and they reported that functional improvements can be expected even at 18 months post - tha, as long as the compliance rate with exercise is 50% and the hip abductor muscle strength has improved. the compliance rate with exercise in the present study was high, at 86.8 18.9% at 2 months postoperatively ; however, this was not extracted as a factor, possibly because exercise tasks were lower in load compared to previous studies. the present results also indicated that it is important to focus on muscle strengthening exercises from the preoperative stage in order to efficiently achieve postoperative hip abductor muscle strength. however, rooks and huang24 conducted a 6-week, pre - tha exercise therapy regimen primarily using muscle strength training machines (~10 rm : 10 times repetition maximum) and pool exercises, and they reported that, while the physical functioning score on the sf-36 improved, gross extensor muscle strength did not improve. further investigations are necessary to identify a method to efficiently improve preoperative hip abductor muscle strength. obese patients needed higher torque of hip abductor muscle strength compared with thin patients because hip abductor muscle strength : torque and the body weight ratio were measured using the spina malleolar distance and body weight. this indicates that obese patients are at a disadvantage for gaining appropriate muscle strength. however, it may not be considered effective to encourage patients to lose weight before surgery. it has been reported that depression after tha is involved in increased perioperative adverse events25 and adl limitations at two years postoperatively26, and it increases the risk of early revision surgery27. it is postulated that the jheq mental score not only affects postoperative hip abductor muscle strength, but it also has a mutual relationship, in that a prolonged decrease in muscle strength affects the patients mental state, such as self - efficacy28. to intervene for the patients mental state29, 30, it is important to encourage the patients self - efficacy for activity and social participation through improving hip abductor muscle strength. additionally, for patients who experience anxiety or frustration about postoperative living, it is necessary to establish initiatives to encourage self - efficacy, including peer counseling by patients who have previously undergone tha and do not experience problems in everyday life31. contrary to the authors expectations, fo was not extracted as a factor affecting postoperative hip abductor muscle strength. tezuka and inaba32 reported that increasing fo together with shifting the hip center medially and distally is effective in hip abductor muscle strength recovery. in contrast, bjrdal and bjrgul33 reported that increased fo did not affect hip function, consistent with the present findings. at 2 months after surgery in the present study, the standard deviation of the mean was smaller for fo than for hip abductor muscle strength (16.4% vs. 26.4%). from this perspective, it is postulated that fo was not extracted as an influencing factor because fo was constructed with consideration of its effects on hip abductor muscle strength, resulting in such effects becoming homogeneous first, preoperative femoral neck anteversion was not measured. however, of the study patients, 77.3% had crowe class i, 21.6% had type ii, and only one patient had type iii. the kinectiv was used in patients with dysplasia, a condition in which anteversion anomaly is a concern. a retroverted neck was used in patients with excessive anteversion, only 2 cases (2/59), and a straight neck was used in the majority of patients. based on this information, the differences between each patient in neck anteversion after tha probably had a minimal effect on postoperative hip abductor muscle strength. second, compliance rates with home exercise were checked by the self - report sheet ; postoperative exercises after discharge were not performed under the supervision of a physical therapist in the present study. as conclusion, the effects of fo, as well as preoperative and postoperative factors, on hip abductor muscle strength were investigated during the first 6 months after tha. the same factors were related to hip abductor muscle strength at 2 months and 6 months after surgery, and the order of extraction was : 1. fo was not extracted as a significant factor related to postoperative isometric hip abductor strength. | [purpose ] the importance and effect of hip joint geometry on hip abductor muscle strength are well known. in addition, other perioperative factors are also known to affect hip abductor muscle strength. this study examined the relative importance of factors affecting hip abductor muscle strength after total hip arthroplasty. [subjects and methods ] the subjects were 97 females with osteoarthritis scheduled for primary unilateral tha. the following variables were assessed preoperatively and 2 and 6 months after surgery : isometric hip abductor strength, radiographic analysis (crowe class, postoperative femoral offset (fo)), frenchay activities index, compliance rate with home exercise, japanese orthopaedic association hip - disease evaluation questionnaire (jheq), and demographic data. factors related to isometric hip abductor muscle strength 2 and 6 months after surgery were examined. [results ] significant factors related to isometric hip abductor muscle strength at 2 and 6 months after surgery were, in extraction order : 1. isometric hip abductor muscle strength in the preoperative period ; 2. bmi ; and 3. the jheq mental score at 2 and 6 months after surgery. [conclusion ] preoperative factors and postoperative mental status were related to postoperative isometric hip abductor strength. fo was not extracted as a significant factor related to postoperative isomeric hip abductor strength. |
although uterine rotation due to a myoma is a rare complication of pregnancy 1, obstetricians should be alerted to avoid making an incorrect uterine incision during cesarean section. a 35-year - old woman (gravida 1, para 0) was referred to our hospital for delivery because her pregnancy was complicated by a left - sided myoma that measured 15 cm in diameter during ultrasonography. the patient 's medical history included renal artery aneurysm, primary aldosteronism, and chronic hypertension. to determine the anatomical relationship between the uterus and the myoma, we performed magnetic resonance imaging (mri) at 30 weeks ' gestation (fig.1a). mri revealed that the myoma was intramural and located on the left side. notwithstanding the myoma, the pregnancy had not been complicated by abdominal pain, placental abruption, fetal growth restriction, or preterm labor and birth. fetal growth was determined to be appropriate for the gestational age, and no major anomalies were revealed by ultrasound. because of breech presentation, the patient was scheduled to undergo an elective cesarean section. owing to her chronic hypertension, the cesarean section was scheduled for 37 weeks ' gestation. (a) magnetic resonance imaging revealed an intramural myoma on the left side (its greatest dimension is not shown in this figure) ; however, imaging did not reveal the degree of uterine rotation. (b) midline laparotomy showed multiple large vessels pressing on the uterus. from the first abdominal incision prior to delivery, the obstetrician was unable to accurately understand the anatomical relationship between the myoma and the intra - abdominally placed uterus. therefore, the abdominal incision was extended vertically around the umbilicus, and the uterus was brought outside the abdominal cavity (fig.2a). as a result, we were able to evaluate the spatial relationship between the tumor and the uterus. we then located the vessels belonging to the utero - ovarian ligament and the uterine parametrium ; they were facing front because the myoma had rotated the uterus 90. a vertical uterine incision was made to open the uterus (fig.2b). intraoperative bleeding was 1600 ml. we managed the section successfully, and the patient delivered a healthy male infant, weighing 2538 g with apgar scores of 4 and 9 at 1 and 5 min, respectively. the neonate had no feeding - related complications ; he gained sufficient weight and was discharged with his mother. six months after delivery, the patient 's myoma had decreased to approximately 11 cm in size. (a) by bringing the uterus outside the abdominal cavity during the cesarean section, we were able to determine that the uterus was rotated 90 by the myoma, and the right side of the uterus was anteriorly directed. in this figure, the rotation has been corrected ; the white arrow denotes the area shown in figure1b. (b) because a low transverse uterine incision was not feasible, a vertical uterine incision was made. at the time of incision, we monitored the surgical margin between the incision and the myoma to ensure that the myoma was maintained in order to prevent hemorrhage. the distance between the incision and myoma usually shortens because of postdelivery uterine contraction. in summary, if the obstetrician has difficulty in confidently identifying the anatomical landmarks required to properly orient the uterine incision during a cesarean section, he or she should bring the patient 's uterus outside the abdomen. if an ill - placed uterine incision is made to deliver the child, massive intraoperative hemorrhaging can result. the authors declare that they have no conflicts of interest or funding disclosures related to this study. | key clinical messagein pregnancies complicated by large myomas, obstetricians may face difficulties during cesarean section if they fail to notice the rotation of the uterus and could make an incorrect uterine incision. this error might cause massive intraoperative hemorrhage. obstetricians must exercise extreme caution during cesarean sections complicated by large myomas. |
consistent and replicable mechanical force on target spinal tissue is critical for minimizing functional and histological variability and for establishing successful contusive spinal cord injury (sci) models. the amount of force applied to a target region of the spinal cord depends on the methods utilized for spine stabilization. positional shifting of the target spine during contact between the impact plunger and the spinal cord alters the resultant injury force. the cervical contusive sci model is a more clinically relevant model than other forms of sci, as approximately 50% of human sci cases occur at this level, and several sci studies have been performed using animal cervical injury models. although contusive sci models often utilize some form of stabilization by clamping the spinal processes anterior and posterior to the injury site, this preparation is difficult for producing cervical sci. as shown in this demonstration, the stabilization method we developed is advantageous in its ability to increase both the quality and reproducibility of contusion injury. particularly, this method of vertebral stabilization was established in an attempt to amend the shortcomings and challenges of other models : 1) variability in vertebral yielding under the impact force may occur by clamping adjacent dorsal spinous processes rostral and caudal to the laminectomy. the degree of vertebral shifting is dependent on the number of vertebral joints between the impact and the vertebrae being stabilized (figure 1). therefore, the more joints involved the less stable the spine becomes ; 2) the dorsal spinous processes are fragile and cause clamp failure as a result of spinous process fracture or the clamp slipping off of the process ; and 3) the spinous processes on these vertebrae are extremely short between the c3 to t1 vertebrae compared to those of the thoracic vertebrae, which makes it difficult using traditional clamps to grasp the spinous processes for stabilizing the cervical spine. here we describe a novel method of stabilizing the spine for producing c5 contusive sci in adult female sprague - dawley rats. this method can be used for stabilization of other levels of the vertebral column and spinal cord, and conjugates well with other contusive sci devices, including the new york university / multicenter animal spinal cord injury study (nyu / mascis) impactor (figure 2), precision systems and instrumentation, llc infinite horizon (ih) device, ohio state university / electromagnetic spinal cord injury device, and the louisville injury system apparatus (lisa), allowing for widespread use in sci research. clean the surgical surface with 70% ethanol, pre - warmed with a heating pad. cover the surface with a sterile surgical drape before placing sterile gauze, cotton swabs, and use a microbead sterilizer for inter - surgery sterilization of surgical tools. anesthetize the rat with ketamine (87.7 mg / kg)/xylazine (12.3 mg / kg) intraperitoneally (ip). the proper plane of anaesthesia is reached when the animal ceases to respond to a toe pinch stimulus. subcutaneously inject 0.01 - 0.05 mg / kg buprenorphine and 5 mg / kg carprofen prior to surgical procedure. buprenorphine should then be administered every 8 - 12 hr and carprofen once daily, for the first 4 - 7 days following surgery. apply protective ointment to the eyes of the animal to prevent corneal drying during surgery. shave the surgical area on the dorsal surface of the rat from the mid - thoracic region to the back of the head with clippers. apply betadine solution to the shaved area as a surgical scrub then clean the area with 70% isopropyl alcohol wipes. use a scalpel blade to perform a 3 - 4 cm midline incision in the skin from the base of the head caudally to mid - thorax. identify the midline of the fascia and subcutaneous muscles anterior to the hibernating gland at the lower neck ; cut through the trapezius and other muscles along the midline to reduce hemorrhage. find the midline of two regions of adipose tissue underlying the muscles ; cut the paraspinous muscles caudally strictly along the midline, and separate muscle layers using a small tissue retractor until the level of the thoracic t2 spinous process is reached. identify and cut away the muscle connected to the t2 spinous process to utilize this structure as an anatomic landmark. remove the cartilaginous tip of the t2 spinous process to improve visibility of the cervical vertebrae. separate the paraspinal muscles laterally from the spinous processes and laminae of c4-t1 ; however, spare the muscle covering on the c3 lamina to prevent bleeding. cut the muscles over the laminae from c4-t1 laterally towards the facets on both sides of the spinal column. after the spinal laminae are exposed, place the animal on its ventral surface in the u - shaped channel of the stabilizer. identify the c5 vertebra by counting the spinous processes rostrally from the t2 landmark to t1, c7, c6, and finally c5. position the two stainless steel arms of the stabilizer to suspend the animal by placing the serrated edges of the arms underneath the lateral facets of the c5 - 6 vertebrae (figure 1c). after securing the arms with vertebrae in place (figure 2b), cut the ligaments between the spinal processes and laminae at c4 - 5 and c5 - 6 to identify the margin of the c5 lamina. using a micro - rongeur, clip away the half of the lamina on the right at c5 as intended for sci (figure 5c - e). secure the animal together with stabilizer on a mount (figure 3a - c) to precisely align the plunger on the spinal cord target using a lateral micro - manipulator (figure 3). under high magnification, locate the c5 and c6 dorsal root entry zones (drezs) on the exposed dorsal spinal cord surface without durotomy. aim the plunger at the middle of the two identified drezs and halfway between the midline and the lateral edge of the spinal cord (figure 5b). using an nyu / mascis impactor device with a 2.5 mm diameter tip (figure 3a & b), produce a c5 hemi - contusion (figure 5b & e) by a 10 g rod x 12.5 mm height drop (figure 2a). verify the injury visually by bruising on the spinal cord (figure. 5e, arrow) and check the injury parameters provided by the nyu software(figure 6). suture muscles and soft tissue with sterile 4 - 0 vicryl suture, then close the skin incision with surgical staples (ez clips). place the animal in a heat - controlled environment (recirculating hot water padcage on a heating pad)) with moist food provided on the bedding (changed daily), and a water bottle with a long spout for easy access placed on the floor of the cage. as this is a unilateral cervical contusive injury, the animal will likely lose function of the ipsilateral forelimb, transiently, which begins to recover during the first few weeks after injury. however, contralateral function should remain intact, thus the animal should be able to eat and drink without impairment, and have only minor impairment in locomotion and grooming. clean the surgical surface with 70% ethanol, pre - warmed with a heating pad. cover the surface with a sterile surgical drape before placing sterile gauze, cotton swabs, and use a microbead sterilizer for inter - surgery sterilization of surgical tools. anesthetize the rat with ketamine (87.7 mg / kg)/xylazine (12.3 mg / kg) intraperitoneally (ip). the proper plane of anaesthesia is reached when the animal ceases to respond to a toe pinch stimulus. subcutaneously inject 0.01 - 0.05 mg / kg buprenorphine and 5 mg / kg carprofen prior to surgical procedure. buprenorphine should then be administered every 8 - 12 hr and carprofen once daily, for the first 4 - 7 days following surgery. apply protective ointment to the eyes of the animal to prevent corneal drying during surgery. shave the surgical area on the dorsal surface of the rat from the mid - thoracic region to the back of the head with clippers. apply betadine solution to the shaved area as a surgical scrub then clean the area with 70% isopropyl alcohol wipes. use a scalpel blade to perform a 3 - 4 cm midline incision in the skin from the base of the head caudally to mid - thorax. identify the midline of the fascia and subcutaneous muscles anterior to the hibernating gland at the lower neck ; cut through the trapezius and other muscles along the midline to reduce hemorrhage. find the midline of two regions of adipose tissue underlying the muscles ; cut the paraspinous muscles caudally strictly along the midline, and separate muscle layers using a small tissue retractor until the level of the thoracic t2 spinous process is reached. identify and cut away the muscle connected to the t2 spinous process to utilize this structure as an anatomic landmark. remove the cartilaginous tip of the t2 spinous process to improve visibility of the cervical vertebrae. separate the paraspinal muscles laterally from the spinous processes and laminae of c4-t1 ; however, spare the muscle covering on the c3 lamina to prevent bleeding. cut the muscles over the laminae from c4-t1 laterally towards the facets on both sides of the spinal column. after the spinal laminae are exposed, place the animal on its ventral surface in the u - shaped channel of the stabilizer. identify the c5 vertebra by counting the spinous processes rostrally from the t2 landmark to t1, c7, c6, and finally c5. position the two stainless steel arms of the stabilizer to suspend the animal by placing the serrated edges of the arms underneath the lateral facets of the c5 - 6 vertebrae (figure 1c). after securing the arms with vertebrae in place (figure 2b), adjust the stabilizing apparatus to ensure the vertebral column is level and centered. cut the ligaments between the spinal processes and laminae at c4 - 5 and c5 - 6 to identify the margin of the c5 lamina. using a micro - rongeur, clip away the half of the lamina on the right at c5 as intended for sci (figure 5c - e). secure the animal together with stabilizer on a mount (figure 3a - c) to precisely align the plunger on the spinal cord target using a lateral micro - manipulator (figure 3). under high magnification, locate the c5 and c6 dorsal root entry zones (drezs) on the exposed dorsal spinal cord surface without durotomy. aim the plunger at the middle of the two identified drezs and halfway between the midline and the lateral edge of the spinal cord (figure 5b). using an nyu / mascis impactor device with a 2.5 mm diameter tip (figure 3a & b), produce a c5 hemi - contusion (figure 5b & e) by a 10 g rod x 12.5 mm height drop (figure 2a). verify the injury visually by bruising on the spinal cord (figure. 5e, arrow) and check the injury parameters provided by the nyu software(figure 6). suture muscles and soft tissue with sterile 4 - 0 vicryl suture, then close the skin incision with surgical staples (ez clips). apply antibacterial ointment to the surgical site. place the animal in a heat - controlled environment (recirculating hot water padcage on a heating pad)) with moist food provided on the bedding (changed daily), and a water bottle with a long spout for easy access placed on the floor of the cage. as this is a unilateral cervical contusive injury, the animal will likely lose function of the ipsilateral forelimb, transiently, which begins to recover during the first few weeks after injury. however, contralateral function should remain intact, thus the animal should be able to eat and drink without impairment, and have only minor impairment in locomotion and grooming. upon following this protocol, consistent and reproducible cervical hemi - contusive sci is produced (figure 5 & 6). the use of a vertebral stabilizer to stabilize the lateral processes of the same vertebra at the level intended for sci allows for such satisfactory results. using this method, not only the target c5 vertebra, but also adjacent c4 and c6 are rigidly fixed. the nyu / mascis software provides a read - out with a graph set on an x and y - axis, and supports the use of our vertebral stabilization method, and equipment (figure 6). this method of stabilization reduces injury variability that can result from the downward shifting of the target tissue and spinal column (figure 1). following injury, a clear unilateral bluish hematoma centered between the c5 and c6 drezs is visible (figure 5e). these injury parameters are consistent from animal to animal according to the readout provided by the nyu / mascis software (figure 6). as the cervical hemi - contusion produces clear forelimb deficits, this model is ideal for assessing forelimb functional abilities such as reaching, grooming, and object manipulation. as hindlimb motor deficits are less prominent, the basso, beattie and bresnahan (bbb) locomotor scoring scale is not appropriate for use in this model. the functional outcome following injury is most noticeable in the ipsilateral forepaw extensor deficits, in which the rat exhibits a clubbed all animals exposed to the same injury severity and level of the spinal cord should exhibit similar deficits to the ipsilateral forelimb illustrated in this protocol, upon correct injury. histologically, this model produces extensive gray and white matter damage at the injury epicenter and rostral and caudal to the site of injury, leading to considerable lesion and cavity formation contained almost exclusively within the injured side of the spinal cord. a large, primarily astrocyte - based glial scar forms at the lesion borders with massive neuronal death. yield of the spine when spinous processes are clamped dorsally, allowing for improper impacts and inconsistent data. the illustration shown in a displays much more flexibility upon impact (red dashed line and large curved arrows) compared to that shown in b (smaller curved arrows), as the clamps are farther from the site of laminectomy and injury. figure c shows lateral stabilization with our described device with the stabilizing arm securely tightened under the transverse process of the vertebra where the site of impact will be performed. there is no flexibility of the spine during this procedure, as the vertebra of interest is completely stabilized. figure a displays the parts and features of the nyu / mascis spinal cord injury device, with multiple rod height settings for injury severity (inset). figures b and c illustrate the u - shaped container that holds the rat, and the serrated stabilization arms that securely stabilize the vertebral column during surgery and injury (designed and produced by y.p. figure 3 : custom mounting system and lateral microadjuster on the nyu / mascis impactor. figure a details the different components of the custom mounting system for the u - shaped rat stabilizer for spinal cord injury. note the lateral microadjuster in figure a, crucial for precise alignment of the rat spinal cord for injury. figures b and c provide further depiction of the stabilizer without (b) and with the u - shaped rat container (c) with respect to other important components of the injury device (mounting system designed and produced by y.p. figure 4 : measurements of the individual components of the surgical stabilization device and attachments. each component of the custom stabilization system is highlighted to show the dimensions and scale (a, c, and d). thoracic stabilization arms (b) are shown to display the potential application of this device for use in different spinal surgical models. figure 5 : surgical landmarks and preparation for cervical hemi - contusion spinal cord injury. figures a and b portray the correct landmarks for proper impact alignment on the exposed rat spinal cord. the appropriate impact point is directly between the c5 and c6 dorsal nerve roots (rostral - caudal) and the midline and lateral edges of the spinal cord (b). figures c - e show, in higher magnification, the process of exposing the desired half of the cervical spinal cord for injury, through careful unilateral laminectomy. also, figures d and e demonstrate the cord immediately before and after spinal cord contusion injury. note the visible hemorrhage (e) caused by the impact (black arrow). examples of acceptable versus unacceptable data readouts following impact with the nyu / mascis impactor. the top graph (a) and top data set (c) illustrate a readout of a very good impact, with data measurements of % error for impact rod velocity, initial height, and starting time, as indicated with the red arrow and underline. conversely, the bottom panel demonstrates data produced by an improper impact caused by improper stabilization of the spinal column (b) and error during zeroing of the impactor rod and tip onto the spinal cord surface, prior to setting the height of the impactor rod (c). note the considerable error indicated for the initial height and start time of the impactor drop, as indicated by the red arrow and underline. the software also provides a warning that error has been detected for these parameters (bottom of panel c). here we have demonstrated a cervical spine stabilization method for producing unilateral contusive sci at c5. this stabilization method increases the precision of the trauma anatomically and produces consistent functional deficits. in other models that rely on dorsal clamping of the spinous processes, the risk of spinous process damage or detachment of the clamps from the vertebra is quite high. these models may also allow considerable spine shifting and yielding from the contusion force and the flexible nature of the spine and vertebral columns (figure 1a and b). the tissue yielding alters the plunger - tissue contact time and results in unpredictable injury force (figure 1a - b & 6b). our described vertebral stabilization also provides other benefits to the surgical preparation : 1) this method fully stabilizes the vertebrae centered at c5 under the surgical microscope which increases the accuracy of laminectomies (figure 1c) ; 2) the animal mounted within the u - shaped stabilizer can be taken directly from the surgical location to the customized mounting attachment, which avoids the procedure of remounting the animal on sci devices and saves time ; and 3) stabilizing the vertebrae at the injury level and directly dorsal and caudal to the intended site of injury can greatly diminish the body movement caused by respiration, another measure to reduce variability. the primary advantage of utilizing this stabilization method is the reduced amount of yielding, or ventral movement of the spinal cord and column upon impact. based on simple physics of a contusion injury, the force and energy of the impact will transfer from the rod to the spinal cord, ideally with the cord absorbing this energy at the site of impact. however, if the spine yields beneath the cord, as is possible in the dorsal spinous clamping method (figure 1a & b), the actual force applied to the cord is decreased and variable, depending upon the degree of yield. although this video illustrates the entire procedure of a cervical contusive sci model, the essence of this article is the introduction of the spinal stabilization method we use in various applications in our lab, specifically for sci studies. a modified version of this stabilization device and method has been used on mice sci. this simple method of spine stabilization is highly useful for sci research, and we have previously used this method and equipment to perform thoracic contusion as well as laceration sci models. another lab has recently described a variation of this form of stabilization for cervical injury in this journal. in summary, we introduce this novel vertebral stabilization method to several surgical procedures for generating reproducible experimental sci ranging from laminectomy to injury production. the benefits of this stabilization device are not limited to cervical spinal cord contusion, as this stabilization method has been adapted for a wide variety of experiments such as intra - spinal injections, cellular transplantation, csf collection from the cisterna magna, hemisection and transection injuries, thoracic contusion injuries, in vivo imaging employing two - photon microscopy, and spinal electrophysiological recording. increasing the quality of the spinal surgical and injury procedures and reducing the experimental variability will help provide insight into true mechanisms of injury and recovery, and screen the effects of different therapies on the devastating disorder of sci. | clinically - relevant animal cervical spinal cord injury (sci) models are essential for developing and testing potential therapies ; however, producing reliable cervical sci is difficult due to lack of satisfactory methods of vertebral stabilization. the conventional method to stabilize the spine is to suspend the rostral and caudal cervical spine via clamps attached to cervical spinous processes. however, this method of stabilization fails to prevent tissue yielding during the contusion as the cervical spinal processes are too short to be effectively secured by the clamps (figure 1). here we introduce a new method to completely stabilize the cervical vertebra at the same level of the impact injury. this method effectively minimizes movement of the spinal column at the site of impact, which greatly improves the production of consistent scis. we provide visual description of the equipment (figure 2 - 4), methods, and a step - by - step protocol for the stabilization of the cervical 5 vertebra (c5) of adult rats, to perform laminectomy (figure 5) and produce a contusive sci thereafter. although we only demonstrate a cervical hemi - contusion using the nyu / mascis impactor device, this vertebral stabilization technique can be applied to other regions of the spinal cord, or be adapted to other sci devices. improving spinal cord exposure and fixation through vertebral stabilization may be valuable for producing consistent and reliable injuries to the spinal cord. this vertebral stabilization method can also be used for stereotactic injections of cells and tracers, and for imaging using two - photon microscopy in various neurobiological studies. |
the majority of these studies were conducted with adult male sprague - dawley rats from a selective - breeding colony which has been previously described14. selectively - bred rats from generations s18, s20 and s21 were transported from the university of michigan (ann arbor, mi) to the university of washington (seattle, wa) for the fscv experiments. during each behavior session, chronically implanted microsensors, placed in the core of the nucleus accumbens, were connected to a head - mounted voltammetric amplifier for detection of dopamine by fscv23. voltammetric scans were repeated every 100 ms to obtain a sampling rate of 10 hz. voltammetric analysis was carried out using software written in labview (national instruments, austin, tx). on completion of the fscv experiments, recording sites were verified using standard histological procedures. to examine the effects of flupenthixol (sigma, st. louis, missouri ; dissolved in 0.9% nacl) on the performance of sign - tracking and goal - tracking behavior, rats received an injection (i.p.) of 150, 300 or 600 g / kg of the drug one hour prior to pavlovian conditioning sessions 9, 11 and 13. doses of the drug were counterbalanced between groups and interspersed with saline injections (i.p., 0.9% nacl ; prior to sessions 8, 10, 12 and 14) to prevent any cumulative drug effects. to examine the effects of flupenthixol on the acquisition of sign - tracking and goal - tracking behavior, rats received an injection of either saline (i.p.) or 225 g / kg of the drug one hour prior to pavlovian conditioning sessions 17. detailed methods and any associated references are available in the online version of the paper at www.nature.com/nature. | individuals make choices and prioritize goals using complex processes that assign value to rewards and associated stimuli. during pavlovian learning, previously neutral stimuli that predict rewards can acquire motivational properties, whereby they themselves become attractive and desirable incentive stimuli. but individuals differ in whether a cue acts solely as a predictor that evokes a conditional response, or also serves as an incentive stimulus, and this determines the degree to which a cue might bias choice or even promote maladaptive behavior. here we use rats that differ in the incentive motivational properties they attribute to food cues to probe the role of the neurotransmitter dopamine in stimulus - reward learning. we show that intact dopamine transmission is not required for all forms of learning in which reward cues become effective predictors. rather, dopamine acts selectively in a form of reward learning in which incentive salience is assigned to reward cues. in individuals with a propensity for this form of learning, reward cues come to powerfully motivate and control behavior. this work provides insight into the neurobiology of a form of reward learning that confers increased susceptibility to disorders of impulse control. |
uterine artery fibroid embolisation (uae) has now been used in clinical practice for > 2 decades in the management of symptomatic uterine fibroids [1, 2 ]. it is estimated that > 50,000 procedures have been performed worldwide since ravina reported his series in france in 1995 [3, 4 ]. uae is emerging as an effective alternative to hysterectomy and myomectomy in women with fibroids. although long - term follow up data are still lacking, early reports regarding its safety and efficacy have been encouraging, and the procedure is increasingly being accepted. however, there is a lack of evidence on future fertility and pregnancy outcomes in women undergoing uae. a 44-year - old nulliparous woman with a body mass index of 27 underwent uae in july 2008 for symptomatic relief of heavy menstrual bleeding. she had previously undergone endoscopic resection of a submucous fibroid in 2002 and open myomectomy in 2003. she subsequently underwent exploratory laparotomy and division of adhesions for relief of small - bowel obstruction in february 2007. a subsequent hysteroscopy in november 2007 showed a large cavity distorted by fibroids. a pelvic ultrasound scan before her procedure showed an antiverted, enlarged uterus measuring approximately 13.5 8 9 cm. the myometrium was noted to be diffusely heterogenous, containing multiple fibroids in the anterior and posterior walls. femoral artery puncture using a 5f sheath, a 4f catheter, and a 3f coaxial catheter. multiple injections of contrast were administered into the internal iliac arteries and uterine arteries. the uterus was noted to be hypervascular and supplied by hypertrophied uterine arteries. each uterine artery was selectively catheterised and embolised with polyvinyl alcohol particles (william cook europe, bjaeverskov, denmark). one vial of particles 350500 m in diameter and two vials of particles 510700 m in diameter were used. the end point of the embolisation process was near - stasis in the uterine artery. the plan was for her to be on bed rest for 12 h for observation of the puncture site for bleeding or swelling and administration of analgesia (diclofenac sodium and paracetamol). nineteen hours after the procedure, the patient had sudden - onset shortness of breath and collapsed. she received cardiopulmonary resuscitation (cpr) for > 1 h. however, there was no cardiac activity throughout cpr, and she was noted to have pulseless electrical activity on cardiac monitoring. cpr was discontinued after 1 h and 10 min, and the patient was pronounced dead. to our knowledge this is the first reported case in the united kingdom in which death occurred from pulmonary embolisation after uae. the embolisation procedure had appeared routine. the size of the uterus was not considered likely to have caused compression and stasis in the lower - limb venous structures. certainly, patients with symptoms from a uterus of greater size than that seen in this patient have been treated at our institution. it is not clear from the postmortem autopsy if the origin of the embolus was from the pelvic or the lower - limb veins. theoretically, it is possible to surmise that pelvic veins are enlarged and engorged in the presence of multiple hyper vascular fibroids, which consequently have decreased flow after embolisation, thus producing a potential scenario for thrombosis. relative contrast stasis can be visualised in veins draining the uterus during any embolisation procedure. if the treatment had been carried out as a day case, then death would have occurred at home. the precipitous nature of the events raises the question as to whether there was a pre - existing thrombosis, which may have rapidly progressed after uae. there was a history of previous pelvic surgery ; however, there was no clinical evidence for pelvic or lower - limb venous thrombosis or clinical history of thrombotic tendency before the embolisation procedure was performed. two women died after uae from septic shock, one in the united kingdom and the other in the netherlands. one woman with known breast cancer died in italy several days after uae from a pulmonary embolus, and two women died in the united states from pulmonary emboli after the procedure. although the risk of developing a fatal venous thromboembolus is considered low, there have so far been at least four reported cases in the literature. we advocate that women undergoing this procedure should routinely receive thromboprophylaxis in the form of thromboembolic - deterrent stockings. however, these would be of no benefit from an embolus originating in the pelvic veins. further research is needed to assess the role of thromboprophylaxis using heparin - like agents with this procedure. at present indeed, the use of such agents to decrease the incidence of embolic events (which are already rare relative to the number of procedures performed) may be accompanied by increased bleeding complications or more ineffective embolisation procedures (and therefore poor clinical outcomes) that rely on inducing local vessel thrombosis as well as physical occlusion. it is not possible to say if patients with a previous history of pelvic surgery are at greater risk of embolus after uae. the continued reporting of all uae cases to a national registry would allow us to monitor the number of women undergoing the procedure, the number and type of complications, and the fertility outcomes in all such cases. | we report a 44-year - old woman who developed a fatal pulmonary embolus after uterine artery fibroid embolisation (uae). bilateral uae was carried out through a single right - femoral artery puncture. the largest fibroid in the anterior fundal wall measured 4.5 cm, and the largest fibroid in the posterior fundal wall measured 6 cm. the appearances after uae were satisfactory, and the procedure was apparently uneventful. no immediate complications were noted. the patient developed sudden - onset shortness of breath and went into cardiac arrest 19 h after the procedure. postmortem autopsy confirmed that the cause of a death was a pulmonary embolism. to our knowledge this is the first reported case in the united kingdom in which death occurred from a pulmonary embolus after uae. |
pulmonary hypertension (ph) can be described as a complication caused by progressive obstruction and obliteration of the pulmonary arteries, ultimately leading to a progressive rise in pulmonary vascular resistance (pvr) and right ventricular (rv) failure and death. ph may be classified into five categories : group 1 - pulmonary arterial hypertension (pah), which includes idiopathic, sporadic, familial, drug - induced, hiv infection ; group 2 - ph due to left heart disease ; group 3 - ph due to lung disease ; group 4 - chronic thromboembolic pulmonary hypertension (ctph) ; and group 5 - ph with multifactorial mechanisms. smooth muscle medial hypertrophy, intimal proliferation, in situ thrombosis and the development of plexiform lesions are some of the pathological changes observed during this condition. prostanoids, endothelin receptor antagonists and phosphodiesterase type v inhibitors are principally used in the drug therapy of pah. the use of epoprostenol is fraught with a myriad of drug delivery issues such as requirement of the patient to be familiar with the techniques of sterile drug preparation, operation of the pump and skill in using intravenous catheter that is surgically implanted, catheter - related infections and pump malfunction. beraprost, which is only approved in japan, has also been shown to lose its effectiveness over 1 year. the limitations with the current crop of molecules has spurred the quest for a better drug molecule for pah. riociguat is the most recent drug approved by the united states food and drug administration for the treatment of pah. this review highlights the key features of this novel first - in - class drug molecule. an electronic search was performed using databases such as pubmed, sciencedirect, cochrane library, google scholar and springer database. the search term used for the literature search was riociguat and pah and cteph. riociguat associated with animal studies, pediatric studies, diabetic, anemia, renal dysfunction, hypertension and obesity were excluded. in vitro studies, poster presentations, conference proceedings, abstracts and editorials flowchart depicting systematic review for riociguat riociguat is a first - in - class agent that belongs to the class of molecules termed as soluble guanylate cyclase stimulators. in ph, there is a breakdown in the signaling mechanisms of nitric oxide - soluble guanylate cyclase and cyclic guanosine monophosphate (cgmp) coupled with a reduction in the nitric oxide synthesis. by virtue of its ability to stimulate guanylate synthase independent of nitric oxide, riociguat is able to increase cgmp that causes vasodilation and a fall in the pulmonary arterial pressure. conducted a 12-week, prospective, open - label, dose - titration (according to systolic blood pressure) phase ii study. they included 42 patients with chronic thromboembolic ph and 33 patients with pah according to the world health organization (who) functional classes ii / iii. safety, tolerability and feasibility of individual titration of riociguat according to peripheral systolic blood pressure (sbp) were the primary end points of the study, combined with secondary end points like change from baseline (week 0) in exercise capacity (6-min walk distance [6mwd ], modified borg dyspnea score and who functional class [assessed after 12 weeks ]). a significant median improvement by 55 m (20.0107.0 ; p < 0.0001) was observed after 12 weeks of treatment in the total population, which was 359.0 m (300.0420.0) at baseline before treatment. 6mwd was 390.0 m (330.0441.0) at baseline in the cteph group, which improved by 55 m (17.0105.0) (p < 0.0001) following 12 weeks of riociguat treatment. 0.0001) was observed in the pah group, which was 337.0 m (215.0406.0) at baseline. the patent-1 and chest-1 studies provided clinching evidence to justify the approval of riociguat in pah therapy. stimulator trial 1 (patent-1) was a phase 3, double - blind study in which 443 patients with symptomatic pah were recruited and received placebo and riociguat in individually adjusted doses of upto 2.5 mg three times daily (2.5 mg - maximum group) or riociguat in individually adjusted doses 1.5 mg three times daily (1.5 mg - maximum group). the primary endpoint of this study was to observe the changes from baseline to the end of week 12 in the distance walked in 6 min. the change in pvr, n - terminal pro brain natriuretic peptide (nt - probnp) levels, who functional class, time to clinical worsening, score on the borg dyspnea scale, quality - of - life variables and safety were the secondary end points included in the study. the results of the study showed that riociguat had increased the 6mwd by week 12 to a mean of 30 m in the 2.5 mg maximum group and had decreased by a mean of 6 m in the placebo group (least - squares mean difference, 36 m ; 95% confidence interval, 2052 ; p < 0.001). it also showed significant improvement in secondary end points, such as pvr (p < 0.001), nt - probnp levels (p < 0.001), who functional class (p = 0.003), time to clinical worsening (p = 0.005) and borg dyspnea score (p = 0.002). the left ventricular systolic dysfunction associated with pulmonary hypertension riociguat trial (lepht) study group was a phase iib, double - blind, randomized, placebo - controlled, dose - ranging hemodynamic study that included 201 patients with heart failure resulting from ph caused by systolic left ventricular dysfunction. they were randomized to double - blind treatment with oral placebo or riociguat (0.5, 1 or 2 mg three times daily) for 16 weeks in four parallel arms. their primary outcome was the placebo - corrected change from baseline at week 16 in mean pulmonary artery pressure. however, the decrease in mean pulmonary artery pressure in the riociguat 2 mg group (-6.1 1.3 mmhg ; p < 0.0001 versus baseline) was not significantly different from placebo (p = 0.10), but the cardiac index (0.4 lminm ; 95% confidence interval, 0.20.5 ; p = 0.0001) and stroke volume index (5.2 ml / m ; 95% confidence interval, 2.08.4 ; p = 0.0018) were significantly increased without changes in heart rate or systemic blood pressure compared with placebo. it also reduced the minnesota living with heart failure score (p = 0.0002). riociguat was well tolerated in patients with ph caused by systolic left ventricular dysfunction and improved cardiac index and pulmonary and systemic vascular resistance, even if the primary end point was not achieved. stimulator trial -1) is a phase 3, multicenter, randomized, double - blind, placebo - controlled study. here, they randomly recruited 261 patients with inoperable chronic thromboembolic ph or persistent or recurrent ph after pulmonary endarterectomy to receive placebo or riociguat. the change from baseline to the end of week 16 in the distance walked in 6 min was their primary end point, and changes from baseline in pvr, nt - probnp level, who functional class, time to clinical worsening, borg dyspnea score, quality - of - life variables and safety were included as secondary endpoints. the 6-min walk by week 16 had increased by a mean of 39 m in the riociguat group as compared with a mean decrease of 6 m in the placebo group. riociguat showed significant improvements in the nt - probnp level (p < 0.001) and for the who functional class (p = 0.003). a study was conducted by grimminger. to evaluate the safety, tolerability and efficacy of riociguat in patients with moderate to severe pah. of the19 patients who were enrolled in the study, four patients were given an hourly incremental dose of riociguat, five patients underwent single dosing regimen of 1 mg and 10 patients were given a 2.5 mg single dose of riociguat. oral administration of riociguat was effective as there was a clinically significant reduction in mean pulmonary artery pressure (mpap), pulmonary vascular resistance (pvr), systolic blood pressure (sbp) and systemic vascular resistance (svr) from baseline triggered by both riociguat 1 mg and 2.5 mg doses. the cardiac index also increased significantly with both doses (p - value between 0.0151 and < 0.0001). the most common serious adverse event in the placebo group and the 2.5 mg maximum group was syncope (4% and 1%, respectively) in the patent study. in the chest-1 study, the observed serious adverse events were rv failure (in 3% of patients in each group) and syncope (in 2% of the riociguat group and in 3% of the placebo group). the most common adverse events in the riociguat 2 mg group were diarrhea (18% versus 7% with placebo), dizziness (16% versus 10% with placebo) and nausea (16% versus 7% with placebo) in the lepht study. majority of the episodes of hypotension occurred during the titration phase and were handled by down - titration of dose. treatment - emergent drug - related serious adverse effects like cardiac failure, ventricular tachycardia, syncope and hypotension were reported in four patients (6%) in the riociguat 2 mg group and ventricular tachycardia and lobar pneumonia, syncope and hypotension were seen in two patients (3%) in the placebo group. it is an orally administered, first - in - class drug for the treatment of pah. the drug reaches its maximal concentration after approximately 0.51.5 h. food does not interfere with the absorption of riociguat. riociguat follows three routes of elimination in humans ; 2771% of the dose gets eliminated by oxidative biotransformation, 13% (up to 44%) gets excreted as unchanged drug in feces and 6% (up to 19%) gets excreted as unchanged drug in urine via glomerular filtration. the drug has a mean terminal half - life of 6.8 h. in elderly healthy subjects, the mean half - lives are prolonged to 12 h. the united states food and drug administration and the health canada approved riociguat as the first direct soluble guanylate cyclase stimulator in october 2013 for using it on patients with cteph and pah. it was launched in the uk in march 2014. in the same month, it was approved in the eu for the treatment of cteph and pah. the drug is to be started at a dose of 1 mg thrice daily, and the dose is escalated every 2 weeks by 0.5 mg until a maximum dose of 2.5 mg thrice daily at 6 weeks. riociguat can not be used for treatment in females with pregnancy and it is also to be avoided in patients with renal failure. the drug should not be used concurrently with no donors such as nitroglycerine due to the increased proclivity to develop hypotension with syncope. hence, it may not be a viable option for pah patients with co - existing coronary artery disease. the drug has not yet been compared on a head - to - head basis with the currently approved drug molecules for pah. riociguat is a first - in - class agent that belongs to the class of molecules termed as soluble guanylate cyclase stimulators. in ph, there is a breakdown in the signaling mechanisms of nitric oxide - soluble guanylate cyclase and cyclic guanosine monophosphate (cgmp) coupled with a reduction in the nitric oxide synthesis. by virtue of its ability to stimulate guanylate synthase independent of nitric oxide, riociguat is able to increase cgmp that causes vasodilation and a fall in the pulmonary arterial pressure. gofhrani. conducted a 12-week, prospective, open - label, dose - titration (according to systolic blood pressure) phase ii study. they included 42 patients with chronic thromboembolic ph and 33 patients with pah according to the world health organization (who) functional classes ii / iii. safety, tolerability and feasibility of individual titration of riociguat according to peripheral systolic blood pressure (sbp) were the primary end points of the study, combined with secondary end points like change from baseline (week 0) in exercise capacity (6-min walk distance [6mwd ], modified borg dyspnea score and who functional class [assessed after 12 weeks ]). a significant median improvement by 55 m (20.0107.0 ; p < 0.0001) was observed after 12 weeks of treatment in the total population, which was 359.0 m (300.0420.0) at baseline before treatment. 6mwd was 390.0 m (330.0441.0) at baseline in the cteph group, which improved by 55 m (17.0105.0) (p < 0.0001) following 12 weeks of riociguat treatment. greater improvement by 57.0 m (25.0117.0) (p < 0.0001) was observed in the pah group, which was 337.0 m (215.0406.0) at baseline. the patent-1 and chest-1 studies provided clinching evidence to justify the approval of riociguat in pah therapy. stimulator trial 1 (patent-1) was a phase 3, double - blind study in which 443 patients with symptomatic pah were recruited and received placebo and riociguat in individually adjusted doses of upto 2.5 mg three times daily (2.5 mg - maximum group) or riociguat in individually adjusted doses 1.5 mg three times daily (1.5 mg - maximum group). the primary endpoint of this study was to observe the changes from baseline to the end of week 12 in the distance walked in 6 min. the change in pvr, n - terminal pro brain natriuretic peptide (nt - probnp) levels, who functional class, time to clinical worsening, score on the borg dyspnea scale, quality - of - life variables and safety were the secondary end points included in the study. the results of the study showed that riociguat had increased the 6mwd by week 12 to a mean of 30 m in the 2.5 mg maximum group and had decreased by a mean of 6 m in the placebo group (least - squares mean difference, 36 m ; 95% confidence interval, 2052 ; p < 0.001). it also showed significant improvement in secondary end points, such as pvr (p < 0.001), nt - probnp levels (p < 0.001), who functional class (p = 0.003), time to clinical worsening (p = 0.005) and borg dyspnea score (p = 0.002). the left ventricular systolic dysfunction associated with pulmonary hypertension riociguat trial (lepht) study group was a phase iib, double - blind, randomized, placebo - controlled, dose - ranging hemodynamic study that included 201 patients with heart failure resulting from ph caused by systolic left ventricular dysfunction. they were randomized to double - blind treatment with oral placebo or riociguat (0.5, 1 or 2 mg three times daily) for 16 weeks in four parallel arms. their primary outcome was the placebo - corrected change from baseline at week 16 in mean pulmonary artery pressure. however, the decrease in mean pulmonary artery pressure in the riociguat 2 mg group (-6.1 1.3 mmhg ; p < 0.0001 versus baseline) was not significantly different from placebo (p = 0.10), but the cardiac index (0.4 lminm ; 95% confidence interval, 0.20.5 ; p = 0.0001) and stroke volume index (5.2 ml / m ; 95% confidence interval, 2.08.4 ; p = 0.0018) were significantly increased without changes in heart rate or systemic blood pressure compared with placebo. it also reduced the minnesota living with heart failure score (p = 0.0002). riociguat was well tolerated in patients with ph caused by systolic left ventricular dysfunction and improved cardiac index and pulmonary and systemic vascular resistance, even if the primary end point was not achieved. the chest-1 (chronic thromboembolic pulmonary hypertension soluble guanylatecyclase stimulator trial -1) is a phase 3, multicenter, randomized, double - blind, placebo - controlled study. here, they randomly recruited 261 patients with inoperable chronic thromboembolic ph or persistent or recurrent ph after pulmonary endarterectomy to receive placebo or riociguat. the change from baseline to the end of week 16 in the distance walked in 6 min was their primary end point, and changes from baseline in pvr, nt - probnp level, who functional class, time to clinical worsening, borg dyspnea score, quality - of - life variables and safety were included as secondary endpoints. the 6-min walk by week 16 had increased by a mean of 39 m in the riociguat group as compared with a mean decrease of 6 m in the placebo group. riociguat showed significant improvements in the nt - probnp level (p < 0.001) and for the who functional class (p = 0.003). a study was conducted by grimminger. to evaluate the safety, tolerability and efficacy of riociguat in patients with moderate to severe pah. of the19 patients who were enrolled in the study, four patients were given an hourly incremental dose of riociguat, five patients underwent single dosing regimen of 1 mg and 10 patients were given a 2.5 mg single dose of riociguat. oral administration of riociguat was effective as there was a clinically significant reduction in mean pulmonary artery pressure (mpap), pulmonary vascular resistance (pvr), systolic blood pressure (sbp) and systemic vascular resistance (svr) from baseline triggered by both riociguat 1 mg and 2.5 mg doses. the cardiac index also increased significantly with both doses (p - value between 0.0151 and < 0.0001). administration of riociguat in study patients did show some adverse effects. the most common serious adverse event in the placebo group and the 2.5 mg maximum group was syncope (4% and 1%, respectively) in the patent study. in the chest-1 study, the observed serious adverse events were rv failure (in 3% of patients in each group) and syncope (in 2% of the riociguat group and in 3% of the placebo group). the most common adverse events in the riociguat 2 mg group were diarrhea (18% versus 7% with placebo), dizziness (16% versus 10% with placebo) and nausea (16% versus 7% with placebo) in the lepht study. majority of the episodes of hypotension occurred during the titration phase and were handled by down - titration of dose. treatment - emergent drug - related serious adverse effects like cardiac failure, ventricular tachycardia, syncope and hypotension were reported in four patients (6%) in the riociguat 2 mg group and ventricular tachycardia and lobar pneumonia, syncope and hypotension were seen in two patients (3%) in the placebo group. it is an orally administered, first - in - class drug for the treatment of pah. the drug reaches its maximal concentration after approximately 0.51.5 h. food does not interfere with the absorption of riociguat. riociguat follows three routes of elimination in humans ; 2771% of the dose gets eliminated by oxidative biotransformation, 13% (up to 44%) gets excreted as unchanged drug in feces and 6% (up to 19%) gets excreted as unchanged drug in urine via glomerular filtration. the drug has a mean terminal half - life of 6.8 h. in elderly healthy subjects, the mean half - lives are prolonged to 12 h. the united states food and drug administration and the health canada approved riociguat as the first direct soluble guanylate cyclase stimulator in october 2013 for using it on patients with cteph and pah. it was launched in the uk in march 2014. in the same month, it was approved in the eu for the treatment of cteph and pah. the drug is to be started at a dose of 1 mg thrice daily, and the dose is escalated every 2 weeks by 0.5 mg until a maximum dose of 2.5 mg thrice daily at 6 weeks. riociguat can not be used for treatment in females with pregnancy and it is also to be avoided in patients with renal failure. the drug should not be used concurrently with no donors such as nitroglycerine due to the increased proclivity to develop hypotension with syncope. hence, it may not be a viable option for pah patients with co - existing coronary artery disease. the drug has not yet been compared on a head - to - head basis with the currently approved drug molecules for pah. the current battery of drugs available in the market has not really made a significant impact in improving the long - term outcomes, besides tolerability issues. riociguat is a new drug that is approved for pah and cteph based on the evidence generated from two pivotal trials, chest-1 and patent-1. it is a direct sgc stimulator and has shown improvement in the primary end points as measured by 6mwd from short - term studies, besides other secondary end points. it is also the first non - surgical therapy that is approved for cteph and appears to offer some respite, especially to the one - third of candidates who are inoperable and do not have any other alternate modalities of treatment. although hypotension and bleeding require careful monitoring, the drug appears to have a reasonable safety profile. nevertheless, there is a definite need to continue monitoring the drug for its long - term outcomes and to compare it with the existing drug molecules before it becomes a front - line option in pah drug therapy. | pulmonary hypertension (ph) continues to be a disease that is associated with woeful outcomes. the search for an ideal drug molecule for ph led to the discovery of riociguat, which is a first - in - class drug molecule that activates soluble guanylate cyclase. we conducted a systematic literature search using databases such as pubmed, science direct, springer, cochrane reviews and google scholar to gather evidence generated from published clinical trials on the efficacy, safety, pharmacokinetics and regulatory status of riociguat. chest-1 and the patent-1 were phase-3 pivotal clinical trials that showed that riociguat was able to significantly improve the 6-min walk distance with 16 weeks of therapy as compared with the placebo arm. the drug also showed improvement in secondary outcome measures such as improvement in the pulmonary vascular resistance, n - terminal pro brain natriuretic peptide levels, world health organization functional class, time to clinical worsening and borg dyspnea score. the drug had a modest safety profile, with hypotension being the most bothersome adverse effect. these findings led to various regulatory agencies around the world granting approval for riociguat for the treatment of pulmonary arterial hypertension (pah) and inoperable chronic thromboembolic pulmonary hypertension (cteph). the entry of a new class of drug for pah and cteph therapy portends some hope for patients with a disease that is traditionally linked with a poor prognosis. |
we used statewide reported ntm isolate data from all laboratories in oregon collected during 20072012. from these data, we defined disseminated ntm as a reported ntm isolate from blood, cerebrospinal fluid, bone marrow, lymph node, or other sterile site in an oregon resident > 18 years of age. in a sensitivity analysis, we expanded this definition to include isolates from nonsterile sites, specifically skin and urine, that could still represent disseminated disease. to identify cases of hiv - associated disseminated ntm, we linked patients with ntm isolates to the statewide hiv surveillance registry by name, date of birth, and sex using registry plus link plus (10). we reviewed all possible matches manually. to calculate incidence, exposure time began with the date of hiv diagnosis. we censored cases at death, ntm diagnosis, or 1 year after the last reported cd4 or viral load result when the gap was > 2 years between laboratory tests. since 2006, oregon law has required that laboratories report all cd4 counts and viral loads to the oregon health authority. we calculated exposure time within cd4 ranges for each interval between reported cd4 counts until patients were censored. we calculated disseminated ntm incidence by cd4 count (closest to ntm diagnosis within preceding 3 months) and year with 95% cis under the poisson distribution in sas version 9.4 (11). we identified 37 disseminated ntm cases among a population of 7,349 hiv - infected patients with 33,072 person - years of exposure ; most were male (28, 75.7%), non - hispanic (29, 78.4%), and white (26, 70.3%), with a median age of 40.0 years (range 22.759.4 years) (table 1). median time from hiv diagnosis to disseminated ntm was 2.1 years (range 020.7 years). most cases were caused by mac (35, 94.6%) ; 19 patients (52.8%, 1 outcome missing) died, with median survival of 0.3 years (range 05.8 years) after ntm diagnosis. median cd4 count and viral load collected closest to ntm diagnosis were 10 cells / mm and 131,446 copies / ml, respectively. at the time of ntm isolation, 23 (74.2%) patients had cd4 counts 200 cells / mm. of the 2 patients with cd4 counts > 200 cells / mm, both had previous cd4 counts > 200 cells / mm ; 1 had an undetectable viral load, and the other had persistent viremia > 200,000 copies / ml. the patient with a cd4 count of 100199 cells / mm at the time of disseminated ntm diagnosis had a cd4 count of 32 cells / mm 9 months before diagnosis. cd4 testing frequency varied substantially in the 6,171 patients with reported cd4 counts during 20072012. median time between cd4 count tests for those with testing intervals 1 cd4 count 1 cd4 count 1 cd4 count 99 cells / mm (maximum 441 cells / mm) (4). our findings are consistent with this and suggest that disseminated ntm should be considered in this population. oregon is a state with a relatively low hiv prevalence (143.1 cases/100,000 persons during 20072012), with a range of 7179 hiv deaths annually and an average of 256 new cases yearly (13). our data might have limited generalizability beyond oregon, given that most patients living with hiv in oregon have access to care ; 87% of all patients in care have a suppressed viral load, and only 16% of aids drug assistance program clients lack reported recent cd4 or viral load test results (13). analysis of incidence by cd4 count was also limited by variability in frequency of laboratory testing, which was determined by the treating clinicians. six (16%) patients with disseminated ntm did not have cd4 counts taken 3 months before or 1 month after diagnosis. in addition, laboratory results could have been missing in oregon residents who receive hiv care outside the state. our clinical data were limited to laboratory results ; therefore, we were unable to analyze the impact of antiretroviral therapy, antimicrobial prophylaxis or treatment, and access to care. given the rarity of this infection in our cohort, we suspect that prophylaxis is routinely being used in those with cd4 count < 50 cells / mm ; however, mortality rates continue to be high in those in whom disseminated ntm infections develop. | we determined disseminated nontuberculous mycobacteria incidence in the hiv - infected population of oregon, usa, during 20072012 by using statewide laboratory surveillance. we identified 37 disseminated nontuberculous mycobacteria cases among 7,349 patients with median annual incidence of 110/100,000 hiv person - years and the highest incidence in those with cd4 counts < 50 cells / mm3 (5,300/100,000 person - years). |
a promising strategy for the treatment of neurodegenerative diseases involves pharmacologically induced activation of a coordinated antioxidant genetic program to shift the intracellular redox balance towards a homeostatic state by means of expression of detoxifying proteins and antioxidant enzymes. a key transcription factor orchestrating antioxidant defense is nuclear factor erythroid 2related factor 2 (nrf2), a member of the cap'n'collar family of basic leucine zipper transcription factors. in addition to its role in protection from oxidative stress, nrf2 triggers expression of genes responsible for drug detoxification, iron metabolism, excretion transporters, immunomodulation, calcium homeostasis, growth factors (such as brain derived neurotrophic factor and nerve growth factor-), intracellular signaling (including neuronal guanine nucleotide exchange factor), and neurotransmitter receptors (moi., 1994). in addition a recent report on identification and validation of 12 antioxidant response element (are)-sequences targeted by nrf2 in 9 autophagy genes (pajares., 2016) points to additional role of nrf2 in combating proteinopathies. the breadth of this endogenous response suggests that its activation might counterbalance many of the large number of etiological pathways implicated in the pathogenesis of majority if not all neurodegenerative diseases (crunkhorn, 2012 ; joshi and johnson, 2012 ; gan and johnson, 2014). numerous proof - of - principle studies involving gain and loss of function of nrf2 have suggested that its induction can ameliorate neurodegeneration, whereas its deficiency can exacerbate neurodegeneration (joshi and johnson, 2012 ; gan and johnson, 2014). despite the well - known fact of nrf2 activation at late stages of all neurodegenerative diseases, there is insufficient nuclear staining of nrf2 in the brains of alzheimer 's (ad) (ramsey., 2007), as well as in aging (senescent animals) (shenvi., 2012) and an increased nuclear staining of nrf2 in surviving neurons of postmortem parkinson 's disease (pd) patients (ramsey., 2007). pre - treatment of pharmacological activators of nrf2 has been shown to be protective in animal models of numerous neurological conditions such as huntington 's disease, amyotrophic lateral sclerosis, pd, ad, and cerebral ischemia (gan and johnson 2014 ; tu., 2015). post - treatment with nrf2 activators such as sulforaphane and tert - butylhydroquinone has been shown to be beneficial mainly for acute injury models such as traumatic brain injury and hemorrhagic stroke, with a very narrow therapeutic window of 30 minutes to 2 hours (saykally, 2009). we have shown that pre - treatment of nrf2 activators demonstrate therapeutic effects in animal models of pd. recently we demonstrated that l-3,4-dihydroxyphenylalanine (l - dopa) bearing a catechol motif as a weak nrf2 activator, and nordihydroguaiaretic acid, a potent natural di - catechol activator of nrf2, is neuroprotective against 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (mptp) mouse model of pd (smirnova., 2016). another recent work of ours that used the fda approved dimethylfumarate (dmf) and its bioactive metabolite monomethylfumarate (mmf) also showed neuroprotective effects against mptp - induced pd in mice (ahuja., 2016). the problem with pharmacologic activation of nrf2 for the treatment of chronic neurodegenerative disorders originates from the fact that most common nrf2-based pharmacophores activate nrf2 by increasing oxidative stress and are harmful chemicals (for e.g., sulforaphane, curcumin, fumarate, triterpenoids, etc. increasing oxidative load on already unhealthy cells may significantly counterbalance the benefits of activation of the antioxidant genetic program, making the unambiguous interpretation of the posttreatment results difficult. this is especially true for the mptp mouse model of pd, where only pre - treatment, but not post - treatment with nrf2 activators are protective. there is a desperate need in nrf2 activating chemical tools that are non - electrophilic, non - toxic, and sufficiently stable in the body to unequivocally demonstrate benefits of nrf2 activation for chronic neurodegenerative diseases. one of the alternative strategies to activate nrf2 pathway is to bypass the keap1-nrf2 interaction by inhibiting btb domain and cnc homolog 1 (bach1), which is an nrf2 inhibitor at the step of transcription complex formation (see figure 1). one may speculate that a combinatorial approach [a) to inhibit bach1, and b) disrupt keap1-nrf2 interaction ] is the best way to activate this neuroprotective pathway. the recent investigation on the cause of a significantly lower level of glutamate cysteine ligase (gclc) pointed to nrf2 binding from an active are to an alternative are element, which is not adequate to maintain basal expression of hepatic gclc in old rats, provides a potential mechanism for the age - related loss of glutathione synthetic and other phase ii enzymes. moreover, the activity at this are locus is diminished during aging because of the presence of bach1 and the absence of creb - binding protein (cbp), a transcriptional repressor and co - activator, respectively (shenvi., 2012). nuclear factor erythroid 2-related factor 2 (nrf2) is constitutively produced in the cell, however, in the absence of environmental stress, nrf2 is sequestered in the cytoplasm by binding to an inhibitory protein, kelch - like ech associated protein-1 (keap1), which promotes continuous ubiquitinylation. electrophilic stress leads to modification of reactive cysteines within keap1 that induces conformational changes resulting in nrf2 stabilization. there, it forms heterodimers with other transcription regulators, such as small maf proteins. this binding of the nrf2-maf complex to the (antioxidant response elements) antioxidant response elements (ares) of the are - containing genes occurs following the nuclear exit of the nrf2 repressor btb domain and cnc homolog 1 (bach1) to subsequently induce nrf2-dependent gene expressions. dgr : double glycine repeat ; gst : glutathione s - transferase ; ho-1 : heme oxygenase 1 ; nqo1 : nad(p)h : quinone oxidoreductase. there are many nrf2 activators known from herbal medicines that work via the alkylation / covalent modification mechanism, e.g., curcumin (turmeric), sulforaphane (broccoli), flavonoids (quercetin, fisetin), nordihydroguaiaretic acid (chapparal). there are multiple herbal supplements on the market based on curcumin (turmeric) in combination with other herbs such as protandim, nrf2 activator (xymogen), nrf2 optimizer (nuley), nrf2 antiox (progressive nutracare), and ultimate protector, however, there is only one fda - approved nrf2 activator tecfidera (dimethylfumarate) for the treatment of multiple sclerosis. all currently reported stabilizers of nrf2 protein work via covalent modification (alkylation) of keap1 active cysteines. for example, bardoxolone (oral formulation of a triterpenoid cddo - im) is the most potent nrf2 activator described to date, working in the nanomolar range, likely having a specific binding site in the keap1 intervening region (ivr) near cys-298 and cys-226, as we described (kaidery., 2013). however, it becomes highly toxic in the sub - micromolar range presumably due to covalent and indiscriminate alkylation of multiple proteins required for normal cellular homeostasis (figure 2). activation of neh2-luc reporter a perfect screening tool for nuclear factor erythroid 2-related factor 2 (nrf2) activators working via stabilization of nrf2 protein (smirnova., 2011) shows a very narrow safe window for bardoxolone at 3 hour incubation in contrast to a wide range of safe biologically active concentrations of dimethylfumarate (dmf). both bardoxolone and tecfidera (dimethylfumarate) are electrophiles and potent alkylating agents, meaning that they can non - specifically and covalently modify nucleophilic groups in proteins such as cysteine residues. dimethylfumarate is also an alkylating agent, similar to the classic nrf2 activator sulforaphane, and has been approved by the fda in 2013 for the treatment of multiple sclerosis (fox., 2012), despite its common side effect of a 30% decline in the lymphocyte count (sweetser. it has been recently repurposed as a therapeutic against a mouse model of -synuclein - induced pd (lastres - becker., 2016). our recent study demonstrates similar therapeutic benefits for dmf and its bioactive metabolite mmf in an in vivo rodent model of pd (ahuja., 2016). despite these similarities in in vivo efficacy, our in vitro studies revealed that mmf is a less potent nrf2 activator and has much lower toxicity due to the orders of magnitude lesser non - specific alkylating capacity than dmf itself. our discovery of therapeutic effects of mmf in an experimental pd model without inducing significant alkylating properties compared to dmf suggests that mmf could be a promising candidate for pd therapeutics. monoethylfumarate (mef) can also be considered as a therapeutic agent, since its alkylating capacity is very low and is similar to that of mmf. despite the fact that fumarates are also alkylating agents, their monosubstituted variants such as mmf and mef will be less toxic than the fda approved dmf, and may be ideal candidates for future clinical trials in pd. it is obvious that the magic bullet could be a non - alkylating nrf2 activator, but in the absence of one, mmf and mef could be the best candidates that can be used as therapeutic agents for pd. the recently developed bach1 inhibitor by vtv therapeutics (high point nc, usa) represents a novel class of hemeoxygenase 1-inducing compounds. these bach1 inhibitors are not reactive electrophiles, are not suppressed by n - acetyl cysteine, and do not perturb either ros or cellular glutathione and are activators of the antioxidant response through the modulation of bach1 binding to the are binding site of target genes our preliminary results validate bach1 inhibition as a very effective target against mptp - induced dopaminergic neurodegeneration by virtue of its ability to activate neuroprotective nrf2/are genetic program (ahuja., 2016). however, more mechanistic and preclinical validation studies in genetic models of pd are required to determine bach1 inhibition as a safe strategy to activate the nrf2 pathway. nrf2 activation without covalent modification of keap1 cysteines can be achieved via nrf2 protein displacement from its complex with keap1 either by a small molecule, or nrf2 peptide (steel., 2012). academic laboratories, small and big pharmaceutical companies are hunting for small molecule nrf2 activators working via this mechanism. five small molecules have been reported so far, but only two validated (figure 3). consistent with this mechanism, more recently a peptide activator of the nrf2 pathway that functions by disrupting nrf2-keap1 interaction was shown to exhibit robust therapeutic effects in a global cerebral ischemia model in rats when the peptide was administered systemically in a post - injury paradigm (tu., 2015). while these findings are highly significant in ameliorating disease pathology in an acute preclinical model, similar peptide - based approaches should be also utilized as a therapeutic strategy for chronic neurodegenerative diseases. displacement activators of nuclear factor erythroid 2-related factor 2 (nrf2). validated small molecules identified in fluorescence polarization assay based on labeled nrf2-peptide displacement from recombinant kelch domain of kelch - like ech associated protein-1 (keap1). 1 : crystal structure of nrf2 peptide in kelch domain of keap1 ; 2 : molecule discovered by lonquin hu 's group (compound 1) (hu., 2013) ; 3 : deposited crystal structure of compound 2 with keap1 side view (3a), top view (3b). compound 1 has been identified in the in vitro homogeneous assay, re - synthesized, 4 enantiomers separated from each other (compound 1 has 3 chiral centers), and only one enantiomer showed the biological activity : a binding constant of 1 m to recombinant keap1, and activation in the in vitro cellular assay only above 10 m (hu., 2013). compound 2 has been identified in a joint effort by biogen idec, merrimack pharmaceuticals, celgene corporation (usa), evotec ag (germany), and novalix (france) (marcotte., it binds keap1 in the in vitro assay in the low micromolar range, however, in the in vitro cellular assay it works only above 30 m. there is a shift in potency by at least one order of magnitude when one compares the in vitro binding constant to keap1 with the actual performance of the nrf2 activator in a cellular assay. this offset in potency when one switches from a test - tube to a cell line illustrates the fact that competing with a protein for binding another protein in the real life is far more challenging than competing with a peptide for a recombinant protein in the tube. on the top of their actual low potency, the molecules identified have little chance of crossing blood - brain barrier because of the complexity of the structure bearing multiple cycles and negatively charged groups, predicted easiness of oxidative decomposition in the liver to form active intermediates, and capable of inducing nrf2 by keap 1 covalent modification. one of the future developments could be a combination of nrf2 displacement activity with mild alkylation potency : in this way the concentration of an alkylating agent will be enriched around nrf2-keap1 complex to enhance the specificity of alkylation. the very recent discovery of nrf2 activators in the low micromolar range among nad - dependent deacetylase sirtuin-2 (sirt2) triazole inhibitors (quinti., 2016) may reflect their specific action on keap1, since in addition to a pro - alkylating motif, they have a stereostructure similar to compound 3 in figure 3. however, in the absence of a crystal structure, this is just a speculation. activation of the nrf2 signaling pathway is an established mechanism for reducing neurodegeneration due to oxidative stress, and represents a promising therapeutic approach for several neurodegenerative diseases. unfortunately there is indeed a desperate need of safe, potent, blood - brain barrier permeable displacement - type nrf2 activators as therapeutic agents for chronic neurodegenerative diseases. given the very low potency of existing displacement - type nrf2 activators and their complex chemical structures that are not ideal for them to cross the blood - brain barrier, it is going to be an arduous task to develop such compounds as therapeutic agents. at this point mmf, which upon hydrolysis gives a natural metabolite fumaric acid, has a low alkylating potency and thus, low toxicity, could be the best option to treat chronic neurodegenerative disease such as pd. more studies should be carried out to test the therapeutic effects of peptidebased inhibitors of nrf2-keap1 interaction as therapeutic agents in preclinical models of chronic neurodegenerative diseases. furthermore, efforts should also focus on validating bach1 inhibition as an alternate strategy for safe and efficient activation of the nrf2 pathway as a novel therapeutic target for pd and related neurodegenerative diseases. | this mini - review presents the authors ' vision on the current status and future trends in the development of neuroprotective agents working via activation of nuclear factor erythroid 2-related factor 2 (nrf2), and in particular, via disruption of nrf2-keap1 interaction. there are two opposite chemical mechanisms underlying such activation : the first one is a non - specific covalent modification of keap1 thiols, resulting in side effects of varied severity, and the second one is the shift of the nrf2-kelch - like ech associated protein-1 (keap1) binding equilibrium in the presence of a competitive and chemically benign displacement agent. at this point, no displacement activators exhibit sufficient biological activity in comparison with common nrf2 activators working via keap1 thiol modification. hence, the hope in therapeutics is now linked to the fda approved dimethylfumarate, whose derivative, monomethylfumarate, as we demonstrated recently, is much less toxic but equally biologically potent and an ideal candidate for clinical trials right now. a newly emerging player is a nuclear inhibitor of nrf2, btb domain and cnc homolog 1 (bach1). the commercially developed bach1 inhibitors are currently under investigation in our laboratory showing promising results. in our viewpoint, the perfect future drug will present the combination of a displacement activator and bach1 inhibitor to insure safety and efficiency of nrf2 activation. |
search cvd is an ancillary study to the search for diabetes in youth study, conducted in colorado and ohio. search is a multicenter study that conducts population - based ascertainment of nongestational cases of physician - diagnosed diabetes in youth age < 20 years at diagnosis (15). a total of 402 search participants with type 1 diabetes, residents of colorado and ohio, who had a duration of diabetes of at least 5 years, were enrolled in the search cvd study between 2009 and 2011. during the same time period, a total of 204 frequency - matched (by age, sex, and race / ethnicity) youth without type 1 diabetes (control subjects) were also recruited in the study. control participants were enrolled from the primary - care offices in the same geographical areas from which the patients with diabetes were referred and were confirmed free of diabetes by fasting glucose levels < 126 mg / dl (16). the study was reviewed and approved by the local institutional review boards that had jurisdiction over the local study population, and all participants provided signed informed consent or assent. participants were invited for an outpatient research visit after an 8-h overnight fast, and medications, including short - acting insulin, were withheld the morning of the visit until after the blood draw was complete. all participants were asked to refrain from any strenuous exercise, smoking, or consumption of any caffeinated drinks 12 h prior to the visit. race / ethnicity was self - reported, and the participants were categorized into non - hispanic white (nhw) and other racial / ethnic group (including hispanic, african american, and asian / pacific islander racial / ethnic groups). participants completed standardized questionnaires including medical history, medication inventory, smoking status, physical activity, daily insulin dose, and family history of diabetes and cvd. current cigarette smoking was defined as having smoked cigarettes on one or more of the 30 days preceding the survey. individuals who had tried smoking or smoked regularly (at least one cigarette every day for 30 days) but were not current smokers were considered past smokers. participants were asked the average number of days in a typical week that they participated in physical activity for at least 20 min that made them sweat or breathe hard and were then categorized as physically inactive (02 days / week) or physically active (37 days / week) (17). height was measured in centimeters using a stadiometer and weight in kilograms using a standardized scale. bmi was calculated as weight in kilograms divided by the square of height in meters, and age- and sex - specific bmi z - scores were derived based on the centers for disease control and prevention national standards (18). waist circumference was measured to the nearest 0.1 cm with the national health and nutrition examination survey protocol (19). resting systolic blood pressure (sbp) and diastolic blood pressure (dbp) were measured three times, using an aneroid sphygmomanometer, while the subjects were seated for at least 5 min and the average of the three measurements was taken. laboratory samples were obtained under conditions of metabolic stability, defined, for case subjects, as no episode of diabetic ketoacidosis during the previous month. a fasting blood draw was conducted for the assessment of the metabolic parameters (hba1c, ldl cholesterol [ldl - c ], hdl cholesterol [hdl - c ], and triglyceride [tg ] levels). urinary albumin was measured from overnight timed urine samples by radioimmunoassay and expressed as albumin excretion rate (aer). aer levels between 20 and 199 g / min were defined as microalbuminuria (20). measurements of tg and hdl - c were performed enzymatically on a hitachi 917 autoanalyzer (roche molecular biochemicals diagnostics, indianapolis, in). ldl - c was calculated by the friedewald equation for individuals with tg concentration < 400 mg / dl and the beta quantification procedure for those with tg concentration 400 mg / dl. hrv was measured in the morning between 7:00 and 11:00 a.m. in a room with a stable room temperature, with the participant lying in the resting supine position for 10 min, using the sphygmocor device (atcor medical, sydney, australia). the device takes into account the normal heart beats, ignoring ectopic beats, to derive the statistical parameters of the normal r - r intervals (n - n intervals) of the electrocardiogram and estimates several time- and frequency - domain hrv indices (21). the time - domain indices of hrv used in the present analysis were sd of the r - r intervals (sdnn) and root mean square difference of successive normal r - r interval (rmssd). sdnn is a measure of overall hrv, so lower sdnn levels indicate reduced overall hrv. rmssd is a measure of parasympathetic autonomic function, and reduced rmssd is a marker of parasympathetic loss. brachial distensibility (brachd) was measured using a dynapulse pathway instrument (pulse metric, san diego, ca), as previously described (22). this device derives brachial artery pressure curves using pulse dynamic analysis of arterial pressure signals obtained from a standard cuff sphygmomanometer to assess distensibility (% /mmhg). brachd was calculated using an empirical model to estimate baseline brachial artery diameter from sex, height, weight, and mean arterial pressure (22). pulse wave velocity (pwv) in the carotid to femoral segment (pwv - trunk) was measured with the sphygmocor device (atcor medical). pwv calculates the speed for the pressure wave generated by cardiac ejection to reach the periphery (m / s) (23). three electrocardiogram leads were applied to the torso, and the average of three distances from the lowest portion of the sternal notch to the carotid and femoral artery sites was obtained. a pressure waveform was obtained for the proximal site (carotid), and a second was recorded from the femoral artery using an applanation tonometer. pwv - trunk is the difference in the carotid - to - femoral path length divided by the difference in r wave - to - waveform foot times, using an average of at least 10 beats to cover a complete respiratory cycle (23). augmentation index (aix) provides information concerning both wave reflections and as (24). the applanation tonometer was placed over the right radial artery, and three radial pulse waves were obtained, as described previously (5). the pressure waves were calibrated using mean arterial pressure and dbp obtained in the same arm. the device then analyzed the pulse wave using a generalized transfer function (24). wave forms collected over a 10-s period were averaged to produce peripheral and corresponding central (ascending aortic) pressure waveforms. ascending aortic the aix was calculated as the difference between the main outgoing wave and the reflected wave of the central arterial waveform, expressed as a percentage of the central pulse pressure. because aix is affected by heart rate, values were adjusted to a standard heart rate of 75 bpm (aix75) (25). all cardiac autonomic and vascular function tests were conducted fasting to prevent the possible influence of a surge in acute ambient glucose levels after a meal (26). statistical analyses were performed using sas for windows (version 9.2 ; sas institute, cary, nc). sdnn, tg, and aer were log - transformed to better meet model assumptions (e.g., homogeneity of variance). comparisons of demographic and clinical characteristics between youth with and without type 1 diabetes were examined using tests for categorical variables and t tests for normally distributed continuous variables. the associations between sdnn (main predictor variable) and as outcomes were initially explored in a combined model, including both youth with and without type 1 diabetes, to test for effect modification by presence of type 1 diabetes by including an interaction term between sdnn and diabetes status. since there was a suggestion of effect modification by presence of type 1 diabetes, subsequent analyses were stratified according to diabetes status. multiple linear regression models were built separately for youth with and without type 1 diabetes to assess the relationships between sdnn (independent variable) and each of the three as measures (dependent variables) : peripheral (brachd), central (pwv - trunk), and aix75. separate models for each as outcome were constructed. a base model (model 1) examined the relationship between sdnn and each as measure after adjustment for demographic factors age, sex, and race / ethnicity and was the model used for our primary test of association between sdnn and each of the as measures. then, sequentially adjusted models explored the effect of adjustment for traditional cvd risk factors : dbp (model 2), lipid (ldl - c, hdl - c, tg : model 3), bmi (model 4), microalbuminuria (model 5), smoking status (model 6), the combined model with all cvd risk factors (model 7), and a final model with all covariates and hba1c (model 8). finally, model 9 explored potential mediation of the association between hrv and as by heart rate. similar analyses were conducted to assess the associations between rmssd and each measure of as. search cvd is an ancillary study to the search for diabetes in youth study, conducted in colorado and ohio. search is a multicenter study that conducts population - based ascertainment of nongestational cases of physician - diagnosed diabetes in youth age < 20 years at diagnosis (15). a total of 402 search participants with type 1 diabetes, residents of colorado and ohio, who had a duration of diabetes of at least 5 years, were enrolled in the search cvd study between 2009 and 2011. during the same time period, a total of 204 frequency - matched (by age, sex, and race / ethnicity) youth without type 1 diabetes (control subjects) were also recruited in the study. control participants were enrolled from the primary - care offices in the same geographical areas from which the patients with diabetes were referred and were confirmed free of diabetes by fasting glucose levels < 126 mg / dl (16). the study was reviewed and approved by the local institutional review boards that had jurisdiction over the local study population, and all participants provided signed informed consent or assent. participants were invited for an outpatient research visit after an 8-h overnight fast, and medications, including short - acting insulin, were withheld the morning of the visit until after the blood draw was complete. all participants were asked to refrain from any strenuous exercise, smoking, or consumption of any caffeinated drinks 12 h prior to the visit. race / ethnicity was self - reported, and the participants were categorized into non - hispanic white (nhw) and other racial / ethnic group (including hispanic, african american, and asian / pacific islander racial / ethnic groups). participants completed standardized questionnaires including medical history, medication inventory, smoking status, physical activity, daily insulin dose, and family history of diabetes and cvd. current cigarette smoking was defined as having smoked cigarettes on one or more of the 30 days preceding the survey. individuals who had tried smoking or smoked regularly (at least one cigarette every day for 30 days) but were not current smokers were considered past smokers. participants were asked the average number of days in a typical week that they participated in physical activity for at least 20 min that made them sweat or breathe hard and were then categorized as physically inactive (02 days / week) or physically active (37 days / week) (17). height was measured in centimeters using a stadiometer and weight in kilograms using a standardized scale. bmi was calculated as weight in kilograms divided by the square of height in meters, and age- and sex - specific bmi z - scores were derived based on the centers for disease control and prevention national standards (18). waist circumference was measured to the nearest 0.1 cm with the national health and nutrition examination survey protocol (19). resting systolic blood pressure (sbp) and diastolic blood pressure (dbp) were measured three times, using an aneroid sphygmomanometer, while the subjects were seated for at least 5 min and the average of the three measurements was taken. laboratory samples were obtained under conditions of metabolic stability, defined, for case subjects, as no episode of diabetic ketoacidosis during the previous month. a fasting blood draw was conducted for the assessment of the metabolic parameters (hba1c, ldl cholesterol [ldl - c ], hdl cholesterol [hdl - c ], and triglyceride [tg ] levels). urinary albumin was measured from overnight timed urine samples by radioimmunoassay and expressed as albumin excretion rate (aer). aer levels between 20 and 199 g / min were defined as microalbuminuria (20). measurements of tg and hdl - c were performed enzymatically on a hitachi 917 autoanalyzer (roche molecular biochemicals diagnostics, indianapolis, in). ldl - c was calculated by the friedewald equation for individuals with tg concentration < 400 mg / dl and the beta quantification procedure for those with tg concentration 400 mg / dl. hrv was measured in the morning between 7:00 and 11:00 a.m. in a room with a stable room temperature, with the participant lying in the resting supine position for 10 min, using the sphygmocor device (atcor medical, sydney, australia). the device takes into account the normal heart beats, ignoring ectopic beats, to derive the statistical parameters of the normal r - r intervals (n - n intervals) of the electrocardiogram and estimates several time- and frequency - domain hrv indices (21). the time - domain indices of hrv used in the present analysis were sd of the r - r intervals (sdnn) and root mean square difference of successive normal r - r interval (rmssd). sdnn is a measure of overall hrv, so lower sdnn levels indicate reduced overall hrv. rmssd is a measure of parasympathetic autonomic function, and reduced rmssd is a marker of parasympathetic loss. brachial distensibility (brachd) was measured using a dynapulse pathway instrument (pulse metric, san diego, ca), as previously described (22). this device derives brachial artery pressure curves using pulse dynamic analysis of arterial pressure signals obtained from a standard cuff sphygmomanometer to assess distensibility (% /mmhg). brachd was calculated using an empirical model to estimate baseline brachial artery diameter from sex, height, weight, and mean arterial pressure (22). pulse wave velocity (pwv) in the carotid to femoral segment (pwv - trunk) was measured with the sphygmocor device (atcor medical). pwv calculates the speed for the pressure wave generated by cardiac ejection to reach the periphery (m / s) (23). three electrocardiogram leads were applied to the torso, and the average of three distances from the lowest portion of the sternal notch to the carotid and femoral artery sites was obtained. a pressure waveform was obtained for the proximal site (carotid), and a second was recorded from the femoral artery using an applanation tonometer. pwv - trunk is the difference in the carotid - to - femoral path length divided by the difference in r wave - to - waveform foot times, using an average of at least 10 beats to cover a complete respiratory cycle (23). augmentation index (aix) provides information concerning both wave reflections and as (24). the applanation tonometer was placed over the right radial artery, and three radial pulse waves were obtained, as described previously (5). the pressure waves were calibrated using mean arterial pressure and dbp obtained in the same arm. the device then analyzed the pulse wave using a generalized transfer function (24). wave forms collected over a 10-s period were averaged to produce peripheral and corresponding central (ascending aortic) pressure waveforms. ascending aortic the aix was calculated as the difference between the main outgoing wave and the reflected wave of the central arterial waveform, expressed as a percentage of the central pulse pressure. because aix is affected by heart rate, values were adjusted to a standard heart rate of 75 bpm (aix75) (25). all cardiac autonomic and vascular function tests were conducted fasting to prevent the possible influence of a surge in acute ambient glucose levels after a meal (26). statistical analyses were performed using sas for windows (version 9.2 ; sas institute, cary, nc). sdnn, tg, and aer were log - transformed to better meet model assumptions (e.g., homogeneity of variance). comparisons of demographic and clinical characteristics between youth with and without type 1 diabetes were examined using tests for categorical variables and t tests for normally distributed continuous variables. the associations between sdnn (main predictor variable) and as outcomes were initially explored in a combined model, including both youth with and without type 1 diabetes, to test for effect modification by presence of type 1 diabetes by including an interaction term between sdnn and diabetes status. since there was a suggestion of effect modification by presence of type 1 diabetes, subsequent analyses were stratified according to diabetes status. multiple linear regression models were built separately for youth with and without type 1 diabetes to assess the relationships between sdnn (independent variable) and each of the three as measures (dependent variables) : peripheral (brachd), central (pwv - trunk), and aix75. separate models for each as outcome were constructed. a base model (model 1) examined the relationship between sdnn and each as measure after adjustment for demographic factors age, sex, and race / ethnicity and was the model used for our primary test of association between sdnn and each of the as measures. then, sequentially adjusted models explored the effect of adjustment for traditional cvd risk factors : dbp (model 2), lipid (ldl - c, hdl - c, tg : model 3), bmi (model 4), microalbuminuria (model 5), smoking status (model 6), the combined model with all cvd risk factors (model 7), and a final model with all covariates and hba1c (model 8). finally, model 9 explored potential mediation of the association between hrv and as by heart rate. similar analyses were conducted to assess the associations between rmssd and each measure of as. a total of 344 youth with type 1 diabetes and 171 healthy control subjects with complete measures of hrv and as were included in these analyses. youth with and without type 1 diabetes had a similar age and sex distribution, though youth with diabetes were more likely to be nhw than control subjects (87 vs. 77% ; p = 0.004). bmi, bmi z - score, and bp were similar among youth with and without type 1 diabetes. however, youth with type 1 diabetes had a worse metabolic profile with higher hba1c (p < 0.0001) and ldl - c (p = 0.01) levels and a higher prevalence of microalbuminuria (10 vs. 2% ; p = 0.007) as compared with healthy control subjects. the heart rate was significantly higher among youth with type 1 diabetes as compared with their healthy counterparts (p < 0.0001). finally, sdnn and rmssd were significantly lower among youth with type 1 diabetes (69.7 vs. 79.4 ms, p = 0.002 ; and 63.7 vs. 79.7 ms, p = 0.0003, respectively) as compared with their healthy counterparts. characteristics of youth with and without type 1 diabetes figure 1 displays graphically the association between sdnn and each of the vascular stiffness measures, brachd (fig. 1c), in youth with and without type 1 diabetes. among youth with type 1 diabetes, reduced hrv (marked by lower sdnn) was significantly associated with all vascular stiffness outcomes : increased peripheral stiffness (lower brachd, p = 0.01 ; fig. in contrast, among control youth, the only significant association was between reduced hrv and peripheral stiffness (brachd, p = 0.004 ; fig. 1a). a formal test for effect modification by diabetes status of the association between sdnn and as measures was marginally significant for central as (pwv - trunk, p = 0.06 ; fig. 1b). the associations between lower hrv and as measures (panel a : brachd ; panel b : pwv - trunk ; panel c : aix75). the p value for interaction is in the combined sample including case and control subjects. the coefficients and p values are from the linear regression models shown separately for case and control subjects adjusted for age, sex, and race / ethnicity. p value for interaction is derived from the combined model including case and control subjects. (a high - quality color representation of this figure is available in the online issue.) table 2 shows results of multiple linear regression analyses exploring the association between sdnn and the three as outcomes, stratified by diabetes status, in sequentially adjusted models. associations between sdnn and measures of as (brachd, pwv - trunk, and aix75) in sequentially adjusted linear regression models among youth with type 1 diabetes, lower sdnn was significantly associated with lower brachd (p = 0.01), higher pwv - trunk (p < 0.0001), and higher aix75 (p = 0.007) independent of demographic variables (model 1). these associations were unchanged on additional adjustment for dbp (model 2), lipid levels (model 3), obesity - related parameter (bmi, model 4), microalbuminuria (aer, model 5), and smoking (model 6). in the fully adjusted model (model 7), with all the covariates included, the relationships between sdnn and pwv - trunk / brachd among youth with type 1 diabetes were virtually unchanged, but the association with aix75 was reduced (p = 0.1). above and beyond the variability included in the base model, blood pressure and obesity - related variables explained most of the variability in brachd (change in adjusted r of 13 and 11%, respectively, from base model) and pwv (change in adjusted r of 7 and 4%, respectively, from base model). addition of hba1c (model 8) resulted in minimal improvement from the model with all cvd risk factors. finally, on additional adjustment for resting heart rate in model 9, the associations between sdnn and markers of as became nonsignificant, with resting heart rate remaining significantly associated with as in all models (data not shown). among healthy control subjects, lower sdnn was significantly associated with brachd (p = 0.004) and remained unchanged and statistically significant in the sequentially adjusted and final models (p = 0.01). obesity - related variables explained most of the variability in brachd in youth without diabetes, with an increase of 26% in adjusted r from the base model. supplementary table 1 shows results of multiple linear regression analyses exploring the association between rmssd and the three as outcomes, stratified by diabetes status, in sequentially adjusted models. among youth with type 1 diabetes, a significant inverse association was found between rmssd and all measures of as (pwv - trunk, brachd, and aix75). we found that cardiac autonomic dysfunction, as measured by lower hrv, is associated with increased vascular stiffness in both central and peripheral vascular beds, among youth with type 1 diabetes. these associations are independent of traditional cvd risk factors, including blood pressure, lipid levels, obesity - related parameters, microalbuminuria, and smoking. no associations between hrv and measures of as were found in the nondiabetic control group, except for an association between sdnn (though not rmssd) and peripheral stiffness (as measured by brachd). our data extend the findings from previous studies that have demonstrated an association between cardiac autonomic function and various measures of as in adults with type 1 diabetes (1214). ahlgren. (12) found that heart rate variation during deep breathing, the expiration / inspiration ratio, correlated with increased aortic stiffness in 40 women (r = 0.49 ; p = 0.002) but not in 38 men (r = 0.14 ; p = 0.4) with type 1 diabetes, independent of duration of diabetes. the stockholm diabetes intervention study found, in a group of 59 adults with type 1 diabetes, that hrv correlated with arterial wall stiffness of the right common carotid artery (13). of note, all these studies were cross - sectional and did not examine the relationship independent of the traditional cvd risk factors. however, in the pittsburgh edc study, lower baseline expiration / inspiration ratio correlated strongly with both greater as (measured by both aix and augmentation pressure) and with reduced estimated myocardial perfusion (measured by subendocardial viability ratio) in 144 adults with type 1 diabetes some 18 years later (11). moreover, although edc did not measure aix and augmentation pressure at baseline, the authors suggested, based on their findings, that cardiovascular autonomic neuropathy may play an important pathophysiological role in the development of arterial stiffening in adults with type 1 diabetes. similarly, an association between lower hrv and progression of coronary artery calcification in both adults with type 1 diabetes and nondiabetic control subjects was recently reported by the coronary artery calcification in type 1 diabetes study (27). our finding of a strong correlation between reduced hrv and increased central as in youth with type 1 diabetes, but not among healthy control subjects, provides indirect support to the hypothesis of a pathophysiological role for can in the development of as. however, given the cross - sectional design of our study, we can not directly test this hypothesis. data from a limited number of animal (28) and human studies (29,30) suggests that the amplified sympathetic tone present in the early stage of can, also identified previously in our youth with type 1 diabetes (9), could potentially increase the vascular tone and thus contribute to increased vascular stiffness, thus providing biologic plausibility for the above hypothesis. indeed, on additional adjustment for resting heart rate (elevated in youth with type 1 diabetes versus control subjects), the associations between sdnn and markers of as became nonsignificant, with resting heart rate remaining significantly associated with as in all models). this suggests that increased resting heart rate may be on the causal pathway linking the reduced hrv with altered sympathovagal balance (parasympathetic loss with sympathetic override) in youth with type 1 diabetes to increased as. we found an association between lower hrv and increased central stiffness in youth with type 1 diabetes but not in control subjects, and this association was independent of traditional cvd risk factors (lipids, blood pressure, microalbuminuria, obesity, and smoking).these results may indicate, rather than a causal relationship, a common pathway, possibly hyperglycemia, leading in parallel to both cardiac autonomic dysfunction and increased as in individuals with type 1 diabetes. there is ample biologic plausibility for the role of hyperglycemia as a common mediator of both abnormalities (31,32). hyperglycemia has been shown to promote accumulation of advanced glycation end products, causing cross - linking and polymerization of collagen molecules within the vessel wall (33), thus resulting in loss of elasticity with subsequent reduction in arterial and myocardial compliance. moreover, hyperglycemia was also shown to induce abnormal signaling of the autonomic neurons via accumulation of advanced glycation end products and microangiopathy, causing ischemic atrophy of the autonomic nerve fibers innervating cardiac and vascular tissue (34). other mechanisms, in addition to hyperglycemia, are likely to be involved. similar to edc, we also found an association between lower hrv and increased aix75. however, in our study, the association was attenuated on adjustment for traditional cvd risk factors. this is not unexpected since, although cardiac autonomic dysfunction and arterial stiffening are both accelerated in the hyperglycemic environment, they likely share additional cvd risk factors. for example, elevated blood pressure levels and smoking were shown to be associated with both as and cardiac autonomic dysfunction in subjects with type 1 diabetes (11,3537). finally, we found a significant association between hrv and peripheral as, independent of demographic and cvd risk factors, in both youth with and without type 1 diabetes. (38) among 382 young healthy japanese men, with a significant negative association between brachial - ankle pwv and hrv parameters for parasympathetic nervous activity. first, the cross - sectional nature of the study limits our ability to evaluate causality and order of events. we therefore intend to prospectively follow this cohort to better understand the progression of cardiac autonomic dysfunction and vascular stiffening over time. second, our sample of healthy control subjects was approximately half of that of youth with type 1 diabetes. however, the nonsignificant associations between hrv and as measures (pwv - trunk and aix75) were not equivocal among our control sample and likely not the result of a type ii error (lack of power). finally, the hrv measure used in our study was derived from a 10-min recording of the baseline electrocardiogram. while this is a relatively short length of recording, it is considered standard practice for clinical and research purposes, and it is advocated by the task force of the european society of cardiology and the north american society of pacing and electrophysiology (21), as opposed to the hrv measures derived from the 24-h holter recordings. our study also has several unique strengths : the setting of this study in a young adult contemporary population, the large and diverse sample of patients with type 1 diabetes, inclusion of a healthy control sample, and the simple noninvasive, bedside assessment of multiple measures of as, including both central and peripheral arteries. in summary, we found a strong association between cardiac autonomic dysfunction and both central and peripheral as in youth with type 1 diabetes, independent of traditional cvd risk factors. while lower hrv was also associated with increased peripheral stiffness in nondiabetic control youth, the association with central stiffness may be unique to individuals with type 1 diabetes. regardless of the mechanisms responsible for this association, which need to be further explored in longitudinal studies, this association may contribute to the increased and premature cardiovascular disease burden in people with type 1 diabetes. | objectivereduced heart rate variability (hrv) and increased arterial stiffness (as) are both present in youth with type 1 diabetes. however, it is unclear whether they are associated and whether their association is independent of cardiovascular disease (cvd) risk factors.research design and methodsthe search cardiovascular disease (search cvd) study explored the cross - sectional relationships between hrv and several measures of as in youth with (n = 344) and without (n = 171) type 1 diabetes. the sphygmocor device (atcor medical, sydney, australia) was used to measure hrv using sd of normal r - r interval (sdnn), as well as as, using pulse wave velocity in the carotid to femoral segment (pwv - trunk) and augmentation index adjusted to a heart rate of 75 bpm (aix75). brachial distensibility (brachd), another index of as, was measured with a dynapulse instrument (pulse metric, san diego, ca). multiple linear regression analyses explored the associations between hrv and each of the three as measures, after adjusting for demographic characteristics and traditional cvd risk factors (blood pressure, lipids, obesity, microalbuminuria, and smoking) separately, for youth with and without type 1 diabetes.resultsamong youth with type 1 diabetes, lower sdnn was associated with peripheral as (lower brachd, p = 0.01 ; r2 = 0.30) and central as (higher pvw - trunk, p < 0.0001 ; r2 = 0.37 ; and higher aix75, p = 0.007 ; r2 = 0.08). these associations were attenuated with adjustment for cvd risk factors, but remained statistically significant for brachd and pwv - trunk. while a similar association between hrv and brachd was present in control youth, lower hrv was not associated with increased central as or with aix75.conclusionslongitudinal studies are needed to understand the pathways responsible for these associations. |
the authors retrospectively reviewed the medical records of 75 eyes from 75 consecutive patients with exudative amd who were treated only with intravitreal injections of 2.5 mg of bevacizumab between 1 january, 2006, and 31 june, 2008, at the vitreoretinal clinic of the inha university hospital, incheon, korea. the study was performed in accordance with the ethical standards of the declaration of helsinki, and data were gathered after obtaining written informed consent. this includes consent for the off - label use of bevacizumab as treatment for exudative amd. approval for this treatment was also obtained from the national ministry of health in south korea. all patients received follow - up for six months or more, and 54 patients received follow - up for more than 12 months. the potential risks and benefits were discussed with all patients before they received injections, and all patients read and signed informed consent forms. inclusion criteria were as follows : 1) patients with exudative amd, defined as the presence of active fluorescein leakage from the lesion as seen on fluorescein angiography, who received anti - vegf treatment in at least three initial injections every four weeks ; and 2) patients who were followed up for a minimum of six months. the exclusion criteria included : 1) patients diagnosed with polypoidal choroidal vasculopathy (pcv) by indocyanine green angiography and treated primarily with pdt ; 2) prior macular photocoagulation ; 3) a history of subtenon injection of triamcinolone acetonide, or pdt, or anti - vegf within six months before the intravitreal bevacizumab injection ; 4) other intraocular surgery or management during follow - up ; 5) the presence of coexisting ocular disease causing macular edema (i.e., diabetic macular edema, retinal vein occlusion, pseudophakic cystoid macular edema, or uveitis) ; and 6) the presence of comorbid ocular conditions that might affect visual acuity. thirty - nine patients who underwent pdt more than six months before injection were included in the study. treatment response was evaluated by comparing the visual acuity (va) and central macular thickness (cmt) measured by optical coherence tomography (oct) at baseline with those same variables in the three follow - up periods : immediately after treatment, six months after treatment, and 12 months after treatment. the study measured change in va, change in cmt measured by oct, and the number of additional intravitreal bevacizumab injections. va change was evaluated with consistent methods using the snellen eye examination chart and then converted into a logarithm of the minimal angle of resolution (logmar) value. amd characteristics were evaluated in all patients by clinical examination including indirect dilated fundus examination, color fundus photography, oct, fluorescein angiography, and indocyanine green test, if needed. greatest linear dimension through fluorescein angiography was calculated by two retinal specialists masked to each genotype. in previous studies the authors collected peripheral venous blood from all patients for extraction of genomic dna and sequencing of single nucleotide polymorphisms. genotyping of the snps in the cfh y402h (rs1061170), loc387715 (rs10490924) and htra1 (rs11200638) genes was carried out using big dye terminator cycle sequencing (applied biosystems inc., foster city, ca, usa) on an automated sequencer (model 3730, applied biosystems inc.). intravitreal bevacizumab (avastin ; genentech, south san francisco, ca, usa) injections of 2.5 mg/0.1 ml were performed after topical anesthesia with 0.5% proparacaine drops (alcaine ; alcon laboratories, fort worth, tx, usa) under sterile conditions. all patients received three initial injections every four weeks and were then treated " as needed " based on if there was sign of recurrence. in this study, the sign of recurrence was a significant increase (more than 20%) of central retinal thickness at foveola due to new or residual subretinal fluid in oct or dye leaks found in fluorescein angiography. treatment response was evaluated by comparing va and cmt at baseline and after three initial injections during the three follow - up periods (immediate, six months, and 12 months after treatment). baseline demographic and clinical parameters were compared using the student 's t - test and anova test for continuous variables and chi - square tests for categorical variables. va improvement and cmt change between baseline and follow - up were evaluated among the different genotypes for each gene at each follow - up period by adjusting for the variables (age, hypertension and prior pdt) and using repeated measurement analysis of variance. the study also used paired t - tests and repeated measurement analysis to evaluate whether undergoing pdt more than six months before the start of study affected va and cmt values at baseline and in each follow - up period. chicago, il, usa). the level of statistical significance was set at p < 0.05. the authors retrospectively reviewed the medical records of 75 eyes from 75 consecutive patients with exudative amd who were treated only with intravitreal injections of 2.5 mg of bevacizumab between 1 january, 2006, and 31 june, 2008, at the vitreoretinal clinic of the inha university hospital, incheon, korea. the study was performed in accordance with the ethical standards of the declaration of helsinki, and data were gathered after obtaining written informed consent. this includes consent for the off - label use of bevacizumab as treatment for exudative amd. approval for this treatment was also obtained from the national ministry of health in south korea. all patients received follow - up for six months or more, and 54 patients received follow - up for more than 12 months. the potential risks and benefits were discussed with all patients before they received injections, and all patients read and signed informed consent forms. inclusion criteria were as follows : 1) patients with exudative amd, defined as the presence of active fluorescein leakage from the lesion as seen on fluorescein angiography, who received anti - vegf treatment in at least three initial injections every four weeks ; and 2) patients who were followed up for a minimum of six months. the exclusion criteria included : 1) patients diagnosed with polypoidal choroidal vasculopathy (pcv) by indocyanine green angiography and treated primarily with pdt ; 2) prior macular photocoagulation ; 3) a history of subtenon injection of triamcinolone acetonide, or pdt, or anti - vegf within six months before the intravitreal bevacizumab injection ; 4) other intraocular surgery or management during follow - up ; 5) the presence of coexisting ocular disease causing macular edema (i.e., diabetic macular edema, retinal vein occlusion, pseudophakic cystoid macular edema, or uveitis) ; and 6) the presence of comorbid ocular conditions that might affect visual acuity. thirty - nine patients who underwent pdt more than six months before injection were included in the study. treatment response was evaluated by comparing the visual acuity (va) and central macular thickness (cmt) measured by optical coherence tomography (oct) at baseline with those same variables in the three follow - up periods : immediately after treatment, six months after treatment, and 12 months after treatment. the study measured change in va, change in cmt measured by oct, and the number of additional intravitreal bevacizumab injections. va change was evaluated with consistent methods using the snellen eye examination chart and then converted into a logarithm of the minimal angle of resolution (logmar) value. amd characteristics were evaluated in all patients by clinical examination including indirect dilated fundus examination, color fundus photography, oct, fluorescein angiography, and indocyanine green test, if needed. greatest linear dimension through fluorescein angiography was calculated by two retinal specialists masked to each genotype. in previous studies the authors collected peripheral venous blood from all patients for extraction of genomic dna and sequencing of single nucleotide polymorphisms. genotyping of the snps in the cfh y402h (rs1061170), loc387715 (rs10490924) and htra1 (rs11200638) genes was carried out using big dye terminator cycle sequencing (applied biosystems inc., foster city, ca, usa) on an automated sequencer (model 3730, applied biosystems inc.). intravitreal bevacizumab (avastin ; genentech, south san francisco, ca, usa) injections of 2.5 mg/0.1 ml were performed after topical anesthesia with 0.5% proparacaine drops (alcaine ; alcon laboratories, fort worth, tx, usa) under sterile conditions. all patients received three initial injections every four weeks and were then treated " as needed " based on if there was sign of recurrence. in this study, the sign of recurrence was a significant increase (more than 20%) of central retinal thickness at foveola due to new or residual subretinal fluid in oct or dye leaks found in fluorescein angiography. treatment response was evaluated by comparing va and cmt at baseline and after three initial injections during the three follow - up periods (immediate, six months, and 12 months after treatment). baseline demographic and clinical parameters were compared using the student 's t - test and anova test for continuous variables and chi - square tests for categorical variables. va improvement and cmt change between baseline and follow - up were evaluated among the different genotypes for each gene at each follow - up period by adjusting for the variables (age, hypertension and prior pdt) and using repeated measurement analysis of variance. the study also used paired t - tests and repeated measurement analysis to evaluate whether undergoing pdt more than six months before the start of study affected va and cmt values at baseline and in each follow - up period. seventy - five patients who were diagnosed with exudative amd were enrolled in the study, and all patients were successfully genotyped using the peripheral blood sample. table 1 shows the demographic and clinical features of exudative amd in the study population. patient distribution and baseline evaluation, including prior pdt, were described according to each genotype of the cfh y402h, loc387715/htra1 genes. for loc387715 (rs10490924), eight patients (10.7%) were gg genotype, 27 patients (36.0%) were gt genotype, and 40 patients (53.3%) were tt genotype. the loc387715 gg genotype had the oldest mean age among the three genotypes (p = 0.056). hypertension was also prevalent, with the highest prevalence in the tt genotypes, followed by the gg, and gt genotypes (p = 0.017). for the htra1 (rs11200638) polymorphism, similar patient distributions of loc3887715 are seen due to its high linkage disequilibrium with loc387715. only one patient had different genotypes in loc387715 (gg) and htra1 (ga). for cfh y402h (rs1061170), 64 patients (85.3%) were tt genotype, 11 patients (14.7%) were tc genotype, and no patients had the high risk cc genotype. the cfh y402h tt genotype group had an older mean age than the tc group (p = 0.139). the prevalence of hypertension was 53.1% and 18.2% in the tt and tc genotype groups, respectively (p = 0.036). in both cfh y402h and loc387715, the group with the non - risk homozygous allele had a tendency for higher greatest linear dimension, although it was not statistically significant. results for patients who had pdt more than six months before bevacizumab treatment did not differ significantly from those who had no history of pdt. however, the data showed that the high risk group of loc387715/htra1 included more previous pdt patients compared with other groups. in order to compare the bevacizumab treatment response according to genotype in each candidate gene, baseline va and cmt were measured and compared with those from the three follow - up periods. table 2 displays mean va and cmt of patients at baseline and in the three follow - up periods after the initial three injection treatments for each genotype of candidate genes. mean pretreatment va was 1.175 (logmar) and mean pretreatment cmt was 354.5 m for the loc387715 gg genotype (n = 8). in the loc387715 gt (n = 27) and tt (n = 40) genotype groups, mean pretreatment va (p = 0.273) and cmt (p = 0.373) mean pretreatment va was 0.946 (logmar) and mean pretreatment cmt was 302.3 m for the y402h tt genotype (n = 64). for the y402h tc genotype (n = 11), mean pretreatment va (p = 0.902) was worse but mean pretreatment cmt was improved than in the y402h tt group (p = 0.868). this study examined how the variables affect treatment response in the three follow - up periods, by adjusting the variables and using repeated measured analysis for the three follow - up periods compared with the baseline data (table 3). the treatment response to intravitreal bevacizumab at six months post - treatment improved as the high risk " t " allele increased ; this effect was statistically significant (logmar ; tt, 0.346 ; gt, 0.264 ; gg, 0.188 ; p = 0.037). however, there was no statistically significant change in va at 12 months after treatment (p = 0.058) among loc3887715 subgroups (fig. both tt and tc genotype groups in cfh y402h showed the greatest improvement in va after six months, and the tc group had a more favorable response to treatment although it was not statistically significant (logmar ; tt, 0.259 ; tc, 0.411 ; p = 0.773). at 12 months after treatment, both the tt and tc genotype groups had decreased va compared to va at six months, but again, this was not statistically significant (p = 0.859). bonferroni multiple comparison correction showed that there was no significant relationship between cfh y402h and loc387715 treatment response. table 4 shows the comparison study of the effect of prior pdt on mean changes in va and cmt, which revealed that prior pdt had no statistically significant effect after bevacizumab injection during the total follow - up period. however, when compared to the control, va in the pdt group tended to show greater improvements in response to treatment during the follow - up period (table 5). this study analyzed the number of additional intravitreal injections of bevacizumab needed to maintain target va or disease stability within subgroups of the cfh y402h and loc387715 genes (table 6). the tc genotype group of cfh y402h required additional bevacizumab injections compared to the tt genotype group (tt, 1.517 ; tc, 3.363 ; p = 0.020). in the subgroup of the loc387715 gene, the number of additional injections tended to be higher in the gg genotype group than in other groups (gg, 2.143 ; gt, 2.000 ; tt, 1.575 ; p = 0.065). in this retrospective study examining the effects of bevacizumab on exudative age - related macular degeneration in the korean population, patients with the risk t allele of loc387715 had better visual outcome and generally required a lower number of additional injections after the initial three injections. although the function of loc387715 is unknown, the gene is in nearly complete linkage disequilibrium with the htra1 gene. the htra1 gene is part of the family of heat shock proteins (hsp) [45 - 47 ]. patients with the risk allele of loc387715/htra1 might have a better treatment response because the htra1 polymorphism could cause higher sensitivity to oxidative damage. the function of hsp is to protect tissues from various types of damage, especially oxidative stress. the role of hsp is particularly important in the retina, which consumes more oxygen than any other organ in the human body. hsp protects the retinal pigmented epithelium, the photoreceptor, and even the vascular endothelium. angiogenesis, which is the main pathogenic factor for exudative age - related macular degeneration, is known to be related to oxidative stress. thus, if there is an alteration in the protective effect of hsp in the high risk allele group, patients might have sensitivity to oxidative damage and the oxidative stress associated with angiogenesis would then cause much more damage to the retina. accordingly, an anti - vegf agent would be able to inhibit angiogenesis related to the oxidative stress, which might reduce the activity of exudative amd in the retina. this study hypothesizes that patients with the risk allele in loc387715/htra1 have a better treatment response due to decreased sensitivity to oxidative damage by anti - vegf, which reduces the photoreceptor 's functional loss and increases the chance of recovery against functional alteration of hsp. therefore, these patients might have better visual acuity and less need for additional injections for disease stability. visual acuity improved significantly in the risk t allele group during the six - month follow - up period. similarly, the 12-month results showed a correlation between the t allele and better treatment response, but this correlation was not statistically significant (p = 0.058). at the end of the entire 12-month follow - up period, 54 of the original 75 patients remained in the study and 21 patients were lost during follow - up. patients lost during follow - up after six months were those with tt (n = 11) and gt (n = 8) genotypes that had good treatment response. this likely contributed to the less distinguishable differences in treatment response at the end of the study period. it is still evident that patients with the risk t allele in loc387715 have better visual acuity after the initial treatment with bevacizumab and less need for additional injections. the anti - angiogenic effect of the treatment may eventually reduce stress, which will have a profound impact on patients with the risk t allele. patients with the risk c allele in cfh y402h genotype had visual improvement at the final 12-month follow - up. after the initial three injections of bevacizumab, patients with the risk c allele had better visual acuity. however, during the monthly follow - up after initial treatment, these patients underwent more additional injections " as needed " based on patient 's symptoms and clinical findings (tt, 1.517 ; tc, 3.363 injections ; p = 0.020). finally, patients with the risk c allele had better visual improvement than those with the tt genotype at the 6-month follow - up and at the end of the study period. interestingly, in the loc387715/htra1 group, patients with a better response received less additional injections in contrast to patients in the cfh group who received more additional injections and also had a better outcome. in order to explain this, one must consider the pathogenesis of exudative age - related macular degeneration : neovascularization and inflammation. these two factors are also related to the mechanism underlying the treatment response between different time periods. in the immediate post - treatment phase, intravitreal bevacizumab reduces amd activity, such as angiogenesis, and reduces the macular edema. the immediate post - treatment cmt was reduced to less than 250 m in all groups. however, in the later phase of treatment (six months post - treatment) macular thickness does not seem to be responsible for the change in visual acuity of patients. all patients had cmt within the normal range at six and 12 months post - treatment, but visual acuity varied between different genotype groups. thus, it appears that the functional status of the photoreceptor is affected by which pathway (inflammatory or metabolic) is responsible for the later phase of the treatment response. with this in mind, cfh inhibits the alternative pathway, which may cause dysregulation of the common pathway in risk allele group and ultimately may cause continued inflammation. thus, additional bevacizumab, an anti - vegf agent with anti - inflammatory effects, is needed to reduce the inflammation. accordingly, appropriate maintenance therapy of additional bevacizumab results in visual improvement. this may also be applicable to the loc387715/htra1 group, in that immediate post - treatment response did not differ between the various loc387715/htra1 genotypes due to bevacizumab 's initial action in reducing macular edema, regardless of genotype. but on follow - up at six months, the risk allele group had improved treatment response. on the other hand, in studies of the genetic effect of cfh y402h on caucasian population, patients with the c allele required additional injections, but treatment still resulted in worse visual acuity. this supports the current study 's hypothesis that the altered inflammatory pathway in the cfh polymorphism is responsible for the need for more bevacizumab injections in the risk c allele group. perhaps if more bevacizumab had been administered after the initial treatment in the caucasian study, there would have been improved visual outcome at the end of study. a recent study by sakurada. showed that higher t - allele frequency in loc387715 a69s was associated with worse visual prognosis after photodynamic therapy for pcv. on the contrary, the present study showed that higher t - allele frequency in loc387715 was associated with better visual prognosis after intravitreal bevacizumab for cnv. these results show the variable effect of genetic polymorphism on treatment response associated with disease phenotype (pcv vs. cnv) and treatment modality (pdt vs. bevacizumab). patients with the risk t - allele could have poor visual prognosis when treated for pcv but could have a better prognosis when treated for cnv ; also, patients with the risk t - allele could have poor visual prognosis due to pdt but may have an improved visual prognosis on bevacizumab treatment. based on these results, one could logically use genetic information of each disease phenotype to personalize treatment modality. for instance, in pcv patients with the risk t allele, it might be useful to incorporate bevacizumab or bevacizumab / pdt combination therapy rather than pdt treatment alone. there are several limitations to the present study : the patient cohort is small, this is a retrospective study, and patient follow - up was incomplete, resulting in insufficient 12-month follow - up results. in fact, the results were not statistically significant ; however, genotypically different distributions were observed based on age, diabetes mellitus, and prior pdt in the loc387715/htra1 group. the authors could not rule out that statistical error might be due to small sample size. therefore, tables 2 and 3 show the adjusted results by multivariate statistical analysis for not only hypertension (which was statistically significant in the baseline study) but also for age and prior pdt treatment. in addition, patients who were treated with pdt more than six months before the start of bevacizumab treatment were included. these patient groups had an unfavorable response to pdt and, therefore, would be potential candidates for bevacizumab treatment. there was no statistically significant difference in va or cmt between the prior pdt group and the control during follow - up (table 4). however, as mentioned previously, statistical error due to limited sample size can not be ruled out. many of the patients in the high risk group of the loc387715/htra1 group had previously received pdt. there was also a tendency for enhanced visual improvement over baseline in patients with prior pdt compared to the control. these results imply that the high risk group, which had a better treatment outcome, might be influenced by pdt. it appears that this response is a result of pdt / bevacizumab combination therapy, not bevacizumab alone. finally, this study was conducted on an asian population and may not be directly applicable to caucasian populations. despite these limitations, the present study is the first to show statistical relevance between the loc387715/htra1 genes and their pharmacogenetic association to bevacizumab in an asian population. this study may be a guide to further studies on bevacizumab as well as other anti - vegf agents in asian population. further studies with prospective randomized, controlled trials are needed, and pharmacogenetic studies of ranibizumab, antioxidant supplements and zinc in asian populations are also recommended. currently, three monthly initial intravitreal injections of anti - vegf agent and additional maintenance treatment for disease stability is a widely accepted treatment protocol for exudative amd. however, results are still inconclusive regarding the recommended treatment interval or type of drug used in maintenance treatment. this report describes a relationship between treatment response and additional injections, although the relationship was not statistically significant. this study could be a guide for future research examining maintenance treatment intervals according to genotyping in exudative amd patients. in conclusion, this study showed that different loc387715/htra1 genotypes had different treatment responses when bevacizumab was used to treat exudative amd. patients with the risk allele had better treatment responses and less need for additional injections. in addition, patients with the risk allele of cfh y402h needed additional injections of bevacizumab for better visual improvement. this suggests that shows pharmacogenetic factors could be used to determine treatment modality and dosing and this study may ultimately provide basic data for ' personalized medicine ' in amd. | purposethe purpose of this study was to determine the pharmacogenetic effects of complement factor h (cfh) y402h, loc387715 and high - temperature requirement factor a1 (htra1) genotypes on the treatment of exudative age - related macular degeneration (amd) by intravitreal bevacizumab injection in a korean population.methodsseventy-five patients diagnosed with exudative amd were treated with intravitreal bevacizumab (2.5 mg) monotherapy. all patients received three initial intravitreal bevacizumab injections every four weeks and were then treated " as needed " based on clinical findings, optical coherence tomography and fluorescein angiography during the 12 month follow - up period after the third injection.resultsthe difference in visual acuity improvement among the three genotypes of loc387715 were statistically significant at six months post - treatment (logarithm of the minimum angle of resolution ; tt, 0.346 ; gt, 0.264 ; gg, 0.188 ; p = 0.037). among the loc387715 genotypes, the number of additional injections was lower in patients who had the risk t allele (gg, 2.143 ; gt, 2.000 ; tt, 1.575 ; p = 0.064). there was no significant difference between visual acuity and central macular thickness change in the cfh y402h polymorphism group during the 12 month follow - up period. however, the tc group of cfh y402h required more additional bevacizumab injections than the tt group (tt, 1.517 ; tc, 3.363 ; p = 0.020).conclusionsthis study demonstrated that different loc387715/htra1 genotypes resulted in different bevacizumab treatment responses on exudative amd. patients with the risk allele had an improved treatment response and less need for additional injections. however, patients with the cfh y402h risk allele needed more additional injections of bevacizumab in order to improve visual acuity. this study illustrates how pharmacogenetic factors may help determine treatment modality and dosing. this could ultimately provide basic data for ' personalized medicine ' in amd. |
the biogenesis and function of eukaryotic mrnas involves a diversity of biochemical reactions. these include capping, splicing, and polyadenylation in the nucleus, as well as transport to the cytosol, where the mrna is engaged in translation before ultimately being degraded. in each case, the biochemical reaction and its specificity are modulated by a variety of mrna - binding factors including proteins, micrornas, and potentially other long noncoding rnas. eukaryotic cells contain a wide variety of quality control systems that lead to the degradation of rnas defective in any of the basic steps of biosynthesis and function (doma and parker, 2007 ; houseley and tollervey, 2009). first, mrnas with a mutation causing an inherent defect in normal function, such as a mutation inhibiting pre - mrna splicing, or an early nonsense codon, will be subject to quality control with the vast majority of the mutant mrnas being degraded. in addition, quality control will also act on specific mrnas whose rna - processing reactions have yielded an mrna lacking normal features. for example, when alternative splicing produces an mrna with an early translation stop codon, such mrnas are rapidly degraded by a pathway called nonsense - mediated decay (lamba., 2003 ; mendell., 2004). finally, due to the competition between normal function and quality control systems, a fraction of mrnas from any given gene that fail to efficiently complete a functional step will also be degraded by quality control. for example, in yeast a low but measurable percentage of various wild - type pre - mrnas are degraded by quality control systems (hilleren and parker, 2003 ; harigaya and parker, 2012). in general, quality control circuits can be understood as a competition between the normal function of an mrna and a competing rna degradation pathway (doma and parker, 2007). the enhanced degradation of nonfunctional rnas by such quality control pathways is then specified by either features of functional mrnas that promote their rapid bypassing of the competing rna degradation step, or features of aberrant mrnas that enhance the rate of the competing degradation pathway on such nonfunctional mrnas. localized mrnas were first observed in specialized biological contexts such as neurons, oocytes, and embryos (martin and ephrussi, 2009). however, it is now clear that many, if not the majority of mrnas, are localized in eukaryotic cells and that mrna localization is not limited to specialized cells. for example, a comprehensive screen of mrna localization in drosophila embryos revealed that over 70% of mrna showed a specific pattern (lcuyer., 2007). moreover, in somatic cells, specific mrnas are localized to the surface of mitochondria, the er, or even with peroxisomal membranes (weis., 2013). an increasing number of these types of examples argue that mrna localization is a widespread and common feature of eukaryotic cells. by localizing mrnas, the production of protein can be constrained to a specific region of the cell. this can allow for more efficient assembly of proteins into larger complexes, or transport of polypeptides across membranes as in the case of localizing mrnas to the er or mitochondria to enhance cotranslational import. localized translation of mrnas can also allow for different cell fates from dividing cells as each progeny cell gets different polypeptides. a well - studied example of this phenomenon is the localization of the ash1 mrna to the bud tip of yeast cells to specify cell type switching only in the daughter cell (heym and niessing, 2012). asymmetric localization of mrnas also plays important roles in numerous cell fate determinations in development and presumably also in stem cell lineages (martin and ephrussi, 2009). localization of mrnas can also allow for local control of translation to allow for different cellular responses in different parts of the cell. for example, in neurons mrnas localized to dendrites can be locally stimulated to enter into translation by synaptic activity (holt and schuman, 2013). finally, the localization of mrnas to specific regions can also limit the toxic effects of broadly producing specific proteins. in this review, we discuss emerging lines of evidence suggesting that the processes of mrna localization and mrna turnover can be interrelated. for example, there are a growing number of examples where mrna degradation is regulated in a spatially restricted manner. second, there are several rna - binding proteins that regulate both localization and mrna degradation. finally, fundamental and general relationships between mrna localization, translation, and degradation dictate that mrna localization and degradation will be intertwined. moreover, these relationships lead us to hypothesize that quality control systems will exist such that mislocalized mrnas will be preferentially degraded. several observations have established that the degradation of mrna can be controlled in a spatially restricted manner, which can then have an impact on the subcellular distribution of mrnas within the cell. in principle, this could be achieved either by cis - mrna sequences in mrnas that promote degradation only in a specific region of the cell, or by regulated localization of the mrna decay enzymes. examples where cis - rna elements determine mrna fate include drosophila embryos, where the enhanced concentration of the nanos and hsp83 mrnas at the posterior pole is partially dictated by increased degradation of these mrnas elsewhere in the embryo (bashirullah., 2001). similarly, the arc mrna is only degraded in the dendrites of neurons after synaptic activity, which promotes its entry into translation (giorgi., 2007). directing specific mrna decay programs to distinct subcellular locations can also spatially control mrna decay. ire1-mediated decay is localized to the er, where it alters mrna stability during stress (gaddam., 2013). alternatively, the concentration of general decay enzymes such as dcp2 and xrn1 into cytoplasmic p - bodies could either accelerate decay of p - body localized transcripts or protect nonresident transcripts from decay (decker and parker 2012). given improved technological advancements in subcellular mrna resolution, one anticipates that more examples of the local control of mrna degradation will be identified in the future. two aspects of the inherent and fundamental relationships between mrna localization, translation, and mrna degradation impact how cells intertwine localization and mrna turnover. first, during mrna localization, mrnas are generally kept in a translationally repressed state (martin and ephrussi, 2009). this is to facilitate transport because localizing an mrnp is potentially simpler than localizing a polysome. moreover, by repressing translation of mrnas until they are localized, where translation repression is relieved, it ensures that proteins are only produced in the proper location. translation repression of mrnas during transport is often achieved by the formation of mrnp complexes that sequester the 5 cap structure away from the translation machinery (sonenberg and hinnebusch, 2009). once mrnas are appropriately localized, modification of mrna - binding proteins can lead to mrnp remodeling and relief of translation repression (httelmaier. the second key principle is that translation initiation and mrna degradation are generally inversely related (coller and parker 2004 ; roy and jacobson, 2013). this relationship can be understood as the dual role of the poly(a) tail and cap structures as both promoting translation initiation through the binding of the poly(a)-binding protein (pab1) and the cap - binding protein eif4e, respectively, as well as being the targets of the deadenylases and decapping enzymes that catalyze the major pathway of mrna turnover. given the repression of translation during localization, and the typical stimulation of mrna degradation by repression of translation initiation, it creates an optimal functional mrnp for efficient and accurate mrna localization. in this view, an mrnp for transport should be translationally repressed until localized, and also protected from mrna degradation for a window of time to allow for localization before degradation. however, the transport mrnp should only be stable for a sufficient time to allow for efficient transport, and would ideally be subject to degradation if not localized within a biologically appropriate time period. another line of evidence for the coupling of mrna localization and degradation comes from the observation that several rna - binding proteins are now known to control both mrna localization and degradation. the specifics of how these proteins function suggest possible manners by which the cell couples localization and mrna degradation. in some cases, proteins play bi - functional roles in promoting both localization and mrna degradation, and by doing so could increase the decay rate of unlocalized mrnas. one example of this phenomenon is the yeast puf3 protein, which is a member of the pumilio family of rna - binding proteins (wickens., 2002). the puf3 protein binds to 200 yeast mrnas that encode proteins involved in mitochondrial function and affect their metabolism in two manners (gerber., 2004). first, puf3 can target bound mrnas to the surface of mitochondria, presumably to increase the efficiency of cotranslational import (saint - georges. second, puf3 is known to promote the deadenylation and decapping of its bound mrnas (olivas and parker, 2000). strikingly, the ability of puf3 to promote decay is modulated by carbon source and puf3 stimulates decay when cells are grown in glucose (and mitochondrial function is decreased) but not when cells are grown in glycerol or ethanol (where mitochondria function is increased ; foat., 2005 ; miller., 2013 these dual roles of puf3 suggest a model whereby the cell regulates its ability to control mrna localization and degradation in a manner dependent on carbon source (fig. 1) with mrnas that fail to get localized being subject to puf3 mediated degradation, while mrnas that get localized are protected from the stimulation of degradation by puf3. an untested prediction of this model is that interactions of puf3 with the mitochondrial surface receptors are anticipated to block its ability to promote deadenylation and decapping. dual functions of puf3. under normal growth conditions (i.e., glucose), puf3 in yeast enhances decapping and deadenylation (left). when grown in the presence of glycerol or ethanol where mitochondria function is increased puf3 trafficks mrnas to the surface of the mitochondria (right). the red pacman puf6 is a second protein that may also have dual roles in mrna localization and degradation. puf6 binds to ash1 mrna and is required for its localization to the bud tip (gu., 2004), and affects the localization of other mrnas to the bud tip (aronov., 2007). puf6 also inhibits translation initiation in a manner proposed to be through interaction with eif5b (deng., 2008). because puf6 represses translation initiation, one would predict that it would also promote mrna degradation given the inverse relationship between translation initiation and mrna degradation, although no direct examination of how puf6 affects mrna degradation has been performed. interestingly, in puf6 strains it appears that ash1 mrna might be somewhat elevated (see fig. 6 in gu., 2004), raising the possibility that puf6 can also promote mrna degradation, perhaps preferentially of unlocalized mrnas. a third example of the direct coupling of localization and mrna degradation is the staufen protein. in metazoans, staufen is a dsrna - binding protein and interacts with and can affect the localization or degradation of mrnas that form extensive dsrna regions in their 3 utr. a role for staufen in mrna transport was first observed during embryogenesis in drosophila (st johnston. staufen family members also play important roles in the transport of mrnas in neurons and in the localization of specific mrnas to dendritic spines (lebeau., 2011 ; heraud - farlow., for example, knockdown of staufen2 causes mislocalization of rgs4 mrna from neuronal dendritic spines (heraud - farlow., 2013). moreover, neuronal transport of reporters bearing either multiple staufen1- or staufen2-binding sites was impaired upon corresponding staufen knockdowns (lebeau., 2011). staufen also affects mrna degradation by triggering a pathway referred to as staufen - mediated decay. in this pathway, staufen bound to the 3 utr of an mrna can recruit upf1 (park and maquat, 2013). upf1 is an rna helicase involved in nonsense - mediated decay at premature stop codons and can also serve a second role in promoting mrna decay when recruited to an mrna by staufen. an unresolved issue is how the processes of staufen - mediated decay and its role in mrna localization are related. one possibility is that they are independent effects on different mrnas in different cells or organisms. for example, staufen s role in mrna decay has primarily been studied in human tissue culture cells, whereas its role in mrna localization is best documented in neurons or oocytes. alternatively, it remains possible that these two functions can overlap and mrnas bound by staufen may recruit upf1 to allow for the activation of a distinct mrna decay pathway if the mrnas are not localized properly in a reasonable time frame. mrna localization and turnover should also be coupled by proteins that function to limit degradation of the mrna during the transport process. in this case, defects in these proteins would be expected to cause accelerated decay and loss of localization. moreover, because a common way of keeping the mrna stable is to sequester the 5 cap structure, which also blocks translation, such mrnp factors would also be expected to be translational repressors. khd1 is known to affect the localization of the ash1 and other mrnas to the bud tip (irie. for example, khd1 binds to and plays a role in localizing the mtl1 mrna to the yeast bud tip (hasegawa., 2008), but also stabilizes the mtl1 mrna from decapping (hasegawa., 2008 ; mauchi., 2010). one possibility in this case is that khd1 stabilizes the mtl1 mrna by forming a translationally repressed complex on the 5 cap structure consisting of khd1, eif4e, and eif4 g, which has been shown to be bound by khd1 in a manner that blocks translation (paquin this would be an example wherein an mrna that was not properly translationally repressed would be degraded (and thus not localized). a new example for mrnas encoding proteins that are imported into the er highlights how mrna degradation can be used to preferentially degrade misfunctional and/or mislocalized mrnas. normally, the nascent signal sequence on mrnas destined for the er is bound by srp, which both limits translation and facilitates the interaction of the nascent chain with the sec61 receptor in the er, thereby allowing translation to resume and cotranslational import of the polypeptide. strikingly, defects in the signal sequence, or srp itself, allow the nascent signal sequence to bind ago2 in human cells, and this then triggers accelerated mrna decay (karamyshev., 2014). this suggests a model where there is competition between ago2 and srp for the emerging signal sequence, and failure of srp to bind the signal sequence and localize the mrna allows for ago2 to bind the signal peptide and trigger mrna degradation (fig. proteins bound for the er contain a signal sequence, a short peptide recognized by the srp, which inhibits translation and targets these nascent polypeptides to the er for cotranslational insertion through interactions with the sec61 receptor (gray bar). mrnas that encode a variant signal sequence that affects srp binding are preferentially degraded. with srp (blue) no longer able to bind, ago2 (green) associates with these mrnps undergoing translation. the inherent coupling of localization, translation, and decay, along with the mrnp remodeling that occurs when mrnas are properly localized and enter translation suggests a model whereby the degradation of localized and unlocalized mrnas will be different. this intersection of localization and degradation then plays roles in increasing the degree of mrna localization, and also provides a possible quality control system to preferentially degrade mrnas that fail to be properly localized. in one model (fig. 3), nascent mrnps targeted for localization would enter the cytosol in a translationally repressed state. such mrnas would be initially protected from mrna decay both by mrnp features that sequester the 5 cap, and by the presence of a long poly(a) tail, which can both inhibit decapping (muhlrad., 1994 ; caponigro and parker, 1995) and protect mrnas from an alternative 3-to-5 degradation mechanism catalyzed by the cytoplasmic exosome (anderson and parker, 1998). once in the cytosol, these mrnps would become substrates for mrna localization, as well as beginning the deadenylation process. if mrnas are localized efficiently they enter translation and serve their normal function. alternatively, if deadenylation is sufficiently advanced before proper subcellular localization then such mislocalized mrnas would then be subject to an increased rate of degradation, potentially both by decapping and 3-to-5 degradation by the exosome. note that for such a system to be effective in quality control, in the nontargeted region of the cell the rate of mrna degradation simply must be faster than the rate of inappropriate entry into translation before localization. once entering the cytoplasm, mrnas that are bound for a specific subcellular location are initially translationally repressed and are subject to deadenylation. if localization proceeds faster than decay (left), the mrna will be properly localized and enter into translation. however, if there is a localization defect, which manifests in accelerated decay of the mrna (right), the mrna will be degraded before reaching its final destination. gray, blue, and green features represent rna - binding proteins (rbps) bound to mrnas before localization. the preeminence of the poly(a) tail in this model is due to two basic tenets : (1) the overwhelming number of examples where transported, translationally repressed mrnps are cap protected ; and (2) deadenylation is a two - step process, whereby loss of significant poly(a) tract residues is tolerated to a point where decapping, and/or 3-to-5 degradation can then occur. moreover, at least in some cases, localized and translationally repressed mrnas have short poly(a) tails once present at their destination. for example, in neurons several mrnas delivered to the synapse are thought to have short poly(a) tails, which are then elongated upon translation activation by the recruitment of cytoplasmic adenylases in an mrna - specific manner (richter, 2010). similarly, many maternal mrnas are stored in a deadenylated state before readenylation and translational activation during development (mcgrew., 1989). second, mrnas that fail to get localized should be degraded at a faster rate. third, some kinetic defects in localization could be rescued by slowing the deadenylation and/or decay rate of the mrna in the nonlocalized compartment. finally, cells will have taken advantage of this coupling to create mrna localization mechanisms that really are selective mrna translation and stabilization in specific regions of the cytosol. one anticipates that mrna localization will involve an overlapping set of mechanisms where the spatial localization of each mrna is dictated by differential effects of localization mechanisms and mrna decay contributions. it is becoming increasingly clear that mrna localization and turnover will be coupled in interesting and biologically relevant manners. given the importance of mrna localization, one anticipates that quality control mechanisms will exist to degrade mislocalized mrnas. such quality control mechanisms could take advantage of bi - functional proteins that affect both localization and mrna turnover, or in some cases may be simply achieved by manipulation of the inherent coupling of translation, localization, and mrna degradation mechanisms. | in eukaryotic cells many mrnas are localized to specific regions of the cytosol, thereby allowing the local production of proteins. the process of mrna localization can be coordinated with mrna turnover, which can also be spatially controlled to increase the degree of mrna localization. the coordination of mrna localization, translation repression during transport, and mrna degradation suggests the hypothesis that an additional layer of mrna quality control exists in cells to degrade mrnas that fail to be appropriately localized. |
mycoplasma pneumoniae (mp) is one of the most common respiratory tract pathogens in community - acquired pneumonia (cap) patients. as one of the smallest bacterial organisms, mp is recognized as a capable of existence in both extracellular and intracellular environments which might facilitate the establishment of latent or chronic states. by the first proven link between an infectious agent and cancer came in the 1960s with the discovery of epstein barr virus in burkitt s lymphoma tissue, it is likely that organisms which can persist at an intracellular level will have the greatest potential to influence oncogenesis. in recent years, the association between malignant cell transformation and infection with mycoplasma has been identified in vitro. nevertheless, there have been very few reports focusing on the cell pathology in mp infection in vivo. therefore, the aim of this study was to identify the degree of cellular dysplasia in respiratory epithelium from mpp in comparison to other cap infections caused by typical pathogens. all patients were over 18 years old of age with cap, who underwent both chest computed tomography (ct) and bronchoscopy in two hospitals between april 2013 and august 2015. the acute phase serum samples were tested for igm antibodies to mp by enzyme - linked immunosorbent assays test. the definitive diagnosis of mp infection was confirmed by a positive balf result using quantitative loop - mediated isothermal amplification (qlampp) assays targeting for the p1 operon sequences using the universal kit for bacterial dna extraction (capitalbio corporation, p.r. china) as described elsewhere. screening for eight common respiratory bacterial pathogens in balf was performed using qlamp assay as described elsewhere. nine respiratory viruses in balf were detected using ftd respiratory pathogens 21 plus multiplex real - time polymerase chain reaction kit (fast - track diagnostics, junglinster, luxembourg). cap caused by bacterial pathogens and demonstrating a negative qlamp assay for mp gene categorized the non - mp (typical cap) infection group (t - cap group). the patients with suspected malignant lesions seen under direct vision on bronchoscopy or on ct scan, or patients with cap caused by respiratory viruses and mixed infection were excluded. the cast - off epithelial cells were obtained via conventional bronchoscopy by brushing the infectious airway mucosa 23 times. the samples were analyzed as a cell smear in the fully automatic liquid - based cytology instrument (thinpreptm2000, hologic, inc. two senior pulmonary cytopathologists evaluated the specimen blindly under light microscopy by hematoxylin and eosin staining. cell morphology was graded for cellular dysplasia according to the cellular and nuclei size, nuclear - cytoplasmic (n : c) ratio, the shape and halves of the nucleus, and chromatin pattern as previously established. statistical analysis was performed using the spss version 16.0 for windows (spss inc., ibm, usa). categorical variables and continuous variables were reported as percentages and as the mean standard deviation, respectively. chi - square test and independent - samples student s t - test were employed. a total of 15 patients with mpp were included in mpp group and 17 with typical cap patients caused by other pathogens (t - cap group). in the mpp group, nine patients were diagnosed based on qlamp assay alone and six patients based on serology alone. a positive bacterium was detected in only 12% (2/17) of the t - cap group patients on qlamp assay, one streptococcus pneumoniae, and one klebsiella pneumoniae. about 17 of 32 patients had received antibiotic therapy (> 3 days duration) prior to admission. the patients in mpp group were younger, more likely to be female, and more likely to have a lower c - reactive protein level than those of the t - cap group (43.33 16.09 years vs. 57.29 15.89 years, 60% vs. 17.6%, and 55.73 44.63 mg / l vs. 115.95 73.90 mg / l, respectively). both epithelial cells and inflammatory cells were found in the brushing samples. a representative high - power photomicrograph of epithelial cellular dysplasia is shown in figure 1, compared to normal epithelial cells in figure 2. the identification of total cellular and nuclear dysplasia was significantly higher in the mpp group [table 1 ]. the respiratory epithelial cells of dysplasia (arrow) varied markedly in size and shape, nuclear pleomorphism with a significantly abnormal karyoplasmic ratio (h and e stained smearing sample, 400 from a patient with mycoplasma pneumonia) the heaped - up normal respiratory epithelial cells were shown (h and e stained smearing sample, 400 from a patient with community - acquired pneumonia) morphological finding of respiratory epithelial cells in patients with mycoplasma pneumonia and other pathogenic pneumonia laboratory data have demonstrated the potential for some mycoplasma species to induce a karyotypic change and malignant transformation during prolonged or chronic tissue - culture infection in vitro. preneoplastic changes in cultured cells may be reversed following eradication by appropriate antibiotic treatment. by a complex and specialized attachment organelle to attach to the respiratory epithelium with ease, mycoplasma is primarily considered a mucosal pathogen for parasitic existence. because it lacks a rigid cell wall, several mycoplasmal species have demonstrated the ability to fuse with and enter host cells which are not normally phagocytic, and the ability to survive, synthesize dna, and undergo cell replication in host cells in vitro. in contrast, the common bacteria such as streptococci are generally considered as extracellular pathogens because their polysaccharide capsule significantly attenuates their ability to invade the cytoplasm of respiratory epithelial cells, although occasional intracellular uptake may occur. in addition, the intracellular damage from mycoplasmal enzymes and cytotoxins may be another cause to nuclear atypia. to our knowledge, this is the first study to demonstrate a clear dyskaryotic change in airway epithelial cells in patients suffering from mp than that in patients suffered by other organisms in vivo. in this study, there was none of patients tested positive bacterial species for routine sputum culture, which was compatible with the findings partly caused by antimicrobial treatment before the collection of specimens as described recently. due to the application of antibiotics in the majority of candidates before admission and consequent effect on direct bacterial identification from delayed balf samples, we applied a method of genetic and immunological exclusion to categorize cap patients. we found that many clinical differences between two groups were similar to those described in other studies. the special biological characteristics and mechanisms of pathogenesis of mp may be reflected in the different cytopathological aspects of mpp. this preliminary study identifies a potential ability of mp to evoke dyskaryotic changes in respiratory epithelium, which may imply an oncogenic potential of latent or chronic mp infection. this study was supported by the national 12th five - year plan major scientific and technological program from the ministry of science and technology of china (no. daniel edward porter, director of department of orthopedics, first hospital of tsinghua university, for kindly helping the english version. this study was supported by the national 12th five - year plan major scientific and technological program from the ministry of science and technology of china (no. daniel edward porter, director of department of orthopedics, first hospital of tsinghua university, for kindly helping the english version. sca carried out the design of the work, conducted the study, performed the statistical analysis and prepared the draft and the final version of the manuscript. | background : this study aimed to explore the cellular morphology of respiratory epithelium in mycoplasma pneumonia (mpp) patients.materials and methods : the cast - off cell morphological findings from bronchoscopic brushings in mpp and community - acquired pneumonia (cap) caused by typical pathogens were reviewed.results:compared with the cap group, cellular dysplasia in respiratory tract epithelial brushings was significantly greater in mpp patients (p = 0.033).conclusion : unique biological characteristics and mechanisms of pathogenesis of mycoplasma pneumoniae (mp) may result in dyskaryotic changes in respiratory epithelium in adult mpp. |
the last decade or so has seen substantial interdisciplinary activity between the arts and sciences, with many scientists applying knowledge and methods from their own areas in order to gain new insights into how art is made and appreciated (journal of consciousness studies, 1999, 2000, 2004 ; zeki, 1999 ; livingstone, 2002 ; solso, 2003 ; martindale, 2006). occasionally scientists have worked closely with art historians to share ideas and approaches (freedberg and gallese, 2007 ; onians, 2008). one of the factors motivating this new collaborative spirit is the realization that artists have made certain discoveries about the way the human brain works that are only now being uncovered by scientists. according to zeki (1999, p. 2) : most painters are also neurologists. cavanagh (2005), another eminent vision researcher, talked of the artist as neuroscientist. given that for many centuries artists have been intensively studying the way the world is perceived it is perhaps not surprising they have come to understand certain features of the way, for example, we sense objects, color, form, or depth. through their investigations artists have left a permanent record of their findings in all the countless works of art in museums and galleries around the world. the task of unpacking all this deposited artistic knowledge and reconciling it with our current scientific understanding of perception and cognition is vast. which is why the recent collaborative activity is to be welcomed, despite the great inter - cultural and methodological challenges it poses. first, though, i will discuss my own experience as an artist collaborating with scientists in the study of art. as will be seen, the process of working closely with scientists has raised a number of issues of the kind i believe many collaborators face when trying to work across two quite distinct traditions. as a result of this work i remain convinced not only that artists and scientists can work together effectively to create new, mutually relevant, knowledge but that it is very important they do. the paper will start by introducing the topic that was the subject of the collaborative investigations, which i term visual indeterminacy. this is an area of great significance in the history of art and, as i hope to show, is potentially of considerable neuroscientific interest also. in setting out the background, i will describe how i became aware of the phenomenon of visual indeterminacy, how other artists have explored its effects, and how i have tried in my own work to produce images that are indeterminate. i will then describe some of the neuroscience that relates to the phenomenon, and the collaborative studies i have undertaken with neuroscientists and psychophysicists to investigate responses to such images. finally, i will consider some of the implications of this work for art science interdisciplinarity in general. visual indeterminacy is a perceptual phenomenon that occurs when a viewer is presented with a seemingly meaningful visual stimulus that denies easy or immediate identification (pepperell, 2006). i first became aware of it as an undergraduate art student watching the silent german expressionist film the cabinet of dr caligari (weine, 1920), which is known for its non - naturalistic sets and highly contrasting monochromatic lighting. about three quarters of the way through watching the film something remarkable happened : the image suddenly became unrecognizable. although i could clearly see the screen was full of shapes (there was no problem with my vision as far as i was aware) they did not form a meaningful scene, and i was left struggling to identify the forms before me. figure 1 shows two stills from the movie, the first at the moment of non - recognition and the second from a few frames on, when a figure leans up from a desk, and i was once again able to make out what was depicted. two stills from the cabinet of dr caligari showing (left) the moment of non - recognition and (right) the moment of recognition some 5 s later. this 5-s sequence had a big impact on me, with repercussions that continue to this day. unlike normal visual perception where the world is full of objects we readily recognize, in this short lapse of time my usual conceptual grip on the world failed. i remember the experience as marked by a mild form of anxiety and bewilderment combined with an active struggle to make sense of what i was seeing. i 've since realized that such experiences are not uncommon. indeed, i 've spoken to many others who report similar momentary lapses of recognition. one of the most vivid televisual memories of my childhood was a segment in an early evening quiz show called ask the family, broadcast in the uk in the 1970s, which pitted two families against each other in a test of general knowledge and observation. the section of the show in question involved an everyday object being presented in close up or from an unusual angle. as the camera pulled out to reveal the object in full the families raced to identify it as quickly as possible. part of the reason, i suspect, this piece of television trivia is remembered so readily by those who saw it is because it was one of the rare occasions in popular culture where an image was deliberately presented in such as way as to be unrecognizable. when faced with such images we seem to be compelled to determine their meaning, so paying a different kind of attention to them than we would with easily recognizable views of the same thing. these days we might even enroll the help of the online community to resolve visual conundrums of this kind. the image in figure 2 was an image posted on a university bulletin board by a confused it manager who wanted help in identifying what his christmas - themed biscuit represented. image of an indeterminate biscuit taken from a university web site, which included the caption : ? found in a package of cadbury 's festive friends chocolate biscuits in the office this afternoon. what on earth is it supposed to be ? visual indeterminacy can be defined, then, as the perceptual experience occurring in response to an image that suggests the presence of objects but denies easy or immediate recognition. anecdotal evidence suggests that being confronted with such images arouses a need to determine what is depicted, so that additional attention is given in order to resolve the conundrum. the allure of indeterminate images has not escaped the attention of artists, who have frequently exploited their capacity to perplex audiences. in the first major study of unrecognizable images in art, gamboni (2002) tracked the use of indeterminacy in works stretching deep into art history showing the way artists deliberately included elements or passages within paintings that confounded the viewers capacity to identify what they saw. a famous example is found in a work made in the late eighteenth century by joseph wright of derby titled experiment on a bird in an air pump (national gallery london, 1768). the painting depicts a scientific demonstration of the effect of oxygen deprivation on a bird, and is generally rendered with immaculate clarity. yet there is a strange object floating in a backlit jar prominently positioned in the foreground of the scene. ever since the painting was first exhibited people have wondered what this object is. it has been variously labeled a bird 's carcass, a skull, and a pickled organ, but there is still no universally agreed interpretation (schupbach, 1989, pp. it has generally been assumed that the artist deliberately fashioned the object in this way in order to add an extra dimension of interest for audiences. one artist who did more than most to exploit the artistic possibilities of visual indeterminacy was j. m. w. turner, the english painter associated with the romantic movement of the early nineteenth century and famous for his atmospheric landscapes and seascapes. in spite of his now titanic reputation, in his lifetime turner was often vilified for producing what were seen as unreadable and indistinct works, which many critics thought flouted good taste and artistic probity (see figure 3). it is surprising that the images turner exhibited publicly and which were complained about most vociferously, such as the landscapes of the early 1800s, appear to us to now as quite clear and distinct. so much was left to be imagined that it was like looking into a coal fire, or upon an old wall, where from many varying and undefined forms the fancy was to be employed in conceiving things (gage, 1975, p. 450). a nineteenth century caricature satirizing j. m. w. turner 's painting methods, which were regarded by many of his contemporaries as producing indistinct or unrecognizable scenes. had critics seen some of the works turner did not show in public, such as the highly indeterminate interior of a great house : the drawing room, east cowes castle of around 1830, now in the tate collection in london, they would very likely have been bewildered. historians are still unclear about the subject or the motive for the painting, and indeed even when inspected closely it is impossible to make out all but a fraction of the objects depicted. (butlin and joll, 1984, p. 282) being executed with a vigor and freedom hardly seen in turner 's contemporaries. it is interesting to speculate what was going on in turner 's mind that led him to create such works, and in the minds of the public who struggled to read even his more recognizable pieces. we do know, however, that his paintings had an impact on the 30-year - old claude monet when he visited london in 1870 to avoid conscription into the franco - prussian war, where he saw turner 's work for the first time (house, 1986, p. 113). monet soon echoed turner 's atmospheric images in a painting made in 1872, impression, sunrise, the title of which, when exhibited in 1874, gave the impressionist movement its name. this rather sketchy rendering of le havre harbour in fog particularly incensed one contemporary critic, who ridiculed its imprecision and scornfully asked : what does that canvas depict ? in fact, as far as monet was concerned the function of his painting was not to obscure but to faithfully depict the appearance of the world, in other words what he saw rather than what he knew to be out there in front of him. a painting like one of the many views he made of rouen cathedral in the 1890s is not so much a depiction of the cathedral 's walls themselves than the light reflected by those walls (house, 1986, p. 221). it is up to us as viewers, according to the theories of vision popular among artists in monet 's day, to read into those patterns of light the form of the cathedral from which they were derived using our own conceptual resources. this is what gombrich (1960, p. 161) referred to in art and illusion as the beholder 's share of the pictorial bargain, the contribution viewers supply to the meaning of the image from their own imaginations. gombrich (1960, p. 250) noted that turner 's great champion, the art critic, and theorist john ruskin, urged artists to paint only what arrives at the childish or innocent eye, that is, the eye as a recorder of flat stains of color, merely as such, without consciousness of what they signify as a blind man would see them if suddenly gifted with sight. wished he had been born blind and then suddenly gained his sight so that he could have begun to paint in this way without knowing what the objects were that he saw before him. (nochlin, 1966, pp. 3536). as a young man in 1895 the russian artist later to be credited with introducing abstraction to european art, wassily kandinsky, saw one of monet 's series of paintings depicting sunlit haystacks in a moscow gallery. unable to recognize what the painting was of, he later recounted : and suddenly for the first time i saw a picture. that it was a haystack (or rather, a grain stack), the catalog informed me. and i noticed with surprise and confusion that the picture not only gripped me, but impressed itself ineradicably upon my memory. a similar experience is recounted in a passage from kandinsky 's reminiscences when he returned to his studio at dusk and was astonished to see an indescribably beautiful picture, pervaded by an inner glow standing against the wall (lindsay and vergo, 1982, pp. it was in fact one of his own rather impressionistic paintings turned on its side, the subject of which he had failed to recognize. he subsequently spent many years refining a visual language through which this insight could be expressed. among contemporary artists, gerhard richter is somewhat unusual in that he works in a number of quite distinct styles. he is particularly recognized for both his photo - like images, precisely rendered, and his generally larger abstract works, which he frequently produces by an almost chance - like act of scraping, leaving the final effect to the unpredictable interaction between paint and tools. but rather than being seen as either realistic, in the conventional sense, or abstract, in the sense of non - representational, richter 's work can be better understood as indeterminate in the way so far described here. what the artist is trying to produce is a sense of uncertainty, lack of fixedness, which draws the viewer in to try and resolve what they are seeing. richter himself is very explicit about this, saying : pictures which are interpretable, and which contain a meaning, are bad pictures. a good picture, on the other hand, demonstrates the endless multiplicity of aspects, it takes away our certainty, because it deprives a thing of its meaning and its name. it shows us the thing in all the manifold significance and infinite variety that preclude the emergence of any single meaning or view. in this exchange with the art critic robert storr he offers an insight into his own theory of indeterminate perception : i try to avoid something in the painting resembling a table or other things. it is terrible if it does because then all you can see is that object. so you allow for aspects or suggestions of images in the abstract work but not actual pictures i just wanted to reemphasize my claim that we are not able to see in any other way. we only find paintings interesting because we always search for something that looks familiar to us. i see something and in my head i compare it and try to find out what it relates to. and usually we do find those similarities and name them : table, blanket, and so on. when we do not find anything, we are frustrated and that keeps us excited and interested until we have to turn away because we are bored. i am just saying that you use paintings as a way of making it difficult for people to read the image. what is evident from this brief survey of visual indeterminacy in art is that artists who make hard to decipher images are doing so not just to be wilfully obscure or to confound their audiences. they are also acting rather like vision scientists by exploring how certain kinds of images engage the visual system and how we make sense of the world. moreover, by heightening our visual awareness, so certain artists believe, indeterminate images in their various forms can produce interesting, even revelatory, esthetic experiences. like the artists cited here, my initial interest in the phenomenon of visual indeterminacy was artistic. i became absorbed by the challenge of creating images, both still and moving, that could induce the same state of visual uncertainty in others that i had undergone myself when watching the cabinet of dr caligari sequence. i tried many methods of achieving this using film, video, collage, fractal image generation, and digital image manipulation. in each case i was trying to produce a picture of sufficient complexity to strongly suggest the presence of some object or scene yet at the same deny easy or immediate identification. i soon found the problem of trapping the human visual system in this way much harder than i had first anticipated. as i now realize is well known to vision scientists, the human visual system is extraordinarily effective at rapidly identifying objects in perception (thorpe., 1996 ; rousselet., 2002). even given the scantest of clues such as two dots and a curve we can interpret things, like faces, almost instantaneously. alternatively, if the information in an image is too noisy or distorted we simply categorize it as a meaningless abstract texture, and make no attempt to discern objects in it (see figure 5). uncertainty 4, paper on card, 29 cm 15 cm, 1992. the image on the left is a noisy texture that does not suggest any objects and so is effectively treated as abstract. the simple arrangement of two dots and a curve on the right show how readily we are able to recognize objects, even from the scantiest of clues. the problem of creating indeterminate images is how to avoid both these kinds of interpretation. the challenge in making artworks that are truly indeterminate, then, was to achieve a fine balance between recognizability and abstraction in order to excite the inquisitiveness of the viewer 's visual system while frustrating its capacity for recognition at the same time. after many years of experimentation i gradually developed a method of drawing, and then painting, which seemed to produce this effect quite reliably. i discovered that by using a classical pictorial architecture, of the kind frequently found in european paintings made between the 1500s and early 1900s, i could create an image that incited strong expectations of recognizable objects and scenes. (this classical period was the epoch in figurative art that many people associate with recognizable depiction of forms, in contrast to later modernism where artists turned increasingly to distortion and abstraction.) by using this overall pictorial structure but omitting, or otherwise manipulating those features of the image that would be readily recognized i was able to achieve a consistently indeterminate image. some examples of these paintings are shown in figures 6, 7, and 8. paralysis, oil on panel, 27 cm 33 cm, 2006. impulse, oil on canvas, 80 cm 70 cm, 2006. collection of the university of exeter. the flight, oil on paper, 30 cm 40 cm, 2007. the process of deciding what made a certain image successfully indeterminate in the terms described above was largely a matter of my personal judgment. i had to rely on my own reading of the image i was producing, and gage whether or not the forms in it were sufficiently evocative of objects or scenes, or whether they were too abstract or textural to incite the curiosity of the viewer. increasingly i sought the opinions of others by showing the paintings in galleries or the studio and asking viewers to describe the processes occurring in their own minds as they studied the works. after doing this many times their initial response was to think they were seeing a classical painting depicting a familiar theme, such as landscape, figure, or still life. but wherever they looked to find objects that would corroborate this initial response they failed to do so. they would fixate on an area in which they thought they saw a human limb or a piece of cloth, but would then realize that this was a false start, and would look for some other salient feature to pin their interpretation on. many reported they were looking at certain forms within the images and sifting through the possible interpretations in their mind, testing various options in order to successfully name what it was they were looking at. most people reported this experience in positive terms, as interesting, or visually exciting, although some did tell me the images were disturbing or made them feel anxious. this process of testing the indeterminacy effect of paintings on viewers was very useful as a way of confirming or refuting my own judgments about the way the images would be read. those paintings i felt were more effective also tended to be the same ones other people would report as having the strongest effect on them. but although useful in guiding my judgment, these viewer surveys were not carried out in any scientifically valid way. they were simply verbal reports elicited under a variety of conditions and recorded rather haphazardly. having had a longstanding interest in the science of perception and visual consciousness i wondered if scientific methods could be usefully applied to study the effect i was investigating in a more systematic way. i also became increasingly interested in what science might have to say about the phenomenon of visual indeterminacy, and what effects the process of looking at indeterminate images might be having on the vision systems and brains of those looking at them. as i started to look for scientific literature relating to visual indeterminacy it became clear this was a relatively lightly investigated area of perception compared, for example, to the related phenomenon of ambiguous or reversible images. ambiguous images, such as the necker cube, the duck rabbit illusion, or the boring vase, are distinguished by having alternating interpretations (the image is perceived either as a duck or a rabbit) each of which is quite determinate (kleinschmidt., 1998 ; meng and tong, 2004). also well known are the issues around perceptual organization and so - called hidden figures, exemplified in r. c. james famous photograph of a dalmatian dog in a dappled environment (gregory, 1970 ; palmer, 1999 ; ramachandran and hirstein, 1999). these, and other similar puzzle pictures, direct the viewer to search for objects that are concealed in some way within the structure of the image, and once found then not easily lost. an example is the image of a cow first presented by dallenbach (1951), a version of which is reproduced in figure 9. this is an image of a cow, although most people are unable to see it at first glance, or even after prolonged study. once seen, however it is very difficult to see the image as it appeared prior to the point of recognition. from american journal of psychology. copyright 1951 by the board of the university of illinois. used with permission of the author and the university of illinois press. when i first saw this photograph i remember having a good deal of difficulty in finding the cow, although once i did it was very hard to see it as anything else. the experience i had prior to the point of recognition was similar, as i recall, to that occurring during the cabinet of dr caligari sequence many years before. both were marked by a sense of struggle in which various alternative interpretations were tried out until the flash of recognition occurred. my interest in such images was less in the moment of recognition than the preceding process of object search, and what kinds of perceptual processes might be taking place during this time. the perceptual state of visual indeterminacy occurring prior to the moment of recognition bears similarities to the rare neurological disorder of associative visual agnosia. a notable case study of this condition, presented by humphreys and riddoch (1987), concerned a patient, john, who had suffered a stroke resulting in a bilateral lesion in the region supplied by the posterior cerebral artery. much of john 's capacity to see was spared, but his ability to recognize what he saw was greatly impaired. when shown a series of line drawings of everyday objects he was able to identify only a small proportion, and relied on working out what was depicted from specific clues within in the image, such as the curliness of a pig 's tail, rather than by seeing the object as a whole (p. 60). in arriving at their diagnosis of associative visual agnosia the authors ruled out other possible factors that could have contributed to john 's inability to recognize everyday objects, including any residual deficit in his stored knowledge or visual sensation. he showed no difficulty in recognizing objects by other means, such as touch, or describing them in detail from memory and was able to make quite accurate copies of drawings, albeit slowly. figure 10 is a drawing made by john (on the right) copied from the picture of the owl (on the left). the authors note that john could quite accurately copy line drawings of objects, even when he had no idea what the object was (p. 69). to demonstrate this they point out that john faithfully reproduced the gap on the right side of the original owl 's head, not seeing it as an omission in the original drawing. the drawing on the right is the copy made by john, the patient with visual agnosia, of the drawing on the left. the fact that john could make this copy showed that his capacity to see was in tact, although he had no idea what it was he was copying, john 's case suggests the normal processes of object recognition involve a number of operations that occur, to some extent, independently of each other but which can be broadly grouped into two layers (pp. the first set of processes organize the perceptual input data according to position and orientation, and bind multiple visual elements into wholes. a subsequent set of processes then match that input data to associations about function and meaning. the authors conclude : in general terms, (john 's) case supports the view that perceptual and recognition processes are separable in her extensive study of visual agnosia farah (2004) makes the same broad distinction between perceptual input and the conceptual associations involved in visual object recognition. while stressing the non - serial, multidirectional processes in vision, she summaries : visual form agnosia validates the distinction implicit in the labels early and intermediate vision, on the one hand, and high - level, object vision on the other, by showing the first set of processes can continue to function when the second set is all but obliterated. it shows us a kind of richly elaborated but formless visual stuff, from which things can be derived the phrase richly elaborated but formless visual stuff accurately describes the appearance of indeterminate images prior to the point of recognition. visual stuff to one 's stored memories and associations that seems to characterize the visually indeterminate state. for most of us this can occur occasionally, but for the unfortunate sufferers of visual agnosia it is a permanent condition. my hunch was that during the period where viewers are searching for meaning among the pictorial clues something is occurring in their cognitive processing which is different from that occurring during normal recognition. this seemed to be supported by some scientific studies looking at brain responses to unrecognizable versus recognizable images. (2005), for example, used eeg techniques to examine the changes in cortical networks within the time - window of the event - related potential component n400. they showed subjects sequences of recognizable and unrecognizable gray scale pictures, the latter matching the former as closely as possible in terms of size, complexity, and structure. the results showed a marked increase in cooperation in certain parts of the brain and a greater degree of overall coherence between different regions during the viewing of unrecognizable pictures as compared with recognizable ones. this, they concluded, reflected the greater demands made on the viewer 's perceptual and cognitive resources and consequent unease involved in the task of semantically matching the undecipherable stimuli : the greater number of coherence increases for meaningless object processing suggests enhanced recruitment of more distributed left and right areas during unsuccessful memory search this finding seemed to corroborate my own sense of unease when confronted with an unrecognizable image, and the sense of mental struggle involved in trying to resolve the conundrum. in another study that compared brain responses to recognizable and unrecognizable images, rainer. (2004) measured neural activity in the v4 area when exposing the monkeys to images that were increasingly degraded, from clear to abstract noise. the monkeys learned to recognize familiar images that were degraded compared to novel ones that were treated in the same way. the researchers found that monkeys exposed to indeterminate images showed significantly increased neural activity in both primary and higher cortical areas of the brain than when faced with familiar or recognizable stimuli. from this rainer and his team drew the conclusion that not only are particular loci in the brain recruited in response to indeterminate stimuli, but that the attempt to decipher such stimuli leads to enhanced overall coordination in brain activity : this suggests that v4 plays a key role in resolving indeterminate visual inputs by coordinated interaction between bottom - up and top - down processing streams it was while presenting a lecture on indeterminate art at the max planck institute for biological cybernetics at tbingen, at the invitation of gregor rainer, that i proposed a possible study in which the effects of looking at indeterminate paintings would be compared to paintings that looked similar but contained recognizable objects. to demonstrate this i showed a painting of my own next to a detail of michelangelo 's sistine chapel ceiling (figure 11). on the left is the painting succulus (oil on canvas, 123 cm 123 cm, 2005) and on the right a detail from michelangelo 's sistine chapel ceiling. both images have a similar visual structure and coloring, yet one is full of recognizable objects while the other is not. my painting had a similar visual structure and colors as the michelangelo, but omitted any clearly discernable objects, such as people or clothing. working on the basis of the intuitive hunch noted above, i proposed that comparing the brain activity of subjects exposed to these similar images might reveal some useful information about the processes involved in object recognition. it happened that in the audience were two scientists who offered, in different ways, to carry out tests using my paintings as stimuli, which led to several collaborative studies being undertaken on art and visual indeterminacy. working with the neuroscientist alumit ishai, and her team at the department of neuroradiology in the university of zrich, i created a set of stimuli that included a selection of my own paintings, all of them in the indeterminate classical style described above, and the same number of paintings made by other artists, which had a similar visual appearance but were full of recognizable objects. these included works by artists such as turner, tintoretto, rubens, michelangelo, and fuseli among others. these stimuli were divided equally into monochrome and color sets, and then presented in a number of behavioral experiments. subjects with no specialist art training were shown the stimuli in random order and asked to perform a number of tasks, including deciding whether each image contained familiar objects (a measure of object recognition) and how powerfully the images affected them (a measure of esthetic response). scientific details of the experiments and the results can be found in the published paper (ishai., 2007) but i 'd like to reflect here on some of the findings that i found surprising and interesting from an artistic point of view. one of the unexpected results concerned the extent to which subjects reported seeing familiar objects in my indeterminate paintings. given that i had striven so hard to remove any trace of recognizable objects, leaving only strong suggestions, it was interesting to discover that people were claiming to see things they recognized on average 24% of the time. (it was less surprising to me that the effect was stronger with the color images compared with the monochrome as i had always found it easier to create the effect of visual indeterminacy when making monochrome paintings ; it is noticeable how readily a pinkish hue will suggest flesh or a bluish hue sky.) as one might expect, subjects reported seeing familiar objects in the other artists work almost 100% of the time. it was also notable that the subjects gave almost identical scores for esthetic affect across all the paintings in the study, regardless of how recognizable they were. what this seems to indicate is that, in rating their esthetic response, the subjects were less influenced by the literal meaning of the images they saw than the immediate visual impact of the shapes, colors, and composition. this is despite the fact that previous studies have shown a tendency for non - art trained audiences to prefer pictures they can recognize more than abstract ones (healey and enns, 2002 ; vartanian and goel, 2004). in art historical terms the distinction between the meaning of an art work and its physical appearance has been understood in terms of content and form, and this distinction has given rise to prolonged and often impassioned debate among theorists of art and esthetics as to which aspect is the more significant in determining the effect of an artwork and, indeed, whether the two aspects can really be distinguished at all (bell, 1914). what this study suggested to me as an artist is that the distinction does have some validity given that the formal properties of the artworks seem to be a more significant factor in their degree of esthetic appreciation than meaning factors, at least over the short (4 s) viewing period used in the trials. the study also showed that subjects were significantly slower to make judgments about indeterminate paintings than they were about recognizable ones, whether they saw objects in them or not, which might suggest that the attempt to find objects in the indeterminate images requires a different kind or greater degree of underlying cognitive processing than when perceiving recognizable images. this seemed to corroborate the implications of the studies cited above, where viewing indeterminate images can lead to differential activity in certain areas of the brain. crucially, though, there was a significant correlation between the length of time taken to determine whether or not images contained objects and rating of esthetic effect, such that the longer it took to make a decision, the more powerful the image was thought to be. it is worth elaborating on the fact that the rating of esthetic effect employed in the study was slightly unusual. rather than using a rating of ugly to beautiful, on the basis that esthetic experience is synonymous with the appreciation of beauty, we used one of powerful affect on a scale of 14, with 4 being the most powerful. the reason was that, as even a cursory glance at art history will show, the esthetic impact of a work of art is not necessarily linked to how beautiful, pleasurable, harmonious, or pleasant it is. some of the most impressive art works can be quite ugly, disturbing, distorted, or dissonant. one thinks of goya 's saturn devouring his son (1823, prado, spain), picasso 's mother and child (1907, muse picasso, paris), or the chapman brother 's hell (19992000, saatchi collection, london). the use of the term powerful arguably more accurately captures the range of emotions felt by an audience in response to a work of art and is therefore more objective as a measure of affect than the more limited category of beauty alone. the fact that from this study it appears increased recognition latencies are associated with an increase in the powerfulness rating of the image indicates that the amount of struggle or effort needed to comprehend an image has some positive relationship to its esthetic value. this was also something i had intuitively suspected, based on my own esthetic experiences of indeterminate artworks and the fact that such images are so often revered in the canon of art. although firm deductions can not be drawn from this single study, it seems that the experiments described above, coupled with the subjective reports i gathered from viewers when making the works, give good reason to believe that something is happening in the case of viewing indeterminate art works that is not happening with immediately recognizable ones. i know my own experiences of seeing indeterminate images, whether art works or not, to be moments of great vividness and highly focused attention, where the habitual operations of recognition are fleetingly suspended as the mind struggles to resolve the components of the image into something meaningful. this is by no means a straightforwardly pleasurable experience ; it can sometimes be quite frustrating or disorienting, and not immediately rewarding. in esthetic terms, however, i regard the experience as being of great value, since for a few moments i am acutely aware of the visual form of the scene before me in a way i am not when the image is semantically determined. this, then, might be thought of as part of the heightened mode of perceptual experience associated with indeterminate images, and may help to explain why artists over the centuries have been so frequently drawn to making them. a follow - up study used neuroimaging techniques to look at the activity in subjects brains while viewing the same stimuli plus another set of artworks that were entirely abstract, that is, with no suggestion of objects at all (fairhall and ishai, 2008). the study was design to test the prediction that abstract, indeterminate, and recognizable images would produce a posterior - to - anterior gradient of activation along the ventral visual pathway, with stronger response to abstract compositions in inferior occipital gyrus ; stronger response to indeterminate paintings in intermediate regions in posterior fusiform gyrus ; and stronger response to representational paintings in anterior fusiform gyrus (p. 925). using a similar object recognition task as employed in the previous study, the behavioral data recorded in the scanner revealed an even stronger propensity for subjects to report seeing familiar objects in my indeterminate paintings (now 36% of the time). they even reported seeing familiar objects in the abstract paintings 18% of the time, even though these had been chosen specifically for their lack of object - suggestive content. as expected, there were almost no reports of objects being seen in the scrambled images. in neuroscientific terms, the results were able to partially confirm the hypothesis, and again i only want to comment here on some of the interesting implications the study had for me as an artist. it was gratifying for me to know, for example, that based on the data in this study at least there is a detectable indeterminacy effect produced in subjects when looking at my paintings. by comparing the level of activation between the scrambled paintings and my own there was a significant differentiation in certain brain areas (precuneus and medial frontal gyrus), which were described in the paper as the neural correlates of object indeterminacy. once again, subjects took longer to decide on the question of whether the images contained familiar objects or not in the indeterminate and abstract paintings compared to the recognizable ones, which suggests a more effortful process is going on when judging ambiguous or suggestive imagery. but i was slightly surprised that the effect of seeing indeterminate images on recordable brain activation was less pronounced than i had expected. in my naivety about the way the brain works, and what the scanning process is able to detect, i had anticipated a far stronger degree of differential activation during the exposure to indeterminate images as compared to recognizable ones than was found. but the study did confirm one of my other intuitively held beliefs about the way we perceive the visual world. part of my anxiety, or unease, during the moment of indeterminate perception in the cabinet of dr caligari sequence arose from the sense of compulsion i felt to make sense of what was in front of me. i have felt the same many times since when unexpectedly confronted with an indeterminate scene. the fact, confirmed in this study, that subjects reported seeing objects in images that did not contain them, even more so than in the one cited previously, is evidence of the involuntary impulse we have to turn the rich and complex visual data around us into meaningful things. as the paper concluded : our findings indicate that this seemingly effortless process (of recognition) occurs not only with familiar objects, but also with indeterminate stimuli that do not contain real objects. it therefore seems that the primate brain is a compulsory object viewer, namely that it automatically segments indeterminate visual input into coherent images. (p. 929) this helps to explain why indeterminate images can be so compelling. (2007a, b) at the max planck institute used the same indeterminate paintings employed in the previous studies, but this time subjected them to a range of psychophysical tests using eye - tracking and categorization tasks. the purpose was to look at the ways subjects would react to indeterminate stimuli, and also to see if there were any empirical grounds for verifying my own intentions in making my art. having worked so long to make successfully indeterminate paintings on the basis of intuition, guesswork, and the informally acquired reports of others, it was again fascinating for me as an artist to see what more rigorous and objective measures might reveal about, quite literally, how people looked at the work. in one set of behavioral experiments, my indeterminate paintings and the visually similar representational paintings were submitted to a range of tests looking at subjects responses to variations in size and orientation. they also undertook a categorization task where participants were asked to classify the images into one of seven genres, which were biblical scenes, landscapes with person, landscape without a person, portrait, still life, battle scene, and none of the above. in another experiment, participants were shown the sequence of indeterminate images and, in addition to the categorization task above, were also asked to identify whether or not the images contained people, during both of which their eye - tracking movements were recorded. again the scientific details can be consulted in the relevant papers, but two outcomes were of particular interest to me as the originator of the indeterminate stimuli. first, the analysis of the data produced by the experiments seemed to verify my intentions in making the indeterminate images. (2007a) proposed generally that visual information can be ordered along two parameter dimensions, namely images that score highly on the unique parameter are very distinct in meaning, whether they are abstract (as in the case of certain symbols or icons) or representational (as in the case of photographs or photorealistic paintings). images that are rated as being more ambiguous may be almost entirely non - representational (as in the case of certain abstract art) or have multiple meanings (as in the case of certain optical illusions or surrealist artworks). these two parameter dimensions also function on two distinct layers which normally operate together in visual perception : the perceptual layer, which broadly speaking is the same bottom - up or lower - level set of processes involved in organizing visual data described above in the section on visual agnosia, and the conceptual layer, which consists in the higher - level or top - down information retrieved from stored memories and associations (figure 12). 2007a) representing the abstract / representational and unique / ambiguous parameter dimensions existing of both perceptual and conceptual layers of vision. indeterminate images occupy the area between representational and abstract and between unique and ambiguous parameters, but tending toward the ambiguous end of the axis. as someone interested in the way we perceive images, this map of what the authors called the visual interpretation space is extremely useful as a way of organizing the different variables that can influence the way an image is read. on could imagine, for example, using it to visualize the whole history of recognizability visual art, and thereby track the shifting patterns of taste across the centuries. when this same parameterization was applied to my own paintings by the team it was expected that in order to fulfill my ambition to make works that were neither fully recognizable nor fully abstract they would need to be assessed as being located roughly in the center right of the graph, that is, avoiding the extremes of each parameter, but tending toward ambiguity. once the genre categorization tasks had been carried out the results showed that the images were indeed distributed around a region of indeterminacy at the center of the graph, with a bias toward to ambiguous end of the axis. for the experimenters, this data offered a perceptual validation of the artistic program behind the work. it was also interesting to note that, as with the previous studies cited, subjects reported a relatively high percentage (37%) of my images as being representational, despite the lack of any clear objects being depicted. the other interesting finding from these experiments from my perspective concerned the differences in eye movements the participants displayed when engaged in the person finding task as compared with the genre categorization task. what surprised me was the extent to which the fixation maps varied between the two tasks, even though subjects were looking at the same images. as has been known since the time of the early eye - tracking experiments by yarbus (1967) how one looks at a image is critically dependent on what is being looked for. while this is clearly well known to scientists it is not, as far as i am aware, something generally known to artists. yet is clearly a fundamental aspect of the way we apprehend the world, which presumably reflects the way expectation and meaning are mediated by the visual system in general and the brain in particular. it is interesting to consider, therefore, how directive clues in art, such as titles or hanging context, might affect the way audiences look at works of art. it also alerted me to how important the use of titles might be in my own work in leading the eye of the viewer as they try to interpret the image. the question of how titles affect the interpretations of paintings stimulated the final art science collaborative study i wish to mention (wiesmann and ishai, 2010). the study used a selection of cubist paintings made by the artists pablo picasso, georges braque, and juan gris in the period before first world war. cubist paintings of this period are characterized as being highly indeterminate in so far as they are directly observed depictions of everyday objects but represented in a fragmented and exploded manner that makes immediate identification very difficult. art experts, and others familiar with the genre, are able to read these cubist scenes and find within them the various forms and objects from which they are constructed. but those without this expertise tend to see only patterns, lines, and textures rather than distinct objects of any kind (golding, 1988). one part of the study looked at the extent to which descriptive titles presented alongside cubist paintings affected the viewer 's capacity to identify objects in the scene. crucially, however, half the subjects undergoing the task of detecting familiar objects received a short training session before the trial in which they were instructed on how to read cubist paintings and find objects in them. the study gathered both behavioral and fmri data, and again the scientific methods and results are available in the published paper. samples of the stimuli can be seen at : http://www.robertpepperell.com/cubism/index.html. what was surprising from my own perspective was the extent to which the trained subjects differed from the control group in terms of the number of objects recognized. despite the fact that the subjects were not art experts and received only a relatively brief training sessions (30 min) they were significantly better than the control group in recognizing familiar objects. the study also found that the role of the descriptive titles, which effectively declared what the paintings depicted, has little effect on the control group but a marked effect in helping the trained group to find more familiar objects. to me, as both an artist and art teacher, these results were somewhat counterintuitive inasmuch as : (a) i would have expected the process of learning to read cubist paintings to be something only acquired over many hours of study rather than the brief period of training undergone by these subjects, and (b) that meaningful titles would have had some positive effect on helping those with no training to find familiar objects more often than when looking at the same image only accompanied by the word the study also showed enhanced activation in the parahippocampal cortex of the trained subjects, the amplitude of which increased as a function of the number of objects recognized. this suggested that the subjects had used broader contextual associations to identify the objects in the paintings rather than the cognitive resources normally linked more specifically to object recognition. it is also tempting to wonder whether subjects thus trained in recognizing objects in cubist paintings are also then better at other object recognition tasks, and indeed whether learning to understand cubist art can actually improve cognitive performance in other areas ; it would certainly be good news for art lovers if that were the case. the various investigations i have undertaken with neuroscientists and psychophysicists have proved illuminating and rewarding from my artistic perspective. i initially set out to discover what science might be able to tell me about the specific issue of visual indeterminacy, and how people respond to my paintings. in doing so i have gained an enormous amount of insight into the way the visual system operates, how the brain functions, and indeed how science itself operates when investigating these phenomena. i have become aware of the great potential of the scientific method to elucidate processes that artists often work with intuitively but rarely grasp in any systematic way. but i have also seen at first hand the limitations of the scientific method when studying the experience of art, and have been reminded of the very different cultures that exist between art and science that make meaningful collaboration a sometimes demanding process. in the final section of this paper i want to briefly reflect on these issues and how future joint research between artists and scientists might benefit from these experiences. in the first place, it is important to acknowledge the inherent limitations of the scientific method when investigating the way we perceive art at least as they appear from an artist 's view. it often goes unremarked, for example, that most if not all lab - based studies of audience responses to art will use reproductions instead of real works of art. reproductions are not always of the highest quality, and can not be shown in a way that properly reflects the physical properties of the work itself. when preparing the images for the cubism study, for instance, it was necessary to conform all the images to the same scale and format due to the demands of the experimental procedure. this meant a lot of cropping and resizing, which resulted in the loss of size discrimination between large and small paintings. and there is the broader question of how valid it is to measure the effects artworks on the basis of reproductions at all. some empirical esthetics studies have shown significant differences in the judged hedonic or pleasure value of original artworks compared to reproductions (locher., 2001). certainly any serious scholar of art would make a point of examining the real work before arriving at any definitive evaluation of its esthetic impact. many qualities inherent in a work of art simply do not covert into photographic media, including scale, degree of surface gloss, texture of brushwork, or the way that certain colors can change depending on the angle of viewing (as is the case, for example, in many paintings by the abstract artist ad reinhardt). all these are crucial esthetic properties that artists work hard to control, and their absence or impoverishment in conventional photographic reproductions restricts what many lab - based studies can tell us about the experience of looking at them. then, of course, there are all the well - known problems associated with subjects being placed in fmri scanners, with the distracting noise and discomfort they create (cooke., 2007). something similar, but less intrusive, is true of eye - tracking devices that require the head to be locked in a stable position something that clearly would not happen in a natural gallery setting. while these limitations do not, in my view, diminish the value of such studies they should perhaps be more frequently acknowledged when discussing the implications of the results. another issue that those wishing to study the effects of art on the brain might want to consider is the risk of what might be called neuro - determinism, that is, the expectation that esthetic experience can be fully accounted for in terms of brain - centered processes. the neurobiologist and pioneer of the neuroesthetic approach to art science integration, zeki (1999, p. 217), said in his seminal book on the subject : my aim in writing this book has been really to convey my feeling that esthetic theories will only become intelligible and profound once based on the workings of the brain while he has been careful elsewhere to insist he is studying the neural correlates of experiences like beauty and not necessarily the causes (kawabata and zeki, 2004), there is a understandable temptation to assume that some of our most uniquely human experiences, such as art appreciation, might be explicable purely in terms of certain kinds of brain activity. these models, to varying degrees, deny or resist the idea that the brain is the sole location of mental properties such as beliefs, memories, and even the mind itself (no, 2005, 2009 ; clark, 2008 ; hurley, 2008 ; velmans, 2008). allied to this is the fact that many artists and art theorists, when discussing the matter, seem to intuitively support the idea that mental properties and esthetic experiences extend beyond the head and into the world (pepperell, 2011). the purpose of raising this issue here is to point out that certain basic assumptions about how esthetic experiences might be constituted can differ fundamentally between those making the art and those studying its biological effects. in order to achieve a fuller understanding of what the brain contributes to esthetic experience as a whole this leads to the final point, which concerns the need to recognize how great the disciplinary gulf still is between art and science, despite all the work done in recent times to bridge it. i have been attending science conferences now for over 10 years, and working closely with scientists on and off for about five. in that time i have rarely found members of the scientific community to be anything other than generous with their time and ideas, politely inquisitive about my proposals, and forgiving of my own naivety about their specialisms. even so, i am also constantly reminded of how different the basic conceptual categories can be between the arts and sciences, a cultural divide of the kind famously identified by snow (1993) in the middle of the last century and still largely in force today. the difference is in part, i believe, born from the need for scientists to be explicit, analytical, and logical in their working and reporting processes. quite often for artists the opposite is the case, their training and traditions having implanted in them a proclivity toward vagueness, synthesis, and irrationality. the cubist painter braque (1971) was fond of saying : art is meant to disturb ; science reassures. it was somewhat sobering for me to discover that the constraints on the experimental equipment used in the collaborative fmri study cited above required the subjects to express their esthetic appreciation for the artworks on a scale between 1 and 4. for those schooled in the infinite subtleties of artistic expression the idea that the merits of a great turner or rubens painting could be judged on such a crude scale and in as brief a moment as 3 or 4 s would border on the absurd. yet if we are to make any progress at all in understanding art using the empirical methods of scientific enquiry these are exactly the kinds of procedures we will have to adopt, at least until more sensitive techniques of investigation become available. just as i have had to modify my expectations about what empirical techniques are able to measure so i have been fortunate to find scientific collaborators willing to adjust their disciplinary spectacles in order to appreciate the relatively chaotic point of view of an artist. the result has been, from my point of view, a deeper understanding of what science can tell us about art, and what art can tell us about science. science collaborations work best when each discipline is enriched through the process, rather than one being parasitic on the other. there is always a risk that the compromises necessary to make progress are made at the expense of the essential values and outlooks of both approaches, which can only result in bad art and bad science. the challenge is how best to reconcile these distinct traditions without sacrificing the integrity of either. only by meeting this challenge will we be able to create a truly interdisciplinary approach to the study of problems as complex as the way we make and appreciate art. the author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. | in this article i will discuss the intersection between art and neuroscience from the perspective of a practicing artist. i have collaborated on several scientific studies into the effects of art on the brain and behavior, looking in particular at the phenomenon of visual indeterminacy. this is a perceptual state in which subjects fail to recognize objects from visual cues. i will look at the background to this phenomenon, and show how various artists have exploited its effect through the history of art. my own attempts to create indeterminate images will be discussed, including some of the technical problems i faced in trying to manipulate the viewer 's perceptual state through paintings. visual indeterminacy is not widely studied in neuroscience, although references to it can be found in the literature on visual agnosia and object recognition. i will briefly review some of this work and show how my attempts to understand the science behind visual indeterminacy led me to collaborate with psychophysicists and neuroscientists. after reviewing this work, i will discuss the conclusions i have drawn from its findings and consider the problem of how best to integrate neuroscientific methods with artistic knowledge to create truly interdisciplinary approach. |
a continuous hydrolipidic film, representing the actual interface between the epidermal viable layers and outer environment, covers human skin. skin surface lipids (ssls) are a mixture of sebaceous and epidermal lipids, displaying a very peculiar composition as compared to lipid fractions of serum or internal tissues. this peculiarity is originated by the unique contribution of sebum secreted from the sebaceous glands, unevenly distributed in all areas of the body with the exception of the palms and foot soles, and becoming extremely specialized in local districts, like the eye, where the meibomian glands exert highly efficient protective functions. ssl composition in the skin areas with the highest concentration of sebaceous glands (forehead, upper chest, and dorsum) mainly reflects sebaceous secretion, flowing from those sites also to areas with lower concentration, where the contribution of cellular lipid components, rich in oleic and linoleic acid, becomes more relevant [2, 3 ]. the keratinocyte membrane lipid contribution and the continuous metabolic action of resident microbial flora hosted at skin surface in healthy conditions are key determinants of the uniqueness of this complex mixture. major lipid components in human sebum include squalene (sq(2,6,10,15,19,23,-hexamethyl-2,6,10,14,18,22-tetracosahexaene), wax esters, and triglycerides. as a whole, the ssl fatty acids fraction is relatively poor in polyunsaturated fatty acids (pufas). typically, sebum is rich in long - chain fatty acids (up to 26 carbon atoms), linear or branched, mainly saturated or monounsaturated [4, 5 ]. these are partly present in the free form, secondary to the microbial and epithelial lipase activity on sebum triglycerides, and are responsible for antimycotic and antibacterial properties of the skin [57 ]. for the most part, these specialized fatty acids are esterified with cholesterol, or with fatty alcohols, to form the fraction of wax mono- and diesters, crucial for skin insulation [810 ], available uniquely on the skin and hair shaft. this fraction has been extensively investigated by analytical lipidomic approach in recent years, allowing, for example, the identification of more than 160 different wax esters ranging from 24 to 42 total carbons, and 73 species of ceramides, in the human proximal hair [11, 12 ]. a most peculiar component of ssl is sq, a key biosynthetic precursor of cholesterol. in humans, about 60 percent of dietary sq is absorbed, transported in serum by very low - density lipoproteins, and distributed ubiquitously in human tissues, with the greatest accumulation in the skin through sebocyte concentration. sq levels, being negligible in other organs, normally range about 12% of total ssl in adult life and can reach up to 20% [14, 15 ]. in the liver and in other tissues, this linear 30-carbon triterpenoid compound is entirely metabolised to sq 2,3-epoxide to be subsequently converted to lanosterol. sq overproduction in sebocytes may be due to altered expression and activity of two key oxygen - regulated enzymes involved in sq metabolism, squalene synthase, and squalene oxidocyclase, in response to the anaerobic environment occurring locally inside the sebaceous gland. this biochemical peculiarity bears important biological implications, in that the peroxidable sq molecule has been extensively proven to be a key mediator of skin reactions to environmental stressors. in defence towards oxidative events occurring on the skin, vitamin e of nutritional origin, actively secreted from sebaceous glands and probably cosecreted with sq and coenzyme q10 of endogenous origin and partly co - synthesized with sq by the sebaceous gland, provide necessary antioxidant protection to the skin lipid film. the cellular - derived component of skin surface lipids consists of phospholipids derived from the plasma membrane of corneocytes, also contributing as the unique component of ceramides characterizing cell envelope [7, 20 ]. lipids from keratinizing cells account for the rather limited contribution of polyunsaturated fatty acids, namely linoleic acid, available in the surface hydrophobic film. more deeply into the cornified envelope, ceramides and proteins concur to form the unique intercellular matrix determining most of the functions of the skin barrier. the overall composition of ssl differs therefore sensibly from lipids of the viable skin epithelial layers, and from systemic lipids, both in the relative percentage and type of lipid fractions, and in the relative amount of the pufa oxidable fraction. following the rather extensive studies on the composition and role of ssl started by the pioneer observations of nicolaides, the research on epidermal surface lipids and their prevalent sebaceous component has been thereafter almost entirely dropped, in favour of the studies on lipids of keratinocyte origin, thus unravelling the essential functions of ceramides in cell signalling and skin disease [23, 24 ]. nevertheless, the role of ssl in mediating the biologic effects of uv irradiation and other environmental stimuli / stressors has been at least partly identified, and, most importantly, alterations in sebum secretion have been recognised as a common feature of several inflammatory chronic skin diseases, finding their main localization in cutaneous areas where sebaceous glands are more concentrated. this is the case of acne [2628 ], atopic and seborrheic dermatitis, pityriasis versicolor [31, 32 ], and androgenic alopecia. sebum must in fact also be regarded as vehicle transporting and transmitting several endogenous and exogenous molecules to the skin, including potential regulatory factors of hair follicles. all the above - mentioned dermatoses are so far lacking satisfactory aetiopathogenic elucidation and consequently established and effective therapies. among the different categories of environmental stressors affecting the skin, uv irradiation is the field of most intense research targeting the increased risk of tumor development connected with overexposure and the effects on cutaneous pigmentation of medical / aesthetic concern. based on the capability of uv rays to penetrate at different depths in the epidermal and dermal layers, most of the studies have been so far focused on the photoreceptors localised in the skin viable compartments beneath corneum, such as dna, urocanic acid, and endogenous or bacterial porphyrins. these molecules are able to selectively absorb in the uv wavelenght range and thus catalyse oxidative cytostatic, cytotoxic, or imunomodulating photoreactions, widely employed for medical applications in skin phototherapy. indeed, the very first target of uv and other environmental radiations during natural, professional, or therapeutic exposure is represented by skin surface lipids. nevertheless, their possible role as mediators of cutaneous and systemic biological effects has been so far not adequately highlighted. the uv - r absorbance spectrum for ssl has been assessed spectrometrically, showing significant absorption, with a maximum at 215 nm. the hydrolipid layer present on forehead skin in healthy conditions is likely to reduce transmission at 300 nm by about 10%. apart from representing a first line of defence by direct uv absorption, ssl constitutes a suitable target and scavenger for all reactive species generated at skin level by different molecular mechanisms, in the course of uv irradiation. this indirect photo - oxidation is definitely the most relevant biological effect of uv on the ssl mantel and is the main mechanism operating in ultraviolet a- (uva-) and visible light - induced photodynamic stress induced on skin for therapeutical purposes. due to the scavenging action of ssl under atmospheric oxidative chemical stress, photoirradiation, or microbial oxidative metabolism, the hydrolipid superficial mantel becomes a relevant source of peroxidated intermediates on the skin, certain molecules of the resulting composition being clearly cytotoxic, irritant, or immunogenic. among cutaneous ssl components, it was previously demonstrated that when human sebum is subjected to high - dosage uvb irradiation in vitro, sq is markedly degraded as compared to cholesterol, sebum triglycerides, or mono-/diunsaturated free fatty acids (ffas) [43, 44 ]. uvr, alone or in combination with photosensitizers or other physicochemical stimuli including microbial peroxidizing metabolism, induces oxidative degradation of sq with the generation of a wide range of by - products of varying polarity and reactivity, that have been clearly characterised by ion mass spectrometry. these include sq monohydroperoxide, different isomers of squalene epoxide, and shorter chain reactive aldehydes, in particular formaldehyde and malonyl dialdehyde (mda) [4648 ] ] (figure 1). more recent studies have demonstrated that sq is oxidized at a much higher rate in physiological conditions by uva either than uvb, and that probably most previous results obtained with experimental uvb irradiation must be ascribed to the effects of minimal doses of uva, always contaminating uvb emission sources. following the initial studies concentrated on sq oxidation dynamic, conclusive works have indicated that the very first molecules undergoing oxidation in vivo under uv irradiation of skin are alpha - tocopherol and ubiquinol-10, both in sebum and viable keratinocyte membranes [17, 19, 5052 ]. these redox - cycling phenols have been undoubtedly recognised as the first targets of uv oxidation in both three - dimensional skin experimental models [50, 51 ] or cell - free sets of sebum ex vivo irradiation [53, 54 ]. only once these borderline lipophilic antioxidant defences of ssl are overcome, there occurs accelerated sq oxidation ; this leaves unchanged the remaining lipid fractions and protects other unsaturated lipids such as cholesterol and, most importantly, the minimal amount of pufa contributed by pure sebum, namely sebaleic acid (5,8-octadecadienoic acid). this special di - unsaturated fatty acid has been recently proven in vitro to be a feasible source of oxidized, biologically active chemoattractant and proinflammatory species, when metabolized by neutrophils and keratinocytes in the skin. in vivo instead, the protective effect of sq on pufa and the major physiological relevance of sq peroxides as compared to sebaleic acid oxometabolites were already indirectly proven by the early observations of morello., documenting the absence of significant sebaleic acid depletion in sebum of patients with severe acne, as compared to healthy controls. based on the elevated proneness of sq to photodecomposition, and the many biological effects of uv - induced sq peroxides it has been recently reproposed that these reactive by - products may be principal physiological molecular mediators of the biological effects of uv irradiation and other pro - oxidants targeting skin. as described above, the protective effects of sq are counterbalanced by the generation, by the same peroxidative mode, of low - molecular weight and relatively hydrosoluble reactive species [57, 58 ], chemically derived from the antioxidant action of the triterpene. these by - products are able to diffuse from the skin outer corneum mantel into viable layers and hence target keratinocyte plasma membrane pufa, thereby causing arachidonic acid decrease and a sequel of consequent biological effects, including the production of a cascade of lipid oxidation reactive nucleophiles, such as 4-hydroxy-2 nonenal (4-hne). sq peroxides display the typical bimodal biological behavior of reactive species, exerting in vitro a paradoxical effect on keratinocyte cells. at low concentrations and short times of incubation, they stimulate dna and protein synthesis, whilst inducing cellular damage and inhibiting mitotic activity at higher exposure times and dosages. sq peroxides also stimulate keratinocytes to release increased amounts of pro - inflammatory cytokines in vitro whereas they induce uv - like immunologic effects on the guinea pig ear model in vivo. topical application in concentrations likely produced under physiological uv irradiation of the skin is in fact able to suppress contact hypersensitivity to topically applied haptens like dinitrofluorobenzene (dnfb), as demonstrated by the reduction of lymphocyte infiltrate and the depletion of atpase positive immunocompetent cells. among ssl fractions, sq is the most efficient quencher of singlet oxygen, produced under uv irradiation of cutaneous photo - sensitizers or under conditions of phagocyte - driven oxidative burst at skin inflammation sites. sq peroxide by - products generated by this scavenging action are able to upregulate the release of pge and cytokines from keratinocytes, and through this mechanism they possibly activate melanocyte dendricity and stimulate melanin synthesis in the lower skin layers, as demonstrated on the guinea pig ear model. in this direction, sq peroxide effects on melanogenesis can in part explain also changes in skin pigmentation in vivo. taken together, all these results confirm earlier classification of sq as a sacrificial antioxidant, being extensively degraded under different types of peroxidant stimuli and very prone to photodecomposition. this way, this unique molecule is able to afford protection of human skin surface from further damage to the lipid mantel and to cellular peroxidable targets of the viable layers, induced by the exposure to uv and other sources of ionizing radiation, both natural and iatrogenic. in view of the many ascertained biological effects of uv - induced sq peroxides, it has been recently re - proposed that these reactive by - products may be principal physiological molecular mediators of the biological effects of uv irradiation and other pro - oxidants targeting skin [39, 62 ]. the recognition of sq as a principle target for oxidative stressors on the hydrolipid mantle has been acknowledged in the last decade also for applicative purposes, in that the quantification of sq oxidative rate, or of sq hydroperoxide formation, has become a commonly used method to test the protective / antioxidant efficacy of natural or artificial ingredients of formulations directed towards skin protection or sunscreening [48, 57, 61, 63 ]. in conclusion, though, from the biological point of view, the reason why sq molecule occurs in high concentration in human, ssl is still considered an enigma. on the basis of all described biochemical properties, it can be sensibly hypothesized that the natural deficiency of squalene oxido - cyclase activity in human sebaceous glands represents an evolutionary advantage, in that sq is capable of neutralizing reactive oxygen species induced by uv irradiation on the skin, thus behaving as an antioxidant and, indirectly (sq does not absorb in the uv range), as a natural sunscreen. the skin of monkeys, unlike that of humans, is covered by a large quantity of hair, protecting from uv rays. in the far less hairy human skin, the shield function is reasonably carried out by sq, in association with the physical defences of stratum corneum and melanin. in contrast to human sebum in fact, ssl of other hominidae contains higher levels of cholesterol, and surprisingly no sq at all. our group has performed a so far unique study on surface lipid composition in the primate superfamily, proving that sq is unique to human sebum, and completely missing in the main genera of non - human primates, including those closer to man, the hominoidea [65, 66 ]. human sebum also contains higher levels of triglycerides and their hydrolysis products and far lower levels of cholesterol. in addition, sq terpene typical of human sebum is also a principal surface lipid of different aquatic mammals, namely otter, beaver, kinkajou, and at least one species of mole [6770 ]. in these species, sq accounts for the essential properties of water repellence and thermal insulation. other nonaquatic mammals or birds have evolved different cutaneous fats, such as wax esters and wax di - esters, ensuring the same vital properties. the relevant distance of human sebum in composition and function from the nearest primates, and the close similarity with semiaquatic mammals, bears interesting evolutionary implications and may offer some support to the discussed hypothesis of the origin of man from some semi - aquatic hominids, feeding on fish. marine food, especially microalgae and seaweeds, as well edible seeds of plants dwelling in mangrovian habitats, like the genus amarantus, display in fact an unusual rich sq content. in the light of the so - called aquatic ape theory, that evidences features of convergence among different semi - aquatic species, such as proboscis monkeys, beavers, sea - otters, hippopotamuses, seals, sea lions, and walruses, these new biochemical data on human sebum squalene offer indeed new space for speculation. as previously mentioned, the epidermal surface hydrolipid layer can also be viewed as the growing medium for residential saprophytic microbial skin flora. the distribution and density of bacterial and yeast population at cutaneous surface is dependent on host age and on environmental factors such as sebum secretion, occlusion, temperature, and humidity [73, 74 ]. sebum produced in the pilo - sebaceous gland is composed purely of squalene, waxes, and triglycerides. once secreted, this rich medium is immediately colonized by various lipotrophic biologic agents, the development of which is controlled by several defensive humoral mechanisms and by the contact with ambient oxygen. bacterial / yeast lipase activity is the main responsible of ffa presence on the skin. oxygen and micro - organisms transform sebaceous moiety and hydrolyse triglycerides to ffa, with consequent relevant alterations of the ssl pattern in cases of pathological microbial colonization of the skin. this is the case of acne, where a role for propionibacterium infection is claimed among the main aetiopathogenic triggers. here, ffas metabolically generated by this lipophilic bacterium account for the chronic inflammatory reaction and the fibrogenetic action on infundibulum epithelium, thus sustaining comedones, pustules, and nodules formation. similar mechanisms have been claimed to explain at least partially the chronic inflammatory process characterizing atopic (ad) and seborrheic dermatitis (sd) [76, 77 ]. pityrosporum ovale is a lipophilic saprophyte belonging to the normal skin flora, mainly localizing in the horny layers, and in the upper tract of the sebaceous follicle. in the scalp, for instance, p. ovale constitutes up to 46% of the cutaneous flora in the healthy subject, while it may increase up to 82% in sd patients. the evidences of defective cell - mediated response to p. ovale and to candida albicans in sd patients, and the elevated incidence of sd in hiv and aids patients, support the hypothesis that a deficit of cell - mediated immunity may play an aetiological role in the disease. a long - lasting pro - inflammatory action of p. ovale is to be taken into account, the yeast being highly immunogenic, able to activate complement and to produce pro - inflammatory reactive oxidized metabolites of selected polyunsaturated ssl, including sq. alterations of ssl composition, along with oxidative by - products of ssl irradiation during antitumor puva or narrow - band uv - b phototherapy, induce similar immunologic impairment locally on skin. this causes an increased incidence of parasite skin colonization, like, for example, the infection caused by the demodex mite, an intrafollicular parasite feeding on sebum, and also frequently causing blepharitis. antimicrobials may reduce the density of the resident pathogenic or saprophytic skin flora, but they do not completely eliminate it. while antimicrobials may cause irritant and allergic contact dermatitis, no evidence exists that their use may change the ecology of resident bacteria on the skin, thereby leading to the overgrowth of pathogenic bacteria. as a consequence, antibiotic / antimycotic treatment is not the elective approach to most of these skin diseases. the antimicrobial function of ffa generated on sebum is an essential factor for the homeostasis of skin microbial colonies, and changes in sebum fatty acid composition are a main cause of microbial alterations on the pathological skin [81, 82 ]. in this respect, skin lipidomics are definitely expected to offer important diagnostic and therapeutic solutions in the near future. due to its high levels of unsaturation, sq in particular has been proposed as the precursor of highly toxic pro - inflammatory mediators, produced by bacterial or yeast lipoperoxidase activity. a further well - characterized example of an aetiologic involvement of ssl in skin pathology is offered by pityriasis versicolor, a pigmentation disease featured by large achromial spots occurring on skin areas with highest concentration of sebum lipids, where pityrosporum orbiculare finds optimal dwelling conditions. this skin saprophyte in some individuals becomes pathogenic, due to still unknown factors. in vitro cultures of p. orbiculare have documented a markedly increased peroxisomal lipid oxidation activity induced by the same unsaturated fatty acids present on the skin, namely linoleic acid, giving rise to hydrogen peroxide through a fenton mechanism and the subsequent generation of hydroxyl radicals. sq, which is not a substrate for lipoxygenase and is not metabolized by pityrosporum, may reasonably be peroxidized in vivo due to the metabolic activities of yeast peroxisomes. in yeast cultures supplemented with linoleic acid plus sq, a marked increase in lipoperoxide formation was observed, with the generation of the same toxic and unstable oxidation products (trans - trans farnesal and sq epoxides) formed under experimental high - dosage uv irradiation of sebum and also identified on skin in vivo. this equivalence substantiates the role of sq peroxides in the development of the clinical features of pityriasis, possibly accounting for melanotoxicity and cutaneous depigmentation. in this connection, the early demonstration that vitamin e supplementation suppresses the induction of peroxisomal beta - oxidation and catalase activity induced by linoleic acid offers promising clues for new treatment approaches all surface lipids examined so far play a role in the complex signaling network originating at the epidermal level, so that skin can no more be viewed as a specialized wrapping material protecting internal organs from environment and guaranteeing the main function of permeability barrier homeostasis, but more extensively as a complex organ actively communicating with the external world. as a consequence, thorough revision has been made of the traditional concept that only mere quantitative alterations of sebum, without any concern for sebum quality and composition, accounted for skin diseases associated with seborrhea or sebostasis. the multifaceted functions of the sebaceous gland are hence gaining momentum [25, 87 ], as the dysfunction of enzymes synthesizing or metabolizing ssl has been found in different disease states, along with altered sebum antioxidant levels. as widely discussed above, ssls are subjected to hydrolysis and oxidative processes, giving rise to biologically active by - products, which are critically modulated by local lipid soluble antioxidant levels, actively transported to the skin surface at the level of the pilosebaceous unit. indeed, ssl composition has been found significantly altered in amount and quality in different skin diseases as well as in the aged skin. in both atopic and seborrheic dermatitis, we and other authors reported a marked reduction of skin total surface lipids [29, 30 ]. it was shown that ssl of children and adults with atopic dermatitis present depleted levels of the lipid fractions of sebaceous origin, sq, and wax esters and correspondingly increased levels of free and esterified cholesterol. analogous alterations were found in seborrheic dermatitis, in hiv - negative and hiv - positive patients, these latter suffering from sd with increased frequency as compared to healthy population. these alterations of ssl composition, summarized in table 2, were associated with significant systemic depletion of the main lipophilic antioxidant levels and detoxifying enzymatic activities, mainly vitamin e, ubiquinol-10, and erythrocyte glutathione peroxidase [88, 89 ]. in the acne pathogenic process, sq peroxides most likely play a role, in that sq monohydroperoxide has been proven to be highly comedogenic when topically applied on skin in the animal model. sebum sq fraction was found increased by 2.2-fold in a group of patients affected with moderate to severe acne, as compared to controls, reaching 20% of the total sebaceous lipids. the ssls undergo important qualitative and quantitative modifications due to photo - aging, where sq peroxides seem again to play a major role, mimicking the effects of chronic uv irradiation when applied experimentally on the skin [93, 94 ]. ssl may hence represent a very efficient marker of the sun - protecting efficacy of chemical sunscreens. experimental uv irradiation of a series of commercial chemical filters in the presence of sq in physiological concentrations led to the conclusion that all most common uv filters protect sq from uvb - driven oxidation at different extents (benzophenone-3 > octylsalicylate > parsol mcx > parsol5000 > octyldimethyl p - hydroxybenzoic acid (paba) > parsol 1789), depending on filter dose and irradiation energy. conversely, upon uva irradiation, filters like parsol 1789 and 5000 and octyl - dimethyl paba exerted a marked pro - oxidant effect, enhancing sq peroxides formation possibly through the action of their self - decomposition by - products induced by uva, deserving careful attention for safety concerns [64, 95 ]. the external lipid film hence represents a reliable in vivo marker of skin disease, easy to monitor through noninvasive analytical techniques [30, 96 ]. being the first target of environmental stressors, ssls also represent a suitable research tool for in vitro screening, to study drug delivery through skin, as well as in vitro assessment of the chemical reactions of jewellery, textiles, cosmetics, drugs, industrial chemicals, and particles in direct and prolonged contact with human skin. to provide meaningful results, the composition of artificial ssl should accurately mimic human sweat and sebum, and the conditions of the in vitro test system should accurately reflect in vivo skin conditions. the wealth of results obtained employing artificial sebum formulations is characterized by the poor physiological value of most models, lacking essential components and presenting unrealistic percent ratios of the single molecules. variables like sweat composition, ph, temperature, and so forth need careful standardization, in order to guarantee reliability of the in vitro test system. the combination of tridimensional skin tissue models with ssl formulations bears promising results for in vitro applications, providing both corneum and sebum components to the skin barrier functional model. in view of the physiological relevance of the surface lipid composition for an optimal performance of the skin organ, the modulation of skin surface lipids composition may represent a powerful approach to enhance skin photo - protection, to prevent skin ageing, and to control microbial symbiotic and pathogenic colonization and consequent skin diseases. this goal is attempted traditionally through local application of lipid and/or lipophilic antioxidant - enriched cosmeceutical formulations, with immediate beneficial effects, albeit in most cases not durable after treatment discontinuation. the possibility to control ssl composition and skin function in general by diet or nutriceutical intervention is far more intriguing and promising a perspective. the administration of skin - tropic lipid - based oral supplements has been claimed to be effective, though available reports are sparse [98, 99 ]. the analysis of the existing literature brings to the conclusion that nutritional factors provide benefits to skin physiology, but information on the effects of low - to - moderate doses of nutrients consumed in the long term by healthy individuals is lacking, as well as are the data on the direct effects on basal skin properties, including hydration, sebum production, and elasticity, up - to - date scant, and often contradictory. the largest part of information refers to pufa administration as a treatment for scaly skin, the observation that the formation of pufa oxidation products on the skin can be suppressed by linoleic acid supplementation through vegetable oil sources demonstrates that skin lipid film can be modulated through the diet more efficiently that through topical application. a low - glycaemic diet regimen also proved effective in the normalization of sebum production and composition in acne patients, confirming the feasibility of the control of disease concurrent factors influencing sebaceous gland physiology through the systemic approach. reported no significant alteration of ssl after a daily oral dosage 200 mg of coq10 for 10 days. oral supplementation of sq to mice resulted in a marked dose - dependent upregulation of cellular and nonspecific immune functions. in healthy volunteers, low- or high - dosage (13 or 27 g daily) sq per os, per 90 days resulted in significant improvement of antiaging effects on photoaged skin, with facial wrinkle decrease, as confirmed by molecular markers of uv - induced skin damage. facial erythema decrease and pigmentation increase were observed though high dose oral administration of fat induced some side effects. data discussed so far allow us to consider skin surface lipids, and in particular its polyunsaturated component squalene, as a main target for pro - oxidant agents on the skin. sq peroxides generated locally upon natural or therapeutic uv irradiation are mediators of the immunological response and the melanogenic process in the skin. the ssls represent suitable markers for the diagnosis of skin disease or aging, and for treatment efficacy monitoring, provided that the results are combined with the analysis of the strictly interconnected systemic biomarkers of oxidative damage and antioxidant defences. | skin surface lipid (ssl) film is a mixture of sebum and keratinocyte membrane lipids, protecting skin from environment. its composition is unique for the high percentage of long chain fatty acids, and of the polyterpenoid squalene, absent in other human tissues, and in non - human primates sebum. here, the still incomplete body of information on ssl as mediators of external chemical, physical, and microbial signals and stressors is revised, focusing on the central event of the continuous oxidative modification induced by the metabolic activity of residential and pathological microbial flora, natural or iatrogenic uv irradiation, exposure to chemicals and cosmetics. once alpha - tocopherol and ubiquinol-10 antioxidant defences of ssl are overcome, oxidation of squalene and cholesterol gives rise to reactive by - products penetrating deeper into skin layers, to mediate local defensive inflammatory, photo - protective, immune reactions or, at higher concentrations, inducing local but also systemic immune depression, ultimately implicating skin cancerogenesis. qualitative modifications of ssl represent a pathogenetic sign of diagnostic value in dermatological disorders involving altered sebum production, like pytiriasis versicolor, acne, atopic or seborrheic dermatitis, as well as photo - aging. achievements of nutriceutical interventions aimed at restoring normal ssl composition and homeostasis are discussed, as feasible therapeutic goals and major means of photo - protection. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.