Datasets:

danieladeeko
/

proccessed_ccdv

Dataset card Data Studio Files Files and versions Community

Split (3)

train · 120k rows

article stringlengths 0 682k	abstract stringlengths 146 3.69k
schwannoma is a benign nerve sheath tumor that most commonly occurs solitary in otherwise normal individuals. occasionally it presents with multiple form involving several areas along the peripheral nervous system, including cranial nerves, spinal nerve roots, the brachial and lumbosacral plexuses, or major peripheral nerves (1, 2). patients can be definitely diagnosed with schwannomatosis if they have had two or more pathologically proven schwannomas and without radiographic evidence of a vestibular nerve tumor at age greater than 18 yr (3). if radiologic examination such as brain magnetic resonance imaging (mri) is not available, then a probable diagnosis may be made if the patient has two or more pathologically proven schwannomas and no clinical symptoms of eighth nerve dysfunction at age greater than 30 yr or two or more schwannomas in an anatomically limited distribution without clinical finding of eighth nerve dysfunction at any age (3). several recent reports have suggested that some patients have schwannomatosis without any other associated stigmata of neurofibromatosis (nf) and that may also be a distinct clinical entity (4, 5). a 21-yr - old woman was hospitalized for evaluation of an incidentally found mediastinal mass on routine check. physical examination revealed palpable soft tissue masses on the right posterior neck and right ankle. those soft tissue masses had been found about four years previously and tumor aspiration had revealed findings of benign soft tissue tumor. her chromosomal analysis showed normal structural variation of chromosome 9 (44,xx, inv(9)(p11q12)) without evidence of chromosomal abnormality. 1a) and another smaller one between the right quadratus lumborum and the psoas muscle at the level of the second lumbar vertebra (fig. contrast - enhanced chest ct scan showed well - defined soft tissue mass in subcutaneous tissue of the right posterior neck and also an enhancing mass in the mediastinum right lateral to the heart (fig. mri of the ankle showed an enhancing mass below the right medial malleolus (fig. excisional biopsy for the soft tissue masses in right carotid space and right ankle was done and en bloc resection of the mediastinal mass was performed. all the round to ovoid tumors were located within the nerves and invested with epineurial tissue. all surgically removed tumor specimens proved to be schwannomas with areas of antoni a and b (fig. the term schwannomatosis or neurilemmomatosis has been used to describe patients with multiple nonvestibular schwannomas with no other stigmatas of nf-2 (6). bilateral vestibular schwannomas are the classic hallmark of nf-2, with multiple schwannomas on cranial, spinal, and peripheral nerves and intracranial and intraspinal meningiomas and intramedullary ependymomas (7). several recent reports have suggested that some patients may develop multiple schwannomas without any associated nf-1 or nf-2 stigma (8). an exact delineation between schwannomatosis and nf-2 has not been made, and an identical genetic background has been suggested. honda. (9) indicated that germline mutations in the nf-2 gene were the molecular mechanism of schwannomatosis, which in this sense would represent an incomplete form of nf-2. maccollin. (7) considered schwannomatosis to be a distinct clinical entity separate form nf-2. some case reports of patients with multiple schwannomas without clear anatomic localization were reported before the national institute of health consensus statement and include patients who would now be classified as having nf-2 (10). patients with highly localized disease may harbor so - called " segmental " mutation of the nf-2 gene or other schwannoma - related genes (7). alternatively, they may have suffered a single early transforming event with local noncontiguous spread of tumors such as that postulated for patients with multiple meningiomas without family history. those persons with more generalized disease may carry a tumor suppressor gene syndrome, as their phenotype is similar to more common tumor suppressor syndromes (11). multiple schwannomas in a child is a difficult clinical problem because the appearance of peripheral schwannoma may precede that of vestibular schwannoma in patients known to have nf-2 (7). some differences have become apparent between schwannomatosis and neurofibromatosis with respect to their clinical manifestations. this age corresponds to that for most patients with sporadic schwannomas, but contrasts with the earlier age of less than 20 yr for patients with nf-2. as for our patient, she was detected without symptom incidentally after 20 yr of age. the second difference with neurofibromatosis additionally, the genetic mechanism of schwannomatosis differs from that of nf-2 (12). there is no evidence of germline mutations on direct sequence of the nf-2 gene among schwannomatosis patients. radiologic features of tumors in schwannomatosis are the same with those of schwannoma, except multiplicity on different anatomical locations. small tumors usually show uniform enhancement, while larger lesions may have a heterogeneous pattern. on mr imaging, schwannomas are slightly hypointense or isointense on t1-weighted image, and show increased signal intensity on t2-weighted image. most schwannomas show intense homogeneous enhancement following contrast administration. to summarize, of patients presenting with schwannoma, 3 to 4% are found to have multiple lesions (8). the diagnosis of schwannomatosis seems justified for adult patients presenting with two or more schwannomas in different anatomical locations who show no clinical or radiological signs of a vestibular nerve tumor and no meningiomas, ependymomas, or any other signs of nf-2. we demonstrate that this rare case of schwannomatosis in a 21-yr - old woman with no associated with nf-1 or nf-2, discontinuously involving peripheral nerves of the right side body.	schwannomatosis or neurilemmomatosis has been used to describe patients with multiple nonvestibular schwannomas with no other stigmata of neurofibromatosis type-2 (nf-2). in our case, schwannomatosis, multiple schwannomas were present in a 21-yr - old woman with no stigmata or family history of nf-1 or nf-2. she had no evidence of vestibular schwannoma or other intracranial tumors. multiple peripheral tumors were found in the carotid space of the neck, and soft tissue of posterior shoulder, lower back, ankle and middle mediastinum. all of those tumors were completely limited to the right side of the body. all surgically removed tumor specimens in this patient proved to be schwannomas.
rna interference (rnai) has opened new avenues for the systematic analysis of phenotypes. with the completion of many whole genome sequences, rnai allows the depletion of gene products in a wide range of organisms, thus enabling reverse genetic approaches where genetic tools are lacking. the molecular mechanism of rnai - mediated gene silencing is conserved from plants to higher animals and studies in many organisms have benefited tremendously from the availability of rnai libraries. compared to classical genetic screens, rnai has the advantage to provide a link from phenotype to gene without the need for positional cloning of mutant alleles, but it lacks the possibility to make stable mutations and may display non - specific off - target effects. depending on the experimental system, rnai approaches are amenable for high - throughput screening, thereby allowing complete genomes to be queried for specific phenotypes. screens can be performed for whole organism phenotypes, which has been done in caenorhabditis elegans (1,2). cell - based rnai experiments have become widely used in particular in drosophila and to a smaller extent in vertebrates, organisms for which many cell lines are available (36). cell - based phenotypes can be measured using simple fluorescent or luminescence reporters or more complex phenotypes as can be detected by immunofluorescence and microscopy (7). however each phenotypic readout method has its specific analysis method and a generally accepted ontology for phenotypes is still missing. in the past few years different rnai libraries have been constructed that cover large parts of many genomes. for invertebrates, such as c.elegans and drosophila, libraries can be produced relatively cheaply, since long double - stranded rnas (dsrnas) can be generated by in vitro transcription. in addition, use of dsrna in these organisms does not elicit an interferon response (8,9). expression of dsrna in bacteria that are fed to c.elegans is sufficient to produce an efficient knock - down of target transcripts (9). in drosophila cells, simple addition of long dsrna to the cell culture medium is sufficient for cells to take up the dsrnas and intracellularly dice them in many different 2123 bp sirnas (8). the efficiency of rnai in invertebrates is likely due to the diversity of sirna species that are intracellularly produced. drosophila cell - based assays are widely used since the genome is well - annotated and many cellular pathways are conserved from flies to man (10,11). for example, depleting dsh by rnai is sufficient to fully recapitulate a wg loss - of - function phenotype, whereas it is necessary to deplete all three homologs (dvl13) in human cells to observe a wnt phenotype (d. ingelfinger and m. boutros, unpublished data). such examples occur in many cellular pathways and it might be necessary in mammalian cells to pool rnai reagents for multiple candidates to generate a loss - of - function phenotype. while this is technically possible, it will significantly increase the complexity of screens. more than 20 genome - wide (or genome - scale) screens in drosophila cells have been published since 2003 and a key challenge remains to integrate and compare different datasets. since many screens have been performed using different rnai libraries and readouts, a proper annotation using minimal information for rnai experiments would be required. the equivalent of a miame convention is currently lacking and the breadth and quality of data provided for screens varies. as large - scale studies remain largely untested in follow - up experiments for a certain period of time, it is crucial to systematically integrate phenotypes and annotation information to estimate false positive and false negative rates. a comparison across multiple screens can also be used to evaluate the reliability of a phenotype or a particular rnai reagent used in these studies. ultimately, phenotypic profiles of many screens can serve to cluster unknown genes and provide guideposts for follow - up analysis (12). since most cell - based rnai screens have been published using drosophila rnai libraries, these screens can serve as a model for the organization of data produced in large - scale rnai experiments. here we describe a publicly accessible database to integrate annotation of rnai reagents and functional information obtained from large - scale rnai experiments. the database allows the user to access phenotype data from published screens and the sequences of their underlying perturbation reagents. specificity and other sequence features are displayed in the context of the genomic location of the targeted gene model. genomernai also facilitates the design of new experiments, using previously designed rnai reagents from independent libraries and links to a design program of rnai constructs for independent retests (13). the database structure is flexible and allows adding large - scale cell - based phenotypic datasets from other organisms once they become available. the database integrates the sequence information of the rnai reagents with phenotypic information based on genome - scale and genome - wide published rnai screens. these include libraries used in heidelberg and boston (4,14), by groups in san francisco and others (15). using the sequence information, all rnai constructs were computationally mapped onto the latest genomic sequence using blast and mummer (16,17) and gene and isoform annotations were derived through the mapping process. all probe information is visualized using an implementation of the generic genome browser (gbrowse) (18). additional information was added to describe the specificity of dsrnas. to this end, we have generated all possible 19mer sequences of annotated gene models (in total > 40 mio.) and identified homologous sequences in the complete genome. these are annotated as tracks in gbrowse and allow evaluation of the specificity of rnai probe sequences. in addition, gbrowse tracks are included that show other types of non - specific regions, such as low complexity and repetitive elements in the gene model which should be avoided in the design of rnai probes. phenotypes mapping to such elements should also be treated with caution until further confirmatory data is available. furthermore, for every single 19mer sequence we have calculated an rnai efficiency score (19) which is shown as a the average predicted efficiency is shown for individual rnai probes from various libraries as well as a track for complete gene models in the gbrowse interface. specificity and efficiency information can also be used to guide the design of new rnai probes for follow - up experiments. rnai phenotypes of large - scale screens from our own lab and all to - date published screens were curated from the author 's websites or the supplementary data. to date, the database contains 24 genome - scale screens which were performed with different genome - wide and subset rnai libraries. a total of 5436 phenotypes are currently stored in genomernai, which will be expanded as more data becomes available. individual gene entries can be directly accessed via a linkout (heidelberg rnai) from flybase (20). from the entry webpage of the database, user can search by gene identifier, by rnai probe i d (if known) or by phenotype (figure 1). for all these search options more detailed web pages are available which offer advanced input options (e.g. sequence homology search). through the phenotype entry page a complete list of all phenotypes this can then be used to access an individual gene or probe list. a second way to search for phenotypes and probe menu page, the user can enter a drosophila (or heterologous) nucleotide or protein sequence which is mapped by using blast against the bdgp transcript file or probe files. this allows for example to search for phenotypes of a homolog of human cdc2 or can be used to find all rnai probes from various libraries that overlap with a query sequence. this page allows direct access to search function by gene, rnai i d or phenotype. more detailed search pages which allow for example to search by sequence homology can be accessed via the main menu. information with respect to genes or rnai probes is subsequently retrieved from the database. in case of gene query, the database retrieves all mapped rnai probes and displays them as a table (figure 2a), including information of phenotypes that were reported, the calculated target transcripts and whether all isoforms are targeted (columns transcripts and specificity). this view shows also how many in silico diced sirnas map to gene model and whether additional transcripts are targeted (column other targets) by the dsrna. the database allows then to drill down and retrieve more detailed information, including primer and amplicon sequences (figure 2b) by following the rnai probe link as well as more detailed information on other targets by following the corresponding link. the completeness of available rnai constructs in their genomic context is summarized in an interactive gbrowse implementation, which shows the gene model, the rnai probes of all available libraries and tracks that allow evaluating the efficiency and specificity of probe sequences (figure 2c). other gbrowse functions can then be used to extract for example non - targeted regions, common exons, regions with high specificity or regions of low - complexity. (a) the table shows the search results from a user query for all probes targeting the cg6210 transcripts. specificity column summarizes how many of the theoretical possible diced 21mer sequences hit the transcript. (b) drill down to access sequence information associated with a particular rnai probe. (c) gbrowse image of all rnai probes that target a particular gene model. if rnai probes target other genes in addition to the intended one, this information is displayed below the rnai probes [e.g. fbgn0036141 (cg6210) + 24 other targets ]. an example of a database session is shown in figure 2. in this case, the user searched for rnai probes that target cg6210 (fbgn0036141), a factor required for the secretion of wg / wnt ligands (3). figure 2a shows that multiple rnai probes are available in different libraries and also links to flybase, if more information on cg6210 is requested. when the user selects the hfa10605 rnai probe, the database shows more detailed information, such as primer sequences used to amplify a template for in vitro transcription, the length and sequence of the amplicon. this page also shows all other phenotypes that were observed with this rnai probe, allowing evaluation of the specificity of the rnai experiment. when selecting the gbrowse image, the user can locate other rnai probes in relation to the gene model ; for example, whereas for cg6210 six dsrnas from different libraries have a similar location, a single dsrna (amc - amplicon) targets only one splice variant (cg6210-ra) and might give only a partial phenotype. these assignments are even more complex for gene models that have a larger number of splice variants and/or overlapping transcripts. the database can also be accessed through searching for phenotypes or selecting from an all phenotypes list which can be retrieved from phenotype search menu. through these pages, the database provides gene annotation by comparing phenotypes in the light of the sequence content of probes targeting the gene of interest. furthermore, individual gene models are linked to external databases such as flybase and flight for other functional information. a link to e - rnai (13) is provided to allow a direct redesign of independent rnai probes. the genomernai database presents phenotype information of large - scale screens in the context of associated sequence information. we believe that this is an important issue since in contrast to genetic mutants, rnai phenotypes depend on the specificity of the used sirnas or dsrnas (2123). furthermore, with changes in gene models, rnai phenotypes attributed to a specific gene may be linked to a different gene in the future. rnai libraries evolve, as we learn more about the rnai mechanism and potential pitfalls such as off - target effects second generation libraries will incorporate these findings into design rules and attempt to generate more specific reagents and make them publicly available (t. horn, a. kiger, m. boutros, unpublished data). the genomernai database is linked to other databases, such as flight and flyrnai (24,25). while all these databases contain rnai phenotype information, the focus of genomernai is to present phenotypes in the context of genomic information, which should facilitate the analysis of rnai phenotypes with respect to gene models and specificity information. genomernai has an integrated pipeline for mapping of rnai probes and phenotypes and integrating the information of different rnai libraries, but the focus is less on the integration of different genomic datasets as provided by flight. a major issue in representing rnai phenotypes remains a lack of standards on minimal information which need to be provided for small and large - scale screening approaches, as well as an ontology to properly describe cellular phenotypes. with time we expect that the community will develop such standards which will become a prerequisite for publication. the same holds true for the analysis of numerical data associated with phenotypic information, which can be analyzed in different ways and which may lead to different phenotype lists depending on the arbitrary threshold that is being used as a cut - off. compendia that include both primary data and the analysis route could alleviate analysis diversity and enable the re - analysis of datasets when new algorithms will be available or datasets will be cross - correlated (26,27). in the future, we plan to add cell - based phenotypes from other species, such as human, including sequence information which is currently largely not available due to proprietary restrictions. cross - specific comparisons should provide a useful means to extract functional and highly confirmed phenotypes.	rna interference (rnai) has emerged as a powerful tool to generate loss - of - function phenotypes in a variety of organisms. combined with the sequence information of almost completely annotated genomes, rnai technologies have opened new avenues to conduct systematic genetic screens for every annotated gene in the genome. as increasing large datasets of rnai - induced phenotypes become available, an important challenge remains the systematic integration and annotation of functional information. genome - wide rnai screens have been performed both in caenorhabditis elegans and drosophila for a variety of phenotypes and several rnai libraries have become available to assess phenotypes for almost every gene in the genome. these screens were performed using different types of assays from visible phenotypes to focused transcriptional readouts and provide a rich data source for functional annotation across different species. the genomernai database provides access to published rnai phenotypes obtained from cell - based screens and maps them to their genomic locus, including possible non - specific regions. the database also gives access to sequence information of rnai probes used in various screens. it can be searched by phenotype, by gene, by rnai probe or by sequence and is accessible at
it has been reported that the lack of insight is prevalent among patients with schizophrenia and that impaired insight is significantly associated with medication noncompliance, frequent relapse, and poor prognosis.15 insight in mental illness is generally a multidimensional concept that includes the following aspects : 1) awareness of the mental disorder, 2) understanding of the social consequences of the disorder, 3) awareness of the need for treatment, 4) awareness of specific signs and symptoms, and 5) the attribution of symptoms to the disorder.13,6 for patients with schizophrenia and related psychotic disorders, however, there has been a crucial extension to the concept of insight : it has been suggested that the cognitive processes involved in patients re - evaluation of their anomalous experiences and of their misinterpretations should be incorporated into this concept.7 the beck cognitive insight scale (bcis) has been developed and utilized to evaluate patients self - reflectiveness and overconfidence in the interpretations of their experiences.7 the bcis assesses patients reports of their objectivity regarding their current anomalous thoughts, their perspective about previous errors, their capacity for reattribution of erroneous explanations, and their receptiveness to corrective information from other people.7,8 previous studies have shown that cognitive insight is significantly disrupted in patients with schizophrenia compared with those with nonpsychotic disorders, such as mood disorders.7,9 this reflects the metacognitive deficits inherent in schizophrenia.10 a recent factor analytic study has found that the bcis score loads with metacognitive awareness in patients with schizophrenia or schizoaffective disorder, indicating that cognitive insight is associated with the ability to form complex images of oneself and others, a synthetic form of metacognition.11 there have been reports on the clinical correlates of cognitive insight in schizophrenia. the disruption of cognitive insight has been linked to delusions,7,12,13 hallucinations,12 negative symptoms,1416 and depressive / anxiety symptoms,17,18 although not all studies observed such associations,16,19,20 and some inconsistencies have arisen. only a few studies, in contrast, have examined the association between cognitive insight and functional outcome measures. metacognitive deficit was found to be associated with impaired coping,10 and a low level of cognitive insight was related to poor social functioning19 and to lower global assessment of functioning scores.21 at present, however, the relationship between cognitive insight and subjective quality of life has not been explored. moreover, the results of previous studies regarding the relationship between clinical, but not cognitive, insight and the subjective quality of life or well - being have been inconclusive.22,23 there have been suggestions that patients with better insight experience more severe depressive symptoms and may realize their restrictions more clearly, which decreases their subjective quality of life and overall sense of satisfaction.2226 considering previous reports that patients with high cognitive insight were more depressed and had received psy - choeducation more often27 and that the increased awareness of self - perceived limitations may also lead to hopelessness,28 it can therefore be hypothesized that a higher level of cognitive insight, or self - reflectiveness, may be associated with more severe emotional distress and a lower subjective quality of life. hence, in the present study, we investigated the relationship between cognitive insight and subjective quality of life in stable outpatients with schizophrenia to further shed light on the nature of cognitive insight and its functional correlates in schizophrenia. the study protocol was approved by the institutional review board of the gachon university gil medical center, and all procedures used in the study were conducted in accordance with international ethical standards, declaration of helsinki. the criteria for patient recruitment were the following : (i) a diagnosis of schizophrenia by the diagnostic and statistical manual of mental disorders, 4th edition,29 which was established using the structured clinical interview for diagnostic and statistical manual of mental disorders, 4th edition;30 (ii) age between 20 and 50 years ; (iii) outpatients on at least 4 weeks of maintenance therapy with atypical antipsy - chotics without changes in the dosage of medications over the same period ; and (iv) be able to be rated reliably on psychiatric rating scales. patients were excluded if they (i) met diagnostic criteria for a psychiatric diagnosis other than schizophrenia, (ii) had a concurrent diagnosis of substance abuse or dependence, (iii) had a history of head trauma with loss of consciousness, or (iv) had concurrent medical or neurological disorders. seventy - one outpatients (33 men and 38 women) were enrolled in the study. informed consent was obtained from all subjects after a full explanation of the study procedure. the subjects had a mean (standard deviation [sd ]) age of 35.9 (10.4) years and a mean (sd) duration of illness of 7.1 (2.8) years. the duration of illness was defined as the period between the time that first psychotic symptoms were reported and the time of enrollment in the present study. all subjects were chronic patients with one or two relapses and were receiving maintenance treatment with atypical antipsychotics. twenty - eight patients (39.4%) had a single relapse and 43 patients (60.6%) had two relapses. the antipsychotics that patients were taking at the time of enrollment were paliperidone (n=30, mean dose : 6.3 [sd=2.7 ] mg / day), olanzapine (n=17, mean dose : 10.9 [sd=5.3 ] mg / day), aripiprazole (n=13, mean dose : 9.0 [sd=4.8 ] mg / day), clozapine (n=7, mean dose : 242.9 [sd=100.7 ] mg / day), and quetiapine (n=4, mean dose : 337.5 [sd=85.3 ] mg / day). regarding concomitant medications, 21 patients (29.6%) were administered both benzodiazepines and anticholinergics, nine patients (12.7%) were administered anticholinergics alone, and 21 patients (29.6%) were administered benzodiazepines only. the mean dosages of benzodiazepines and anticholinergics were 1.1 (sd=0.7) mg / day (lorazepam equivalents) and 1.5 (sd=0.5) mg / day (benztropine equivalents), respectively. cognitive insight was assessed using the bcis,7 which was developed to evaluate patients self - reflectiveness and their overconfidence in their interpretations of their experiences. the bcis is a 15-item self - report questionnaire with a 9-item self - reflectiveness subscale and a 6-item self - certainty subscale. each item is rated on a 4-point scale from 0 (do not agree at all) to 3 (agree completely), and two subscale scores are obtained. a composite index is also obtained by subtracting the self - certainty subscale score from the self - reflectiveness subscale score. patients subjective quality of life was assessed using the schizophrenia quality of life scale revision 4 (sqls - r4).33 the sqls - r4 is a self - administered scale comprising 33 items in two domains, that is, psychosocial and vitality. the sqls - r4 is a schizophrenia - specific quality of life instrument and it measures quality of life from the patients own perspective. all except four items are scored on a 5-point likert - type scale (0= never, 1= rarely, 2= sometimes, 3= often, and 4= always), with the exceptional four items being reverse coded (0= always, 1= often, 2= sometimes, 3= rarely, and 4= never). the scores for the two domains and total scores are obtained. a lower score represents a better quality of life, while a higher score indicates a lower quality of life.3336 previous studies have shown sufficient internal consistency and construct validity of the sqls - r4.3436 the psychometric properties of the korean version of the sqls - r4 were previously examined,36 which was used in this study. the sqls - r4 has been increasingly used in different populations of patients with schizophrenia.37,38 the symptoms of schizophrenia were evaluated using the manchester scale (ms).39 the ms is a widely used clinician - rated instrument for assessing psychiatric symptoms in schizophrenia and scores are summed across items rated on a 5-point likert scale.3942 it consists of eight items measuring a broad range of symptoms : delusion, hallucination, incoherence, flattened affect, poverty of speech, psychomotor retardation, depression, and anxiety. the positive symptom score is defined as the sum score of delusion, hallucination, and incoherence items, and the negative symptom score is indicated by the sum score of flattened affect, poverty of speech, and psychomotor retardation. the depression / anxiety symptom score represents the sum score of depression and anxiety items and is one of the important dimensions of general psychopathology in schizophrenia.3946 the severity of depressive symptoms was also assessed using the calgary depression scale for schizophrenia (cdss).47 the cdss is the most widely used clinician - rated scale for assessing depression in schizophrenia.47,48 each patient had a baseline interview and was evaluated using the ms and the cdss by an investigator who was sufficiently trained and familiar with the assessment of psychiatric symptoms in schizophrenia46,49,50 and was assessed using the bcis and the sqls - r4 in the presence of a research assistant who monitored whether or not the questions were completely understood. the primary measures for analysis were the bcis scores and the sqls - r4 scores. pearson s partial correlation analyses were also performed between bcis scores and sqls - r4 scores, controlling for the severity of symptoms, to adjust for the possible effects of symptoms and to exclusively assess the correlation between cognitive insight and subjective quality of life. for all analyses, all statistical analyses were performed using spss 19.0 for windows (spss, chicago, il). the study protocol was approved by the institutional review board of the gachon university gil medical center, and all procedures used in the study were conducted in accordance with international ethical standards, declaration of helsinki. the criteria for patient recruitment were the following : (i) a diagnosis of schizophrenia by the diagnostic and statistical manual of mental disorders, 4th edition,29 which was established using the structured clinical interview for diagnostic and statistical manual of mental disorders, 4th edition;30 (ii) age between 20 and 50 years ; (iii) outpatients on at least 4 weeks of maintenance therapy with atypical antipsy - chotics without changes in the dosage of medications over the same period ; and (iv) be able to be rated reliably on psychiatric rating scales. patients were excluded if they (i) met diagnostic criteria for a psychiatric diagnosis other than schizophrenia, (ii) had a concurrent diagnosis of substance abuse or dependence, (iii) had a history of head trauma with loss of consciousness, or (iv) had concurrent medical or neurological disorders. seventy - one outpatients (33 men and 38 women) were enrolled in the study. informed consent was obtained from all subjects after a full explanation of the study procedure. the subjects had a mean (standard deviation [sd ]) age of 35.9 (10.4) years and a mean (sd) duration of illness of 7.1 (2.8) years. the duration of illness was defined as the period between the time that first psychotic symptoms were reported and the time of enrollment in the present study. all subjects were chronic patients with one or two relapses and were receiving maintenance treatment with atypical antipsychotics. twenty - eight patients (39.4%) had a single relapse and 43 patients (60.6%) had two relapses. the antipsychotics that patients were taking at the time of enrollment were paliperidone (n=30, mean dose : 6.3 [sd=2.7 ] mg / day), olanzapine (n=17, mean dose : 10.9 [sd=5.3 ] mg / day), aripiprazole (n=13, mean dose : 9.0 [sd=4.8 ] mg / day), clozapine (n=7, mean dose : 242.9 [sd=100.7 ] mg / day), and quetiapine (n=4, mean dose : 337.5 [sd=85.3 ] mg / day). regarding concomitant medications, 21 patients (29.6%) were administered both benzodiazepines and anticholinergics, nine patients (12.7%) were administered anticholinergics alone, and 21 patients (29.6%) were administered benzodiazepines only. the mean dosages of benzodiazepines and anticholinergics were 1.1 (sd=0.7) mg / day (lorazepam equivalents) and 1.5 (sd=0.5) mg / day (benztropine equivalents), respectively. cognitive insight was assessed using the bcis,7 which was developed to evaluate patients self - reflectiveness and their overconfidence in their interpretations of their experiences. the bcis is a 15-item self - report questionnaire with a 9-item self - reflectiveness subscale and a 6-item self - certainty subscale. each item is rated on a 4-point scale from 0 (do not agree at all) to 3 (agree completely), and two subscale scores are obtained. a composite index is also obtained by subtracting the self - certainty subscale score from the self - reflectiveness subscale score. a korean version of the bcis was developed31,32 and used in this study. patients subjective quality of life was assessed using the schizophrenia quality of life scale revision 4 (sqls - r4).33 the sqls - r4 is a self - administered scale comprising 33 items in two domains, that is, psychosocial and vitality. the sqls - r4 is a schizophrenia - specific quality of life instrument and it measures quality of life from the patients own perspective. all except four items are scored on a 5-point likert - type scale (0= never, 1= rarely, 2= sometimes, 3= often, and 4= always), with the exceptional four items being reverse coded (0= always, 1= often, 2= sometimes, 3= rarely, and 4= never). the scores for the two domains and total scores are obtained. a lower score represents a better quality of life, while a higher score indicates a lower quality of life.3336 previous studies have shown sufficient internal consistency and construct validity of the sqls - r4.3436 the psychometric properties of the korean version of the sqls - r4 were previously examined,36 which was used in this study. the sqls - r4 has been increasingly used in different populations of patients with schizophrenia.37,38 the symptoms of schizophrenia were evaluated using the manchester scale (ms).39 the ms is a widely used clinician - rated instrument for assessing psychiatric symptoms in schizophrenia and scores are summed across items rated on a 5-point likert scale.3942 it consists of eight items measuring a broad range of symptoms : delusion, hallucination, incoherence, flattened affect, poverty of speech, psychomotor retardation, depression, and anxiety. the positive symptom score is defined as the sum score of delusion, hallucination, and incoherence items, and the negative symptom score is indicated by the sum score of flattened affect, poverty of speech, and psychomotor retardation. the depression / anxiety symptom score represents the sum score of depression and anxiety items and is one of the important dimensions of general psychopathology in schizophrenia.3946 the severity of depressive symptoms was also assessed using the calgary depression scale for schizophrenia (cdss).47 the cdss is the most widely used clinician - rated scale for assessing depression in schizophrenia.47,48 each patient had a baseline interview and was evaluated using the ms and the cdss by an investigator who was sufficiently trained and familiar with the assessment of psychiatric symptoms in schizophrenia46,49,50 and was assessed using the bcis and the sqls - r4 in the presence of a research assistant who monitored whether or not the questions were completely understood. the primary measures for analysis were the bcis scores and the sqls - r4 scores. pearson s partial correlation analyses were also performed between bcis scores and sqls - r4 scores, controlling for the severity of symptoms, to adjust for the possible effects of symptoms and to exclusively assess the correlation between cognitive insight and subjective quality of life. for all analyses, the level of statistical significance was defined as p0.05), sex (=0.21 to 0.06, p>0.05), duration of illness (r=0.14 to 0.04, p>0.05), number of relapses (r=0.18 to 0.10, p>0.05), years of education (r=0.22 to 0.11, p>0.05), or marital status (=0.11 to 0.05, p>0.05). the type of antipsychotics, which patients were taking at the time of the assessment, was not significantly associated with the bcis scores (=0.21 to 0.05, p>0.05). the bcis scores had no significant correlations with the duration of current antipsychotic treatment (r=0.04 to 0.01, p>0.05) or the use of concomitant medications (=0.01 to 0.03, p>0.05). with respect to the ms scores, the bcis scores had no significant correlations with the positive symptom score (r=0.15 to 0.18, p>0.05), negative symptom score (r=0.02 to 0.07, p>0.05), or depression / anxiety symptom score (r=0.07 to 0.02, p>0.05 ; table 2). in addition, there were no significant correlations between the bcis scores and the cdss score (r=0.05 to 0.16, p>0.05 ; table 2). the sqls - r4 scores had no significant correlations with age (r=0.09 to 0.03, p>0.05), sex (=0.11 to 0.08, p>0.05), duration of illness (r=0.10 to 0.02, p>0.05), number of relapses (r=0.09 to 0.01, p>0.05), years of education (r=0.08 to 0.01, p>0.05), or marital status (=0.04 to 0.01, p>0.05). the type of antipsychotics was not significantly associated with the sqls - r4 scores (=0.14 to 0.07, p>0.05). the sqls - r4 scores had no significant correlations with the duration of current antipsychotic treatment (r=0.05 to 0.02, p>0.05) or the use of concomitant medications (=0.09 to 0.07, p>0.05). with respect to the ms scores, the sqls - r4 scores had no significant correlations with the positive symptom score (r=0.19 to 0.20, p>0.05) or negative symptom score (r=0.19 to 0.22, p>0.05). however, the sqls - r4 scores showed significant correlations with depression / anxiety symptom score (r=0.36 to 0.43, p<0.01 ; table 3). in addition, there were significant correlations between the sqls - r4 scores and the cdss score (r=0.50 to 0.58, p<0.01 ; table 3). with regard to the correlations between bcis and sqls - r4 scores, the self - reflectiveness subscale score of the bcis had significant positive correlations with the sqls - r4 psychosocial subscale (r=0.31, p<0.01) and total sqls - r4 scores (r=0.24, p=0.04), indicating that the higher the level of cognitive insight, the lower the subjective quality of life (table 4). there was also a tendency toward a positive correlation between the bcis composite index and the sqls - r4 psychosocial subscale score (r=0.23, p=0.05 ; table 4). since only the ms depression / anxiety and cdss scores significantly correlated with the sqls - r4 scores, we performed partial correlation analyses between bcis scores and sqls - r4 scores, controlling for the ms depression / anxiety and cdss scores. the bcis self - reflectiveness subscale score still had a significant positive correlation with the sqls - r4 psychosocial domain score (r=0.30, p=0.01 ; table 5), indicating that the strength of the association remained unchanged. however, the correlation coefficient between the bcis self - reflectiveness subscale score and the total sqls - r4 score was reduced to a nonsignificant statistical tendency (r=0.22, p=0.08 ; table 5). in the present study, we examined the relationship between cognitive insight and subjective quality of life in stable outpatients with schizophrenia. the main finding was the significant relationship between the scores of bcis self - reflectiveness subscale and sqls - r4 psychosocial domain even after controlling for the ms and cdss scores. to the best of our knowledge, this is among the first reports to explore the relationship between cognitive insight and subjective quality of life. in pearson s correlation analyses, the bcis self - reflectiveness subscale score had significant positive correlations with the sqls - r4 psychosocial subscale and total sqls - r4 scores. the bcis composite index also had a tendency to be positively correlated with the sqls - r4 psychosocial subscale score. since a lower sqls - r4 score represents a better quality of life and a higher score indicates a lower quality of life,3336,51 these results indicate that there is an inverse relationship between the level of cognitive insight and the subjective quality of life. our findings are in line with previous suggestions that the awareness of anomalous experiences and misinterpretation and the inability to objectively evaluate them may lead to significant subjective discomfort.28,52 our results are also in accordance with the findings of giusti who showed that the self - report of being in recovery was significantly correlated with low self - reflectiveness of cognitive insight in patients with schizophrenia. notably, after controlling for the ms depression / anxiety and cdss scores, the partial correlation between the bcis self - reflectiveness subscale and sqls - r4 psychosocial domain scores remained significant, while the correlation between self - reflectiveness and the total sqls - r4 score did not. these results suggest that even though the severity of depression / anxiety symptoms may affect the relationship between cognitive insight and subjective quality of life to some degree, the correlation between the self - reflectiveness aspect of cognitive insight and the psychosocial domain of subjective quality of life has unique variance that is not due to depression / anxiety symptoms. there were previous reports that awareness of illness was associated with poor subjective quality of life, even when co - varying for the brief psychiatric rating scale54 depression item.24 our results may extend these findings to include cognitive insight that is conceptually relevant to metacognition.10 one possible explanation for these findings is that internalized stigma - related variables may moderate the relationship between cognitive insight and subjective quality of life.55 a second possibility is that personality characteristics or symptoms other than depression / anxiety may mediate or moderate the relationship between the two.23 furthermore, as previously suggested by lysaker self - reflectivity is closely related to the ability to synthesize or integrate discrete judgments into integrated wholes and to form complex ideas about oneself and monitor them over time. as such, greater awareness could leave vulnerable persons open to perceiving things that are deeply unsettling, which may result in current and prospective emotional discomfort and poor interpersonal relationships.56 it should be noted that the sqls - r4 scores had significant correlations with the ms depression / anxiety score and the cdss score. these results are clearly in line with previous reports that psychiatric symptoms, particularly general psychopathology, are significantly inversely related to quality of life.57,58 in addition, our findings are consistent with previous findings that depressive mood and anxiety are significantly associated with a low quality of life in schizophrenia.59,60 in our study, the ms positive or negative symptoms were not significantly correlated with the bcis or sqls - r4 scores ; therefore, they were not controlled in the partial correlation analysis. in contrast, the ms depression / anxiety and cdss scores were significantly correlated with the sqls - r4 scores and were controlled in the analysis. however, as previously reported by lincoln psychiatric symptom severity is an important mediator in the long - term relationship between insight and functional outcome. therefore, prospective studies on the relationship between cognitive insight and subjective quality of life are required using a more thorough assessment of psychopathology with different comprehensive scales. in the present study, the depression / anxiety symptom score was significantly correlated with both domains of the sqls - r4, while it was not associated with the self - reflectiveness score. considering that the self - reflectiveness score had a significant correlation with the sqls - r4 psychosocial domain score, our findings suggest that self - reflectivity and depression / anxiety symptoms may have additive effects on the psychosocial domain of subjective quality of life. the results of our study also has an implication that careful individualized approaches focused on coping strategies may be required to enhance both cognitive insight and subjective quality of life. the therapeutic approaches that assist patients to develop more complex accounts of their lives, to develop integrated and realistic ideas about their own identities, and to use these representations to understand and effectively respond to psychological and interpersonal challenges are to be emphasized.62 it should be noted that we used a self - report quality of life scale. previous studies have shown that self - report and observer - rated quality of life instruments often have different determinants63 and that the correlations between the two range from low to moderate.64,65 thus, if an observer - rated quality of life scale had been used in our study, different results might have been found. in a previous longitudinal study,66 better insight, as assessed by the item g12 from the positive and negative symptom scale for schizophrenia,67 was significantly correlated with improved social functioning measured by an observer - rated scale. patients with higher cognitive insight were also more likely to live independently.19 the self - report quality of life assessment is considered to have the advantage of gathering information on specific aspects conveniently and of understanding those aspects on the part of patients;68,69 however, it is not complemented by objective assessments of socio - occupational functioning. therefore, future studies should include observer - rated scales, in addition to self - report instruments, to capture the multidimensional domains of quality of life in patients with schizophrenia. the interpretation of the results of the present study should be considered in light of some limitations. a prospective study with a larger sample is warranted to confirm the stability of the relationships that were observed.70 the subjects were all outpatients receiving stable doses of antipsychotics ; as such, the findings may not be generalized to a more diverse group of patients. the number of relapses and the medication status were not associated with the bcis or sqls - r4 scores ; therefore, they were not considered to be confounding factors. future studies should include first - episode or drug - nave patients to evaluate whether the relationship observed in the present study holds true for those patients and to obtain valuable insights into the complex nature of the relationship between cognitive insight and quality of life. as previously mentioned, we used a self - rating scale to assess subjective quality of life. the use of an observer - rated quality of life scale might have led to different results. the results of our study suggest that cognitive insight, particularly the level of self - reflectiveness, is significantly negatively associated with the subjective quality of life and that this relationship is not wholly due to the confounding effect of depressive symptoms. the findings in our study also suggest that careful individualized approaches focused on coping strategies may be required to enhance both cognitive insight and the subjective quality of life in patients with schizophrenia. future studies are necessary to explore possible mediating and moderating factors, for example, neurocognitive function, personality traits, or self - stigma, and to evaluate the effects of pharmacological and nonpharmacological interventions on the relationship.	backgroundthe concept of cognitive insight refers to the cognitive processes involved in patients re - evaluation of their anomalous experiences and of their misinterpretations. the purpose of the present study was to examine the relationship between cognitive insight and subjective quality of life in patients with schizophrenia to further shed light on the nature of cognitive insight and its functional correlates in schizophrenia.methodsseventy-one stable outpatients with schizophrenia were evaluated for cognitive insight and subjective quality of life using the beck cognitive insight scale (bcis) and the schizophrenia quality of life scale revision 4 (sqls - r4). the symptoms of schizophrenia were also assessed. pearson s correlation analysis and partial correlation analysis that controlled for the severity of symptoms were performed to adjust for the possible effects of symptoms.resultsthe self - reflectiveness subscale score of the bcis had significant positive correlations with the sqls - r4 psychosocial domain and total sqls - r4 scores, indicating that the higher the level of cognitive insight, the lower the subjective quality of life. in partial correlation analysis controlling for symptoms, the bcis self - reflectiveness subscale score still had a significant correlation with the sqls - r4 psychosocial domain score. the correlation coefficient between the bcis self - reflectiveness and total sqls - r4 scores was reduced to a nonsignificant statistical tendency.conclusionthe results of our study suggest that cognitive insight, particularly the level of self - reflectiveness, is negatively associated with the level of subjective quality of life in outpatients with schizophrenia and that this relationship is not wholly due to the confounding effect of symptoms. future studies are necessary to explore possible mediating and moderating factors and to evaluate the effects of therapeutic interventions on the relationship.
brucellosis is one of the world 's major bacterial zoonosis and an important cause of a serious debilitating disease in humans ; further, it is the cause of abortion and sterility in animals. brucella canis, a facultative, gram - negative, intracellular pathogen, is the etiologic agent of canine brucellosis. canine brucellosis is widely distributed around the world and this is an important disease due to the economic losses in animal production and its risks for human health. serological diagnosis is usually performed using a tube agglutination test (tat), a rapid slide agglutination test, and a gel immunodiffusion test [24 ]. however, agglutination tests often give false positive results because of cross - reactions with other pathogens. a general strategy for eliminating cross - reactions is to use purified antigen with unique epitopes in the serological tests. bacterial cell wall antigens of b. canis can be prepared by hot saline extraction and are reportedly useful in serological diagnosis. in a previous study, we reported the characterization of crude hot saline extracts and identified three antigens, namely, rhizopine - binding protein (rbp, former assigned ribose abc transporter), cu - zn superoxide dismutase (sod), and a hypothetical protein (ag 4). this paper describes the development of latex beads coated with purified recombinant versions of these antigens and demonstrates the usefulness of these antigen - coated latex beads in the serological diagnosis of canine brucellosis. the gene encoding each antigen was amplified from chromosomal dna isolated from b. canis using pcr with the pair of primers shown in table 1. his - tagged antigens were expressed in the escherichia coli strain dh5, and their purification was performed as described by the manufacturer (novagen, darmstadt, germany). serum samples (n = 743) were collected from fleas- or ticks - infested dogs consecutively admitted to animal hospitals in japan by the hospital staff in 2012 and 2013. b. canis - infected control sera were collected from three pcr - positive dogs, and b. canis - free control sera were collected from three specific pathogen - free (spf) dogs. covalent coupling of the proteins to carboxylated polystyrene latex beads was performed as described by the manufacturer (polyscience inc., warrington, pa, usa). briefly, equal volumes of antigen solution (protein concentration 300 g / ml, measured using lowry method) and 2.5% latex beads (diameter 1 m, polyscience inc.) were mixed for 18 h at room temperature with stirring. then, the latex beads were blocked with 0.2 m borate buffer containing 0.25 m ethanolamine for 30 min at room temperature with stirring and were washed three times with 0.2 m borate buffer containing 1% bovine serum albumin. the latex beads were then adjusted to a final concentration of 2.5% (w / v) with storage buffer and were maintained at 4c. this test was performed by mixing equal volumes (50 l) of latex bead solution and canine serum diluted 50-fold with pbs in each well of a 96-well round - bottom microwell plate (nunc, roskilde, denmark) and incubating the plate at room temperature for 18 h without shaking. this test was performed by adding equal volumes (0.5 ml) of heat - inactivated b. canis qe-13 whole - cell antigens (optical density of 0.8 at 450 nm, kitasato laboratories, saitama, japan), with serum that had been serially diluted 2-fold with pbs, and incubating the mixture at 50c for 24 h. agglutination titers were determined from the final dilution of serum showing 50% agglutination. the antigen solution was separated using 10% sds - page and then transferred to immobilon - p membranes (millipore, billerica, ma, usa). the efficiency of transfer was determined using coomassie brilliant blue r-250, and then the membranes were tested for reactivity with antibodies in the b. canis - infected control sera that were collected from three pcr - positive dogs [6, 8 ]. immunoreactions were visualized using the enhanced chemiluminescence detection system (ge healthcare life science, little chalfont, uk). to test antigenic reactivity, four recombinant antigens were subjected to western blotting along with the dog sera that had tested positive or negative in the tat. all recombinant antigens showed strong reactivity with the positive sera, but not with the negative sera (figure 1). to identify b. canis - infected sera, we performed tat on canine serum samples (n = 743) collected from dogs consecutively admitted to animal hospitals in japan by the hospital staff. antibodies to b. canis were detected in 9 of the 743 (1.2%) serum samples (table 2). latex beads were coated with single or multiple recombinant b. canis antigens with the aim of achieving a serodiagnostic method that is faster and easier to perform. sera from b. canis - infected dogs, in which infection had been confirmed by tat and pcr previously, were mixed with the antigen - coated latex beads, and then this mixture was incubated at room temperature for 18 h. agglutination was clearly observed in all antigens (figure 2). in contrast, b. canis - free dog serum showed no agglutination (figure 2). various results were obtained when mat was conducted using the 743 dog serum samples with each of the antigen - coated latex beads, as shown in table 2. sod reacted with 8 tat - positive sera (88.9%), but rbp, ag 4, and hsp60 (heat shock protein 60) reacted with 6 (66.7%), 6 (66.7%), and 7 (77.8%) sera, respectively (table 2). it is well known that hemolysis of serum samples induces false positive results in tat. to investigate if this source of false positive results is eliminated in the mat, we performed the assay with antigen - coated latex beads using three artificial hemolytic sera from b. canis - free dogs. indeed, hemolyzed serum showed a false positive result in tat (figure 3). in contrast, mat with rbp - coated latex beads gave a negative result with the hemolyzed serum (figure 3). the same results were obtained with latex beads coated with other antigens (data not shown). tat and mat, using whole b. canis antigens, are currently being used for serological diagnosis in dogs in japan [11, 12 ]. however, nonspecific reactions occur in the serological diagnoses using whole bacterial cell antigens. in a previous study, we reported a rapid slide agglutination test using latex beads that were coated with antigens extracted by hot saline for the serological diagnosis of canine brucellosis. to develop a serological diagnosis method that is faster and easier to perform however, we observed nonspecific reaction in mat and, therefore, we used latex beads coated with purified recombinant antigens in this study. analysis of the antigens contained in the crude hot saline extracts, performed in our previous study, identified three antigens, namely, rbp, sod, and ag 4. rhizopines are known to be nutritional mediators and play a role in nitrogen - fixing symbiotic associations between members of the rhizobiaceae and legume plants. because b. canis is not a plant symbiont in addition, the function of ag 4 is currently unknown, and because sod is a known antigenic protein of b. abortus, its potential value as a vaccine for brucellosis prevention and as a diagnostic reagent for the disease has been investigated [9, 16, 17 ]. the results from our previous study also showed that recombinant sod was useful for the detection of canine brucellosis using elisa. hsp60 has also been known as an immunoreactive protein and virulence factor of b. abortus. the present study showed that these four recombinant antigens can be used as a potential diagnostic marker for canine brucellosis. in particular, because the sod antigen showed the highest reactivity to tat - positive sera in the mat, recombinant sod may be most useful for serological diagnosis. usually, serum samples taken from dogs living in japanese household do not show a positive result for pcr but sometimes show a positive result for tat. we think bacteremia of brucella may be rare case in dogs that are kept at home in japan [68 ]. although nonspecific agglutination shows a relationship with hemoglobin concentration, its detailed mechanism is still unclear. the purified recombinant antigen - coated latex beads developed in the present study will be useful tools for the serological diagnosis of canine brucellosis from hemolyzed serum specimens. furthermore, mat can be used for very small serum samples and offers potential for high throughput testing ; therefore, it would be suitable for the screening of valuable samples such as those from wildlife or small animals.	brucella canis, a facultative intracellular pathogen, is the causative agent of canine brucellosis. the diagnosis of canine brucellosis is based on bacteriological examination and serological methods, including agglutination and gel diffusion tests. in this study, four recombinant antigens, heat shock protein 60, rhizopine - binding protein, cu - zn superoxide dismutase, and hypothetical protein (ag 4), were constructed. these antigens were coated on latex beads and their usefulness in the serological diagnosis of canine brucellosis was examined. all recombinant antigens showed specific reaction with sera from b. canis - infected dogs in western blotting. in a microplate agglutination test, mixing sera from b. canis - infected dogs, but not sera from b. canis - free dogs, with single or multiple antigens - coated latex beads produced clear agglutination. moreover, the antigen - coated latex beads did not show nonspecific agglutination in hemolyzed serum samples. a survey of canine serum samples conducted by the microplate agglutination test using single antigen - coated latex beads showed that this method would be useful in the serological diagnosis of canine brucellosis. further investigations using more serum samples are required to confirm the usefulness of our method.
to characterize hcv - specific cd8 t cell mediated responses associated with severe liver pathology in acute hcv infection, we analyzed the global profile of the hcv - specific t cell response in eight patients who showed variable outcomes of acute hcv infection (fig. 1 a, patients 1 and 2) that were infected with genotype 1b hcv showed a severe clinical course of acute hepatitis c with rapidly rising bilirubin levels, elevated alt values, and prolonged prothrombin time (fig. 1, b and c). six patients (patients 38) that were also infected by genotype 1 hcv displayed a mild course of liver disease, as generally observed after hcv infection (fig. a comprehensive analysis of the hcv - specific t cell repertoire was performed using a panel of 601 15-mer peptides overlapping by 10 residues and spanning the entire hcv sequence of genotype 1a. direct ex vivo frequency of ifn-producing t cells was evaluated in patients 15 and 8 (fig. 2, a and b) in the acute phase of infection at the peak of alt. a dramatic difference in the t cell repertoire was evident in the two patient populations. although t cell responses were narrowly focused on a few peptide pools in patients 1 and 2 (fig. 2 a), simultaneous recognition of multiple hcv sequences was detected in patients 35 and 8 (fig. 2 b), as previously described in recovered and acutely infected patients (79). characteristics of the population of patients with acute hepatitis c. (a) clinical and virological features of the eight patients with acute hcv infection studied. (b) sequential evaluation of serum alt levels from the time of clinical presentation. (c) behavior of serum alt levels (closed squares), prothrombin activity (open squares), and quantitative (open circles) and qualitative hcv - rna and anti - hcv antibodies in patient 1. pbmcs from patients with severe course (a, patients 1 and 2) and with mild course (b, patients 35 and 8) of acute hcv infection were stimulated overnight with 119 pools of overlapping 15-mer peptides covering the whole hcv sequence. elispot analysis was performed when the patients first reported to the clinics (fig. 1 b, day 1). (c) longitudinal analysis of the t cell response to the 119 pools of overlapping peptides performed in patients 1 and 8 at the indicated weeks after the time of exposure to hcv that was precisely identified. (d) the same sequential study was performed in patients 3 and 5 at the indicated weeks after the first presentation in the clinics (unknown time of infection). of the 119 mixtures of synthetic peptides tested, 34 in patient 3, 33 in patient 4, 18 in patient 5, and 12 in patient 8 were able to induce ifn- production. these broad t cell responses were directed toward all viral antigens and different peptide mixtures induced responses of different intensity, ranging from 50 to 1,100 spot - forming cells (sfc)/10 pbmcs in patient 3, from 500 to 3,700 in patient 4, from 50 to 920 in patient 5, and from 45 to 1,000 in patient 8. further analysis performed by ics to identify the responses were sustained by a mixed activation of both cd4 and cd8 t cell subsets (unpublished data). in contrast, only a single sequence containing the previously described hla - a2restricted ns3 10731081 cd8 epitope (10) was identified in patients 1 and 2. the profound immunodominance of ns3 10731081specific cd8 + t cells in these hla - a2 + patients was confirmed by direct ex vivo tetramer staining for five distinct hcv epitopes (1114). confirming the data obtained with elispot, both patients showed extremely elevated frequencies of ns3 10731081-specific cd8 t cells, whereas other specificities were negative also using peptides of optimal length for cd8 t cell recognition and corresponding to well - characterized hla - a2restricted epitopes. ns3 10731081 tetramer+ cd8 t cells reached values of 36 and 12% of the total cd8 t cells in patients 1 and 2 (fig. these frequencies were much higher than those previously reported in acute hcv infection (1517) and those detected in three subjects with mild course of infection who were analyzed for comparison (fig. the phenotypic analysis of the tetramer+ cells in the five patients showed an identical maturation stage (effector - memory stage). almost all tetramer+ cells were ccr7, cd45ra, and cd27, and predominantly hla - dr+ and cd69 + (unpublished data). peripheral blood frequency of hcv - specific cd8 t cells by ex vivo tetramer staining. (a) dot plot analysis of hcv ns3 1073 tetramer+ cd8 t cells in patients 1 and 2. (b) percentage of tetramer+ cd8 t cells specific for five hcv epitopes corresponding to ns3 1073, ns3 1406, ns4 1812, ns4 1992, and ns5 2627 detected ex vivo in pbmcs of five hla - a2 + patients with acute hcv infection at the time of presentation in the clinics (fig. 1 a, patients 13, 6, and 7). all plots illustrate the results obtained at the first time the patients reported to the clinic. the different breadth of the cd8 t cell response in patients with severe and milder courses of the disease may reflect the different times after infection at which individual patients were studied. to exclude this possibility, we analyzed hcv - specific t cell responses longitudinally in patient 1 (severe hepatitis) and in patient 8 (milder disease). the precise time of infection was known in both, allowing us to perform a complete sequential analysis of the cd8 t cell response (fig. 2 c). in patient 1, cd8 t cell responses were already positive, extremely vigorous, and narrowly focused on a single epitope 3 wk after infection. except for a marginal and transient broadening on week 8, the response remained focused on the ns3 sequence 10731081 throughout the follow - up (from week 3 to 24). in contrast, the cd8 t cell response became detectable later in patient 8 (fig. 2 c) ; it was widely multispecific with simultaneous recognition of multiple epitopes at the time of the first positive assay (week 11) and a comparable breadth of the response was maintained thereafter (week 16). the behavior of patient 8 was consistent with the responses in patients 3 and 5 with milder disease (fig. 2 d), in whom the precise time of infection could not be established. their cd8 t cell response was multispecific at the first determination and the breadth of response remained similar throughout the follow - up. therefore, hcv - specific cd8 t cell mediated responses in subjects who displayed different clinical courses of acute hepatitis c showed clear differences in their t cell repertoire. a strong dominance of a single hcv - specific cd8 t cell response was detected in patients with severe hepatic damage, whereas a milder disease was associated with a broader repertoire of the hcv - specific t cell response. a possible interpretation of these results is that the dramatic expansion of ns3 1073specific cd8 t cells in patients 1 and 2 was related to the presence of a private repertoire of memory t cells able to cross - react with the hcv sequence. the high degree of homology reported between hcv ns3 10731081 and influenza na 231239 sequences (10) supports this possibility. moreover, t cell cross - reactivity between these two hcv and influenza sequences was observed in humans (hcv - infected patients and healthy hcv - uninfected subjects) and in hla - a2 + transgenic mice (10). in addition, severe immunopathology after viral infection was shown to be caused in mice by the expansion of memory t cells from an earlier infection that cross - reacted with a second unrelated heterologous virus (36). homology of the ns3 10731081 and the influenza na 231239 sequences was confirmed in our study by sequence analysis of the ns3 region performed on individual cdna clones (18) in the patients with severe liver pathology (patients 1 and 2). furthermore, database analysis indicates that the influenza na 231239 epitope is highly conserved among the published influenza sequences of h1n1 and h3n2 subtypes that are the only influenza subtypes isolated during the last 15 yr in the geographical region where the patients lived. to determine whether potentially cross - reactive cd8 t cells were present in patients with severe liver pathology, direct ex vivo ifn- elispot analysis was performed in patients 1 and 2 (severe liver pathology) and in patients 6 and 7 (milder disease) for comparison. although all patients showed a flu matrix 5866specific cd8 t cell response, demonstrating prior sensitization to influenza, na 231 influenza 4 a). recognition of hcv ns3 1073 and flu na 231 peptides by hcv ns3specific cd8 t cells. pbmcs from four hla - a2 + patients with acute hcv infection were stimulated overnight with the peptides ns3 1073, flu na 231, and flu matrix 58. the results are expressed as change in spot - forming cells (sfc) per 10 pbmcs. (b and c) cd107a expression and of ifn- production by ics analysis ex vivo. pbmcs from patients 1 and 7 were incubated for 2 h (cd107a expression) or 4 h (ifn- production) with hcv ns3 1073, flu na231, flu ma 51 peptides, or medium alone. (b) histograms represent cd107a expression in gated hcv ns3 tetramer+ cd8 t cells at the indicated experimental conditions. (c) plots represent ifn- production in gated tetramer+ (top) or tetramer (bottom) hcv ns3 1073 cells. (d) ifn- production in ns3- and flu - specific t cell lines by ics analysis. t cell lines produced by 10-d stimulation with the ns3 1073 or the flu na 231 peptides (top) were stimulated for 4 h in medium alone, with the hcv ns3, with the flu na, or with a control hla - a2restricted mage peptide (mage 271279 ; flwgpralv). numbers at the top of the bars indicate the percentage of ifn-positive cd8 t cells. ns3 1073specific t cell lines from patients 1 and 7 (bottom) were stimulated at the indicated experimental conditions. the numbers indicated in each plot represent the percentage of ifn-positive cells among the hcv ns3 tetramer+ cd8 t cell population. no ifn- production was detectable in patient 1 upon stimulation with the flu na 231 peptide in ns3 tetramer cd8 t cells (not depicted). (e) cytotoxic activity of hcv ns3 1073specific t cell lines produced by 10-d stimulation with the ns3 1073 peptide in patients 1 and 3 against hla - a2 + target cells (e / t ratio = 40:1) incubated in medium alone or pulsed either with the hcv ns3 1073 peptide or with the flu na 231 peptide or with a control mage peptide. each bar shows the percentage of cr release at the different experimental conditions described above. next, functional experiments were performed to assess whether ns3 1073specific cd8 + t cells in patients 1 and 2 could be activated by the na 231239 sequence. ex vivo analysis showed that na 231239 peptide stimulation elicited up - regulation of cd107a expression (fig. 4 b ; reference 19) and ifn- production (fig. 4 c) selectively among ns3 10731081 tetramer+ cells, but not among the tetramer cd8 t cell subset. in keeping with ex vivo experiments, cross - recognition of hcv ns3 1073 and flu na 231 peptides was observed in ns3-specific and flu na specific t cell lines derived from patients 1 and 2 but not in ns3-specific lines derived from patients 3 and 7 (fig. 4 d). furthermore, ifn- production upon na 231239 peptide stimulation was restricted to the ns3 10731081 tetramer+ cd8 fraction of the ns3-specific lines in patient 1 (fig. 4 d). finally, cytotoxicity experiments performed using hcv ns3 1073specific t cell lines derived from patients 1 and 3 confirmed the selective presence of cross - reactivity in patients with severe liver pathology (fig. 4 e). together, these data show that although sensitization to influenza is a very common event, the individual private repertoire of memory t cells seems to be the limiting factor for cross - reactivity between hcv and influenza to occur. a private t cell repertoire of hcv / influenza cross - reactive t cells was present exclusively in the patients with severe hepatic immunopathology. in this setting, reactivation of preexisting influenza - specific memory cd8 + t cells by a primary hcv infection may have resulted in the strong immunodominance of the ns3 1073specific cd8 + t cell response present in these two patients. notably, the kinetics of expansion and contraction of hcv - specific cd8 + t cell responses in patient 1 further supports the possibility that memory cd8 + t cells able to cross - react with the hcv ns3 1073 sequence were actually present. in this patient, a massive expansion (36%) of ns3 1073specific cd8 + t cells was already detectable as early as 23 wk from the time of a previous hospitalization, which likely corresponds to the time of infection. in contrast, other hcv - specific cd8 + t cells (against the ns5 sequence 19922000) increased their frequency at later time points, when the ns3 1073specific response was already in a contracting phase (fig. because memory t cells exhibit a more rapid response than naive t cells, the differential kinetics of hcv - specific cd8 t cells specific for different epitopes located in nonstructural proteins further supports the view that ns3 1073 cross - reactive memory t cells were present before hcv infection. this rapid appearance of ns3 1073specific t cell responses is also different from the kinetics reported in patients accidentally infected by needlestick exposure to hcv positive blood (17) and in primary infection of chimpanzees (20) in which hcv - specific t cell responses were detectable only 2 mo after infection. kinetics of hcv - specific cd8 t cell mediated responses in patient 1 analyzed ex vivo by tetramer staining and elispot assay. (a) percentage of tetramer+ cd8 t cells specific for hcv ns3 1073 (gray bars) and ns4 1992 (black bars) epitopes measured ex vivo at sequential time points from the time of infection. hcv viremia detected by branched dna assay (lower limit of detection, 2,500 copies / ml) is also illustrated. (b) ifn- production analyzed sequentially during the first 10 wk after infection by elispot upon pbmc stimulation with ns3 1073 (gray line) and ns4 1992 (black line) peptides. our findings provide a unique example of how the course of the pathology associated with primary hcv infection can be profoundly influenced by the virus - specific cd8 t cell repertoire elicited in the individual subjects. as shown in mice (36), it is possible that previous infection and the presence of cross - reactive t cells between different viruses is responsible for the marked immunodominance present in subjects with severe hepatic disease. although ns3-specific cd8 t cells expanded rapidly and vigorously, the virus was not efficiently controlled and liver pathology was severe. hcv chronicity could not be attributed, at least in patient 2, to the development of escape mutants because in this subject a longitudinal analysis of the ns3 1073 sequence was performed over a 9-mo period and mutations within this region were not found. thus, a robust, but isolated, response to the ns3 1073 epitope seems inadequate for viral control. a poor cd4 t cell response may have contributed to the lack of antiviral efficacy of the ns3-specific cd8 t cell response (21). alternatively, the absence of a concomitant multispecific cd8 t cell response might be implicated in the inability to control hcv. the inability of ns3-specific cd8 + t cells to efficiently control viral replication within the liver may have also contributed to the severity of liver cell damage. intrahepatic activation of a large quantity of hcv - specific cd8 t cells with poor antiviral function might have sustained a massive recruitment of nonspecific immune cells causing severe liver inflammation (22). focusing the cd8 t cell response on single immunodominant epitope with poor antiviral efficacy may have severe pathological consequences. eight patients with acute hepatitis c were enrolled at the department of infectious diseases of the university hospital of parma. the diagnosis of acute hcv infection was based on documented seroconversion to anti - hcv antibodies by riba assay, levels of serum alt at least 10 times the upper limit of normal (50 u / l), detection of hcv rna, exclusion of other possible causes of acute hepatitis. for two patients (patients 1 and 8), patient 1 developed jaundice and became symptomatic 3 wk after a previous hospitalization, during which he was treated with parenteral infusions of glucose and saline solutions. anti - hcv antibodies were negative and alt levels were normal at that time, indicating that infection was acquired during hospitalization. patient 8 had an accidental exposure to hcv - infected blood ; he was anti - hcv antibody negative and hcv - rna negative at the time of the parenteral exposure. anti - hcv antibodies were determined by commercial enzyme immunoassay kits (ortho diagnostic systems) and by riba (riba ii ; ortho diagnostic systems). serum hcv - rna was quantified by branched dna assay (model 340bdna analyzer ; bayer corporation) ; the lower limit of detection by this method is 2,500 copies / ml. this study was approved by the ethical committee of the azienda ospedaliero universitaria di parma, and all subjects gave written, informed consent. synthetic peptides representing the hla - a2restricted epitopes hcv ns3 10731081 (cingvcwtv), ns3 14061415 (klvalginav), ns4 18121820 (llfnilggwv), ns4b 19922000 (vlsdfktwl), ns5 25942602 (alydvvtkl), influenza virus na 231239 (cvngscftv), and ma 5866 (gilgfvftl), and a panel of 601 15-mer peptides overlapping by 10 residues and covering the overall sequence of hcv-1 were purchased from chiron mimotopes. hla a2 tetramers contained the hcv peptides ns3 10731081, ns3 14061415, ns4 18121820, ns4b 19922000, and ns5 25942602. pbmcs were resuspended in 96-well plates at a concentration 2 10/ml and stimulated with hcv peptides at a final concentration of 1 m. recombinant il-2 was added on day 4 of culture (50 ui / ml) and the immunological assays were performed on day 10. staining with tetramers and other surface markers and ifn- staining were performed as described previously (15). 601 15-mer peptides, based on a genotype 1a sequence (hcv-1) covering all structural (core, e1, and e2) and nonstructural (ns3, ns4, and ns5) hcv regions and overlapping by 10 residues, were pooled in 119 mixtures, each containing 10 synthetic peptides. hcv - specific t cell responses were analyzed upon overnight stimulation with individual peptide mixtures. plates were counted using an automated elispot reader (aid elispot reader system ; autoimmune diagnostika gmbh). the number of specific ifn-secreting pbmcs was calculated by subtracting the unstimulated control value from the stimulated sample. cytotoxic activity was assessed by incubating peptide - stimulated pbmcs with peptide - pulsed cr - labeled, hla - a2matched ebv - transformed b cells as targets for 4 h in round - bottom 96-well plates. cr released in the presence of culture medium ranged between 15 and 25% of total releasable counts. to adopt very stringent criteria and avoid the risk of false positive results, only levels of ctl lysis 13% were considered significant. eight patients with acute hepatitis c were enrolled at the department of infectious diseases of the university hospital of parma. the diagnosis of acute hcv infection was based on documented seroconversion to anti - hcv antibodies by riba assay, levels of serum alt at least 10 times the upper limit of normal (50 u / l), detection of hcv rna, exclusion of other possible causes of acute hepatitis. for two patients (patients 1 and 8), patient 1 developed jaundice and became symptomatic 3 wk after a previous hospitalization, during which he was treated with parenteral infusions of glucose and saline solutions. anti - hcv antibodies were negative and alt levels were normal at that time, indicating that infection was acquired during hospitalization. patient 8 had an accidental exposure to hcv - infected blood ; he was anti - hcv antibody negative and hcv - rna negative at the time of the parenteral exposure. anti - hcv antibodies were determined by commercial enzyme immunoassay kits (ortho diagnostic systems) and by riba (riba ii ; ortho diagnostic systems). serum hcv - rna was quantified by branched dna assay (model 340bdna analyzer ; bayer corporation) ; the lower limit of detection by this method is 2,500 copies / ml. this study was approved by the ethical committee of the azienda ospedaliero universitaria di parma, and all subjects gave written, informed consent. synthetic peptides representing the hla - a2restricted epitopes hcv ns3 10731081 (cingvcwtv), ns3 14061415 (klvalginav), ns4 18121820 (llfnilggwv), ns4b 19922000 (vlsdfktwl), ns5 25942602 (alydvvtkl), influenza virus na 231239 (cvngscftv), and ma 5866 (gilgfvftl), and a panel of 601 15-mer peptides overlapping by 10 residues and covering the overall sequence of hcv-1 were purchased from chiron mimotopes. pe - labeled tetrameric peptide hla a2 tetramers contained the hcv peptides ns3 10731081, ns3 14061415, ns4 18121820, ns4b 19922000, and ns5 25942602. pbmcs were resuspended in 96-well plates at a concentration 2 10/ml and stimulated with hcv peptides at a final concentration of 1 m. recombinant il-2 was added on day 4 of culture (50 ui / ml) and the immunological assays were performed on day 10. staining with tetramers and other surface markers and ifn- staining were performed as described previously (15). 601 15-mer peptides, based on a genotype 1a sequence (hcv-1) covering all structural (core, e1, and e2) and nonstructural (ns3, ns4, and ns5) hcv regions and overlapping by 10 residues, were pooled in 119 mixtures, each containing 10 synthetic peptides. hcv - specific t cell responses were analyzed upon overnight stimulation with individual peptide mixtures. plates were counted using an automated elispot reader (aid elispot reader system ; autoimmune diagnostika gmbh). the number of specific ifn-secreting pbmcs was calculated by subtracting the unstimulated control value from the stimulated sample. cytotoxic activity was assessed by incubating peptide - stimulated pbmcs with peptide - pulsed cr - labeled, hla - a2matched ebv - transformed b cells as targets for 4 h in round - bottom 96-well plates. cr released in the presence of culture medium ranged between 15 and 25% of total releasable counts. to adopt very stringent criteria and avoid the risk of false positive results, only levels of ctl lysis 13% were considered significant.	hepatitis c virus (hcv) can cause liver disease of variable severity. expansion of preexisting memory cd8 t cells by cross - reactivity with a new heterologous virus infection has been shown in mice to shape the repertoire of the primary response and to influence virus - related immunopathology (selin, l.k. 2004. immunity. 20:516). to determine whether this mechanism can influence the course of hcv infection, we analyzed the features of the hcv - specific cd8 t cell response in eight patients with acute hcv infection, two of whom had a particularly severe illness. patients with severe hepatitis, but not those with mild disease, showed an extremely vigorous cd8 t cell response narrowly focused on a single epitope (ns3 10731081), which cross - reacted with an influenza neuraminidase sequence. our results suggest that cd8 t cell cross - reactivity influences the severity of the hcv - associated liver pathology and depicts a model of disease induction that may apply to different viral infections.
naja sumatrana, commonly known as the black spitting cobra or equatorial spitting cobra, is the dominant cobra species in peninsular malaysia, singapore, borneo, and sumatra. it was estimated that the highest burden of snake bites exists in south asia, southeast asia, and sub - saharan africa. cobra bites are common in peninsular malaysia and require significant medical intervention [3, 4 ]. however, snake bites are considered uncommon in largely urban singapore [5, 6 ]. it is an equine polyvalent antivenom raised against the indian binocellate cobra (naja naja), common krait (bungarus caeruleus), russell 's viper (vipera russelli), and saw - scaled viper (echis carinatus). the antivenom composition of the haffkine was chosen for the treatment of black spitting cobra snake bites due to the empirical belief that cobras are originated from the naja naja. it is unknown if the haffkine product has any effective paraspecific activity against the naja sumatrana venom. there have been no previous papers that report the outcomes of patients given this antivenom for black spitting cobra bites. this study aims to examine if effective cross - neutralisation exists for naja sumatrana envenoming when using the haffkine antivenom. using comparable doses of naja naja or naja sumatrana venom, this study analysed the neutralising capability of the haffkine antivenom in a mouse model. this was followed by a challenge test by giving a fixed dose of naja sumatrana venom intramuscularly and subsequent attempt at rescue with the antivenom. naja naja venom was purchased from accurate chemical corporation (new york, usa). naja sumatrana venom was pooled from five local adult naja sumatrana cobras housed at the zoo, lyophilised, and stored at 20c. the antivenom used was a commercial product from the haffkine bio - pharmaceutical corporation (mumbai, india). ethics committee approvals from tan tock seng hospital (ttsh) and singapore zoo were first sought. the experiments were carried out in the animal research laboratory at ttsh. only male swiss albino mice about five weeks of age were used. the mice were bred locally at the laboratory animals centre and weighed between 25.5 and 37.5 grams. the ld50 is the dose of venom required to kill 50% of mice within 24 hours. the lethal toxicity was determined by injecting 0.2 ml of venom, at various concentrations per mouse, into the tail vein. the injections were performed using a 1 ml syringe fitted with a 29-gauge needle. the ed50 is the dose of antivenom required to produce 50% survival of mice within 24 hours when used against intravenous venom at 2.5 ld50 for each mouse. the venom and antivenom were incubated prior to intravenous administration. lyophilised venoms of naja naja and naja sumatrana the haffkine antivenom used to neutralise both types of cobra venom was reconstituted from the same batch. venom at 2.5 ld50 and antivenom of various concentrations were mixed and incubated at 37c for 30 minutes prior to injection. each mouse was injected with 0.2 ml of venom - antivenom mixture into the tail vein. each was given an intramuscular injection of arbitrarily two times the intravenous ld50 into the left thigh muscle from the same batch of reconstituted lyophilised naja sumatrana venom, in 0.05 ml. after two minutes, this was followed by an intraperitoneal administration of haffkine antivenom at various concentrations, in two ml. one - way anova was used to compare the mean weight of the mice for the four groups. level of significance was set at 5%, and data analysis was carried out using spss (illinois, usa). in most of the groups compared the mice were similar in weight. the mean difference in weight for the overall groups of mice was significant (p = 0.022, by one - way anova). pairwise comparisons using the bonferroni method showed significant difference between the weight of mice used for naja naja ed50 and that of naja sumatrana ed50 determination (p = 0.028). however, the actual difference in the means was only 1.96 g. table 1 summarises the weight of the mice used. the cohort of mice used in the in vivo challenge test was also significantly smaller than those used in the preincubation experiments. after tail - vein injection of venom, both groups envenomed with naja sumatrana and naja naja venom exhibited weakness and diminished physical activity prior to death. table 2 summarises the survival of the mice at 24 hours at various naja naja venom concentrations, and table 3 for the naja sumatrana venom. the ld50 of naja naja venom was 78.13 g, standard error (se) 13.3 g. the ld50 of naja sumatrana venom was 55.5 g, se 12.0 g. results of the preincubation experiments are summarised in tables 4 and 5, for naja naja and naja sumatrana, respectively. the data showed a similar dose - response relationship, with improved survival on higher doses of antivenom, with the venom load fixed at 2.5 ld50. the ed50 of the haffkine antivenom against naja naja venom was 45.9 mg, se 7.5 mg. the ed50 of the haffkine antivenom against naja sumatrana venom was 73.9 mg, se 12.0 mg. after the initial intramuscular envenoming, the mice exhibited paralysis in the left leg but continued to be mobile. the intraperitoneal ed50 against 111 g intramuscular naja sumatrana envenoming was 136.95 mg, se 36.74 mg. there was no local tissue destruction over the site of injection 24 hours later among the surviving mice. there have been no published studies addressing antivenom therapy in naja sumatrana envenoming, but this species represents the dominant venomous snake in this region. beyond this region, the species might also be found in zoos or in private collections. the haffkine polyvalent antivenom exhibits effective cross - neutralisation against naja sumatrana venom, revealing a stepwise improvement in survival with increasing antivenom dose. the ed50 was higher than the usual effective dose required for naja naja neutralisation in preincubation experiments. however, it is not clear which fraction or a combination of fractions of the naja naja, bungarus caeruleus, vipera russelli, or echis carinatus antibodies that drove the results we obtained. an in vivo challenge using intraperitoneal haffkine antivenom, given following the intramuscular naja sumatrana envenoming, also showed a stepwise dose response as the dose of antivenom was increased. the quality of snake venom varies between individual snakes and within the same snake milked on different occasions. to improve the consistency of the venom and minimise stress to the snakes likewise, the antivenoms used were checked to ensure they belong to the same batch in manufacture. ld50 experiments sought to standardise the lethal dose for each venom in this particular mouse model. ed50 experiments compared the neutralising capacity of a standard antivenom against a comparable venom load. these parameters were useful in the present cross - neutralisation study, and would also prove useful in future antivenom or intervention studies on the subject. preincubation experiments were chosen initially to investigate if the haffkine antivenom had any efficacy against the naja sumatrana venom. this was considered better than gel diffusion experiments as apparent reactions in gel diffusion plates occur in vitro and may not be uniformly associated with survival. it was anticipated that there would be immediate bioavailability if antivenom was given intravenously ; but if venom was administered intramuscularly or subcutaneously, it would have slower onset, more sustained effect, and could remain lethal after the effects of intravenous antivenom have worn off. preincubation experiments were chosen as this technique would control the differences in venom and antivenom bioavailability that may confound the results. only male mice were used to avoid intergender difference in survival if any. to validate the results, the intraperitoneal ed50 of the haffkine antivenom against naja sumatrana was indeed higher than the ed50 in preincubation studies due to the reduced bioavailability of intraperitoneal antivenom compared to the inherently efficient intravenous availability of antivenom in preincubation studies. in anticipation of this, the higher dosages of antivenom required would not be easily miscible in the small volumes compatible with intravenous tail - vein administration. the intraperitoneal route was chosen, as it allowed for greater volumes for antivenom dilution to occur. the intramuscular envenoming followed by a single dose of intraperitoneal antivenom exhibited compatible pharmacokinetic properties to allow for the observations made in the in vivo challenge tests. the ld50 varies according to the route of administration, and the intramuscular ld50 was not determined. in the in vivo challenge test, twice the preincubation naja sumatrana intravenous ld50 dose (111 g) was arbitrarily used intramuscularly, while we explored the ed50. the choice of this dose did not affect the comparisons which were made between groups of mice that differed only in the intraperitoneal doses of the antivenom. the 1.96 g difference in mean weights between the mice used for naja naja ed50 and naja sumatrana ed50 determination was not significant in practice. it was more crucial for the mice used for ld50 and its corresponding ed50 for the same venom to be comparable. the venom of the naja sumatrana shares similar composition with naja naja [11, 12 ]. cobras have l - amino acid oxidase, phospholipase a2, protease, phosphodiesterase, 5-nucleotidase, alkaline phosphomonoesterase, hyaluronidase, and acetylcholinesterase in common. these similarities in the lethal components of the venoms may explain the paraspecific activity of the haffkine antivenom against naja sumatrana venom. however, regional differences in venom composition may limit the explanation that could be derived from the similarities in venom composition. this experiment was conducted using mice, and the difference between their metabolism and that of humans is significant, but the results would probably hold true for humans. the findings should be correlated with clinical observations in humans. a higher dose of 1.6 times was determined using pre - incubation experiments, and it would likely not apply in a clinical situation. the observations were made over 24 hours, focusing on the acute lethal effects of naja sumatrana venom from neuromuscular paralysis. beyond 24 hours, the venom could remain lethal from other mechanisms, for example, haematological disorders not studied in this experiment. the experiment reveals effective paraspecific activity against paralysis, between haffkine antivenom in naja sumatrana envenoming, when used at a higher dose in this model. the haffkine is a viable choice of antivenom available to address naja sumatrana envenoming until specific antivenom is developed, and treatment could be instituted at more efficient and perhaps safer doses	naja sumatrana is the dominant cobra species in malaysia, singapore, borneo, and sumatra, and it does not have specific antivenom. the haffkine antivenom has been advocated instead. this study aims to determine the efficacy of this antivenom against naja sumatrana envenoming using a mouse model. methods. male swiss albino mice were used. intravenous ld50 was first determined separately for naja naja and naja sumatrana venom. ed50 was determined by preincubating antivenom with each venom at 2.5 ld50 before administering the mixture into the tail vein. validation was carried out using a challenge test. each mouse received 111 g of naja sumatrana venom intramuscularly followed by intraperitoneal administration of dilute haffkine antivenom. survival was recorded 24 hours after envenoming. results. the ld50 of naja naja venom was 78.13 g, standard error (se) 13.3 g. the ed50 of the haffkine antivenom against naja naja venom was 45.9 mg, se 7.5 mg. the ld50 and ed50 of naja sumatrana venom were 55.5 g, se 12.0 g ; and 73.9 mg, se 12.0 mg, respectively. the intra - peritoneal ed50 against 111 g intramuscular naja sumatrana venom was 136.95 mg, se 36.74 mg. conclusion. the haffkine polyvalent antivenom exhibited cross - neutralisation against naja sumatrana venom when used at a higher dose.
the setting was the kaiser permanente medical care program of northern california (kpnc), a large group practice prepaid health plan where gdm is diagnosed in accordance with the american diabetes association (ada) guidelines (2,13). the study was conducted in collaboration with the kpnc regional perinatal service center, which provides supplemental prenatal care over the telephone to women with gdm. women with gdm according to the ada criteria (13) were eligible to participate. exclusion criteria included : age 1), and pregravid bmi (1), and pregravid bmi (0.05. because the postpartum weight goals differed between women with pregravid bmi 0.05 except for change in percent of calories from fat (p = 0.001). ninety - three percent of the women randomized to the intervention completed the first prenatal session, and 79% completed two or more. on average, the pregnancy telephone sessions lasted 31.2 17.7 min, while the in - person sessions lasted approximately 1 h. for the early postpartum phase, 74% of the women completed the 8 core intervention sessions. the telephone sessions lasted on average 32.6 15.7 min each, while the in - person sessions lasted approximately 1 h. women returned a median of 3 self - monitoring diaries, with 30.9% returning 6 or more. overall, the women were very satisfied with the intervention (97%) and most (92%) would recommend the program to others with gdm. a majority (82%) said they were likely to continue to set weight goals. two focus groups, each with 8 intervention participants, were conducted upon completion of the study. for physical activity, the following themes emerged : 1) the need for support for physical activity from family and others in their social network ; 2) the addition of a website to connect with other gdm women ; and 3) tips on how to exercise with a new infant. reported barriers to physical activity were personal and child illnesses, returning to work, and bad weather. for diet, the following themes emerged : 1) the need for information on the optimal type of carbohydrate for the transition from the pregnancy diet to the low - fat postpartum diet and 2) the need for low - fat recipes. the proportion of women who reached their postpartum weight goal was higher in the intervention condition (table 2). although this difference was not statistically significant, the condition difference in absolute proportion was 16.1% (p = 0.07) at 12 months postpartum. similar results were obtained after adjusting for 1-h glucose levels and in subgroup analyses where women were stratified by smoking or employment status (data not shown). proportion of women with gdm meeting the postpartum weight goals by randomization group and time since delivery all p values for treatment condition and follow - up visit interaction are > 0.05. because the postpartum weight goals differed between women with pregravid bmi 0.05 except for change in percent of calories from fat (p = 0.001). ninety - three percent of the women randomized to the intervention completed the first prenatal session, and 79% completed two or more. on average, the pregnancy telephone sessions lasted 31.2 17.7 min, while the in - person sessions lasted approximately 1 h. for the early postpartum phase, 74% of the women completed the 8 core intervention sessions. the telephone sessions lasted on average 32.6 15.7 min each, while the in - person sessions lasted approximately 1 h. women returned a median of 3 self - monitoring diaries, with 30.9% returning 6 or more. overall, the women were very satisfied with the intervention (97%) and most (92%) would recommend the program to others with gdm. a majority (82%) said they were likely to continue to set weight goals. two focus groups, each with 8 intervention participants, were conducted upon completion of the study. for physical activity, the following themes emerged : 1) the need for support for physical activity from family and others in their social network ; 2) the addition of a website to connect with other gdm women ; and 3) tips on how to exercise with a new infant. reported barriers to physical activity were personal and child illnesses, returning to work, and bad weather. for diet, the following themes emerged : 1) the need for information on the optimal type of carbohydrate for the transition from the pregnancy diet to the low - fat postpartum diet and 2) the need for low - fat recipes. this pilot study, which evaluated a dpp - based lifestyle intervention that aimed to reduce diabetes risk factors and started soon after the diagnosis of gdm and continued into the postpartum period, was shown to be feasible. thus, the dpp lifestyle intervention delivered by telephone was successfully adapted for women with gdm. the intervention appeared to reduce type 2 diabetes and gdm risk factors such as body weight and dietary fat intake (7,23) and increased breastfeeding. the intervention helped women meet their postpartum weight goals by reducing postpartum weight retention in normal - weight women and helping overweight or obese women to lose weight. only two randomized controlled trials have included women with a pregnancy complicated by gdm. in both trials, the affected pregnancies occurred several years prior to study initiation. in the troglitazone in the prevention of diabetes (tripod) trial (8), treatment with troglitazone reduced the incidence of diabetes by over 50%. subgroup analyses (24) among dpp women with a history of gdm demonstrated that intensive lifestyle intervention and metformin both decreased the risk of type 2 diabetes by approximately 50%. our study provides feasibility data suggesting that a dpp - based intervention delivered by telephone in pregnancy through the postpartum period is feasible and effective in women with gdm. the higher proportion of women reaching their postpartum weight goal is mostly because of the postpartum intervention, however the short pregnancy intervention may have promoted some initial behavioral changes, making the postpartum intervention more effective as shown by our subgroup analyses according to gwg. given the strong association between gwg and postpartum weight retention (9,11,25), it may be difficult to intervene and reduce postpartum weight without first preventing excessive gwg. in our stratified analyses, the intervention appeared to be more effective among women who met the guidelines for gwg, either because the postpartum intervention was easier for such women to adopt as they may be more adherent to health recommendations or because of the biological connection between gwg and postpartum weight retention. the limitations are familiar to feasibility studies : a relatively small sample size and an intervention that needed additional refinement, specifically with input from the target population. information learned from this feasibility trial will inform a future, adequately powered, randomized lifestyle intervention trial. there was also a small differential loss to follow - up between the intervention and the usual care conditions. this difference may be because of the translational nature of the study, which did not require participants to attend at least two baseline study visits before randomization, as is common practice in efficacy trials. in conclusion, our study suggests that an adaptation of the dpp lifestyle intervention, delivered primarily by telephone, is feasible for women with gdm. it may also reduce pregnancy weight retention and may help overweight or obese women lose weight in the postpartum period. although the intervention was effective in reducing dietary fat intake, strategies for helping postpartum women to overcome barriers and increase their physical activity are needed. future randomized control trials should focus on developing such strategies, particularly for soliciting social support for increasing physical activity.	objectiveto pilot, among women with gestational diabetes mellitus (gdm), the feasibility of a prenatal / postpartum intervention to modify diet and physical activity similar to the diabetes prevention program. the intervention was delivered by telephone, and support for breastfeeding was addressed.research design and methodsthe goal was to help women return to their prepregnancy weight, if it was normal, or achieve a 5% reduction from prepregnancy weight if overweight. eligible participants were identified shortly after a gdm diagnosis ; 83.8% consented to be randomly assigned to intervention or usual medical care (96 and 101 women, respectively). the retention was 85.2% at 12 months postpartum.resultsthe proportion of women who reached the postpartum weight goal was higher, although not statistically significant, in the intervention condition than among usual care (37.5 vs. 21.4%, absolute difference 16.1%, p = 0.07). the intervention was more effective among women who did not exceed the recommended gestational weight gain (difference in the proportion of women meeting the weight goals : 22.5%, p = 0.04). the intervention condition decreased dietary fat intake more than the usual care (condition difference in the mean change in percent of calories from fat : 3.6%, p = 0.002) and increased breastfeeding, although not significantly (condition difference in proportion : 15.0%, p = 0.09). no differences in postpartum physical activity were observed between conditions.conclusionsthis study suggests that a lifestyle intervention that starts during pregnancy and continues postpartum is feasible and may prevent pregnancy weight retention and help overweight women lose weight. strategies to help postpartum women overcome barriers to increasing physical activity are needed.
florid cemento - osseous dysplasia (fcod) refers to a group of fibro - osseous lesions, which are exuberant, multiquadrant and arise from the tooth - bearing area of the jaws. fcod is a benign jaw lesion and is discovered most frequently in the mandible of middle - aged black female. it usually presents a multiple radiopaque bone / cemetum - like masses distributed throughout the jaw. fcod lesions have a striking tendency towards bilateral, often quite symmetrical, location, and it is not unusual to find extensive lesions in all 4 posterior (molar - premolar region) quadrants of the jaw. the word " florid " was introduced to describe the wide spread, extensive manifestations of the disease in multiple quadrants of the jaws. the various synonyms used are multiple enostoses, multiple cemento - ossifying fibromas, multiple periapical osteofibromatosis, florid cement - osseous dysplasia and gigantiform cementom. in 2005, world health organization subdivided cemento - osseous dysplasias (cods) into periapical, florid and other cods. the definite diagnosis of these 3 diseases can not be reached by clinical ground, but only by histopathologic examination. although, the disease may be totally asymptomatic, some patients present with pain, swelling, purulent discharge and sequestrum formation. rare reports of its association with simple bone cysts (sbc) are present usually when the cases reported are symptomatic. melrose and co - workers were the first to observe this association in their series of 34 cases, where 14 patients had concurrent, biopsy - proven simple bone cyst. fcod is not associated with any other extragnathic abnormalities and there are no abnormalities in blood chemistry of patients. most benign fibro - osseous lesions of jaws are asymptomatic and slowly progressing. those benign fibro - osseous lesions that present as an atypical radiographic appearance require a detailed clinical, radiographic and laboratory workup to arrive at a diagnosis. for the asymptomatic patient, the best management consists of regular recall examinations with prophylaxis and reinforcement of good home hygiene care to control periodontal disease and prevent tooth loss. the case presented here highlights a rare combination of fcod co - existing with a multilocular radiolucency. computed tomography (ct), because of its ability to give three - dimensional axial, sagittal, and frontal views, is useful in the evaluation of these lesions. this paper presents the case of a patient, who was diagnosed with fcod on the basis of clinical and radiographic findings. we hereby report one rare case of co - occurrence of florid cemento - osseous dysplasia with simple bone cyst presenting with symptoms of pain and swelling in the jaw. 41 year old female patient reported to the department of oral and maxillofacial radiology, ab shetty memorial institute of dental sciences, nitte university, deralakatte, mangalore, karnataka, india, with a complaint of pain in the right posterior region of the mandible since 4 days. the pain radiated to the right side of the face, and was continuous in nature. patient gave a history of extraction of a tooth in the same region 2 years ago. tooth was extracted due to decay, after which timely healing did not occur and was associated with mild intermittent pain. extraoral examination revealed single diffuse smooth swelling on the right side of the jaw, approximately 1 x 1 cm in size, with normal overlying skin (figure 1). right submandibular lymph nodes were tender on palpation. clinical photograph of the patient showing swelling on the right side of the cheek (white arrow). normal response was seen in all the teeth, when electric pulp testing was carried out. superiorly, it extended 0.5 cm from the crest of the edentulous alveolar ridge and presented with scalloped border, with incomplete septa running into the radiolucency (figure 3). the inferior and anterior extent of the radiolucency were not clear, hence an opg was suggested. intraoral periapical radiograph showing well defined radiolucency with scalloped border (white arrows). orthopantomography revealed well defined radiolucency in the body of mandible on the right side, measuring approximately 3 x 4 cm. it was present in the region of teeth # 46, # 47 and # 48 involving the periapical area of # 45 anteriorly, up to the anterior border of the ramus posteriorly. the radiolucent area extended superiorly up to 0.5 cm from the edentulous alveolar crest and 0.5 cm above the lower border of the mandible. multiple mixed radio - opacities were present around the periapical region of all mandibular teeth above the level of the mandibular canal. the radiolucency was also observed at the periapices of teeth # 18, # 12, # 26 and # 28 in the maxilla suggestive of a fibro - osseous lesion. the radio opacities presented with a radiolucent halo around them (figure 4). mandibular occlusal view of the same region revealed expansion of the buccal and lingual cortical plates with presence of multiple internal loculations (figure 5). orthopantamogram showing multilocular radiolucency on the right body of the mandible (white arrow) and multiple radio opacities in all the quadrants of both jaws (yellow arrows). mandibular occlusal radiograph showing cortical expansion and internal loculations (encircled in yellow). based on these radiological findings, lists of differential diagnoses for the radiolucenct, as well as radio - opaque areas were made. for the multilocular radiolucency ameloblastoma, odontogenic keratocyst, simple bone cysts were enlisted and for the diffuse radioopaque lesion, diffuse sclerosing osteomyelitis, florid cemento - osseous dysplasia, paget 's disease were enlisted as differential diagnoses. to determine the boundaries of the lesion preoperatively, it revealed, a well defined expansile osteolytic lesion measuring approximately 1.7 x 2.3 x 2.7 cm in size in the right body of the mandible at the level of the molar teeth. there is a narrow zone of transition (figure 6). ct section showing a well defined expansile osteolytic lesion in the right body of the mandible (yellow arrow). multiple patchy well defined hyperdense lesions with hypodense rim were observed in the body of mandible located above the level of mandibular canal, between the inter - radicular and inter - dental areas of maxilla and mandible (figure 7 and figure 8). the ct scan findings were consistent with florid cemento - osseous dysplasia - stage iii (mature stage). coronal ct section showing multiple patchy well defined hyperdense lesions with hypodense rim were observed above the level of mandibular canal (yellow arrow). sagittal ct section showing multiple patchy well defined hyperdense lesions with hypodense rim (yellow arrows). surgical exploration of the multilocular lesion showed connective tissue that was tightly adherent to the surrounding bone and was devoid of epithelium. the area was thoroughly cleaned with curette and the adjacent bony areas were sent for histopathological examination. internal titanium plate fixation was done to the lower border of the mandible to avoid pathologic fracture due to thinning of the cortex (figure 9). histological examination of the tissue lining the bony cavity revealed presence of fibrocellular connective tissue with osteoid areas as well as mineral deposition within them. the connective tissue shows spindle shaped fibroblasts and collagen fibres. blood vessels and chronic inflammatory cells in the form of lymphocytes were additionally identified (figure 10). hematoxylin and eosin stained histopathological section (original magnification x10) of periapical bone and buccal cortex in the region of teeth # 45 and # 46 showing immature bone with osteocytes. histopathological examination of stained slides of periapical bone and buccal cortex in the region of teeth # 45 and # 46 shows immature bone with osteocytes. hematoxylin and eosin stained histopathological section (original magnification x40) of cavity lining showing fibrocellular connective tissue with osteiod areas within them (black arrow). based on these histopathological, as well as supporting clinico - radiological findings a confirmative diagnosis of florid cemento - osseous dysplasia co - occurring with simple bone cyst was made. fcod is the most common pathologic condition of the jaws that occurs as radiopacities in multiple quadrants of the tooth - bearing regions of the jaws. this disorder is strictly localized to the tooth bearing areas and not associated with any other skeletal disease. however, the etiopathogenesis is not clear. waldron. have proposed that reactive or dysplastic changes in the periodontal ligament might be a cause for the disease. this condition has also been classified by various authors as sclerosing osteomyelitis, sclerosing osteitis, sclerotic cemental masses, gigantiform cementoma, and various other terms. fcod is a benign fibro - osseous lesion in which mature bone is replaced with a woven bone in a matrix of fibrous connective tissue. fcod is a rare disease entity especially in the indian population ; only 2% cases have been reported among the indians in the literature. these lesions are most commonly seen in middle - aged black women, although it may also occur in caucasians and asians. clinically, these lesions are often asymptomatic and may present as an incidental radiological findings. symptoms such as dull pain or drainage are almost always associated with exposure of sclerotic calcified masses in the oral cavity. no such features were seen in our case. this may occur as a result of progressive alveolar atrophy under a denture or after extraction of teeth in the affected area. the patient presented herein, underwent tooth extraction 2 years ago after which the healing did not occur. occasionally patients may also present with complaint of intermittent, poorly localized pain in the affected bone, especially when a simple bone cyst has developed within the lesion. progressive increase in the bulk of the lesion was seen in case report presented by miyake and nagahata. waldron suggested that periapical cemento - osseous dysplasia and focal cemento - osseous dysplasia may also develop into florid cemento - osseous dysplasia. a simple bone cyst can be found in association with benign fibro - osseous lesions such as cemento - osseous dysplasia and fibrous dysplasia. some reports have described an association between solitary bone cysts and fibro - osseous lesions including fibrous dysplasia and cemento - osseous dysplasias. venous obstruction and blockage of interstitial fluid drainage, in these areas of rapidly growing and remodelling cancellous bone, may lead to formation of the simple bone cysts. in our case, an elective surgical procedure including biopsy was not performed, because of the risk of secondary infection. secondary infection occurs in such lesions due to abundant cementum formation and poor vascularity. radiographically, fcod is characterized by extensive sclerotic areas, often involving the posterior quadrants of the mandible and maxilla in a symmetric fashion. fcod is a diffuse form characterised by multiple periapical lesions involving one or both the jaws. it occurs around the root apices of vital tooth in middle - aged women with a predilection for mandibular incisors. in the early stage, it appears as a well defined radiolucent lesion, which gradually becomes totally radiopaque with a thin lucent rim in the mature stages. asymptomatic lesions do not require intervention because, complete resection of the lesion would be impractical as it usually occupies most of the mandible and maxilla. when surgical intervention is indicated, a remodelling resection is recommended for aesthetic reasons. histopathologically, fcod is composed of a proliferating fibrous connective tissue stroma containing foci of cementum along with the presence of osteoid or bone., large sclerotic masses are formed that are hypocellular and extremely dense with small marrow spaces and few haversian systems. the simple bone cysts that occur without any association with cemento - osseous dysplasia tend to heal better after surgery than those associated with cemento - osseous dysplasia. the histological features of simple bone cysts are mostly non - specific, and when a tissue is submitted from this lesion, a microscopic examination will reveal only a strip of fibrous connective tissue, occasionally with an associated rim of bone. expansion of the buccal and lingual cortical plates is not observed in fcod unless associated with cystic changes. a similar finding supported our case. as differential diagnosis we can include paget 's disease which would present radiologically with cotton - wool appearance and diffuse sclerosing osteomyelitis which can also be a complication associated with fcod. paget 's disease is also characterized by deformities of multiple bones and produces biochemical serum changes, such as elevated alkaline phosphate levels. regular follow - up during six month was maintained and patient reported to be asymptomatic after the surgery. the management of florid cemento - osseous dysplasia may not be satisfactory, since the disease process may run for a very long time without any symptoms. when patients are asymptomatic, optimum oral hygiene has to be maintained to avoid tooth loss and periodontal disease. elective intraoral procedures have to be avoided due to the associated risk of infection or subsequent osteomyelitis and fracture. when the patient is symptomatic secondary to a tooth pain, the tooth may be managed endodontically by avoiding extractions. since our patient will require frequent scans during the follow - ups, imaging modalities with lesser radiation doses have to be employed. the treatment options should be easily available and accessible, affordable to the masses without hampering the aesthetics and function of the patient.	abstractbackgroundthe purpose of this report is to present a rare case of co - occurrence of florid cemento - osseous dysplasia with simple bone cyst in a middle aged asian woman. most of the reported cases are isolated cases of simple bone cyst or florid cemento - osseous dysplasia, but co - occurrence of these two entities is extremely rare.methodsthe authors report a 41 year old female patient with co - occurrence of mandibular florid cemento - osseous dysplasia with simple bone cyst. a thorough clinical and radiological examination was carried out.resultsit was diagnosed mandibular cyst with possible co - occurrence of florid cemento - osseous dysplasia. surgical exploration of the multilocular lesion was applied. since, the patient was symptomatic at the time of presentation utmost caution was taken during the surgical procedure as florid cemento - osseous dysplasia is associated with hypo - vascularity of the affected bone. based on histopathological, as well as supporting clinico - radiological findings a confirmative diagnosis of florid cemento - osseous dysplasia co - occurring with simple bone cyst was made. patient was followed - up for a period of six months and was reported to be asymptomatic.conclusionstimely diagnosis and well planned treatment is important to obtain a good prognosis when a rare co - occurrence of two or more bone lesions affects the jaws.
gaucher disease (gd) is an autosomal recessive lysosomal glycolipid storage disorder characterized by the accumulation of glucocerebroside (glucosylceramide) in reticuloendothelial cells. the gene coding for the deficient enzyme glucocerebrosidase (acid beta - glucosidase) is located on chromosome 1q21.three phenotypes are traditionally recognized based on the absence (type 1) or presence and severity (types 2 and 3) of cns involvement. specific mutations in the beta - glucocerebrosidase gene are associated with specific clinical presentations, for example, the l444p mutation produces neurologic involvement. the liver, the spleen, and long bones are the primary organs affected by the storage of glucosylceramide, mainly derived from the normal turnover of leukocytes and erythrocytes. the highly cytotoxic substance glucosylsphingosine (the nonacyl derivative of glucosylceramide) is also stored in excess in the viscera and in the brain, leading to cell death. such neuronal destruction involves mainly the brain stem and deep cerebellar nuclei, but the thalamus, basal ganglia, and spinal cord are also affected. type 3 (gd3) represents the subacute, juvenile neuronopathic form, with onset in the teenage years and a chronic course. the severity of gd3 is intermediate between type 1 (gd1) and type 2 (gd2) with milder neurological features. the first symptoms are due to the massive visceral involvement, and disorders of eye movements are the usual presenting signs. adult patients [4, 5 ] in whom symptoms had begun in late childhood, adolescence, or early adult years present myoclonic epilepsy and a distinctive supranuclear eye movement disorder affecting primarily horizontal gaze and only occasionally vertical gaze [79 ]. the early defect in horizontal gaze involves the saccadic system, and the disorder mimics closely congenital ocular motor apraxia. ocular motor abnormalities include horizontal saccadic initiation failure (sif), with blinking, strabismus, slow horizontal and downward saccades, and an abnormal vestibulo - ocular reflex. horizontal sif is the most consistent finding and is frequently the first sign of neurological involvement. vertical sif usually indicates a progression of the disease, even if one case with vertical without horizontal sif has been pointed out. both quick phases of optokinetic nystagmus and voluntary saccades can be used to early detect and follow the neurological involvement. the phenotypic continuity between nonneuronopathic and severe acute neuronopathic forms of gaucher disease (gd) is emerging from the literature [1416 ], contrary to a clear - cut distinction among the classical gd1, gd2, and gd3 types. in a large series of french patients, the clinical characteristics suggest that the three forms of gd each involves a different profile of neurological manifestations. gd1 is treatable with appropriate amounts of exogenous enzyme (imiglucerase) replacement therapy (ert), whose safety and efficacy have been clearly documented. ert is however unable to stop the progression of the neurological involvement. due to the fact that infusion of glucocerebrosidase increases enzyme activity in the cns if a dosage of 120 u / kg body weight or higher is given, the role of such high - dose ert in neuronopathic cases was studied : it was concluded that the latter is not able to stabilize neurological disease. to protect the brain of gd patients, substrate reduction therapy (srt) performed by n - butyldeoxynojirimycin (miglustat) could be an alternative. the formation of glycosphingolipids is decreased to amounts that may be metabolised by the residual enzyme. in patients with visceral gd, the efficacy of srt with miglustat has been demonstrated, while the benefit of miglustat also for patients with neuronopathic gd is not proved, given the contrasting results obtained [23, 24 ]. in this paper, the clinical history of two gd sisters, initially treated with ert, is described. one of them developed saccadic eye movement alterations that disappeared after two years of miglustat therapy. two sisters (f. i. and a. i.), out of 7 siblings (5 females, 2 males), offspring to second cousin parents, presenting the same genotype (r353g / r353 g), were gd diagnosed in 1983 and both submitted to splenectomy in the same year. during adolescence, they presented epilepsy responsive to barbiturate : generalized tonic - clonic seizures (patient f. i.) and partial complex seizures (patient a. i.). a first saccadic eye movements recording was carried out in both patients in year 2000, during their annual clinical control. f. i., born in 1961 and suffering from hepatosplenomegaly, anemia, thrombocytopenia, and bilateral necrosis of the femoral epiphysis at the moment of diagnosis, began ert in 1995 (alglucerase / imiglucerase : 30 u / kg every 2 weeks). at that time she showed liver cirrhosis without signs of liver insufficiency ; focal spike activity at eeg (left temporal region) ; normal visual evoked potentials (vep) and auditory brain responses (abr) ; increased threshold intensity and reduced amplitude at upper limb motor - evoked potentials. the 2005 control brought out that in the previous 5 years ert therapy had been performed without continuity ; therefore, treatment was changed to srt miglustat (200 mg, 3 t.i.d) oral therapy. the barbiturate therapy continued. at the 2007 control, liver volume remained stable, no bone fracture was reported or detected, and the eeg proved unchanged (infrequent focal paroxysmal discharges). the miglustat treatment was confirmed owing to the absence of adverse events (gastrointestinal disturbances) in the two years of oral treatment. a. i., born in 1967 and suffering from splenomegaly, anemia and thrombocytopenia at the moment of diagnosis, began ert in 2002 (regularly performed) because of a hepatic involvement (imiglucerase : 15 u / kg every 2 weeks). at that time she did not manifest neurological signs and had normal eeg and abr, so that the barbiturate therapy was stopped. she changed the treatment to srt miglustat (100 mg, 3 t.i.d.) too, oral therapy, that was confirmed at the 2007 control, thanks to the tolerability of the oral treatment. saccadic movements of both eyes were recorded by means of the infrared limbus tracking technique (a very accurate technique in cooperative patients), with the subject looking at a target (a red light spot) in random horizontal motion, in a visual range of 15 deg with amplitudes of 5, 10, 15, and 20 deg. the ophthalmic and orthoptic examinations, performed before each saccadic test, showed the absence of relevant ocular and/or oculomotor disturbances. for each identified saccade, the amplitude (a), duration (d), latency, and peak velocity (vp) were calculated. a / d and a / vp relationships (main sequence) were evaluated and best fitted. for the a / d relation a linear regression (d = ma + q) was used, while for the a / vp relation the fitting curve was derived from the function vp = 1/(+ /a). the k (mean velocity / peak velocity ratio) and skewness (saccadic rise time / duration ratio) parameters, able to provide a description of velocity responses, were also evaluated [25, 26 ], and their relationships with the amplitude (a / k, a / skewness) were examined by linear best fitting (k = mka + qk ; skewness = msa + qs). at a first examination of the acquired traces, a worsening was evident in the second test performed by f. i., with some sif tracts and frequent blinks ; a recovery was instead evident in the last recording. the saccadic parameters, resulting from all the six registrations, are summarized in table 1, where the normal values (obtained from a sample of 10 normal adult subjects performing the same test) are also indicated. while a. i. presents normal values in the three tests, f. i. shows a significant alteration of the main sequence at the second test, characterized by saccadic slowing (lower 1/ values in the a / vp relationship, p <.05) with duration increase (greater m slope in the a / d relationship, p <.01) and a subsequent improvement after miglustat therapy. moreover, from 2000 to 2007 she presents a large reduction in mk slope and an increase in ms slope in the a / k and a / skewness relationships, respectively, even though their values appear within the normal confidence interval (table 1). the two patients were initially treated with an ert dosage for gd1, because epilepsy was considered a casual event not correlated to the cns glycolipid storage observed in gd3, and the barbiturate therapy was effective. in fact, even if it is known that barbiturate treatment could affect eye movements, in f. i. the therapy was always the same ; therefore, it is unlikely that the eye movement changes could be due to barbiturate. in f. i., with more important visceral symptoms, ert was started more precociously, but during the 20002005 period it was performed with considerable discontinuity because of the unaccepted administration route. at the second eye movement recording control (2005), the presence of oculomotor abnormalities is a sufficient condition to change the classification from nonneuronopathic to neuronophatic illness type, as indicated by harris. and accardo. her r353g / r353 g genotype, already proposed as a neurological type because of the presence of epilepsy, is confirmed as neurological owing to the onset of the new oculomotor alterations. we underline that in spite of the gd1 ert dosage therapy, till about 40 years of age no evidence of neurological involvement (if we exclude epilepsy) was present ; this indicates a low grade of neurological aggressiveness of this genotype. after two years of miglustat therapy, the oculomotor signs disappeared, showing the efficacy of srt to improve (even by itself and not only if combined with ert [23, 24 ]) some neurological symptoms. a positive result in one gd3 patient with myoclonic epilepsy was reported by capablo. using a combined ert and srt therapy. in our case srt therapy alone did not influence the course of epilepsy, while it normalized saccades. on the contrary, a controlled trial in 30 gd3 patients, where miglustat was used in addition to ert, did not show significant differences in the neurological signs (included saccadic eye movement characteristics) in a 24-month period, while a positive effect on systemic disease (pulmonary function and chitotriosidase activity) was observed. the vertical and horizontal saccadic velocities were significantly different between the gd patients and 10 age - matched control subjects at the starting point, but the standard deviation in the gd group was very large, therefore including cases with low velocities and other cases with normal ones. our case presented a clear peak velocity reduction, only 259 deg / s, which became 851 deg / s after two years of therapy (srt alone), a very large variation (confirmed by two tests). to compare our results to other clinical cases, it would be interesting to know whether gd patients with the lowest saccadic velocities in the schiffmann. series clearly improved their ocular motor ability after miglustat therapy (together to ert). in a. i., the clinical picture appears unchanged in the 2005 and 2007 controls : the eye movements were normal as in 2000. in spite of the low dosage therapy and of the neurological genotype r353g / r353 g, at an age of 38 years she did not yet show other neurological signs (in addition to the temporary epilepsy). perhaps, the change of therapy (from ert to srt) did not permit any further mild neurological manifestation. concerning the presence of epilepsy, it was initially considered as a casual event in the two patients. after the appearance, in f. i., of new ocular motor pathological signs, it seemed more probable that epilepsy was part of the neurological picture of some gd3 patients. however, the inefficacy of the srt therapy on eeg paroxysmal, with the necessity to maintain the barbiturate therapy, seems to indicate a low grade of brain activity of srt, probably able to recover from only light and initial neurological manifestations. considering the clinical course in the two siblings, it can be hypothesised that the r353 g homozygote genotype corresponds to a low - aggressiveness and late - onset gd3 illness. in f. i., eye movement analysis permitted to point out the new slight neurological worsening, showing once more the value of this instrumental examination in monitoring the neurological situation, including the efficacy of therapy. in gd patients, beside eye movement examination, it is suitable to execute other exams able to investigate the brain - stem reticular formation, particularly those regarding the auditory pathways. in fact, ocular motility is not the only neurological aspect showing up at the beginning of gd3, even if it is the most precocious. thus we recommend the convenience to exam periodically ocular motility in gd patients with risks genotypes to develop neurological symptoms. it was previously reported that some gd1 patients present some slight eye movement alterations, related to saccadic velocity profiles, or evident neurological symptoms, bringing forward the concept of a phenotypic continuum from gd1 to gd3 classification. this concept is similar to the one that was already proposed by goker. for the heavy neurological involvements : a continuum between gd2 and gd3 classification. the results of the present study seem to be in agreement with this new approach to the evaluation of gd patients.	in gaucher disease (gd) the enzyme (imiglucerase) replacement therapy (ert) is not able to stop the progression of the neurological involvement, while the substrate reduction therapy (srt), performed by n - butyldeoxynojirimycin (miglustat), is an alternative that should be evaluated. two sisters, presenting the same genotype (r353g / r353 g), were diagnosed as suffering from gd ; one of them later developed neurological alterations identified by quantitative saccadic eye movements analysis. the aim of the study was to quantitatively measure the miglustat effects in this gd neurological patient. eye movement analysis during subsequent controls was performed by estimating the characteristic parameters of saccadic main sequence. the study demonstrates that the srt alone can be effective in gd3. moreover, it confirms that quantitative eye movement analysis is able to precociously identify also slight neurological alterations, permitting more accurate gd classification.
up to 10% of newborn infants require admission to the neonatal intensive care unit (nicu) for ongoing medical care [13 ]. antibiotic administration is known to perturb the composition of the intestinal microbiota, resulting in suppression of anaerobic bacteria (with the exception of clostridia, which remain at detectable levels) and increased numbers of potentially pathogenic bacteria such as klebsiella, enterobacter, citrobacter, and pseudomonas [4, 5 ]. since the pioneering microbiota of infancy probably create perpetual habitats for themselves, defining the life - long composition of the gut microbiota and consequently contributing to host health and well - being [6, 7 ] have several reported health - promoting effects, including inhibition of growth of harmful bacteria, stimulation of the immune system, alleviation of constipation, and prevention of intestinal infections [813 ]. species commonly associated with humans include bifidobacterium infantis, b. longum, b. bifidum, b. breve, b. catenulatum, b. pseudocatenulatum, b. angulatum, b. gallicum, and b. adolescensis, of which the first four are prevalent in infants. suppression of the bifidobacteria population as occurred following antibiotic exposure in children [5, 15, 16 ] may have negative effects on host well - being and can be associated with higher susceptibility to enteropathogenic bacterial infection. however, the impact, if any, of parenteral antibiotics prescribed shortly following birth on the developing bifidobacterial population has not been addressed. the aim of this study was therefore to determine the impact of intravenous antibiotic treatment in the neonatal period on the evolution of bifidobacterial colonization over time. faecal material was sampled, using swabs, from 18 infants, nine infants previously treated with antibiotics and nine healthy controls (table 1). approval for the study protocol was obtained from the clinical research ethics committee of the cork teaching hospitals, cork, ireland. inclusion criteria were defined as full or near term infants requiring parenteral antibiotic administration within the first 48 hours of life. control subjects were eligible if they were full or near term infants who were otherwise well and did not require admission to the nicu. infants placed on oral antibiotics, those kept nil by mouth or requiring surgery, infants with congenital anomalies, or those born before term were excluded from the study. the indications for antibiotic treatment were determined clinically, based on symptoms and/or signs of suspected sepsis, and independent of the study investigators. stool samples were taken by the same clinician at four and eight weeks after birth and stored at 20c pending analysis. bacterial dna was extracted from swabs using a qiaamp dna stool minikit (qiagen, hilden, germany) by following the manufacturer 's instructions (lysis temperature, 95c). to investigate the bifidobacterial population in the samples, pcr was performed as a nested approach. the first pcr applied primers im26-f (5- gattctggctcaggatgaacg -3) and im3-r (5- cgggtgcticcccactttcatg -3) described by kaufmann. amplified a 1,417 bp fragment of the bifidobacterial 16s rrna gene. pcr volumes of 50 l contained 5 l of 10 pcr buffer, 5 l of mgcl2 (2.5 mm), 8 l of dntps (0,2 mm each), 1 l of each primer (5 pmol), 0.5 l of taq polymerase (5 u/l), 28.5 l of sterile milli - q water, and 1 l of dna solution. the following pcr program was used : initial denaturation at 94c for 5 min ; 3 cycles of denaturation at 94c for 45 s, annealing at 57c for 2 minutes, and extension at 72c for 1 min ; 30 cycles of denaturation at 94c for 20 s, annealing at 57c for 1 min, and extension at 72c for 1 min ; and final extension at 72c for 5 min followed by cooling to 4c. the presence of pcr products was verified on a 1.5% (w / v) agarose gel. in order to eliminate the remaining oligonucleotides and original template dna, purification of the amplicons was performed by use of the qiaquick pcr purification kit (qiagen) according to the manufacturer 's instructions. a second pcr was performed using the amplicons of the first pcr as template dna. the primer set used (f357-gc and 518r) (5gc - clamp- gcctacggaggcagcag -3 and 5- attaccgcggctgctgg -3, resp.) the forward primer contained a gc clamp (5- cgcccgccgcgcgcggcgggcggggcgggggcacggggg -3) to facilitate separation of the amplicons in a dgge gel. pcr volumes of 50 l contained 5 l of 10 pcr buffer, 2 l of mgcl2 (1 mm), 8 l of dntps (0.2 mm each), 2 l of each primer (5 m), 0.5 l of taq polymerase (5 u/l), 29.5 l of sterile milli - q water, and 1 l of 10-fold diluted dna solution (obtained from the first pcr). the following pcr program was used : initial denaturation at 94c for 5 min, 30 cycles of denaturation at 94c for 20 s, annealing at 58c for 45 s, and extension at 72c for 1 min, and final extension at 72c for 7 min, following by cooling to 4c. pcr products were analyzed on dgge gels based on the protocol by temmerman.. a dcode universal mutation detection system (bio - rad laboratories, hercules, ca, usa) was used, utilizing 16 cm by 16 cm by 1 mm gels. eight percent polyacrylamide gels were prepared and run with 1 tae buffer diluted from 50 tae buffer (2 m tris base, 1 m glacial acetic acid, and 50 mm edta). the denaturing gradient was formed with two 8% acrylamide (acrylamide - bis / acrylamide 40%) stock solutions (severn biotech ltd, worcestershire, uk). a 100% denaturing solution contained 40% (v / v) formamide and 7.0 m urea. the gels were poured from the top by using a gradient maker (cbs scientific linear gradient maker, bio - rad laboratories) and a pump (bio - rad laboratories) and gradients of 50% to 70% were used for the separation of the generated amplicons. before polymerization of the denaturing gel (24 ml gradient volume), a 6 ml stacking gel without denaturing chemicals was added, and the appropriate comb was subsequently inserted. pcr amplicons were separated by electrophoresis at a constant voltage of 60 v in a 0.5 tae buffer at a constant temperature of 60c for 16 h. gels were stained in ethidium bromide for 30 min, allowing digital capturing of the dgge band profiles under uv light. a mixture of five different species of bifidobacteria which are the most commonly isolated species of bifidobacteria from the infant gastrointestinal tract (git) [14, 20, 21 ] was used to create a reference ladder in order to enable a visual comparison of the bands. dna extraction from the reference strains, bifidobacterium breve, b. bifidum, b. infantis, b. adolescentis, and b. longum, was performed according to the method described by hoffman and winston. nine subjects were recruited to both control and antibiotic - treated groups in this study. while the gender distribution and feeding history was similar in both groups, the antibiotic treated infants were more likely to be born by caesarean section (5/9 infants) and all control infants were born by spontaneous vaginal delivery. ampicillin and gentamicin were the only antibiotics used and the median duration of therapy was 2 days (range 29 days). in order to investigate the population of bifidobacteria in the samples, amplicons obtained using these primers served as template dna for the v3 primer combination v3r and v3f, during a second pcr step. the mobility of the pcr products obtained by these primers in dgge was compared with the pcr pattern of bifidobacteria reference strains. because of the high g+c content of bifidobacteria, the conventional 35% to 70% denaturing gradient was replaced with a 50% to 70% denaturing gradient. at four weeks of age, species of bifidobacteria were detected in six out of nine infants treated with antibiotics (subjects a r). the samples from the antibiotic treated infants exhibited a lower number of bands in the dgge gel (figure 1(a)) compared with controls (figure 1(b)) at four weeks of age, representing a less diverse population of bifidobacteria at this age. five of six infants in the antibiotic - treated group showed a single dominant band, which corresponded to b. longum (figure 1(a)). all five infants had been treated with intravenous ampicillin / gentamicin for two days and there were both breast fed (subject f, g) and formula fed (subject d, h, i) infants within this group. the sample lacking a band in the position of b. longum was obtained from an infant that had received antibiotics for five days (subject e). according to the band pattern of this subject, some bifidobacterium species were able to colonize this infant despite antibiotic treatment for five days ; that is, the lower band appears to be b. bifidum, while the upper band is not comparable to any of the species within the reference ladder. all samples from the formula fed controls (k, l, m, q, r) exhibited a band in the same position as b. longum at four weeks of age, except for one infant (subject j) (figure 1(b)). in contrast, samples from the breast fed infants in the control group (n, o, p) showed bands in the positions of b. infantis and b. bifidum. these two species were only found in one of the formula fed infants. while all vaginally born infants in the antibiotic - treated group harboured bifidobacteria by four weeks of age, two out of five infants born by caesarean section harboured bifidobacteria (b. bifidum and b. longum) at this time point. at eight weeks of age, eight out of nine antibiotic - treated infants and all controls had detectable levels of bifidobacteria in their stools. interestingly, the only sample in which bifidobacteria was not detected was from an infant that had received antibiotics for nine days (subject a) (the other infants were treated with antibiotics for 25 days). between four and eight weeks, an increase in bifidobacteria diversity in both groups was observed as evidenced by the increased number of bands (figure 2). nonetheless, while both groups were similar at eight weeks, samples from antibiotic - treated infants continued to display a less diverse population of bifidobacteria when compared with controls (figure 2). the samples obtained from the breast - fed infants in the control group had in general a more diverse population of bifidobacteria compared with formula - fed infants (7 - 8 bands compared with 25 bands, resp.). however, no differences between the samples from the breast - fed and formula - fed infants in the antibiotic - treated groups were observed. moreover, the band with highest intensity at four weeks, identified as b. longum, was replaced by another dominant strain, identified as b. breve, after eight weeks. four of the five infants in the antibiotic - treated group born by caesarean section harboured bifidobacteria by week eight. as found at week four, all vaginally born infants harboured bifidobacteria at eight weeks of age, with a higher diversity observed compared with four weeks of age. overall, b. longum appeared to be the most commonly detected bifidobacterium species in the infants at eight weeks of life (present in 15 out of 17 infants harbouring bifidobacteria) (figure 2). bifidobacterium and lactobacillus species are considered among the most important beneficial bacteria in the human git and their presence in large numbers in the microbiota is regarded as beneficial [23, 24 ]. suppression of these beneficial components could facilitate growth of potentially pathogenic bacteria such as klebsiella and clostridium and have consequences for the well - being of the host. this study demonstrates that even brief parenteral antibiotic treatment alters the pattern of bifidobacterial evolution over time. infants treated with antibiotics showed a reduction in both colonisation and diversity of bifidobacteria compared with controls. while control and antibiotic - treated groups were similar by eight weeks of age, a number of control subjects continued to display a more diverse population of bifidobacteria. reported that the colonisation of bifidobacteria in infants is normally well established by one week of age. it is tempting to speculate that the observed difference in detectable levels of bifidobacteria between the antibiotic - treated infants and controls in our study reflects the early antibiotic exposure. previously described a significant difference in the microbiota of a single infant receiving antibiotics compared to four nonantibiotic treated infants, using similar methodology that is, pcr - dgge and bifidobacterium - specific primers as used in our study. were absent in the antibiotic - treated infant at all time points assessed, from five days to five months of age. however, in that study, the antibiotic - treated subject received prolonged antibiotic therapy with both parenteral and oral agents (thirteen days of parenteral coamoxiclav followed by oral cotrimoxazole). in contrast, the majority of participants in our study had relatively brief periods of intravenous antibiotic administration and yet differences were still observed compared with controls. b. longum was the dominant species in both the antibiotic - treated infants and in the control group. this finding is consistent with the study by grnlund. which found b. longum to be the most common bifidobacterium species present in infants. this result correlates with a recent finding by mtt., demonstrating that b. longum has a higher minimum inhibitory concentration (mic) for ampicillin compared with other bifidobacterium species. thus, it appears that the antibiotic treatment itself may have selected for this species. one infant showed a decrease in numbers of species from three species at four weeks of age to one species at eight weeks of age. the species that showed the highest intensity in the dgge gel after four weeks was replaced by another dominant species after eight weeks. these results are in agreement with a study by favier. in which the initially dominant bifidobacteria in two infants were replaced following the emergence of new species within the study time period. although less than half of the infants in this study were breast - fed, our study confirms previous reports that breast - feeding is positively associated with a more diverse bifidobacterial population compared with formula - fed infants [16, 28, 29 ]. bifidobacterium species are considered among the most important beneficial bacteria in the human git [18, 19, 24 ]. a higher density of beneficial bacteria in infants may confer a degree of protection against childhood diseases. for example, bifidobacterial colonisation has been associated with a lower risk of atopy [21, 30, 31 ]. in a prospective study, children with lower numbers of fecal bifidobacteria and increased numbers of clostridia from the first weeks of life were more likely to become sensitized to common allergens. in addition, it has been reported that differences in the gut microbiota during infancy may precede the onset of obesity. in this study by kalliomki., the numbers of bifidobacterium spp. were higher during infancy in children who remained at normal weight than those in children who became overweight. factors such as breast - feeding, vaginal delivery, and the absence of antibiotic exposure would promote microbial diversity with higher numbers of bifidobacteria. in conclusion, the present study demonstrates that short - term parenteral antibiotic treatment of neonates causes a disturbance in the expected colonization pattern of bifidobacteria in the first months of life. whether a delay in bifidobacterial colonisation could adversely influence health status, either in infancy or later life remains unknown. however, adequately powered prospective studies that document changes in the microbiota and incorporate long - term health status outcomes are needed to further our understanding of the sequelae, if any, of early neonatal antibiotic administration. until such data are available, supplementation with bifidobacteria in this patient group can not be justified.	we investigated the impact of parenteral antibiotic treatment in the early neonatal period on the evolution of bifidobacteria in the newborn. nine babies treated with intravenous ampicillin / gentamicin in the first week of life and nine controls (no antibiotic treatment) were studied. denaturing gradient gel electrophoresis was used to investigate the composition of bifidobacterium in stool samples taken at four and eight weeks. bifidobacteria were detected in all control infants at both four and eight weeks, while only six of nine antibiotic - treated infants had detectable bifidobacteria at four weeks and eight of nine at eight weeks. moreover, stool samples of controls showed greater diversity of bifidobacterium spp. compared with antibiotic - treated infants. in conclusion, short - term parenteral antibiotic treatment of neonates causes a disturbance in the expected colonization pattern of bifidobacteria in the first months of life. further studies are required to probiotic determine if supplementation is necessary in this patient group.
night blindness is a visual disorder associated with visual disturbance during the night or in darkness. in addition, patients with night blindness need more time for accommodation when the lucency of an environment is decreased. night blindness occurs in response to a decrease in rhodopsin in retinal light - sensitive rod cells. night blindness is usually due to retinitis pigmentosa, which is an inherited disorder (1). rhodopsin also decreases in response to vitamin a deficiency (vad) (2). according to a world health organization (who) report, the prevalence of night blindness in iran is moderate (more than 1% and less than 5% in pre - school age children). but this prevalence is highly variable in different areas of iran because of different nutritional situations (3). it is well known that vad is associated with a higher prevalence of night blindness and eye disorders (4). xerophthalmia is advanced form of vitamin a deficiency that is associated with dry and unclear conjunctiva (5, 6). photosensitivity, decreased tearing, ulcers, and infection are also more prevalent in these patients. studies in iran have shown a high prevalence of vad among pregnant women in hormozgan, which is an important health issue in this province (7). the prevalence of night blindness is classically an indicator of nutritional and vitamin a deficiency situations. the aim of the current study is to assess the prevalence of night blindness in bashagard in 2011. this descriptive cross - sectional study was done in the winter of 2011 in the bashagard district, located in hormozgan province. considering the prevalence of night blindness in different studies (2%) and a confidence interval of 95%, a sample size of 819 was selected. considering the geographical diversity of the bashagard district, cluster sampling therefore, the calculated sample size was divided between the covered populations of five health centers (goharan, tisoor, tidar, sar dasht, and jakdan). a checklist (including demographic data such as name, family name, place of residence, covering health center, sex, age, and educational level) was used to collect the data. in the second section the data about the duration of the disease and treatments received for the disease were also recorded. the third section concerned the patient s history of eye trauma, surgery, and ophthalmic infection. in the final section, some questions about nutrition and meat, fruit, and vegetable consumption were asked. table 1 shows the frequency and percentage of the studied people in each of the five health centers. among the 814 people studied, 32 had disturbances in their vision at night. the youngest individual with night blindness was 5 years old and the oldest one was 70 years old. twelve people in tidar, ten in sar dasht, eight in jakdan, one in goharan, and one in tisoor had night blindness. therefore, the prevalence of night blindness in males and females was 3.4% and 4.4%, respectively. the mean duration of the disease was 2.5 years. among all patients, two (6.25%) had physician visits and were using drugs for their disease. another four (12.5%) had physician visits and were using glasses for their disease. one (3.1%) had a history of eye trauma, another one (3.1%) had a history of eye infection, and one (3.1%) also had a history of eye surgery. twenty - one patients (65.6%) had nt met the daily recommended consumption of fruits and vegetables, one (3.1%) had nt even met the once - a - week recommended meat consumption, and three (9.4%) had nt met the twice - a - week milk and dairy recommended consumption. among the 814 people studied, seventy - four were 2 to 6 years old ; among them, one (1.4%) had night blindness. of 341 women between 15 to 49 years old, six among them (1.8%) had night blindness. one of the most important known etiologies is vitamin a deficiency (8). according to who statistics, the prevalence of night - blindness is less than one percent, meaning a mild to moderate prevalence (9). in the current study, we found that the prevalence of night - blindness is 3.93% in bashagard, which is three times greater than the average national prevalence. the prevalence of visual disorders and ophthalmic diseases are higher in this province, which may be due to vitamin a deficiency. the prevalence of night blindness in beshno and cistomacity (9.43% and 9.45%, respectively) indicates a higher prevalence in some areas of bashagard, which calls for immediate action. vitamin a plays a vital role in prevention of the disease and development, in addition to its role in the visual system. it is especially important in children 2 to 6 years old and pregnant women (10). another important point in this study was that about 60% of the participants are non - educated. therefore, they have a low socioeconomic level and need support and attention. according to who indexes, vitamin a deficiency is a important health issue in areas with a prevalence of 1 to 5 percent of night blindness (9). therefore, our findings show that vitamin a deficiency is an important health issue in bashagard. vitamin a deficiency in rural areas and towns in hormozgan is shown in previous studies and needs the attention of health system policy makers. it is shown that vitamin a supplementation and nutrients and also diet changes in the areas with significant levels of vitamin a deficiency can significantly decrease ophthalmic and visual problems. in this study, the initial assessment of a health issue problem in bashagard was done. we recommend other studies on the measurement of vitamin a serum level, ophthalmic assessment, and specific tests and interventions in the study population.	background : night blindness is a visual disorder associated with unusual vision during the night or in darkness. vitamin a deficiency (vad), which is easily preventable, is the main known etiology of night blindness. malnutrition is a common health issue in bashagard and some other areas in the hormozgan province of iran. the aim of the current study was to determine the prevalence of night blindness in bashagard.methods:this descriptive cross - sectional study was done on 814 bashagard residences. data was analyzed using spss software and descriptive studies.results:about 60% of the study participants were uneducated people or people with low education. thirty - two out of 814 people that were studied had problems with night vision. therefore, the prevalence of night blindness in bashagard was 3.93%.conclusion : prevalence of night blindness in bashagard is three times higher than its prevalence in all of iran. therefore, preventive interventions such as dietary regimes with vitamin a enrichments or supplementations are recommended.
here we have reviewed the conventional definitions and fundamental characteristics of the two basic types of stem cells, embryonic stem cells (escs) and somatic stem cells (sscs). by taking into account the often - overlooked asymmetric cell kinetics of sscs, we consider the evidence that should sscs retain these growth kinetics in vitro, a natural kinetic barrier to ssc propagation exists. recent discoveries showing that the tumor suppressor gene p53 can act as a regulator of asymmetric cell kinetics provide a target pathway for in vitro ssc propagation strategies.	abstracthere we have reviewed the conventional definitions and fundamental characteristics of the two basic types of stem cells, embryonic stem cells (escs) and somatic stem cells (sscs). by taking into account the often - overlooked asymmetric cell kinetics of sscs, we consider the evidence that should sscs retain these growth kinetics in vitro, a natural kinetic barrier to ssc propagation exists. recent discoveries showing that the tumor suppressor gene p53 can act as a regulator of asymmetric cell kinetics provide a target pathway for in vitro ssc propagation strategies.
horner 's syndrome, along with weakness and atrophy of upper limb, as well as anaesthesia to pain and temperature, is well recognized finding in patients with syringomyelia. few cases have been reported regarding isolated horner 's syndrome as a presenting manifestation of a chiari i malformation with syringomyelia. we report a 41 year old man with left side hemi hidrosis probably a part of horner 's syndrome who was found to have a chiari i malformation with holocord syrinx. a 41-year - old man presented in medicine ward with a complaint of neck and back pain and loss of sweating in right side of the body that had begun eight months before. there was no history of hypertension, diabetes, and immunocompromised status. on examination whole left side of body including face was dry, there was no evidence of sweating [figures 1 and 2 ]. this test is described as drawing a metal spoon across the surface of the skin after adequate physical exercise. neurological examination was unremarkable with no limb weakness, wasting or numbness and temperature impairment on the side of anhidrosis. this was done to rule out any mass in the upper lobe of the lung which may present as horner syndrome. mri spine was performed which showed hyperintense signal (red arrow head) in t2-weighted sections extending whole spinal cord up to eighth thoracic cord level with herniation of cerebellar tonsil (blue arrow head) compatible with syringomyelia along with chiari i malformation [figure 3 ]. dry left nipple with anhyrosis holocord syrinx up to 8 spinal cord level (red arrow head), herniation of cerebellar tonsil (blue arrow head) syringomyelia is the development of a fluid - filled cavity or syrinx within the spinal cord. more than half of all cases are associated with chiari type 1 malformations in which the cerebellar tonsils protrude through the foramen magnum and into the cervical spinal canal. it may occur after a trauma, secondary to a tumor, craniocervical or intracerebral pathology or idiopathic. fibers originating in the cerebral cortex traverse the hypothalamus, and then cross in the medulla to the lateral horn of the spinal cord. these fibers leave the spinal cord to synapse in the sympathetic ganglia with neurons that innervate the sweat glands. thus, a cortical lesion will cause contralateral anhidrosis, a lesion in the medulla could result in contralateral or ipsilateral anhidrosis, and any lesion distal to the medulla will cause ipsilateral anhidrosis. slowly progressive tissue damage around the syrinx reaches the lateral horn, it will segmentally affect the sympathetic preganglionic neurons or adjacent structures. search for publications dealing with anhidrosis in syringomyelia there was lack of information regarding this. in our case probable hypothesis may be hypo activity due to autonomic disturbances because of progressive and irreversible damage to the sympathetic preganglionic neurons due to expanding syrinx. physicians should be aware of the different ways in which syringomyelia can present to ensure its early diagnosis. anhidrosis of the face and upper part of the body, segmental anhidrosis is reported in horner syndrome and syringomyelia but hemi hidrosis of the whole boy was unique in this case.	we present a 41-year - old man with chiari type 1 malformation and syrinx up to tenth thoracic level who presented with left side hemi anhidrosis. neurological findings of syrinx were absent in this case. though horner 's syndrome is reported, this report is probably first.
oxcarbazepine (oxc), (chemically known as 10,11-dihydro-10-oxo-5h - dibenzo[b, f]azepine-5-carboxamide), is a novel antiepileptic drug, which was developed as a second generation and a follow - up compound to carbamazepine. clinically, it has been used to treat several types of epilepsy [13 ] and bipolar disorders. the ever - increasing use of oxc in pharmaceutical formulations has necessitated its determination as a matter of foremost importance. various analytical methods such as hplc [58 ], hptlc, gc, microemulsion electrokinetic chromatography, capillary electrokinetic chromatography, voltammetry [12, 13 ] and capillary electrophoresis have been reported for the determination of oxc in pharmaceuticals. however, these methods involve the use of expensive instruments which are not available at most quality control laboratories in developing and underdeveloped nations. titrimetry is still widely used in analytical chemistry for its superior speed and simplicity with little sacrifice in accuracy and precision. oxc is present in relatively large amounts (150 to 600 mg per tablet) in pharmaceutical formulations. the simplicity and rapidity of titrimetry is more advantageous especially for macroanalysis over any instrumental methods. since there is no stringent conditions to be maintained, more precise and accurate results are obtained from titrimetry. because of one or the other advantage of titrimetry, it is widely applicable for the assay of many pharmaceutical compounds in many pharmacopoeias. on the other hand, the spectrophotometric technique continues to be used in the assay of different classes of drugs in pure and in pharmaceutical formulations [1518 ]. despite being one of the most widely used antiepileptic drugs, no titrimetric method has been reported for oxc, and even a few visible spectrophotometric methods reported [1921 ] suffer from one or another disadvantage. of the two methods reported by gandhimathi and ravi, the first method uses folin - ciocalteu 's (f - c) reagent in alkaline medium in which blue chromogen measured at 760 nm, whereas the second method involves addition of a fixed volume of 3-methyl-2-benzothiazolinone hydrazine hydrochloride (mbth) after treating of oxc with ferric chloride followed by the measurement of absorbance at 456 nm. the methods obey beer 's law over the linear range of 530 and 1050 g ml for f - c and mbth methods, respectively, and the corresponding molar absorptivity values are 8.06 10 and 3.126 10 the method is based on the reduction of iron(iii) ions to iron(ii) ions by drug, which in presence of hexacyanoferrate(iii) produces green coloured chromogen measurable at 770 nm. this method is applicable over the concentration range of 428 g ml oxc with the molar absorptivity value of 4.63 10 l mol cm. the yellow chromogen with an absorption maximum at 430 nm formed by the reaction of oxc with methanolic koh in dmso medium as the basis for the assay of oxc (linear range 1.07.0 g ml ; molar absorptivity 1.21 10 l mol cm) has been reported by sathish and nagendrappa. all the four reported spectrophotometric methods are less sensitive besides employing either organic solvent medium or heating step. in the present paper, we report one direct titrimetric (method a) and one indirect spectrophotometric (method b) methods using nbs as brominating agent in sulphuric acid medium for the assay of oxc. in titrimetry, the acidic solution of oxc was titrated with nbs in sulphuric acid medium. in spectrophotometry, for the first time, bromopyrogallol red (bpr) has been used to determine the unreacted nbs after completion of the reaction between oxc and nbs in sulphuric acid medium. the proposed methods are simple, highly accurate, and can be readily applied to the determination of oxc in bulk drug and in tablets. a systronics model 106 digital spectrophotometer with 1 cm path length matched quartz cells was used to record the absorbance values. distilled water was used throughout the investigation. acetic acid (2 : 3 and 1 : 9 v / v) and sulphuric acid (10 m) were prepared by diluting appropriate volumes of their concentrated acids (99% glacial acetic acid and 98% sulphuric acid -both from merck, mumbai, india) with water. two brands of tablets namely, trioptal-300 (novartis india ltd, mumbai, india) and oxetol-600 (sun pharmaceuticals, sikkim) were purchased from local commercial sources. an approximately 0.01 m solution was prepared by dissolving an accurately weighed quantity of nbs (loba chemie ltd, mumbai, india, assay 99) in water with the aid of heat. the solution was cooled to room temperature, standardized iodometrically, kept in an ambered coloured bottle, and stored at 4c. for method b, nbs solution after standardization was diluted with water to get a working concentration of 120 g ml. an aqueous 0.03% bpr solution was prepared daily afresh by dissolving an accurately weighed 30 mg of the dye (loba chemie, mumbai, india, purity 99%) in 10 ml of methanol in a 100 ml volumetric flask, and the volume was made upto the mark with water. a stock standard solution containing 2 mg ml oxc was prepared by dissolving 200 mg of pure oxc (jubilant organosys ltd, nanjangud, mysore, india, purity 99.5%) in 40 ml of glacial acetic acid ; the volume was brought to 100 ml with water in a volumetric flask and used for assay in method a. a 100 g ml oxc standard solution was also prepared by dissolving an accurately weighed 10 mg of pure oxc in 10 ml of glacial acetic acid and diluting to the mark with water in a 100 ml calibrated flask, and this was diluted with 1 : 9 acetic acid to get a working concentration of 20 g ml oxc and used in method b. a 39 ml aliquot of pure drug solution containing 618 mg of oxc was accurately measured and transferred into a 100 ml titration flask. ten ml of 10 m h2so4 was added, and the solution titrated with 0.01 m nbs using a drop of methyl orange as indicator until the red colour disappeared. the amount of oxc in the measured aliquot was calculated from : (1)amount (mg)= vmwrn, where v = volume of nbs consumed, ml, m w = relative molecular mass of drug (252.268), r = molar concentration of nbs, and n is the reaction stoichiometry (number of moles nbs reacting with each mole of oxc). different aliquots (0.44.0 ml) of standard 20 g ml oxc solution were transferred into a series of 10 ml volumetric flasks using a microburette, and the total volume in all the flasks was adjusted to 4 ml by adding 1 : 9 acetic acid. to each flask, 1 ml each of 10 m h2so4 and 120 g ml nbs solutions were added, the content was mixed well and kept aside for 30 min at room temperature with occasional shaking. finally, 1 ml of 0.03% bpr was added to each flask and the volume was made up to mark with water. then, the absorbance of the unreacted dye was measured at 460 nm against reagent blank prepared similarly without oxc. a standard graph was prepared by plotting absorbance against concentration, and the unknown concentration was read from the standard graph or computed from the regression equation derived using beer 's law data. an accurately weighed quantity of the tablet powder equivalent to 200 mg oxc was transferred into a 100 ml volumetric flask, and about 40 ml of glacial acetic acid was added. the content of the flask was shaken for 10 min, 30 ml of water was added, shaken for 10 more min, and finally the volume was completed to the mark with water. first 10 ml portion of the filtrate was discarded and a suitable aliquot (say 5 ml) was then subjected to analysis by following the procedure described earlier. a quantity of tablet powder containing 10 mg of oxc was transferred into a 100 ml volumetric flask containing 10 ml of glacial acetic acid. the content was shaken for 5 min, 50 ml of water was added, and content was mixed well and shaken again for 15 more min. first 10 ml portion of the filtrate was discarded and the resulting tablet extract (100 g ml in oxc) was diluted to 20 g ml with 1 : 9 acetic acid. suitable aliquot was then subjected to analysis by following the general procedure. a placebo blank containing starch (10 mg), acacia (15 mg), hydroxyl cellulose (10 mg), sodium citrate (10 mg), talc (20 mg), magnesium stearate (15 mg) and sodium alginate (10 mg) was prepared by combining all components to form a homogeneous mixture. a 5 mg of the placebo blank was accurately weighed and its solution was prepared as described under tablets, and then subjected to analysis by following the general procedure. a synthetic mixture was prepared by adding an accurately weighed 200 mg of oxc to the placebo mentioned above. the extraction procedure for tablets as described for method a and method b were applied separately by taking required quantity of synthetic mixture to prepare 2 mg ml and 20 g ml oxc solutions, respectively. three different volumes of the resulting synthetic mixture solution (equivalent to 6, 12 and 18 mg oxc in method a ; 2, 4 and 6 g ml in method b) were subjected to analysis by following the respective general procedure. n - bromosuccinimide contains unstably bound bromine and is used for bromination in organic chemistry. in the reactions where nbs used as brominating agent, the monovalent positive bromine of the nbs (the bond between bromine and nitrogen is polarized by the two neighbouring carbonyl groups) is responsible for bromination. the formation of the monovalent bromine due to hydrolysis of nbs is as shown in scheme 1. the proposed methods are based on the bromination of the drug by nbs in sulphuric acid medium. in the proposed titrimetric method, oxc is directly titrated with nbs in sulphuric acid medium. the reaction between oxc and nbs was found to occur in 1 : 1 (drug : nbs) stoichiometric ratio, and all the calculations are based on this fact. using 0.01 m nbs, 618 mg of oxc was conveniently determined. in spectrophotometry, a known excess of nbs was treated with oxc and after the reaction between oxc and nbs ensured to be complete, the unreacted nbs was reacted with a fixed concentration of bpr followed by the measurement of residual dye at 460 nm (figure 1 and scheme 3). the drug is not soluble in any of the solvents like water, hcl, h2so4, hno3, and h3po4 except acetic and perchloric acids. the titration was performed in the presence of different volumes and different concentrations of perchloric acid. no consistent stoichiometry was obtained at any volume / concentration of perchloric acid. at very high concentrations of perchloric acid, blank consumption was more, and at lower concentrations no reaction of oxc with nbs took place. the drug solution was found to be unstable when stored for longer time, and colloidal particles were observed when oxc was dissolved in acetic acid of concentration lower than 2 : 3 (acetic acid : water). therefore, 2 : 3 acetic acid was used as solvent system. preliminary experiments were carried out to choose the proper medium for the quantitative and stoichiometric reaction between oxc and nbs. the reaction was rapid and quantitative when 812 ml of 10 m h2so4 in a total volume of 20 ml was maintained. when the volume was less than 8 ml and greater than 12 ml, slightly lower and higher stoichiometric ratios, respectively, were observed. therefore, 10 ml of 10 m h2so4 was used throughout the investigation. under the optimized reaction conditions, a definite reaction stoichiometry of 1 : 1 (oxc : nbs) (1) absorption spectrabpr in h2so4 medium is red in colour and exhibited an absorption maximum at 460 nm. addition of bpr to nbs resulted in the formation of yellow coloured product (bromo derivative of bpr) with an absorption maximum at 390 nm. oxc and nbs had no absorption at either 460 or 390 nm. when increasing concentrations of oxc were reacted with a fixed concentration of nbs in acid medium, there occurred a concomitant decrease in the concentration of nbs. addition of a fixed concentration of bpr to decreasing concentrations of nbs resulted in a proportional increase in the concentration of residual bpr leading to a linear increase in absorbance at 460 nm with the drug concentration, which formed the basis for the assay. figure 1 illustrates the absorption spectra of bpr, and the reaction product formed between nbs and bpr in the absence of oxc (reagent blank). bpr in h2so4 medium is red in colour and exhibited an absorption maximum at 460 nm. addition of bpr to nbs resulted in the formation of yellow coloured product (bromo derivative of bpr) with an absorption maximum at 390 nm. when increasing concentrations of oxc were reacted with a fixed concentration of nbs in acid medium, there occurred a concomitant decrease in the concentration of nbs. addition of a fixed concentration of bpr to decreasing concentrations of nbs resulted in a proportional increase in the concentration of residual bpr leading to a linear increase in absorbance at 460 nm with the drug concentration, which formed the basis for the assay. figure 1 illustrates the absorption spectra of bpr, and the reaction product formed between nbs and bpr in the absence of oxc (reagent blank). (2) selection of reaction mediumoxc solution in dilute acetic acid (1 : 9) is stable for longer time (more than two days) at 4c. the effect of acid concentration on the reaction between oxc and nbs was studied by varying the concentration of h2so4 keeping the concentrations of nbs and drug fixed. the reaction was found to be rapid yielding a constant absorbance with maximum sensitivity and stability when the h2so4 concentration was maintained in the range of 0.71.3 m (0.7 to 1.3 ml of 10 m in a total volume of 10 ml). the same acid concentration was found sufficient for the instantaneous reaction between unreacted nbs and bpr. at acid concentrations higher than 1.5 m therefore, 1 ml of 10 m h2so4 in a total volume of 10 ml was used throughout the work. oxc solution in dilute acetic acid (1 : 9) is stable for longer time (more than two days) at 4c. the effect of acid concentration on the reaction between oxc and nbs was studied by varying the concentration of h2so4 keeping the concentrations of nbs and drug fixed. the reaction was found to be rapid yielding a constant absorbance with maximum sensitivity and stability when the h2so4 concentration was maintained in the range of 0.71.3 m (0.7 to 1.3 ml of 10 m in a total volume of 10 ml). the same acid concentration was found sufficient for the instantaneous reaction between unreacted nbs and bpr. at therefore, 1 ml of 10 m h2so4 in a total volume of 10 ml was used throughout the work. (3) optimization of nbsto fix the optimum concentration of nbs, different concentrations of nbs were reacted with a fixed concentration of bpr in h2so4 medium and the absorbance was measured at 460 nm. a constant and minimum absorbance resulted with 12 g ml nbs and, hence, different concentrations of oxc were reacted with 1 ml of 120 g ml nbs in h2so4 medium before determining the residual nbs via the reaction scheme illustrated earlier. this facilitated the optimization of the linear dynamic range over which procedure could be applied for the assay of oxc. to fix the optimum concentration of nbs, different concentrations of nbs were reacted with a fixed concentration of bpr in h2so4 medium and the absorbance was measured at 460 nm. a constant and minimum absorbance resulted with 12 g ml nbs and, hence, different concentrations of oxc were reacted with 1 ml of 120 g ml nbs in h2so4 medium before determining the residual nbs via the reaction scheme illustrated earlier. this facilitated the optimization of the linear dynamic range over which procedure could be applied for the assay of oxc. (4) optimization of bprto fix the upper beer 's law limit with respect to bpr, different concentrations of the dye were reacted with a fixed 1 ml of 120 g ml nbs in sulphuric acid medium. after the reaction between nbs and bpr was ensured to be complete, the absorbance of the unreacted bpr was measured at 460 nm. it was found that a reproducible and minimum absorbance value was obtained when 1 ml of 0.03% bpr used. hence, 1 ml of 0.03% of bpr was used throughout the investigation. to fix the upper beer 's law limit with respect to bpr, different concentrations of the dye were reacted with a fixed 1 ml of 120 g ml nbs in sulphuric acid medium. after the reaction between nbs and bpr was ensured to be complete, the absorbance of the unreacted bpr was measured at 460 nm. it was found that a reproducible and minimum absorbance value was obtained when 1 ml of 0.03% bpr used. hence, 1 ml of 0.03% of bpr was used throughout the investigation. (5) study of reaction time and stability of the coloured speciesunder the described experimental conditions, the reaction between oxc and nbs was complete within 30 min (figure 2) at room temperature (28 2c). after the addition of bpr, the reaction between nbs and dye was instantaneous and the absorbance of the unreacted dye was stable for at least 45 min, thereafter. under the described experimental conditions, the reaction between oxc and nbs was complete within 30 min (figure 2) at room temperature (28 2c). after the addition of bpr, the reaction between nbs and dye was instantaneous and the absorbance of the unreacted dye was stable for at least 45 min, thereafter. (6) effect of diluentin order to select proper solvent for dilution, solvents like 1 : 9 acetic acid, water, methanol and 10 m h2so4 were tried. satisfactory results were obtained when water was used as the diluent. in order to select proper solvent for dilution, solvents like 1 : 9 acetic acid, water, methanol and 10 m h2so4 were tried. the range investigated (618 mg), a fixed reaction stoichiometry of 1 : 1 [oxc : nbs ] was obtained in titrimetry which served as the basis for calculations. the linearity between two parameters is apparent from the correlation coefficient of 0.9955 obtained by the method of least squares. from this, it is implied that the reaction between oxc and nbs proceeds stoichiometrically in the ratio 1 : 1 in the range studied. in spectrophotometry, the calibration graph was found to be linear from 0.8 to 8.0 g ml oxc. the least square calibration equation was a = 0.1044c 0.0113 [where the concentration (c) is measured in g ml ] with a regression coefficient of 0.9993 (n = 5). the calculated molar absorptivity and sandell sensitivity values are 2.52 10 l mol cm and 0.010 g cm, respectively. the limits of detection (lod) and quantification (loq) were calculated according to the ich guidelines using the formulae : lod = 3.3 s / slope and loq = 10 s / slope, (where s is the standard deviation of the absorbance of six blank readings). the calculated lod and loq are 0.28 and 0.86 g ml, respectively. the repeatability of the proposed methods was determined by performing replicate determinations (n = 7). the intraday and interday variation in the analysis of oxc was measured at three different levels. the accuracy of an analytical method expresses the closeness between the reference value and the found value. accuracy was evaluated as percentage relative error between the measured and taken amounts / concentrations. the results of this study are compiled in table 1 and speak of good intermediate precision (% rsd 3.06) and accuracy (% re 3.75) of the results. in the analysis of placebo blank, the volume of nbs consumed was the same as that of the indicator blank (method a) and in spectrophotometry, the absorbance of the placebo blank was not different from that of the reagent blank suggesting the noninterference by the inactive ingredients added to prepare the placebo. in method a, three different aliquots of the synthetic mixture extract were analyzed titrimetrically (n = 3 in each case), which yielded a % recovery values in the range from 98.66 to 103.1 of oxc with standard deviation values in the range of 0.621.74. in spectrophotometry, three different aliquots of 20 g ml oxc were subjected to analysis (n = 3). the recovery values of 99.11104.9% oxc with standard deviation 0.851.56 were obtained. these results which are close to 100% recovery complement the findings of the placebo blank analysis with respect to selectivity. to evaluate the robustness of the methods, volume of h2so4 was slightly altered (10 1 ml) with reference to optimum values in titrimetry. however, in spectrophotometry, the reaction time (after adding nbs, time varied was 30 2 min) and volume of bpr (1 0.2 ml of 0.03%) were slightly altered. to check the ruggedness, analysis was performed by four different analysts, and on three different burettes (method a) or spectrophotometers (method b) by the same analyst. the robustness and the ruggedness were checked at three different drug levels (6, 12, and 18 mg in method a ; 2, 4, and 6 g ml in method b). the intermediate precision, expressed as percent rsd, which is a measure of robustness and ruggedness, was within the acceptable limits (1.263.15%) as shown in table 3. commercial oxc tablets were analyzed using the developed methods and also by a reference published method. the method is based on spectrophotometric determination of oxc using f - c reagent in alkaline medium. the results obtained were compared statistically by the student 's t - test and the variance - ratio f - test. the calculated t- and f - values did not exceed the tabulated values of 2.77 (t) and 6.39 (f) at the 95 % confidence level and for four degrees of freedom, indicating close similarity between the proposed methods and the reference method with respect to accuracy and precision. to further ascertain the accuracy and reliability of the methods, recovery experiments were performed via standard - addition procedure. preanalyzed tablet powder was spiked (6 mg in method a ; 2 g ml in method b) with pure oxc at three different levels (3, 6, and 9 mg in method a ; 1, 2, and 3 g ml in method b), and the total was found by the proposed methods. the percent recovery of pure oxc added (table 5) was within the permissible limits indicating the absence of interference by the inactive ingredients in the assay. one titrimetric and one new spectrophotometric method were developed and validated for the determination of oxcarbazepine using nbs as brominating agent. the titrimetric method, first to be reported for oxcarbazepine, is applicable over a semi - micro - scale (618 mg), and using spectrophotometry at a small concentration as 0.86 g ml drug can be determined with confidence and with a fair degree of accuracy and precision. the new approach of utilizing nbs and bromopyrogallol red as reagents in spectrophotometry is the first of such reports. the method is the most sensitive ever developed for oxcarbazepine, though somewhat less rapid requiring a standing time of 30 min. both methods are simple, accurate, and precise and are free from extreme experimental conditions such as heating at high temperature and use of organic solvent unlike in some reported methods. compared to many existing instrumental methods for oxcarbazepine, the proposed spectrophotometric method has two additional advantages of simplicity of operations and low - cost instrument. both the methods make use of very easily available and cheaper reagents which demonstrates their cost - effectiveness.	titrimetric and spectrophotometric methods are described for the determination of oxcarbazepine (oxc) in bulk drug and in tablets. the methods use n - bromosuccinimide (nbs) and bromopyrogallol red (bpr) as reagents. in titrimetry (method a), an acidified solution of oxc is titrated directly with nbs using methyl orange as indicator. spectrophotometry (method b) involves the addition of known excess of nbs to an acidified solution of oxc followed by the determination of the unreacted nbs by reacting with bpr and measuring the absorbance of the unreacted dye at 460 nm. titrimetry allows the determination of 618 mg of oxc and follows a reaction stoichiometry of 1 : 1 (oxc : nbs), whereas spectrophotometry is applicable over the concentration range of 0.88.0 g ml1. method b with a calculated molar absorptivity of 2.52 104 l mol1 cm1 is the most sensitive spectrophotometric method ever developed for oxc. the optical characteristics such as limits of detection (lod), quantification (loq), and sandell 's sensitivity values are also reported for the spectrophotometric method. the accuracy and precision of the methods were studied on intraday and interday basis. the methods described could usefully be applied to routine quality control of tablets containing oxc. no interference was observed from common pharmaceutical adjuvants. statistical comparison of the results with a reference method shows an excellent agreement and indicates no significant difference in accuracy and precision. the reliability of the methods was further ascertained by recovery studies in standard addition procedure.
life in the ocean is dependent on fixation of carbon (c) and nitrogen (n) by planktonic microalgae, ranging in diameter from 100 m. these phytoplankton consist of eukaryotic algae, which photosynthetically fix carbon dioxide (co2) into organic matter, and cyanobacteria that fix co2 and also fix di - nitrogen (n2) to form ammonium. they make up less than 1% of the plant biomass on earth, but account for almost 50% of global primary production (field., 1998) and are a major source of trace gases such as dimethylsulfide that influence climate (charlson., 1987 ; andreae and crutzen, 1997). up until the ground breaking experiments of john martin (martin and fitzwater, 1988 ; martin., 1991), the growth of marine phytoplankton was thought to be primarily limited by the availability of the major nutrient nitrogen and to a lesser extent phosphorus. however, numerous iron - addition experiments in bottles and in mesoscale patches of surface seawater in the ensuing decades have demonstrated that the trace metal nutrient iron limits the growth of phytoplankton and regulates their species composition in 3040% of the world ocean, especially in high nitrate - low chlorophyll (hnlc) regions : the southern ocean, the equatorial and subarctic pacific, and some coastal upwelling systems (hutchins., 2002 ; in addition, there is substantial evidence that iron limits the fixation of n2 by cyanobacteria in the ocean, and thus, controls oceanic inventories of biologically available fixed nitrogen (rueter, 1983 ; falkowski, 1997 ; wu. several other trace metal nutrients (zinc, cobalt, manganese, and copper) have also been shown to stimulate phytoplankton growth in bottle incubation experiments with natural ocean water, but their effects are usually less substantial than those for iron (coale, 1991 ; crawford., 2003 ; franck., 2003 ; saito., 2005). however, these metals may play important roles in regulating the species composition of phytoplankton communities because of large differences in cellular trace metal concentrations and growth requirements among species (brand., 1983 ; sunda and huntsman, 1995a, b ; crawford., 2003 ; ho., 2003). in this review, i will discuss interactions between trace metal nutrients [iron (fe), zinc (zn), cobalt (co), manganese (mn), copper (cu), nickel (ni), cadmium (cd), and molybdenum (mo) ] and phytoplankton in the ocean. these interactions involve not only the effect of the metals on the growth and species composition of phytoplankton communities, but also the profound effect of marine plankton on the distribution, speciation chemistry, and biological availability of these nutrient metals (figure 1). there are many aspects to consider in these interactions, including (1) the distribution of metal nutrients in the ocean on various temporal and spatial scales ; (2) the sources, sinks, and cycling of metals ; (3) metal speciation and redox cycling, (4) the influence of these metals on phytoplankton metabolism and growth at different levels of biological organization (molecular, cellular, population, community, ecosystem, ocean / earth system), and (5) the influence of phytoplankton and the planktonic community as a whole on the chemistry and cycling of metal nutrients in the ocean. conceptual diagram of the mutual interactions between trace metal nutrients (fe, mn, zn, co, cu, mo, and cd) and phytoplankton in the sea. in these interactions the chemistry of trace metal nutrients (their concentrations, chemical speciation, and redox cycling) regulate the productivity, species composition, and trophic interactions of marine phytoplankton communities. these communities in turn regulate the chemistry and cycling of the trace metals through cellular uptake and assimilation, vertical transport of biogenic particles (intact cells and fecal pellets), mediation of metal regeneration processes (by grazers, bacteria, and viruses), production of organic chelators, and biological mediation of metal redox cycling. the distribution patterns of trace metal nutrients in the ocean have a profound influence on phytoplankton communities. concentrations of filterable fe and zn (that which passes through a 0.2 or 0.4 m - pore filter) are often extremely low (0.020.1 nm) in surface open ocean waters (bruland, 1980 ; martin., 1989 ; johnson., 1997) filterable concentrations of cd, a nutrient analog for zn, can reach values as low as 0.0020.004 nm in surface waters of the north pacific and atlantic oceans (bruland, 1980 ; bruland and franks, 1983 ; table 1). filterable levels of these and other trace metal nutrients can increase by orders of magnitude in surface transects from the open ocean to coastal and estuarine waters owing to metal inputs from continental sources : rivers, ground water, aeolian dust, and coastal sediments (bruland and franks, 1983 ; sunda, 1988/89). filterable fe can reach micromolar levels in estuaries and 1020 m in high humic rivers, 1000 to 10,000-fold higher than concentrations in surface ocean waters. filterable iron in rivers occurs largely as colloidal particles (0.020.4 m diameter), which are rapidly lost from estuarine and coastal waters via salt - induced coagulation and particulate settling (boyle., 1977). because of this efficient removal, much of the iron in rivers is deposited in estuarine and coastal sediments, and little directly reaches the open sea. however, reducing conditions in organic - rich shelf and margin sediments can re - mobilize some of the river - derived particulate fe via reduction to soluble fe(ii), and thereby provide an important fe source to the ocean (moore and braucher, 2008). another equally if not more important source of iron to the ocean is aeolian deposition of iron - containing mineral dust transported by the wind from arid regions (duce and tindale, 1991 ; jickells., 2005). these aeolian inputs change seasonally with variations in rainfall and prevailing winds and are highest in waters downwind of deserts (measures and vink, 1999 ; jickells and spokes, 2001). regions far removed from aeolian and sedimentary continental sources, such as the south pacific and southern ocean receive low external iron inputs and are among the most iron - limited areas of the oceans (martin., 1990 ; behrenfeld and kolber, 1999 ; coale., 2004). other external sources such as glaciers / iceberg melt, seasonal sea ice melting, island wakes, volcanism, and hydrothermal activity can provide important local inputs of iron and other metals (boyd and ellwood, 2010). organic complexation of fe, cu, zn, and cd in filtered (0.4 m) surface and deep waters of the northeast pacific ocean (n.d. near - surface values only are given because of a potential problem with the differential pulse anodic stripping titration data in the deep water samples (moffett and dupont, 2007). because of the much lower trace metal concentrations in the open ocean relative to those in coastal waters, oceanic algal species have evolved the ability to grow at much lower external and intracellular concentrations of fe, zn, and mn (brand., 1983 ; brand, 1991 ; sunda and huntsman, 1986, 1992, 1995a, b). in doing so they have been forced to rearrange their metabolic architecture (e.g., by decreasing the abundance of iron - rich protein complexes [photosystem i and the cytochrome b6/f complex ] in photosynthesis ; strzepek and harrison, 2004), by switching from iron - containing enzymes to less carbon - efficient metal free enzymes (the replacement of ferredoxin by flavodoxin in photosynthetic electron transport (la roche., 1996) and n2-fixation (saito., 2011), or by switching from scarce metals to more - abundant ones in some critical metalloenzymes [e.g., the replacement of cytochrome c6 which contains iron with the copper protein plastocyanin in photosynthetic electron transport (peers and price, 2006) ]. residence times of trace metal nutrients in the ocean vary over a wide range from 20 to 40 years for mn (landing and bruland, 1987 ; bruland., 1994) to 800,000 years for mo (emerson and huested, 1991 ; morford and emerson, 1999). concentrations of zn, cd, ni, and cu, which have intermediate to long residence times (3000100,000 years ; bruland and lohan, 2003) relative to the average ventilation time of ocean water (1000 years for deep ocean water), increase with depth, similar to increases observed for major nutrients (nitrate, phosphate, and silicic acid ; figures 2 and 3). in the northeast pacific, filterable concentrations of zn and cd increase by 80-fold and 400-fold, respectively, between the surface and 1000 m (bruland, 1980). the similarity between vertical profiles of trace metal nutrients and those of major nutrients suggest that both sets of nutrients undergo similar biological uptake and regeneration processes in which each is taken up by phytoplankton in sunlit surface waters and are thereby efficiently removed from solution. much of these assimilated metals and major nutrients are recycled within the euphotic zone by the coupled processes of zooplankton grazing and excretion, viral lysis of cells, and bacterial degradation of organic materials (hutchins., 1993 ; hutchins and bruland, 1994 ; poorvin., 2004 ; however, a portion of the assimilated metals and major nutrients is continuously lost from the euphotic zone by vertical settling of biogenic particulate matter, including intact algal cells, zooplankton fecal pellets, and organic detritus. the macro- and micro - nutrients contained in these settling biogenic particles are then returned to solution in non - lit deeper waters by bacterial degradation processes, with the rate of this regeneration decreasing exponentially with water depth. over time the uptake, settling, and regeneration processes deplete trace metal and major nutrients in sunlit surface waters to low levels and increase concentrations at depth at elemental ratios equal to average values in phytoplankton. this set of processes also transfers co2 to the deep sea and is important in regulating atmospheric co2 concentrations (sigman and boyle, 2000). the cycle is completed when the nutrient and co2 reservoirs in deeper waters are returned to the surface via vertical mixing and advection (upwelling) processes. depth profiles for major nutrients (a c) [nitrate (pacific only), phosphate, and silicic acid ] and filterable concentrations (that passing a 0.4-m filter) of trace metal nutrients (d h) (zn, cd, ni, cu, and mn) in the central north pacific (, 32.7n, 145.0w, september 1977) and north atlantic (, 34.1n, 66.1w, july 1979 ; bruland and franks, 1983). depth profiles for (a) phosphate and filterable concentrations of trace metal nutrients (b d) (fe, zn, and co) in the subarctic north pacific ocean (ocean station papa, 50.0n, 145.0w, august 1987 ; martin., 1989) and the northeast atlantic (40n, 20w, may 1989 ; martin., 1993). based on the above dynamics, the plots of trace metal nutrients with longer residence times (cu, zn, ni, and cd) vs those of major nutrients (e.g., phosphate) should have slopes equal the average ratios of trace metals to major nutrients in marine plankton. such behavior was previously demonstrated for depth dependent plots of nitrate vs phosphate concentrations in which the slope of these relationships (16 mol mol) equaled the average n : p measured in ocean plankton (redfield., 1963). similar behavior has been observed for plots of zn, cd, ni, and cu vs phosphate, but with several caveats (martin., 1976 ; sunda and huntsman, 1992, 1995c, 2000 ; croot., 2011 ; figure 4). in depth profiles for the northeastern pacific (figure 2), the concentrations of three of the metals (ni, cu, cd) within the nutricline are linearly related to those of phosphate, and for cu and cd, the metal : p slopes (or equivalent metal : c ratios) agree well with values measured in net plankton samples or in algae cultured at the concentration of unchelated metal [m ] (or other controlling metals in the case of cd) observed in the sunlit surface layer (figures 4b, c ; table 2). however, unlike n vs p plots, these relationships have positive y - intercepts for cu and ni, indicating that these metals are not completely used up biologically in n- and p - depleted surface waters. by contrast, the zn : p relationship exhibits increasing slopes with increasing zn concentrations and a negative y - intercept for a linear regression of zn vs p (figure 4a ; table 2). here the zn : p slope (and associated zn : c molar ratio) in the productive surface layer (0185 m) agrees with zn : p and zn : c values for marine algae grown at the measured [zn ] range within the surface layer (tables 1 and 2 ; figure 5) and the zn : c ratio (3.7 mol mol) in phytoplankton growing in near - surface seawater in the northeast pacific (lohan., 2005). however at greater depths (185800 m), the zn : p slope and associated zn : c ratio (22 mol mol) is similar to average values for phytoplankton growing at the much higher [zn ] range observed at depth (sunda and huntsman, 1992 ; table 2 ; figure 5). comparison of slopes of nutrient metal to phosphate plots for station h-77 (bruland, 1980) in the northeast pacific with metal : p ratios in net plankton (martin., 1976) and metal : c ratios in cultured marine algae. based on a c : p for marine plankton of 106 (redfield., 1963). mean and range based on mean and range of [zn ] computed from the zn chelation data of bruland(1989 ; see table 1) and the zn : c vs [zn ] relationship for the oceanic diatom thalassiosira oceanica (figure 5). based on the mean cu : c in the diatoms t. oceanica and t. pseudonana, and the coccolithophore emiliana huxleyi at the mean log [cu ] in northeast pacific ocean water (11.8, see table 1 ; sunda and huntsman, 1995c). plots of concentrations of (a) zn, (b) cd, (c) ni, and (d) cu vs phosphate within the nutricline of the northeast pacific (upper 8001000 m) at stations h-77 and c - i (bruland, 1980). cellular zn : c vs log [zn ] in the oceanic diatom thalassiosira oceanica, the coastal diatom t. pseudonana, and the oceanic coccoclithophore emiliania huxleyi in seawater at 20c based on data from sunda and huntsman (1995a). these results are compared with the mean and range (errors bars) of zn : c measured at the same temperature and a single [zn ] in 15 different species of marine eukarotic phytoplankton from five major algal groups (ho., 2003). the log [zn ] range for ocean water is shown based on data of bruland (1989) (table 1). the non - linearity of the zn vs p plots likely reflects the very large variation in [zn ] in ocean waters and the associated variation in zn : p and zn : c ratios in phytoplankton growing in these waters (sunda and huntsman, 1992). although waters with high [zn ] are usually found below the photic zone, and thus, can not influence the removal of metals by algal growth and uptake, thermohaline and wind - driven upwelling can bring these high - nutrient, high - zinc waters to the surface, especially in polar regions. as a consequence of these processes, filterable zn in surface waters of the atlantic sector of the southern ocean increased from 0.5 nm at a latitude of 46s to 4.5 nm at 66s along with increases in phosphate and nitrate (croot., 2011). the [zn ] in surface waters increased to as high 1.8 nm, as the zinc concentration exceeded that of strong zn binding ligands (baars and croot, 2011), a value 400-fold higher than mean surface [zn ] in the north pacific (table 1). subsequently, the lateral changes in nutrient and metal concentrations in these near - surface waters caused by algal uptake, biogenic particulate settling, and net regeneration in deeper waters are transposed to deeper depths and more northern latitudes with downwelling and lateral advection, which is most intense during winter (redfield., 1963). in this way near - surface processes of algal uptake, settling, and shallow water regeneration can influence the composition and vertical structure of major and trace metal nutrients in deep ocean waters worldwide. indeed, at depths at and just above the phosphate maximum in the atlantic ocean (600800 m ; see figures 2b and 3a), about half of the phosphate occurs as preformed phosphate, which was present when the water originally subducted from the surface to form the antarctic intermediate water layer, while the remainder occurs as regenerated phosphate (redfield., 1963). likewise, only a portion of the trace metal nutrients at depth are likely derived from regeneration of settling biogenic particles, while the remainder must occur as preformed metal nutrients. the deep water concentrations of both major nutrient elements (n, p, and si) and many longer - lived metal micro - nutrients (zn, cd, ni, and cu) are two- to fivefold higher in deep waters of the north pacific than the north atlantic (figures 2 and 3) because of large scale differences in the thermohaline circulation patterns between the atlantic and pacific oceans. in the pacific the major water inflow occurs at depth where concentrations of nutrients and longer - lived nutrient metals are high (broecker, 1991). consequently, the pacific acts as a nutrient trap and concentrates high levels of nutrients and longer - lived nutrient metals in its deeper waters (broecker, 1991). the atlantic, by contrast, has the opposite circulation pattern, with its major inflow at the surface where nutrients and metals are depleted, and its major outflow at depth, the north atlantic deep water. as might be expected, this circulation pattern tends to lower deep water concentrations of major nutrients and longer - lived nutrient metals. two trace metal nutrients with short ocean residence times (mn and co), show the opposite pattern to cu, zn, cd, and ni, and have highest concentrations at or near the surface and lower deep water concentrations in north pacific than in the north atlantic (figures 2h and 3d ; landing and bruland, 1987 ; jickells and burton, 1988 ; martin., 1989). the short residence times and low concentrations in the older deep waters of the north pacific are due to bacterially catalyzed oxidation of soluble mn(ii) and co(ii) to insoluble mn(iii and iv) and co(iii) oxides, and subsequent removal via particulate aggregation and settling as the water advects along its flow path. likewise, iron is scavenged from deep ocean waters by oxide formation and adsorption onto particles, but it is also avidly taken up by phytoplankton in surface waters. it has moderately short residence times (70200 years) and shows similar deepwater concentrations in the north atlantic and pacific (johnson., 1997 ; figure 3b). it exhibits surface depletion and increasing concentrations with depth in iron - limited regions such as the subarctic pacific and northeast atlantic during spring (figure 3b), but can show pronounced surface maxima in stratified ocean waters receiving high aeolian inputs (bruland., 1994 ; measures and vink, 1999). in contrast to the other nutrient metals, mo occurs at essentially the same concentration (100110 nm) independent of depth or ocean basin (collier, 1985). its concentration is roughly proportional to salinity and its lack of depletion in surface waters indicates minimal removal of mo by marine plankton relative to its seawater concentration, which is orders of magnitude higher than surface levels of other trace metal nutrients (figures 1 and 2). trace metal nutrients in the ocean exist as a variety of different chemical species and forms, which strongly influences their biological uptake and biogeochemical cycling. all but mo occur as cationic metal ions that are complexed to varying degrees by inorganic and organic ligands or are adsorbed onto or bound within various abiotic and biotic particles. many of these metals (fe, cu, mn, and co) occur in different oxidation states, which have different solubilities, binding strengths with organic ligands, ligand exchange kinetics, and biological availabilities. consequently, the redox chemistry of these metals has a major influence on their chemical behavior, biological uptake, and biogeochemical cycling. ni, zn, and cd exist in oxygenated seawater as soluble divalent cations that are complexed to varying degrees by inorganic ligands (cl, oh, and co32 ; byrne., 1988) and organic chelators. only a small percentage of ni is complexed by organic ligands (030% ; saito., 2004), while 97% of the filterable zinc (bruland, 1989) and 63% of filterable cadmium (bruland, 1992) is chelated in north pacific surface waters by unidentified strong organic ligands present at low concentrations (table 1). similar strong chelation of zn has been observed in the north atlantic and in subantarctic waters (ellwood and van den berg, 2000 ; ellwood, 2004). based on zn concentrations in filtered surface waters from the north pacific (0.060.9 nm ; bruland, 1980) and organic complexation data (bruland, 1989), the concentration of biologically available dissolved inorganic zinc species (zn) can be as low as 12 pm in surface ocean water, low enough to limit the growth of at least some algal species (sunda and huntsman, 1992, 1995a). however, in deep ocean waters (bruland, 1989), and upwelled surface waters in the southern ocean (baars and croot, 2011), zn concentrations exceed the concentration of strong zn binding ligands, resulting in up to 1000-fold increases in zn levels (table 1). manganese exists in seawater in three oxidation states : mn(ii), mn(iii), and mn(iv). insoluble mn(iii) and mn(iv) oxides are the stable redox forms of this metal in oxygenated seawater, although mn(iii) also occurs as soluble chelates with organic ligands in some environments (e.g., hypoxic waters ; trouwborst., 2006). these oxides can be reduced chemically and photochemically to dissolved mn(ii), which is highly soluble and is not bound appreciably by organic ligands (sunda and huntsman, 1994). although mn(ii) is unstable with respect to oxidation by molecular oxygen (o2), the chemical kinetics of this reaction are exceedingly slow in seawater (with a half life of 500 years at ph 8.1), allowing mn(ii) to persist despite its thermodynamic instability (morgan, 1967). enzymes present within the outer polysaccharide sheath of certain bacteria, catalyze mn(ii) oxidation to mn(iv) oxides (tebo., 2004 ; anderson., 2009), a reaction which appears to account for virtually all mn(ii) oxidation in marine waters (emerson., 1982 ; sunda and huntsman, 1988). the bacterial formation of mn oxides, and their subsequent removal via particle settling results in short residence times and low - mn concentrations in deep ocean waters as noted earlier (figure 2h). in the ocean s surface mixed layer, oxidation is greatly diminished owing to photo - inhibition of the mn - oxidizing bacteria while mn oxides are dissolved by photo - reduction to mn(ii ; sunda and huntsman, 1988, 1994 ; moffett, 1990). in the southwestern sargasso sea, mn oxidation rates increased from undetectable levels (99.9%) of the filterable fe(iii) in seawater is strongly bound to complex mixtures of organic ligands (gledhill and van den berg, 1994 ; rue and bruland, 1995 ; buck and bruland, 2007 ; gledhill and buck, 2012). this organic complexation minimizes iron adsorption and precipitation, and thus reduces iron removal from seawater by particulate scavenging processes (johnson., 1997). titrations utilizing ligand competition / cathodic stripping voltammetry reveal two classes of iron chelating ligands in near - surface seawater, a high - affinity class (l1) and lower affinity class (l2), with most of the filterable iron bound to the l1 class (rue and bruland, 1995 ; cullen. however in deeper water (500 m) only l1 class ligands are detected (table 1), suggesting that they are produced by biological processes in the productive surface layers of the ocean. the two ligand classes and their iron chelates exist in both soluble (i.e., dissolved) and colloidal (0.020.4 m size range) phases, with most of the ligands present in the soluble phase and some of the colloidal iron being inert to ligand exchange (wu. the identity of the two ligand classes is yet to be determined (vraspir and butler, 2009 ; gledhill and buck, 2012). many of the high - affinity ligands may be bacterial siderophores, strong ferric chelators produced by bacteria to solubilize iron and facilitate its intracellular uptake (macrellis., 2001). individual siderophores, largely in the hydroymate class, have been identified in ocean waters, but their concentrations account for only a few percent of the strong iron - binding ligands (mawji., 2008, 2011 ; velasquez. the low measured abundance of identifiable siderophores, however, may largely reflect our inability to quantitatively isolate other more - abundant classes of marine siderophores (e.g., catecholates and carboxylates) or reflect the presence of a large number of yet to be identified siderophores released by marine bacteria (velasquez., 2011 ; there is also evidence that humic substances comprise at least some of the iron - binding ligands in coastal and deep ocean water and that many of these ligands may be derived from rivers and sedimentary sources (laglera and van den berg, 2009 ; laglera., 2011). other iron ligands with weak to moderate binding strengths are released from biological sources (e.g., grazing, viral lysis, and algal or bacterial secretion) and include porphyrins (hunter and boyd, 2007 ; vong., 2007), acidic polysaccharides (hassler., 2011a, b), and secreted chelating compounds such as domoic acid (rue and bruland, 2001). ferric iron can be reduced in seawater to highly soluble fe(ii) (ferrous iron) by several processes, including, biological reduction at cell surfaces (maldonado and price, 2001 ; shaked., 2005), direct photolysis of ferric chelates (kuma., 1992 ;, 2001 ; barbeau, 2006), reduction by photochemically or biologically produced superoxide radicals (o2 ; voelker and sedlak, 1995 ; rose. 2005), or reduction within o2 depleted zones in organic particles or aggregates (balzano., 2009). as a result up to 64% of the filterable iron in near - surface seawater occurs as fe(ii), with the highest percentage observed during daytime near the surface, suggesting a largely photochemical or algal source (waite., 1995 ; croot., 2008 ; roy., 2008 ; shaked, 2008 ; sarthou., 2011). because fe(ii) binds much more weakly to organic ligands than fe(iii) and because direct photolysis of ferric chelates involves oxidation and degradation of the ligand, the photo - reduction or biological reduction of chelated - fe(iii) often results in dissociation of fe(ii) from the chelate (barbeau, 2006 ; figure 6). the resulting soluble fe(ii) is unstable in the presence of o2, and is re - oxidized to dissolved fe(iii) hydrolysis species [fe(iii) ], which are then re - chelated by organic ligands (sunda, 2001). because fe(ii) and fe(iii)are continuously produced during redox cycling, elevated steady state concentrations of each are often established (sunda and huntsman, 2003), with fe(ii) residence times that increase with decreasing temperature, ph, and concentrations of oxidants (primarily o2 ; santana - casiano., 2005). in air - equilibrated seawater at ph 8.0, computed residence times for fe(ii) range from 3.2 h at 0c to 2.2 min at 30c (santana - casiano., 2005 there is evidence for fe(ii) chelation by unidentified organic ligands, which retards oxidation rates in some regions (croot., 2008 ; roy., 2008) and increases them in others (roy and wells, 2011), apparently linked to differences in the chemical nature of the complexing ligands. the nature and degree of organic complexation of fe(ii) needs to be quantified as it not only affects redox cycling of iron, but may also influence iron uptake by phytoplankton (shaked and lis, 2012). photo - redox cycling of ferric chelates (fe(iii)l), such as photoactive siderophore complexes. the cycle is initiated by the absorption of light by the ferric chelate and a subsequent photolytic reaction in which the iron is reduced to fe(ii) and the ligand is oxidized. the fe(ii) dissociates from the degraded chelate to give dissolved inorganic ferrous species (fe(ii)) which are then rapidly oxidized to dissolved inorganic ferric hydrolysis species (fe(iii)) by molecular oxygen and hydrogen peroxide. the fe(iii) is then re - chelated by the ligand to reform the ferric chelate. the cycle increases the uptake rate of iron by algal cells by increasing the steady state concentrations of biologically available fe(ii) and fe(iii). the transport system t directly accesses fe(ii) and indirectly accesses fe(iii) by reduction to fe(ii). once inside the cell, much of the iron is used for synthesis of cytochromes (cyt) and fe - s redox centers, needed in high amounts in photosynthesis. thus, iron undergoes a dynamic redox cycling in surface seawater, which can greatly enhance its biological availability to phytoplankton by increasing concentrations of highly available dissolved inorganic fe(ii) and fe(iii) species (anderson and morel, 1982 ; sunda, 2001 ; maldonado., 2005 ; fan, 2008 ; figure 6). the photochemical enhancement of iron uptake by phytoplankton increases with decreasing temperature because the photolysis of fe(iii) chelates should be largely insensitive to temperature while the oxidation rates of photochemically produced fe(ii) to dissolved fe(iii) slows as does the re - chelation of fe(iii) by organic ligands (sunda and huntsman, 2011 ; figure 6). these slower reoxidation and re - chelation rates at lower temperatures increases the steady state concentrations of the highly biologically available fe(ii) and fe(iii) species in the presence of sunlight, as shown for ferric complexes with the synthetic chelator edta (sunda and huntsman, 2003, 2011). this enhanced photochemical effect should increase the availability of iron to phytoplankton in iron - limited polar regions such as the southern ocean, and without this effect, these regions might experience even more severe iron limitation. other micronutrient metals such as cu and co also exist in different oxidation states and are heavily chelated by organic ligands. copper can exist in seawater as thermodynamically stable cu(ii), or as instable cu(i) (moffett and zika, 1988). most (> 99%) of the cu in near - surface seawater is heavily chelated by strong organic ligands (log kcu,l1 = 1215) present at low concentrations (26 nm in open ocean waters), which decreases cu(ii) concentrations to very low levels (0.00110 pm ; coale and bruland, 1990 ; moffett, 1995 ; moffett and dupont, 2007 ; buck., 2010 ; table 1). different electrochemical methods show consistent strong chelation of cu in surface waters ; however, in the deeper waters of the north pacific (> 200 m) the results diverge, with differential pulse anodic stripping voltammetry showing a complete loss of the strong l1 ligand class at depths below 200 m, while ligand competition / cathodic stripping voltammetry shows continued strong complexation of copper by this ligand class down to at least 2500 m (coale and bruland, 1988, 1990 ; moffett and dupont, 2007). the reasons for these analytical differences are not known, but may be related to a change in the nature of the ligands and possibly the oxidation state of the bound copper between the surface and deeper waters (moffett and dupont, 2007). cu(ii) can be reduced to cu(i) by photochemical processes (moffett and zika, 1988), reduction at cell surfaces (jones., 1987) or by reaction with chemical reducing agents, such as sulfur containing organic ligands (leal and van den berg, 1998). in surface waters, the resulting cu(i) is re - oxidized by reaction with o2 on time scales of minutes and steady state cu(i) concentrations can comprise 510% of the filterable copper (moffett and zika, 1988 ; sharma and millero, 1988). however, the effect of this redox cycling on the biological availability of copper is not known. cobalt exists in seawater as soluble co(ii) or as co(iii), which forms insoluble oxides at the ph of seawater. the formation of these oxides appears to be microbially mediated and may be largely responsible for the removal of this metal from deep ocean waters (tebo. much of the filterable co in seawater (up to100%) is strongly bound to organic ligands (ellwood and van den berg, 2001 ; saito and moffett, 2001 ; saito., 2005). the conditional stability constant(s) for the co complexes is extremely high (10 to 10 m), consistent with co binding as kinetically inert co(iii) chelates (saito., trace metal nutrients, like major nutrients, are taken up intracellularly by specialized transport proteins on the cytoplasmic membrane of algal cells. consequently, uptake rates generally follow michaelis menten enzyme kinetics as observed for mn, fe, zn, and cu (sunda and huntsman, 1986, 1998a ; hudson and morel, 1990 ; lane., 2008 ; guo., 2010). in eq. 1 vmax is the maximum uptake rate, [m ] is the concentration of chemical species that react with receptor sites on the transport protein (and thus are bioavailable by definition), and ks is the [m ] at which half of the transport sites are bound to the nutrient metal and the uptake rate is half of vmax. virtually all of these proteins act as pumps and require energy for intracellular transport. with some exceptions, the binding of metals to the receptor sites on these proteins is determined by the concentration of free aquated metal ions or in many cases, the concentration of kinetically labile dissolved inorganic species, m (aquated metal ions and inorganic complexes with cl, oh, and co32 ; hudson and morel, 1993 ; sunda and huntsman, 1998b). thus, chelation by organic ligands generally decreases metal uptake and chemical speciation is extremely important in regulating the cellular uptake of metals (hudson, 1998). although eq. 1 is relatively simple, its application is not entirely straight forward. one complicating factor is that the relevant substrate concentration, [m ], is that at the surface of the cell membrane, which can be much less than that in bulk seawater in cases where the uptake rate approaches the maximum rate of diffusive flux of available metal species to the cell surface (hudson and morel, 1993). this indeed occurs for uptake of zn and co(ii) by small diatoms and coccolithophores (3.56 m diameter) at low zn and co concentrations (sunda and huntsman, 1995a ; figure 7). since diffusive flux per unit of cell biovolume varies with the inverse square the cell diameter, diffusion limitation of uptake intensifies substantially as the cell size increases, and can be a major impediment for the uptake of some nutrient metals (zn, co, fe) in larger cells (hudson and morel, 1993 ; sunda and huntsman, 1995a ; sunda, 2001). another complicating factor is that the vmax of metal uptake systems is often under negative feedback regulation by the cell and can decrease substantially with increases in [m ] and intracellular metal pools (sunda and huntsman, 1992, 1998b). 1 to the results of short - term metal uptake experiments as the vmax of the transport system investigated can vary during the course of the experiment (sunda and huntsman, 1985, 1986, 1992). a final complicating factor is that the values of ks can increase and vmax decrease with increasing concentrations of competing metals that bind with and are taken up intracellularly by the transport system, as occurs for cu, cd, and zn inhibition of mn uptake and cu inhibition of zn uptake (sunda and huntsman, 1996, 1998c). all of these complicating factors must be taken into account for the proper application of the michaelis menten equation to laboratory and field metal uptake data. cellular uptake rates for zn, co, and cd (normalized per mol of cell carbon) for the oceanic diatom thalassiosira oceanica plotted as a function of the log10 of the molar concentration of dissolved inorganic zinc species (zn). concentrations of cd and co were held constant at 2.7 and 1.5 pm, respectively, within the range of values for near - surface ocean water (bruland, 1992 ; saito., 2004). uptake rates for cd and co increase by at least two orders of magnitude when zn concentrations decrease below 10 m. the large increase in uptake rates reflect the induction of a high - affinity cellular transport system (or systems) for cd and co in response to declining intracellular zn levels or transport of the two metals into the cell by an inducible high - affinity zn transport system. uptake systems are highly variable and range from simple to highly complex depending on the chemical speciation of the metal, its biological demand (requirement) relative to its seawater availability, and the range of concentrations of available metal species. uptake systems appear to be simplest for dissolved mn(ii), which is taken up in phytoplankton by a single high - affinity transport system (ks = 15140 nm mn) that is under negative feedback regulation (sunda and huntsman, 1985, 1986). in this negative feedback, as the concentration of mn(ii) decreases, the vmax of the transport system is increased to maintain relatively constant mn uptake rates and intracellular mn concentration. this constant regulated cellular mn level is two to four times higher than that needed to support the maximum growth rate, providing a buffer against decreasing mn concentrations ([mn ]) or increases in cellular demand, as occurs with decreasing light intensity (see below). at sufficiently low [mn ] the vmax values reach a maximum constant value and the cellular mn uptake rate and intracellular mn concentration decreases with further decreases in [mn ] causing mn - limitation of growth rate. uptake systems for zn, cd, co, and cu are more complex. like that of mn(ii), algal uptake of these metals is believed to be related to the concentration of dissolved inorganic metal species (m = zn, cd, co, and cu) and metal chelates are generally not directly available for metal uptake, with the exception of some cu chelates at low cu levels (hudson, 1998 ; sunda and huntsman, 1998b ; guo., 2010). the phytoplankton species examined to date have at least two separate zn transport systems, a low - affinity system whose vmax is relatively constant, and an inducible high - affinity system, whose affinity (1/ks) and vmax increase with decreasing zn concentration ([zn ]) and decreasing intracellular zn (sunda and huntsman, 1992). the low - affinity system has higher vmax and ks values and transports zn at high [zn ]. the inducible high - affinity system is responsible for zn uptake at low [zn ]. at very low [zn ] (< 10 pm), zn uptake approaches limiting rates for the diffusion of zn species to the cell surface, and consequently the zn uptake rate is proportional to [zn ] in the medium (sunda and huntsman, 1992, 1995a ; figure 7). similar biphasic high and low - affinity uptake systems, whose high - affinity uptake system is under negative feedback regulation, are observed for cu in an oceanic diatom (guo., 2010). the existence of high and low - affinity transport systems results in sigmoidal relationships between uptake rates for zn and cu (and cellular zn : c and cu : c ratios) and zn and cu concentrations (figures 4 and 7 ; sunda and huntsman, 1992, 1995a, c). co and sometimes cd can metabolically substitute for zn in many zn enzymes such as carbonic anhydrase (price and morel, 1990 ; lane and morel, 2000 ; xu., the uptake of these divalent metals is increased by over 100-fold in diatoms and coccolithophores with decreasing [zn ] in the external medium and decreasing cellular zn (figure 7 ; sunda and huntsman, 1995a, 2000). uptake of cd and co by this inducible transport system (or systems) is down - regulated at high [zn ] and intracellular zn levels (figure 7). under these conditions, cd is taken up into the cell by the cellular mn(ii) transport system (sunda and huntsman, 1996, 2000) or a putative fe(ii) transport system (lane., 2008), and consequently, is inversely related to concentrations of mn(ii) and fe(ii). thus, cellular uptake of cd in the ocean is regulated by complex interactions among dissolved concentrations of cd, zn, mn(ii), and fe(ii) (sunda and huntsman, 2000 ; cullen and sherrell, 2005 ; lane., 2009). likewise, since co uptake is repressed at high [zn ], biological removal of co often does not occur until after zn is depleted, as observed in the subarctic pacific (figure 8 ; sunda and huntsman, 1995a). plots of filterable zn and co vs phosphate concentrations at two stations in the subarctic pacific (station t-5, 39.6n, 140.8w and station t-6, 45.0n, 142.9w, august 1987). the decrease in zinc with decreasing phosphate is caused by the simultaneous removal of both metals via cellular uptake and assimilation by phytoplankton. cobalt decreases with decreasing phosphate only after zinc concentrations drop to very low levels (< 0.2 nmol kg). this pattern is consistent with metabolic replacement of co for zn, as observed in phytoplankton cultures (see figure 5). iron is the most limiting trace metal nutrient, and its chemistry is arguably the most complex. as noted earlier, iron is highly bound in seawater as ferric chelates and ferric ions associated with various particulate phases such as fe(iii) oxyhydroxides. early evidence suggested that cyanobacteria and eukaryotic marine algae utilized fundamentally different uptake systems to access this bound iron (wilhelm and trick, 1994 ; hutchins., 1999). both cyanobacteria and heterotrophic bacteria were thought to utilize primarily siderophore uptake systems, in which high - affinity fe(iii)-binding ligands (siderophores) were released extracellularly, followed by intracellular uptake of the resulting ferric - siderophore chelates (martinez. siderophore uptake systems are widespread in terrestrial and enteric bacteria, and may also be common in sedimentary and particle - associated marine bacteria (sandy and butler, 2009). however, recent genomic data from cultures and natural communities shows little evidence for proteins involved in siderophore biosynthesis or for cellular uptake of ferric - siderophore chelates in the picocyanobacteria (synechococcus and prochlorococcus) that often dominate open ocean phytoplankton communities, or by major oceanic n2-fixing cyanobacteria such as trichodesmium or crocosphaera (hopkinson and morel, 2009 ; hopkinson and barbeau, 2012). instead these species possessed a high abundance of fe atp binding cassette (abc) transporters, which can acquire iron from ligand exchange reactions with dissolved labile fe(iii) species such as fe(iii) (hopkinson and barbeau, 2012). a reductive step, however, may be required to free the iron from ferric chelates, prior to its uptake (rose., 2005 ; kranzler., 2011 ; shaked and lis, 2012), and many marine cyanobacteria also possess non - specific metal transporters that transport fe(ii) and other divalent metals (hopkinson and barbeau, 2012). a coastal synechococcus isolate produced a suite of siderophores (synechobactins), which like many other marine siderophores, are both photoreactive and amphiphilic (ito and butler, 2005). but how widespread such siderophore production is in coastal cyanobacterial species is currently unknown (hopkinson and morel, 2009). eukaryotic phytoplankton do not appear to produce siderophores and there is little evidence for the direct cellular uptake of ferric - siderophore chelates (sunda, 2001). instead there is mounting evidence for the utilization of a high - affinity transport system that accesses a variety of fe(iii) coordination species (including fe(iii) and ferric chelates) via reduction to fe(ii ; maldonado and price, 2001 ; kustka., 2007 ; amin. the released fe(ii) binds to fe(ii) receptors on specific transmembrane proteins, which transport the iron into the cell. this intracellular transport involves the reoxidation of bound fe(ii) to fe(iii) by a copper protein (a multi - cu oxidase ; maldonado., 2006). the ability of this transport system to access iron is dependent on the ease of reduction of ferric complex species, which is inversely related to the stability of the fe(iii) coordination complex (maldonado and price, 2001). weakly complexed ferric hydrolysis species fe(iii) are reduced at orders of magnitude higher rates than strongly bound fe - siderophore chelates, and are thus much more accessible for cellular uptake (shaked., 2005 ; morel., 2008 likewise fe(iii) colloids are less available because of their slow diffusion kinetics within the cell s diffusive boundary layer and because interior ferric ions within the colloid are not readily accessible for reduction and subsequent release as dissolved fe(ii). as a consequence, iron uptake by this system is highly dependent on the chemical speciation of iron in seawater, and increases in dissolved fe(ii) or fe(iii) concentrations can considerably increase the biological availability of iron (hudson and morel, 1990 ; morel., photo - reductive dissociation of ferric chelates increases iron uptake by diatoms and other eukaryotic algae by increasing steady state fe(ii) and fe(iii) concentrations, as shown in culture experiments with photolabile ferric complexes with synthetic chelators (e.g., ethylenediaminetetraacetic acid, edta ; anderson and morel, 1982 ; sunda and huntsman, 2011), marine siderophores (barbeau., 2001 ; amin., 2009), and sugar acids (ozturk., 2004 ; figure 6). similarly, in an incubation experiment in the southern ocean, natural planktonic assemblages exhibited higher iron uptake rates from an added photoactive siderophore (fe - aerobactin) in the presence of sunlight than from a non - photoactive one (fe - desferrioximine b ; buck., 2010). in other recent iron uptake experiments in southern ocean waters, the pre - equilibration of fe - labeled iron with the monosaccharide glucuronic acid increased the uptake of the radiolabeled iron by 2-fold compared to the uptake observed when iron was added by itself (hassler., 2011b). these effects may be attributed to the formation of more biologically available weak organic chelates (hassler. however as noted above, dissolved ferric chelates and coordination complexes of adsorbed sugar acids and polysaccharides on the surfaces of iron oxyhydroxides can undergo photolysis and subsequent iron redox cycling, which should increase fe(ii) and fe(iii) concentrations (kuma., 1992 ; ozturk., 2004 ; steigenberger., the influence of mono and polysaccharides on iron chemistry, photochemical redox cycling, and bioavailability needs further investigation given the high abundance of these compounds in dissolved and colloidal marine organic matter and the widespread production of extracellular polysaccharides by marine phytoplankton and bacteria (steigenberger., 2010 ; the trace metal concentration in algal cells normalized to cell volume or to cell carbon is not only dependent on the rates of intracellular metal uptake by transport systems (as discussed above) or adsorption on cell surfaces (tovar - sanchez., 2003), but also by the rate of biodilution by new biomass or cell carbon (sunda and huntsman, 1998b). the rate of change in cellular metal per mole of cell carbon (dq / dt) equals the cellular uptake rate vm (normalized to cell carbon) minus the rate of biodilution, which equals the net specific rate of c - fixation (c) times the cellular metal : c ratio (q) : at steady state dq / dt = 0 and the equation collapses to : based on these equations, any factor that decreases growth rate but has no or a lesser effect on the metal uptake rate will increase the cellular metal : c ratio. this is seen in the response of cell fe : c, mn : c, and zn : c ratios in diatoms and dinoflagellates to light limitation of growth rate, where a 6070% decrease in specific growth rate with a decrease in light intensity from 500 to 50 mol quanta m s increased the cell metal : c ratios by two- to threefold for a given [m ] (sunda and huntsman, 1997, 1998c, 2005). for mn and fe, the higher mn : c and fe : c values helped the cells to photoacclimate to the low light conditions (see fe and mn sections below and figure 9), and for zn, the higher zn : c ratio lowered the [zn ] needed to achieve maximum growth rate. however, as discussed previously, decreasing light can also decrease fe and mn uptake rates by decreasing [fe ] and [mn(ii) ] levels, so the overall effect of lower light may still be to lower cell fe : c and mn : c ratios (sunda and huntsman, 2011). temperature, another major growth - controlling factor, could potentially also affect cellular m : c ratios, but in the one case examined to date, a temperature decrease from 20 to 10c caused similar decreases in vm and specific growth rate (at constant [fe ]) so there was no effect on cellular fe : c ratios (sunda and huntsman, 2011). effect of light on cellular growth requirements for (a) iron and (b) manganese in the coastal diatom thalassiosira pseudonana at 20c. (a) relationships between specific growth rate and fe : c molar ratio for cells growing under a 14:10 h light : dark cycle at light intensities of 500 (black triangles), 85 (green triangles), and 50 (blue triangles) mol photons m s. open diamonds give data for cells growing at the highest light intensity (500 mol photons m s) but a 50% shorter daily photoperiod (7 h). (b) relationships between specific growth rate and cellular mn : c molar ratio for cell growing under a 14:10 h light : dark cycle at light intensities of 500 (black circles), 160 (red circles), and 90 (green circles) mol photons m s. equations 2 and 3 also have important implications for diel changes in cellular m : c ratios. carbon is photosynthetically fixed only during the day (and a portion is respired at night), but metal uptake can continue during both the light and dark period (sunda and huntsman, 2004). consequently, cellular m : c ratios should decrease during the light period and increase at night. in agreement with this prediction, the cell fe : c ratio in an iron - limited diatom (thalassiosira pseudonana) growing at a specific rate of 1.6 day decreased by 60% (from 63 to 25 mol fe mol c) from the beginning to the end of the 14 h light period (sunda and huntsman, 2004). this result was for a metal chelate system (fe - nitrilotriacetic acid) with no photochemical enhancement of [fe ] during the day, and the diel effect can be less or even reversed in marine systems with substantial photochemical redox cycling of iron (sunda and huntsman, 2004). for zn, co, cd, and ni, where photochemical cycling does not occur, the cellular m : c ratios should also decrease during the light period. this effect was observed in the diatom t. pseudonana where cell zn : c decreased by twofold over the course of the light period (sunda and huntsman, 2004). metal uptake rates invariably increase with the concentration of available metal as observed for zn uptake in the oceanic diatom thalassiosira oceanica (figure 7). for this diatom and the coccolithophore emiliania huxleyi the specific growth rate is unaffected over most the oceanic [zn ] range (log [zn ] = 11.8 to 8.7). consequently, the cellular zn : c is proportional to the cellular zn uptake rate, and increases with increasing [zn ] (see figures 5 and 7). cellular metal : c ratios can vary substantially among species. the cell zn : c was two- to fivefold higher in the coccolitiophore e. huxleyi than the diatoms t. oceanica and t. pseudonana, depending on the [zn ] in the culture medium (sunda and huntsman, 1995a ; figure 5). (2003) are consistent with those of sunda and huntsman (1995a) and show a 10-fold variation in zn : c ratios in 15 different marine algal species representing five major algal groups (figure 5). even larger variations of 13-, 71-, and 50-fold, respectively, were observed for cu : c, co : c, cd : c ratios in these same algal species grown at a constant set of [m ] values (ho., 2003). recent advances in synchrotron x - ray fluorescence microscopy has allowed measurement of metal : p and metal : s ratios in single cells for a wide array of trace metals. as in the above culture data, large intriguing variations were observed in different algal cells and cell types present in the same water samples (twining., 2004, 2010, 2011). in a recent study in the equatorial pacific, diatoms had sevenfold higher ni : p ratios and fourfold higher fe - p and zn : p ratios than autotrophic flagellates (e.g., coccolithophores and dinoflagellates), but had 2.5-fold lower co : p ratios (twining., 2011). cells have the capacity to take up iron and other nutrient metals in far excess of that needed to support growth and metabolism, which helps them to take advantage of pulsed inputs, such as episodic increases in aeolian iron deposition associated with large desert dust storms (sunda and huntsman, 1995b ; marchetti., 2006). luxury uptake also protects cells from future declines in metal availability as blooms develop or to increases in metabolic demand for iron and other metals linked to decreases in light or increases in temperature (sunda and huntsman, 2011). in addition, because of a certain degree of non - specificity of transport systems, many reactive trace metals (including metal nutrients, e.g., cu and cd), can leak into cells via the transport systems for other metal nutrients such as mn and zn (sunda and huntsman, 1996, 1998c). within the cell unchelated redox active metals such as iron and copper can mediate the formation of toxic reactive oxygen species (e.g., hydroxyl radicals via fenten chemistry) and reactive metals such as cu, cd, and zn can adventiciously bind with coordination sites of proteins or displace nutrient metals from their active sites in metalloproteins (hartwig, 2001 ; valko., 2005). consequently, it is essential that excess concentrations of these metals be sequestered within algal cells to prevent metal toxicity or inhibition of metabolism (finney and ohalloran, 2003). excess iron not occurring in metabolic proteins is bound within the iron storage protein ferritin in the pennate diatom pseudo - nitzschia (marchetti., 2009), and in dps protein (another member of the ferritin protein family) in the n2-fixing cynaobacterium trichodesmium (castruita., 2006). both of these algae have unusually high storage capacities for excess iron (kustka. many marine picocyanobacteria (e.g., synechococcus) possess genes for dps or bacterioferritin iron storage proteins although the actual presence of these proteins has not yet been verified (scanlan. other marine eukaryotic phytoplankton such as centric diatoms also have substantial capacities to store excess intracellular iron (sunda and huntsman, 1995b), but the means by which they do so remains unclear. high intracellular levels of cd or cu in a variety of eukaryotic phytoplankton are bound by phytochelatins, a set of sulfhydryl containing chelating ligands found in terrestrial plants, microalgae, and fungi. these ligands consist of small polymers of glutathione with the structure (-glutamate - cysteine)n - glycine, where n = 211 (ahner., 1995 ; ahner and morel, 1995 ; ahner., 1997). although low basal levels of these cellular chelators exist in cells, the cellular synthesis of phytochelatins is up - regulated by exposure to high concentrations of toxic nutrient or non - nutrient metals (e.g., cd, cu, or hg) or low levels of competing metal nutrients such as zn or mn, which promote increased cellular cd or cu uptake (ahner. trace metal nutrients are essential for the metabolism, growth, and reproduction of all marine phytoplankton. they play essential roles in photosynthetic c - fixation, respiration, n2-fixation, and the uptake and metabolic assimilation of major nutrient elements (n, p, and c). thus the growth requirements of specific metals are influenced by the availability of light and the concentration and chemical forms of inorganic carbon, phosphorus and nitrogen species. of the trace metal nutrients, iron is needed in the greatest amount for algal growth and most frequently limits the growth of marine phytoplankton. it serves essential metabolic functions in photosynthetic electron transport, respiration, nitrate and nitrite reduction, sulfate reduction, n2-fixation, and detoxification of reactive oxygen species such as superoxide radicals and hydrogen peroxide (raven, 1988 ; da silva and williams, 1991 ; raven., 1999). the major requirement for iron in phytoplankton and likely all phototrophs is in the primary photochemical reactions of photosynthesis and associated photosynthetic electron transport (raven, 1990 ; strzepek and harrison, 2004). to acclimate to low, subsaturating light conditions, phytoplankton increase the cellular concentration of photosynthetic pigments, reaction centers, and electron transport proteins and protein complexes, and to do this they need an increased amount of cellular iron (raven, 1990). these iron - containing photosynthetic components include photosystem ii (23 fe), the cyt f / b6 complex (5 fe), photosystem i (12 fe), cytochrome c6 (1 fe), and ferredoxin (2 fe ; raven., 1999). this increased growth requirement for iron under low light conditions has been confirmed in culture experiments (sunda and huntsman, 1997, 2011 ; strzepek and harrison, 2004 ; figure 9a). such interactions between light and iron limitation can lead to iron - light co - limitation of algal growth in low light environments such as occur with deep vertical mixing during winter at higher latitudes (e.g., the subarctic pacific and southern ocean ; maldonado., 1999) and in the deep chlorophyll maximum near the bottom of the photic zone in thermally stratified mid - ocean gyres (sunda and huntsman, 1997 ; hopkinson and barbeau, 2008). algal cells acclimate similarly to a decrease in the photoperiod by increasing their photosynthetic pigments and cellular iron requirement for daily c - fixation and growth (sunda and huntsman, 2004, 2011 ; figure 9a). such day length effects could contribute to a higher level of iron limitation of phytoplankton growth during the shorter days of the fall than during the spring at high latitudes. iron is also needed for the assimilation of important chemical forms of nitrogen, which next to carbon is the second most abundant nutrient element in the cell. nitrogen limits the growth and biomass of phytoplankton in roughly 60% of the ocean (moore., 2002, 2004) and the overwhelming majority of biologically available fixed nitrogen in deep ocean reservoirs occurs as nitrate (figure 2a). nitrate is supplied to sunlit surface waters by upwelling and vertical mixing of deep ocean waters, but to utilize this substrate algal cells must first reduce it to ammonium, a process catalyzed by two iron - containing enzymes : nitrate reductase and nitrite reductase. in addition, both enzymatic reactions require the input of cellular energy (adenosine triphosphate, atp) and reductant molecules (nadph), and large amounts of cellular iron are needed for their photosynthetic production. based on model calculations (raven, 1988) and empirical measurements (maldonado and price, 1996), algal cells growing on nitrate require 50% more iron to support a given growth rate than do cells growing on ammonium. consequently, iron can be especially limiting in oceanic upwelling systems (such as the equatorial and subarctic pacific) where waters containing high nitrate concentrations, but low - iron, are advected to the surface (martin and fitzwater, 1988 ; coale. the low - iron concentrations favor the growth of small phytoplankton, which are rapidly grazed by microzooplankton, preventing blooms from developing, whose formation ultimately must be supported by inputs of upwelled nitrate (price., 1991, 1994). the rapid grazing also supplies recycled ammonium which is more efficiently assimilated by the iron - limited cells. thus the net population growth of such systems can be viewed as being co - limited by iron and nitrate due to the high iron requirement for nitrate utilization (price., 1994). a more important iron - nitrogen linkage is provided by the large metabolic requirement for iron in n2-fixation. all eukaryotic algae and most cyanobacteria are incapable of assimilating n2 which is present at a high concentration in the atmosphere (a mole fraction of 0.81) and in all ocean waters. certain marine cyanobacteria, such as members of the genera trichodesmium and chrocosphera, are able to enzymatically reduce n2 to ammonium (referred to as n2-fixation ; zehr, 2011). n2-fixation requires very high amounts of cellular iron, and consequently, trichodesmium growing on n2 as a nitrogen source require up to five times more cellular iron for growth than cells growing on ammonium (kustka., 2003a). this much higher iron requirement is partly caused by the large amount of iron in the n2-fixation enzyme nitrogenase, and the low catalytic rate of this enzyme (kustka. however, it is also caused by the large amount of energy in the form of atp needed to break the n2 triple bond (16 atp per n2 molecule), which must be supplied either directly or indirectly from photosynthesis. as a result of the high metabolic iron cost and the low - iron concentrations in seawater, iron appears to limit n2-fixation in large regions of the ocean, and along with denitrification (respiratory reduction of no3 to n2), controls oceanic inventories of fixed nitrogen (rueter., 1992 ; falkowski, 1997 ; kustka., 2003a ; sohm., 2011 consequently, nitrogen is the primary limiting major nutrient in most ocean waters (moore., 2004), while in lakes, where iron concentrations are much higher, phosphate is typically the primary limiting nutrient (schindler, 1977). because the low level of fixed nitrogen in the ocean is largely caused by iron limitation of n2-fixation, the ocean can be viewed as being co - limited by iron and nitrogen. ocean n2-fixation is largely restricted to warm tropical and subtropical waters (moore., 2004 ; zehr, 2011). n2-fixation varies regionally in these waters and is greatest in areas receiving high iron inputs from deposition of desert dust (or other continental sources), such as the subtropical north atlantic, arabian sea, and the western margin of the pacific (sohm., and n2-fixation is lowest in the south atlantic and south pacific where continental inputs of iron are low. n2-fixation in regions with high atmospheric iron inputs tend to be dominated by trichodesmium, which typically forms colonies 13 mm in diameter (sohm., 2011). the colonies are able to intercept iron - containing dust particles and physically transport them to the colony s interior where the iron is solubilized and assimilated by unidentified reductive processes (rueter., 1992 ; rubin., 2011 the colonies can vertically migrate at velocities exceeding 3 m h, as enabled by the large colony size and variations in specific gravity (walsby, 1992). this vertical movement increases the colony s encounter frequency with iron - containing dust particles, which further facilitates iron uptake (sunda, 2001). in the mid - ocean waters of the subtropical and tropical pacific, continental inputs of iron are low as are iron concentrations, and here n2-fixation is dominated by much smaller unicellular cyanobacteria, such as crocosphaera watsonii (montoya., 2004 ; sohm., the much smaller cell size (26 m diameter), and attendant higher surface to volume ratios and higher diffusive flux of soluble iron to cell surfaces (per unit of biomass) help increase cellular iron uptake by these cyanobacteria in these low - iron waters (sunda, 2001). in addition, recent proteomic data indicate that these cells undergo a large scale diel cellular cycle in which a portion of the iron - containing proteins involved in photosynthesis are degraded near the end of the light period and the iron released is then used to synthesize the iron - containing nitrogenase needed for nighttime fixation of n2, which is fueled by the atp produced from respiratory consumption of stored carbohydrates (saito., 2011). the nitrogenase proteins are then degraded near the end of the dark period and the liberated iron is reused to synthesize iron - containing photosynthetic proteins needed for c - fixation. this cellular strategy is energetically expensive, but solves two critical problems in iron - limited oceanic waters : it temporally separates n2-fixation and photosynthesis, and thereby avoids poisoning of nitrogenase enzyme complex by photosynthetically produced o2 (zehr., 2001) ; and equally important, it reduces the cellular iron requirement for diazotrophic growth by 40% (saito., 2011). the combination of higher iron uptake rates related to small cell size and the lower cellular iron requirement for diazotrophic growth provide a competitive advantage to crocosphaera in low - iron oceanic waters, such as those in vast regions of the tropical and subtropical pacific. due to iron limitation of c - fixation and n2-fixation in major regions of the ocean, iron plays a significant role in regulating carbon and nitrogen cycles in the ocean. it thus helps regulate the biological co2 pump discussed earlier, which along with the physical co2 pump, controls the ocean / atmosphere co2 balance and co2-linked greenhouse warming (martin, 1990 ; sigman and boyle, 2000). there is evidence that climatically driven variations in the input of iron - rich continental dust to the ocean has played an important role in regulating glacial - interglacial climate cycles by influencing the intensity of the biological co2 pump (martin, 1990 ; falkowski, 1997 ; martnez - garcia., 2011). manganese may influence the growth and species composition in certain low - mn environments such as the subarctic pacific and southern ocean, where mn additions have been observed to stimulate algal growth in bottle incubation experiments (buma. mn occurs in the water oxidizing complex of photosystem ii (which contains four mn atoms), and thus is essential for oxygenic photosynthesis. consequently, like iron, it is needed in higher amounts for algal growth at low light intensities (raven, 1990 ; sunda and huntsman, 1998d ; figure 9b), such as the bottom of the photic zone where mn concentrations are often lower than at the surface (figure 2h). mn also occurs in superoxide dismutase, an antioxidant enzyme that removes toxic superoxide radicals, produced as byproducts of photosynthesis (peers and price, 2004 ; wolfe - simon., 2006). because it has fewer metabolic functions, its cellular growth requirement is less than that for iron (figure 9a, b). quantitative requirements for zn in marine phytoplankton are similar to those for mn (sunda and huntsman, 1995a, 1998d). zn is needed in a variety of essential proteins needed for cell growth and replication (da silva and williams, 1991). it occurs in carbonic anhydrase (ca), an enzyme that catalyzes the reversible reaction : thus ca is critical to intracellular co2 transport and fixation and is needed to support the cell s co2 concentrating mechanism(s) (badger and price, 1994). higher amounts of this enzyme are needed at low co2 concentrations, leading to potential co - limitation by zn and co2 in the ocean (morel., 1994 ; sunda and huntsman, 2005). however, the 40% increase in co2 in the atmosphere and surface ocean waters from the burning of fossil fuels makes zn - co2 co - limitation less likely in the modern ocean than in pre - industrial times. zinc occurs in zinc finger proteins and rna polymerase, involved in dna regulation and transcription, and in trna synthetase, involved in trna translation into proteins (da silva and williams, 1991). it is also found in alkaline phosphatase, needed to acquire orthophosphate via hydrolysis of organic phosphate esters, which dominate phosphate pools in surface ocean waters with low p concentrations (lomas., 2010). consequently, zn and p may co - limit algal growth in ocean regions where both nutrients occur at low levels such as the sargasso sea (wu., 2000 zn additions have been found to stimulate algal growth in bottle incubation experiments in the subarctic pacific and in some coastal upwelling regimes along the eastern margin of the pacific, but the effects were modest relative to those for added fe (coale, 1991 ; crawford., 2003 ; franck., 2003). however, zn addition had a large effect on algal species composition, and preferentially stimulated the growth of the coccolithophore e. huxleyi (crawford., 2003), which has an unusually large cellular uptake and growth requirement for zn / co (sunda and huntsman, 1995a ; see figure 5). e. huxleyi and other coccolithophores are largely responsible for calcium carbonate formation and regulation of ocean water alkalinity, which in turn influences the air - sea exchange of co2 (dymond and lyle, 1985). thus, by affecting the growth of coccolithophores, zn (and possibly co, see below) could indirectly affect atmospheric co2 and global climate. co and sometimes cd can substitute for zn in ca, alkaline phosphatase and other zn enzymes, leading to complex interactions among the three metals in marine phytoplankton (price and morel, 1990 ; sunda and huntsman, 1995a ; xu., 2007 ; the presence of cd in ca appears to explain its nutrient - like distribution in ocean waters (figure 2e), and the identification of a unique cd - ca enzyme in zinc - limited marine diatoms means that it functions as a micronutrient in these microalgae (park., 2007 ; xu., 2008). however, the substitution of zn for cd in this protein yields a more catalytically active enzyme (xu., 2008), suggesting that zn may have been evolutionarily the original metal center for this enzyme. co also occurs in vitamin b12, an essential vitamin required for growth of many eukaryotic algal species (croft., this vitamin is synthesized by bacteria but not by eukaryotic phytoplankton, resulting in potential interactions among co availability, b12-production by bacteria and b12-utilization by eukaryotic algae in the ocean (croft., 2005 ; a specific requirement for co not involving b12 or a metabolic replacement for zn is seen in marine cyanobacteria, including members of the genera synechococcus and prochlorococcus, but the biochemical basis for this is not known (sunda and huntsman, 1995a ; saito., 2002). a similar co - requirement for optimal growth is observed in the bloom - forming prymnesiophytes e. huxleyi (sunda and huntsman, 1995a ; jakuba., because of its unique requirement by cyanobacteria, co may influence their growth in the ocean, as demonstrated by growth stimulation of synechococcus by added co in the costa rico upwelling dome (saito., 2005). it occurs along with iron in cytochrome oxidase, the terminal protein in respiratory electron transport that reduces o2 to h2o (da silva and williams, 1991). and it occurs in plastocyanin, which substitutes for the iron protein cytochrome c6 in photosynthetic electron transport in oceanic diatoms (peers and price, 2006), some cyanobacteria (scanlan., 2009), and the prymnesiophyte e. huxleyi (guo., it is also an essential component of the high - affinity iron transport system of at least some eukaryotic algae (maldonado., 2006 ; kustka., 2007) and possibly some oceanic cynaobacteria (guo., 2012). because cu is needed for fe uptake and can metabolically substitute for fe, co - limitations can occur for cu and fe, as observed in diatom cultures (peers. 2008), and also in deck - board incubation experiments in iron - limited ocean water (coale, 1991). these co - limitations are most prevalent for oceanic algal species, where substitutions of cu proteins (plastocyanonin and cu / zn - sod) for iron enzymes (cytochrome c6 and fe - sod) may help decrease the fe growth requirements of oceanic species (annett., 2008 ; guo., it serves as the active metal center in urease, which hydrolyzes urea to ammonium. consequently, it is essential for utilization of urea, an important nitrogen source in n - limited oceanic waters (price and morel, 1991). recently a ni - superoxide dismutase (ni - sod) was found to occur in marine cyanobacteria, a dominant group of picophytoplankton in open ocean waters (dupont. this finding may explain the unusually high ni : p ratios in picoplankton (which were presumed to be cyanobacteria) in the equatorial pacific (twining., 2011). the ni - sod findings may be of significance evolutionarily as other forms of this critical antioxidant enzyme, which contain other metals in their catalytic centers (i.e., fe - sod, mn - sod, and cu / zn - sod), are the main sods in eukaryotic algae and virtually all land plants and animals. thus, the occurrence of ni - sod in oceanic cyanobacteria may help to reduce the biochemical demand for other micronutrient metals (fe, zn, cu, and mn) which generally occur at lower concentrations than ni in surface ocean waters (see figures 2 and 3). mo occurs with fe in several key n - assimilation enzymes, including nitrogenase and nitrate reductase (da silva and williams, 1991). thus, it is important in the ocean s nitrogen cycle ; however, it is unlikely to limit algal growth due to the high concentration of molybdate ions in ocean water (105 nm ; collier, 1985). in addition to the fe - mo enzyme, some n2-fixing bacteria also contain other isoforms of nitrogenase, one that contains a homologous fe - s cluster without mo in its active center and another that contains fe and vanadium (boyd., 2011). however, the fe - mo enzyme is at least 50% more catalytically active than either of the other two isoforms which helps to minimize fe - limitation of n2-fixation in the ocean (anbar and knoll, 2002). the interactions between trace metal nutrients and marine phytoplankton are reciprocal. while trace metals clearly influence the productivity and species composition of planktonic algae and bacteria, these microorganisms in turn have a profound effect on the chemistry and cycling of these metals in the ocean on a variety of time and spatial scales (figure 1). one example of this interaction is the effect of algal uptake, particulate settling, and regeneration cycles on the vertical distribution and inter - ocean transfer of nutrient metals, as described earlier (figures 2 and 3). in addition marine biota influence the chemical speciation of metals through a variety of processes : (1) the release of metal chelates and metal chelating ligands through zooplankton grazing, digestion, and defecation, and through viral lysis of cells and microbial degradation processes (poorvin., 2004 ; strzepek., 2005) ; (2) the active release of chelating compounds such as siderophores (butler and theisen, 2010) and polysaccharides (hassler., 2011a), and (3) the reduction and oxidation of redox active metals (fe, mn, co, and cu) by various biological processes. these processes include the reduction of iron and copper by cell surface reductases (strzepek., 2011) or by biologically produced reducing agents (rose., 2005), reduction of metals within particulate reducing microzones generated by microbial respiration, and oxidation of mn(ii), co(ii), and fe(ii) to their respective oxides by specific groups of bacteria (moffett and ho, 1996). one of the most important effects of microorganisms on trace metal chemistry is in mediating the production of organic ligands that chelate fe, cu, zn, and co, especially in oceanic environments where the supply of terrestrial humic materials and other land - derived chelators is minimal. this chelation minimizes the loss of these essential metals by abiotic (and biotic) particulate scavenging and thereby minimizes their loss from ocean waters. the organic carbon needed for the in situ formation of these ligands is ultimately derived from algal photosynthesis, and thus the production of these ligands is at least indirectly dependent on marine algal productivity. however, many of these ligands appear to directly result from biological processes, and at least some directly facilitate biological uptake of metals. the release of siderophores clearly facilitates biological uptake of iron, as the releasing bacteria have specific transport systems for active uptake of iron - siderophore chelates (butler and theisen, 2010). however, most iron - siderophore chelates are orders of magnitude less available for algal uptake than is unchelated fe (shaked., 2005), and thus, in facilitating their own iron uptake, the bacteria could inadvertently lessen the uptake of iron by phytoplankton. such an effect in turn could lessen photosynthetic production of organic carbon on which the bacteria depend for growth and survival. to avoid this conundrum, nature may have devised a clever mechanism to allow the bacteria to sequester iron for their own use, and at the same time make it more available to support photosynthetic fixation of carbon in sunlit surface ocean waters. unlike the siderophores produced by soil and enteric bacteria, whose iron - siderophore chelates are unaffected by exposure to sunlight, the iron chelates of most siderophores produced by near - surface marine bacteria undergo photolysis owing to the presence of alpha hydroxy - carboxylate functional groups (barbeau., 2003 ; vraspir and butler, 2009 ; butler and theisen, 2010). by contrast, these photoactive functional groups are relatively rare in terrestrial siderophores (barbeau., 2003). the photolysis of the siderophore chelates can substantially increase the steady state concentrations of biologically available fe(ii) and fe(iii) species, and thereby increases the uptake of iron by phytoplankton, as directly shown in culture experiments with marine diatoms and dinoflagellates (barbeau., 2001 ; amin., 2009). in this way the bacteria are not only able to increase the availability of iron to themselves, but to phytoplankton in sunlit surface waters, thereby promoting the photosynthetic production of organic carbon needed for bacterial growth and reproduction, and ultimately for the production of siderophores. it is noteworthy that the marine bacteria found in close mutualistic association with marine dinoflagellates and cocolithophores produce a weaker iron - siderophore (vibrioferrin ; log kfe = 10.9), which contains two alpha hydroxy ligand groups, and is 10- to 20-times more photoreactive than the siderophores produced by free living marine bacteria (amin., the in situ photolysis of this siderophore in the presence of attenuated sunlight increased the iron uptake rate in the dinoflagellate scrippsiella trochoidea by 20-fold but also increased the iron uptake rate by the producing bacterium (marinobacter sp.) by 70% (amin.. here the photolysis reaction not only promoted iron uptake by the mutualistic algal partner, but also by the siderophore - producing bacterium. there is also evidence that the strong ligands that tightly chelate cu in seawater are produced by phytoplankton, especially cyanobacteria. in stratified waters of the north pacific and atlantic such strong cu - binding ligands often occur at highest levels near the deep chlorophyll maximum where cyanobacteria are abundant (coale and bruland, 1988, 1990 ; moffett, 1995). the chelators appear to perform an important function of detoxifying copper. in the presence of the cu - chelators the average cu in surface northeast pacific waters occurred at a non - toxic concentration (1.2 pm ; table 1) while in their absence cu levels would have been 500 pm, a level toxic to many marine phytoplankton (brand., 1986 ; coale and bruland, 1988). ligands having similar cu - binding strength (log kcu = 11.8) as many of the strong chelators in surface seawater are produced by synechococcus, an abundant group of oceanic cyanobacteria, that are particularly sensitive to copper toxicity (brand., 1986 ; moffett, 1995 ; moffett and brand, 1996). in experiments with synechococcus, the production of the ligand was greatly enhanced in response to additions of toxic levels of cu, indicating that the cyanobacteria can actively modulate the availability and toxicity of cu in their external environment via production of cu - chelators. similar enhanced ligand production in response to added cu was observed in cultures of eukaryotic phytoplankton, but the stability constants for cu - binding by these ligands (log kcu = 9.210.8) were lower than those for the chelators released by synechococcus (croot., there is also evidence from laboratory and field experiments that the strong ligands that chelate co in seawater are also produced by cyanobacteria, and that these ligands, like siderophores, facilitate the uptake of the chelated metal (co) by these organisms (saito., 2002, 2005). thus, trace metal nutrients and planktonic communities comprise an interactive system in the ocean in which each exerts a controlling influence on the other (figure 1). on longer geological time scales, the feedback interactions between microorganisms and the chemistry and availability trace metals have been profound, and have substantially influenced the overall chemistry and cycling of major biological elements (c, o, h, n, and s) in the ocean and the earth as a whole, and have had a major impact on the evolution of life on this planet (da silva and williams, 1991). currently, the air we breathe and virtually the entire ocean contain high concentrations of dioxygen molecules (o2), generated over billions of years from the release of o2 as a byproduct of oxygenic photosynthesis. because of the presence of o2, the modern ocean is oxidizing, which as noted previously, limits the solubility of critical trace metal nutrients (fe, co, and mn) whose stable oxidation states under oxic conditions are sparingly soluble fe(iii) oxyhydroxides and insoluble co(iii) and mn(iv) oxides. however, prior to the advent of oxygenic photosynthesis ca 3 billion years ago (blankenship., 2007) and the appearance of o2 in the atmosphere 2.42.3 billion years ago (bekker., 2004), the chemistry of the atmosphere and the ocean were far different from what exists today. there was no free o2 and the entire ocean, and earth s surface and atmosphere were chemically much more reducing (da silva and williams, 1991). under these conditions the stable redox states of fe, mn, and co were soluble fe(ii), mn(ii), and co(ii), and that of copper was cu(i). furthermore, the stable redox form of sulfur was sulfide (s[-ii ]), rather than sulfate (s[vi ]), which occurs in present day seawater at a high concentration (28 mm). the presence of moderate to high levels of sulfide greatly restricted the availability of zn, cu, mo, and cd, which form insoluble sulfide precipitates and biologically less available metal sulfide complexes ; but it had a much a lesser impact on other metals [mn(ii), fe(ii), co(ii), and ni(ii) ] which form much more soluble metal sulfides (da silva and williams, 1991 ; saito., 2003). thus, early life in the ocean likely evolved in an environment of high availability of fe, mn, co, and ni and much lower availabilities of zn, mo, cu, and cd, contrasting the situation in the modern ocean. given the utility of fe as a versatile redox catalyst and its abundance in the earth s crust and early ocean, it is perhaps not surprising that this metal was utilized in the evolution of many of the central redox catalysts of life (mauzerall, 2007). it occurs in high amounts in the redox centers of nitrogenase responsible for n2 reduction to nh3 and in the various cytochromes and fe - s redox centers involved in anoxygenic and oxygenic photosynthesis (da silva and williams, 1991 ; raven., 1999). in addition, the abundant soluble mn(ii) in the ancient ocean was utilized in the evolution of the water oxidizing centers of photosystem ii, which allowed cyanobacteria to utilize abundant water molecules as a photosynthetic electron donor, thereby freeing photosynthetic primary producers from the need to utilize much less abundant substrates such as sulfide or ferrous ions (mauzerall, 2007). the resultant oxidation of h2o to o2 and burial of photosynthetically produced organic carbon in marine sediments and sedimentary rocks, slowly (over 12 billion years) oxidized fe(ii) to fe(iii) oxides and sulfide minerals to soluble sulfate, ultimately resulting in the buildup of free o2 first in the atmosphere and surface ocean beginning ca. 2.3 billion years ago, and gradually in the ocean as a whole by 500600 million years before present (anbar and knoll, 2002 ; katz., 2007). the precipitation of ferric oxides from the sea has resulted in the chronic fe - limitation of c - fixation and n2-fixation that we currently observe in the ocean. however, this negative effect is more than offset by the large amount of biological energy produced by o2-dependent respiration utilized by all present day plants and animals and most aerobic microbes. indeed the large amount of energy obtained from the respiratory reaction of o2 with organic molecules likely was essential for the development of multicellular forms of life, paving the way for the evolution of mammals, including man (mauzerall, 2007). furthermore, the release of zn, cu, mo, and cd from insoluble sulfides and biologically unavailable sulfide complexes allowed for the proliferation of numerous enzymes utilizing these metals (including many zn and cu enzymes), many of which appear to have evolved following the appearance of free o2 (da silva and williams, 1991). thus, evolution has involved a continuous feedback between biological systems and the surrounding chemical environment, with biological trace metal catalysts playing a central mediating role in this process. the author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.	in addition to control by major nutrient elements (nitrogen, phosphorus, and silicon) the productivity and species composition of marine phytoplankton communities are also regulated by a number of trace metal nutrients (iron, zinc, cobalt, manganese, copper, and cadmium). of these, iron is most limiting to phytoplankton growth and has the greatest effect on algal species diversity. it also plays an important role in limiting di - nitrogen (n2) fixation rates, and thus is important in controlling ocean inventories of fixed nitrogen. because of these effects, iron is thought to play a key role in regulating biological cycles of carbon and nitrogen in the ocean, including the biological transfer of carbon to the deep sea, the so - called biological co2 pump, which helps regulate atmospheric co2 and co2-linked global warming. other trace metal nutrients (zinc, cobalt, copper, and manganese) have lesser effects on productivity ; but may exert an important influence on the species composition of algal communities because of large differences in metal requirements among species. the interactions between trace metals and ocean plankton are reciprocal : not only do the metals control the plankton, but the plankton regulate the distributions, chemical speciation, and cycling of these metals through cellular uptake and recycling processes, downward flux of biogenic particles, biological release of organic chelators, and mediation of redox reactions. this two way interaction has influenced not only the biology and chemistry of the modern ocean, but has had a profound influence on biogeochemistry of the ocean and earth system as a whole, and on the evolution of marine and terrestrial biology over geologic history.
the human immunodeficiency virus (hiv) infection is a global pandemic, with cases reported from virtually every country. at the end of 2010, an estimated 34 million people were living with hiv globally, including 3.4 million children less than 15 years. in 2010, an estimated 250 000 children less than 15 years died from aids - related causes. in nigeria, an estimated 3.6 percent of the population is living with hiv and aids. unlike in adults where more than 90% of hiv infections occur through sexual route, in children the kidney is one of the many organs involved with the progression of hiv infection. renal involvement in hiv infected children is a common finding and hiv - associated nephropathy (hivan) is a type of kidney disease that occurs in patients who are infected with hiv. highly active antiretroviral therapy (haart) has been found to be beneficial not only in long term patient survival but also slowing down renal involvement and rapid progression to end stage renal disease. microalbuminuria refers to albumin excretion above the normal range, but below the level of detection by dipstick. microalbuminuria is defined as urinary albumin excretion between 30 and 300 mg / day or in concentrations 20 to 200 g / min [4, 5 ]. microalbuminuria is also defined as 30 to 300 mg albumin / g creatinine on a first morning urine specimen [4, 5 ]. microalbuminuria has been studied in many diseases such as diabetic nephropathy, hypertension, obesity, hiv, and sickle cell disease. microalbuminuria develops from progressive, subclinical, structural, and functional changes in the kidney and it is useful as an early biomarker in the detection of kidney disease. microalbuminuria and proteinuria are believed to be precursors of hiv related renal disease ; early detection with intervention may prevent end stage renal disease (esrd) in hiv infected children. chronic kidney disease and end stage renal disease pose enormous problems to patients and physicians alike for reasons which, in no small part, have to do with the lack of resources needed for their management. treatment of esrd relies on dialysis and transplantation, which are very expensive and often unavailable. transplantation is currently available in nigeria in only a few hospitals and costs over 3 million naira, while dialysis can cost over 100 000 naira monthly. consequently, preventive measures offer the greatest hope in the management of patients with chronic kidney disease. primary prevention (nephroprevention) is advocated for those subjects in the general population at risk of progressive renal failure [911 ]. any cost effective, sensitive, and selective marker that allows patient identification as low- or high - risk would facilitate the choice of appropriate intervention, to provide optimal risk - benefit ratio. screening for microalbuminuria, a simple and relatively inexpensive procedure may identify hiv infected patients with impaired renal function early and enable them to benefit from measures which may slow or halt the progression of disease. the study was conducted in the paediatric infectious disease clinic (pidc) of aminu kano teaching hospital (akth), kano, where hiv infected children are seen and followed up. study population was hiv infected children that presented newly or on followup at the pidc. children who satisfied the inclusion criteria were enrolled in the study. inclusion criterion. inclusion criterion was all hiv infected children between the ages of 1 and 15 years at the time of enrolment who presented newly or on followup at the pidc of akth during the study period. exclusion criteria were as follows : children with haematuria or proteinuria, evidenced by dipstick urinalysis of trace or greater, children with diabetes mellitus, hypertension, children with fever at presentation, children with ongoing menstruation, children with overt clinical signs and symptoms of renal disease or on followup at the paediatric nephrology clinic, refusal of consent from parent(s) or accompanying caregiver(s). children with haematuria or proteinuria, evidenced by dipstick urinalysis of trace or greater, children with diabetes mellitus, hypertension, children with fever at presentation, children with ongoing menstruation, children with overt clinical signs and symptoms of renal disease or on followup at the paediatric nephrology clinic, refusal of consent from parent(s) or accompanying caregiver(s). sample size was determined using the formula n = zp(1 p)/d, where n is the desired sample size, z is the standard normal deviate corresponding to 95% confidence level = 1.96, p is the prevalence of microalbuminuria in hiv infected children : 12% (reported in port harcourt, nigeria), and d is the absolute sampling error that can be tolerated = 0.05. to allow for attrition ethical approval for the study was obtained from the ethical committee of the hospital. informed consent was obtained from the parent(s) or the accompanying caregiver(s) of each child after explaining the nature and purpose of the study. the pidc register was obtained and the case / medical file of the patients attending the hiv clinic reviewed to determine age bracket distribution of 15 years, 610 years, and 1115 years. a review of the records showed a proportionate distribution of children as 30%, 47%, and 23%, respectively. the desired sample size in each stratum was then calculated as 54, 83, and 41. using systematic sampling technique, a sampling interval of 1 in 3 the first child was selected at random and, subsequently, every third child who met the inclusion criteria was then recruited until the desired number was obtained for each stratum. it was administered by the investigator to the parents / caregivers or where appropriate to the child. physical examination was carried out with emphasis on general examination, anthropometry, and blood pressure measurement. sample collection. the procedure was explained to the parents / caregivers and to the patients if old enough to understand. all patients were provided with properly labelled universal bottles for collection of first batch samples, that is, first morning void collected at home and spot urine samples collected on presentation at the clinic. parents or accompanying caregivers of urine continent patients the urine specimens were delivered to the hospital within 2 hours of collection or refrigerated and transported as soon as possible. for those patients that tested positive for microalbuminuria from analysis of the first batch sample, a follow - up second batch sample (first morning void only) was collected after 6 weeks for analysis. the age groups 15 years and 6 years had equal prevalence of microalbuminuria of 3.37%, respectively (table 5). macroscopic and dipstick examination of urine was carried out by the researcher following the manufacturer 's instructions using dipstick specific for microalbumin and creatinine, combostick 2ac. samples that tested positive for ma using the microalbumin and creatinine specific dipstick were subjected to more technical procedures including urine creatinine and microalbumin quantitative measurements in the laboratory using the u - albumin immunometric assay method and the jaffe reaction method, respectively. this was conducted by the laboratory scientist in collaboration with the researcher and supervising chemical pathologist. the findings of the clinical examination and laboratory investigation were communicated to the caregivers and patients. patients with overt renal symptoms such as hypertension, proteinuria, or haematuria were referred to the paediatric nephrologist for further evaluation and management. statistical analysis was conducted using the statistical package for the social sciences (spss) version 16.0. quantitative variables were summarized using the mean and median, while qualitative variables were summarized using percentages. comparison of means was done using the student t - test and chi square test was used to test association between microalbuminuria and patient characteristics. one hundred and seventy - eight children were recruited for the study and a response rate of 100% was recorded. one hundred and three (57.9%) participants were males while 75 (42.1%) were females, giving a male to female ratio of 1.4 : 1 (table 1). the mean weight of the study participants was 21.3 7.6 kg with a range of 9 to 52 kg (table 2). all the participants had normal blood pressure with a mean systolic and diastolic blood pressure of 79.7 12.8 mm / hg and 52.0 9.7 mm / hg, respectively (table 2). the mean duration of infection in the study participants was 47.9 29.1 months as indicated in table 2. the majority of the study participants, 144 (80.9%), were classified as having who stage 1 disease, with only 2 (1.1%) participants having stage 3 disease and none with stage 4 disease (table 1). also, the majority of the study participants, 157 (88.2%), were on antiretroviral therapy (art), while 21 of them (11.8%) were yet to haart (table 1). for those on art, their mean duration of treatment was 39.5 28.0 months (table 2). the study participants were also classified based on their immunological status using their absolute cd4 count. this classification was guided by the cdc immunologic classification for various age groups in hiv infected children. the majority of the study participants, 127 (71.4%), had no evidence of suppression, whereas only 6 (3.4%) of them had severe suppression based on the cdc immunological classification (table 3). there was no statistically significant difference between gender and the presence of persistent microalbuminuria (table 4). all participants provided early morning and spot urine samples during the first batch of samples collection. twelve (6.7%) tested positive for microalbuminuria using the ems and 11 (6.2%) tested positive for microalbuminuria using the sus. that is, only one (8.3%) out of the 12 that tested positive for microalbuminuria using ems tested negative using the sus. there was no significant statistical difference in the use of ems or sus in screening for microalbuminuria, = 0.05, p = 0.83. the mean values of microalbuminuria in early morning sample (ems) and spot urine samples (sus) were 65.8 30.9 and 56.7 30.8 mg / g, respectively. there was no statistical difference between the two mean values, p = 0.56. there was also no significant difference between the mean values of microalbuminuria of the two early morning samples (taken at least 6 weeks apart) ; p value was 0.148 (table 6). the mean duration of hiv infection in participants with and without microalbuminuria was 42.8 32.8 and 48.3 28.8 months, respectively. there was no statistical difference between the mean duration of hiv infection between children with microalbuminuria and those without microalbuminuria, t = 0.63 with p value of 0.528 (table 7). eleven (91.7%) out of the 12 participants with microalbuminuria were on haart, while only 1 (8.3%) of the participants with microalbuminuria was yet to commence haart. there was no significant difference between the use of haart and the finding of microalbuminuria, p = 1.0 (table 8). the mean duration of hiv treatment in participants with and without microalbuminuria was 38.3 35.3 and 39.5 27.6 months, respectively. there was no statistical difference between the mean duration of treatment and the presence of microalbuminuria, t = 0.14 with p of 0.887 (table 8). this finding is lower than the reported prevalence of 1033% reported from port harcourt, nigeria, africa, india, and the united states [13, 1620 ]. it is, however, higher than 0% reported from enugu, nigeria, and france, respectively. comparison of this study with previous ones was made difficult by various factors which include differing cut - off values for the definition of microalbuminuria, differing assay techniques, and widely varying sample sizes, in addition to widely varying study population and selection criteria. the finding of a lower prevalence in the index study when compared to others [13, 1619 ] that reported higher prevalence may be explained by the various factors mentioned above. for example, the majority of the studies with a higher prevalence [13, 1619 ] than this study recruited haart nave patients for their studies, whereas in this study both haart nave patients and patients on treatment with haart were enrolled. the laboratory methods used in this study were similar to those used in the tanzanian study. a dipstick specific for microalbumin and creatinine expressed as albumin creatinine ratio (acr) was used on spot urine samples in both studies. however, the tanzanian study had a larger sample size of 240 participants and the authors reported a higher prevalence of microalbuminuria of 20.4% and also reported that a lower cd4 count (10 years) who also had a longer duration of infection and advanced disease. on the other hand, a study conducted in uganda reported that the majority of the children who had microalbuminuria were less than 5 years and were not on haart. these findings revealed that even though microalbuminuria may be related with age, other clinical parameters such as duration of infection, use of haart, and immunologic status may also influence the finding of microalbuminuria. in this study, no significant relationship was observed between gender and microalbuminuria which has been corroborated in many of the previous studies [13, 1619 ]. in this study, duration of infection, use of haart, and duration of treatment were analyzed for an association with microalbuminuria and no significant statistical difference was found between these clinical factors and microalbuminuria. this observation is similar to the findings by shah., who reported that the manifestation of microalbuminuria does not always correlate with duration and severity of hiv infection. on the contrary, most of the studies discussed earlier [13, 1720 ] indicated that the presence of microalbuminuria was more prevalent in patients with moderate to severe immunosuppression or advanced disease who were also haart nave. eke. in the port - harcourt study reported a prevalence of 12%, where the majority of patients that had microalbuminuria (83.3%) had clinical aids and severe immunosuppression. mistry in a south african study also reported that patients with microalbuminuria were moderately immunosuppressed and had who clinical stages 2 and 3 disease. all the studies [13, 1618 ] that recruited only haart nave subjects had a higher prevalence than that observed in this study, while those studies [21, 22 ] that reported zero prevalence recruited only patients on haart who had no advanced disease. this can be explained by the fact that the use of haart slows or even reverses the progression of hiv related kidney disease. the study in enugu that reported zero prevalence recruited patients on haart and most had early disease with no evidence of immunosuppression. the conclusion reached was that microalbuminuria occurs mainly in children who were not on harrt. there was no significant statistical difference between the findings of microalbuminuria in the early morning urine samples (ems) and spot urine samples (sus) from this study. where albumin creatinine ratio (acr) is evaluated, however, there is a need for larger studies to strengthen the findings of this study. the small sample size used for this study may have affected the results and probably the reason for the lack of association of microalbuminuria with patient characteristics identified in this study. screening for microalbuminuria may identify hiv infected patients with impaired renal function early and enable them to benefit from measures which may slow or halt the progression of disease. in this study, microalbuminuria was observed in some of the children with hiv infection seen at akth and there was no significant relationship between the finding of microalbuminuria and age, gender, duration of infection, use of haart, and duration of treatment. there was also no significant difference between the use of ems and sus in screening for microalbuminuria in hiv infected children seen in akth. in an attempt to improve patient compliance and acceptability, sus may be considered in place of ems to screen for microalbuminuria. periodic screening for microalbuminuria using albumin specific dipstick, a simple and relatively inexpensive procedure, should be considered for children with hiv infection. furthermore there is the need to conduct further studies to establish the natural course of microalbuminuria in children with hiv infection.	microalbuminuria has been reported to be a precursor of hiv related renal disease, which if detected early and coupled with appropriate intervention may slow or retard the progress of the disease. one hundred and seventy - eight hiv infected children aged 15 years and below were recruited from the paediatric infectious disease clinic of aminu kano teaching hospital (akth), kano, to determine the prevalence of persistent microalbuminuria using the albumin creatinine ratio (acr). early morning urine samples and spot urine samples were analyzed using a dipstick specific for microalbumin. those who tested positive had their samples reanalyzed in the laboratory using immunometric assay and jaffe reaction method for albumin and creatinine, respectively. patients that had acr of 30300 mg / g were said to have microalbuminuria and had their urine samples retested after 6 to 8 weeks. twelve children (6.7%) had persistent microalbuminuria and had a mean age of 7.5 3.3 years, with a male to female ratio of 1 : 1. there was no significant relationship between the finding of microalbuminuria and age, sex, duration of infection, and the use of highly active antiretroviral therapy. periodic screening for microalbuminuria using albumin specific dipstick should be considered for children with hiv infection.
lymphoma, malign melanoma and rhabdomyosarcoma are the most common tumors that metastasize to the breast tissue. breast metastases in cases of leukemia are very rare and occur primarily in patients with acute myeloid leukemia. we report the conventional and advanced magnetic resonance imaging (mri) findings of unilateral breast involvement of all and review the literature. a 32-year - old woman with all under remission was admitted to the department of internal medicine in our institution. this patient was first diagnosed with all in june 2004 and was treated between june and december 2004. the giant mass, involving the whole right breast at the time of presentation grew progressively in a period of 3 months. the mass and contralateral breast tissue was further evaluated with mri, diffusion weighted imaging (dwi) and mr spectroscopy. mri was done with a 1.5 tesla mr device (signa hdx ; general electric, milwaukee, usa). the routine sequences were axial short ti inversion recovery (stir), sagittal fast spin echo (fse), fat saturated t2w, sagittal 3d vibrant (postcontrast fat saturated t1w). we added dwi with b=0 and b=600 values and brease (single voxel mr spectroscopy) sequence. the giant right breast mass was hyperintense - isointense on precontrast fat saturated t1w images (figure 1a) and heterogeneously hypointense - hyperintense on stir and fat saturated t2w images (figure 1b and 1c). in the vibrant sequence, there was a prominent enhancement of the solid components (figure 1d and 1e). time - signal intensity curves obtained by post - processing were classified as type 2 (figure 1f). the lesion was hyperintense on dwi (figure 1 g), and hypointense in apparent coefficient diffusion (adc) maps (figure 1h). the adc value was extremely low (3.1210 mm / sec) representing prominent restricted diffusion. a prominent choline peak compatible with malignancy was detected at 3.2 ppm in the brease sequence (figure 1i). there was no sign of chest wall invasion and the other breast was normal. with these findings cd34 (+), tdt (+), cd20 (-), cd3 (-), cd79 (-), mpo (-) were found in immunhistochemical analysis. a new chemotherapy regimen was started, but unfortunately the treatment was not successful and the patient died. metastases to the breast from extramammary malignant neoplasms are unusual and were described first in 1903. metastatic cancer to the breast is often discovered as a superficial solitary mass (85%), located in the upper outer quadrant (66%). metastases are frequently multiple and bilateral, but they are more commonly large, solitary tumors. metastatic breast leukemia is very rare and occurs primarily in patients with acute myeloid leukemia. the explanation of this ring - enhancement is reported due to the central necrosis and peripheral angiogenesis in the literature. malignant tumors, show attenuated diffusion on dwi, and the adc values are low secondary to high cellular density. choline takes part in cellular membrane turn - over and is a marker of cellular proliferation. in malignancy, the choline concentration increases as a result of both intracellular phosphocholine and high cellular density of the lesion. moreover, it was reported that high choline content was compatible with the increase of angiogenetic activity. in our case the extremely rare involvement of the breast in cases of leukemia can be the only complaint at initial presentation or seen as relapse. moreover, radiotherapy performed for breast malignancies can also cause acute leukemia in breast tissue. in a patient with a known malignancy, any enlarging breast mass, even one with a reassuring benign sonographic appearance must be investigated promptly, initially with fine - needle aspiration or core needle biopsy. breast metastases are usually associated with disease originating elsewhere, and the prognosis is generally poor.	breast metastases in cases of leukemia are rare. we aimed to report the conventional - advanced magnetic resonance imaging (mri) findings of unilateral breast involvement of acute lymphoblastic leukemia (all) and review the literature. a 32-year - old woman was first diagnosed with all in treated in 2004. she did not continue the follow - up after 2008. she was presented with a giant, progressive right breast palpable mass in 2010. mass, contralateral breast tissue were evaluated with mri, diffusion weighted imaging and mr spectroscopy. with mri findings, lesion was evaluated as malignant, tru - cut biopsy revealed recurrence of all. lymphoma, malignant melanoma, rhabdomyosarcoma are most common tumors metastase to breast. breast metastases of leukemia are rare and occur primarily in patients with acute myeloid leukemia. secondary all breast involvement is uncommon. in a patient with malignancy, any enlarging breast mass, even with benign radiologic appearance, should be investigated carefully and metastasis should not be forgotten.
. advanced laparoscopic procedures are increasingly being utilized as an alternative for laparotomy in gynecologic surgery. a metaanalysis of 27 prospective randomized trials has proven the benefits of laparoscopic - assisted vaginal hysterectomy (lavh) compared with abdominal hysterectomy (ah) : decreased pain, decreased surgicalsite infections (decreased relative risk 80%), decreased hospital stay (2 days less), quicker return to activity (2 weeks sooner), and fewer postoperative adhesions (decreased 60%). in a cost - effectiveness analysis of lavh versus ah for large uteri, current procedural terminology (cpt) codes characterize large uteri as uteri > 250 g, (4 times normal uterine weight). several authors have described the use of lavh for uteri weighing 500 g. however, no authors have looked specifically at the use of lavh for uteri weighing 1000. the purpose of this study was to evaluate the safety and efficacy of lavh performed for uteri weighing 1000 g. fifteen patients underwent attempted lavh for uteri > 1000 g. patients were identified through the senior author 's surgical log from january 2005 to may 2007. all patients requiring surgery for large leiomyoma 's were offered lavh ; no patients refused lavh, and no patients were excluded. institutional review board approval was obtained, and a retrospective computerized chart review was performed. a single lavh was converted to laparotomy due to extensive pelvic adhesions, and the patient and surgical characteristics were not included. a minimally invasive, academic gynecological oncologist from our minimally invasive surgical institute performed all cases, assisted by a senior gynecologic resident and a junior gynecologic resident or medical student. all patients received a preoperative bowel prep with 45 ml of fleets phosphosoda orally, a single dose of preoperative prophylactic antibiotics and external pneumatic cuffs. on postoperative day 1, patients were given bowel stimulation with 45 ml of fleets phosphosoda, started on a general diet, and were discharged when fluid intake was adequate. all procedures were performed with the patient under general endotracheal anesthesia. an orogastric tube was inserted and removed at the end of surgery. the patient was positioned in the dorsolithotomy position with legs in allen stirrups, and placed in a maximal trendelenburg position (30). a gel pad was placed under the buttocks to prevent the patient from gravitating towards the head of the table. a 5-mm trocar was inserted in the supraumbilical or left upper quadrant (depending on uterus size, previous abdominal / pelvic incisions, and body habitus) following veress needle pneumoinsufflation. two additional 5-mm ports were placed in the right and left side, the position depending on the size and shape of the uterus. it is essential to place an adequate number of ports to allow maximum uterine manipulation out of the pelvis and medial off of the pelvic side wall. typically, a vaginal manipulator and 3 laparoscopic graspers are used to manipulate the uterus. one grasper is applied to the contralateral round ligament, and 2 graspers are used as fulcrums (figure 1). round ligaments were excised with the plasmakinetic cutting forceps (gyrus acmi, southborough, ma). retroperitoneal spaces were dissected, both ureters were identified, and the infundibulopelvic ligaments or ovarian ligaments / fallopian tubes (depending on patient 's preference for ovarian conservation) were excised with the pk cutting forceps. the anterior and posterior leaf of the broad ligament was dissected. using multiple laparoscopic graspers and the vaginal uterine manipulator, the uterus after the uterus had been manipulated out of the pelvis, the bladder was dissected off the cervix with monopolar electrosurgery. because of the enlarged size of the uterine vessels, the vessels were coagulated on the uterus prior to the standard coagulating and cutting. all attempts were made to excise the cardinal and uterosacral ligaments with the pk cutting forceps. the remainder of the uterosacral ligament was cut and suture ligated with 0 polyglycolic acid sutures. pain assessment was evaluated using the visual analog scoring system : 0 - no pain, 2 mild pain, 5 moderated pain, 7 severe pain, and 10 excruciating pain. at our institution, visual analog scoring is performed and recorded every 4 hours by the nursing staff. the highest visual analog score on postoperative day 0 or postoperative day 1 were used. all patients were evaluated by the same nursing staff and had the same preprinted postoperative pain management protocol. all patients received a preoperative bowel prep with 45 ml of fleets phosphosoda orally, a single dose of preoperative prophylactic antibiotics and external pneumatic cuffs. on postoperative day 1, patients were given bowel stimulation with 45 ml of fleets phosphosoda, started on a general diet, and were discharged when fluid intake was adequate. all procedures were performed with the patient under general endotracheal anesthesia. an orogastric tube was inserted and removed at the end of surgery. the patient was positioned in the dorsolithotomy position with legs in allen stirrups, and placed in a maximal trendelenburg position (30). a gel pad was placed under the buttocks to prevent the patient from gravitating towards the head of the table. a 5-mm trocar was inserted in the supraumbilical or left upper quadrant (depending on uterus size, previous abdominal / pelvic incisions, and body habitus) following veress needle pneumoinsufflation. two additional 5-mm ports were placed in the right and left side, the position depending on the size and shape of the uterus. it is essential to place an adequate number of ports to allow maximum uterine manipulation out of the pelvis and medial off of the pelvic side wall. typically, a vaginal manipulator and 3 laparoscopic graspers are used to manipulate the uterus. one grasper is applied to the contralateral round ligament, and 2 graspers are used as fulcrums (figure 1). round ligaments were excised with the plasmakinetic cutting forceps (gyrus acmi, southborough, ma). retroperitoneal spaces were dissected, both ureters were identified, and the infundibulopelvic ligaments or ovarian ligaments / fallopian tubes (depending on patient 's preference for ovarian conservation) were excised with the pk cutting forceps. the anterior and posterior leaf of the broad ligament was dissected. using multiple laparoscopic graspers and the vaginal uterine manipulator, the uterus after the uterus had been manipulated out of the pelvis, the bladder was dissected off the cervix with monopolar electrosurgery. because of the enlarged size of the uterine vessels, the vessels were coagulated on the uterus prior to the standard coagulating and cutting. all attempts were made to excise the cardinal and uterosacral ligaments with the pk cutting forceps. the remainder of the uterosacral ligament was cut and suture ligated with 0 polyglycolic acid sutures. pain assessment was evaluated using the visual analog scoring system : 0 - no pain, 2 mild pain, 5 moderated pain, 7 severe pain, and 10 excruciating pain. at our institution, visual analog scoring is performed and recorded every 4 hours by the nursing staff. the highest visual analog score on postoperative day 0 or postoperative day 1 were used. all patients were evaluated by the same nursing staff and had the same preprinted postoperative pain management protocol. median age was 45 years old (range, 31 to 57), and median weight was 170 pounds (range, 130 to 236). nine of the 14 patients (64%) had medical comorbidities, and 6 of 14 patients (43%) had prior pelvic surgery. median operative time was 3.5 hours (range, 2 to 4.6), and median blood loss was 400cc (range, 100 to 1200). median postoperative pain score was 4 discomforting (range, 0 to 8). at 28-day follow - up interestingly, the one patient converted to laparotomy developed a pulmonary embolus on postoperative day 6. we were successful in performing lavh for uteri > 1000 g in 14 of 15 patients (93%). median operating time was 3.5 hours, and median blood loss was 400 ml. all patients were discharged on postoperative day one. consistent with a large meta - analysis showing advantages of lavh verses abdominal hysterectomy for normal size uteri, our patients had little pain, no surgical site infections, and a hospital stay of only one day. if an abdominal approach is chosen for uteri weighing > 1000 g, a long abdominal incision would be required resulting in increased postoperative pain, increased chance of surgical site infection, and longer hospital stay. as we have previously reported, no significant increased cost is incurred with lavh verses abdominal hysterectomy for large uteri because the increased cost of operative time associated with lavh is balanced by the increased cost of the additional 2 days of hospital stay for abdominal hysterectomy. because of the technical challenges in performing lavh for uteri > 1000 g, it is our opinion, that several surgical techniques are essential. first, patients must be placed in a maximum trendelenburg position. because median procedure time is 3.5 hours, we recommend placing a gel pad under the buttocks to prevent the patient from gravitating towards the head of the table. second, an adequate number of ports and surgical assistants are necessary to manipulate the uterus out of the pelvis and off of the pelvic side wall. the round ligament, infundibulopelvic ligament (or ovarian ligament / fallopian tubes) and broad ligament must be resected to allow uterine manipulation. frequently, the uterus needs to be rocked with the laparoscopic graspers and vaginal uterine manipulator to manipulate it out of the pelvis. third, we do not attempt to dissect the bladder off the cervix until the uterus has been manipulated out of the pelvis to avoid bladder injury. we performed multiple coagulations of the uterine vessels on the uterus bilaterally to control back bleeding before coagulating and cutting the uterine vessels. without performing this technique finally, the surgeon must have patience when morcelating the uterus vaginally because it typically takes approximately one hour. it is our opinion that vaginal morcelization with monopolar electrosurgery is approximately 50% faster than using the laparoscopic morcelator. we performed a pub med literature search from 1965 to the present and located 6 articles addressing lavh for large uteri, but none specifically for urteri weighing 1000 g or more. pelosi reported on lavh for uteri weighing 500 g. they described a single uterus that weighed > 1000 g (1095 g), but the lavh was converted to abdominal hysterectomy. darai reported on lavh for uteri between 290 g and 1560 g. procedures for both of the large uteri, 1450 g and 1560 g had to be converted to laparotomy. wang presented a study on lavh for uteri > 500 g, and successfully removed 2 uteri weighing more than 1000 g. lyons presented a study for lavh for uteri > 300 g. at least one uterus weighing > 1000 g was successfully removed. finally, wattiez reported on laparoscopic hysterectomies for uteri > 500 g and successfully removed a uterus weighing 1230 g. we successfully performed lavh for uteri > 1000 g in 14 of 15 patients (93%), with 3.5-hour operative time and 400 ml blood loss. all patients were discharged on postoperative day 1, and median pain was only discomforting. we believe that lavh is a safe and effective approach for uteri > 1000 g. it is our opinion that 3 surgical techniques are required ; maximum trendelenburg position, adequate number of ports, and double coagulation of the uterine vessels.	introduction : prospective randomized trials have proven the benefits of laparoscopic - assisted vaginal hysterectomy (lavh) compared with abdominal hysterectomy. the purpose of this study was to evaluate the safety and efficacy of lavh performed for uteri weighing 1000 grams.methods:fifteen patients underwent attempted lavh for uteri > 1000 g. median age was 45 years old (range, 31 to 57), and median weight was 170 pounds (range, 130 to 236) ; 64% had medical comorbidities, and 43% had prior pelvic surgery. five ports (5 mm) were used to allow maximum uterine manipulation. uterine vessels were doubly coagulated.results:fourteen of 15 cases (93%) were successfully completed laparoscopically. median uterine weight was 1090 grams (range, 1000 to 1650). median operative time was 3.5 hours (range, 2 to 4.6), and median blood loss was 400 ml (range, 100 to 1200). all patients were discharged on postoperative day one, and no patients developed a postoperative complication.conclusion:we believe that lavh is a safe and effective approach for uteri larger than 1000 g. it is our opinion that 3 surgical techniques are required ; maximum trendelenburg position, adequate number of ports, and double coagulations of the uterine vessels.
the data deluge brought about by the genomic projects has fostered an unprecedented level of expectation for new medical, pharmacological, environmental and biotechnological discoveries. proteins mediate the majority of the functions of an organism, and all these functions are, by and large, determined by the proteins ' 3d structure. despite the progress achieved so far by structural genomics projects (1), the exploration of the complete protein structure space through experimental techniques such as x - ray crystallography and nmr spectroscopy is still out of reach, because these techniques are time and resource consuming and not necessarily successful in all cases. consequently the gap between the numbers of known protein structures and sequences is steadily increasing. natural proteins spontaneously assume a unique 3d structure that, by and large, only depends upon the protein sequence. the problem of understanding the rules governing the folding process is very challenging and as yet unsolved. however, approximate methods for inferring the structure of a protein from its amino acid sequence are flourishing (2). their results are of enormous relevance in many fields, from medicine to biology, from biotechnology to pharmacology. information derived from protein models has indeed proven to be useful by itself and in combination with experiments. protein models have been shown to be instrumental for the refinement of experimental structures (3,4), the design of site - directed mutants (5), the characterization of molecular function (6) and structure - based drug design (7). not surprisingly, a growing number of scientific papers reporting the results of modelling experiments and their application to the design and interpretation of experiments are appearing in the literature. unfortunately, the models described in these reports are rarely publicly available and, in general, only accessible via direct interaction with the authors. the difficulty of mining the available structural model data leads to duplication of efforts and impairs the possibility of numerically evaluating the correctness of the models when the experimental structure becomes available. the establishment of public repositories for these protein 3d models can partly overcome these problems. specialized databases, such as modbase (8) and the swiss - model repository (9), are already available for automatically built protein structure models. we have developed, and describe here, a protein model database (pmdb) where manually built models can be deposited and retrieved, together with their supporting information. pmdb (interactively accessible at) is a relational database of protein models submitted by users and obtained with different structure prediction techniques. the database is implemented on a linux server (suse enterprise server 9) running apache, and the management system is mysql 4.1.12. the queue management system is written in perl. php scripts and gd libraries are used for launching applications such as blast and for display, respectively. the current release contains > 74 000 models for 240 proteins, the majority of which are predictions submitted to the critical assessment of techniques for structure prediction experiment (2). other models include those generated by our group (10,11) and models that we uploaded using published alignments (1215). the database entry point is a protein target, for which one or more structural models can be present in the database. available information for each target includes the protein name, sequence and length, organism and, whenever applicable, links to the swissprot sequence database (16). several models can be present for each target protein, or for different regions of the same target protein and the user can navigate through them using a graphical view shown in figure 1. after the structure of a target is solved, the database entry is also linked to the experimental structure in the pdb (17). models can be submitted in the form of a pdb file (ts format) or as an alignment to one or more known protein structures (al format). in the latter case the coordinates of the backbone of the model are built using the al2ts program (). when a user submits a model for a protein, the system verifies whether the exists (i.e. there is already a model for some regions of the same protein). if not, the target is created and the model mapped to it. unless the target is an artificial or mutant protein, the target entry is linked to existing sequence databases [at present the ncbi nr database (18) ]. the predictor can provide the ncbi i d of the protein (in which case the system performs a sequence check), ask for a blast search in the database to retrieve the i d (if more than one entry matches the sequence, the user is requested to select the correct one), or inform the system that the target is not expected to be present in any sequence database. the sequence of the target is derived from the submitted model pdb or alignment file. in the former case, if the distance between consecutive c is larger than expected for connected residues, the user is asked whether he or she wants to complete the target sequence (figure 1). the system also reports cases where atoms in the model are closer than the sum of their van der waals radii. the database stores information about the author of the model, a short description of the method used and supporting evidence, in the form, for example, of a multiple sequence alignment. submitters are also asked to assign a reliability value to their model(s) and a literature reference that can also be provided at a later stage. models can be kept on hold upon request and made available to the general users after at most 6 months from deposition. at the end of the submission procedure, the user interface allows the model(s) to be searched by protein or organism name, protein accession number (in the nr database), author, pmdb model identifier, model type (i.e. a complete coordinate set indicated by ts or an alignment to a known structure indicated by al). search results are displayed in the form of a table, listing the records satisfying all selected criteria (figure 1). each row refers to a target sequence and related models, along with summary information. every model that is not on hold can be downloaded or displayed through the 3d visualization program rasmol (20). immediate future plans for the database include the possibility of using uniprot identifiers (21) for the protein targets and to perform more sophisticated searches. we also plan to add provisions for evaluating the models, other than the simple stereochemical checks performed at present, using tools such as whatcheck (22), verify3d (23) and prosa (24) as well as tools to automatically evaluate the quality of models of proteins the structure of which is subsequently solved (25). this will permit, in the future, to analyse the correlation between the actual quality of the models with the reliability values assigned by the authors and with those estimated by automatic verification tools. when a user uploads a model, its amino acid sequence is automatically retrieved from its coordinate file. residues for which coordinates are not available in the pdb model file, if any, can be manually inserted.	the protein model database (pmdb) is a public resource aimed at storing manually built 3d models of proteins. the database is designed to provide access to models published in the scientific literature, together with validating experimental data. it is a relational database and it currently contains > 74 000 models for 240 proteins. the system is accessible at and allows predictors to submit models along with related supporting evidence and users to download them through a simple and intuitive interface. users can navigate in the database and retrieve models referring to the same target protein or to different regions of the same protein. each model is assigned a unique identifier that allows interested users to directly access the data.
autophagy is induced downstream of signaling by danger receptors including toll like receptors (tlr ; xu., 2007 ; delgado., 2008), retinoic acid inducible gene i - like receptors (rlr ; yano., 2008 ; cooney., 2010 ; travassos., xenophagy describes the process by which intracellular microbes are selectively degraded by autophagy (levine, 2005). xenophagy eliminates bacteria that access the cytosol including streptococcus pyogenes (nakagawa., 2004) and mycobacterium tuberculosis (gutierrez., guerin (bcg), autophagy facilitates the fusion of mycobacteria containing vacuoles with late endosomes / lysosomes to promote mycobacteria degradation (singh., 2006). salmonella - containing vacuoles are targeted by lc3 (birmingham., 2006) and can be engulfed by autophagosomes (kageyama., 2011). interestingly, recruitment of autophagy machinery to damaged bacterial vacuoles involves the exposure of host sugar residues that attract receptor galectin 8 (thurston., 2012). one example is the degradation of the sindbis virus capsid by the autophagy pathway (orvedahl., 2010). autophagy can also impair viral replication by trafficking cytosolic viral replication products to the endolysosomal compartment where they are detected by tlr and a type i interferon (ifn) response is triggered. this is the case for vesicular stomatitis virus (vsv) infection of plasmacytoid dendritic cells (pdc ; lee., 2007). given its role in anti - viral defense, many viruses encode proteins to disable autophagy. gammaherpes virus 68 (ku., 2008), influenza a virus (gannage., 2009), herpes simplex virus-1 (hsv-1 ; orvedahl., 2007), human cytomegalovirus (chaumorcel., 2012), and human immunodeficiency virus (hiv;kyei., 2009) are examples of viruses that encode proteins to block autophagy initiation by interfering with beclin 1 activity. other interesting examples of viral interference with the autophagy pathway include kaposi s sarcoma - associated herpesvirus encoded fadd - like interleukin-1 beta - converting enzyme (flice)-like inhibitor protein that blocks interaction between lc3 and atg4 (lee., 2009) and hiv nef that prevents autophagosomal maturation (kyei., 2009). like viruses l. monocytogenes, via the expression of acta, recruits host proteins to its surface to disguise itself from autophagic recognition (yoshikawa., 2009) similarly, shigella hides from the autophagy machinery by expressing icsb, that inhibits atg5 binding to the shigella surface (ogawa., this is particularly well described for interleukin (il)-1 and il-18, where the absence of autophagy exacerbates their secretion by murine macrophages when stimulated with pro - inflammatory compounds. specifically, this has been described for beclin1 (nakahira., 2011), lc3b (nakahira., 2011), atg16l1 (saitoh., 2008), and atg7 (saitoh., 2008) macrophages or following expression of inactive atg4b or due to treatment with the chemical autophagy inhibitor 3-methyladenine (3-ma ; saitoh., 2008 ; harris., 2011). enhanced secretion of il-1 also occurs when human peripheral blood mononuclear cells are stimulated in the presence of an impaired autophagy pathway due to treatment with 3-ma (crisan., conversely, stimulation of murine dc with rapamycin suppresses il-1 production in response to inflammatory stimuli (harris., 2011). rapamycin administration in vivo, inhibits the detected increase in il-1 but not il-12, in the serum 4 h following lipopolysaccharide (lps) treatment (harris., 2011). stimuli that do include lps, or treatment of lps - primed macrophages with adenosine 5-triphosphate (atp) or monosodium urate (msu). salmonella typhimurium or muramyl dipeptide, a nucleotide - binding oligomerization domain - containing protein 2 (nod2) ligand, do not provoke such a response (saitoh. ligands that engage tlr4 and to some extent those recognized by tlr3, tlr7, and tlr9, but not tlr2 or tlr5, elicit enhanced il-1 in autophagy - deficient macrophages (saitoh., 2008). in murine macrophages, excessive cytokine production following autophagy shutdown requires tir - domain containing adapter inducing ifn (trif), an adapter molecule for tlr signaling (saitoh., 2008), while in human cells the response is dependent on p38 mitogen activated protein kinase (mapk) phosphorylation (crisan., 2011). excessive il-1 secretion in the absence of autophagy is not associated with alterations in nfb activation (saitoh., 2008). importantly, exaggerated inflammatory cytokine production in the absence of autophagy translates to the development of severe disease in vivo. atg16l1-deficient mice display enhanced inflammatory infiltrates in the distal colon, elevated il-1, and il-18 serum levels and reduced survival in a dextran sulfate sodium induced model of experimental colitis (saitoh., 2008). lc3b - deficient mice exhibit enhanced susceptibility to lps - induced lethality (nakahira., 2011), while both lc3b - deficient and beclin1 mice have increased il-1 and il-18 serum levels in response to cecal ligation and puncture - induced sepsis (nakahira., 2011). in addition to il-1/il-18, the type i ifn pathway is also susceptible to modulation by autophagy. again the absence of a functional autophagy pathway promotes amplified secretion of type i ifn in response to a given stimulus. vsv infection of atg5-deficient murine embryonic fibroblasts (mef) elicits increased production of ifn, ifn, il-6, and ip-10 and as such dramatically attenuates viral replication rendering cells resistant to infection (jounai. another example is atg9a - deficient mef that exhibit enhanced ifn production in response to stimulation with inflammatory double stranded dna (saitoh., 2009). therefore, autophagy has the potential to exert a critical influence on the regulation of pro - inflammatory cytokine production and downstream effector mechanisms of innate immunity. the ability of autophagy to limit inflammatory cytokine production renders it a target pathway for pathogens to activate as a strategy to facilitate replication. hepatitis c virus (hcv) is an example of a pathogen that is proposed to do this. if hcv infection occurs in the absence of a functional autophagy pathway, hcv viral replication is severely attenuated due to the corresponding activation of the type i ifn pathway. therefore, hcv infection elicits active autophagy in the infected cell, limiting type i ifn production and enabling successful viral replication (ke and chen, 2011). triggering autophagy is therefore a putative mode of immune escape. pro - inflammatory stimuli induce the transcription of inactive precursors pro - il-1 or pro - il-18. cleavage of the inactive proteins into their active secreted forms requires the assembly of an inflammasome, a large protein complex that, under inflammatory conditions, processes pro - caspase-1 to caspase-1. active caspase-1 then cleaves pro - il-1 and pro - il-18 liberating the active cytokines for secretion by the cell. in mouse cells, the levels of precursor il-1 are not altered following lps stimulation in the absence of autophagy (saitoh., 2008), rather there is an increase in the cleaved form of caspase-1 (saitoh., 2008 ; in contrast, in human cells, transcription of il-1 is elevated (crisan., a major role for autophagy in inflammatory cytokine secretion is considered to be via its contribution to maintaining a healthy intracellular environment. namely, autophagy has a pivotal role in the clearance and elimination of damaged and dysfunctional organelles. studies have demonstrated autophagic degradation of depolarized mitochondria (sandoval., 2008), expanded endoplasmic reticulum (bernales., 2006), mature ribosomes (kraft., 2008 ; kundu., the role of autophagy in the maintenance of mitochondrial integrity is a process known as mitophagy. in the absence of functional mitophagy, cells accumulate damaged mitochondria that produce high levels of reactive oxygen species (ros), a side product of cellular respiration (zhou., 2011). the accumulation of damaged mitochondria is further exacerbated following stimulation with inflammatory compounds as observed for lc3b or beclin 1-deficient macrophages treated with lps plus atp (nakahira., 2011). without the autophagy pathway to remove these dysfunctional organelles, ros levels increase (saitoh., 2008), a known trigger for the nucleotide binding domain, leucine rich - containing family, pyrin domain containing 3 (nlrp3) inflammasome (zhou., 2011). damaged mitochondria also display increased membrane permeability with mitochondrial dna (mtdna) then being able to translocate to the cytosol. mtdna is detected in higher abundance in the cytosol of lc3b and beclin 1-deficient macrophages, most notably following stimulation with lps plus atp (nakahira., 2011). as such, autophagy, by acting to maintain turnover of damaged organelles and preserving mitochondrial integrity, indirectly restricts excessive inflammatory cytokine production by removing endogenous triggers of the inflammasome. the second mechanism by which autophagy controls inflammatory cytokine activity is through its direct interaction with proteins involved in inflammatory cascades. in this case, proteins are targeted by autophagosomes or the autophagy machinery. following inflammasome induction, components of the absent in melanoma 2 (aim2) inflammasome associate with p62 and beclin1 and exhibit k63-linked ubiquitination (shi., 2012). other examples of the direct targeting of inflammatory proteins by autophagy include the co - localization of the autophagosomal protein lc3 and il-1 in punctate autophagosomal structures following stimulation of bone marrow - derived macrophages with a variety of tlr ligands including lps, pam3cys, poly (i : c), r837, or cpg (harris., 2011). the authors suggest that autophagy limits il-1 secretion by facilitating its degradation in the auto - lysosome. a direct role for autophagy in modulating components of the type i ifn response is illustrated by several examples where the autophagy machinery targets proteins involved in this signaling cascade. atg5atg12 directly interacts with the cytosolic viral rna sensor rig - i and the signaling molecule ifn promoter stimulator-1 (ips-1). interaction with atg5atg12 blocks caspase recruitment domain (card)-mediated signaling and the downstream production of type i ifn (jounai., 2007). another interesting example is stimulator of interferon genes (sting), a molecule critical for type i ifn signaling. atg9a is critical for the localization of sting to cytoplasmic punctae following treatment of cells with dsdna (saitoh., 2009). mislocalization of sting to the endoplasmic reticulum results in exacerbated ifn responses (saitoh., 2009), although the specific details of why this is the case remain to be elucidated. in contrast to il-1, il-18 and type i ifn, mouse tumor necrosis factor (tnf) and il-16 (harris., 2011), and human tnf (crisan., 2011) production is inhibited when autophagy is suppressed. this is the case for macrophages following stimulation with lps or pam3cys in the presence of 3-ma. another example is the reduced production of il-8 by intestinal epithelial cells with silenced atg7 (li., 2011b). the mechanism of why these cytokine pathways require autophagy may involve autophagic inhibition of p38 phosphorylation (crisan., 2011). therefore the role of autophagy in modulating cytokine output is complex with its contribution varying for individual cytokines. another mechanism by which autophagy modulates inflammation is by restricting the expression of extracellular inflammatory signals. during programmed cell death, autophagy enables the generation of a cellular corpse that is efficiently phagocytized and less likely to elicit detrimental inflammatory outcomes. this is elegantly illustrated in a model of embryonic cavitation, where apoptotic embryonic stem cells lacking atg5 or beclin1 fail to exhibit critical engulfment signals (qu. these include failing to expose phosphatidylserine (ps) at the outer membrane and lack of secretion of the chemoattractant lysophosphatidylcholine. as a consequence, autophagy - deficient cellular corpses are not engulfed for clearance by immune cells. the failure to eliminate autophagy - deficient apoptotic corpses excess apoptotic corpses are detected in the lungs and retina, together with the presence of an abnormal inflammatory infiltrate in these tissues. interestingly, atg5 (uhl., 2009), beclin1 (li., 2008), or atg12 2008) cells loaded with antigen are less efficient at facilitating dc antigen presentation to cd8 t cells (cross - presentation). the requirement for autophagy in the display of engulfment signals is thought to be due to the pathway s role in maintaining cellular bioenergetics. restoration of atp levels in autophagy - deficient cells by treatment with methylpyruvate restores corpse clearance (qu., 2007). induction of autophagy in dying cells also stimulates the release of immune modulator high mobility group b1 (hmgb1 ; thorburn., 2009) that promotes immunogenicity and removal of apoptotic corpses (scaffidi., 2002). proteolysis provides the peptide epitopes displayed by major histocompatibility complex (mhc) molecules to elicit t cell responses. all nucleated cells utilize the proteasome, a multiproteolytic complex located in the cytosol that generates ligands for mhci presentation. in mhcii expressing cells, lysosomal proteases generate ligands for these molecules. autophagy participates in generating the pool of peptides displayed by mhcii molecules due to its role in trafficking cytosolic proteins to the lysosomes, the same compartment where biosynthesis and loading of mhcii molecules occurs. indeed, the autophagosomal protein lc3 co - localizes with mhcii loading compartments in dc (schmid., 2007). fusion of influenza matrix protein m1 (schmid., 2007) or the hemagglutinin (ha) site 1 epitope (comber., 2011) to lc3 enhances their presentation by mhcii to cd4 t cells as a result of the intersection of autophagosomes and mhcii loading compartments. autophagy contribution to mhcii antigen presentation is further supported by detailed analysis of the steady state mhcii repertoire where up to a third of peptides displayed by mhcii are shown to be derived from cytoplasmic or nuclear sources (chicz., 1993 ; dongre., 2001) and would potentially rely on autophagy trafficking to access the mhcii loading compartment. induction of autophagy increases the relative display of these peptides compared to those derived from membrane proteins (dengjel. peptides derived from lc3b and gamma - aminobutyric acid receptor - associated protein (gabarap), components of the autophagy machinery are eluted from mhcii molecules (dengjel., 2005). there is now a growing list of antigens that are documented as being trafficked by autophagy for mhcii display. these include self proteins together with virus and bacterial - derived antigens (munz, 2009). the role of autophagy in presenting self antigen by mhcii, means that autophagy contributes to cd4 t cell selection in the thymus. studies in which atg5 thymi were grafted into normal recipients elegantly illustrate that autophagy trafficking in thymic epithelial cells participates in the display of self antigen by mhcii (nedjic., 2008). transplant of atg5-deficient thymi into mhcii - restricted tcr transgenic hosts results in reduced positive selection of ha and sep - specific cd4 tcr t cells. selection of and, do11.1, or dep - specific cd4 tcr transgenic t cells, on the other hand, proceeds efficiently in the absence of autophagy. autophagy is therefore considered to facilitate the thymic mhcii presentation of some self proteins but not others. in doing so, autophagy contributes to the complex composition of the repertoire of mhcii epitopes that are displayed by the thymic epithelium. the role for autophagy in thymic selection is further evidenced by an increase in ie5268ia complexes at the surface of cortical thymic epithelial cells that lack atg5 (nedjic., 2008). in this case, it is postulated that the removal of autophagy dependent endogenous epitopes due to the absence of atg5, reduces competition and increases access of the ie peptide to mhcii. in addition to autophagy shaping the cd4 t cell repertoire that emerges from the thymus, it also participates in effective cd4 t cell immunity during infection. autophagy dependent - mhcii presentation of cytosolic model antigens has been described for complement c5 (brazil., 1997), tumor antigen mucin 1 (dorfel., 2005) and neomycin phosphotransferase (nimmerjahn., 2003) where presentation is inhibited following treatment with 3-ma. nuclear antigen 1 of epstein - barr virus (ebna-1) is a prominent example of a viral - derived antigen that requires autophagy for presentation by mhcii (paludan., 2005). treatment with 3-ma or silencing of atg12 inhibits ebna-1 specific cd4 t cells from recognizing a lymphoblastoid cell line (paludan., antigen presenting cell types that utilize autophagy to deliver antigen for mhcii presentation include b cells (brazil., 1997), macrophages (brazil., 1997), and dc (schmid., 2007 ; jagannath., 2009 ; lee., autophagy - mediated delivery of antigen for mhcii presentation to cd4 t cells means that triggering autophagy represents a promising immunotherapeutic strategy to promote robust cd4 t cell responses. indeed, immunization with rapamycin - treated dc, enhances mhcii presentation and cd4 t cell immunity to the anti - tuberculosis bcg vaccine antigen (jagannath., 2009). this is an exciting outcome, with major implications for improving vaccine efficacy in multiple settings. whether autophagy exhibits selectivity in the substrates targeted this is important if the autophagy pathway is to be manipulated for delivery of antigen to mhcii. while basal autophagy initiated under starvation conditions is considered to be a non - selective process, autophagy initiated under steady state conditions in immune cells is considered to be selective. a general observation is that long lived proteins are considered to be turned over by lysosomal proteolysis and hence are autophagy substrates, while the proteasome degrades short lived polypeptides (henell., 1987). aggregates of long lived poly - ubiquitinated proteins are known substrates of autophagy (mizushima and klionsky, 2007). of interest, protein aggregates form in activated dc (lelouard., 2002) and in macrophages following tlr4 stimulation (fujita., 2011). autophagy receptors have been described that act to recruit ubiquitinated proteins to autophagosomes via an lc3-interacting motif (lir). known autophagy receptors identified to date include p62/sequestosome1 (komatsu., 2007), neighbour of brca1 (nbr1) (kirkin., 2009), nuclear dot protein 52kda (ndp52) (thurston., 2009), and optineurin (wild., 2011) with all of these proteins possessing binding domains for both ubiquitin (ubd) and lc3 (lir). for example, p62, optineurin, and ndp52 all target ubiquitinated salmonella enterica for destruction in lysosomes (wild., 2011). while optineurin and ndp52 colocalize, p62 binds to a separate subdomain of the ubiquitinated bacteria. interestingly, optineurin is subject to phosphorylation by tank binding kinase (tbk)1, providing the molecular trigger to promote autophagic clearance of cytosolic bacteria (wild., 2011). identification of a growing number of autophagy receptors is exciting with the detail of the specific e3 ubiquitin ligases involved, the selective recognition of ubiquitin chains and their specific regulation by phosphorylation all remaining to be further studied. somewhat unexpectedly, in addition to assisting the display of cytosolic antigen by mhcii molecules, autophagy also contributes to the presentation of extracellular antigen and phagocytosis. individual components of the autophagy machinery are recruited to phagosomes in the presence of tlr signaling. during a process termed (sanjuan and green, 2008), lc3 is recruited to latex - bead phagosomes in macrophages, when beads are coupled with the tlr agonists lps or pam3cys or in response to phagosomes containing killed yeast particles (zymosan ; sanjuan., 2007). lap also contributes to the phagocytosis of apoptotic, necrotic, or receptor interacting kinase-3 (ripk3)-necrotic cells with this response being triggered by the t cell immunoglobulin and mucin domain containing molecule (tim)4 receptor (martinez., 2011). entosis, the engulfment of live cells, also involves localization of lc3 to the entotic vacuole (florey., 2011). the recruitment of lc3 to phagosomes requires other components of the autophagy machinery given that it does not take place in the absence of atg5 (sanjuan., 2007 ; martinez., 2011), atg7 (sanjuan., 2007 ; martinez., 2011), or beclin-1 (martinez., 2011) the role of autophagy in extracellular phagocytosis and mhcii antigen presentation is evident given that atg5-deficient dc show impaired mhcii presentation of soluble and cell - associated antigen and elicit impaired cd4 t cell responses in response to antigens derived from herpes simplex virus-2 (hsv-2 ; lee., infection of atg5-deficient mice with hsv-2 results in a failure of atg5-deficient mice to mount protective cd4 t cell immunity and enhanced disease progression occurs (lee., autophagy also contributes to exogenous processing and mhcii presentation of hiv-1-derived protein (blanchet., 2010). the autophagy machinery is considered to contribute to phagocytosis by facilitating phagosome to lysosome fusion and the delivery of lysosomal proteases to phagosomes, required for effective antigen degradation. extracts of phagosomes isolated from atg5-deficient dc displayed impaired cathepsin (cat) s, catb / l activity when assayed with fluorogenic substrates (lee., 2010). a contribution of autophagy to mhci antigen presentation is less obvious, given that the major proteolytic source of peptide generation for mhci is the proteasome and not lysosomal proteases. indeed, there are several reports discarding a role for autophagy in mhci presentation of antigen derived from extracellular sources (cross - presentation ; blanchet. one report demonstrates the requirement for autophagy in macrophage mhci presentation of glycoprotein b (gb), a hsv-1-derived protein (english., 2009). in this case, treatment with 3-ma or silencing of atg5 reduced presentation of gb by macrophages late after infection. gb is proposed to be trafficked from the nuclear envelope to the autophagosome from where its escapes for degradation by the proteasome and mhci display. whether this applies only to hsv-1 infection, macrophages, or another example is the cross - presentation of antigen loaded al2o3 nanoparticles (li., mhci presentation of al2o3 nanoparticles loaded with ova is inhibited following 3-ma treatment or silencing of atg12 or beclin1. the mechanism is unknown, however internalized nanoparticles are shown to access autophagosomes that are considered to be immunogenic (li., 2008). autophagy may also impact mhci presentation by degrading mhci molecules themselves (li., 2010). an important contribution of autophagy to adaptive immunity is its cell intrinsic role in lymphocyte survival. an active autophagy pathway operates in t cells, with autophagosomes detected, particularly following activation via the t cell receptor (tcr) (espert. analysis of t cell compartments in atg5-deficient mice illustrates a role for autophagy in mature t cell survival (pua., 2007). while thymus cellularity is reduced in the absence of atg5, thymocyte development is unperturbed. in the periphery, reduced numbers of cd4 and cd8 t cells are present in the spleen and lymph node. the cd8 t cell compartment is more affected, with a large proportion of atg5-deficient cd8 t cells staining with annexin v, indicative of cells undergoing early apoptosis. both cd4 and cd8 t cells that survive in the absence of atg5 display proliferative defects following tcr stimulation, with fewer cells undergoing division, and fewer divisions completed in response to anti - cd3 compared with wildtype t cells. the proliferative defect is not rescued by anti - cd28 or il-2 and the cells display normal levels of tcr and upregulate t cell activation markers cd69 and cd25. a similar phenotype is observed in atg7lck - cre mice where the specific deletion of atg7 in the t cell lineage results in mostly normal thymocyte development, however cd4 and cd8 t cell numbers are greatly reduced in the peripheral lymphoid compartment. both subsets of peripheral t cells display evidence of apoptosis ; with a large proportion staining with annexin v and exhibiting caspase 9 activity. impaired t cell survival in the absence of autophagy is likely to arise from its pivotal role in maintaining intracellular organelle integrity. atg7-deficient t cells possess increased numbers of mitochondria and increased ros levels (pua., 2009). for the b cell compartment, the absence of atg5 impairs b cell development in the bone marrow, with reduced survival of pre - b cells and consequently reduced numbers of mature b-1a cells in the periphery (miller., 2008). in some settings examples include autophagy - mediated t cell death following growth factor withdrawal (li., 2006) and following binding of the hiv-1 envelope protein to c - x - c chemokine receptor 4 (espert., therefore, autophagy serves as a critical pathway in lymphocytes that facilitates the intricate balance between survival and death. the critical impact of autophagy on effector functions of innate and adaptive immunity outlined herein, is highlighted by the association of autophagy gene mutations with increased incidence of inflammatory disease, susceptibility to microbial infection and autoimmune disease. a prominent example is atg16l1, a susceptibility gene for crohn s disease (massey and parkes, 2007), where the small intestine exhibits chronic inflammation triggered by a breakdown in the clearance of commensal bacteria. atg16l1-deficient paneth cells possess elevated pro - inflammatory cytokine transcripts, while atg16l1-deficient mice develop exacerbated intestinal inflammation following environmental triggers, similar to that observed in human patients (cadwell., 2008). other examples include cystic fibrosis, a chronic inflammatory disease of the pulmonary airways, where autophagy - mediated maintenance of lung epithelial cell homeostasis is important to limit lung inflammation and disease (luciani., 2010). autophagy is also postulated to contribute to inflammation - associated responses underlying metabolic diseases, such as obesity (yang., 2010). in infectious disease settings, irgm, a human immunity - related gtpase that plays a critical role in regulating autophagy - mediated clearance of mycobacteria, is a genetic risk factor for tuberculosis (intemann., 2009). finally, a link between single nucleotide polymorphisms in the atg5 gene and susceptibility to systemic lupus erythematosus, a debilitating autoimmune disease has been reported (gateva., 2009). the emergence of often surprising roles for autophagy in diseases of the immune system means that a wide range of immune - related diseases may now be amenable to targeting by autophagy modulating drugs. as such studies of autophagy in innate and adaptive pathways provide excellent insights into this complex pathway, uncovering new roles for autophagy in disease. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.	macroautophagy (autophagy) is a cellular pathway facilitating several critical functions. first, autophagy is a major pathway of degradation. it enables elimination of microbes that have invaded intracellular compartments. in addition, it promotes degradation of damaged cellular content, thereby acting to limit inflammatory signals. second, autophagy is a major trafficking pathway, shuttling content between the cytosol and the lysosomal compartment. given these two key roles, autophagy can have significant and sometimes unexpected consequences on mechanisms that initiate robust immunity. here, we will discuss the impact of autophagy on pathways of innate and adaptive immune responses including microbe elimination, inflammatory cytokine production, antigen processing and t and b lymphocyte immunity.
in response to a dynamic nutrient environment, cells must assess their metabolic state to decide whether to grow, survive, or die. it has become evident that metabolites themselves must feed back to regulate gene expression, signal transduction, and various protein activities in cellular decision - making processes. these small molecule metabolites play critical roles in relaying metabolic information to their protein and nucleic acid counterparts. however, despite increased recognition of such reciprocal interplay, many aspects of the mechanisms through which metabolites exert their influence on cellular regulatory mechanisms are still being unraveled. amongst the thousands of metabolites present in the cellular milieu at any given time, which might represent the sentinel one well - known signature of metabolic state is amp, which indicates cellular energy charge and accumulates upon atp insufficiency. amp regulates the activity of the amp - activated protein kinase (ampk), which phosphorylates many proteins involved in cellular energy homeostasis. another example is nad, which indicates the cellular redox status as a ratio of nad to nadh. herein, we discuss the hypothesis that acetyl - coa represents an additional prominent gauge of the cell s metabolic state with substantial influence on numerous biological regulatory mechanisms. acetyl - coa is a metabolite derived from glucose, fatty acid, and amino acid catabolism. during glycolysis, glucose is broken down into two three - carbon molecules of pyruvate. the mitochondrial pyruvate dehydrogenase complex then catalyzes the oxidative decarboxylation of pyruvate to produce acetyl - coa, a two - carbon acetyl unit that is ligated to the acyl - group carrier, coa. in the mitochondria, citrate synthase then catalyzes the condensation of the acetyl moiety of acetyl - coa with oxaloacetate to yield a six - carbon citrate molecule. citrate can proceed to be oxidized via the tca cycle, or alternatively it can be transported to the cytosol as a substrate for the enzyme atp citrate lyase, which cleaves citrate to regenerate acetyl - coa and oxaloacetate (fig. the function of this pathway is to direct acetyl - coa away from the mitochondria and back to the cytosol for the synthesis of fatty acids and sterols. as such, cells can store excess carbohydrates as fat. thus, the function of the atp citrate lyase enzyme offers a clue to the logic and direction of carbon flow acetyl - coa units are shipped out of the mitochondria in the form of citrate when carbon sources are abundant, indicating a favorable nutrient state. nucleocytosolic pools of acetyl - coa are also utilized for histone acetylation and the activation of gene expression. atp citrate lyase was shown to provide a source of acetyl - coa for histone acetylation in mammalian cells. the budding yeast saccharomyces cerevisiae, which lacks atp citrate lyase, relies on acetyl - coa synthetase enzymes to supply acetyl - coa for histone acetylation. moreover, a special cohort of yeast genes important for growth, such as those required for ribosome biogenesis and the g1 cyclin cln3, are especially dependent on histone acetylation for their activation. as such, the expression of these growth genes is closely coupled to acetyl - coa as an indicator of the cell s nutritional state. thus, when carbon sources are abundant, nucleocytosolic amounts of acetyl - coa accumulate and facilitate the processes of lipid synthesis and histone acetylation (fig. during starvation, cells must typically shift from growth to survival mode and alter metabolism towards functions important for viability. instead of shipping acetyl units out to the cytosol, there is now a greater requirement for acetyl - coa to be oxidized in the mitochondria for atp synthesis (fig. coa synthesis is induced to activate fatty acids as fatty acyl - coas, which can then be transported into mitochondria via the carnitine shuttle for -oxidation. as a result, acetyl - coa is generated in the mitochondria for oxidation or other possible fates. in the liver, mitochondrial acetyl - coa is used to synthesize ketone bodies (acetoacetate and -hydroxybutyrate) as alternative fuel sources for the brain and heart under conditions of carbohydrate scarcity. under such conditions, lower nucleocytosolic acetyl - coa will also limit fatty acid synthesis, histone acetylation, and other growth - related processes. atp citrate lyase is inhibited under these situations at both the transcriptional and post - translational levels. depletion of nucleocytosolic acetyl - coa also represents a cue to induce autophagy. in yeast, the expression of a core autophagy gene (atg7) is repressed by acetyl - coa. during the yeast metabolic cycle (ymc), many atg genes (including atg1 and atg8) are repressed during growth phases when acetyl - coa levels rise, and are activated only during the stress / survival phases when acetyl - coa levels fall. more generally, many other genes with functions involved in stress and survival are induced concomitantly with core autophagy genes. these genes tend to be less dependent on histone acetylation for their activation, perhaps due to reduced availability of acetyl - coa. in mammalian cells, autophagy regulation by acetyl - coa occurs in a manner dependent on the p300 acetyltransferase. thus, the regulation of autophagy by acetyl - coa may occur primarily at the level of transcriptional control of core autophagy genes. taken together, under fasted or carbon - poor states, nucleocytosolic amounts of acetyl - coa decrease in cells, while mechanisms to channel acetyl - coa into the mitochondria are engaged. these considerations support a model in which the subcellular compartmentalization of acetyl - coa units undergoes a major shift during starvation, and the utilization of these acetyl units is re - purposed to support survival strategies (fig. it is perhaps no coincidence that acetyl - coa doubles as the acetyl donor for protein acetylation modifications (including histone acetylation) (fig. the abundance of protein acetylation modifications could therefore reflect the cell s metabolic state to regulate various protein activities. studies performed under carbon - rich conditions where acetyl - coa synthesis is not limiting may mask the contributions of this metabolite in cellular regulation. however, most organisms, as well as particular tissue microenvironments in vivo experience challenges in the nutrient environment that might limit acetyl - coa biosynthesis or availability (e.g., carbon starvation or hypoxia). recent studies have begun to provide compelling evidence that many protein acetylation modifications are indeed modulated by acetyl - coa availability. besides histones, the acetyl - coa synthetase family of enzymes was also identified to be regulated by reversible acetylation [2931 ]. the acetylation of an active site lysine residue was observed to inhibit the activity of acetyl - coa synthetase as a mechanism of feedback inhibition in response to high acetyl - coa [3234 ]. the deacetylation of these enzymes, catalyzed by sirtuins, restores their activity [3234 ]. subsequent mass spectrometry surveys have now revealed that thousands of other proteins, including many other metabolic enzymes, can be acetylated [3538 ]. in some cases, although the majority of these modifications were found to be inhibitory, several were reported to be activating. in some instances, the acetylation of particular metabolic enzymes was responsive to glucose levels in the media, suggesting that they could be linked to intracellular acetyl - coa abundance. whether specific acetyltransferase enzymes catalyze the majority of these acetylation modifications present on metabolic enzymes is not yet clear. the yeast metabolic cycle (ymc) offers a system to investigate whether particular acetylation modifications might be coupled to acetyl - coa itself. studies of yeast cells undergoing the ymc during continuous, glucose - limited growth in a chemostat have revealed periodic changes in intracellular acetyl - coa amounts as yeast cells alternate between growth and quiescent - like phases. several proteins are dynamically acetylated precisely in phase with the observed acetyl - coa oscillations. these include histones, several components of the transcriptional coactivator saga, a subunit of the swi / snf chromatin remodeling complex snf2p, and a transcriptional coactivator of ribosomal subunit gene expression ifh1p. interestingly, the dynamic acetylation of all of these proteins is dependent on the acetyltransferase gcn5p, suggesting this enzyme has the capability of acetylating its substrates in tune with acetyl - coa fluctuations in vivo. consistent with this hypothesis, mutations within gcn5p slow growth, disrupt the yeast metabolic cycle, or alter the cell s responsiveness to acetate. moreover, acetylation of saga subunits appears to aid its recruitment to growth genes. a brief survey of other acetylated proteins that are not known to be gcn5p substrates showed they are not dynamically acetylated across the ymc. an analysis of the genomic regions bound by these acetylated histones revealed that several marks, in particular h3k9ac, were present predominantly at growth genes, specifically during the growth phase of the ymc when acetyl - coa levels rise. these considerations suggest that the acetylation of these nuclear - localized proteins collectively functions to promote the activation of growth genes in response to a burst of nucleocytosolic acetyl - coa. given the thousands of newly identified acetylated proteins, a pertinent question is what proportion of each protein is acetylated ? recent studies aiming to determine the stoichiometry of acetylated sites estimate that for many proteins, only a small fraction of the peptides are actually acetylated. however, nuclear proteins, including histones and transcription factors, were estimated to be acetylated at much higher stoichiometry. conventional shotgun detection of peptides by mass spectrometry is biased towards abundant proteins, so perhaps it is unsurprising that a small fraction of a very abundant protein that is acetylated could be scored as a positive. moreover, lysine residues on proteins can react spontaneously with thioesters such as acetyl - coa or other acyl - coa metabolites, resulting in non - enzymatic acetylation or acylation [4448 ]. non - enzymatic acetylation or acylation may be especially prominent within the mitochondria, which is thought to have higher acetyl - coa concentrations and higher ph, thereby increasing the nucleophilicity of lysyl side chains. thus, while some non - enzymatic acetylation or acylation events could have evolved to be regulatory, the possibility also exists that many of these modifications could be spurious. these considerations must be taken into account when determining the physiological significance of any detected acetylation site. moreover, there are limitations to mutation of a lysine residue to either arginine or glutamine. these mutations are not always accurate acetylated or deacetylated lysine mimics, and could perturb protein function independent of site - specific acetylation. as such, it can be challenging to demonstrate whether a particular acetylation modification is functionally important in vivo. to help address these issues, methods for site - specific incorporation of acetyllysine, as well as the use of these and other methods will help clarify the extent through which protein acetylation modifications are responsive to acetyl - coa fluctuations in a regulatory manner, either enzymatically or non - enzymatically. the accumulation of acetyl - coa in subcellular compartments may also necessitate the activity of deacetylase enzymes to remove non - enzymatic acetylation modifications that could intentionally or unintentionally compromise protein function. such a repair or detoxification consistent with this idea, hyperacetylation of mitochondrial enzymes occurs in the absence of mitochondrial sirt3 [5557 ], and deacetylation of these enzymes typically increases their activity. moreover, the expression of sirt3 is increased specifically under fasting states, in response to high - fat diets, or during exercise - conditions that all promote increased mitochondrial acetyl - coa. likewise, the potential of proteins to be modified by other acyl - coa metabolites besides acetyl - coa is supported by the discovery of a wide variety of acylation modifications present on proteins, along with associated sirtuins that preferentially catalyze their removal [5861 ]. evidence that sirtuins evolved specifically to remove non - enzymatic protein acylation as a form of protein quality control has been summarized in a recent review. in this model, failure of sirtuins to remove aberrant acylation modifications would hinder the function of effected proteins and consequently lead to dysfunctions in metabolism and susceptibility to disease. however, deacylation of a lysine residue can also be executed using water as a nucleophile without a requirement for nad, a mechanism employed by many histone deacetylases (hdacs). the dependency of sirtuins on nad have led to the hypothesis that their activity could be regulated by fluctuations in nad concentrations. however, such dependency on nad may serve an additional purpose and enable the removal of the acyl group via covalent attachment to adp - ribose, to produce o - acyl - adp - ribose metabolites, which themselves may have biological functions. moreover, if the acyl group were liberated as a free carboxylate, then the respective acyl - coa synthetase enzymes could potentially convert these free carboxylates back to acyl - coa metabolites, facilitating re - acylation and thus leading to a futile cycle (fig. in summary, there is now compelling evidence that acetyl - coa represents a fundamental gauge of cellular metabolic state that is monitored by the cell by way of distinctive protein acetylation modifications. perhaps it is no coincidence that nature chose to carefully monitor the abundance of acetyl - coa as a proxy for its metabolic state due to its requirement in the biosynthesis of cellular building blocks, two carbons at a time. some of these acetyl - coa - responsive modifications may be established by a delicate balance between the opposing activities of acetyltransferase and deacetylase enzymes, while others could be set in a non - enzymatic manner. understanding the sources and fates, as well as the movement of acetyl groups between subcellular compartments reveals an underlying logic to metabolic strategies employed under growth versus survival, fed versus fasted, or normal versus tumorigenic metabolic states. based on recent stoichiometry studies, it is tempting to speculate that acetylation originally evolved as a means to link nuclear activities with acetyl - coa equivalents produced in the mitochondria. however, a consequence of using electrophilic acyl - coa metabolites in cellular metabolism and regulation is their tendency to react spontaneously with nucleophilic moieties on proteins such as lysine residues. as such, the accumulation of particular acyl - coa metabolites in various cellular compartments may have necessitated a mechanism to remove unintended acylation modifications on proteins. future studies will continue to reveal the mechanisms and consequences of employing acetyl - coa and other acyl - coas in cellular metabolism - their reciprocal influence on metabolism and cell regulation should no longer be overlooked.	acetyl - coa represents a key node in metabolism due to its intersection with many metabolic pathways and transformations. emerging evidence reveals that cells monitor the levels of acetyl - coa as a key indicator of their metabolic state, through distinctive protein acetylation modifications dependent on this metabolite. we offer the following conceptual model for understanding the role of this sentinel metabolite in metabolic regulation. high nucleocytosolic acetyl - coa amounts are a signature of a growth or fed state and promote its utilization for lipid synthesis and histone acetylation. in contrast, under survival or fasted states, acetyl - coa is preferentially directed into the mitochondria to promote mitochondrial - dependent activities such as the synthesis of atp and ketone bodies. fluctuations in acetyl - coa within these subcellular compartments enable the substrate - level regulation of acetylation modifications, but also necessitates the function of sirtuin deacetylases to catalyze removal of spontaneous modifications that might be unintended. thus, understanding the sources, fates, and consequences of acetyl - coa as a carrier of two - carbon units has started to reveal its underappreciated but profound influence on the regulation of numerous life processes.
the importance of evidence - based practice (ebp) in allied health is well documented in the literature.1,2 clinical decisions that are based on patients unique circumstances, sound clinical expertise, and the best available research evidence are known to deliver the best outcomes for patients and their families.35 allied health practitioners hold positive attitudes toward ebp and believe in the value of research evidence in informing their clinical decisions. however, applying research findings to clinical decisions is not a simple process and is often difficult to achieve. one of the most commonly reported barriers to evidence uptake in allied health is the lack of knowledge of the ebp process and lack of skill in critically appraising research.68 teaching ebp is therefore an important step in promoting evidence - based clinical decision making. allied health practitioners need to understand the principles of ebp before they can apply it. early ebp educational programs include the development of clinical questions, literature searches, and critical appraisal.9 to evaluate the impact of such educational programs and document competence of individual practitioners, educators need objective and psychometrically sound instruments or assessment tools. based on a review of the literature, the fresno test is the only available instrument that comprehensively assesses ebp competence across all relevant domains.10 the fresno test consists of two clinical scenarios and 12 short - answer questions that require respondents to formulate a focused question, identify the most appropriate research design that will address the question, show knowledge of electronic database searching, identify issues important for determining the relevance and validity of a research paper, and discuss the magnitude and importance of research findings.11 the test is scored by using a standardized grading rubric that describes explicit grading criteria. the fresno test has content validity, good - to - excellent interrater reliability for all questions, and excellent internal consistency.11 however, this tool focuses on assessing competence in medical students only, and therefore it can not be used across different health disciplines. in 2009, mccluskey and bishop modified the fresno test to measure the change in ebp skills and knowledge of occupational therapists following exposure to an ebp workshop.12 new clinical scenarios (ie, versions 1 and 2) were developed to suit rehabilitation professionals, such as physiotherapists and occupational therapists. the 12 questions in the original fresno test were reduced to seven (ie, questions 17), removing questions about diagnosis and complex statistics (ie, questions 812). similar to the original fresno test, the seven - item adapted fresno test (aft) measures the following : the ability to develop a focused clinical question using the pico (population, intervention, comparison, and outcome) format, the ability to develop a search strategy, the ability to interpret and critically appraise a research paper, and knowledge associated with understanding of the hierarchy of evidence and methodological biases in study designs, databases, and other sources of evidence and study designs. the aft has been reported to have acceptable psychometric properties : interrater reliability ranged from good to excellent for individual items (version 1, intraclass correlation coefficient [icc ] 0.800.96 ; version 2, 0.680.94) and excellent for the total score (version 1, 0.96 ; version 2, 0.91) ; acceptable internal consistency (cronbach s 0.74) ; and responsive to change in novice learners.12 the current versions of the aft are limited to physiotherapists and occupational therapists, and new scenarios and scoring rubrics are required for other allied health disciplines. therefore, the aim of this study was to examine the validity, interrater reliability, and internal consistency of aft versions developed for speech pathologists, social workers, and dieticians / nutritionists. this study was approved by the human research ethics committee of the university of south australia and the ethics review board of the university of tasmania. an expert panel consisting of four practitioners from each discipline was formed to content - validate the aft. content validity refers to how well the combined elements used to construct the instrument truly describe the conceptual domain of interest.13 the panel represented practitioners with more than 10 years of clinical experience and with previous exposure to ebp training or research. the panel members were presented with the original fresno test and aft, and were asked to examine the questionnaire and comment on which questions should be included in the new versions for speech pathologists, social workers, and dieticians / nutritionists. all members agreed that only questions adapted by aft should be included for these disciplines. the scoring rubric of the aft was considered applicable to the new versions except for questions 1 (write a focused clinical question for one scenario to help you organize a search of the literature), 2 (where might you find answers to these and other similar clinical questions ? name as many possible sources of information as you can, not just the ones you think are good sources), and 4 (if you were to search for medline for original research to answer your question, describe the search strategy you might use). discipline - specific information was required to revise the scoring key for these questions. following consultation with the expert panel, a draft instrument including the clinical scenarios, questionnaire, and scoring rubric was prepared by the primary author. the draft instrument was emailed to the experts for feedback on the clarity of the entire instrument and completeness of the scoring rubric. the instrument and scoring rubric for each discipline were revised based on comments from the expert panel and returned to them for a final round of feedback. the new aft versions were completed by ten speech pathologists, 16 social workers, and 12 dieticians / nutritionists who agreed to participate in a larger study aimed at examining the impact of a journal club on the ebp knowledge and skills of allied health professionals.14 they were asked to individually complete either a paper - and - pencil version or electronic version of the questionnaire at a time convenient for them. less than half had previous training in research or ebp, and the majority had been in clinical practice for less than 10 years. interrater reliability is the degree to which measurements of the same phenomenon by different raters will yield the same results, or the consistency of results between raters.15 interrater reliability was calculated for individual items and the total aft score using iccs (2,1) and 95% confidence intervals. for interpretation of results, icc values of 0.80 indicate excellent reliability, values between 0.60 and 0.79 denote moderate reliability, and values < 0.60 mean questionable reliability.16 four individuals experienced in research and teaching ebp for allied health students served as raters for the study. before the study began, the raters reviewed and discussed the aft test, and collaboratively scored a sample test for each discipline. they were then given a practice period, where they scored another set of sample tests, then compared and discussed their differences in scoring. following discussion, the raters were instructed to score each test independently without conferring or comparing ratings. initial examination of the interrater reliability showed poor reliability between raters for questions 2, 4, and 5 of all versions (ie, aft for speech pathology, social work, and dietetics / nutrition) and question 7 for social work and dietetics / nutrition. this prompted the first author, who has experience in using the previous aft versions, to provide further training and discussion of the scoring procedure to the raters. the training involved an explanation of the rating system, discussion of common rater errors, advice on process for decision making, and practice on interpreting the rubric. reflects the coherence of the components of a scale or instrument.17 the internal consistency of the aft was examined using cronbach s. an expert panel consisting of four practitioners from each discipline was formed to content - validate the aft. content validity refers to how well the combined elements used to construct the instrument truly describe the conceptual domain of interest.13 the panel represented practitioners with more than 10 years of clinical experience and with previous exposure to ebp training or research. the panel members were presented with the original fresno test and aft, and were asked to examine the questionnaire and comment on which questions should be included in the new versions for speech pathologists, social workers, and dieticians / nutritionists. all members agreed that only questions adapted by aft should be included for these disciplines. the scoring rubric of the aft was considered applicable to the new versions except for questions 1 (write a focused clinical question for one scenario to help you organize a search of the literature), 2 (where might you find answers to these and other similar clinical questions ? name as many possible sources of information as you can, not just the ones you think are good sources), and 4 (if you were to search for medline for original research to answer your question, describe the search strategy you might use). discipline - specific information was required to revise the scoring key for these questions. following consultation with the expert panel, a draft instrument including the clinical scenarios, questionnaire, and scoring rubric was prepared by the primary author. the draft instrument was emailed to the experts for feedback on the clarity of the entire instrument and completeness of the scoring rubric. the instrument and scoring rubric for each discipline were revised based on comments from the expert panel and returned to them for a final round of feedback. the new aft versions were completed by ten speech pathologists, 16 social workers, and 12 dieticians / nutritionists who agreed to participate in a larger study aimed at examining the impact of a journal club on the ebp knowledge and skills of allied health professionals.14 they were asked to individually complete either a paper - and - pencil version or electronic version of the questionnaire at a time convenient for them. less than half had previous training in research or ebp, and the majority had been in clinical practice for less than 10 years. interrater reliability is the degree to which measurements of the same phenomenon by different raters will yield the same results, or the consistency of results between raters.15 interrater reliability was calculated for individual items and the total aft score using iccs (2,1) and 95% confidence intervals. for interpretation of results, icc values of 0.80 indicate excellent reliability, values between 0.60 and 0.79 denote moderate reliability, and values < 0.60 mean questionable reliability.16 four individuals experienced in research and teaching ebp for allied health students served as raters for the study. before the study began, the raters reviewed and discussed the aft test, and collaboratively scored a sample test for each discipline. they were then given a practice period, where they scored another set of sample tests, then compared and discussed their differences in scoring. following discussion, the raters were instructed to score each test independently without conferring or comparing ratings. initial examination of the interrater reliability showed poor reliability between raters for questions 2, 4, and 5 of all versions (ie, aft for speech pathology, social work, and dietetics / nutrition) and question 7 for social work and dietetics / nutrition. this prompted the first author, who has experience in using the previous aft versions, to provide further training and discussion of the scoring procedure to the raters. the training involved an explanation of the rating system, discussion of common rater errors, advice on process for decision making, and practice on interpreting the rubric. internal consistency reflects the coherence of the components of a scale or instrument.17 the internal consistency of the aft was examined using cronbach s. the content validity of the aft instrument was established through formal feedback from the expert panel. the comments received were consistent across disciplines, and involved issues associated with the wording of the clinical scenarios. no comments were made on the questionnaire itself ; however, additional possible answers were suggested for the scoring rubric. for example, in question 1, where respondents are asked to write a focused clinical question, the expert panel provided additional pico terms or synonyms. some members of the panel suggested further sources of research information for question 2, such as discipline - specific electronic databases, websites, and professional organizations. two new clinical scenarios and a revised scoring rubric were developed for each discipline. a copy of the scoring rubric may be obtained from the primary author upon request. the reliability among raters was excellent for questions 1, 3, and 6 across all disciplines, as shown in table 3. question 7 showed excellent reliability for speech pathology, but not for social work or dietetics / nutrition. all other reliability coefficients increased to moderate or excellent levels following further training and discussion. cronbach s was 0.71 for speech pathology, 0.68 for social work, and 0.74 for dietetics / nutrition, indicating internal consistency was acceptable for all disciplines. deletion of any of the items did not improve the internal consistency of the aft for any discipline. the content validity of the aft instrument was established through formal feedback from the expert panel. the comments received were consistent across disciplines, and involved issues associated with the wording of the clinical scenarios. no comments were made on the questionnaire itself ; however, additional possible answers were suggested for the scoring rubric. for example, in question 1, where respondents are asked to write a focused clinical question, the expert panel provided additional pico terms or synonyms. some members of the panel suggested further sources of research information for question 2, such as discipline - specific electronic databases, websites, and professional organizations. two new clinical scenarios and a revised scoring rubric were developed for each discipline. a copy of the scoring rubric may be obtained from the primary author upon request. the reliability among raters was excellent for questions 1, 3, and 6 across all disciplines, as shown in table 3. question 7 showed excellent reliability for speech pathology, but not for social work or dietetics / nutrition. all other reliability coefficients increased to moderate or excellent levels following further training and discussion. cronbach s was 0.71 for speech pathology, 0.68 for social work, and 0.74 for dietetics / nutrition, indicating internal consistency was acceptable for all disciplines. deletion of any of the items did not improve the internal consistency of the aft for any discipline. the results provide preliminary evidence of the psychometric integrity of the aft, and support its use in the assessment of ebp knowledge and skills of speech pathologists, social workers, and dieticians / nutritionists. similar to the original aft, the new versions assess knowledge and skills of the key processes involved in ebp, including the development of clinical questions, searching for literature, critical appraisal, and interpretation of research findings. the new aft has content validity, moderate - to - excellent reliability and acceptable internal consistency. these results are consistent with the previously reported validity and reliability of the original fresno test11 and aft versions for rehabilitation professionals (ie, occupational therapist and physiotherapist).12 the importance of ebp training in facilitating an evidence - based approach to clinical practice has been highlighted by a number of systematic reviews.1821 many of the training programs reported in these reviews relied on self - report data, which potentially reflect inaccuracies in actual knowledge.22 measuring the effectiveness of such training programs therefore requires objective and robust instruments to document changes in the competence of the individuals being trained. to the authors knowledge, the aft is the only objective measure of ebp knowledge and skills that has been tested and applied in allied health. mccluskey and bishop, who first reported about the validity and reliability of the aft, urged researchers to develop new clinical scenarios and modify the instrument to suit other health disciplines.12 the current study addressed this gap and provided researchers and educators an instrument to measure ebp skills and knowledge in speech pathologists, social workers, and dieticians / nutritionists. the new versions of the aft were content - validated, and although the internal consistency of the different versions was slightly lower than the original aft, the cronbach s -values were still acceptable. the reliability estimates for some of the items (questions 2, 4, 5, and 7) were questionable ; however, after further training, the iccs increased considerably, indicating moderate - to - excellent reliability of scores for these items. this finding highlights the importance of providing training to raters as a strategy to improve interrater reliability. rater training has been shown to increase consistency of scoring between raters.23 it emphasizes developing a common understanding among raters so they will apply the rating system as consistently as possible.24 this common understanding, also called frame of reference, addresses the common sources of rater disagreements, which include lack of overlap among what is observed, discrepant interpretations of descriptor meanings, and personal beliefs or biases.24 however, research also suggests that even comprehensive training will not ensure rater agreement.25 studies have suggested that a rater s expertise may improve accuracy,23,26 which implies that rater characteristics are also an important consideration in ensuring consistency between raters. reliability in examination scoring can be expected if the raters are highly knowledgeable in the domain in which ratings are made. studies have found a relationship between rater expertise and rating accuracy, as well as the ability to differentiate between different domains in a rating scale.24,26 the raters involved in this study are experienced ebp educators and researchers, and these attributes could have contributed to the consistency in scoring. because of their exposure to teaching, the raters may have already gained a wealth of experience in examination assessment, and could be expected to respond well to training. it is therefore not surprising to find that following training in aft rating, the reliability estimates improved significantly for the previously questionable items. based on the results of the current study, it appears that there are three important variables that can contribute to rater reliability : an explicit scoring criteria (ie, scoring rubric), raters training, and raters professional experience. as with any study first, the sample size may have been too small to produce sufficiently reliable results. second, the expert panel was limited to four practitioners, which may not represent the collective set of views in the different professions. third, the ability of the test to detect change following educational programs has not been tested. despite these limitations, the results of this study provide a valuable resource for ebp educators and researchers who require an objective instrument to measure knowledge and skills among social workers, speech pathologists, and dieticians / nutritionists. the authors propose the use of aft in evaluating the ebp knowledge and skills of social workers, speech pathologists, and dieticians / nutritionists. ebp educators and researchers should identify raters with experience in ebp teaching or those with previous ebp training, who should then receive training for aft scoring. while the content validity, internal consistency, and reliability of the aft have been shown in this study, further research is required to establish its sensitivity to detect change in knowledge and skills following an educational intervention for dieticians, speech pathologists, and social workers.	purposethe current versions of the adapted fresno test (aft) are limited to physiotherapists and occupational therapists, and new scenarios and scoring rubrics are required for other allied health disciplines. the aim of this study was to examine the validity, reliability, and internal consistency of the aft developed for speech pathologists (sps), social workers (sws), and dieticians / nutritionists (dns).materials and methodsan expert panel from each discipline was formed to content - validate the aft. a draft instrument, including clinical scenarios, questionnaire, and scoring rubric, was developed. the new versions were completed by ten sps, 16 sws, and 12 dns, and scored by four raters. interrater reliability was calculated using intraclass correlation coefficients (2,1) for the individual aft items and the total score. the internal consistency of the aft was examined using cronbach s.resultstwo new clinical scenarios and a revised scoring rubric were developed for each discipline. the reliability among raters was excellent for questions 1, 3, and 6 across all disciplines. question 7 showed excellent reliability for sps, but not for sws and dns. all other reliability coefficients increased to moderate or excellent levels following training. cronbach s was 0.71 for sps, 0.68 for sws, and 0.74 for dns, indicating that internal consistency was acceptable for all disciplines.conclusionthere is preliminary evidence to show that aft is a valid and reliable tool for the assessment of evidence - based practice knowledge and skills of sps, sws, and dns. further research is required to establish its sensitivity to detect change in knowledge and skills following an educational program.
embryonic development and later rejuvenation of adult tissue is regulated by a population of stem cells that, by undergoing self - renewal maintain their own pool and give rise to differentiated progenitors that replace cells used up during the life cycle (1). therefore, scs are guardians of tissue / organ integrity and regulate the life span of an adult organism. the most important sc population, from a regenerative point of view, is pluripotent stem cells (pscs) (2). such cells, according to their definition, must fulfill some in vitro as well as in vivo criteria, such as i) they give rise to cells from all three germ layers, i.e. the ectoderm, mesoderm, and endoderm ; ii) complete blastocyst development ; and iii) form teratomas after inoculation into experimental animals (3). during embryo development, pluripotent stem cells are established from the most primitive stem cells, i.e. fertilized zygote. these cells are called totipotent and possess the ability to give rise to both embryo and placenta. totipotent zygotes further develop into pscs in the inner cell mass (icm) of blastocysts and may give rise to all three germ layers of a developing embryo, however, they lose the ability to differentiate into placenta. the pscs in this stage could be expanded ex vivo as embryonic stem cell (escs) lines (4, 5). the pluripotency is inherited from fertilized zygote, cells from inner - cell mass in blastocysts, to epiblasts from primitive ectoderm after implantation (6). after gastrulation, almost all cells lose their pluripotency and are committed into specialized lineage. however, primordial germ cells (pgcs) derived from proximal epiblast cells, germ - line stem cells maintain their pluripotency by expressing pluripotency - specific genes, such as oct4 and nanog (7). the pgcs also lose their pluripotency and initiate their commitment to gametes, i.e. oocytes and sperm cells, after migration into the genital ridge. therefore, the pscs could be specific population detected during only the narrow developmental period of early embryogenesis. indeed, embryonic stem cells (escs), epiblast - derived stem cells (episcs), and embryonic germ cells (egcs) are established from these early embryonic pscs using specialized in - vitro cell cultures (3). as previously mentioned, pscs are detected only during very early embryonic development and they disappear in adulthood as they differentiate into terminally differentiated monopotent somatic or germ - line cells (2). however, several attempts have been made in the past few years to purify a population of pluripotent stem cells (pscs) from adult tissue. potential pscs in adult tissue were described as i) multipotent adult progenitor cells (mapcs) (8), ii) multipotent adult stem - cells (mascs) (9, 10), iii) unrestricted somatic stem - cells (usscs) (11), iv) marrow - isolated adult multilineage - inducible (miami) cells (12), and v) multilineage - differentiating, stress - enduring stem (muse) cells (13). it is conceivable that all of these cells may be closely related and some stem cell described by different investigators may be overlapped. our group recently isolated a population of pluripotent, very small, embryonic - like stem cells (vsels) from adult, murine bone marrow (bm) (14), fetal livers (15), several adult - murine organs (16), and also from human cord blood (17). vsels express many morphological, e.g. relatively large nuclei containing euchromatin, and molecular, e.g. expression of ssea-1, oct4, and nanog, markers characteristic for escs (14). we hypothesize that vsels are deposited during early gastrulation in developing tissues / organs, survive into adulthood, and have an important role as a back - up population of pscs in the turnover of tissue - committed stem cells (tcscs). in this review article, we will discuss in detail the molecular nature of the oct4 vsels. vsels were isolated using the multiparameter fluorescence - activated cell sorter (facs) as a population of sca-1lincd45 in several other adult murine organs, e.g. brain, liver, skeletal muscles, heart, and kidney, and as a population of cd133cxcr4lincd45 in human cord blood and peripheral blood (14, 16, 17). these very small sized (36 m) cells express pluripotent markers such as oct4, nanog, and ssea-1 (mouse) or ssea-4 (human). morphologically, vsels similarly to escs possess large nuclei containing unorganized chromatin (euchromatin) and exhibit a significantly higher nuclear / cytoplasm (n / c) ratio and a lower cytoplasmic area compared to hscs (16). when freshly isolated vsels are cultured under a c2c12 myoblast feeder layer, they form spheres that correspond to embryoid bodies (ebs) from escs (18). the vsel - derived spheres (vsel - dss) contain primitive scs that, after replating into specific, differentiation - inducing media differentiate into cells from all three germ layers. furthermore, we reported that vsels are mobilized into peripheral blood during several models of organ injury and circulate there in an attempt to enrich and regenerate damaged tissue, e.g. heart infarct and stroke (1924). this physiological mechanism undoubtedly has a more significant role in the regeneration of some small tissue and organ injuries. to investigate the relationship between vsels and the embryonic type of pscs, e.g. escs, episcs, pgcs, and egs, we used several molecular strategies to evaluate the molecular signature of vsels. highly purified sca-1lincd45 vsels from murine bm were evaluated for expression of i) pluripotent genes, ii) epiblast / germ line markers, and iii) expression of developmentally crucial imprinted genes (fig. 1). unlike differentiated somatic cells, pscs commonly express pluripotency core transcription factors (tfs), such as oct4, nanog, and sox2. these tfs form the pluripotent core circuitry by reinforcing the expression of genes, and are involved in maintaining the psc undifferentiated status but repress the differentiation inducing transcription (25). the significance of these core factors is experimentally demonstrated by the inducible pluripotent stem cells (ipscs) protocol in which fully differentiated somatic cells can be reprogrammed into esc - like stem cells by transduction of the so - called yamanaka factors (oct4, sox20, klf4, and cmyc) (26, 27). we noted that murine vsels express both the oct4 transcript and protein (28). however, a few recent reports cast doubts regarding the true expression of this important pscs marker in cells isolated from adult tissue, especially, as postulating the expression of several oct4 pseudogenes can produce false - positive rt - pcr results (29, 30). therefore, we evaluated in murine the epigenetic status for the oct4 promoter, which are the most convincing in vitro criteria for the evaluation of putative stem cells. when the dna methylation status of the oct4 promoter was examined by bisulfate sequencing using the highly purified sca-1lincd45 vsels, the oct4 promoter in vsels, similar to that in cells isolated from escs - derived ebs, was hypomethylated (28% and 13.2%, respectively) (28). with the carrier chromatinimmunoprecipitation (chip) assay using human hematopoietic cell - line thp-1 as the carrier (31), we found that the oct4 promoter chromatin in murine vsel is enriched with h3ac, an open chromatin histone code, but was less associated with h3k9me2, a heterochromatin histone code (28). for determining the epigenetic status for the nanog promoter, it was methylated (50%) at the dna level, however, quantitative chip data confirmed that the h3ac / h3k9me2 ratio supports the active status of the nanog promoter in these cells (28). based on these results, vsel exhibits the open chromatin structure in the promoter of the oct4 and the nanog in order to support the true expression of these genes. of note, we also reported that vsels express also several other markers of pscs, such as ssea-1 antigen as well as sox2 and klf4 transcription factors. after gastrulation, most embryonic cells lose their expression of pluripotency - specific tfs except for some of the sc population from proximal epiblasts, which are precursors for pgcs development. the pgcs derived from epiblast reset epigenetic marks to icm - like status, resulting in re - activation of pluripotency and germ - line - related genes (6). the pgcs are epiblast - derived, alkaline phosphatase (ap)-positive, migratory - stem cells. they emerge in extraembryonic mesorderm at the base of the allantois, an appendage arising from the posterior, primitive streak around e7.25 (32). at this time the specification of pgcs is initiated by the expression of germ - line master regulators, such as fragilis, blimp1, and stella, in response to signals from extra - embryonic tissues (33). at e8.5, pgcs enter back into the primitive streak region of the embryo and begin migration through hindgut endoderm and mesentry in aorta - gonads - mesonephros (agm), and reach the genital ridge around e11.5 to e12.5. during this period after e13.0 (post - migration), pgcs i) cease proliferation, ii) change in cell morphology and cell - adhesion molecules, iii) lose cell migratory capacity, and iv) initiate gametogenesis. during migration, pgcs initiate epigenetic reprogramming, such as erasure of genomic imprinting, dna demethylation, and x chromosome reactivation and complete them after colonizing at the genital ridge. this epigenetic reprogramming could be responsible for the proper expression timing of various germ - line genes, such as blimp1, stella, mvh, dazl, and sycp3 (7). therefore, early emerging, migratory, and post - migratory pgcs show distinguished characteristics regarding the epigenetic status and gene expression profile. importantly, vsels highly express the genes involved in the germ - line specification of the epiblast, e.g. stella, prdm14, fragilis, blimp1, nanos3, and dnd1. subsequently, the expression of stella, blimp1, and mvh protein was confirmed by immunostaining (34). in addition, this promoter was highly enriched with transcriptionally active histone modifications (h3ac and h3k4me3), but was less enriched for transcriptionally repressive histone markers (h3k9me2 and h3k27me3) (34). taken together, vsels express specific genes and display a stella promoter chromatin structure that is characteristics for germ - line specification. interestingly, late migratory pgcs markers including dppa2, dppa4, and mvh are highly expressed in vsels, however, these cells do not express sycp3, dazl, and line1 genes that are highly expressed in post - migratory pgcs (34). thus, our results in toto support the concept that vsels deposited into murine bm show some similarities in gene expression and epigenetic signatures to epiblast - derived migratory pgcs (e10.5e11.5). owing to their limited number in adult tissue, it has been difficult to gain a better insight regarding the molecular nature of vsels in detail. we recently established a cdna library from 20 cells of facs - sorted vsels, hematopoietic stem cells (hscs) or a cultured embryonic stem - cell line, esc - d3 (35). by performing single - cell - based, genome - wide gene expression analysis (36), we found that vsels show similar, but characteristic transcriptome compared with escs and hscs (35). one gene of particular interest which is highly expressed in vsels is ezh2, a polycomb group protein. ezh2 has an essential role for maintaining the bivalent domain (bd) epigenetic marker. in undifferentiated psc, the promoter regions of some developmentally crucial transcription factors are epigenetically marked both the transcriptionally active h3k4me3 codes and the repressive histone ones such as trimethylated on lysine27 of histone3 (h3k27me3) and this epigenetic modification is called bivalent domain. the bivalent domain is detected mainly in the promoter region for the homeodomain containing development master tfs, such as dlx, irx, lhx, pou, pax, and six family proteins (3739). due to the overwhelming effect of transcription - repressive activity endowed from h3k27me3, the transcription of bivalent domain target genes is transiently re - pressed in order to prevent the premature expression of the differentiation inducing tfs. however, in response to the development stimuli, the bivalent domain of these promoters is switched into a monovalent domain in order to determine their gene expression. by conducting differentiation and rna interference experiments, we demonstrate that ezh2 in vsels has a similar role for preventing premature activation of lineage - committing transcription factors (35). taken together, therefore, both positive (expression of oct4-nanog - sox2 pluripotency circuitry) and negative (repression of differentiation inducing tfs by bivalent domain) regulatory mechanisms are indispensable in order to maintain the pluripotency of vsels. unlike differentiated somatic cells, pscs commonly express pluripotency core transcription factors (tfs), such as oct4, nanog, and sox2. these tfs form the pluripotent core circuitry by reinforcing the expression of genes, and are involved in maintaining the psc undifferentiated status but repress the differentiation inducing transcription (25). the significance of these core factors is experimentally demonstrated by the inducible pluripotent stem cells (ipscs) protocol in which fully differentiated somatic cells can be reprogrammed into esc - like stem cells by transduction of the so - called yamanaka factors (oct4, sox20, klf4, and cmyc) (26, 27). we noted that murine vsels express both the oct4 transcript and protein (28). however, a few recent reports cast doubts regarding the true expression of this important pscs marker in cells isolated from adult tissue, especially, as postulating the expression of several oct4 pseudogenes can produce false - positive rt - pcr results (29, 30). therefore, we evaluated in murine the epigenetic status for the oct4 promoter, which are the most convincing in vitro criteria for the evaluation of putative stem cells. when the dna methylation status of the oct4 promoter was examined by bisulfate sequencing using the highly purified sca-1lincd45 vsels, the oct4 promoter in vsels, similar to that in cells isolated from escs - derived ebs, was hypomethylated (28% and 13.2%, respectively) (28). with the carrier chromatinimmunoprecipitation (chip) assay using human hematopoietic cell - line thp-1 as the carrier (31), we found that the oct4 promoter chromatin in murine vsel is enriched with h3ac, an open chromatin histone code, but was less associated with h3k9me2, a heterochromatin histone code (28). for determining the epigenetic status for the nanog promoter, it was methylated (50%) at the dna level, however, quantitative chip data confirmed that the h3ac / h3k9me2 ratio supports the active status of the nanog promoter in these cells (28). based on these results, vsel exhibits the open chromatin structure in the promoter of the oct4 and the nanog in order to support the true expression of these genes. of note, we also reported that vsels express also several other markers of pscs, such as ssea-1 antigen as well as sox2 and klf4 transcription factors. after gastrulation, most embryonic cells lose their expression of pluripotency - specific tfs except for some of the sc population from proximal epiblasts, which are precursors for pgcs development. the pgcs derived from epiblast reset epigenetic marks to icm - like status, resulting in re - activation of pluripotency and germ - line - related genes (6). the pgcs are epiblast - derived, alkaline phosphatase (ap)-positive, migratory - stem cells. they emerge in extraembryonic mesorderm at the base of the allantois, an appendage arising from the posterior, primitive streak around e7.25 (32). at this time the specification of pgcs is initiated by the expression of germ - line master regulators, such as fragilis, blimp1, and stella, in response to signals from extra - embryonic tissues (33). at e8.5, pgcs enter back into the primitive streak region of the embryo and begin migration through hindgut endoderm and mesentry in aorta - gonads - mesonephros (agm), and reach the genital ridge around e11.5 to e12.5. during this period after e13.0 (post - migration), pgcs i) cease proliferation, ii) change in cell morphology and cell - adhesion molecules, iii) lose cell migratory capacity, and iv) initiate gametogenesis. during migration, pgcs initiate epigenetic reprogramming, such as erasure of genomic imprinting, dna demethylation, and x chromosome reactivation and complete them after colonizing at the genital ridge. this epigenetic reprogramming could be responsible for the proper expression timing of various germ - line genes, such as blimp1, stella, mvh, dazl, and sycp3 (7). therefore, early emerging, migratory, and post - migratory pgcs show distinguished characteristics regarding the epigenetic status and gene expression profile. importantly, vsels highly express the genes involved in the germ - line specification of the epiblast, e.g. stella, prdm14, fragilis, blimp1, nanos3, and dnd1. subsequently, the expression of stella, blimp1, and mvh protein was confirmed by immunostaining (34). in addition, this promoter was highly enriched with transcriptionally active histone modifications (h3ac and h3k4me3), but was less enriched for transcriptionally repressive histone markers (h3k9me2 and h3k27me3) (34). taken together, vsels express specific genes and display a stella promoter chromatin structure that is characteristics for germ - line specification. interestingly, late migratory pgcs markers including dppa2, dppa4, and mvh are highly expressed in vsels, however, these cells do not express sycp3, dazl, and line1 genes that are highly expressed in post - migratory pgcs (34). thus, our results in toto support the concept that vsels deposited into murine bm show some similarities in gene expression and epigenetic signatures to epiblast - derived migratory pgcs (e10.5e11.5). owing to their limited number in adult tissue, it has been difficult to gain a better insight regarding the molecular nature of vsels in detail. we recently established a cdna library from 20 cells of facs - sorted vsels, hematopoietic stem cells (hscs) or a cultured embryonic stem - cell line, esc - d3 (35). by performing single - cell - based, genome - wide gene expression analysis (36), we found that vsels show similar, but characteristic transcriptome compared with escs and hscs (35). one gene of particular interest which is highly expressed in vsels is ezh2, a polycomb group protein. ezh2 has an essential role for maintaining the bivalent domain (bd) epigenetic marker. in undifferentiated psc, the promoter regions of some developmentally crucial transcription factors are epigenetically marked both the transcriptionally active h3k4me3 codes and the repressive histone ones such as trimethylated on lysine27 of histone3 (h3k27me3) and this epigenetic modification is called bivalent domain. the bivalent domain is detected mainly in the promoter region for the homeodomain containing development master tfs, such as dlx, irx, lhx, pou, pax, and six family proteins (3739). due to the overwhelming effect of transcription - repressive activity endowed from h3k27me3, the transcription of bivalent domain target genes is transiently re - pressed in order to prevent the premature expression of the differentiation inducing tfs. however, in response to the development stimuli, the bivalent domain of these promoters is switched into a monovalent domain in order to determine their gene expression. by conducting differentiation and rna interference experiments, we demonstrate that ezh2 in vsels has a similar role for preventing premature activation of lineage - committing transcription factors (35). taken together, therefore, both positive (expression of oct4-nanog - sox2 pluripotency circuitry) and negative (repression of differentiation inducing tfs by bivalent domain) regulatory mechanisms are indispensable in order to maintain the pluripotency of vsels. unlike escs, we noticed that murine oct4 vsels do not proliferate in vitro if cultured alone and do not grow teratomas in vivo. on the other hand, cells isolated from vsel - dss regain their proliferation potential, thus suggesting that vsels are a quiescent cell population and that some mechanisms must exist to prevent their proliferation in a normal physiological condition. similarly to vsels, pgcs in cultures freshly isolated from embryos proliferate for a few days only and then disappear either because they differentiate or die (14). however, when pgcs are cultured over the feeder layer and with appropriate growth factors cocktails, they restore the proliferation potency and can be established into eg cells. therefore, it is possible that two stem - cell populations could employ similar molecular mechanisms to regulate their pluripotency and to prevent unleashed cell proliferation. genomic imprinting is an epigenetic process ensuring paternal - specific, mono - allelic expression of so - called imprinted genes. approximately 80 imprinted - genes (expressed from maternal or paternal chromosomes only) have been reported in mouse genome and their proper mono - allelic expression regulates totipotency and pluripotency of the zygote and developmentally early stem cells, respectively (40). furthermore, most imprinted genes, such as insulin - like growth factor 2 (igf2), h19, igf2 receptor (igf2r), and p57 (also known as cdkn1c), are directly involved in embryo growth and development. as the majority of imprinted - genes exist as gene clusters enriched for cpg islands, their expression is coordinately regulated by the dna methylation status on cpg - rich cis - elements known as differently methylated regions (dmrs) (41). the differential methylation status of dmrs is mediated by dna methyltransferases (dnmts), depending upon the parental allele origin. depending on the developmental period of methylation, there are two types of dmrs, i.e. primary dmrs which are differentially methylated during gametogenesis, and secondary dmrs which acquire allelic specific methylation after fertilization. to date, 15 primary dmrs have been identified in mouse genome. interestingly, most primary dmrs are maternally methylated ones and only three dmrs, i.e. igf2-h19, rasgrf1, and meg3 loci, are paternally methylated (42). in addition to dna methylation on dmr, histone modifications also contribute to the monoallelic expression of the imprinted genes. shortly after pgcs specification at e7.25, pgcs initiate the epigenetic reprogramming programs resulting in progressive global dna demethylation and changes in histone modifications (43). as a result, dna methylation marks for genomic imprinting in both parental chromosomes are erased during pgcs migration into the genital ridge and new genomic imprints are established during terminally maturation into gametes in the sex - dependent manner. the erasure of genomic imprints could be a potential mechanism used to restrict the oct4 expressing germ - line stem cells from unleashed cell proliferation and teratoma formation. for example, while the nuclei of early migrating pgc at e8.59.5 can be successfully used as donors for nuclear transfer, nuclei from post - migratory pgc after e11.5 are unable to support full - term development (44). since vsels exhibit a similar molecular signature to pgcs, we have hypothesized that vsels might employ the epigenetic reprogramming of genomic imprinting to prevent them from unleashed proliferation and this mechanism may be responsible for maintaining their quiescent status in adult tissue. indeed, vsels freshly isolated from murine bm erase the paternally methylated imprints, e.g. igf2-h19 and rasgrf1 loci, however, at the same time they hypermethylate the maternally methylated ones, e.g. igf2 receptor (igf2r), kcnq1-p57, and peg1 loci (28, 34). because paternally expressed, imprinted - genes (igf2 and rasgrf1) enhance the embryo growth and maternally expressed genes (h19, p57kip2, and igf2r) inhibit cell proliferation (28, 34), the unique genomic imprinting pattern observed on murine vsels demonstrates that the pattern of genomic imprints in these cells is favorable to the repression of cell proliferation. accordingly, vsels highly express growth - repressive imprinted gene transcripts, h19, p57, and igf2r, and down - regulate growth - promoting ones, igf2 and rasgrf1, and which explains the quiescent status of vsels (28). importantly, cells isolated from vsel - dss which proliferate and differentiate progressively recover all of the growth repressive patterns of genomic imprinting. these results suggest that epigenetic reprogramming of genomic imprinting should be primary mechanism for maintaining the quiescence of the most primitive pluripotent adult stem cells, e.g. oct4 vsels, deposited in the adult body and protect them from premature aging and tumor formation (28). indeed, we demonstrated that the epigenetic changes of some imprinted genes, igf2-h19, igf2r, and rasgrf1 loci regulate the responsiveness to the insulin factor signaling pathway in murine vsels. it is well - known that the attenuation of the insulin / insulin - like growth factor (ins / igf) signaling that positively correlates with longevity (45). thus, our experimental data using several animal model mice for longevity and ins / igf signaling demonstrate that the pool and regeneration potency of vsels deposited in adult tissue gradually decrease throughout life in an ins / igf signaling - dependent manner and the ageing associated dysfunction of vsels could be an important mechanism of aging (4648). therefore, the investigation of potential modulation of mechanisms controlling genomic imprinting in vsels is crucial for developing more powerful strategies to unleash the regenerative potential of these cells for efficient use in the clinical setting. to get a better molecular insight about the quiescent state of vsels, we recently performed the genome - wide analysis of murine bm - derived vsels. accordingly, the attenuation of mitogenic growth - factor signaling pathways also has a crucial role in their quiescence and ageing (49). of particular interest, vsels down - regulate genes involved in the uv radiation response, mrna processing, and mitogenic growth factor signaling, e.g. from igf-1 and trka receptors as well as for the erk and pi3k pathways. using leading - edge, subset analysis and real - time, quantitative pcr assays, we observed that several genes, such as grb2, sos1, shc1, map2k1, akt3, elk1, rps6ka3, gsk3, and csnk2a1, which are involved in mitogenic growth - factor signaling pathways, were commonly down - regulated in vsels. in contrast, we observed that oct4 vsels up - regulates tissue - specific gene sets and a gene set encoding the complement - coagulation cascade. thus, we are investigating the role of these putative molecular targets for regulating the quiescence and ageing of vsels. several attempts have been made in the past few years to purify a population of pscs from adult tissue. the very primitive vsels in adult tissue could function as a precursor for monopotent tcscs. pluripotency of murine vsels is already supported by their i) ability in vitro to differentiate in co - culture systems into three germ line - ages, ii) the presence of primitive, unorganized euchromatin in nuclei, iii) true expression of oct4 and nanog supported by demonstration of the hypomethylated promoter status and its association with acetylated histones, and iv) the presence of bivalent domains on homeodomain - containing, developmental transcription factors. however, these cells do not grow teratomas and are ineffective in blastocyst complementation assay due to modulation of methylation on regulatory sequences in developmentally important, imprinted genes, similarly seen in pgcs, to prevent them from unleashed cell proliferation and teratoma formation. furthermore, vsels could be specified into several tissue residing tcscs, e.g. mscs, hscs, and cardiac stem cells, in response to tissue / organ injury. taken together, it is very likely that these cells have a physiological role in the rejuvenation of a pool of tcscs under steady state conditions. vsels developmentally originate from epiblast - derived, migrating pgcs and they could be deposited in adult organs early in the development as a reserve pool of primitive stem cells for tissue repair and regeneration. therefore, vsels isolated from adult tissue are an alternative and not ethically controversial source of stem cells for regenerative medicine. to successfully use vsels in the realm of regenerative medicine, it is very important to establish experimental protocols for the reprogramming of growth - repressive, genomic imprinting status in vsels into a somatic pattern in order to unleash their regenerative potential.	pluripotent stem cells (pscs) have been considered as the most important cells in regenerative medicine as they are able to differentiate into all types of cells in the human body. pscs have been established from several sources of embryo tissue or by reprogramming of terminally differentiated adult tissue by transduction of so - called yamanaka factors (oct4, sox2, klf4, and cmyc). interestingly, accumulating evidence has demonstrated the residence of pscs in adult tissue and with the ability to differentiate into multiple types of tissue - committed stem cells (tcscs). we also recently demonstrated that a population of pluripotent oct4 + ssea-1+sca-1+lincd45 very small embryonic - like stem cells (vsels) resides in the adult murine bone marrow (bm) and in other murine tissue. these very small (36 m) cells express pluripotent markers such as oct4, nanog, and ssea-1. vsels could be specified into several tissue - residing tcscs in response to tissue / organ injury, and thus suggesting that these cells have a physiological role in the rejuvenation of a pool of tcscs under steady - state conditions. in this review article, we discuss the molecular nature of the rare population of vsels which have a crucial role in regulating the pluripotency, proliferation, differentiation, and aging of these cells.
abnormal involuntary movements may appear in any part of the body, and can be embarrassing, distressing, disfiguring or dangerous. tremor is an involuntary rhythmic oscillation of one or more parts of body about a fixed plane in space. tremors are observed with the use of various drugs, including tricyclic antidepressants, monoaminooxidase inhibitors, antipsychotics, lithium, valproate, lamotrigine, antihistamines, thyroxine and nicotine. these tremors tend to disappear after withdrawal of the offending drug. in a young person receiving psychotropic medication, appearance of unilateral tremor is unusual and various diagnostic possibilities need to be kept in mind. in this report a 26-year - old young male, employed as a tailor, from rural background, presented with 6 months duration of symptoms suggestive of mania. at the time of admission, detailed clinical examination including bedside neurological examination revealed no abnormalities. he was prescribed risperidone 2 mg / day and diazepam 30 mg / day on the first day of admission. as he remained aggressive even after this sodium valproate 500 mg / day it was observed that he developed regular rhythmic movements of his neck and right hand, with no other extrapyramidal symptoms. for optimal control of his manic symptoms the dose of risperidone was increased to a maximum of 8 mg and valproate to 1400 mg on day 46 of his admission. trihexyphenidyl 2 mg / day was also added to his ongoing therapy, in view of tremors. however, these movements became more prominent involving the neck along with head and right upper limb. they were rhythmic and regular with 3 - 4 hz, and present at rest. the tremor used to disappear as the target was approached, thus did not cause any difficulty in eating or writing. as this symptom caused significant distress to the patient, valproate was stopped on day 60. however, there was no improvement even after one week of this, and hence risperidone was also stopped. two weeks after stopping risperidone, there were no visible tremor at rest, but it would appear when he became emotionally disturbed. he was discharged on olanzepine (10 mg / day), which he tolerated well, and remitted completely from mania. the liver function tests showed raised liver enzyme -sgot which was 93iu (0 - 25) in the first week which returned to baseline subsequently. investigations for complete blood count, wilson 's disease, thyroid abnormalities and folic acid levels were normal. low serum vitamin b12 levels (41 pg / ml ; normal > 201 pg / ml) and serum ceruloplasmin on lower side of normal range (25 microg / dl, normal range 25 - 63 microg/ dl) were detected. the common causes for unilateral tremor include parkinson 's disease, wilson 's disease, neuropathic, familial essential tremor syndrome, holmes tremor and psychogenic tremor. rubral tremor is a special type of visible tremor appearing as flexion - extension movement at wrist and fingers present at rest and during action, not associated with bradykinesia or cogwheel rigidity and considered as a separate entity compared to holmes tremor. thus our patient had rubral tremor of right upper limb associated with tremor of the neck. cases of rubral tremor developing following exposure to fluphenazine and risperidone have been reported. however, both these cases had symptom or sign suggesting of structural brain damage, unlike in our case. the clinical examination and laboratory investigations ruled out other causes for the tremor and suggested a possibility of drug - induced tremor in this case. causality analysis using the naranjo algorithm suggested that risperidone was scored to be the probable causal agent. however, other contributory factors could have been vitamin b12 deficiency and the concurrent use of valproate. there is a suggestion that bipolar illness itself may increase risk for antipsychotic - induced movement disorder. furthermore, this patient 's nicotine use may have suppressed features of drug induced parkinsonism, causing tremors to dominate the clinical presentation. in a young person with a unilateral tremor of acute onset, drug - induced movement disorder must be considered among the diagnostic possibilities. the role of concurrent valproate therapy and vitamin b12 deficiency as suggested in this atypical case presentation require further elucidation. this case highlights the complexities involved in identifying drug induced movement disorders in patients receiving multiple psychotropic medications.	identification and management of drug - induced movement disorders is a clinical challenge, more so when the clinical presentation is atypical. a young male with acute mania was under treatment with sodium valproate and risperidone. he developed tremors of right hand and neck. these were present at rest and exacerbated by mental activity, when under observation and during voluntarily initiated activity. there were no associated extra pyramidal symptoms or cerebellar signs. investigations for other common causes of tremors did not reveal any evidence except for low value of serum vitamin b12 levels. the tremors persisted after the withdrawal of valproate, but resolved following the withdrawal of risperidone. it is a common dictum that drug - induced tremors are bilateral. this may not be true always as we found out in our case. these movements were probably induced by risperidone. this atypical presentation could be due to concurrent use of valproate and low serum vitamin b12 levels.
lobular carcinoma in situ (lcis) is a form of in situ neoplasia that develops within the terminal lobules of the breast. it is extremely rare in males due to the lack of lobular development in the male breast. furthermore, there is scarce data on the utility of screening mri for male patients who are known to have high risk lesions. we herein report a rare case of lcis in a male breast discovered incidentally on pathologic analysis of the breast tissue, which had been removed during breast reduction surgery for gynecomastia. invasive ductal carcinoma developed in the ipsilateral breast two years later, as was detected on screening mri. the patient is a 55-year - old african american male who reported a brief history of anabolic steroid use and no family history of breast cancer. the patient had a history of multiple surgical procedures for recurrent gynecomastia over the course of many years. pathologic evaluation demonstrated a few foci of lcis within the left breast along with atypical duct cell hyperplasia in a background of gynecomastia. due to the highly unusual finding of lcis in this male patient, genetic analysis was performed and the male xy genotype was confirmed. the patient was subsequently referred to our breast imaging center for a screening bilateral breast mri. this demonstrated mild diffuse background enhancement bilaterally without suspicious enhancing signal abnormalities in either breast. screening annual breast mri was recommended in view of his highly unusual diagnosis of lcis. screening mri of both breasts performed 15 months later demonstrated interval development of a 1.1 cm enhancing ill - defined mass at the 1 o'clock axis of the left breast (figure 1). a corresponding solid hypoechoic mass with angulated margins was seen on targeted left breast ultrasound (figure 2). no dominant mass or suspicious clustered microcalcifications were identified in either breast (figure 3). physical exam at that time revealed that his gynecomastia had recurred and the patient was noted to have c - cup sized breasts. he had significant hypertrophic circumareolar and inframammary scars on both breasts from his previous breast surgeries. the breast reduction specimen consisted of 426 grams of tissue from the right breast and 490 grams of tissue from the left breast. extensive histopathologic sampling of the left breast revealed a few foci of lobular carcinoma in situ which was confirmed with a negative e - cadherin immunostain (figures 4 and 5). atypical duct cell hyperplasia, cribriform and micropapillary type was also present in a few foci on the left (figure 6). the ultrasound guided core biopsy specimen demonstrated invasive ductal carcinoma and subsequent bilateral mastectomy specimens revealed a 1.4 x 1.2 x 1.0 cm irregular hard mass at the 1 o'clock position of the left breast. histopathologic examination of the left breast mass revealed a 1.3 cm well differentiated invasive ductal cancer with a nottingham score of 5 of 9, including a tubule score of 2, nuclear pleomorphism score of 2 and mitotic count score of 1 (figure 7). the carcinoma was strongly and diffusely positive for both estrogen and progesterone receptors and negative for her-2/neu. breast carcinoma in men is an uncommon disease, representing approximately 1% of all breast cancers and 1% of all malignancies in men ; although based on current statistics, the incidence of male breast cancer is increasing 1,2. while the etiology of male breast cancer is uncertain, risk factors include genetic predisposition, prior radiation exposure, alterations of the estrogen - testosterone ratio, and occupational hazards 3. to date, there is no evidence linking gynecomastia with male breast cancer 4,5. male breast cancers are predominantly of ductal origin due to the lack of terminal lobules within the male breast. as a result, lcis and infiltrating lobular carcinoma are extremely unusual in male patients 6. nance reported the first case of lcis in a phenotypic and apparently genotypic male in 1989 in association with a large infiltrating lobular carcinoma 7 ; and in fact, only a limited number of cases of infiltrating lobular carcinoma of the male breast have been reported 8. over the past decade, there has been an increase in the number of imaging studies performed in male patients. these are largely performed in patients who present with complaints of a breast lump and/or breast pain. although there are no standardized protocols in evaluating the male breast, mammography is usually the initial study and is followed by ultrasound as needed 9. occasionally, mri may be obtained for further evaluation, and it has been shown that the diagnostic criteria used in the evaluation of the female breast may be applied to the male breast as well 10. however, there are no guidelines regarding screening mammography in asymptomatic men at any age due to the rarity of male breast cancer. in the absence of screening, most male patients present with clinical symptoms and more advanced disease 11. current national comprehensive cancer network guidelines for men with brca mutations recommend consideration of baseline mammography followed by annual mammography in those men who are shown to have gynecomastia on the baseline study 12. the role of screening mri even in female patients with lcis is not well established despite the fact that lcis is known to represent a high risk marker lesion. in fact, lifetime risk estimates for patients with incidentally diagnosed lcis range from 10 to 20%, imparting a significant lifetime risk for the development of invasive ductal or lobular carcinoma in either breast 13,14. in 2007, a retrospective study evaluated screening mri in asymptomatic female patients with lcis, demonstrating a small increase in early cancer detection 15. subsequently, the 2007 american cancer society guidelines for screening breast mri advised that there was insufficient evidence to recommend for or against screening mri in patients with a known diagnosis of lcis and only recommended annual screening breast mri for patients with a lifetime risk of greater than 20 - 25% 16. the 2009 national comprehensive cancer network guidelines, however, advised consideration of annual breast mr imaging as an adjunct to mammography and clinical examination in these patients 17. more recently, two additional retrospective studies specifically studied screening breast mri in asymptomatic female patients with lcis and concluded that screening breast mri is a useful adjunctive tool to mammography in this high risk population 18,19. as such, one may extrapolate this information to males with a known diagnosis of lcis and recommend screening mri, as was done in this case. this case report is, to the best of our knowledge, the first reported case of a genotypic and phenotypic male patient without a brca mutation, who was found to have incidental lcis which was unrelated to a lobular carcinoma. in addition, this is the first reported case of a male patient with lcis to be screened with annual mri surveillance and in whom the mri detected a mammographically occult stage i invasive ductal carcinoma. this case highlights the importance of imaging management and the potential for an improved prognosis in men who are at high risk for breast cancer.	lobular carcinoma in situ is a form of in situ neoplasia that develops within the terminal lobules of the breast. it is an extremely rare finding in males due to the lack of lobular development in the male breast. the authors herein report an unusual case of incidentally discovered lobular carcinoma in situ in a male patient with recurrent bilateral gynecomastia who was subsequently diagnosed with invasive ductal carcinoma of the left breast. the pathology of lobular carcinoma in situ in a male as well as screening mri surveillance of male patients at high risk for breast cancer are discussed, emphasizing the importance of screening and imaging follow up in men who are at high risk for breast cancer.
obesity has been considered as a general health problem around the world. in the united states, the prevalence of obesity is 35.5% among men and 35.8% among women and in iran it has been reported 42.9% among men and 56.9% among women. obesity is related to increased risk of hyper - tension, diabetes mellitus, cardiovascular disease, arthritis, gallbladder disease, and cancer. mechanisms of physiological, psychological and behavioral are involved in the relationship between obesity and migraine. the prevalence of vitamin d deficiency is 30 - 80% among children and adult world - wide. in iran, prevalence of vitamin d deficiency has been observed 72.1% in men and 75.1% in women. in isfahan, 19.6%, 23.9% and 26.9 of people vitamin d deficiency is related to musculoskeletal disorders, cancer, autoimmune disorders, cardiovascular disorders, kidney disorders, mental disorders, and skin disorders. evidence have determined an inverse relationship between vitamin d levels with headache.[5915 ] number of studies have found that serum vitamin d levels are associated with obesity among population health and patients.[1623 ] however, in some other studies, the relationship was not seen. thus, the present study was conducted to investigate the association between serum levels of vitamin d with general and abdominal obesity among patients with migraine. this is a cross - sectional study that was performed among 66 migraine patients aged 19 - 61 years in isfahan city, iran, in autumn 2012. informed consent was taken from all participants. at baseline, age, gender, weight, height, waist circumference (wc), body mass index (bmi), education level, medical history, the use of vitamin and mineral supplements were gathered. weight was determined (within 0.5 kg) using analog scale in light clothes and without shoes. overweight and obesity was defined as bmi 25 and bmi 30, respectively. bmi was obtained through weight (kilogram) divided into height (meter squared). bmi category was determined as : l0 ean (values < 18.5) ; normal weight (values 18.5 - 24.9) ; overweight (values 25 - 29.9) and obesity (values 30). abdominal obesity was assessed by wc. central obesity was determined as wc 88 for women and wc 102 for men. wc were taken (within 0.5 cm) using inelastic tape at the narrowest part of body, under the ribs. serum 25-oh - d3 was measured to evaluate serum vitamin d levels using enzyme - linked immunosorbent assay. serum vitamin d levels were categorized as : v0 itamin d deficiency (values less than 12 ng / ml) ; vitamin d insufficiency (values between 12 ng / ml and 30 ng / ml), and vitamin d sufficiency (values more than 30 ng / ml). calcium, phosphor, and albumin measurements were conducted for the diagnosis of primary hyperparathyroidism. partial correlation was conducted to survey the association between serum levels of vitamin d with general and abdominal obesity. this is a cross - sectional study that was performed among 66 migraine patients aged 19 - 61 years in isfahan city, iran, in autumn 2012. at baseline, age, gender, weight, height, waist circumference (wc), body mass index (bmi), education level, medical history, the use of vitamin and mineral supplements were gathered. weight was determined (within 0.5 kg) using analog scale in light clothes and without shoes. overweight and obesity was defined as bmi 25 and bmi 30, respectively. bmi was obtained through weight (kilogram) divided into height (meter squared). bmi category was determined as : l0 ean (values < 18.5) ; normal weight (values 18.5 - 24.9) ; overweight (values 25 - 29.9) and obesity (values 30). abdominal obesity was assessed by wc. central obesity was determined as wc 88 for women and wc 102 for men. wc were taken (within 0.5 cm) using inelastic tape at the narrowest part of body, under the ribs. serum 25-oh - d3 was measured to evaluate serum vitamin d levels using enzyme - linked immunosorbent assay. serum vitamin d levels were categorized as : v0 itamin d deficiency (values less than 12 ng / ml) ; vitamin d insufficiency (values between 12 ng / ml and 30 ng / ml), and vitamin d sufficiency (values more than 30 ng / ml). calcium, phosphor, and albumin measurements were conducted for the diagnosis of primary hyperparathyroidism. partial correlation was conducted to survey the association between serum levels of vitamin d with general and abdominal obesity. in this study, 66 migraine patients with mean age of 35.9 9.01 years were included for analysis. patients with diabetes mellitus, metabolic syndrome, cardiovascular diseases and hyper - tension, and liver diseases were excluded. there were 49 women with mean age of 35.7 years and 17 men with mean age of 36.6 10.2 years. deficiency, insufficiency, and sufficiency of vitamin d were observed 13.6%, 66.7%, and 19.7% among migraine patients, respectively. demographical characteristics of patients table 2 shows serum vitamin d status among women and men. 77.6% of women and 88.2% of men have serum vitamin d levels less than 30. there was no differences between serum levels of albumin, calcium, and phosphorus among different vitamin d groups. serum vitamin d status according to gender table 3 describes serum vitamin d status in different groups according to bmi category. serum vitamin d status according to body mass index category partial correlation was used to investigate the association between serum levels of vitamin d with bmi and wc. table 4 shows the relationship between vitamin d with bmi and wc among patients with migraine. according to table 4, significant association was not found between serum 25-oh - d levels with wc (p = 0.83) and bmi (p = 0.92). in this analysis, confounding variables such as sex, age, and education were adjusted. however results of the present study showed that serum levels of vitamin d are not related to wc and bmi. however, a significant inverse relationship was observed between bmi and wc among patients with migraine. most studies have shown an inverse relationship between serum levels of vitamin d and general obesity among population health and patients.[1623 ] however, in some other studies, the association was not found. furthermore, some studies have shown inverse relationship between serum vitamin d levels with wc, but in some other studies the relationship was not observed. in a cross - sectional study conducted on obese or overweight patients, vitamin d status was associated with the degree of obesity, especially, in patients with bmi more than 40.patients with vitamin deficiency had higher bmi and wc and the relationship between vitamin d with metabolic syndrome was not dependent to the degree of obesity. in another study, inverse association was found between serum vitamin d (25-oh - d3 and 1,25-(oh)2-d3) with bmi. prevalence of vitamin d deficiency was the highest among patients with bmi more than or equal to 40. this results shows one out of every three female and one out of every two male with bmi more than or equal to 40 have vitamin d deficiency. in kuala lumpur, a study by khor. a study conducted among cancer patients, showed that obese patients have lower vitamin d levels compared with normal weight and overweight individuals. after adjustments for age, a unit increase in bmi was significantly related to reduced 0.42 ng / ml in serum levels of 25-oh - d3. inverse correlation was determined between bmi with serum vitamin d levels. however, when they were divided into three groups based on vitamin d status, patients with serum levels of vitamin d more than 35 nmol / l had significantly lower bmi compared to serum levels of vitamin d less than 25 nmol / l. vilarrasa. observed inverse correlation between serum vitamin d levels with weight, bmi, waist to hip ratio, body fat, fat mass and fat free mass. however, after adjustment for confounder variables, only relationship was seen between serum vitamin d with body fat. in another study, higher levels of 25-oh - d3 was inversely associated with bmi, hip circumference and total body fat (tbf) among women not men. however, after adjustments for confounder variables, only inverse relationship was observed between tbf and 25-oh - d3.. reported, bmi and wc are related to vitamin d insufficiency (less than 50 increased wc and bmi is associated within adequate intakes of vitamin d, but with adjustment for confounding variables, wc remained significant. it looks obese people require higher doses of vitamin d compared with lean people to reach the same levels of vitamin d. in a study, increase in serum vitamin dafter a year, was significantly and inversely related to bmi at baseline., investigated the association between obesity and increase in serum vitamin d after consumption of vitamin d supplementation. however, after consumption of vitamin d, increase in the serum vitamin d levels were more obvious at the lower primary levels among individuals with normal weight compared to obese people. the relationship between serum levels of 25-oh - d and 1,25(oh)2d with body composition was assessed among obese patients. pmol / l lower in lowest quartile compared to highest quartile of 25-oh - d. a unit increase in bmi was associated with decreased 1 nmol / l in 25-oh - d and decreased 0.9 pmol / l in 1, 25-(oh)2-d. in this regard, several hypothesis and mechanisms have been determined for relationship between serum vitamin d levels with obesity. second, obese patients have inadequate intakes of vitamin d. third, reduced bioavailability of vitamin d among obese patients. forth, vitamin d is fat - soluble that is mainly sequestered in adipose tissue, thus, is low in serum levels of obese patients. first, the current study is cross - sectional, for this reason we can not determine a causal link, therefore, clinical trial studies are essential to conduct. second, the sample size of this study is small and more studies are needed to perform with greater sample size. third, more adjustments for confounding variables such as physical activity and sun exposure must be performed. in summary, no association was observed between serum vitamin d levels with bmi and wc among migraine patients.	background : obesity is a common health problem around the world. studies have shown inverse relationship between serum vitamin d levels with obesity among patients and healthy population. the aim of this present study is to examine the relationship between serum vitamin d levels with general and abdominal obesity among migraine patients.methods:the present study is a cross - sectional and 66 migraine patients aged 19 - 61 years were included for analysis. partial correlation was performed to assess association between serum 25-oh - d with general and abdominal obesity. adjustments were performed for age, sex, and education.results:no relationship was found between serum levels of vitamin d with general and abdominal obesity. however, a significant association was shown between waist circumferences (wc) with body mass index (bmi).conclusions : serum levels of 25-oh - d were not associated with wc and bmi. furthermore, after adjustment for confounder variables, no association was observed.
refractory ascites can occur in patients with conditions such as liver cirrhosis, congestive heart failure, nephrotic syndrome, and lupus serositis1 and in many cases cause abdominal discomfort and respiratory distress to the patient. the treatments for refractory ascites, eg, bed rest, salt and water restriction, diuretics, intravenous administration of albumin, and repeated paracentesis, are usually unsatisfactory. several procedures based on the reinfusion of ascitic fluid have been performed for ascitic fluid removal.28 this report introduces the procedure flow control reinfusion of ascites into the dialyzer during hemodialysis (hd) (figure 1a), by which a 34-year - old lupus patient with massive ascites, respiratory distress, and acute renal failure (arf), who did not respond to diuretics, repeated paracentesis with intravenous albumin infusion, and hd, was successfully treated. prophylactic fresh frozen plasma infusion, sequential ultrafiltration, and reduced dialysate temperature during hd in previous treatments did not prevent intradialytic hypotension. the patient s symptoms were remedied by seven sessions of flow control reinfusion of ascites during hd (figure 1b, c). a 34-year - old female with systemic lupus erythematosus was admitted due to progressive lower leg edema, massive ascites, and nausea after treatment of bed rest, salt and water restriction, diuretics, intravenous administration of albumin and methylprednisolone, and repeated paracentesis for 2 months. on physical examination, her blood pressure was 127/82 mm hg, pulse rate 84 beats / min, respiratory rate 20 breaths / min, and body temperature 37c. the results obtained in laboratory investigations were as follows : white blood cells (wbcs) 5.8 10/l (normal range 4.511 10/l), hemoglobin 89 g / l (normal range 120160 range 150350 10/l), serum blood urea nitrogen (bun) 13.5 mmol / l (normal range 2.57 mmol / l), creatinine 170 mol / l (normal range 50110 mol / l), albumin 19 g / l), alanine aminotransferase 0.24 kat / l (normal range 00.66 kat / l), aspartate aminotransferase 0.60 kat / l (normal range 0.080.76 kat / l), c - reactive protein 0.286 mg / dl (normal range 00.5 mg / dl), complement 3 (c3) 0.4 g / l), and double - strand dna (dsdna) 263 iu / ml (normal range < 30 iu / ml). the results of bacteria culture, acid - fast stain, malignant cell, and tuberculosis polymerase chain reaction of ascites were negative. the doppler of the main portal vein, inferior vena cava, major portal branches, and hepatic vein were patent without obstruction. unfortunately, progressive massive ascite accumulation gave rise to breathing difficulty and decreased urine output, despite an increase in serum albumin from 19 the serum bun and creatinine levels were increased to 30.5 mmol / l and 720 mol / l from 13.5 mmol / l and 170 mol / l, respectively. her lupus activity did not respond to plasma exchange, methylprednisolone 1000 mg pulse therapy, oral prednisolone 60 mg daily, or cyclosporine 100 mg twice daily. her renal failure, leg edema, and refractory ascites could not be controlled by hd due to frequent intradialytic hypotension, which could not be corrected by prophylactic fresh frozen plasma infusion, sequential ultrafiltration, and reduction in dialysate temperature during hd. therefore, continuous flow control reinfusion of ascites into a dialyzer during hd was designed to alleviate the ascites. a paracentesis pigtail catheter was inserted into the abdominal cavity and connected to a sterile three - way stopcock. when ascite reinfusion was planned, a set of dialysis tubing was connected with the sterile three - way stopcock to draw out the ascites at the speed of 1215 ml / min (720900 ml / h) into the dialyzer to mix with the blood by the roller pump during hd. the mixed blood and ascites were then channeled into the systemic circulation during a 4-hour hd session (figure 1a). the ultrafiltration rate of the dialyzer was maintained at around 1 l / h to allow fluid removal from the blood and infused ascites in each 4-hour hd session. after seven sessions of continuous reinfusion of ascites into the dialyzer during hd, 20 l of ascites were drawn out. the body weight and abdominal girth decreased from 50.2 kg to 37 kg and from 92 cm to 72 cm, respectively (figure 3). g / dl to 0.7 g / dl and from 0.1 g / dl to 0.13 g / dl, respectively. a piece of omentum was obtained by peritoneoscopy for the evaluation of the cause of refractory ascites. the pathologic finding of the omentum was chronic inflammation with cell infiltration, congestion, and fibrosis (figure 4). in the following 60 months in our patient, liver cirrhosis, congestive heart failure, carcinomatous peritonitis, and bacterial peritonitis - related ascites were excluded by serial examinations. the refractory ascites caused by lupus serositis was most likely due to the high level of dsdna, low serum level of c3/c4, and inflammatory omentum (figure 4). the patient s refractory ascites, leg edema, and respiratory distress improved after seven sessions of continuous infusion of ascites into the dialyzer during hd after failure of other treatments, including bed rest, salt and water restriction, diuretics, intravenous administration of albumin, repeated paracentesis, sequential ultrafiltration, and reduced dialysate temperature during hd. the success of this treatment showed that the removed body fluid was replaced by the drawn out ascites at a speed of 1215 ml / min (720900 ml / h) concurrently during hd while ultrafiltration was set at around 1 l / h. there were 2.883.6 l of ascitic fluid from the abdomen infused into the dialyzer and a net 0.41.12 l of fluid removed from the systemic circulation during each 4-hour hd session. g / l after seven sessions of continuous reinfusion was due to the infused ascites and protein into the systemic circulation during hd (figure 3). the increase in serum level of albumin might have also pulled the interstitial fluid into the intravascular space via the increase in serum oncotic pressure.5,7,9 leg edema, pleural effusion, and refractory ascites were ameliorated by small negative fluid balance and increased serum albumin level during hd. in this case, arf occurred, along with the progressively worsening ascites and respiratory distress, but improved after the refractory ascites subsided. this implied that arf was mostly related to the refractory ascite - induced hypovolemia and unstable hemodynamic status. ascite reinfusion has been reported in chronic hd patients with cirrhotic, lupus, or nephrogenic ascites.28,1013 in this case, ascitic fluid was infused into the dialyzer under flow control by the roller pump, and the fluid was removed from the systemic circulation simultaneously during hd. several procedures based on the reinfusion of ascitic fluid have been reported in chronic hd patients with cirrhotic, lupus, or nephrogenic ascites, eg, intravenous reinfusion of concentrated ascites, extracorporeal ultrafiltration of ascite fluid with peritoneal reinfusion, ascitic fluid concentration with blood reinfusion during hd, and peritoneovenous shunt.28,1013 in comparison with those procedures, the flow control reinfusion of ascites during hd is rapid, easier, and effective. this procedure and mcgill s method13 could simultaneously control the flow of ascite reinfusion by the flow control roller pump and the amount of body fluid removal by the ultrafiltration rate of dialyzer. the serum albumin level was increased after the infusion of protein - rich ascites into the systemic circulation during hd. the elevated serum level of albumin pulls the interstitial fluid into the intravascular space via increased serum oncotic pressure. with the successful outcome of this case report, we believe that flow control reinfusion of ascites during hd is an effective alternative treatment for the alleviation of refractory ascites in patients with renal failure, who are unresponsive to bed rest, salt and water restriction, diuretics, intravenous administration of albumin, repeated paracentesis, sequential ultrafiltration, and reduced dialysate temperature during hd. although not observed in this case, the potential adverse effects, such as fever, gastrointestinal bleeding, dic, peritonitis, or septicemia, by the intravenous or intra - abdominal infusion of ascites should be kept in mind.14,15 the activation of fibrinolytic activity of ascites due to the relative plasminogen activator inhibitor type-1 deficiency and enhanced basal tissue plasminogen activator has been reported.1619 therefore, clotting tests should be carried out before the procedure is initiated, and if the patient s blood and ascites denote a fibrinolytic activity, the procedure should be considered hazardous and probably contraindicated. in conclusion, the alleviation of ascites and arf attest to the success of the procedure of continuous infusion of ascites into the dialyzer during hd. with normal coagulation function, it is an effective alternative treatment of refractory ascites, especially in patients with renal failure or who are unresponsive to bed rest, salt and water restriction, diuretics, intravenous administration of albumin, repeated paracentesis, sequential ultrafiltration, and reduced dialysate temperature during hd.	refractory ascites can occur in patients with various conditions. although several procedures based on the reinfusion of ascitic fluid have been reported after the failure of bed rest, salt and water restriction, diuretics, intravenous administration of albumin, and repeated paracentesis, these procedures are performed for ascitic fluid removal without dialytic effect. in this study, a flow control reinfusion of ascites during hemodialysis (hd) was performed to demonstrate the efficacy of this method in a lupus patient with massive refractory ascites and respiratory and acute renal failure (arf). the alleviation of ascites and arf attests to the success of the flow control reinfusion of ascites during hd. this procedure can control the rate of ascites and body fluid removal simultaneously during hd using the roller pump. in conclusion, with a normal coagulation profile, the procedure of flow control reinfusion of ascites during hd is an effective alternative treatment for the alleviation of refractory ascites with renal failure.
the behavior of oral health providers and their attitudes towards their own oral health reflect their understanding of the importance of preventive dental procedures and improving the oral health of their patients. also, dental students should instruct their friends, family members, patients and their society to maintain good oral health.1,2 the basis for health care in countries with similar social systems is usually the same. comparison of countries having different bases for health care and different languages is much more complicated and time - consuming.3 hiroshima university - dental behavioral inventory (hu - dbi) was developed by kawamura to investigate dental health behavior, attitudes and perceptions.4 oral health attitudes and behavior of dental and/or dental hygiene students were evaluated frequently by using this scale in several countries.58 but there is insufficient data for oral health attitudes and behavior among turkish dental students. the purpose of this study was to evaluate self - reported oral health attitudes and behavior among a group of turkish dental students by using modified hu - dbi and to compare differences in oral health attitudes between years of study and gender. this study included 267 dental students (153 female, 114 male) in gazi university. the data collection was conducted during the autumn semester of academic year 20072008. a modified english version of hu - dbi survey (table 1) which consists of twenty - eight dichotomous responses (yes - no) was used in this study. while first 25 items of the inventory were related with oral health attitudes and behavior, last 3 items were related with smoking habit of dental students. this inventory has good test - retest reliability as well as good translated validity.9 the translation was discussed with one expert who had experience with questionnaires and survey research. the aim of this study was explained and the students completed the questionnaires in their classrooms during one lecture. data analysis was performed by using spss - version 11.5 for windows (spss inc., each item of the inventory was analyzed with kruskal wallis test for years of study and analyzed with mann whitney u test for gender. chi - square test was performed for analysis between each of first 25 items and last 3 items. data analysis was performed by using spss - version 11.5 for windows (spss inc., il). each item of the inventory was analyzed with kruskal wallis test for years of study and analyzed with mann whitney u test for gender. chi - square test was performed for analysis between each of first 25 items and last 3 items. totally 267 dental students (153 female, 114 male) who were mean age of 21.16 and consisting 141 preclinical (1, 2 and 3 years of study) and 126 clinical students (4 and 5 years of study) participated in the study (table 2). statistically significant differences (p<.05) were found for item 1, 12, 14, 19, 22, 26 and 28 between years of study. for living with family (item 1), there were statistically significant differences (p<.05) between 15, 25 and 35 years of study. for brushing each of teeth carefully (item 12), statistically significant differences (p<.05) were found between 12, 13, 14 and 15 years of study. for cleaning the teeth well without using toothpaste (item 14), there were statistically significant differences (p<.05) between 15, 25, 35 and 45 years of study. for using a toothbrush which has hard bristles (item 19), statistically significant differences (p<.05) were found between 15, 25 and 35 years of study. for having had their dentist tell that they brush very well (item 22), there were statistically significant differences (p<.05) between 15, 14, 25 and 35 years of study. for smoking habit (item 26), statistically significant differences (p<.05) were found between 23, 24 and 25 years of study. for smoking more than one year (item 28), there were statistically significant differences (p<.05) between 13, 14 and 24 years of study. statistically significant differences were found (p<.05) between females and males for item 19 (i use a toothbrush which has hard bristles) and item 23 (i do use tooth floss on regular basis). statistically significant differences (p<.05) were found between females and males for item 26 (i am a smoker), item 27 (i smoke more than 10 cigarettes per day) and item 28 (i have been smoking for more than one year). last 3 items which respond yes and no is shown in table 5. there were statistically significant differences (p<.05) between item 1 (living family)-item 26 (smoking), item 27 (smoking more than 10 cigarettes per day) and item 28 (smoking more than one year). the rates of yes responses to items 26, 27 and 28 were higher in the students not living with family than living with family. statistically significant differences (p<.05) were found for item 12 (brushing each of the teeth carefully), item 17 (it is impossible to prevent gum disease with tooth brushing alone) and item 24 (i do use mouth wash on regular basis) between smokers and non - smokers. oral health behavior and attitudes among oral health workers and students were evaluated by using hu - dbi survey worldwide in several studies,1,4,6 which were performed in different countries. even, cultural differences in countries with similar or different social systems were investigated in previous studies.3,7,1012 due to lack of studies about oral health attitudes and behavior among turkish dental students, this study is of prime importance in this field. self - reported oral health attitudes and behavior among a group of turkish dental students by using modified hu - dbi and differences between years of study, gender and effect of smoking habits on oral health attitudes were evaluated. it was reported that education about dental health care in the pre - university curriculum could be an important factor that can influence the oral health attitudes of students entering dental field.2 kirtiloglu and yavuz13 indicated that self - preventive oral behavior of the turkish non - dental university students is at a lower level than in industrialized countries. they reported that 68% of the students brushed their teeth two or more times per day and few subjects (3%) used dental floss daily. thirty percent of the students visited a dentist for preventive treatment at least once a year. the rate of tooth brushing twice daily or more was 74.1% and the rate of usage dental floss regularly was 32.3% and 46.5% of the study sample put off going to the dentist until they have toothache among a group of turkish dental students. this result exhibited that more dental health care education is effective and needed to improve oral health in turkey. several studies13,8 reported as dental health attitudes become more positive and improved with increasing level of education. the improvement of personal oral health among dental students has shown to be linked to their dental education experience5 and oral health attitudes and behavior seem to increase significantly in the fourth and fifth years of dental education.6 in this study, statistically significant differences (p<.05) were found between first and all senior years of study for brushing each of teeth carefully and cleaning the teeth well without using toothpaste. there were statistically significant differences between preclinical and clinical students for using a toothbrush which has hard bristles and having had their dentist tell that they brush very well. the results of this study confirmed that oral and dental health behavior and attitudes and also their knowledge about oral and dental health care of dental students improved with increasing level of education in accordance with previous studies. additionally, it was seen that responds of the students in the fourth and fifth years were mostly very similar as described by polychronopoulou.6 in general, female dental students had better oral health attitudes and take better care of their teeth than male dental students.14,15 this condition may be explained on the basis that females usually care more about their body and appearance. they would thus be more concerned about visiting the dentist and would tend to be more educated about their dentition even before entering a course related to dentistry.2 in this study, there were statistically significant differences between females and males for only item 19 (i use a toothbrush which has hard bristles) and 23 (i do use tooth floss on regular basis). but, dental care behavior of female students such as tooth brushing twice daily or more, brushing each of the teeth carefully and usage the tooth floss regularly were better than males in this study in agreement with previous studies.2,14,15 clinical studies16,17 and regional health surveys have found an association between smoking and poor oral health. the rate of smoking among turkish university students was found to be 49.4%.18 in this study, it was lower (22.0%) than the prevalence of smoking among the other university students. health care providers play an important role in educating patients about the health risks of tobacco use and in promoting tobacco cessation.19 smoking and its association with periodontitis and many other oral diseases should be clearly taught to students as they could be role models for their future patients.20 in this study, statistically significant difference was found between brushing each of the teeth carefully and smoking. oral and dental health behavior and attitudes and also their knowledge about oral and dental health care of a group of turkish dental students improved with increasing level of education. while, oral and dental health care of female students were better than males and oral and dental health care of non - smokers were better than smokers in agreement with previous studies which were performed in different countries. as a health care provider dental students should be a good model to their family members, friends and especially patients for oral health behavior. further studies are needed to examine cultural differences between turkish and other dental students in different countries.	objectivesthe purpose of this study was to evaluate self - reported oral health attitude and behavior among a group of turkish dental students and to compare differences in oral health attitudes between years of study and gender.methodsthis study included 267 (153 female, 114 male) dental students. a modified english version of hiroshima university dental - behavioral inventory (hu - dbi) which consists of twenty - eight dichotomous responses (yes - no) was used.resultstotally 141 preclinical (1, 2 and 3rd years of study) and 126 clinical students (4 and 5th years of study) who were mean age of 21.16 participated in the study. statistically significant differences were found between years of study for brushing each of teeth carefully, cleaning the teeth well without using toothpaste, using a toothbrush which has hard bristles and for having had their dentist tell that they brush very well. there were statistically significant differences between females and males for using a toothbrush which has hard bristles and using tooth floss regularly. statistically significant differences were found for brushing each of the teeth carefully and using mouth wash on regular basis between smokers and non-smokers.conclusionsthis study confirmed that oral and dental health behavior and attitudes and also their knowledge about oral and dental health care of dental students improved with increasing level of education while oral and dental health care of female students were better than males and oral and dental health care of non - smokers were better than smokers.
treacher collins syndrome (tcs) is a severe congenital disorder of craniofacial development characterized by numerous developmental anomalies that are restricted to the head and face. hypoplasia of the facial bones, particularly the mandible and zygomatic complex, is an extremely common feature of tcs. although the condition was probably first described by thomson (1846) followed by toynbee (1847) and berry (1889), it is named after e. treacher collins who described the essential components of the syndrome in 1900. the first extensive review of the condition was done by franceschetti and klein in 1949, who coined the term mandibulofacial dysostosis to describe the clinical features. in england and in the american continent this abnormality is described as the treacher collins syndrome and in the european continent as mandibulo - facial dysostosis or franceschetti syndrome. an 18-year - old female reported to the department of oral medicine and radiology with the chief complaint of forwardly placed teeth in the upper anterior region of jaw. family history revealed that her father and grandmother had typical signs of the treacher collins syndrome. on extra oral examination, she presented with antimongloid slanting of the palpebral fissures with sparse eyelashes on the lower eyelid. the maxillary incisors were proclined and there were spacing in the maxillary and mandibular anteriors. radiographs revealed prominent antigonial notch, short ramus [figure 3 ], hypoplasia of the mandible, proclined upper anteriors [figure 4 ], hypoplasia of zygomatic bone, and maxillary sinus [figure 5 ]. front view of the patient showing hypoplasia of facial bones, downsloping palpabral fissures, with scanty lower eye lashes lateral view showing retruded mandible and prominent nose orthopantomogram showing prominent antigonial notch, short ramus lateral cephalogram showing hypoplastic mandible, prominent nose, and proclined upper anteriors pa water showing hypoplasia of zygomatic bone and maxillary sinus tcs or franceschetti syndrome is an autosomal dominant disorder of craniofacial development which has an incidence of approximately one in 50,000 live births. while 40% of cases have a previous family history, the remaining 60% appear to arise as a result of a de novo mutation. in our case, several hypotheses were proposed to explain the pathogenesis of tcs including abnormal patterns of neural crest cell migration, abnormal domains of cell death, improper cellular differentiation during development, or an abnormality of the extracellular matrix ; however, there was little experimental evidence to support any of these hypotheses. recently genetic, physical, and transcript mapping techniques have identified the gene mutated in tcs which is designated as tcof1 and mapped to human chromosome 5q32 - -33.2 locus. it was found to encode a low complexity, serine / alanine - rich, nucleolar phosphoprotein termed treacle.- valdez. suggested that haploinsufficiency of treacle in tcs patients might cause insufficient rrna production in the prefusion neural folds, resulting in abnormal craniofacial development. (the cephalic neural crest cells probably require a higher threshold concentration of rrna for their survival and proper differentiation during early embryogenesis.) the structures affected in tcs are derived from the first and second pharyngeal arch, groove, and pouch. franceschetti and klein (1949) reviewed the literature and described the typical characteristics of the syndrome as follows : (1) antimongoloid palpebral fissures with either a notch or coloboma of the outer third of the lower lid, and occasional absence or paucity of the lashes of the lower lid. (2) hypoplasia of the facial bones, especially the malar bones and mandible. (3) malformation of the external ear, and occasionally of the middle and inner ear, with low implantation of the auricle. (4) macrostomia, high palate, malocclusion, and abnormal position of the teeth. (5) atypical hair growth in the form of tongue - shaped processes of the hairline extending toward the cheeks in the preauricular region. (6) association at times with other anomalies, such as obliteration of the nasofrontal angle, pits, or clefts between the mouth and ear, and skeletal deformities. after this description was published, some of these features were regarded as being of lesser importance and some were emphasized in the diagnosis. (1963) named the following features as obligatory : (1) antimongoloid palpebral fissures, (2) anomaly of the lower lid : coloboma of the outer third, or deficient lashes, or both, (3) hypoplasia of the malar bones, (4) hypoplasia of the mandible. in our case, while the clinical features are generally bilaterally symmetrical, expression of the mutated gene is highly variable. at one extreme, the features can be so mild that it may be difficult to reach a diagnosis. at the other extreme, the facial complex may be so severely hypoplastic that prenatal death ensues as a result of compromisation of the airway. prenatal diagnosis of tcs has only been performed in families with a history of tcof1 using either fetoscopy or ultrasound imaging in the second trimester of pregnancy (approximately 18 weeks) when termination of pregnancy is a particularly traumatic procedure psychologically as it involves the induction of labor. however, the onset of tcs abnormalities occurs very early during human embryonic development, typically within the first 4 - -8 weeks. hence first trimester prenatal diagnosis would seem to be preferable, particularly if the family feel that termination of pregnancy is desirable in the event that the fetus is affected. phenotypic diagnosis at this stage (first trimester) even with the most sophisticated ultrasonography available today is not possible. although linkage analysis (molecular analysis) has been used to make first trimester diagnostic predictions in a pregnancy at high risk of producing an affected child, it is not possible to predict how severely affected a fetus might be using this approach alone ; consequently, ultrasonography is an invaluable aid to prenatal diagnosis, as this technique may provide information about the severity of affected pregnancies and can be used to evaluate fetal progression. nager syndrome has similar facial features to tcs, particularly in the region of the eyes (downward slanting with a deficiency of eyelashes). however, the mandible is usually more hypoplastic, the lower lid colobomas are rare, and preaxial limb abnormalities (hypoplastic, or aplastic thumbs, fused radius and ulna) are a consistent feature of nager syndrome, unlike tcs. miller syndrome also has some similarity in the facial features to tcs ; in addition it has postaxial limb defects (absence or incomplete development of the fifth digital ray of all four limbs) and ectropion or outturning of the lower lids. also cleft lip, with or without cleft palate, is more common than in tcs and some patients may exhibit congenital heart defects. the development of speech and language skills depends on the child 's ability to hear during the first 3 years of life. as the great majority of these patients are of normal intelligence, early recognition of deafness and its correction with hearing aids or surgery, when possible, is of great importance for development. an affected parent of either sex will transmit the defect to 50% of his or her offspring in accordance with mendelian laws of genetics. it is shown that chemical and genetic inhibition of p53 function can repress the wave of neuroepithelial apoptosis associated with tcs and in doing so prevents the pathogenesis of craniofacial anomalies. however, p53 performs many critically important cellular functions and suppressing p53 function completely is a very risky approach given that loss - of - function mutations in p53 are the most common mutations associated with cancer and tumorigenesis. therefore appropriate titration of p53 function is key in preventing the pathogenesis of tcs without risking the onset of tumorigenesis. individuals diagnosed with severe tcs typically undergo, over several years, multiple major reconstructive surgeries that are rarely fully corrective. although stem cell therapy holds promise for treating degenerative diseases, it is unlikely to benefit the reconstructive repair of severe craniofacial malformations. consequently, prevention provides the best hope for improving the prognosis of at - risk or affected individuals.	franceschetti syndrome is an autosomal dominant disorder of craniofacial development with variable expressivity. it is commonly known as treacher collins syndrome (tcs). it is named after e. treacher collins who described the essential components of the condition. it affects both genders equally. this article reports a case of tcs in an 18-year - old female.
type 2 diabetes mellitus (t2 dm) is a progressive disease where hyperglycemia occurs when insulin secretion fails to keep pace with insulin resistance.1 therefore, long - term disease management warrants intensification of treatment over time, especially in step with declining beta - cell function.2 in general, t2 dm management commences with lifestyle and dietary advice, with an oral antidiabetic drug (oad) added if glycemic control remains or becomes suboptimal. metformin is often recommended as the first - line pharmacotherapy given its well - established efficacy, as well as being weight - neutral and inexpensive.3 metformin can be used in combination with other oads or insulin, but the traditional oads (sulfonylureas [su ] and thiazolidinediones [tzd ]) and insulin are associated with weight gain, which can compromise patients ongoing attempts at weight reduction.4 at the point of introducing exogenous insulin, depending on national guidelines and individual preferences, oads other than metformin are often discontinued. the ultimate level of intervention is to add mealtime bolus insulin to, typically, basal insulin plus metformin, or to substitute a premixed insulin regimen. over the last few years we have seen the advent of newer drugs in the form of incretin - based therapies. these act primarily by increasing the physiological effects mediated via the hormone glucagon - like peptide-1 (glp-1), which is secreted along with glucose - dependent insulinotropic polypeptide (gip) by intestinal cells when food is ingested, probably via the neural and endocrine signals associated with feeding.5 glp-1 and gip have multiple actions that enhance beta - cell response in a glucose - dependent fashion. in t2 dm, the incretin response is diminished.6 however, the insulinotropic action of gip is diminished, while that of glp-1 is preserved, although the secretion of glp-1 appears to be diminished.7,8 nevertheless, as the tissue sensitivity to glp-1 is preserved7,9 restoration of glp-1 signal forms the basis of use of glp-1 receptor agonists as a therapeutic option in t2 dm. two strategies can restore the glp-1 signal : inhibiting the enzyme dipeptidyl peptidase-4 (dpp-4), which rapidly degrades glp-1 in vivo resulting in increased concentrations of endogenous glp-1 ; or using dpp-4 resistant mimetics of glp-1 (eg, glp-1 receptor agonists [glp-1ra ]). drugs acting through the former mechanism are called incretin enhancers, while those with the latter action are classed as incretin mimetics. the various effects (both insulinotropic and extra - pancreatic) of glp-1 are well documented. most of these effects complement the role of incretin therapy in t2 dm (table 1).7,1017 from a blood glucose - lowering point of view, the most appealing property is that glp-1 glucose dependently increases insulin secretion and suppresses glucagon secretion. moreover, counter - regulatory responses to hypoglycemia (including glucagon secretion) are fully preserved, even when pharmacological levels of glp-1 are administered.18 in addition, glp-1 induces satiety and has weight limiting effects,13,19,20 along with potential beta - cell sparing actions.15,16table 1potential benefit of incretin therapy in the treatment of type 2 diabetes mellitussummary of pancreatic and extra - pancreatic effects of glucagon - like peptide-1 in humansglucose - dependent stimulation of insulin secretion7glucose - dependent suppression of glucagon secretion7enhanced glucagon secretion during hypoglycemia10,11reduced gastrointestinal motility and pancreatic exocrine function12increased satiety13improvement of beta - cell function14increased beta - cell mass with inhibition of beta - cell apoptosis1517 potential benefit of incretin therapy in the treatment of type 2 diabetes mellitus dpp-4 inhibitors (incretin enhancers) are orally available drugs that are weight neutral with low propensity to cause hypoglycemia.5,21,22 several dpp-4 inhibitors have been developed (e.g. vildagliptin, sitagliptin, saxagliptin). currently, two glp-1ra (incretin mimetics) are clinically available (exenatide, which is administered twice daily [b.i.d. ] and liraglutide, administered once daily [o.d. ]). both are given subcutaneously. glp-1ra reduce hyperglycemia in t2 dm either when given as monotherapy or when added to various oad regimens, and incretin mimetics often achieve weight loss.5 like dpp-4 inhibitors, glp-1ra carry a low risk of hypoglycemia. gastrointestinal adverse effects are transient, with nausea generally subsiding by 8 weeks after initiation of exenatide treatment and by 4 weeks after initiation of liraglutide treatment.23 even though incretin enhancers and mimetics act through the same therapeutic axis, their overall drug profile varies (table 2). hence, these differences offer a unique role for each of the drug groups in the treatment algorithm for t2 dm. table 2comparing different types of incretin based therapyglp-1 receptor agonists (incretin mimetics)dpp-4 inhibitors (incretin enhancers)mode of actionincreased receptor signaling, results in pharmacological levels of glp-1, specific effect and hence results in extra - pancreatic effects such weight loss and delayed gastric emptyingincreased levels of circulating glp-1 ; nonspecific, limited by endogenous secretionroute of deliveryparenteral (subcutaneous injection)oralhba1c reduction0.8% to 1.8%0.5% to 1.1%effects on weightinduces weight lossweight neutralside effectsincreased gi symptoms, potentially increased propensity to cause hypoglycemia, in comparisonfewer gi side effects and comparatively reduced risk of iatrogenic hypoglycemiadpp-4=dipeptidyl peptidase-4 ; gi = gastrointestinal ; glp-1=glucagon - like peptide-1 ; hba1c = hemoglobin a1c. comparing different types of incretin based therapy dpp-4=dipeptidyl peptidase-4 ; gi = gastrointestinal ; glp-1=glucagon - like peptide-1 ; hba1c = hemoglobin a1c. post - marketing cases of acute pancreatitis in patients treated with exenatide and acute pancreatitis in patients treated with liraglutide in clinical trials have led to amended label precautions for these agents. similar case reports with sitagliptin (88 cases reported to the food and drug administration [fda ] between october 2006 and february 2009) have been reported. however, patients with t2 dm have a three - fold increased risk of pancreatitis compared with individuals who do not have diabetes.24 in summary, the data so far does not establish causality in terms of the use of incretin - based therapy, and a possible increase incidence in pancreatitis. however, a precautionary note is now included in all the drug labels and also warrants appropriate patient education. thyroid neoplasia preclinical rodent studies with liraglutide have shown an increase in c - cell thyroid cancer, which so far has not been demonstrated in monkeys or humans.25 based on the preclinical studies in rodents, the fda has requested a boxed warning for liraglutide, which includes contraindications for use in... patients with a personal or family history of medullary thyroid carcinoma (mtc) or in patients with multiple endocrine neoplasia syndrome type 2 (men 2).25 recent findings from a large screening study in 5000 subjects treated with liraglutide did not support an effect of glp-1 receptor activation on serum calcitonin levels in humans, as reported in rodent studies.26 however, ongoing studies are evaluating the long - term safety of incretinbased therapy. other adverse events include hypoglycemia, particularly when glp-1ra are used in conjunction with other oad, especially secretagogs. injection site - related adverse events, such as itching and skin rashes, have also been reported. since 2009, the fda required the possible associations between the use of exenatide and altered renal function to be highlighted in the prescribing information. however, given their unique pharmacological properties, it is imperative that we explore further their changing roles within our treatment algorithms for t2 dm. most studies to date have assessed incretin - based therapies as monotherapy or in combination with standard oads.5,22 accordingly, a growing number of treatment guidelines now incorporate incretin - based therapies, generally suggesting their consideration as add - ons to metformin or metformin plus other oad combination therapy, and before resorting to insulin.2 exenatide has also been compared with insulin therapy as an add - on to oad. heine.27 compared response to addition of exenatide (10 g b.i.d.) versus insulin glargine (titrated to target fasting plasma glucose [fpg ] of 3 months) plus oad. mean duration of t2 dm 9.9 years with mean hba1c of 8.2%33924 weekshba1c decreased by 1.16% in the lispro group and by 1.40% in the glargine group with modest weight gain (+ 0.3 kg and + 0.7 kg respectively).levin. effect of adding glargine, exenatide or the combination of two to oad was assessed.glargine (93) mean age 65 years. combination (74) mean age 60 years.- hba1c reduction varied, as did the baseline control. changes of 1.51% (glargine, baseline 9.2%), 0.86% (exenatide, baseline 8.2%) and 0.81% (combination, baseline 8.5%). the glargine only group gained 1.3 kg) while those on exenatide, alone (3.25 kg) or in combination (2.65 kg) lost weight.dpp-4 inhibitor basedtransition study 201169prospective study in insulin - nave patients. compared simultaneous addition of sitagliptin plus insulin detemir (with discontinuation of su) to introduction of sitagliptin alone with su continued. mean hba1c of 8.5% on metformin and su.21726 weekshba1c changed by 1.44% with detemir plus sitagliptin and 0.89% with sitagliptin + / su (p 8.6%. sitagliptin 100 mg or placebo was added to insulin (basal or premixed regimes) + /- insulin and metformin doses were kept constant.64124 weekshba1c changed by 0.6% in the sitagliptin group with no change in the placebo group (p 3 months) plus oad. mean duration of t2 dm 9.9 years with mean hba1c of 8.2%33924 weekshba1c decreased by 1.16% in the lispro group and by 1.40% in the glargine group with modest weight gain (+ 0.3 kg and + 0.7 kg respectively).levin. effect of adding glargine, exenatide or the combination of two to oad was assessed.glargine (93) mean age 65 years. combination (74) mean age 60 years.- hba1c reduction varied, as did the baseline control. changes of 1.51% (glargine, baseline 9.2%), 0.86% (exenatide, baseline 8.2%) and 0.81% (combination, baseline 8.5%). the glargine only group gained 1.3 kg) while those on exenatide, alone (3.25 kg) or in combination (2.65 kg) lost weight.dpp-4 inhibitor basedtransition study 201169prospective study in insulin - nave patients. compared simultaneous addition of sitagliptin plus insulin detemir (with discontinuation of su) to introduction of sitagliptin alone with su continued. mean hba1c of 8.5% on metformin and su.21726 weekshba1c changed by 1.44% with detemir plus sitagliptin and 0.89% with sitagliptin + / su (p<0.001%) fpg levels were significantly lower in the group on detemir with sitagliptin (fpg decreased by 3.7 mmol / l)than with sitagliptin + / sulphonylurea (fpg decreased by 1.2 mmol / l ; p<0.001). self - monitored plasma glucose profiles suggested that 2-hour postprandial glucose levels were significantly lower with detemir plus sitagliptin.b.i.d.=twice daily ; dpp-4= dipeptidyl peptidase-4 ; fpg = fasting plasma glucose ; gi = gastrointestinal ; glp-1= glucagon - like peptide-1 ; hba1c= hemoglobin a1c ; oad= o.d.=once daily ; su = sulfonylureas ; t2dm - type 2 diabetes mellitus. studies comparing combination of insulin with incretin - based therapies studies comparing combination of insulin with incretin - based therapies b.i.d.=twice daily ; dpp-4= dipeptidyl peptidase-4 ; fpg = fasting plasma glucose ; gi = gastrointestinal ; glp-1= glucagon - like peptide-1 ; hba1c= hemoglobin a1c ; oad= o.d.=once daily ; su = sulfonylureas ; t2dm - type 2 diabetes mellitus. another argument supporting this concept is that incretin - based therapies (particularly glp-1ra) added to plus basal insulin could negate the weight gain associated with insulin that can arise through a number of potential mechanisms including the retention of previously excreted glucose and an inappropriately high exposure of adipocytes to insulin after systemically administered.42 this offers the prospect of improved glycemia without weight gain. finally, it is important to note that current practice is to maintain metformin in insulin - treated t2 dm, and this approach is compatible with additional incretin therapy. as well as directly inhibiting hepatic glucose and increasing tissue sensitivity to insulin,43 metformin also increases glp-1 levels.44 this increase follows metformin - mediated increased glp-1 production45 and dpp-4 inhibition.46,47 thus, metformin is likely to act additively or synergistically with both dpp-4 inhibitors and glp-1 derivatives. indeed, dpp-4 inhibitors have been found to be significantly more effective when combined with metformin than when introduced as monotherapy in previously drug - naive patients.48,49 hence, fixed - combination products are now available. in short, a regimen of incretin - based therapy plus basal insulin could mimic the pharmacological benefits of basal - bolus insulin therapy, but without the attendant calorie counting, and the associated risks of hypoglycemia and weight gain (table 4). table 4benefits of introducing incretin therapy before establishing patients on insulinpotentially delay or avert the need for insulinlow risk of hypoglycemia in comparison to insulin therapyweight gain associated with insulin initiation might be minimized by established incretin therapytolerance to nausea is established before insulin is introduced benefits of introducing incretin therapy before establishing patients on insulin recent clinical studies allude to the advantage of adding incretin - based therapies to basal insulin, especially in terms of offsetting the associated weight gain as well as the reduction or neutrality in incidence of hypoglycemia.5055 these effects are observed even when incretin - based therapies are added at a relatively later stage of disease. there have also been some studies assessing insulin added to incretin - based therapies.56,57 data from these studies, albeit limited, demonstrates that a glp-1ra can continue to make a major contribution to glucose lowering once insulin is introduced and supports yet another theoretically appealing treatment approach (table 4). on the other hand, there are pathophysiological and pharmacological arguments for introducing incretin therapies early in the disease process before insulin is needed. for example, the insulin - releasing effect of incretins is likely to decline with progressive beta - cell failure. a recent study in t2 dm patients showed that the proinsulin : c - peptide ratio of a beta - cell response to glp-1 is reduced following a period of near - normoglycemia with insulin treatment,58 implying that the insulinotropic effect of glp-1 is more efficient when beta - cells are less stressed. any ability to reverse or preserve beta - cell mass is also likely to decline with disease progression.16 as incretin and insulin therapy becomes more widely used, many more studies will be published. at present, however, with the exception of the arnolds. pilot study,55 we lack any trials that directly compare alternative incretin therapies in combination with insulin or alternative insulins combined with an incretin therapy. nevertheless, the evidence so far suggests that glp-1ra are more effective at mitigating insulin - associated weight gain and generally tend to provide somewhat greater reductions in hyperglycemia than dpp-4 inhibitors. both liraglutide59 and extended release exenatide60 have been shown to lower hba1c and reduce weight to a greater extent than sitagliptin when added to metformin. however, possible tolerability advantages for the dpp-4 inhibitors, such as their oral administration and a reduced likelihood of nausea and, perhaps, hypoglycemia,5 must be weighed against these efficacy advantages of the glp-1ra. such issues and the relative performances of incretin plus basal insulin regimens versus basal plus bolus insulin regimens at various stages in the t2 dm disease process require testing in future trials. it would also be interesting to study the effects of combination of dpp-4 inhibitors with glp-1ra, with and without insulin. dpp-4 plays a role in the metabolism of at least some of the glp-1ra, such as liraglutide;61 the two drug types could potentially be combined synergistically. it is also unclear how the efficacy of various incretin plus insulin regimens will change longitudinally in the course of the t2 dm disease process, and hence, whether and how we will need to adapt dosing. some data, mostly preclinical, had suggested that prolonged stimulation of glp-1 receptors might cause desensitization.62 the effects studied on islet cells, however, did not translate into clinical desensitization in vivo. recently, there has also been some human data published in line with glp-1 receptor desensitization and possible tachyphylaxis.63 nauck and colleagues63 administered native glp-1 continuously for 8.5 hours to healthy human subjects without t2 dm, and assessed the glucoregulatory responses to liquid test - meals given 5 hours apart with ongoing continuous glp-1 infusion. the ability of glp-1 to inhibit gastric emptying and glucagon levels was significantly reduced by the second test meal. however, c - peptide and insulin levels were preserved but slightly diminished with the second meal. levels of pancreatic polypeptide, a marker of vagal activation, were not as inhibited during the second test meal. hence, even short - term continuous glp-1 receptor stimulation may be association with some degree of rapid tachyphylaxis, mostly evident in effects mediated through the vagus nerve and gastric emptying.63 immunogenicity is another factor which may potentially affect the efficacy of intecrin - based therapies, affecting especially glp-1ra. most of the data around antibodies is based on the findings of the lead-6 and duration-1 trials.64,65 lead-6 was a 26-week trial comparing exenatide 10 g b.i.d. against liraglutide 1.8 mg o.d. with a 52 week extension period following switch over from exenatide to liraglutide therapy.64 duration-1 compared exenatide 10 g b.i.d. against once weekly exenatide long - acting release (lar) (2 mg) over 30 weeks.65 high titers were noted for antibodies against exenatide (61% at week 26), whereas low titers were observed for anti - liraglutide antibodies (2.6 % at week 79 of continued liraglutide therapy, 3% at week 79 in group switched from exenatide to liraglutide in week 26).64 after the switch from exenatide to liraglutide, the percentage of patients with anti - exenatide antibodies decreased to approximately 18% by the end of the 78 weeks.64 the presence of persistent anti - exenatide antibodies did not appear to compromise glycemic response. on the contrary, patients with the highest titers of anti - exenatide antibodies also had the greatest reduction in hba1c.64 in duration-1, anti - exenatide antibody levels were higher with exenatide taken once a week (p=00002 vs exenatide b.i.d.) ; however, most antibodies were either not detectable or of low (< 1/625) titre.65 despite the presence of higher antibody titers, a significantly greater reduction in hba1c (1.9%) was observed in the exenatide lar group in comparison to the exenatide b.i.d. group.65 therefore, based on the findings of head - to - head trials, antibody generation was more pronounced for exenatide lar and less with liraglutide. overall, liraglutide is less immunogenic than exenatide and antibody titers do not appear to affect glycemic efficacy or safety.64 another related question is whether there is a continuing role for incretin therapies when prandial insulin becomes necessary. an ongoing effect on alpha - cell function would imply that there could be a useful role for incretin therapies in late - stage t2 dm and even type 1 diabetes.66 the prospect of prolonged use of incretin therapies also requires us to study the long - term safety profiles of these agents and regimens. many useful new insights are likely to emerge from epidemiological and observational studies, as well as those expected from the randomized trials currently in progress. in addition, and most importantly, data in terms of hard cardiovascular endpoints with prolonged use of incretin - based therapy, have yet to accumulate. treatment guidelines currently position incretin - based therapies and insulin after conventional oad, but from what we know of t2 dm pathophysiology and the pharmacology of the incretin therapies, current practices may not produce optimal results. we believe that evidence so far supports the combined use of incretins and insulin early in the t2 dm disease process, albeit in selected patients. however, the biggest challenge would be selecting the right group of patients who would derive the maximum benefit from such a combination. in addition, the timing of implementing incretin - based therapy with insulin would be a major determinant of treatment efficacy. given that progressive beta - cell decline characterizes the natural history of t2 dm and given the dependence of incretin - based therapies on endogenous insulin production, it would be prudent to initiate therapy while there is still some beta - cell function remaining. furthermore, there is a lack of clinical data correlating efficacy of incretin - based therapy with declining beta - cell function. in addition, there is little robust data in terms of long - term safety and effect on hard cardiovascular endpoints with incretin - based therapy. similarly, there is insufficient clinical evidence to substantiate potential role of incretin - based therapy in increasing beta - cell mass and altering t2 dm progression. in our opinion, incretin plus basal insulin therapy has a logical rationale and may provide excellent efficacy and tolerability in the treatment of t2 dm for a very selective group of patients. it is, perhaps, better to start with an incretin - based agent and then add insulin rather than vice versa as this avoids the complexity of having to down - titrate insulin, and any nausea issues with glp-1ra are likely to have subsided with this sequence. while we advocate the introduction of incretin - based therapy prior to insulin, we also stress that patients suboptimally controlled on high - dose basal insulin can nevertheless benefit from the addition of an incretin. given the evidence from combination studies, a dpp-4 inhibitor at mealtime with basal / premixed insulin or a short acting glp-1 receptor agonists (b.i.d. or o.d.) with basal / premixed insulin might be preferred. once again, due to lack of evidence so far, selecting patients who would benefit from such a combination would be dependent on the clinician s expertise. finally, given the paucity of data, it would be difficult to predict the role of longer acting glp-1ra such as exenatide lar, in such combination therapy. in summary, data from initial studies looking at a combination of insulin and incretin - based therapy are promising. though several questions still remain to be answered, there is already evidence to advocate this tactic in patients who are not contraindicated and who have reached the point of requiring intensification from metformin other oad or metformin plus basal - only insulin. the cost of incretin - based therapy, however, remains a major limiting factor, especially in the united kingdom where healthcare is still primarily state funded. therefore, and in the absence of longterm safety data, it would be prudent to exercise caution with the use of an incretin - based therapy.	type 2 diabetes mellitus (t2 dm) is a progressive disease warranting intensification of treatment, as beta - cell function declines over time. current treatment algorithms recommend metformin as the first - line agent, while advocating the addition of either basal - bolus or premixed insulin as the final level of intervention. incretin therapy, including incretin mimetics or enhancers, are the latest group of drugs available for treatment of t2 dm. these agents act through the incretin axis, are currently recommended as add - on agents either as second - or third - line treatment, without concurrent use of insulin. given the novel role of incretin therapy in terms of reducing postprandial hyperglycemia, and favorable effects on weight with reduced incidence of hypoglycemia, we explore alternative options for incretin therapy in t2 dm management. furthermore, as some evidence alludes to incretins potentially increasing betacell mass and altering disease progression, we propose introducing these agents earlier in the treatment algorithm. in addition, we suggest the concurrent use of incretins with insulin, given the favorable effects especially in relation to weight gain.
literature was searched in the medline database, using the following criteria : human epididymis protein 4 (he4), ovarian carcinoma, ca125 ; and screening or diagnosis or prognosis or monitoring ; and ovarian carcinoma or he4 or human epididymis protein 4, or ca125. filters are publication dates from january 1, 2008, to december 31, 2013. all of the titles were generated by the search, and the abstracts were reviewed for relevance, after which the full articles were obtained for those selected. the articles were evaluated by level of evidence (loe) and strength of recommendation (sor) according to the classifications provided in tables 1 and 2, respectively.10,11 earlier guideline articles and their references were also searched.4,8 the results of the literature search were structured according to the types of marker utility as presented in table 3. level of evidence used to grade the presented egtm guidelines10 strength of recommendation used to grade the presented egtm guidelines11 utility of cancer biomarkers as defined in the presented egtm guidelines the prostate, lung, colorectal, and ovarian cancer trial in the united states was a randomized controlled trial in which 78,216 women aged 55 to 74 years were included between 1993 and 2001. there was no evidence of a shift to early - stage disease associated with screening using ca125 and transvaginal ultrasound. furthermore, ovarian cancer mortality was equivalent in both groups.12 an earlier multicenter randomized controlled trial was conducted in japan between 1985 and 1999, in which postmenopausal women were assigned to either a screening group (n = 41,688) or a control group (n = 40,799). the study showed a decrease in stage at detection ; however, analysis of mortality in the screening and control group has not yet been reported.13 in a single - arm prospective study, the university of kentucky ovarian cancer screening trial conducted from 1987 to 2011, 37,293 women were screened annually with ultrasound and ca125.14 eligibility criteria included all asymptomatic women aged 50 years or older and women aged 25 years or older with a documented family history of ovarian cancer. although there was no randomization against a control group, a historic control group was available, consisting of 380 patients diagnosed with ovarian cancer during the study period. the trial suggested a decrease in stage at detection as well as a survival benefit.14 another single - arm, prospective multicenter study, also from the united states, investigated the utility of a 2-stage ovarian cancer screening strategy using a risk of ovarian cancer algorithm among 4051 postmenopausal women. the study showed a specificity and positive predictive value of 99.9% and 40%, respectively.15 the united kingdom collaborative trial of ovarian cancer screening is ongoing.16 from 2001 to 2005, 202,638 postmenopausal women, aged 50 to 74 years were randomly assigned to annual transvaginal ultrasound alone (n = 50,639) or annual ca125 with transvaginal ultrasound performed at rising ca125 concentrations (n = 50,640) or no investigative procedures (n = 101,359). the trial is expected to conclude in 2015, and the effect of diagnosis at early stage of disease on ovarian cancer mortality awaits analysis of these data.16 at present, the conclusion from these major trials is that owing to limitations of ca125 sensitivity and specificity, its use among asymptomatic women outside the context of a clinical trial can not be recommended for general population screening (table 4).4 however, ca125, in combination with transvaginal ultrasound, may have a role in early detection of ovarian cancer in women with hereditary alterations in the brca1 and brca2 tumor suppressor genes, where the lifetime risk of developing ovarian cancer is approximately 40% for brca1 carriers and 18% for brca2 carriers.22 however, there is as yet no evidence that ovarian cancer screening results in a stage shift to earlier stage disease, or that it reduces morbidity or mortality from ovarian cancer. the best prevention in these women is bilateral salpingooophorectomy.2325 recommendations published by different groups for use of ca125 in ovarian cancer european group on tumor markers statement screening for ovarian cancer based on ca125 is not recommended among asymptomatic women due to lack of sensitivity both for stage i disease and for mucinous epithelial ovarian tumors. postmenopausal women with ca125 concentrations greater than 35 ku / l should be considered for transvaginal ultrasound examination as well as a computed tomography scan. ku / l has been reported to discriminate malignant from nonmalignant pelvic masses with a positive predictive value of 95%.8 for premenopausal women, the american college of obstetrics and gynecologists suggested that patients with a pelvic mass and ca125 concentrations greater than 200 ku / l should be referred to a gynecologist for consultation.26 algorithms to calculate the risk of malignancy index (rmi) have been developed by jacobs and by tingulstad as rmi 1 and rmi 2, respectively. both rmi scoring systems are the product of ultrasound score menopausal score ca125 concentration in ku / l (table 5). the difference between the rmi 1 and the rmi 2 scores is the number of ultrasound findings considered. three studies have compared the 2 rmi systems using score values above 200 to indicate malignancy. the validity of the rmi 1 and the rmi 2 scores was similar.2830 another algorithm was developed and validated in co - operation with a number of european centers specialized in ultrasound of the pelvis (international ovarian tumor analysis group). the algorithm challenged the suggestion that the ca125 concentration added to ultrasound in distinguishing nonmalignant from malignant ovarian masses.31 in the hands of these expert centers, the ultrasound criteria only performed better than the rmi 1.32 the same group has, however, reintroduced ca125 in the latest version of their algorithm, assessment of different neoplasias in the adnexa.33 the national institute for health and care excellence has introduced guidelines for early detection of ovarian cancer in symptomatic women for use by general practitioners.34 the potential advantages and disadvantages of the guidelines have been discussed with focus on the use of ca125 among premenopausal women where its increasing use may lead to waste of health care resources.35 the recommendations from different scientific societies are provided in table 4. the risk of malignancy index european group on tumor markers statement the rmi calculated either as rmi 1 or as rmi 2 is recommended for differential diagnosis of non - malignant and malignant pelvic masses in postmenopausal women. however, it has been suggested that in patients who had a preoperative ca125 concentration greater than 65 ku / l, the 5-year survival rates in univariate and multivariate analyses were found to be significantly lower as compared to patients who had values less than 65 ku / l. for the studies including early - stage disease (ia, b, c), the initial ca125 values would be more closely related to histology (serous vs nonserous) rather than prognosis within the serous population.36,37 studies by prat and xu,39 based on multivariate analysis suggested that the nadir concentrations after primary treatment and follow - up may provide prognostic information in terms of overall survival (os). however, this information needs confirmation because it is not unusual to observe transient elevations in ca125 after chemotherapy, likely reflecting tumor necrosis and release of circulating ca125. finally, there has been no consistent effort to differentiate between patients who have primary optimal cytoreduction (which can reduce ca125 before chemotherapy) and patients selected for neoadjuvant chemotherapy with interval cytoreduction, who must rely only on chemotherapy. as such, knowledge of single - point ca125 measurements would not change ongoing primary therapy and provides only limited prognostic information. the inconsistent results from different studies may also be attributed to the unspecific use of ca125 for all epithelial ovarian cancer types. markman reported that a decrease in ca125 concentrations of 50% or greater during the initial 2 cycles of platinum - based chemotherapy was a powerful independent prognostic indicator for os. riedinger reported that one third of ca125 decrease patterns observed among 130 stages iic to iv patients receiving paclitaxel or platinum - based chemotherapy were biexponential with a half - life greater than 14 days, indicating persistent ca125 production and a poor response to chemotherapy and impaired survival. van altena found that patients who achieved complete clinical remission after standard primary treatment and also reached a ca125 nadir concentration less than 5 ku / l had a significantly longer progression - free survival and os than patients with nadir values between 6 and 35 ku / l. overall, all investigators reported that a prolonged half - life was indicative of persistent ca125 production and was predictive of a poor response to chemotherapy.41 the recommendations by different scientific societies are provided in table 4. european group on tumor markers statement a change in sequential measurements during primary treatment is recommended as prognostic indicator for response to treatment. the utilization of ca125 to monitor tumor response was initially developed for evaluation of new treatments in the setting of recurrent disease. however, the mentioned criteria may also be considered during primary therapy because ca125 is used in routine clinical practice. rustin have proposed a set of definitions for ca125 decrements as at least a 50% reduction or a 75% reduction of an elevated pretreatment concentration. patients can be evaluated with ca125 if the pretreatment concentration is at least twice the upper limit of normal.44 the gynecological cancer intergroup reached a consensus in 2011 where the criteria to evaluate decrements proposed by rustin were simplified and included in the response evaluation criteria in solid tumors for use in first - line trials in ovarian cancer. a ca125 response was defined as at least a 50% reduction in ca125 levels from a pretreatment sample. the response must be confirmed and maintained for at least 28 days.46 another definition was suggested by tuxen who based interpretation of decreasing concentrations, on a statistical estimation adjusted to both analytical and biological variation of the marker. a similar methodology has been proposed to interpret biomarker changes during monitoring of patients with breast and prostate cancer.48,49 the criteria introduced by rustin,51 depend on the ca125 concentrations. for patients with elevated pretreatment concentrations that normalize on first - line chemotherapy, the criterion require increasing concentrations to twice the upper limit of normal (> 70 ku / l). for patients with elevated pretreatment concentrations that never normalizes, the criterion was a doubling of the nadir value.51 tuxen,52 also suggested 2 criteria depending on whether the increment started below or above the cutoff. for an increment starting below the cutoff, the criterion was a significant increase to above the cutoff. for an increment starting above cutoff, rustin enrolled 1442 women in complete remission after first - line platinum - based chemotherapy and a normal ca125 concentration. they compared the outcome after the initiation of treatment of relapsed ovarian cancer based on rising ca125 levels from below cutoff (35 ku / l) to twice the upper limit of normal (> 70 the patients were registered from 59 centers across europe, russia, and south africa. in the ca125 guided treatment arm, second - line chemotherapy was started at a median of 4.8 months earlier and third - line chemotherapy with a median of 4.6 months earlier as compared with the treatment arm where therapy was delayed until clinically indicated. surprisingly, in this study, early treatment on the basis of an early rise in ca125 did not improve survival or quality of life.44,54 this may reflect the ineffective therapies at the time of the study and illustrates the difficulties in conducting clinical trials over a decade.54 results may be invalidated because not all patients received more recent and effective treatments, potentially underestimating the benefit of earlier detection of recurrence.55,56 in addition, in this trial, ca125 measurements were made in local laboratories rather than centrally, and no information is available about the analytical quality of the measurements and no indication of whether contributing laboratories participated in external quality assessment schemes or compared their results with those of other laboratories. however, all laboratories participated in local quality assurance schemes. according to the requirements of the protocol, all samples from an individual patient were measured in the same laboratory, which is crucial for a trial looking at serial change in marker levels.55 the european group on tumor markers (egtm) has recognized the challenges associated with planning, conducting, and reporting clinical tumor marker surveillance programs and now offers advice on how to design and conduct these types of studies.57 the european society of gynecologic oncologists has recently advised against universally abandoning ca125 in the routine follow - up of all patients with ovarian cancer. accordingly, ca125 monitoring should be considered in patients who (i) after complete response on primary treatment have been or are being treated as part of a clinical trial, (ii) would be eligible for (future) clinical trials on second - line treatment, (iii) will not have routine (3 monthly) follow - up including regular imaging, and (iv) are eligible for secondary surgery at recurrence.44 the current position of the egtm is that ca125 is recommended for monitoring of patients if surveillance is likely to have clinical consequences (table 4). ca125 is recommended for monitoring of primary therapy and post - therapy surveillance. a ca125 decrement is defined as at least a 50% reduction in ca125 levels from a pre - treatment sample. the decrement must be confirmed and maintained for at least 28 days. a ca125 decrement may also be defined by a 50% decrease over four measurements or a 75% decrease over three measurements. a ca125 increment among patients with elevated pretreatment concentrations that never normalizes is defined by a doubling of the nadir value. a ca125 increment among patients with elevated pretreatment concentrations that normalize is defined by increasing concentrations from below the normal cut - off (35 ku / l) to twice the upper limit of normal (> 70 ku / l). alternatively, a ca125 decrement and increment may be based on a statistical estimation of the change adjusted to both analytical and biological variation of ca125. reasons for this wide range may be due to the relationship between increasing he4 serum levels and increasing age.58,59 women older than 49 years have higher concentrations as compared with women younger than 40 years.58 there is a correlation between the histological type and the serum concentration of he4 with higher concentrations in serous ovarian cancer and with concentrations lowest in patients with mucinous ovarian carcinomas.58,60 the he4 in serum has also been identified in pulmonary, endometrial, and breast carcinomas and mesotheliomas, but less frequently in gastrointestinal, renal, and transitional cell carcinomas.58,61 the most important source of false - positive results in serum is renal failure where concentration of he4 may be greater than 2000 pmol / l.62 wu reported a meta - analysis based on 9 studies evaluating the performance of he4 among patients with pelvic masses. the pooled sensitivity and specificity of he4 to diagnose ovarian cancer was 83% (95% confidence interval [95% ci ], 77%88%) and 90% (95% ci, 87%92%), respectively, when the control group consisted of healthy women. when the control group was composed of women with nonmalignant diseases, the pooled sensitivity and specificity for he4 was 74% (95% ci, 69%78%) and 90% (95% ci, 87%92%), respectively. li reported a review including 2878 patients from 11 studies where he4 was not superior to ca125 for differential diagnosis. yu,65 in a meta - analysis including 2607 patients from 12 publications, found that he4 was better than ca125 for the diagnosis of ovarian cancer in terms of sensitivity and specificity. hallamaa observed no significant variation in serum he4 concentrations during the menstrual cycle or during hormonal treatment, suggesting that serum he4 may be measured at any phase of the menstrual cycle and during hormonal treatment with contraceptives. overall, despite several publications comparing the diagnostic performance of he4 and ca125 in distinguishing malignant from non - malignant diseases a clear consensus has yet to be reached.67 steffensen found that an elevated he4 concentration is a strong and independent indicator of worse prognosis in epithelial ovarian cancer patients as compared with ca125. elevated serum he4 levels before therapy significantly correlated with high tumor grade, serous histology, peritoneal involvement, nodal invasion, tumor stage, operative time, and residual tumor size.69 in 2009 moore presented the risk of ovarian malignancy algorithm (roma), combining he4 and ca125 in an attempt to predict the risk of serous epithelial ovarian cancer in women with a pelvic mass. they compared the diagnostic performance of the roma with the performance of the rmi as reported by jacobs and by bailey. the diagnostic performance of the roma was similar to the performance of the rmi as reported by jacobs but was superior to the performance of the rmi as reported by bailey molina reported on the sensitivity and specificity of roma among 285 patients with nonmalignant gynecological diseases (226 premenopausal and 59 postmenopausal) and 111 patients with ovarian cancer (27 premenopausal and 84 postmenopausal). among premenopausal women, the sensitivity and specificity of roma was 74.1% and 88.9%, respectively. among postmenopausal women, the sensitivity and specificity was 95.2% and 83.1%, respectively. van gorp investigated 389 women with a pelvic mass in a prospective study, where 228 women had nonmalignant disease and 161 women had malignant disease. they reported that neither he4 nor the roma performed better than ca125 in the differentiation of ovarian cancer from other pelvic masses. montagnana found preoperative roma calculations advantageous when compared to ca125, but found no advantage when compared to he4. karlsen found that the roma and the rmi approach performed similarly in differentiating between nonmalignant and malignant pelvic masses. further well - designed prospective studies are needed to clarify whether he4 measurements and the roma calculation should be implemented into routine clinical practice. he4 measurements, either alone or in combinations with ca125, as in roma, may be considered for differential diagnosis of pelvic masses especially in premenopausal patients. ca125 is not recommended as a routine screening test in asymptomatic women due to a low sensitivity for stage i disease as well as a low specificity especially among premenopausal women. the rmi 1 and rmi 2 algorithms, particularly in postmenopausal women, are recommended as a way to estimate the probability of malignant potential of a pelvic mass. the roma and the adnex algorithms, particularly in premenopausal women, may be considered for estimating the probability of malignant potential of a pelvic mass. an important application of ca125 is in the monitoring of patients if early recognition of a changing tumor burden has clinical implications. reports have indicated an increased specificity of he4 as a single marker as compared to ca125., ca125 remains the best available marker for routine use among patients with serous epithelial ovarian cancer. the prostate, lung, colorectal, and ovarian cancer trial in the united states was a randomized controlled trial in which 78,216 women aged 55 to 74 years were included between 1993 and 2001. there was no evidence of a shift to early - stage disease associated with screening using ca125 and transvaginal ultrasound. furthermore, ovarian cancer mortality was equivalent in both groups.12 an earlier multicenter randomized controlled trial was conducted in japan between 1985 and 1999, in which postmenopausal women were assigned to either a screening group (n = 41,688) or a control group (n = 40,799). the study showed a decrease in stage at detection ; however, analysis of mortality in the screening and control group has not yet been reported.13 in a single - arm prospective study, the university of kentucky ovarian cancer screening trial conducted from 1987 to 2011, 37,293 women were screened annually with ultrasound and ca125.14 eligibility criteria included all asymptomatic women aged 50 years or older and women aged 25 years or older with a documented family history of ovarian cancer. although there was no randomization against a control group, a historic control group was available, consisting of 380 patients diagnosed with ovarian cancer during the study period. the trial suggested a decrease in stage at detection as well as a survival benefit.14 another single - arm, prospective multicenter study, also from the united states, investigated the utility of a 2-stage ovarian cancer screening strategy using a risk of ovarian cancer algorithm among 4051 postmenopausal women. the study showed a specificity and positive predictive value of 99.9% and 40%, respectively.15 the united kingdom collaborative trial of ovarian cancer screening is ongoing.16 from 2001 to 2005, 202,638 postmenopausal women, aged 50 to 74 years were randomly assigned to annual transvaginal ultrasound alone (n = 50,639) or annual ca125 with transvaginal ultrasound performed at rising ca125 concentrations (n = 50,640) or no investigative procedures (n = 101,359). the trial is expected to conclude in 2015, and the effect of diagnosis at early stage of disease on ovarian cancer mortality awaits analysis of these data.16 at present, the conclusion from these major trials is that owing to limitations of ca125 sensitivity and specificity, its use among asymptomatic women outside the context of a clinical trial can not be recommended for general population screening (table 4).4 however, ca125, in combination with transvaginal ultrasound, may have a role in early detection of ovarian cancer in women with hereditary alterations in the brca1 and brca2 tumor suppressor genes, where the lifetime risk of developing ovarian cancer is approximately 40% for brca1 carriers and 18% for brca2 carriers.22 however, there is as yet no evidence that ovarian cancer screening results in a stage shift to earlier stage disease, or that it reduces morbidity or mortality from ovarian cancer. the best prevention in these women is bilateral salpingooophorectomy.2325 recommendations published by different groups for use of ca125 in ovarian cancer european group on tumor markers statement screening for ovarian cancer based on ca125 is not recommended among asymptomatic women due to lack of sensitivity both for stage i disease and for mucinous epithelial ovarian tumors. postmenopausal women with ca125 concentrations greater than 35 ku / l should be considered for transvaginal ultrasound examination as well as a computed tomography scan. ku / l has been reported to discriminate malignant from nonmalignant pelvic masses with a positive predictive value of 95%.8 for premenopausal women, the american college of obstetrics and gynecologists suggested that patients with a pelvic mass and ca125 concentrations greater than 200 ku / l should be referred to a gynecologist for consultation.26 algorithms to calculate the risk of malignancy index (rmi) have been developed by jacobs and by tingulstad as rmi 1 and rmi 2, respectively. both rmi scoring systems are the product of ultrasound score menopausal score ca125 concentration in ku / l (table 5). the difference between the rmi 1 and the rmi 2 scores is the number of ultrasound findings considered. three studies have compared the 2 rmi systems using score values above 200 to indicate malignancy. the validity of the rmi 1 and the rmi 2 scores was similar.2830 another algorithm was developed and validated in co - operation with a number of european centers specialized in ultrasound of the pelvis (international ovarian tumor analysis group). the algorithm challenged the suggestion that the ca125 concentration added to ultrasound in distinguishing nonmalignant from malignant ovarian masses.31 in the hands of these expert centers, the ultrasound criteria only performed better than the rmi 1.32 the same group has, however, reintroduced ca125 in the latest version of their algorithm, assessment of different neoplasias in the adnexa.33 the national institute for health and care excellence has introduced guidelines for early detection of ovarian cancer in symptomatic women for use by general practitioners.34 the potential advantages and disadvantages of the guidelines have been discussed with focus on the use of ca125 among premenopausal women where its increasing use may lead to waste of health care resources.35 the recommendations from different scientific societies are provided in table 4. the risk of malignancy index european group on tumor markers statement the rmi calculated either as rmi 1 or as rmi 2 is recommended for differential diagnosis of non - malignant and malignant pelvic masses in postmenopausal women. however, it has been suggested that in patients who had a preoperative ca125 concentration greater than 65 ku / l, the 5-year survival rates in univariate and multivariate analyses were found to be significantly lower as compared to patients who had values less than 65 ku / l. for the studies including early - stage disease (ia, b, c), the initial ca125 values would be more closely related to histology (serous vs nonserous) rather than prognosis within the serous population.36,37 studies by prat and xu,39 based on multivariate analysis suggested that the nadir concentrations after primary treatment and follow - up may provide prognostic information in terms of overall survival (os). however, this information needs confirmation because it is not unusual to observe transient elevations in ca125 after chemotherapy, likely reflecting tumor necrosis and release of circulating ca125. finally, there has been no consistent effort to differentiate between patients who have primary optimal cytoreduction (which can reduce ca125 before chemotherapy) and patients selected for neoadjuvant chemotherapy with interval cytoreduction, who must rely only on chemotherapy. as such, knowledge of single - point ca125 measurements would not change ongoing primary therapy and provides only limited prognostic information. the inconsistent results from different studies may also be attributed to the unspecific use of ca125 for all epithelial ovarian cancer types. markman reported that a decrease in ca125 concentrations of 50% or greater during the initial 2 cycles of platinum - based chemotherapy was a powerful independent prognostic indicator for os. riedinger reported that one third of ca125 decrease patterns observed among 130 stages iic to iv patients receiving paclitaxel or platinum - based chemotherapy were biexponential with a half - life greater than 14 days, indicating persistent ca125 production and a poor response to chemotherapy and impaired survival. van altena found that patients who achieved complete clinical remission after standard primary treatment and also reached a ca125 nadir concentration less than 5 ku / l had a significantly longer progression - free survival and os than patients with nadir values between 6 and 35 ku / l. overall, all investigators reported that a prolonged half - life was indicative of persistent ca125 production and was predictive of a poor response to chemotherapy.41 the recommendations by different scientific societies are provided in table 4. european group on tumor markers statement a change in sequential measurements during primary treatment is recommended as prognostic indicator for response to treatment. however, it has been suggested that in patients who had a preoperative ca125 concentration greater than 65 ku / l, the 5-year survival rates in univariate and multivariate analyses were found to be significantly lower as compared to patients who had values less than 65 ku / l. for the studies including early - stage disease (ia, b, c), the initial ca125 values would be more closely related to histology (serous vs nonserous) rather than prognosis within the serous population.36,37 studies by prat and xu,39 based on multivariate analysis suggested that the nadir concentrations after primary treatment and follow - up may provide prognostic information in terms of overall survival (os). however, this information needs confirmation because it is not unusual to observe transient elevations in ca125 after chemotherapy, likely reflecting tumor necrosis and release of circulating ca125. finally, there has been no consistent effort to differentiate between patients who have primary optimal cytoreduction (which can reduce ca125 before chemotherapy) and patients selected for neoadjuvant chemotherapy with interval cytoreduction, who must rely only on chemotherapy. as such, knowledge of single - point ca125 measurements would not change ongoing primary therapy and provides only limited prognostic information. the inconsistent results from different studies may also be attributed to the unspecific use of ca125 for all epithelial ovarian cancer types. markman reported that a decrease in ca125 concentrations of 50% or greater during the initial 2 cycles of platinum - based chemotherapy was a powerful independent prognostic indicator for os. riedinger reported that one third of ca125 decrease patterns observed among 130 stages iic to iv patients receiving paclitaxel or platinum - based chemotherapy were biexponential with a half - life greater than 14 days, indicating persistent ca125 production and a poor response to chemotherapy and impaired survival. van altena found that patients who achieved complete clinical remission after standard primary treatment and also reached a ca125 nadir concentration less than 5 ku / l had a significantly longer progression - free survival and os than patients with nadir values between 6 and 35 ku / l. overall, all investigators reported that a prolonged half - life was indicative of persistent ca125 production and was predictive of a poor response to chemotherapy.41 the recommendations by different scientific societies are provided in table 4. european group on tumor markers statement a change in sequential measurements during primary treatment is recommended as prognostic indicator for response to treatment. the utilization of ca125 to monitor tumor response was initially developed for evaluation of new treatments in the setting of recurrent disease. however, the mentioned criteria may also be considered during primary therapy because ca125 is used in routine clinical practice. rustin have proposed a set of definitions for ca125 decrements as at least a 50% reduction or a 75% reduction of an elevated pretreatment concentration. patients can be evaluated with ca125 if the pretreatment concentration is at least twice the upper limit of normal.44 the gynecological cancer intergroup reached a consensus in 2011 where the criteria to evaluate decrements proposed by rustin were simplified and included in the response evaluation criteria in solid tumors for use in first - line trials in ovarian cancer. a ca125 response was defined as at least a 50% reduction in ca125 levels from a pretreatment sample. the response must be confirmed and maintained for at least 28 days.46 another definition was suggested by tuxen who based interpretation of decreasing concentrations, on a statistical estimation adjusted to both analytical and biological variation of the marker. a similar methodology has been proposed to interpret biomarker changes during monitoring of patients with breast and prostate cancer.48,49 the criteria introduced by rustin,51 depend on the ca125 concentrations. for patients with elevated pretreatment concentrations that normalize on first - line chemotherapy, the criterion was a doubling of the nadir value.51 tuxen,52 also suggested 2 criteria depending on whether the increment started below or above the cutoff. for an increment starting below the cutoff, the criterion was a significant increase to above the cutoff. for an increment starting above cutoff, rustin enrolled 1442 women in complete remission after first - line platinum - based chemotherapy and a normal ca125 concentration. they compared the outcome after the initiation of treatment of relapsed ovarian cancer based on rising ca125 levels from below cutoff (35 the patients were registered from 59 centers across europe, russia, and south africa. in the ca125 guided treatment arm, second - line chemotherapy was started at a median of 4.8 months earlier and third - line chemotherapy with a median of 4.6 months earlier as compared with the treatment arm where therapy was delayed until clinically indicated. surprisingly, in this study, early treatment on the basis of an early rise in ca125 did not improve survival or quality of life.44,54 this may reflect the ineffective therapies at the time of the study and illustrates the difficulties in conducting clinical trials over a decade.54 results may be invalidated because not all patients received more recent and effective treatments, potentially underestimating the benefit of earlier detection of recurrence.55,56 in addition, in this trial, ca125 measurements were made in local laboratories rather than centrally, and no information is available about the analytical quality of the measurements and no indication of whether contributing laboratories participated in external quality assessment schemes or compared their results with those of other laboratories. however, all laboratories participated in local quality assurance schemes. according to the requirements of the protocol, all samples from an individual patient were measured in the same laboratory, which is crucial for a trial looking at serial change in marker levels.55 the european group on tumor markers (egtm) has recognized the challenges associated with planning, conducting, and reporting clinical tumor marker surveillance programs and now offers advice on how to design and conduct these types of studies.57 the european society of gynecologic oncologists has recently advised against universally abandoning ca125 in the routine follow - up of all patients with ovarian cancer. accordingly, ca125 monitoring should be considered in patients who (i) after complete response on primary treatment have been or are being treated as part of a clinical trial, (ii) would be eligible for (future) clinical trials on second - line treatment, (iii) will not have routine (3 monthly) follow - up including regular imaging, and (iv) are eligible for secondary surgery at recurrence.44 the current position of the egtm is that ca125 is recommended for monitoring of patients if surveillance is likely to have clinical consequences (table 4). ca125 is recommended for monitoring of primary therapy and post - therapy surveillance. a ca125 decrement is defined as at least a 50% reduction in ca125 levels from a pre - treatment sample. the decrement must be confirmed and maintained for at least 28 days. a ca125 decrement may also be defined by a 50% decrease over four measurements or a 75% decrease over three measurements. a ca125 increment among patients with elevated pretreatment concentrations that never normalizes is defined by a doubling of the nadir value. a ca125 increment among patients with elevated pretreatment concentrations that normalize is defined by increasing concentrations from below the normal cut - off (35 ku / l) to twice the upper limit of normal (> 70 ku / l). alternatively, a ca125 decrement and increment may be based on a statistical estimation of the change adjusted to both analytical and biological variation of ca125. rustin have proposed a set of definitions for ca125 decrements as at least a 50% reduction or a 75% reduction of an elevated pretreatment concentration. patients can be evaluated with ca125 if the pretreatment concentration is at least twice the upper limit of normal.44 the gynecological cancer intergroup reached a consensus in 2011 where the criteria to evaluate decrements proposed by rustin were simplified and included in the response evaluation criteria in solid tumors for use in first - line trials in ovarian cancer. a ca125 response was defined as at least a 50% reduction in ca125 levels from a pretreatment sample. the response must be confirmed and maintained for at least 28 days.46 another definition was suggested by tuxen who based interpretation of decreasing concentrations, on a statistical estimation adjusted to both analytical and biological variation of the marker. a similar methodology has been proposed to interpret biomarker changes during monitoring of patients with breast and prostate cancer.48,49 the criteria introduced by rustin,51 depend on the ca125 concentrations. for patients with elevated pretreatment concentrations that normalize on first - line chemotherapy, the criterion require increasing concentrations to twice the upper limit of normal (> 70 ku / l). for patients with elevated pretreatment concentrations that never normalizes, the criterion was a doubling of the nadir value.51 tuxen,52 also suggested 2 criteria depending on whether the increment started below or above the cutoff. for an increment starting below the cutoff, the criterion was a significant increase to above the cutoff. for an increment starting above cutoff, rustin enrolled 1442 women in complete remission after first - line platinum - based chemotherapy and a normal ca125 concentration. they compared the outcome after the initiation of treatment of relapsed ovarian cancer based on rising ca125 levels from below cutoff (35 the patients were registered from 59 centers across europe, russia, and south africa. in the ca125 guided treatment arm, second - line chemotherapy was started at a median of 4.8 months earlier and third - line chemotherapy with a median of 4.6 months earlier as compared with the treatment arm where therapy was delayed until clinically indicated. surprisingly, in this study, early treatment on the basis of an early rise in ca125 did not improve survival or quality of life.44,54 this may reflect the ineffective therapies at the time of the study and illustrates the difficulties in conducting clinical trials over a decade.54 results may be invalidated because not all patients received more recent and effective treatments, potentially underestimating the benefit of earlier detection of recurrence.55,56 in addition, in this trial, ca125 measurements were made in local laboratories rather than centrally, and no information is available about the analytical quality of the measurements and no indication of whether contributing laboratories participated in external quality assessment schemes or compared their results with those of other laboratories. however, all laboratories participated in local quality assurance schemes. according to the requirements of the protocol, all samples from an individual patient were measured in the same laboratory, which is crucial for a trial looking at serial change in marker levels.55 the european group on tumor markers (egtm) has recognized the challenges associated with planning, conducting, and reporting clinical tumor marker surveillance programs and now offers advice on how to design and conduct these types of studies.57 the european society of gynecologic oncologists has recently advised against universally abandoning ca125 in the routine follow - up of all patients with ovarian cancer. accordingly, ca125 monitoring should be considered in patients who (i) after complete response on primary treatment have been or are being treated as part of a clinical trial, (ii) would be eligible for (future) clinical trials on second - line treatment, (iii) will not have routine (3 monthly) follow - up including regular imaging, and (iv) are eligible for secondary surgery at recurrence.44 the current position of the egtm is that ca125 is recommended for monitoring of patients if surveillance is likely to have clinical consequences (table 4). a ca125 decrement is defined as at least a 50% reduction in ca125 levels from a pre - treatment sample. the decrement must be confirmed and maintained for at least 28 days. a ca125 decrement may also be defined by a 50% decrease over four measurements or a 75% decrease over three measurements. a ca125 increment among patients with elevated pretreatment concentrations that never normalizes is defined by a doubling of the nadir value. a ca125 increment among patients with elevated pretreatment concentrations that normalize is defined by increasing concentrations from below the normal cut - off (35 ku / l) to twice the upper limit of normal (> 70 ku / l). alternatively, a ca125 decrement and increment may be based on a statistical estimation of the change adjusted to both analytical and biological variation of ca125. reasons for this wide range may be due to the relationship between increasing he4 serum levels and increasing age.58,59 women older than 49 years have higher concentrations as compared with women younger than 40 years.58 there is a correlation between the histological type and the serum concentration of he4 with higher concentrations in serous ovarian cancer and with concentrations lowest in patients with mucinous ovarian carcinomas.58,60 the he4 in serum has also been identified in pulmonary, endometrial, and breast carcinomas and mesotheliomas, but less frequently in gastrointestinal, renal, and transitional cell carcinomas.58,61 the most important source of false - positive results in serum is renal failure where concentration of he4 may be greater than 2000 pmol / l.62 wu reported a meta - analysis based on 9 studies evaluating the performance of he4 among patients with pelvic masses. the pooled sensitivity and specificity of he4 to diagnose ovarian cancer was 83% (95% confidence interval [95% ci ], 77%88%) and 90% (95% ci, 87%92%), respectively, when the control group consisted of healthy women. when the control group was composed of women with nonmalignant diseases, the pooled sensitivity and specificity for he4 was 74% (95% ci, 69%78%) and 90% (95% ci, 87%92%), respectively. li reported a review including 2878 patients from 11 studies where he4 was not superior to ca125 for differential diagnosis. yu,65 in a meta - analysis including 2607 patients from 12 publications, found that he4 was better than ca125 for the diagnosis of ovarian cancer in terms of sensitivity and specificity. hallamaa observed no significant variation in serum he4 concentrations during the menstrual cycle or during hormonal treatment, suggesting that serum he4 may be measured at any phase of the menstrual cycle and during hormonal treatment with contraceptives. overall, despite several publications comparing the diagnostic performance of he4 and ca125 in distinguishing malignant from non - malignant diseases a clear consensus has yet to be reached.67 steffensen found that an elevated he4 concentration is a strong and independent indicator of worse prognosis in epithelial ovarian cancer patients as compared with ca125. elevated serum he4 levels before therapy significantly correlated with high tumor grade, serous histology, peritoneal involvement, nodal invasion, tumor stage, operative time, and residual tumor size.69 in 2009 moore presented the risk of ovarian malignancy algorithm (roma), combining he4 and ca125 in an attempt to predict the risk of serous epithelial ovarian cancer in women with a pelvic mass. they compared the diagnostic performance of the roma with the performance of the rmi as reported by jacobs and by bailey. the diagnostic performance of the roma was similar to the performance of the rmi as reported by jacobs but was superior to the performance of the rmi as reported by bailey molina reported on the sensitivity and specificity of roma among 285 patients with nonmalignant gynecological diseases (226 premenopausal and 59 postmenopausal) and 111 patients with ovarian cancer (27 premenopausal and 84 postmenopausal). among premenopausal women, the sensitivity and specificity of roma was 74.1% and 88.9%, respectively. among postmenopausal women, the sensitivity and specificity was 95.2% and 83.1%, respectively. van gorp investigated 389 women with a pelvic mass in a prospective study, where 228 women had nonmalignant disease and 161 women had malignant disease. they reported that neither he4 nor the roma performed better than ca125 in the differentiation of ovarian cancer from other pelvic masses. montagnana found preoperative roma calculations advantageous when compared to ca125, but found no advantage when compared to he4. karlsen found that the roma and the rmi approach performed similarly in differentiating between nonmalignant and malignant pelvic masses. further well - designed prospective studies are needed to clarify whether he4 measurements and the roma calculation should be implemented into routine clinical practice. he4 measurements, either alone or in combinations with ca125, as in roma, may be considered for differential diagnosis of pelvic masses especially in premenopausal patients. ca125 is not recommended as a routine screening test in asymptomatic women due to a low sensitivity for stage i disease as well as a low specificity especially among premenopausal women. the rmi 1 and rmi 2 algorithms, particularly in postmenopausal women, are recommended as a way to estimate the probability of malignant potential of a pelvic mass. the roma and the adnex algorithms, particularly in premenopausal women, may be considered for estimating the probability of malignant potential of a pelvic mass. an important application of ca125 is in the monitoring of patients if early recognition of a changing tumor burden has clinical implications. reports have indicated an increased specificity of he4 as a single marker as compared to ca125., ca125 remains the best available marker for routine use among patients with serous epithelial ovarian cancer.	objectiveto present an update of the european group on tumor markers guidelines for serum markers in epithelial ovarian cancer.methodssystematic literature survey from 2008 to 2013. the articles were evaluated by level of evidence and strength of recommendation.resultsbecause of its low sensitivity (5062% for early stage epithelial ovarian cancer) and limited specificity (9498.5%), cancer antigen (ca) 125 (ca125) is not recommended as a screening test in asymptomatic women. the risk of malignancy index, which includes ca125, transvaginal ultrasound, and menopausal status, is recommended for the differential diagnosis of a pelvic mass. because human epididymis protein 4 has been reported to have superior specificity to ca125, especially in premenopausal women, it may be considered either alone or as part of the risk of ovarian malignancy algorithm, in the differential diagnosis of pelvic masses, especially in such women. ca125 should be used to monitor response to first - line chemotherapy using the previously published criteria of the gynecological cancer intergroup, that is, at least a 50% reduction of a pretreatment sample of 70 ku / l or greater. the value of ca125 in posttherapy surveillance is less clear. although a prospective randomized trial concluded that early administration of chemotherapy based on increasing ca125 levels had no effect on survival, european group on tumor markers state that monitoring with ca125 in this situation should occur, especially if the patient is a candidate for secondary cytoreductive surgery.conclusionsat present, ca125 remains the most important biomarker for epithelial ovarian cancer, excluding tumors of mucinous origin.
recombinant atxa, atnl and its quadruple h28y / l31v / n33g / s49d mutant lw were prepared by in vitro refolding following expression in e. coli as described. all other chemicals were from sigma aldrich or gibco life technologies. adult male balb / c mice (2025 g) were maintained and humanely killed according to the guiding principles in the use of animals in toxicology (society of toxicology, 1999, guidelines are available at www.toxicology.org) and the animals (scientific procedures) act 1986. hemidiaphragms and accompanying phrenic nerves were dissected and placed into 10 ml tissue baths containing krebs solution (118.4 mm nacl, 4.7 mm kcl, 25 mm nahco3, 1.2 mm kh2po4, 1.4 mm mgso4 and 2.5 mm cacl2), maintained at 37c and oxygenated with a mixture 95% o2 and 5% co2. muscle contractions were evoked indirectly or directly. in the case of indirect neurally - evoked twitches, the attached phrenic nerve was stimulated at a frequency of 0.2 hz with rectangular pulses of 0.2 ms duration and a supramaximal voltage (< 15 v) from a grass force displacement transducer. muscle twitches were recorded on a grass polygraph model 79 (grass instruments). in order to reveal the triphasic effect of recombinant proteins on nm transmission, in some experiments the preparation was partially paralyzed (to 1520% of control) by reducing the concentration of ca to 0.380.50 mm and allowing the tissues to equilibrate for 3045 min. in these experiments recombinant proteins were added to the tissue bath and changes in the amplitude of twitch tension responses were followed continuously. the functionality of the muscle in the preparation at the end of the recordings was checked directly by acetylcholine stimulation or indirectly by 2.5 mm ca stimulation. in experiments with directly - evoked twitches the preparation was set up as described for the phrenic nerve - hemidiaphragm for recording neurally - evoked twitches. in addition, one end of a bipolar stimulating electrode was sutured into the diaphragm muscle near the costal margin and the other one was attached to the base of the hemidiaphragm. the directly - evoked twitches were recorded by supramaximal voltage stimulation (50 v) at a frequency of 0.2 hz and 2 ms duration. to eliminate nm transmission in the preparation, d - tubocurarine (10 m), an antagonist of the nicotinic acetylcholine receptors, was added into the organ bath 5 min prior to the beginning of direct stimulation. positive controls for the neurotoxic triphasic effect were performed by adding taipoxin (0.51 g / ml) after reducing the concentration of ca in order to partially paralyze the nm preparation as described above. recombinant atxa, atnl and its quadruple h28y / l31v / n33g / s49d mutant lw were prepared by in vitro refolding following expression in e. coli as described. all other chemicals were from sigma aldrich or gibco life technologies. adult male balb / c mice (2025 g) were maintained and humanely killed according to the guiding principles in the use of animals in toxicology (society of toxicology, 1999, guidelines are available at www.toxicology.org) and the animals (scientific procedures) act 1986. hemidiaphragms and accompanying phrenic nerves were dissected and placed into 10 ml tissue baths containing krebs solution (118.4 mm nacl, 4.7 mm kcl, 25 mm nahco3, 1.2 mm kh2po4, 1.4 mm mgso4 and 2.5 mm cacl2), maintained at 37c and oxygenated with a mixture 95% o2 and 5% co2. muscle contractions were evoked indirectly or directly. in the case of indirect neurally - evoked twitches, the attached phrenic nerve was stimulated at a frequency of 0.2 hz with rectangular pulses of 0.2 ms duration and a supramaximal voltage (< 15 v) from a grass force displacement transducer. muscle twitches were recorded on a grass polygraph model 79 (grass instruments). in order to reveal the triphasic effect of recombinant proteins on nm transmission, in some experiments the preparation was partially paralyzed (to 1520% of control) by reducing the concentration of ca to 0.380.50 mm and allowing the tissues to equilibrate for 3045 min. in these experiments recombinant proteins were added to the tissue bath and changes in the amplitude of twitch tension responses were followed continuously. the functionality of the muscle in the preparation at the end of the recordings was checked directly by acetylcholine stimulation or indirectly by 2.5 mm ca stimulation. in experiments with directly - evoked twitches the preparation was set up as described for the phrenic nerve - hemidiaphragm for recording neurally - evoked twitches. in addition, one end of a bipolar stimulating electrode was sutured into the diaphragm muscle near the costal margin and the other one was attached to the base of the hemidiaphragm. the directly - evoked twitches were recorded by supramaximal voltage stimulation (50 v) at a frequency of 0.2 hz and 2 ms duration. to eliminate nm transmission in the preparation, d - tubocurarine (10 m), an antagonist of the nicotinic acetylcholine receptors, was added into the organ bath 5 min prior to the beginning of direct stimulation. positive controls for the neurotoxic triphasic effect were performed by adding taipoxin (0.51 g / ml) after reducing the concentration of ca in order to partially paralyze the nm preparation as described above.	the molecular mechanism of action of presynaptically neurotoxic secreted phospholipases a2 (spla2s) has not been fully elucidated. we have recently proposed a model to explain one of the hallmarks of their action the reduction in endocytosis leading to synaptic vesicle depletion in nerve terminals. our results speak strongly in favor of a mechanism in which both specific protein - protein interactions and enzymatic activity of the neurotoxic spla2 ammodytoxin a (atxa) are necessary for impairment of clathrin - dependent endocytosis in yeast cells. the reduction of endocytosis was strictly dependent on the enzymatic activity of spla2s expressed ectopically in our yeast model cells and was not observed with the catalytically inactive, non - neurotoxic atxa - homolog, ammodytin l (atnl). here we confirm the validity of the model in mammalian cells also, by demonstrating that the enzymatically active mutant of atnl, shown to inhibit endocytosis in yeast, acts as a presynaptically neurotoxic spla2 at the mammalian neuromuscular junction.
porphyromonas gingivalis is a gram - negative oral anaerobe that is involved in the pathogenesis of periodontitis, an inflammatory disease that destroys the tissues supporting the tooth which eventually may lead to tooth loss. among the over 500 bacterial species living in the oral cavity, a bacterial complex named red complex and composed of porphyromonas gingivalis, treponema denticola, and tannerella forsythia has been strongly associated with advanced periodontal lesions. research on porphyromonas gingivalis, a periodontopathogen, has provided a tremendous amount of information in terms of phylogenetic as well as proteomic criteria over the last 20 years, which may exceed other closely related members, including bacteroides fragilis and bacteroides thetaiotaomicron, as major anaerobic, opportunistic pathogens in the dental field. the microbiota of the human oral mucosa consists of a myriad of bacterial species that normally exist in commensal harmony with the host. porphyromonas gingivalis, an etiological agent in severe forms of periodontitis (a chronic inflammatory disease), is a prominent component of the oral microbiome and a successful colonizer of the oral epithelium. the authors have used both latest as well as older reviews and studies to compile a comprehensive overview of this key periodontal pathogen. special attention has been paid to clinically relevant properties of porphyromonas gingivalis, such as pathogenicity and its possible relation to certain systemic diseases. the perturbation of epithelial cells by bacteria is the first stage in the initiation of inflammatory and immune processes which eventually cause destruction of the tissues surrounding and supporting the teeth which ultimately result in tooth loss. porphyromonas gingivalis can locally invade periodontal tissues and evade the host defense mechanisms. in doing so, it utilizes a panel of virulence factors that cause deregulation of the innate immune and inflammatory responses. porphyromonas gingivalis rapidly adheres to the host cell surface followed by internalization via lipid rafts and incorporation of the bacterium into early phagosomes. the replicating vacuole contains host proteins delivered by autophagy that are used by this asaccharolytic pathogen to survive and replicate within the host cell. when autophagy is suppressed by 3-methyladenine or wortmannin, internalized porphyromonas gingivalis transits to the phagolysosome where it is destroyed and degraded. for that reason, the survival of porphyromonas gingivalis depends upon the activation of autophagy and survival of the endothelial host cell, but the mechanism by which porphyromonas gingivalis accomplishes this remains unclear. the harsh inflammatory condition of the periodontal pocket suggests that this organism has properties that will facilitate its ability to respond and adapt to oxidative stress. because the stress response in the pathogen is a major determinant of its virulence, a comprehensive understanding of its oxidative stress resistance strategy is vital. the ability of porphyromonas gingivalis to cause adult periodontitis is determined by its arsenal of virulence factors. biofilm formation and bacterial dipeptidyl peptidase iv (dppiv) activity contribute to the pathogenic potential of porphyromonas gingivalis. furthermore, biofilm formation may enhance porphyromonas gingivalis virulence through increased dppiv activity. because of their importance for bacterial colonization and growth, biofilm formation and its chronic persistence in the periodontium depends on its ability to evade host immunity without inhibiting the overall inflammatory response, which is actually beneficial for this and other periodontal bacteria. indeed, the inflammatory exudate (gingival crevicular fluid) is a source of essential nutrients, such as peptides and hemin - derived iron. porphyromonas gingivalis contributes to the pathogenesis of aggressive periodontitis by inducing high levels of proinflammatory cytokines, such as il-1 and il-6 by peripheral cd4 t helper cells. porphyromonas gingivalis serotypes k1 and k2 but not others are associated with an increased production of the osteoclastogenesis - related factor rankl. this important information suggests that these serotypes could elicit a greater bone resorption in vivo and have a significant role in the periodontitis pathogenesis. destructive periodontitis is associated with a th1-th17-immune response and activation of rankl - induced osteoclasts. these porphyromonas gingivalis serotypes induce higher osteoclasts activation, by increased th17-associated rankl production and an antigen - specific memory t lymphocyte response. chronic porphyromonas gingivalis oral infection prior to arthritis induction increases the immune system activation favoring th17 cell responses which ultimately accelerate arthritis development. these results suggest that chronic oral infection may influence rheumatoid arthritis development mainly through activation of th17-related pathways. salivary concentrations of metalloproteinase mmp-8, interleukin il-1, and porphyromonas gingivalis are associated with various clinical and radiographic measures of periodontitis. high salivary concentrations of metalloproteinase mmp-8, interleukin il-1, and porphyromonas gingivalis have been associated with deepened periodontal pockets and alveolar bone loss and mmp-8 and il-1 with bleeding on probing. the bacterium utilizes amino acids as energy and carbon sources and incorporates them mainly as dipeptides. therefore, a wide variety of dipeptide production processes mediated by dipeptidyl peptidases (dpps) could be beneficial for the organism. iron utilized by this pathogen in the form of heme has been shown to play an essential role in its growth and virulence. instead, it employs specific outer membrane receptors, proteases (particularly gingipains), and lipoproteins to acquire iron / heme. specific proteins involved in iron and heme capture have been described. additionally, the proteolytic activities of gingipain r and gingipain k contribute to processing / maturation of various cell - surface proteins of porphyromonas gingivalis, such as fima fimbrilin (a subunit of major fimbriae), 75-kda protein (a subunit of minor fimbriae), hemagglutinins, and the hemoglobin receptor protein, which are important for the bacterium to colonize and proliferate in the gingival crevice and to invade the periodontium. these findings strongly point out the critical roles of gingipain r and gingipain k in the virulence of porphyromonas gingivalis. protease gingipain r exists as 110-, 95-, and 70- to 90- and 50-kda proteins, the first two being a complex of the 50-kda catalytic subunit with hemagglutinin / adhesins, with or without an added membrane anchorage peptide. the predominant form of gingipain k in porphyromonas gingivalis strains is a complex of a 60-kda catalytic protein with hemagglutinin / adhesins. molecular cloning and structural characterization of the gingipain r and gingipain k genes has shown that they code for 1704 and 1722 amino - acid residue preproenzymes, respectively. the virulence of argingipain was further substantiated by disruption of argingipain - encoding genes on the chromosome by use of suicide plasmid systems. on the other hand, the roles of host cell - derived proteinases in the periodontal tissue breakdown have been studied. levels of lysosomal proteinases such as cathepsins b, h, l, and g and medullasin were determined in gingival crevicular fluid from periodontitis patients and experimental gingivitis subjects by activity measurement and sensitive immunoassay. retention and growth of porphyromonas gingivalison diverse surfaces are facilitated by a repertoire of adhesins including fimbriae, hemagglutinins, and proteinases. we hypothesized that histatin 5 binds to porphyromonas gingivalis hemagglutinin b (hagb) and attenuates hagb - induced chemokine responses in human myeloid dendritic cells. thus histatin 5 is capable of attenuating chemokine responses which may help control oral inflammation. porphyromonas gingivalis produces large amounts of arginine- and lysine - specific cysteine proteinases in cell - associated and secretory forms. these enzymes, referred to as gingipains, cleave protein and peptide substrates after arginine (gingipain r) and lysine residues (gingipain k), and it has been found that neither is easily inhibited by host proteinase inhibitors. examination of the properties of each proteinase clearly indicates a role(s) for both in the dysregulation of a number of normally tightly controlled pathways. the effects of such uncontrolled proteolysis are the development of edema (kallikrein / kinin pathway activation by gingipain r), neutrophil infiltration (complement pathway activation by gingipain r), and bleeding (degradation of fibrinogen by gingipain k). the crystal structure of the k1 domain, an adhesin module of the lysine gingipain (kgp) expressed on the cell surface by the periodontopathic anaerobic bacterium, porphyromonas gingivalis w83, is comparable to the previously determined structures of homologues k2 and k3, all three being representative members of the cleaved adhesin domain family. in the structure of k1, the conformation of the most extensive surface loop is unexpectedly perturbed, perhaps by crystal packing, and is displaced from the previously reported arginine - anchored position observed in k2 and k3. this displacement allows the loop to become free to interact with other proteins ; the alternate flipped - out loop conformation is a novel mechanism for interacting with target host proteins, other bacteria, or other gingipain protein domains. furthermore, the k1 adhesin module, like others, is found to be hemolytic in vitro and thus functions in erythrocyte recognition contributing to the hemolytic function of kgp. k1 was also observed to selectively bind to hemalbumin with high affinity, suggesting this domain may be involved in gingipain - mediated hem acquisition from hemalbumin. consequently, it is most likely that all cleaved adhesin domains of kgp contribute to the pathogenicity of porphyromonas gingivalis in more complex ways than simply mediating bacterial adherence. the presence of antibodies to the porphyromonas gingivalis - specific virulence factor arginine gingipainb was screened by elisa method. significantly higher anti - rgpb antibody levels were detected in the periodontitis subset, compared to the nonperiodontitis control subset. significantly increased anti - rgpb antibody levels in periodontitis serum, compared to nonperiodontitis serum, may suggest that elevated anti - rgpb igg levels can be used as a proxy for chronic periodontitis in studies where the periodontal status is of interest but unknown. porphyromonas gingivalis hmuy hemophore - like protein binds heme and scavenges heme from host hemoproteins to further deliver it to the cognate heme receptor hmur. the characterization of structural features of hmuy variants in the presence and absence of heme with respect to roles of tryptophan residues in conformational stability is the aim of the further research. porphyromonas gingivalis contains exceedingly high concentrations of cysteine proteinases with trypsin - like activity which has been implicated as a virulence factor in adult - onset periodontitis. several of these enzymes are apparently expressed as active proteolytic products following processing of larger precursor proteins. in addition, more recent data have suggested a close relationship between some of these enzymes and two other potential virulence factors of porphyromonas gingivalis : hemagglutinins and collagenases. surface components of porphyromonas gingivalis have contact with host tissues and cells because of the outermost cell elements. as a result, porphyromonas gingivalis fimbriae are a critical factor for mediation of interaction of this bacterial organism with host tissues, as porphyromonas gingivalis promotes both bacterial adhesion to and invasion of targeted sites. porphyromonas gingivalis fimbriae are likely to interrupt the cellular signaling via extracellular matrix proteins / integrins in periodontal regions. fimbriae are also thought to be critically important in invasive events of this bacterial organism to host cells. porphyromonas gingivalis fimbriae are capable of binding to salivary enzymes, extracellular matrix proteins, and commensal bacteria as well as also strongly adhering to cellular alpha5beta1-integrin. following adhesion to alpha5beta1-integrin, porphyromonas gingivalis is captured by cellular pseudopodia which enable invagination through an actin - mediated pathway. the invasive event has been reported to require host cellular dynamin, actin fibers, microtubules, and lipid rafts. following passage through the epithelial barrier, the intracellular porphyromonas gingivalis pathogen impairs cellular function. porphyromonas gingivalis fimbriae are classified into 6 genotypes (types i to v and ib) based on the diversity of the fima genes encoding each fimbria subunit. intracellular porphyromonas gingivalis with type ii fimbriae has been found to clearly degrade integrin - related signaling molecules, paxillin and focal adhesion kinase which disables cellular migration and proliferation of the host cells. a majority of periodontitis patients were found to carry type ii fima fibriae of porphyromonas gingivalis, followed by type iv ; type ii fima fimbriae of porphyromonas gingivalis were found significantly more often in patients with more severe forms of periodontitis. porphyromonas gingivalis fimbriae act as an important virulence factor in atherosclerosis progression. regulatory t cells (tregs) however, whether porphyromonas gingivalis infection is associated with tregs dysregulation during atherosclerosis is still unknown and the prevalence of different porphyromonas gingivalis fima genotypes during this process is unclear. gingival fibroblasts, which are the major constituents of gingival connective tissue, may directly interact with porphyromonas gingivalis and its bacterial products, including lipopolysaccharide, in periodontitis lesions. due to its ability to potently activate host inflammatory and innate defense responses, it has been proposed to function as an important molecule that alerts the host of potential bacterial infection. however, although highly conserved, lipopolysaccharide contains important structural differences among different bacterial species that can significantly alter host responses. plasminogen activator inhibitor type 1 (pai-1) mrna binding protein expression was increased in gingiva from periodontitis patients. porphyromonas gingivalis lps induces proinflammatory cytokines, such as il-1, il-6, and il-8, which induce periodontal tissue destruction. periodontal ligament stem cells (pdlscs) play an important role in periodontal tissue regeneration and are expected to have future applications in cellular therapies for periodontitis. porphyromonas gingivalis lps inhibited the alkaline phosphatase activity, collagen type 1 alpha 1, and osteocalcin production and mineralization in the pdlscs which are positive for stro-1 and ssea-4. porphyromonas gingivalis lps also promoted cell proliferation and produced il-1, il-6, and il-8. the effect of porphyromonas gingivalis lps was compared with that of toll - like receptor 2 agonist synthetic triacylated lipoprotein pam3-cys - ser-(lys)4 (pam3csk4). gene and protein expression of intercellular adhesion molecule-1, vascular cell adhesion molecule-1, and e - selectin could be measured using rt - pcr and flow cytometry, respectively. porphyromonas gingivalis lps stimulates the expression levels of all adhesion molecules in a dose - dependent manner. the cysteine proteases of porphyromonas gingivalis are extracellular products of an important etiological agent in periodontal diseases. many of the in vitro actions of these enzymes are consistent with the observed deregulated inflammatory and immune features of the disease. they are significant targets of the immune responses of affected individuals and are viewed by some as potential molecular targets for therapeutic approaches to periodontal diseases. these enzymes are involved in both the destruction of periodontal tissues and interrupting host - defense mechanisms through the degradation of immunoglobulins and complement factors leading eventually to disease progression. the utilization of monospecific mutants defective in individual proteases has demonstrated that protease activity is important in virulence but also has suggested the complexity of the functions of the enzymes in the physiology of these microorganisms. activation of the complement leads to deposition of c3b on the bacterial surface and phagocytosis of the opsonized bacteria by host cells. alternatively, the entire complement pathway, including terminal components c5b-9, may be activated on the cell surface which gives rise to generation and insertion of the membrane attack complex into the bacterial membrane and cell lysis. bacterial resistance to complement may be by enzyme digestion of complement components or by the generation or acquisition from the host of cell surface molecules which allow the organism to adopt host complement control proteins. the proadhesive pathway is initiated when porphyromonas gingivalis fimbriae bind cd14 and activate toll - like receptor 2 (tlr2) and phosphatidylinositol 3-kinase - mediated signaling leading to induction of the high - affinity conformation of cr3 in leukocytes. although this tlr2 proadhesive signaling pathway may normally be involved in enhancing leukocyte - endothelial cell interactions and transendothelial migration, intriguing evidence suggests that porphyromonas gingivalis has co - opted this pathway for enhancing the interaction of its cell surface fimbriae with cr3. indeed, activated cr3 interacts with porphyromonas gingivalis fimbriae and induces downregulation of interleukin-12 p70, a key cytokine involved in intracellular bacterial clearance. moreover, the interaction of activated cr3 with porphyromonas gingivalis leads to the internalization of the pathogen by macrophages. since cr3 does not readily activate microbicidal mechanisms and constitutes a preferred receptor for certain intracellular pathogens, possible exploitation of cr3 by porphyromonas gingivalis for evading innate immune clearance might be a plausible hypothesis. signaling crosstalk between complement and toll - like receptors (tlrs) normally serves to coordinate host immunity. however, the periodontal bacterium porphyromonas gingivalis expresses c5 convertase - like enzymatic activity and adeptly exploits complement - tlr crosstalk to subvert host defenses and escape elimination. intriguingly, this defective immune surveillance leads to the remodeling of the periodontal microbiota to a dysbiotic state that causes inflammatory periodontitis. understanding the mechanisms by which porphyromonas gingivalis modulates complement function to cause dysbiosis offers new targets for complement therapeutics. periodontopathogens, such as porphyromonas gingivalis, have developed different strategies to perturb the structural and functional integrity of the gingival epithelium. neutrophils, primed or stimulated by the presence or persistence of infection, express an elevated and excessive response. the triggering receptor expressed on myeloid cells 1 (trem-1) is a cell surface receptor of the immunoglobulin superfamily with the capacity to amplify proinflammatory cytokine production and regulate apoptosis. polymorphonuclear neutrophils (pmns) are the first line of defense against infection and a major source of trem-1. the differential regulation of trem-1 by the porphyromonas gingivalis gingipains may present a novel mechanism by which porphyromonas gingivalis manipulates the host innate immune response helping to establish chronic periodontal inflammation. porphyromonas gingivalis can modulate eukaryotic cell signal transduction pathways, directing its uptake by gingival epithelial cells. within this privileged site, porphyromonas gingivalis can replicate and impinge upon components of the innate host defense. elucidation of a possible association of genotypic profiles under either diseased or clinical healthy conditions is important for understanding the pathogenic characteristics of porphyromonas gingivalis. genotypic characterization of porphyromonas gingivalis strains has revealed extensive heterogeneity in natural populations of this bacterium. regulation of hemin - responsive genes in porphyromonas gingivalis may occur by a negative regulator as has been described in other pathogenic organisms. the primary gingival epithelial cells express a family of g - protein coupled receptors known as adenosine receptors, including the high - affinity receptors a1 and a2a and low - affinity receptors a2b and a3. a2a receptor antagonism and knockdown via rna interference significantly reduced metabolically active intracellular porphyromonas gingivalis. the gingival epithelial cells express functional a2a receptor and porphyromonas gingivalis may use the a2a receptor coupled danger signals adenosine signaling as a means to establish successful persistence in the oral mucosa, possibly via downregulation of the proinflammatory response. currently, researchers are trying to find exactly how the symbiosis among the bacterial populations within the mouth works, specifically between porphyromonas gingivalis and aggregatibacter actinomycetemcomitans, as they are the major causes of gingivitis. their specific aims include seeing what components are shuttled between the bacteria as it has already been proven that neither bacterial species can survive without the other. also, more studies are focusing on the fimbriae, specifically finding ways to inhibit the minor fimbriae production as that would prevent the formation of a biofilm on the tooth. another major area of research is finding out how current methods to destroy these pathogens work such as ammonium nitrate. even though solutions like these have been used for some time now, the exact mechanism of how they are cytotoxic is unknown. future research aiming at finding the reasons which cause the changes in the oral homeostasis to allow the growth of aggregatibacter actinomycetemcomitans may give insight into novel prevention strategies for aggregatibacter actinomycetemcomitans - associated periodontitis. since porphyromonas gingivalis infection is related to a typical periodontal ecopathology, the susceptibility to person - to - person transmission of porphyromonas gingivalis pathogen may be controlled by periodontal treatment and emphasizing the significance of high standard oral hygiene. recent clinical and epidemiological studies have provided strong evidence for a significant association between rheumatoid arthritis and periodontitis. moreover, our findings show that porphyromonas gingivalis, the major etiologic factor in periodontitis, facilitates the development and progression of collagen induced arthritis. porphyromonas gingivalis, a major cause of chronic periodontitis, has also been implicated in the etiology of rheumatoid arthritis, specifically in anti - citrullinated protein / peptide antibody positive, based on its unique property among pathogens to express a citrullinating peptidylarginine deiminase enzyme. porphyromonas gingivalis peptidyl - arginine deiminase has the ability to convert arginine residues in proteins to citrulline. protein citrullination alters protein structure and function ; hence, peptidyl - arginine deiminase may be involved in deregulation of the host 's signaling network and immune evasion. furthermore, accumulating evidence suggests a role for autoimmunity against citrullinated proteins in the development of rheumatoid arthritis. the research of the effects of tea catechin epigallocatechin gallate on established biofilms and biofilm formation by porphyromonas gingivalis, a major pathogen of periodontal disease, shows that catechin epigallocatechin gallate destroys established porphyromonas gingivalis biofilms and inhibits biofilm formation. the results from current research indicate that, when treated with lps from porphyromonas gingivalis, the ephb4 receptor on osteoblasts and the ephrinb2 ligand on osteoclasts may generate bidirectional antiosteoclastogenic and pro - osteoblastogenic signaling into respective cells and potentially facilitate the transition from bone resorption to bone formation. in bone remodeling, the eph family is involved in regulating the process of osteoclast and osteoblast coordination in order to maintain bone homeostasis. the leptomeningeal cells transduce inflammatory signals from peripheral macrophages to brain - resident microglia in response to porphyromonas gingivalis lipopolysaccharide. the expression of toll - like receptor 2 (tlr2), tlr4, tnf-, and inducible no synthase was mainly detected in the gingival macrophages of chronic periodontitis patients. the leptomeninges serve as an important route for transducing inflammatory signals from macrophages to microglia by secretion of proinflammatory mediators during chronic periodontitis. porphyromonas gingivalis causes alveolar bone resorption and morphologic measurements are the most frequent methods to identify bone resorption in periodontal studies. the microbiota of the human oral mucosa consists of a myriad of bacterial species that normally exist in commensal harmony with the host. porphyromonas gingivalis, an etiological agent in severe forms of periodontitis (a chronic inflammatory disease), is a prominent component of the oral microbiome and a successful colonizer of the oral epithelium. porphyromonas gingivalis lipopolysaccharide circulates systemically in over 50% of periodontal disease patients and is associated with increased matrix metalloproteinase. the low systemic lipopolysaccharide stimulates an inflammatory response in the left ventricle through metalloproteinase leading to a decrease in cardiac function. in the outer membrane, vesicles of porphyromonas gingivalis the sera from periodontitis patients had significantly stronger reactivity against an outer membrane vesicles - producing strain than the isogenic outer membrane vesicles - depleted strain. the gingipain - laden outer membrane vesicles may contribute to tissue destruction in periodontal diseases by serving as a vehicle for the antigens and active proteases. porphyromonas gingivalis and aggregatibacter actinomycetemcomitans can be transmitted from family member to family member and may cause periodontitis in the recipient individual. recent advances in the understanding of the pathomechanisms of porphyromonas gingivalis may lead to the development of novel strategies for eradication of porphyromonas gingivalis and treatment for periodontal diseases in the future. the past decades of biomedical research have yielded massive evidence for the contribution of the microbiome in the development of a variety of chronic human diseases. there is emerging evidence that porphyromonas gingivalis, a well - adapted opportunistic pathogen of the oral mucosa and prominent constituent of oral biofilms, best known for its involvement in periodontitis, may be an important mediator in the development of a number of multifactorial and seemingly unrelated chronic diseases, such as rheumatoid arthritis and orodigestive cancers. orodigestive cancers represent a large proportion of the total malignancies worldwide and include cancers of the oral cavity, gastrointestinal tract, and pancreas. for prevention and/or enhanced prognosis of these diseases, a good understanding of the pathophysiological mechanisms and the interaction between porphyromonas gingivalis and host is much needed. porphyromonas gingivalis, an etiological agent in severe forms of periodontitis, is a prominent component of the oral microbiome and a successful colonizer of the oral epithelium. this gram - negative anaerobe can also exist within the host epithelium without the existence of overt disease. the latest studies tend to focus on the research of its possible direct and indirect influence on certain systemic diseases such as atherosclerosis and reumatoid arthritis. mutual relations between porphyromonas gingivalis and other pathogens of the oral cavity are another subject of intensive studies. the authors have used both latest as well as older reviews and studies to compile a comprehensive overview of this key periodontal pathogen.	porphyromonas gingivalis is a gram - negative oral anaerobe that is involved in the pathogenesis of periodontitis and is a member of more than 500 bacterial species that live in the oral cavity. this anaerobic bacterium is a natural member of the oral microbiome, yet it can become highly destructive (termed pathobiont) and proliferate to high cell numbers in periodontal lesions : this is attributed to its arsenal of specialized virulence factors. the purpose of this review is to provide an overview of one of the main periodontal pathogens porphyromonas gingivalis. this bacterium, along with treponema denticola and tannerella forsythia, constitute the red complex, a prototype polybacterial pathogenic consortium in periodontitis. this review outlines porphyromonas gingivalis structure, its metabolism, its ability to colonize the epithelial cells, and its influence upon the host immunity.
bipolar disorders (bd) are of particular public health significance as they are prevalent, severe and disabling, and often associated with elevated risks of premature mortality, adverse medical outcomes, accidents, and complications from comorbid substance use disorders.1 the world health organization reported, in 2001, that bipolar disorder was the fifth cause of years lived with disability among young adults. bd is characterized by periods of mania, depression, or mixed episodes, often multiple times during a lifetime. mania is the most characteristic phase of bipolar disorder, and a major cause of disability, stigma and cognitive impairment. lithium is the traditional treatment option, but the majority of patients do not respond to lithium monotherapy. other drugs have been introduced in recent years, such as the anticonvulsants valproate and carbamazepine, some typical antipsychotics (eg, haloperidol, chlorpromazine), atypical antipsychotics (such as quetiapine, olanzapine, risperidone, ziprasidone, aripiprazolo and clozapine), and benzodiazepines (eg, lorazepam and clonazepam).2 therapy for mood disorders is a major problem in psychiatry despite the availability of effective treatments. mood disorders frequently remain undiagnosed and, even if recognized, treatment duration and dosage are often inadequate and adherence to the medication regimen is poor.3 greater antidepressant adherence has been linked to greater response and remission among depressed subjects,3 whereas nonadherence has been shown to be related to less improvement of depressive symptoms and greater relapse / recurrence of depression.47 it is estimated that nonadherence ranges from 10% to 60% in mood disorders, with a median of 40%.8 however, according to lingam and scott,8 this topic is understudied, and only 1%2% of all publications on the treatment of affective disorders explore factors associated with medication nonadherence. bd is associated with high levels of long - term morbidity, comorbidity, hospitalization, disability, and increased mortality rates resulting from suicide, accidents, adverse outcomes of comorbid substance use and abuse, and medical illnesses.913 nonadherence with medication regimens appears to contribute substantially to worse outcomes and possibly to treatment failures among patients with bd. all currently approved antipsychotic drugs block dopamine d2 receptors, and all atypical antipsychotics are also more potent antagonists of the 5-hydroxytryptamine receptor 2a (5-ht2a).14 asenapine (saphris) is a second - generation antipsychotic, which received regulatory approval in august 2009 by the us food and drug administration (fda) for the acute treatment of schizophrenia and for the acute treatment of manic or mixed episodes associated with bd - i disorder in adults. the first substantive mention of the molecule in the published literature is an animal study published in 1990 that suggested that it had antipsychotic and anxiolytic potential related to dopamine and serotonin receptor antagonism. it was investigated originally in europe and japan in intravenous and oral formulations, but because of low bioavailability and high hepato - gastrointestinal first - pass metabolism of the oral formulation, a sublingual dosage form was developed. the development of sublingual asenapine began in 1996 for the treatment of schizophrenia, and in 2004 for the treatment of bipolar disorder. asenapine is classified as a dibenzo - oxepino pyrrole and has properties that are most similar to those of quetiapine, olanzapine, and clozapine.15 as with other antipsychotic agents, asenapine exhibits a higher binding affinity for the 5ht2a receptor compared with d2 receptors. moreover, asenapine has a broad range of effects on other neurotransmitter systems including 5-ht2c, 5-ht7, 5-ht2b, 5-ht6, 5-ht1a, 5-ht1b, 2b, 1a, 2a, 2c, d3, d4, d2l, d1, d2s, and h2 receptors. one major difference between asenapine and most other atypical antipsychotics (except for risperidone, ziprasidone and aripiprazolo) is that it exhibits little muscarinic receptor antagonist effects, which may produce a less cognitively deleterious profile, but it may result in weight gain. given that d2 receptor occupancy has been deemed as vital for antipsychotic efficacy, it is important to note that 5 mg tablets result in roughly 75% d2 occupancy, while occupancy is 85% with 10 mg tablets. the sublingual administration results in a rapid absorption with peak plasma concentrations within 0.51.5 hours and moderate (35%) bioavailability. this is in the low to mid - range of other antipsychotics, which exhibit 20%70% bioavailability at appropriate doses. the primary metabolic pathways of asenapine are direct glucuronidation by glucuronidyl transferases and oxidative metabolism by cytochrome p450 isoenzymes. thus, coadministration of asenapine with known inhibitors, inducers or substrates of these metabolic pathways, including the cyp1a2 inhibitor fluvoxamine, can alter the metabolism of asenapine. importantly, given the high incidence of smoking, smoking during administration does not alter the pharmacokinetics of asenapine. the reduced bioavailability via oral consumption means, however, that eating or drinking within 10 minutes can alter the bioavailability of asenapine.16 the aim of this concise overview is to investigate the role of asenapine, a new second - generation antipsychotic agent, in the treatment of manic and mixed states associated with bd - i disorder. in order to provide a new, timely and concise mini - review of asenapine in the treatment of manic and mixed states associated with bd disorder, we performed careful medline, excerpta medica and psycinfo searches to identify papers published in english over the past 7 years. search terms were asenapine, manic, mixed states, each term was also cross - referenced with the others using the mesh method (medical subjects headings). the selection of trials for inclusion in the review was firstly performed by the principal reviewer (mp) followed by a further independent (blind to each other) review by the other authors after employing the search strategy described previously. where a title or abstract appeared to describe a trial eligible for inclusion, the full article was obtained and inspected to assess relevance to this review based on the inclusion criteria. no blinding to the names of authors, institutions and journal of publication took place. when this proved impossible, we sought further information and, in the interim, added these trials to the awaiting assessment list. patients included in this review were adult (18 years old) with a current diagnostic and statistical manual of mental disorders, fourth edition (dsm - iv) primary diagnosis of bipolar i disorder who were experiencing manic or mixed episodes. the fda approved asenapine based on the efficacy outcomes from four clinical trials (two studies of acute schizophrenia and two studies of mania / mixed episodes of bd - i). these pivotal trials were supported by a number of other studies that also contributed safety data. the briefing documents, prepared by the fda, reported 51 completed trials and 12 ongoing clinical trials in the asenapine clinical program. of these, 29 are clinical pharmacology studies in healthy subjects and subjects with renal or hepatic impairment, and eight are clinical pharmacology studies in subjects with schizophrenia or schizoaffective disorder. this leaves 14 completed phase ii and iii studies of asenapine in schizophrenia and bipolar mania. very little of this research has been published in peer - reviewed journals, and only some has appeared in posters and presentations. however, the briefing documents available do provide sufficient detail to allow an appraisal of the evidence regarding the efficacy and tolerability of asenapine.17 to date, only four studies of asenapine for the treatment of manic or mixed episodes associated with bd - i have been published. these are four progressive trials, conducted by mcintyre, that analyzed asenapine s efficacy, tolerability, and safety in both the short - term and long - term1821 (tables 13). eligible patients were adults who met diagnostic and statistical manual, fourth edition (dsm - iv) criteria for bd - i and who were experiencing manic or mixed episodes. the authors conducted two identical 3-week, randomized, double - blind, placebo controlled trials with 488 and 489 patients respectively. they were randomly assigned to flexible - dose sublingual asenapine (5 or 10 mg), oral olanzapine (520 mg) or placebo. the patients who completed the trials were eligible for a 9-week, double - blind extension study (504 patients) that did not include a placebo arm and, finally, those who completed this extension study could enter a 40-week extension study (218 patients). efficacy evaluations were made using the young mania rating scale (ymrs).22 tolerability and safety assessment included adverse effects, physical examinations, extrapyramidal symptom ratings, and laboratory tests. in both studies, no significant differences were identified between olanzapine and asenapine when compared with placebo in the ymrs total score. in the first study, ymrs response and remission rates with olanzapine, but not with asenapine, were greater than placebo but, in the second study, both drugs, olanzapine and asenapine were superior to placebo. discontinuation rates (for reasons such as extrapyramidal - related adverse effects) were generally low in both trials, with no significant differences between the groups. in both trials, a poor weight gain profile was observed in the olanzapine group when compared with the asenapine and placebo groups. changes from baseline in metabolic chemistries, laboratory tests and vital signs were generally small and not clinically relevant, although prolactin levels were slightly greater with olanzapine than with asenapine.1821,23 long - term efficacy and safety were investigated during the 9-week and 40-week double blind extension studies. in these studies, asenapine was not inferior to olanzapine for changes from baseline in ymrs total score, but clinically significant weight gain was greater with olanzapine than asenapine. the use of asenapine was also studied in a trial as adjunctive treatment for acute mania associated with bd - i. in this randomized, controlled trial, adjunctive asenapine significantly improved the symptoms of bd - i in adult patients not fully responsive to pre - existing mood stabilizers.24 research indicates that asenapine is generally well - tolerated, with no significant differences between groups in terms of adverse events or extrapyramidal symptoms in the short - term and long - term. in all four trials, the risk for clinically significant weight gain was greater with olanzapine than with asenapine, and that risk increased with extended treatment. changes from baseline in metabolic chemistries, laboratory tests and vital signs were generally small and not clinically relevant, although prolactin levels were slightly greater with olanzapine than with asenapine. compared with olanzapine, asenapine was less likely to cause dry mouth and weight gain, but more likely to cause dizziness, nausea, akathisia, and oral hypoesthesia. in conclusion, this review indicates that asenapine is efficacious and not inferior to olanzapine in the treatment of mixed or manic episodes associated with bd - i in the short - term and long - term. it is also well - tolerated, with a low incidence of side effects, the most common of which are somnolence, akathisia, dizziness, nausea, weight gain and oral hypoesthesia due to its sublingual administration. moreover it seems that asenapine s weight gain profile is better than that associated with several other second - generation antipsychotics, including olanzapine. asenapine is administered through a sublingual route which could be an advantage in a patient population that refuses to swallow. the disadvantages are twice - daily dosing (because an increase in dosing frequencies seem to have a negative effect on the compliance of patients to the treatment), and there is also a need to avoid food and drink for 10 minutes after dosing. because of the small number of trials to date, the therapeutic impact of asenapine on the treatment of bipolar disorder requires further clinical investigation.	background : bipolar disorders (bd) are of particular public health significance as they are prevalent, severe and disabling, and often associated with elevated risks of premature mortality. the aim of this concise overview is to investigate the role of asenapine in the treatment of manic and mixed states associated with bd type 1 disorder.method:medline, excerpta medica and psycinfo searches were performed to identify papers in english published over the past 7 years. search terms were asenapine, manic or mixed states, bipolar i disorder. subjects included in this study suffered from bd type 1 disorder.results:to date, only four studies of asenapine for the treatment of manic or mixed episodes associated with bd type 1 have been published.conclusion:research indicates that asenapine is generally well - tolerated, and that asenapine is efficacious and not inferior to olanzapine in the treatment of mixed or manic episodes associated with bd type 1 in the short - term and long - term.
a 3-month - old girl child presented to us with a history of swelling on back since birth. she had a history of full term normal vaginal delivery with no significant family history. there was complete flaccid paralysis of right lower extremity with normal anal tone. on local examination, an initial diagnosis of a myelomeningocele was made and patient was referred for magnetic resonance imaging (mri) of neuraxis. mri spine revealed a bony spur at d11 level dividing the spinal cord into two halves suggesting pang type 1 split cord malformation (scm) or diastematomyelia. right hemicord, along with meninges and cerebrospinal fluid was herniating through the defect in posterior element of same vertebra forming a large hemimeningomyelocele [figures 1 and 2 ]. t2-weighted sagittal (a) and coronal (b) magnetic resonance imaging of dorso - lumbar spine shows a hemivertebrae from d10 to d12 level along with a bony spur at d11. continuation of left hemicord is appreciable in coronal view (b) t2 weighted axial image shows a bony spur dividing the cord into two halves (a and b). herniation of right hemicord, meninges and cerebrospinal fluid is noted through the defect in posterior element, forming a large hemi - meningomyelocele (c). two hemicords are visible below the level of herniation (d) which reunites at d12 level to form a single cord (e) based on clinical examination and mri a final diagnosis of scm type 1 with right hemimyelomeningocele (hmm) was made and patient was prepared for surgery. excision of bony spur along with microneurosurgical dissection and meticulous layered closure of myelomeningocele was achieved. according to pang 's unified theory of embryogenesis, the whole spectrum of split cord syndrome originates from one basic ontogenic error occurring around the time of primitive neurenteric canal closure. this basic error is the formation of accessory neurenteric canal between the amniotic cavity and the yolk sac. this abnormal fistulous connection bisects the notochord and the neural plate on approximately postovulatory day 18. final appearance of matured scm depends on the ability of the embryo to heal around this abnormal fistulous connection aka endomesenchymal tract. according to pang., formation of endomesenchymal tract before postovulatory day 21 gives rise to scm type 2 or diplomyelia, whereas formation of this tract after postovulatory day 30 gives rise to scm type 1 or distematomyelia. the formation of this tract between postovulatory day 21 and 30 gives rise to composite / mixed scm. each hemineural plate undergoes neurulation in which, the neural folds converge and fuse each other in relation to their respective hemi - notochords. this process of primary neurulation occurs between postovulatory days 2228. in case of neurulation defect on one side, hmm or hemimeningocele myelomeningocele are frequently associated with chiari malformation diastematomyelia (up to 45% in some reported series) and other congenital vertebral defects such as spondylocostal dysostosis, jarcho - levin syndrome, klippel - feil anomaly and a wide range of syndromic malformation complexes, but true hemimeningocele, where a single hemicord fails to neurulate is rare. the neurological deficit in children with hmm is less severe than compared to myelomeningocele patients and is limited only to the side of exposed hemicord. this case report highlights the importance of detailed imaging of complete neuraxis in cases of spinal dysraphism for optimal neurosurgical management. second the rarity of this condition suggests that formation of the endomesenchymal tract and neurulation defect are two separate embryological events, and their coexistence at the same level is only by chance though more inputs are warranted in this regard.	variations in split cord malformation (scm) have been described earlier. however, a true hemimyelomeningocele (hmm) as only congenital malformation is extremely rare and is reported infrequently in published literature. we are reporting the case of a 3-month - old girl child who presented with a swelling on the lower back since birth. magnetic resonance imaging revealed a type 1 scm with right hemicord forming a hmm. precise diagnosis and thorough anatomical detail of dysraphism is essential for optimal, individualized neurosurgical management.
interact is a large, prospective, case - cohort study of 27,779 individuals from eight european countries (denmark, france, germany, italy, the netherlands, spain, sweden, and u.k.) nested within the european prospective investigation into cancer and nutrition (epic) (20). the objective of the study was to investigate the interplay between genetic and lifestyle factors and the effect on risk of type 2 diabetes (21). the sample was taken from a total cohort of 340,234 individuals comprising 3.99 million person - years of follow - up time ; 12,403 individuals (6,238 women) with clinically incident type 2 diabetes were selected for interact together with a representative subcohort of 16,835 individuals (10,378 women). after exclusion of those with prevalent diabetes (n = 548), those without information regarding diabetes status (n = 129), and individuals with postcensoring diabetes (n = 4), 16,154 subcohort members were available for analysis (10,043 women), 778 of whom were also incident cases (394 women). all epic centers obtained written informed consent from participants and obtained approval from local ethics committees. as previously described (21), cases of incident type 2 diabetes were ascertained using multiple sources of evidence, including self - report (self - reported or doctor - diagnosed history of type 2 diabetes or diabetes drug use), linkage to primary or secondary care registers, medication use reported from drug registers, hospital admissions, and mortality data. in most centers, evidence of type 2 diabetes was sought from at least two independent sources from those listed or by reviewing individual medical records to verify incident cases. the exceptions were danish and swedish centers where cases were ascertained through local and national diabetes and pharmaceutical registers rather than self - reported ; thus, all cases were considered to be verified. information regarding diabetes status was used from any follow - up visit or external evidence with a date later than that of baseline data collection. follow - up was censored at the date of diagnosis, 31 december 2007, or the date of death, whichever occurred first. if a diagnosis date could not be identified from any of the sources described, then the midpoint between recruitment and censoring was used. information regarding age at menarche in completed whole years was obtained by questionnaire in each of the contributing centers. the normal physiological age range at menarche was considered to be between 8 and 18 years. a total of 34 women were excluded because they reported menarche after age 18 years, which may reflect an underlying pathological cause. another 685 women were excluded because they did not provide information about age at menarche. this left 15,168 women, of whom 5,955 were considered incident type 2 diabetes cases and 9,590 were represented in the subcohort (377 of whom became type 2 diabetes cases). early menarche was defined as onset of menstruation occurring between ages 8 and 11 years. baseline information regarding reproductive factors was collected using self - administered questionnaires, which asked about age at first full - term pregnancy, number of still births and live births, menopausal status, and use of the oral contraceptives and hormone replacement therapy. parity was derived from the number of reported live births and still births. in the bilthoven center (the netherlands), this information was unavailable and number of children was used. lifestyle factors including smoking status, alcohol consumption, and educational level also were assessed at baseline by self - report. levels of physical activity were assessed using a questionnaire previously validated against objective methods and coded as inactive, moderately inactive, moderately active, and active (22). height, weight, and waist circumference of participants were measured by trained health professionals, except in the french centers and the u.k. bmi was calculated as weight (in kg) divided by height (in m) squared. recalled body weight at age 20 years was available in five countries (italy, u.k., germany, sweden, and denmark) and was used to calculate estimated bmi in young adulthood (recalled body weight at age 20 [kg ] divided by height [m ] squared). bmi cutoffs of 25 kg / m and 30 kg / m were used to define overweight and obesity, respectively, in accordance with guidelines from the world health organization (23). the association between age at menarche and adult bmi was tested in the interact subcohort using linear regression with adjustment for age at recruitment and center in each country before using random - effects meta - analysis to obtain a pooled estimate. to estimate the association between age at menarche and type 2 diabetes, prentice - weighted cox regression models, with age as the underlying time scale, country - specific hazard ratios (hrs) for type 2 diabetes per year later age at menarche were subsequently combined using random - effects meta - analysis. heterogeneity between countries was assessed using the i statistic. because girls previously have been shown to be at increased risk for later disease according to age at menarche in a nonlinear manner (6,19), we also modeled menarche as a categorical variable (811, 12, 13, 14, and 1518 years, which approximately equate to quintiles) with the median age (13 years) as the reference category. a quadratic age at menarche term added to the existing linear model basic models were adjusted for center, age at recruitment, and date of birth to account for potential cohort effects. first, lifestyle factors including smoking status (never, former, current), alcohol consumption (30 kg / m), overweight (bmi > 25 kg / m), smoking status, and physical activity level and the effects on the risk of diabetes were performed in prentice - weighted cox regression models adjusted for center, age at recruitment, lifestyle and reproductive factors, and adult bmi. analyses were performed separately by country and were pooled using random - effects meta - analysis. to explore whether the association between menarche timing and type 2 diabetes differed according to the age of onset of diabetes, we defined the following two new outcomes : type 2 diabetes diagnosed before age 60 years and type 2 diabetes diagnosed at age 60 years or older. the association between age at menarche and each outcome was then estimated using the methods described, with follow - up censored at age 60 years for the analysis of younger - onset diabetes. all analyses were conducted using stata version 11.2 (statacorp, college station, tx). interact is a large, prospective, case - cohort study of 27,779 individuals from eight european countries (denmark, france, germany, italy, the netherlands, spain, sweden, and u.k.) nested within the european prospective investigation into cancer and nutrition (epic) (20). the objective of the study was to investigate the interplay between genetic and lifestyle factors and the effect on risk of type 2 diabetes (21). the sample was taken from a total cohort of 340,234 individuals comprising 3.99 million person - years of follow - up time ; 12,403 individuals (6,238 women) with clinically incident type 2 diabetes were selected for interact together with a representative subcohort of 16,835 individuals (10,378 women). after exclusion of those with prevalent diabetes (n = 548), those without information regarding diabetes status (n = 129), and individuals with postcensoring diabetes (n = 4), 16,154 subcohort members were available for analysis (10,043 women), 778 of whom were also incident cases (394 women). all epic centers obtained written informed consent from participants and obtained approval from local ethics committees. as previously described (21), cases of incident type 2 diabetes were ascertained using multiple sources of evidence, including self - report (self - reported or doctor - diagnosed history of type 2 diabetes or diabetes drug use), linkage to primary or secondary care registers, medication use reported from drug registers, hospital admissions, and mortality data. in most centers, evidence of type 2 diabetes was sought from at least two independent sources from those listed or by reviewing individual medical records to verify incident cases. the exceptions were danish and swedish centers where cases were ascertained through local and national diabetes and pharmaceutical registers rather than self - reported ; thus, all cases were considered to be verified. information regarding diabetes status was used from any follow - up visit or external evidence with a date later than that of baseline data collection. follow - up was censored at the date of diagnosis, 31 december 2007, or the date of death, whichever occurred first. if a diagnosis date could not be identified from any of the sources described, then the midpoint between recruitment and censoring was used. information regarding age at menarche in completed whole years was obtained by questionnaire in each of the contributing centers. the normal physiological age range at menarche was considered to be between 8 and 18 years. a total of 34 women were excluded because they reported menarche after age 18 years, which may reflect an underlying pathological cause. another 685 women were excluded because they did not provide information about age at menarche. this left 15,168 women, of whom 5,955 were considered incident type 2 diabetes cases and 9,590 were represented in the subcohort (377 of whom became type 2 diabetes cases). early menarche was defined as onset of menstruation occurring between ages 8 and 11 years. baseline information regarding reproductive factors was collected using self - administered questionnaires, which asked about age at first full - term pregnancy, number of still births and live births, menopausal status, and use of the oral contraceptives and hormone replacement therapy. parity was derived from the number of reported live births and still births. in the bilthoven center (the netherlands), this information was unavailable and number of children was used. lifestyle factors including smoking status, alcohol consumption, and educational level also were assessed at baseline by self - report. levels of physical activity were assessed using a questionnaire previously validated against objective methods and coded as inactive, moderately inactive, moderately active, and active (22). height, weight, and waist circumference of participants were measured by trained health professionals, except in the french centers and the u.k. bmi was calculated as weight (in kg) divided by height (in m) squared. recalled body weight at age 20 years was available in five countries (italy, u.k., germany, sweden, and denmark) and was used to calculate estimated bmi in young adulthood (recalled body weight at age 20 [kg ] divided by height [m ] squared). bmi cutoffs of 25 kg / m and 30 kg / m were used to define overweight and obesity, respectively, in accordance with guidelines from the world health organization (23). the association between age at menarche and adult bmi was tested in the interact subcohort using linear regression with adjustment for age at recruitment and center in each country before using random - effects meta - analysis to obtain a pooled estimate. to estimate the association between age at menarche and type 2 diabetes, prentice - weighted cox regression models, with age as the underlying time scale, country - specific hazard ratios (hrs) for type 2 diabetes per year later age at menarche were subsequently combined using random - effects meta - analysis. heterogeneity between countries was assessed using the i statistic. because girls previously have been shown to be at increased risk for later disease according to age at menarche in a nonlinear manner (6,19), we also modeled menarche as a categorical variable (811, 12, 13, 14, and 1518 years, which approximately equate to quintiles) with the median age (13 years) as the reference category. a quadratic age at menarche term added to the existing linear model basic models were adjusted for center, age at recruitment, and date of birth to account for potential cohort effects. first, lifestyle factors including smoking status (never, former, current), alcohol consumption (30 kg / m), overweight (bmi > 25 kg / m), smoking status, and physical activity level and the effects on the risk of diabetes were performed in prentice - weighted cox regression models adjusted for center, age at recruitment, lifestyle and reproductive factors, and adult bmi. analyses were performed separately by country and were pooled using random - effects meta - analysis. to explore whether the association between menarche timing and type 2 diabetes differed according to the age of onset of diabetes, we defined the following two new outcomes : type 2 diabetes diagnosed before age 60 years and type 2 diabetes diagnosed at age 60 years or older. the association between age at menarche and each outcome was then estimated using the methods described, with follow - up censored at age 60 years for the analysis of younger - onset diabetes. all analyses were conducted using stata version 11.2 (statacorp, college station, tx). age at menarche was normally distributed in both the interact incident type 2 diabetes cases (mean, 13.08 years ; sd, 1.73) and subcohort (mean, 13.14 years ; sd, 1.58). women not reporting age at menarche were slightly older at recruitment and weighed more than those included in our analyses. those with younger age at menarche tended to be younger at baseline (likely reflecting the secular decline in menarcheal age), heavier, shorter, less active, more educated, and more likely to have higher parity. overall, the average age at recruitment was 52 years and the mean bmi was 25.7 kg / m. baseline characteristics of the interact subcohort by age at menarche mean ages at recruitment and ages at menarche of the interact subcohort stratified by country are presented in table 2. mean menarcheal age ranged from 12.6 years in italy to 13.6 years in sweden and denmark. older age at menarche was consistently associated with decreased adult bmi across all countries in the interact subcohort (table 2). overall, menarche at each year later was associated with 0.32 kg / m lower bmi in adulthood (95% ci, 0.270.32 ; p < 0.001). the magnitude of association with estimated bmi at age 20 years (in the five countries that had this information available, italy, u.k., germany, sweden, and denmark ; overall n = 3,665) was smaller, with menarche at each year later conferring 0.21 kg / m lower bmi (95% ci, 0.150.26 ; p < 0.001). mean age at menarche by country and its association with adult bmi in the interact subcohort the incidence of type 2 diabetes in women with history of early menarche in the interact subcohort was 4.3 cases per 1,000 person - years, compared with 2.9 cases per 1,000 person - years in those with the median age at menarche. menarche at each year later was associated with a 9% lower risk of development of type 2 diabetes in a linear model adjusting for age at recruitment, date of birth, and center (hr, 0.91 ; 95% ci, 0.880.93 ; p < 0.001) (table 3, model 1). this association was largely unchanged after adjusting for lifestyle and reproductive factors (table 3, models 2 and 3). quadratic age at menarche terms were significant (p < 0.001). in models using categorical age at menarche, compared with women in the middle category of age at menarche (13 years), the risk of development of diabetes in women in the earliest category (811 years) was 70% higher (hr, 1.70 ; 95% ci, 1.481.94 ; p < 0.001) after accounting for potential confounding factors. there also was a less pronounced association with diabetes in women who had menarche at age 12 years compared with the median age (hr, 1.26 ; 95% ci, 1.101.44 ; p = 0.001). in contrast, there did not appear to be a protective effect of older age at menarche in women with menarche between 15 and 18 years (hr, 0.97 ; 95% ci, 0.841.11 in women ; p = 0.63), suggesting a nonlinear association between menarche timing and diabetes (fig. 1). age at menarche and hrs for type 2 diabetes in the interact study hrs for type 2 diabetes by category of age at menarche in the epic - interact study. results presented are hrs for diabetes in each group compared with the reference category (13 years, representing the median age at menarche). results are from prentice - weighted cox regression models performed within each country participating in interact and pooled using the random - effects meta - analysis. models are adjusted for age at recruitment, date of birth, center, and lifestyle and reproductive factors (), and with additional adjustment for adult bmi (). adjusting for adult bmi partially reduced the hr for type 2 diabetes in girls with early menarche (811 years) compared with a median menarcheal age from 1.70 to 1.42 (95% ci, 1.181.71 ; p < 0.001) in models adjusted for all measured potential confounders (table 3, model 4). additional inclusion of waist circumference into the model had a negligible effect on these results (model 5). adjusting for bmi at the age of 20 years, rather than later adult bmi, only modestly attenuated the association between early menarche and diabetes from 1.63 (95% ci, 1.302.04) to 1.58 (95% ci, 1.252.01) (model 6). in a maximum sample analysis, the addition of adult bmi to the basic model resulted in a similar attenuation in the hr (table 3, model 7). by country, the association between early menarche (811 years compared with all others) and type 2 diabetes was directionally consistent both before and after adjustment for adult bmi, with no detectable heterogeneity (supplementary fig. the estimated hr for type 2 diabetes in girls with early menarche (811 years) compared with menarche at older ages (total effect, 1.68 ; 95% ci, 1.272.22) comprised a direct effect of early menarche (hr, 1.33 ; 95% ci, 1.001.78) and an indirect effect mediated by adult bmi (hr, 1.23 ; 95% ci, 1.181.30). overall, 41% (95% ci, 3150%) of the higher risk of type 2 diabetes related to early menarche in the interact subcohort was attributable to higher adult bmi (supplementary table 1). there was no statistically significant interaction between menarcheal age and menopausal status, bmi, obesity status, smoking status, or physical activity level and the effect on the risk of development of type 2 diabetes (data not shown). the association between early menarche and type 2 diabetes diagnosed at age 60 years or older (hr, 1.67 ; 95% ci, 1.431.95 ; p < 0.001) was comparable with the association with type 2 diabetes diagnosed before age 60 years (hr, 1.64 ; 95% ci, 1.431.89 ; p < 0.001) in a model adjusting for potential confounding factors. for both end points, the association between early menarche and incident diabetes was partially attenuated by adjustment for adult bmi (supplementary table 2). age at menarche was normally distributed in both the interact incident type 2 diabetes cases (mean, 13.08 years ; sd, 1.73) and subcohort (mean, 13.14 years ; sd, 1.58). women not reporting age at menarche were slightly older at recruitment and weighed more than those included in our analyses. those with younger age at menarche tended to be younger at baseline (likely reflecting the secular decline in menarcheal age), heavier, shorter, less active, more educated, and more likely to have higher parity. overall, the average age at recruitment was 52 years and the mean bmi was 25.7 kg / m. mean ages at recruitment and ages at menarche of the interact subcohort stratified by country are presented in table 2. mean menarcheal age ranged from 12.6 years in italy to 13.6 years in sweden and denmark. older age at menarche was consistently associated with decreased adult bmi across all countries in the interact subcohort (table 2). overall, menarche at each year later was associated with 0.32 kg / m lower bmi in adulthood (95% ci, 0.270.32 ; p < 0.001). the magnitude of association with estimated bmi at age 20 years (in the five countries that had this information available, italy, u.k., germany, sweden, and denmark ; overall n = 3,665) was smaller, with menarche at each year later conferring 0.21 kg / m lower bmi (95% ci, 0.150.26 ; p < 0.001). heterogeneity across countries was not statistically significant in either analysis. mean age at menarche by country and its association with adult bmi in the interact subcohort the incidence of type 2 diabetes in women with history of early menarche in the interact subcohort was 4.3 cases per 1,000 person - years, compared with 2.9 cases per 1,000 person - years in those with the median age at menarche. menarche at each year later was associated with a 9% lower risk of development of type 2 diabetes in a linear model adjusting for age at recruitment, date of birth, and center (hr, 0.91 ; 95% ci, 0.880.93 ; p < 0.001) (table 3, model 1). this association was largely unchanged after adjusting for lifestyle and reproductive factors (table 3, models 2 and 3). quadratic age at menarche terms were significant (p < 0.001). in models using categorical age at menarche, compared with women in the middle category of age at menarche (13 years), the risk of development of diabetes in women in the earliest category (811 years) was 70% higher (hr, 1.70 ; 95% ci, 1.481.94 ; p < 0.001) after accounting for potential confounding factors. there also was a less pronounced association with diabetes in women who had menarche at age 12 years compared with the median age (hr, 1.26 ; 95% ci, 1.101.44 ; p = 0.001). in contrast, there did not appear to be a protective effect of older age at menarche in women with menarche between 15 and 18 years (hr, 0.97 ; 95% ci, 0.841.11 in women ; p = 0.63), suggesting a nonlinear association between menarche timing and diabetes (fig. 1). age at menarche and hrs for type 2 diabetes in the interact study hrs for type 2 diabetes by category of age at menarche in the epic - interact study. results presented are hrs for diabetes in each group compared with the reference category (13 years, representing the median age at menarche). results are from prentice - weighted cox regression models performed within each country participating in interact and pooled using the random - effects meta - analysis. models are adjusted for age at recruitment, date of birth, center, and lifestyle and reproductive factors (), and with additional adjustment for adult bmi (). adjusting for adult bmi partially reduced the hr for type 2 diabetes in girls with early menarche (811 years) compared with a median menarcheal age from 1.70 to 1.42 (95% ci, 1.181.71 ; p < 0.001) in models adjusted for all measured potential confounders (table 3, model 4). additional inclusion of waist circumference into the model had a negligible effect on these results (model 5). adjusting for bmi at the age of 20 years, rather than later adult bmi, only modestly attenuated the association between early menarche and diabetes from 1.63 (95% ci, 1.302.04) to 1.58 (95% ci, 1.252.01) (model 6). in a maximum sample analysis, the addition of adult bmi to the basic model resulted in a similar attenuation in the hr (table 3, model 7). by country, the association between early menarche (811 years compared with all others) and type 2 diabetes was directionally consistent both before and after adjustment for adult bmi, with no detectable heterogeneity (supplementary fig. the estimated hr for type 2 diabetes in girls with early menarche (811 years) compared with menarche at older ages (total effect, 1.68 ; 95% ci, 1.272.22) comprised a direct effect of early menarche (hr, 1.33 ; 95% ci, 1.001.78) and an indirect effect mediated by adult bmi (hr, 1.23 ; 95% ci, 1.181.30). overall, 41% (95% ci, 3150%) of the higher risk of type 2 diabetes related to early menarche in the interact subcohort was attributable to higher adult bmi (supplementary table 1). there was no statistically significant interaction between menarcheal age and menopausal status, bmi, obesity status, smoking status, or physical activity level and the effect on the risk of development of type 2 diabetes (data not shown). the association between early menarche and type 2 diabetes diagnosed at age 60 years or older (hr, 1.67 ; 95% ci, 1.431.95 ; p < 0.001) was comparable with the association with type 2 diabetes diagnosed before age 60 years (hr, 1.64 ; 95% ci, 1.431.89 ; p < 0.001) in a model adjusting for potential confounding factors. for both end points, the association between early menarche and incident diabetes was partially attenuated by adjustment for adult bmi (supplementary table 2). in a large case - cohort study nested with a large pan - european cohort study, we have demonstrated an association between early menarche and increased risk of type 2 diabetes that was highly consistent across eight european countries. girls in the youngest category of age at menarche had the highest risk, with women who were between 8 and 11 years at the time of menarche having a 70% higher incidence of future diabetes than women who had menarche at the average age of 13 years. although these findings are generally consistent with previous reports (69,18), the large size of our study allowed us to demonstrate the nonlinear nature of the association and to formally quantify the extent of mediation by higher adult bmi, which explained less than half of the increased diabetes risk associated with early menarche. these findings suggest that early puberty has an effect on metabolic disease risk, which is partly mediated by increased bmi, but also has some direct effect through other biological pathways that act independently of adiposity. overall, early menarche conferred a 42% increase in the risk of development of diabetes independently of adult bmi. in contrast to our findings, results from the nurses health study (nhs) showed that accounting for self - reported bmi collected during follow - up in adulthood completely attenuated the association between early menarche and diabetes risk (18). however, among younger women in nhs - ii, the increased risk of type 2 diabetes persisted after adjustment for bmi (18). in the atherosclerosis risk in communities (aric) study, adulthood adiposity partially attenuated the association between early menarche and prevalent diabetes and completely attenuated the association with incident diabetes (6). in epic - norfolk, the effect of later menarche on diabetes risk appeared to be completely attenuated after adjustment for adult bmi (7). such contrasting findings may be attributable to the lower power of these studies to detect the more modest direct association between age at menarche and type 2 diabetes (7), or because of error introduced by using self - reported rather than measured bmi in some of the studies (18). consistent with our findings, in the kora f4 study of 1,503 german women, the association between older age at menarche and lower diabetes risk remained significant after adjustment for bmi (9). the association between menarche and diabetes may exist because early menarche may be a marker of higher prepubertal bmi, with prolonged effects of increased adiposity being the main risk factor for diabetes. however, girls with earlier puberty have higher weight, height, bmi, and waist circumference measurements in young childhood, and it is highly unlikely that early maturation is associated with adiposity or lean mass alone (27,28). our results suggest an association between menarche and diabetes risk independent of adult bmi. however, the true nature of this relationship is difficult to determine without information about body size during childhood, which was unavailable in our study. bmi at age 20 years was available in a subset of interact participants, which is likely to be a better marker of prepubertal bmi than when assessed in later adulthood. consistent with some previous reports (8,18), the association between age at menarche and diabetes risk was attenuated to a larger extent when accounting for later adult bmi compared with bmi measured in childhood, adolescence, or early adulthood. this suggests that excess adiposity in later adulthood, a more likely indicator of long - term exposure to being overweight, is more important in the mediation of increased diabetes risk associated with early menarche than bmi earlier in life. in further support of this, one study has shown that the association between menarche and increased adult bmi is not explained by higher prepubertal bmi (29). using genetic variation at lin28b, which is associated with age at menarche but not prepubertal bmi, we previously provided evidence for a possible direct effect of puberty timing on adiposity in young adult life in women (30). our findings of a consistent association between early menarche and diabetes in women diagnosed at ages older than and younger than 60 years support the finding that puberty timing has a long - lasting effect on metabolic health. findings from the nhs showed that there was a stronger association between early menarche and diabetes in younger women (younger than 45 years) compared with older women (45 years or older). because our participants were older at recruitment, we did not have sufficient cases to explore the association between menarche timing and diabetes diagnosed at this particularly young age. the strengths of this study lie in the large scale and the prospective nature of interact, together with the heterogeneity in age at menarche across eight european countries, the accurate assessment of bmi, and comprehensive consideration of a range of confounding factors. the high number of verified incident diabetes cases incorporated using the case - cohort design make this study a powerful resource to address questions relating to diabetes etiology. our prospective analysis of incident cases of type 2 diabetes avoids the problem of reverse causality, whereby insulin resistance during early life may increase the tempo of development (31). limitations of this study include the fact that age at menarche was recalled in adulthood and was only recorded to the nearest year. however, age at menarche assessed by recall during adulthood has shown high correlations with prospectively assessed childhood data (1,32). furthermore, any misclassification would be expected to be nondifferential with respect to type 2 diabetes status and therefore cause an underestimation of the true association. it is likely that bmi may not adequately account for adiposity, because it does not differentiate between fat and fat - free mass. however, accounting for waist circumference, which is a better indicator of central adiposity, made little difference in our findings. furthermore, results from the framingham heart study have shown that bmi appears to be a good marker of differences in body composition (33). body weight at age 20 years was assessed by recall and is likely to introduce error rather than bias, therefore leading to an underestimation of the true association. however, in the nhs recalled body weight at age 18 years was highly correlated with measured weight (pearson coefficient r = 0.96) (34), so the degree of error may be small. finally, although we considered a wide range of potential confounders, it is possible that imprecision in measurement could lead to residual confounding, and there remains the possibility of confounding by other unconsidered factors. mechanisms explaining the direct relationship between pubertal timing and later metabolic risk are not well understood. we and others identified lin28b as the first genetic locus to be robustly associated with age at menarche (35). mice that overexpress lin28, a homolog of this gene, exhibit both later pubertal maturation and increased glucose uptake (36). in addition, they are resistant to obesity and type 2 diabetes when placed on a high - fat diet (36). this shows a direct link between genes controlling puberty timing and glucose homeostasis and provides a possible mechanistic link between puberty and diabetes risk. metabolic disease may be linked to differential exposure to sex hormones ; early menarche is associated with higher level of sex hormones (37) and decreased levels of sex hormone binding globulin (38), which may have a role in the pathogenesis of type 2 diabetes (39). in conclusion, women with younger than average age at menarche are more likely to develop type 2 diabetes, and this association is only partially explained by higher adult bmi. in contrast, women with older than average age at menarche have no reduction in diabetes risk. although avoidance of adult overweight and obesity may attenuate the risk of type 2 diabetes in women with early menarche, our findings suggest that strategies to prevent early menarche may be important in their own right.	objectiveyounger age at menarche, a marker of pubertal timing in girls, is associated with higher risk of later type 2 diabetes. we aimed to confirm this association and to examine whether it is explained by adiposity.research design and methodsthe prospective european prospective investigation into cancer and nutrition (epic)-interact case - cohort study consists of 12,403 incident type 2 diabetes cases and a stratified subcohort of 16,154 individuals from 26 research centers across eight european countries. we tested the association between age at menarche and incident type 2 diabetes using prentice - weighted cox regression in 15,168 women (n = 5,995 cases). models were adjusted in a sequential manner for potential confounding and mediating factors, including adult bmi.resultsmean menarcheal age ranged from 12.6 to 13.6 years across interact countries. each year later menarche was associated with 0.32 kg / m2 lower adult bmi. women in the earliest menarche quintile (811 years, n = 2,418) had 70% higher incidence of type 2 diabetes compared with those in the middle quintile (13 years, n = 3,634), adjusting for age at recruitment, research center, and a range of lifestyle and reproductive factors (hazard ratio [hr ], 1.70 ; 95% ci, 1.491.94 ; p < 0.001). adjustment for bmi partially attenuated this association (hr, 1.42 ; 95% ci, 1.181.71 ; p < 0.001). later menarche beyond the median age was not protective against type 2 diabetes.conclusionswomen with history of early menarche have higher risk of type 2 diabetes in adulthood. less than half of this association appears to be mediated by higher adult bmi, suggesting that early pubertal development also may directly increase type 2 diabetes risk.
cigarette butts and other tobacco product waste (tpw) items are the most ubiquitous form of litter worldwide, with an estimated 4.5 trillion of the estimated annual 6 trillion globally consumed cigarettes deposited as butts somewhere into the environment each year. this material comprises the largest percentage of waste (approximately 19 % 38 % of total waste products by count) collected globally during the coastal cleanups each year (see ocean conservancy data for 2012, [table 1 ]). at a local level, data from a city of san francisco street litter audit revealed that 24.6 % by count of all litter items collected were from tobacco products (including butts, wrappers, and packages).table 1top 10 marine debris items collected, international coastal cleanuprankdebris itemnumber of debris itemspercentage of total debris items1cigarettes / cigarette filters2,117,93119 % 2food wrappers / containers1,140,22210 % 3beverage bottles (plastic)1,065,17110 % 4bags (plastic)1,019,9029 % 5caps, lids958,8939 % 6cups, plates, forks, knives, spoons692,7676 % 7straws, stirrers611,0486 % 8beverage bottles (glass)521,7305 % 9beverage cans339,8753 % 10bags (paper)298,3323 % top 10 total debris items collected8,765,87180 % total debris items collected worldwide10,957,338100 % source : ocean conservancy, 2012 : http://www.oceanconservancy.org/our-work/international-coastal-cleanup/top-10-items-found-1.html. top 10 marine debris items collected, international coastal cleanup source : ocean conservancy, 2012 : http://www.oceanconservancy.org/our-work/international-coastal-cleanup/top-10-items-found-1.html. although it is difficult to estimate what percentage of the trillions of cigarettes consumed globally each year are discarded as waste, bans on indoor smoking may have exacerbated the accumulation of tpw outdoors. residents, business owners, and politicians have reported an increase in the quantity of cigarette butts littered after bans on indoor smoking took effect in local areas [35 ]. in the united kingdom, a report by the advocacy group keep britain tidy, estimated a 43 % increase in the number of littered cigarettes attributable to a ban on indoor smoking. keep britain tidy is supported by the tobacco industry, which in the past has used these data as an argument to undermine clean indoor air laws. one community (tacoma, washington, usa) conducted a litter study in 2010 and estimated that 1 in 3 smoked cigarettes are discarded into the environment. the american legacy foundation surveyed a national sample of 1000 smokers and found that most (74.1 %) admitted disposing of butts on the ground or out of a car window at least once in their lives. recent observational studies of smokers document that a majority (76.7 % ; 95 % ci 70.882.0 %) of 219 subjects littered their cigarette butts ; this behavior appears to be the norm among smokers in urban settings, even in the presence of appropriate waste receptacles. given that the weight of 20 cigarette filters is 0.12 ounces (3.4 gm), the estimated discarded waste from u.s. cigarette consumption in 2011 alone (292.8 billion) would weigh about 49.8 million kg ; this estimate does not include the weight of remnant tobacco, discarded packages, lighters, matches, and other tobacco products such as cigars, e - cigarettes, and smokeless tobacco. the casual disposal of tpw is a normative part of smoking and creates a potentially toxic environmental burden and potentially a risk to human health through environmental contamination (fig. 1). tpw is washed by the rain or by street cleaning from urban sidewalks and streets into the storm drains and then into the larger aquatic environment. this review will evaluate the potential for environmental toxicity due to chemicals leached out of the main tpw element (cigarette butts) ; we will propose policy options for mitigating tpw.fig. 1possible pathways for human health risks due to tpw possible pathways for human health risks due to tpw tpw is unlikely to be thought of as a toxic waste product by smokers, nonsmokers, manufacturers, or communities. further, it has not yet been considered as such by state or local environmental protection agencies. nonetheless, the numerous chemicals found in cigarette tobacco and generated when the tobacco burns [14 ] are likely to be harmful to the environment, including pesticides, herbicides, insecticides, fungicides, and rodenticides that are used in the agricultural production of tobacco products. in fact, many of the chemicals found in tobacco products are included in the environmental protection agency s toxic release inventory (tri) program. chemicals covered by the tri are those that cause 1 or more of the following : cancer or other chronic human health effects, significant adverse acute human health effects, or significant adverse environmental effects. tobacco contains nicotine (which is a chemical also used in plant pesticides), polyaromatic hydrocarbons, various carcinogenic nitrosamines, ammonia, acetaldehyde, formaldehyde, phenol, pyridines, acetone, and heavy metals, among other toxicants [17, 18 ]. for example, dane. found 3 previously undetected pesticides (flumetralin, pendimethalin, and trifluralin) in both mainstream and side stream cigarette smoke. cigarette filters are theoretically designed to absorb various constituents of cigarette smoke, including gaseous emissions and particulates, and, thus, if harmful chemicals in tobacco leaf are transferred to cigarette smoke, they could also be retained by cigarette filters and tobacco remnants in discarded butts. if these chemicals leach from discarded cigarette filters, they could potentially be toxic in various environments and could bio - accumulate in the human food chain. ethyl phenol is used in the tobacco industry as a flavoring agent and is present in cigarette smoke. thompson. identified a relatively high lethal concentration (lc) 50 (the concentration at which there is 50 % lethality in a bioassay) for ethyl phenol at 150 mg / l. although the concentration of ethyl phenol in mainstream smoke of a single cigarette is less than the lc50, it may still represent a potential toxicant in tpw. this toxicity might occur because cellulose acetate, the major component of cigarette filters, has been shown to effectively remove phenols from cigarette smoke [2326 ]. consequently, ethyl phenol may be present in the discarded cigarette filter at much higher concentrations than in cigarette smoke and may leach into the environment. approximately 0.6 % to 3.0 % of the dry weight of tobacco is nicotine, which has been used as a plant pesticide since the 15th century. it became a popular pesticide in the united states in the 1940s and 50s, but nicotine - based pesticides have not been sold in the united states since 2008. nicotine is known to be acutely toxic to animals and humans [30, 31 ]. an average cigarette yields approximately 12.3 mg of nicotine [32, 33 ] and, in this low concentration, nicotine acts as a stimulant ; it is the main chemical responsible for tobacco dependence. of note is that the nicotine content in cigarettes increased 1.6 % between 1998 and 2005. additives are reported to constitute 10 % of the weight of the tobacco in a cigarette and 4 % of the total weight of the cigarette. additives (such as menthol) make cigarette smoke more palatable and appealing to the consumer, especially those who are initially experimenting with smoking. humectants, for example, increase shelf life, and along with sugars, aid in the dissolution of nicotine, making smoke milder and easier to inhale. diethylene glycol, commonly used as automotive antifreeze, was added to cigarette tobacco as a humectant in the 1930s and removed as a result of public advocacy in the 1980s. this sequence of events, however, contradicts the usual expectation for consumer products such that safety is established for their content before a product is used. (interestingly, history is repeating itself now with the increasing popularity of e - cigarettes, which produce several vaporized chemicals, have no regulatory oversight, and contain varying amounts of nicotine.) cigarette tar, technically the material deposited on a filter when the smoke is passed through, is used as a catch - all term for the particulate components of cigarette smoke, except for alkaloid compounds such as nicotine. the discarded cigarette filter may retain many of these potential carcinogens that may be leached into the environment and transferred to aquatic organisms, some in the human food chain. few studies have addressed the toxic effects of tpw on living things, but aquatic ecosystems, such as shorelines and waterways, may be the most vulnerable settings, as the majority of land - based litter is ultimately deposited into these environments [17 ]. several studies have shown chemicals that leach from cigarette butts can be acutely toxic to aquatic organisms [11, 37, 38 ]. found that arsenic, nicotine, pahs, and heavy metals such as cadmium and lead are released into the environment as part of roadside tpw. in this study, roadside waste was collected in a japanese suburb prospectively over a 4-month period. the distribution, quantity, and types of waste were studied, as well as the environmental loading of pahs and other pollutants over time from this waste. environmental contamination by heavy metals, such as lead, copper, chromium, and cadmium, as well as by pahs (table 2) from cigarette butt waste, was confirmed.table 2polyaromatic hydrocarbons (pahs) in roadside cigarette butt waste and roadside soil, japan, 2009pahsconcentration (mg / kg wet)load potential (mg / km / month) cigarette buttsroadside soilfluorene0.0280.010.0023phenanthrene0.0780.140.0063anthracene0.0710.00580.00057pyrene0.0910.360.0074benzo(a)anthracene0.0260.0840.0021chrysene0.0440.110.0035benzo(b)fluoranthene0.0310.0880.0025benzo(k)fluoranthene0.0150.0550.0012benzo(a)pyrene0.0310.120.0025dibenzo(a, h)anthracene0.00650.0160.00053benzo(g, h, i)perylene0.0310.0930.0025total0.391.10.032 values of load potential were calculated using the quantity of cigarette butts per month, concentration of pahs, and length of sampling environment (3.2 km).reprinted with permission from waste management. moriwaki h, kitajima s, katahira k. waste on the roadside, poi - sute waste : its distribution and elution potential of pollutants into environment. polyaromatic hydrocarbons (pahs) in roadside cigarette butt waste and roadside soil, japan, 2009 values of load potential were calculated using the quantity of cigarette butts per month, concentration of pahs, and length of sampling environment (3.2 km). reprinted with permission from waste management. moriwaki h, kitajima s, katahira k. waste on the roadside, poi - sute waste : its distribution and elution potential of pollutants into environment. moerman and potts determined the concentration of al, ba, cd, cr, cu, fe, mn, ni, pb, sr, ti, and zn from cigarette butts in aqueous solution, including assessment of ph effects and soaking time on metal concentration leached [18 ]. all metals were detected in leachates 24 hours after cigarette butt addition, with the exception of cd, and were released at varying rates. this research suggests that cigarette butts are potential sources of heavy metal environmental contamination and have the potential to cause acute and chronic harm to various organisms. register followed the usepa s 1996 aquatic invertebrate acute toxicity test, freshwater daphnids protocol in performing toxicity bioassays of cigarette butts. cigarette butt leachate was prepared by allowing cigarette butts to soak in deionized water for 1 hour. this study found that leachates from smoked cigarette tobacco, smoked cigarette filters, and unsmoked cigarette filters were acutely toxic to the freshwater cladoceran daphnia magna at 0.125 and 0.25, 1, and 2, and greater than 16 cigarette butts / l (lc50), respectively. this test took place over a 48-hour period, and survival was the single endpoint. prepared cigarette butt leachate by placing cigarette butts in water and shaking for 1 hour. the lc50 of leachates from smoked cigarette butts, smoked cigarette filters, and unsmoked cigarette tobacco were reported for the freshwater cladoceran ceriodaphnia dubia at 0.05, 0.15, and 1.7 cigarette butts / l, respectively. this test took place over a 48-hour period and the sub - lethal effect, immobilization, was the single end point. in addition, lc50 for the marine bacterium vibrio fischeri by smoked cigarette butts, smoked cigarette filters, and unsmoked cigarette tobacco was 0.6, 1.25, and greater than 970 cigarette butts / l, respectively. this study of v. fischeri took place over a 30-minute period and the sub - lethal effect, bioluminescence, was the single endpoint. micevska. followed usepa protocols to perform daphnid bioassays and new south wales environmental protection agency protocols for bacterium bioassays. smoked cigarette butt leachates from 19 different brands of smoked cigarette butts were found to be toxic to ceriodaphnia dubia at concentrations between 8.9 and 25.9 mg butts / l (48-hour ec50 (immobilization) and to vibrio fischeri at concentrations between 104 and 832 mg butts / l (30-minute ec50 [bioluminescence ]). this study also completed a toxicity identification evaluation (tie) phase i and preliminary phase ii tests using usepa [40, 42, 43 ] protocols. these evaluations identified nicotine and ethyl phenol as the most likely causative toxicants in cigarette butt leachate. [17 ] analyzed cigarette butt - derived leachates for aquatic toxicity to saltwater and fresh water test fish. survival was the single endpoint, and data were analyzed to identify the lc50 of machine - smoked cigarette butt leachates in the laboratory environment. the lc50 for leachate from smoked cigarette butts (with remnant tobacco intact) was approximately 1.1 cigarette butts / l for both the marine pacific topsmelt (atherinops affinis) and the freshwater fathead minnow (pimephales promelas). leachate from smoked cigarette filters without tobacco remnants was less toxic than that from smoked cigarettes with tobacco remnants, with lc50 values of 4.1 and 5.5 cigarette butts / l, respectively for both fish species. unsmoked cigarette filters (without any tobacco remnants) were also found to be toxic, with lc50 values of 5.1 and 13.5 cigarette butts / l, respectively for both fish species. toxicity was found to be highest for smoked cigarettes with remnant tobacco, but also for only the smoked filter (without tobacco) and to a lesser extent for the unsmoked filter. in summary, cigarettes and their waste, deposited as discarded filters with remnant tobacco, contain many chemicals that may be harmful to the environment. these chemicals are sourced from agricultural treatments of tobacco plants, uptake from contaminated soils, additives instilled in the manufacturing process, the attached cellulose acetate filter, and combustion products generated in the course of smoking cigarettes. limited studies of toxicity from these products to aquatic organisms have been reported, but given the total global burden of tpw, additional research is needed to explore the actual risks that this toxic waste has on freshwater and marine environments, the fate of such chemicals in aquatic environments, as well as their potential for bioaccumulation and human health effects. several studies have shown chemicals that leach from cigarette butts can be acutely toxic to aquatic organisms [11, 37, 38 ].. found that arsenic, nicotine, pahs, and heavy metals such as cadmium and lead are released into the environment as part of roadside tpw. in this study, the distribution, quantity, and types of waste were studied, as well as the environmental loading of pahs and other pollutants over time from this waste. environmental contamination by heavy metals, such as lead, copper, chromium, and cadmium, as well as by pahs (table 2) from cigarette butt waste, was confirmed.table 2polyaromatic hydrocarbons (pahs) in roadside cigarette butt waste and roadside soil, japan, 2009pahsconcentration (mg / kg wet)load potential (mg / km / month) cigarette buttsroadside soilfluorene0.0280.010.0023phenanthrene0.0780.140.0063anthracene0.0710.00580.00057pyrene0.0910.360.0074benzo(a)anthracene0.0260.0840.0021chrysene0.0440.110.0035benzo(b)fluoranthene0.0310.0880.0025benzo(k)fluoranthene0.0150.0550.0012benzo(a)pyrene0.0310.120.0025dibenzo(a, h)anthracene0.00650.0160.00053benzo(g, h, i)perylene0.0310.0930.0025total0.391.10.032 values of load potential were calculated using the quantity of cigarette butts per month, concentration of pahs, and length of sampling environment (3.2 km).reprinted with permission from waste management. moriwaki h, kitajima s, katahira k. waste on the roadside, poi - sute waste : its distribution and elution potential of pollutants into environment. polyaromatic hydrocarbons (pahs) in roadside cigarette butt waste and roadside soil, japan, 2009 values of load potential were calculated using the quantity of cigarette butts per month, concentration of pahs, and length of sampling environment (3.2 km). moriwaki h, kitajima s, katahira k. waste on the roadside, poi - sute waste : its distribution and elution potential of pollutants into environment. moerman and potts determined the concentration of al, ba, cd, cr, cu, fe, mn, ni, pb, sr, ti, and zn from cigarette butts in aqueous solution, including assessment of ph effects and soaking time on metal concentration leached [18 ]. all metals were detected in leachates 24 hours after cigarette butt addition, with the exception of cd, and were released at varying rates. this research suggests that cigarette butts are potential sources of heavy metal environmental contamination and have the potential to cause acute and chronic harm to various organisms. register followed the usepa s 1996 aquatic invertebrate acute toxicity test, freshwater daphnids protocol in performing toxicity bioassays of cigarette butts. cigarette butt leachate was prepared by allowing cigarette butts to soak in deionized water for 1 hour. this study found that leachates from smoked cigarette tobacco, smoked cigarette filters, and unsmoked cigarette filters were acutely toxic to the freshwater cladoceran daphnia magna at 0.125 and 0.25, 1, and 2, and greater than 16 cigarette butts / l (lc50), respectively. this test took place over a 48-hour period, and survival was the single endpoint. prepared cigarette butt leachate by placing cigarette butts in water and shaking for 1 hour. the lc50 of leachates from smoked cigarette butts, smoked cigarette filters, and unsmoked cigarette tobacco were reported for the freshwater cladoceran ceriodaphnia dubia at 0.05, 0.15, and 1.7 cigarette butts / l, respectively. this test took place over a 48-hour period and the sub - lethal effect, immobilization, was the single end point. in addition, lc50 for the marine bacterium vibrio fischeri by smoked cigarette butts, smoked cigarette filters, and unsmoked cigarette tobacco was 0.6, 1.25, and greater than 970 cigarette butts / l, respectively. this study of v. fischeri took place over a 30-minute period and the sub - lethal effect, bioluminescence, was the single endpoint. micevska. followed usepa protocols to perform daphnid bioassays and new south wales environmental protection agency protocols for bacterium bioassays. smoked cigarette butt leachates from 19 different brands of smoked cigarette butts were found to be toxic to ceriodaphnia dubia at concentrations between 8.9 and 25.9 mg butts / l (48-hour ec50 (immobilization) and to vibrio fischeri at concentrations between 104 and 832 mg this study also completed a toxicity identification evaluation (tie) phase i and preliminary phase ii tests using usepa [40, 42, 43 ] protocols. these evaluations identified nicotine and ethyl phenol as the most likely causative toxicants in cigarette butt leachate. however, the concentrations of these chemicals in the leachates were not measured. 17 ] analyzed cigarette butt - derived leachates for aquatic toxicity to saltwater and fresh water test fish. survival was the single endpoint, and data were analyzed to identify the lc50 of machine - smoked cigarette butt leachates in the laboratory environment. the lc50 for leachate from smoked cigarette butts (with remnant tobacco intact) was approximately 1.1 cigarette butts / l for both the marine pacific topsmelt (atherinops affinis) and the freshwater fathead minnow (pimephales promelas). leachate from smoked cigarette filters without tobacco remnants was less toxic than that from smoked cigarettes with tobacco remnants, with lc50 values of 4.1 and 5.5 cigarette butts unsmoked cigarette filters (without any tobacco remnants) were also found to be toxic, with lc50 values of 5.1 and 13.5 cigarette butts / l, respectively for both fish species. toxicity was found to be highest for smoked cigarettes with remnant tobacco, but also for only the smoked filter (without tobacco) and to a lesser extent for the unsmoked filter. in summary, cigarettes and their waste, deposited as discarded filters with remnant tobacco, contain many chemicals that may be harmful to the environment. these chemicals are sourced from agricultural treatments of tobacco plants, uptake from contaminated soils, additives instilled in the manufacturing process, the attached cellulose acetate filter, and combustion products generated in the course of smoking cigarettes. limited studies of toxicity from these products to aquatic organisms have been reported, but given the total global burden of tpw, additional research is needed to explore the actual risks that this toxic waste has on freshwater and marine environments, the fate of such chemicals in aquatic environments, as well as their potential for bioaccumulation and human health effects. the discarded cigarette butt consists of unsmoked remnant tobacco, the paper wrap remnants, and the filter (99 % of cigarettes sold in the united states are filtered). in fact, as discussed above, the cigarette filter may compound the potential environmental effect of chemicals leached from butts because it is essentially a nonbiodegradable plastic collection of cellulose acetate fibers. most filters have 2 layers of paper and/or rayon wrapping, the porosity of which acts to control the amount of airflow (ventilation) through the filter. cigarettes also contain glues to hold the paper and filter together and alkali metal salts of organic acids (eg, sodium acetate) to maintain burning. although exposure to uv rays may eventually cause the filter to deteriorate into small pieces, the plastic particles and their toxicants may never disappear from water or soil and may continue leaching chemicals for up to 10 years [45, 46 ]. cigarette manufacturers have promoted light and low - tar cigarettes that imply a health claim for these filtered (or safer) cigarettes. however, smokers who switched to low - yield, filtered brands in the 1950s and 1960s did not benefit from reduced exposures to tar and nicotine because of changes in their puffing behavior (known as compensatory smoking,) and design changes in manufactured cigarettes. in the early 2000s, tobacco control researchers reported on how filter ventilation represents a dangerous, defective technology that could be regulated out of the cigarette market [48, 49 ]. the national cancer institute s comprehensive review of light and low - tar cigarettes concluded that epidemiological and other scientific evidence, including patterns of mortality from smoking - caused diseases, does not indicate a benefit to public health from changes in cigarette design and manufacturing over the last 50 years. under the 2009 u.s. family smoking prevention and tobacco control act tobacco companies are now prohibited in the united states from the advertising or labeling of tobacco products with the descriptors light, mild, or low. these terms have misled smokers about implied benefits of filtered cigarettes since their market entry, and, thus, claims about filters that reduce yield of tar have been found to be misleading and fraudulent. the large scale uptake of filtered cigarettes may have been associated with a reported histologic shift in predominant lung cancer type from squamous cell to adenocarcinoma [53, 54 ]. smokers may be discouraged from quitting as many still believe that filtered cigarettes protect their health, and young people may find it easier to inhale their first puff with filtered cigarettes. because of these issues, filters may be considered as defective products in terms of protecting smokers health. because of their relative nonbiodegradability and the preliminary research indicating the toxicity of tpw to a variety of aquatic organisms, the filter tip as product source of environmental contamination may be a target for product alteration under the principle of extended producer responsibility (epr see section 2, below). although anti - littering laws exist that may apply to tpw in many jurisdictions, most enforcement is directed at large littering problems such as illegal dumping. enforcement of such laws directed toward individual smokers tpw littering is impractical and has been clearly ineffective in preventing the accumulation of tpw. research on both the extent and nature of the tpw problem, the potential chemical impact on the environment, wildlife, and humans, the defectiveness of filtered cigarettes, and the tobacco industry s efforts in avoiding responsibility for tpw environmental contamination is needed. the findings would strengthen the evidence base for taking action on this global environmental problem. tpw mitigation requires novel environmental interventions and new partnerships between tobacco control and environmental groups. many of these interventions would serve to reduce the social acceptability of smoking while reducing the environmental burden of tpw. based on this review of the tpw problem, the following policy approaches are suggested : increase public awareness about the toxicity and other environmental impacts of tpwenvironmental advocacy joined with tobacco control advocacy can be an effective approach to the tpw issues. feared such an alliance among these different camps, and has sought to invest in environmental advocacy that emphasizes tpw cleanups, hand - held ashtrays, butt receptacle installations, and other downstream approaches. mobilizing public opinion on exposure to second hand smoke has resulted in myriad local and state regulations to prevent this environmental health hazard (see : http://www.no-smoke.org/goingsmokefree.php?id=519). thus, similar advocacy, with mobilization of environmental groups, will be necessary to implement effective policies to prevent and mitigate the environmental burden of tpw.apply the extended producer responsibility principle to tpwepr requires total life cycle environmental improvements, placing liability, economic / financial, physical, and informational responsibilities onto the manufacturers of the waste product. product stewardship (ps) overlaps principles of epr but extends responsibility to all parties involved in the life cycle of the product. in the case of tpw, this would include sellers, distributors, and perhaps even facilitators such as bars and restaurants that allow outdoor smoking on their premises. a key focus of both epr and ps involves postconsumer take - back and final disposal. this could involve a deposit - return scheme or simply require manufacturers to take back all discarded tpw. epr has been emphasized in europe since the early 1990 s, and it was incorporated into official european union environmental policy in 2002. however, epr regulations have not yet been considered at the federal level in the united states. nevertheless, as of october 2010, 32 us states have enacted epr laws that mandate costs of recycling or safe disposal of consumer products to be covered by the manufacturers of these products ; these products include batteries, carpets, cell phones, other electronics, fluorescent lighting, mercury - containing thermostats, paint, and pesticide containers.apply the precautionary principle to tpwthis principle implies that it is not necessary to have identified each and every tpw toxic chemical and its potential health effects before regulating tpw and is a hallmark of environmental health policy in the united states and elsewhere. such policies re - focus the concern on tpw upstream from the consumer, community, and environment to the manufacturers and distributors of tobacco products.label cigarette packageswith evidence for the effectiveness of cigarette package warning labels, additional package labels and public information about the toxicity of discarded butts may be considered. these would include specific instructions for the safe disposal of the toxic waste product and brief information about why this disposal is important. these labels would contribute to public information about tpw toxicity.deposit/return schemesas for deposit schemes, oregon and several other u.s. states have implemented deposit - return schemes on glass and metal beverage containers as a way to reduce the environmental burden of discarded beverage containers. these laws impose a consumer - paid monetary deposit on specified items that is reimbursed when the item is returned. the oregon law reduced litter and increased recycling, with return rates of up to 90 % and reduction of roadside beverage container litter from 40 % to < 6 % of total litter. similarly, cigarettes could be sold with a butt deposit to be refunded when the butts are returned to the vender or perhaps to a hazardous waste disposal facility. this could encourage smokers to behave more responsibly and could provide income to butt retrievers. it would also increase the costs of smoking, thus having a beneficial effect on cigarette consumption. further, vendor reluctance to accept returned butts (due to aesthetic, logistical, or storage problems) might reduce the number of outlets selling cigarettes. recycling schemes for tpw have been proposed by a variety of environmental groups and commercial entities, including those funded by the tobacco industry [60, 61].cost recoverytobacco litter abatement costs to cities are substantial, even when the costs of potential environmental toxicity and potential effects on tourism are excluded. one solution to reducing toxic waste from computers, telephones, and televisions is a consumer - funded advanced recycling fee (arf) ; this is assessed at the time of purchase for these products and it is meant to pay for the costs of recycling and disposing properly of any non - recyclable material ; california and maine have implemented such fees on electronics.total public litter abatement costs to a city range from $ 3 to $ 16 million. tpw comprises 23 % 36 % of all visible litter, and, thus, the costs borne by the public for tpw range from $ 1 to $ 5 million for a typical city. the costs of mitigating this externality of tpw in a mid - sized metropolitan area (such as has been implemented in san francisco) can be offset by a fee of approximately $ 0.20$0.40 per pack. these fees would then increase the cost of cigarettes, thereby reducing consumption.litigationlitigation brought by states against the tobacco industry has focused mainly on recovering the state - funded health care costs attributable to smoking. as for environmental costs, the tobacco industry could be held responsible for cleanup and nuisance costs associated with tobacco products. epr may then be invoked to address tobacco industry responsibility. under this principle, litigation has been pursued against manufacturers of several other products that have damaged the environment through class action lawsuits. these suits are typically based on 2 legal theories : negligence and nuisance. the primary basis for a negligence case would be proof of the defendant s wrongful conduct in failing to prevent environmental damages from normal usage of their products (again, invoking the precautionary principle). right of quiet enjoyment that is disrupted such that a tort is being committed. litigation against the tobacco industry by state or local entities may be considered as a means to recover environmental cleanup and nuisance costs.product changessome hazardous products have been banned entirely by state and local authorities through restrictions on sales and distribution. these include pop - tops on aluminum cans, plastic tampon applicators, and non - fire - safe children s clothing. thus, states could consider banning the sale of filtered cigarettes if these were to be considered an environmental hazard and nuisance burden. (in fact, a bill has been submitted in 2014 to the california legislature to ban the sale of single - use filtered cigarettes for environmental reasons.)there may in fact be significant positive behavioral and health impacts if the sale of filtered cigarettes were prohibited because such prohibition may reduce consumption of cigarettes in general or smoking initiation among children by making the cigarette less palatable. filters are a marketing tool and not a health device, and, thus, banning them on environmental grounds may make sense, both as an environmental intervention and as a public health intervention.the issue of whether there is a safe cigarette for consumers has been laid to rest, and the environmental burden of tpw will benefit from the absence of the defective cellulose acetate filter. however, one may wonder whether the family smoking prevention and tobacco control act signed into law in 2009 would preempt state or local actions to ban the sale of filtered cigarettes. this legislation in fact preserves the rights of states to raise tobacco tax rates, implement and enforce comprehensive smoke - free laws, adequately fund strong state tobacco prevention programs, enhance access to smoking cessation, and take any actions to restrict the sale and distribution of tobacco products. thus, banning the sales of filtered cigarettes may be considered by states as a means of significantly reducing the tpw environmental and economic burden at the state or local level. increase public awareness about the toxicity and other environmental impacts of tpw environmental advocacy joined with tobacco control advocacy can be an effective approach to the tpw issues. feared such an alliance among these different camps, and has sought to invest in environmental advocacy that emphasizes tpw cleanups, hand - held ashtrays, butt receptacle installations, and other downstream approaches. mobilizing public opinion on exposure to second hand smoke has resulted in myriad local and state regulations to prevent this environmental health hazard (see : http://www.no-smoke.org/goingsmokefree.php?id=519). thus, similar advocacy, with mobilization of environmental groups, will be necessary to implement effective policies to prevent and mitigate the environmental burden of tpw. apply the extended producer responsibility principle to tpw epr requires total life cycle environmental improvements, placing liability, economic / financial, physical, and informational responsibilities onto the manufacturers of the waste product. product stewardship (ps) overlaps principles of epr but extends responsibility to all parties involved in the life cycle of the product. in the case of tpw, this would include sellers, distributors, and perhaps even facilitators such as bars and restaurants that allow outdoor smoking on their premises. a key focus of both epr and ps involves postconsumer take - back and final disposal. this could involve a deposit - return scheme or simply require manufacturers to take back all discarded tpw. epr has been emphasized in europe since the early 1990 s, and it was incorporated into official european union environmental policy in 2002. however, epr regulations have not yet been considered at the federal level in the united states. nevertheless, as of october 2010, 32 us states have enacted epr laws that mandate costs of recycling or safe disposal of consumer products to be covered by the manufacturers of these products ; these products include batteries, carpets, cell phones, other electronics, fluorescent lighting, mercury - containing thermostats, paint, and pesticide containers. precautionary principle to tpw this principle implies that it is not necessary to have identified each and every tpw toxic chemical and its potential health effects before regulating tpw and is a hallmark of environmental health policy in the united states and elsewhere. such policies re - focus the concern on tpw upstream from the consumer, community, and environment to the manufacturers and distributors of tobacco products. label cigarette packages with evidence for the effectiveness of cigarette package warning labels, additional package labels and public information about the toxicity of discarded butts may be considered. these would include specific instructions for the safe disposal of the toxic waste product and brief information about why this disposal is important. states have implemented deposit - return schemes on glass and metal beverage containers as a way to reduce the environmental burden of discarded beverage containers. these laws impose a consumer - paid monetary deposit on specified items that is reimbursed when the item is returned. the oregon law reduced litter and increased recycling, with return rates of up to 90 % and reduction of roadside beverage container litter from 40 % to < 6 % of total litter. butt deposit to be refunded when the butts are returned to the vender or perhaps to a hazardous waste disposal facility. this could encourage smokers to behave more responsibly and could provide income to butt retrievers. it would also increase the costs of smoking, thus having a beneficial effect on cigarette consumption. further, vendor reluctance to accept returned butts (due to aesthetic, logistical, or storage problems) might reduce the number of outlets selling cigarettes. recycling schemes for tpw have been proposed by a variety of environmental groups and commercial entities, including those funded by the tobacco industry [60, 61 ]. tobacco litter abatement costs to cities are substantial, even when the costs of potential environmental toxicity and potential effects on tourism are excluded. one solution to reducing toxic waste from computers, telephones, and televisions is a consumer - funded advanced recycling fee (arf) ; this is assessed at the time of purchase for these products and it is meant to pay for the costs of recycling and disposing properly of any non - recyclable material ; california and maine have implemented such fees on electronics. total public litter abatement costs to a city range from $ 3 to $ 16 million. tpw comprises 23 % 36 % of all visible litter, and, thus, the costs borne by the public for tpw range from $ 1 to $ 5 million for a typical city. the costs of mitigating this externality of tpw in a mid - sized metropolitan area (such as has been implemented in san francisco) can be offset by a fee of approximately $ 0.20$0.40 per pack. litigation brought by states against the tobacco industry has focused mainly on recovering the state - funded health care costs attributable to smoking. as for environmental costs, the tobacco industry could be held responsible for cleanup and nuisance costs associated with tobacco products., litigation has been pursued against manufacturers of several other products that have damaged the environment through class action lawsuits. the primary basis for a negligence case would be proof of the defendant s wrongful conduct in failing to prevent environmental damages from normal usage of their products (again, invoking the precautionary principle). right of quiet enjoyment that is disrupted such that a tort is being committed. litigation against the tobacco industry by state or local entities may be considered as a means to recover environmental cleanup and nuisance costs. some hazardous products have been banned entirely by state and local authorities through restrictions on sales and distribution. these include pop - tops on aluminum cans, plastic tampon applicators, and non - fire - safe children s clothing. thus, states could consider banning the sale of filtered cigarettes if these were to be considered an environmental hazard and nuisance burden. (in fact, a bill has been submitted in 2014 to the california legislature to ban the sale of single - use filtered cigarettes for environmental reasons.) there may in fact be significant positive behavioral and health impacts if the sale of filtered cigarettes were prohibited because such prohibition may reduce consumption of cigarettes in general or smoking initiation among children by making the cigarette less palatable. filters are a marketing tool and not a health device, and, thus, banning them on environmental grounds may make sense, both as an environmental intervention and as a public health intervention. the issue of whether there is a safe cigarette for consumers has been laid to rest, and the environmental burden of tpw will benefit from the absence of the defective cellulose acetate filter. however, one may wonder whether the family smoking prevention and tobacco control act signed into law in 2009 would preempt state or local actions to ban the sale of filtered cigarettes. this legislation in fact preserves the rights of states to raise tobacco tax rates, implement and enforce comprehensive smoke - free laws, adequately fund strong state tobacco prevention programs, enhance access to smoking cessation, and take any actions to restrict the sale and distribution of tobacco products. thus, banning the sales of filtered cigarettes may be considered by states as a means of significantly reducing the tpw environmental and economic burden at the state or local level.	cigarette butts and other tobacco product wastes (tpw) are the most common items picked up in urban and beach cleanups worldwide. tpw contains all the toxins, nicotine, and carcinogens found in tobacco products, along with the plastic nonbiodegradable filter attached to almost all cigarettes sold in the united states and in most countries worldwide. toxicity studies suggest that compounds leached from cigarette butts in salt and fresh water are toxic to aquatic micro - organisms and test fish. toxic chemicals have also been identified in roadside tpw. with as much as two - thirds of all smoked cigarettes (numbering in the trillions globally) being discarded into the environment each year, it is critical to consider the potential toxicity and remediation of these waste products. this article reviews reports on the toxicity of tpw and recommends several policy approaches to mitigation of this ubiquitous environmental blight.
astasia is a clinical postural disorder characterized by the inability to stand without external support despite having sufficient muscle strength. this symptom can be observed in post - stroke patients who have experienced thalamic hemorrhage or ischemia1,2,3, and it is frequently accompanied by falling toward the contralesional side without exhibiting pushing behavior, which is a tendency to actively push away from the ipsilesional side4. it has been reported that symptoms of astasia tend to spontaneously disappear several days after stroke onset1,2,3. it is thought that vertical perception has a pivotal role in maintaining upright posture in humans. one of the important vertical perceptions is subjective postural vertical (spv), defined as bodily vertical perception mainly derived from somatosensory information5. the authors of previous studies have suggested that the functionality of spv influences the chance of postural disorders in post - stroke patients6. indeed, in post - stroke patients, the correlation between the degree of spv bias and that of falling toward the contralesional side is very strong6. based on these lines of evidence, it was hypothesized that abnormal spv can be one of the functional mechanisms underlying postural disorders in astasia patients. in the present study, this hypothesis was tested in a single case study of a post - stroke patient with prolonged astasia. the patient was a 72-year - old man diagnosed with a right thalamic hemorrhage and post - stroke astasia. the patient s spv and ability to stand were assessed and confirmed an abnormality, especially in spv. then, to further elucidate the causal relationship between the abnormal spv and the postural disorder, a 1 week program of standing training aimed at regulating spv was applied and its effect on vertical perception and standing ability was evaluated. during this training, the patient was asked to maintain his body orientation vertical in reference to complementary somatosensory inputs arising from the ipsilesional upper limb. several previous studies demonstrated that somatosensory inputs arising from a hand or finger, by lightly touching it to a stable object, reduce postural sway during standing in healthy subjects7, as well as in post - stroke patients8. these findings seem to imply that somatosensory input from the upper limb can be used as supporting information conveying body orientation7, 9, 10, which may contribute to regulating somatosensory - dependent vertical perception (i.e., spv). therefore, it was expected that this standing training could help the astasia patient regulate abnormal spv, and thereby lead to an improvement in his postural disorder. a 72-year - old right - handed man diagnosed with right thalamic hemorrhage including the posterolateral nucleus participated in the study. the patient started receiving standard physical therapy such as sitting, sit - to - stand, and gait training on the stroke care unit 2 days after stroke onset for about an hour per day. sixteen days after onset, the patient was transferred to the recovery rehabilitation unit and continued the physical rehabilitation and standard physical therapy for about 3 hours per day. fifty days after onset, he still had mild hemiplegia and severe somatosensory dysfunction of the upper and lower limbs on the contralesional side (table 1table 1.the patient s physical and cognitive function at each phasebefore the baselineafter the baselineafter the intervention sias - motor (hip / knee / ankle)4/4/44/4/44/4/4knee extension force (left / right / sum total) (nm / kg) 0.26/0.38/0.64 not assessed0.28/0.36/0.65sias - sensory (upper / lower)0/00/01/0mas (upper / lower)1/11/11/1sara (left / right)nose - finger test0/00/00/0heel - shin slide test1/01/01/0mmse20not assessed20scp (standing) (section a / b / c)1/0/01/0/00.25/0/0fim motor total464648bed transfer445toilet transfer445sias : stroke impairment assessment scale ; mas : modified ashworth scale ; sara : scale for assessment and rating of ataxia ; mmse : mini mental state examination ; scp : scale of contraversive pushing). in addition, he was not able to stand and gait was not possible without assistance because of a tendency to fall toward the contralesional side despite not having any pusher behavior (his total score on the scale of contraversive pushing was less than the cut off point11). it was thought that this was not due to muscle weakness on the contralesional side, because the sum of knee extension force of both sides (0.64 nm / kg) was higher than the cut - off point for sit - to - stand independence (0.40 nm / kg)12. it was also assumed that the patient s postural disorders were not directly caused by severe somatosensory dysfunction since it has been shown that humans can stand alone with complete somatosensory loss13. accordingly, the patient was diagnosed with post - stroke astasia. sias : stroke impairment assessment scale ; mas : modified ashworth scale ; sara : scale for assessment and rating of ataxia ; mmse : mini mental state examination ; scp : scale of contraversive pushing for measuring spv, the patient was seated on a tilt table (ua - a501, og giken, japan) with his eyes closed. a physical therapist supported the patient s body with his body from behind, acting like the backrest of a chair without touching the patient with his hands. another therapist carefully checked the patient s posture from his front in order to keep his torso and head in a straight line. for the assessment, the tilt table was passively tilted either from the right (ipsilesional) toward the left or from the left (contralesional) toward the right with a constant velocity (2.5 degrees / s) in the roll plane. the initial tilting angle was set as either 5 degrees toward the right (5 degree) or left (5 degree) with respect to the earth vertical. while the table was tilting, the patient was required to verbally indicate the time when he felt his body was vertical. the table s tilting angle (i.e., the angle from the horizontal line) at this time was recorded as the index for spv. because of the tendency to feel that the body is vertical when the body was still leaning to the side of the initial tilt5, 14, 15, ipsilesional (spv - i) and contralesional tilt conditions (spv - c) were separately assessed. spv - i corresponded to the condition in which the table started tilting from the right (ipsilesional) to the left, whereas spv - c corresponded to the one from the left (contralesional) to the right. both spv - i and spv - c were evaluated five times in a randomized order. the patient was instructed to keep his eyes closed throughout the measurement in order not to receive visual feedback about his position. since this assessment used different devices from those used in previous studies6, 14, the intra - rater reliability of this assessment was determined by evaluating intra - class correlation coefficients (iccs) with eight right - handed healthy subjects (age, 25.5 2.9, mean sd). spv was measured five times per subject and the icc was calculated using spss (version 22, ibm). the icc value was 0.95 for the condition from the right and 0.85 for the condition from the left, indicating the high reliability of this method of measurement. the measurement was performed under four different conditions : eyes open or closed with or without holding a side cane. for the measurement with eyes opened, specific visual reference (e.g. a vertical bar) was not presented. each condition was measured three times and the longest duration was selected for each condition. first, the 1 week baseline period occurred. in this week, standard physical therapy including sit - stand, standing, transfer, and gait training was provided. during gait training, the patient wore a knee - ankle - foot orthosis (kafo) while holding a cane or parallel bars. occupational therapy, mainly focusing on daily activities such as toilet and dressing training, was also performed each day. the total rehabilitation time was 3 hours per day, 7 days per week. spv, standing duration, and physical and cognitive function were assessed before the therapy on the first day and after the therapy on the last day. in the second week (intervention period), standing training (body - tilting training) was added (fig. the patient was randomly tilted toward either ipsilesional (right) or contralesional (left) side, then the tilt table tilted toward opposite direction until he verbally indicated that his body orientation reached upright. the subject aligned his body orientation in reference to magnitude of somatosensory inputs from his ipsilesional upper limb. left : when his body orientation was upright, the magnitude of somatosensory inputs was large, right ; when his body orientation was tilted, the magnitude of those was small.). the patient stood upright with a kafo on the contralesional leg beside the wall on his non - paretic ipsilesional side. the patient kept the ipsilesional arm close to his body while extending the elbow. then, the patient was instructed to keep the forearm, upper - arm, and fingers touching the wall, in order for him to recognize the relationship between the actual vertical in standing with the magnitude of somatosensory inputs from the upper limb. next, the patient actively tilted his body away from the wall. at this time, he was instructed to keep at least his fingers touching the wall to recognize the relationship between torso listing and reduced haptic inputs from the non - paretic ipsilesional upper limb. it was expected that, through this training, the patient could recognize his body orientation in reference to the magnitude of somatosensory inputs from the non - paretic ipsilesional upper limb. in the middle of the week, the training setting was changed to reduce the contribution of visual information. during the first 3 days, the patient performed this training about 2 meters ahead of a vertical bar, which could provide the patient with a salient visual vertical reference. over the next 4 days, the patient was asked to perform the training with his eyes closed and he was given verbal feedback about his body orientation for every trial. during the intervention period, sit - to - stand and standing training were replaced with body - tilt training, but gait training was continued. thus, total rehabilitation time in this week was comparable to that in the baseline period. spv, standing duration, physical function, and disability were assessed after the therapy on the last day of the week. the patient was randomly tilted toward either ipsilesional (right) or contralesional (left) side, then the tilt table tilted toward opposite direction until he verbally indicated that his body orientation reached upright. the subject aligned his body orientation in reference to magnitude of somatosensory inputs from his ipsilesional upper limb. left : when his body orientation was upright, the magnitude of somatosensory inputs was large, right ; when his body orientation was tilted, the magnitude of those was small. before the baseline period, both spv - i and spv - c were biased toward the ipsilesional and the contralesional side, respectively (table 2table 2.the patient s spv and standing duration at each phasebefore the baselineafter the baselineafter the intervention spv - i (degree)2.7 0.30.3 0.30.4 0.8spv - c (degree)3.0 0.42.7 0.30.8 0.4standing duration (sec)eyes open (with / without cane)5/020/037/34eyes closed (with / without cane)0/05/035/5data are presented in the form meanstandard error. for spv - i and spv - c, positive value correspond to ipsilesional (right) tilt relative to vertical, and negative value correspond to contralesional (left) tilt relative to vertical.). the absolute value of both spv conditions was greater than that in the younger healthy subjects measured for the icc (0.2 0.9 and 0.3 0.9 degrees under the conditions where the table started tilting from the right and left, respectively). at the end of the baseline period, spv - i showed greater improvement, namely getting closer to zero, and remained close to zero until the end of the intervention period. in contrast, spv - c was still biased at the end of the baseline period, but finally showed improvement after the intervention period. data are presented in the form meanstandard error. for spv - i and spv - c, positive value correspond to ipsilesional (right) tilt relative to vertical, and negative value the subject was able to keep standing for less than 5 s with his eyes open before the baseline period. after the baseline period, standing duration was slightly increased, especially under conditions with the eyes open. standing duration under for the assessment of physical functions, functional independence measure (fim) scores for bed and toilet transfer were improved after the intervention period (from 4 to 5, table 1). the present study investigated whether postural disorders observed in a post - stroke astasia patient were attributed to abnormal spv. this abnormality improved through a 1-week period of body - tilting training utilizing complementary somatosensory inputs from the upper limb. in line with this improved spv, standing duration and activities of daily living (i.e., transferring) showed greater improvement after the 1 week intervention period. these findings suggest that abnormal spv can be one of the functional mechanisms underlying postural disorders in post - stroke astasia patients, and support the effectiveness of the intervention. before the baseline period, both spv - i and spv - c were biased more greatly than that of younger healthy subjects. these results support the hypothesis that astasia observed in post - stroke patients is accompanied by abnormal vertical perception, mainly in spv. in the present study, the body - tilting training was applied to regulate abnormal spv and investigated its effectiveness for postural disorders, in order to further investigate the causal relationship between them. interestingly, abnormal spv - i improved during the week of the baseline period when standard physical treatments were applied, whereas spv - c remained biased after the baseline period but improved after the week of the intervention period when the body - tilting training was applied. in concordance with the improved spv - c, a previous study indicated that post - stroke patients show abnormal vertical perception, especially when their body orientation is tilted toward the contralesional side compared to when it is tilted toward the ipsilesional side16, 17. this suggests that the abnormality is more robust in spv - c than in spv - i, corresponding to the present results that spv - c remained biased after application of standard physical therapy. however, biased spv - c and postural disorders seem to be effectively improved through body - tilting training with complementary somatosensory inputs from the upper limb. somesthetic (somatosensory) graviceptive inputs play a crucial role in the perception of body orientation in external space6, 18, 19. light sensory inputs from touching a static object with the upper limb seemed to provide enough additional useful information about body orientation to reduce postural sway during standing7, 8. considering the present post - stroke astasia patient, we speculate that complementary somatosensory inputs from the upper limb could be used as a reference for regulating abnormal perception of body orientation (i.e., abnormal spv), which resulted in improvements in standing balance, prolonging standing duration and improving transferring ability in daily living. one may claim that vestibular inputs would also change by the training, which might somehow affect spv and postural control. however, it has been suggested that spv was mainly derived from bodily somatosensory information, but not vestibular graviceptive information5, 6. thus, we assume that possible changes of vestibular inputs during the training would less effective on improvements of abnormal spv bias and postural disorder. moreover, it is possible that improvements in vertical perception and postural disorders are due to spontaneous recovery rather than the effect of body - tilting training. however, we consider that the possibility of spontaneous recovery is less plausible, given the fact that astasia symptoms in the present case had persisted well beyond several days after stroke onset, when most patients show spontaneous recovery from this symptom1,2,3, and that his vertical perception and postural disorders were greatly improved after the 1 week intervention period as compared to those after the 1 week baseline period. the present patient had a lesion in the right thalamus, including the posterolateral nucleus as seen in other post - stroke astasia patients in previous studies1, 2. the posterolateral thalamus functions to process both vestibular graviceptive20 and somesthetic graviceptive information6. thus, the posterolateral thalamus is thought to be a part of a second graviceptive system, which contributes to controlling body orientation21. therefore, it is highly plausible that post - stroke patients who have posterolateral thalamus lesions frequently present with postural disorders. while it has been reported that symptoms of astasia tend to spontaneously disappear several days after stroke onset1,2,3, the present case had symptoms more than 50 days after the stroke. it might be that the present case had severe somatosensory dysfunction in the contralesional side compared with the previous astasia cases, in which somatosensory dysfunction in the contralesional side was absent or mild. as mentioned above, therefore, it seems that severe somatosensory dysfunction on one side of the body might delay the improvement of abnormal vertical perception, which might result in prolonged postural disorders, as in the present case. our study demonstrated the functional relationship between abnormal spv and postural disorders in a post - stroke astasia patient. however, it should be noted that the present astasia patient might be a unique case, because symptoms of astasia spontaneously tend to disappear several days after stroke onset1,2,3, while the present case had prolonged astasia symptoms more than 50 days after stroke. thus, it remains unclear whether the abnormal vertical perception found in the present case is a common dysfunction observable in other astasia patients as well. to systematically investigate this relationship and the effectiveness of our standing training, further investigation with a large number of patients is required. despite this, we believe that the present case report provides useful insights into the clinical condition of post - stroke astasia patients and suggests a possible option to help treat these patients.	[purpose ] post - stroke astasia is an inability to stand without external support despite having sufficient muscle strength. however, the dysfunction underlying astasia is unclear. we tested the hypothesis that astasia is the result of an abnormal bias in vertical perception, especially subjective postural vertical (spv), mediated by somatosensory inputs. [subjects and methods ] a patient with a right posterolateral thalamus hemorrhage had a tendency to fall toward the contralesional side during standing after 8 weeks of treatment. spv, standing duration, and physical function were evaluated before and after a 1 week standard rehabilitation baseline period, and after a 1 week intervention period, where standing training requiring the patient to control his body orientation in reference to somatosensory inputs from his ipsilateral upper limb was added. [results ] spv was biased toward the contralesional side before and after the 1 week baseline period. however, spv improved into the normal range and he could stand for a longer duration after the intervention period. [conclusion ] this case suggests that abnormal spv is one of the functional mechanisms underlying astasia, and it indicates the effectiveness of standing training with somatosensory information to improve abnormal spv and postural disorders.
a 34-year - old male presented with proptosis of the left eye (os) in november 2014 since 2 years with occasional pain and blurred vision. best - corrected visual acuity was 6/6, n6 right eye (od), 6/18 with pinhole improvement to 6/9, n10 (os). axial proptosis was noted with hertel 's exophthalmometry measurement of 14 mm in the od and 20 mm in os. there were no ocular motility restrictions in either eye. slit lamp and fundus examination revealed normal anterior and posterior segments in both the eyes (ou). computerized tomography scan of the orbit and brain in os revealed a retrobulbar mass, well delineated and intraconal in location, displacing the optic nerve medially [fig. 1 ]. (a) computerized tomography scan of brain and orbit with intraconal orbital mass and (b) gross bluish black encapsulated cavernous hemangioma left sided lateral orbitotomy under general anesthesia was planned and carried out under proper consent. the specimen was sent to ocular pathology laboratory where encapsulated bluish black mass measuring (22.1 mm 16.18 mm 12.24 mm) was documented [fig. 1 ]. grossly, the tumor showed surface vascularity over the capsule. surface vessels were in different dimensions and were also seen piercing the capsule. after dissecting a small portion of capsule, numerous tecs were seen, some of which formed a pattern of endothelial podosome rosette which was documented. sprouting of tec and the blood vessels with intracellular gap junctions among the tecs was observed. endothelial cells on the surface of the blood vessels and tec were seen under high power objective illumination of microscope (axioskop 40 with axiocam mrc camera). microscopic appearance showed capsulated vascular tumor with numerous dilated blood vessels of varying sizes filled with red blood cells and lined by endothelial cells. some of the endothelial cells showed sprouting of its extension, which were also documented under microscope [figs. 2 and 3 ]. pericytes and fibrocytes with varied morphology were seen in intervening stroma. some of the lymphocytic collections were seen at the edges of the lumen of the blood vessels. all the microscopic findings were consistent with cavernous hemangioma, and interesting finding of surface blood vessel and tecs was similar to some of the established cell culture tumor model in vitro experimental pathology. immunohistochemistry (ihc) of the tumor showed cd31, cd34, actin, and vimentin positive. sprouting of end of small vessels in gross with suspected angiogenesis (400, unstained specimen) outgrowth of small twig of sprouting from endothelial surface of blood vessel (h and e 400) sprouting angiogenesis is an enlargement of new capillary blood vessels arising out of preaccessible ones. it was long being discussed that how a new vessel could arise from the exiting one when the metabolic needs in the adjoining tissue is similar. it has been documented in various conditions such as neovascularization in diabetes, pannus in synovium of joints in rheumatoid arthritis, vascular system complications, and in tumor biology. in tumors, sprouting angiogenesis is not only seen in primary tumors but also in micrometastasis and obvious metastasis. in all these conditions, sprouting angiogenesis was seen in oxygen deficient area where angiogenesis starts with activation of endothelial cells by various growth factors that bind to the specific sites. extracellular matrix and bm surrounding the endothelial cells despoiled locally by activated factors. by the process of polarization, the migrating endothelial cells are created within the lumen, and immature blood vessels are formed. the entire development of angiogenesis is firmly prescribed by positive and negative regulators, the stability of which determined the level of ongoing angiogenesis. in 1980, thereafter, vascular endothelial growth factor played a major role in prompt of various blood vessels in diverse organs. our case was a 34-year - old male presented with proptosis in os for 2 years. after surgery, the specimen was meticulously examined for its small vascular pattern over that tumor 's capsule and its surrounding. tecs were important morphological structures that were documented and compared with the endothelial cells of the surface blood vessels. a pattern of endothelial podosome rosette [fig. 4 ] was another pathological structure that was seen and adjoining to them, the tec showed intracellular gap junctions [figs. 5 and 6 ]. sprouting of blood vessels could be seen in very high power objective of microscope and compare with stained section. ihc for cd34 showed positivity demarcating the structures of endothelial cells of the blood vessels. structure simulating podosome rosette formed by tumor endothelial cell and small blood vessels encircling the rosette comparative size of tumor endothelial cell and endothelial cells of small blood cells the gap junction of tumor endothelial cell in direct examination of the tissue under high power objective of compound microscope (400) we have seen in our case that there was a strong pathological evidence of tumor angiogenesis with sprouting of the blood vessels. tec which was mostly evident in the model conceptualized for tumor angiogenesis play a significant role in the biology of vascular tumor such as cavernous hemangioma.	cavernous hemangioma is the most common orbital tumor in adult. there is lot of literatures for clinicopathological features of this tumor. these tumors had been studied for the model of angiogenesis in many of the experimental setups. we present a case of 34-year - old male with this tumor in the left eye with computerized tomography evidence. postsurgical laboratory findings gave interesting evidence of tumor angiogenesis with tumor endothelial cells and sprouting of the small vessels endothelial cells. podosome rosette could be conceptualized from the characteristic patterns seen in the tumor.
the prevalence of placenta previa has been recently estimated to be approximately 0.5% of all pregnancies, and this increase correlates to the elevated cesarean section rate1. placenta previa is a major cause of maternal morbidity and mortality because of the associated massive antepartum and intrapartum hemorrhage 2, 3. moreover, placenta previa is associated with preterm delivery, with the neonatal mortality increasing threefold as a result of prematurity 4. although placenta previa is associated with antepartum hemorrhage, massive hemorrhage necessitating preterm cesarean section is not observed in all women with the condition. the ability to predict severe antepartum hemorrhage and emergency cesarean section is critical in the management of placenta previa. to date, no consensus exists on the preterm delivery risk of different types and locations of placenta previa. only a few reports have focused on the maternal and perinatal outcomes of different types of placenta previa 5, 6, 7, 8. furthermore, the effect of anterior / posterior placental position on preterm delivery is unknown, although increased perinatal risks, including placenta accreta, excessive intraoperative blood loss, hysterectomy, and neonatal anemia, have been reported to be associated with anterior placenta previa 9, 10. in the present study, we evaluated whether different types and locations of placenta previa influence risk of antepartum hemorrhage - related preterm delivery. we retrospectively analyzed the medical records of 164 women with singleton pregnancies presenting placenta previa whose deliveries were conducted at our institute between january 2004 and march 2012. informed consent was obtained from each patient and protection of personal data and confidentiality were prioritized. institutional review board approval was obtained, and the study has been performed in accordance with the ethical standards laid down in the 1964 declaration of helsinki and its later amendments. two women whose indications for preterm cesarean section were not antepartum hemorrhage were excluded, and a total of 162 women were finally included in this study. patients were categorized into complete or incomplete placenta previa according to the type of placenta previa, and they were assigned to anterior and posterior groups according to placental location. maternal characteristics, and perinatal outcomes, including admission, tocolytic use, antepartum hemorrhage, gestational age at bleeding onset, gestational age at delivery, birth weight, apgar score, umbilical artery ph, placenta accreta incidence, anterior placental position, cervical length at delivery, and intraoperative blood loss, were compared between women with complete and incomplete placenta previa. in addition, differences between the anterior and posterior groups were evaluated. according to our hospital protocol, asymptomatic women with placenta previa were treated as outpatients. however, if bleeding or frequent uterine contractions were observed, patients were immediately admitted to the hospital, where treatment, including bed rest, vaginal lavage, and augmentation of tocolytic agents such as ritodrine, magnesium sulfate, and progesterone, was implemented. scheduled elective cesarean section for placenta previa was usually performed at 37 weeks of gestation according to our institutional protocol, but was occasionally performed early in the 38th week in stable cases. blood loss over approximately 200ml and continuous hemorrhage without tendency of decrease is the indication for emergent cesarean section in our institute. in women with placenta accreta the diagnosis of placenta previa was confirmed by transvaginal ultrasound, performed by trained attending physicians within 1 week of cesarean section after placental migration. complete placenta previa was defined as a placenta that completely covered the internal cervical os, with the placental margin > 2 cm from the os. partial placenta previa was defined as when the placenta partially covered, but the placental margin was situated within 2 cm of the internal os. marginal placenta previa was defined when the placental margin was situated adjacent to the internal os, with the placenta not covering the os. we employed this classification of complete and incomplete placenta previa because precise differential diagnosis of partial and marginal placenta previa is reported to be sometimes difficult in the absence of cervical dilatation 11. placental location was categorized as anterior or posterior, on the basis of the side of the uterine wall to which placenta was attached. placenta accreta was diagnosed only when direct invasion of trophoblast cells into the myometrium was histologically confirmed after hysterectomy. tokyo, japan). for categorical variables, the chi - square test or fisher 's exact test was applied. for continuous variables, depending on their distribution, the independent t - test or nonparametric mann - whitney u test was used. of the 162 women included in this study, 71 (43.8%) had complete placenta previa and 91 (56.2%) had incomplete placenta previa. thirty - one women (19.1%) had anterior and 131 (80.9%) had posterior placental position. there were no significant differences in maternal characteristics between women with complete and incomplete placenta previa, except in the prior cesarean rate, which was higher in women with complete placenta previa than in those with incomplete placenta previa [odds ratio (or) 3.18 ; 95% confidence interval (ci) 1.14 - 8.84 ; p = 0.04 ; table 1 ]. perinatal outcomes in women with complete and incomplete placenta previa are shown in table 2. antepartum hemorrhage was more prevalent in women with complete placenta previa than in those with incomplete placenta previa (59.1% versus 17.6% ; or 6.79 ; 95% ci 3.31 - 13.92 ; p < 0.001). consequently, the incidence of preterm delivery was higher in women with complete placenta previa than in those with incomplete placenta previa (45.1% versus 8.8% ; or 8.51 ; 95% ci 3.59 - 20.18 ; p < 0.001), with a higher incidence of delivery before 34 weeks of gestation in complete placenta previa (18.3% versus 1.1% ; or 24.38 ; 95% ci 3.09 - 192 ; p < 0.001). the incidences of birth weight < 2500 g and < 2000 g both increased in women with complete placenta previa (< 2500 g : or 2.64 ; 95% ci 1.31 - 5.33 ; p < 0.01, and < 2000 g : or 5.97 ; 95% ci 1.61 - 22.06 ; p < 0.007). however, there were no significant differences in the incidence of apgar scores < 7 at 1 and 5 min and umbilical arterial ph between women with complete and incomplete placenta previa. placenta accreta and anterior placental position were significantly more prevalent in women with complete placenta previa than in those with incomplete placenta previa, and intraoperative blood loss was increased in women with complete placenta previa. the prevalence of short cervical length (35 mm) did not significantly differ between women with complete and incomplete placenta previa. no significant differences were evident in maternal characteristics and treatments such as admission and tocolytic use, between the anterior and the posterior groups among women with complete placenta previa (tables 3 and 4). in complete placenta previa, incidence of antepartum hemorrhage did not significantly differ between the anterior and the posterior groups (76.2% versus 54.0% ; or 2.73 ; 95%ci 0.86 - 8.59, p=0.139). however, median gestational age at bleeding onset in the anterior group was lower than in the posterior group (26.4 weeks versus 31.4 weeks, p = 0.016). the incidence of preterm delivery was higher in the anterior group than in the posterior group (76.2% versus 32.0% ; or 6.8 ; 95% ci 2.12 - 21.84 ; p = 0.002), with a higher incidence of preterm delivery before 34 weeks gestation (38.1% versus 10.0% ; or 5.54 ; 95% ci 1.55 - 19.85 ; p = 0.014). the incidences of birth weight < 2500 g and < 2000 g were both higher in the anterior group than in the posterior group (< 2500 g : or 3.79 ; 95% ci 1.30 - 11.04 ; p = 0.025, and < 2000 g ; or 7.08 ; 95% ci 1.84 - 27.27 ; p = 0.006). there were no significant differences in umbilical arterial ph or the incidence of apgar scores < 7 at 1 and 5 min between the anterior and posterior groups. the incidence of placenta accreta was higher in the anterior group than in the posterior group (or 9.6 ; 95% ci 1.75 - 52.66 ; p = 0.01), resulting in increased intraoperative blood loss. however, in women with incomplete placenta previa, there were no differences in maternal characteristics and perinatal outcomes between the anterior and posterior groups, except in the incidence of placenta accreta (tables 3 and 4). prematurity is a consistent finding in studies reporting on women with placenta previa 5, 12, 13 some patients necessitate preterm cesarean section and hysterectomy for life - threatening hemorrhage, whereas others undergo elective cesarean section at term without hemorrhagic complications. in this study, antepartum hemorrhage and preterm delivery were significantly more prevalent in women with complete placenta previa. bahar. reported that antepartum hemorrhage in women with placenta previa, especially major placenta previa (complete and partial placenta previa), were associated with preterm delivery 8. on the contrary, tuzovic. reported no difference in the frequency of preterm delivery between women with complete and incomplete placenta previa 6. daskalakis. also reported no differences in gestational age at delivery between different placenta previa types 5. the discrepancies between these studies may have resulted from differences in maternal background, gestational period at diagnosis, or patient management. in this study this low rate suggests that placental tissue preferentially develops on the posterior uterine wall in placenta previa. a previous study reported that the incidence of placental migration is higher and the migration rate is faster in women with anterior placenta previa 14. moreover, anterior placental position is reportedly related to multiparity and history of more than two cesarean sections 9. however, we observed no significant differences in parity and prior cesarean delivery between the anterior and posterior groups, irrespective of the placenta previa type. this may be because of the relatively low parity of our subjects : only four patients were multiparous, and none had undergone more than two cesarean sections. on the other hand, the incidence of placenta accreta was significantly higher in the anterior group, irrespective of placenta previa type. eight of ten patients with placenta accreta (80%) were in the anterior group, and six of eight patients (75%) with anterior placenta accreta had prior cesarean sections. this concurs with previous reports, which suggest that placenta accreta develops through placental implantation over a cesarean scar9, 15, 16. the present study also revealed that gestational age at bleeding onset was significantly lower in the anterior group in women with complete placenta previa. consequently, the incidences of preterm delivery and low birth weight were significantly higher in the anterior group. interestingly, in women with incomplete placenta previa, anterior placental position did not significantly influence perinatal outcomes such as bleeding onset and preterm delivery. these results suggest that anterior placental position confers a remarkable risk of early bleeding and preterm delivery only in women with complete placenta previa., while analyzing the ultrasound parameters for emergency cesarean section in placenta previa, reported no statistically significant increased risk with anterior placental position17. this may because women with incomplete placenta previa constituted 36% of the study population in their analysis. previous studies have reported that a short cervical length is associated with preterm delivery not only in women with normal placental position but also in those with placenta previa 18, 19. in this study, although gestational age at delivery was significantly earlier in the anterior groups in complete placenta previa, no significant difference was observed in cervical length at delivery between the anterior and posterior groups. therefore, complete placenta previa combined with anterior placental location may confer a higher risk of early cervical shortening than incomplete placenta previa or posterior placental location. we speculated that mechanical stimulation of the anterior uterine wall during daily life is more frequent and direct than that of the posterior wall, which is protected by the pelvis. if the placenta is located on the anterior wall, such stimulation may cause uterine contractions and subsequent unknown reactions in the underlying decidua basalis, where abundant blood flow exists. however, a previous study revealed that background uterine electromyographic activity, measured from the abdominal surface in the middle trimester of pregnancy, was independent of placental implantation site 20. further study is necessary to explore the pathophysiology underlying the clinical differences associated with anterior and posterior placental position in women with complete placenta previa. in conclusion, obstetricians should be aware of the high risk of preterm delivery for antepartum hemorrhage in women with complete placenta previa, particularly when the placenta is located on the anterior uterine wall. conversely, women with incomplete placenta previa are at relatively low risk of preterm delivery, and the incidence of preterm delivery is not influenced by placental position.	purpose : to evaluate whether type and location of placenta previa affect risk of antepartum hemorrhage - related preterm delivery. methods : we retrospectively studied 162 women with singleton pregnancies presenting placenta previa. through observation using transvaginal ultrasound the women were categorized into complete or incomplete placenta previa, and then assigned to anterior and posterior groups. complete placenta previa was defined as a placenta that completely covered the internal cervical os, with the placental margin > 2 cm from the os. incomplete placenta previa comprised marginal placenta previa whose margin adjacent to the internal os and partial placenta previa which covered the os but the margin situated within 2 cm of the os. maternal characteristics and perinatal outcomes in complete and incomplete placenta previa were compared, and the differences between the anterior and the posterior groups were evaluated. results : antepartum hemorrhage was more prevalent in women with complete placenta previa than in those with incomplete placenta previa (59.1% versus 17.6%), resulting in the higher incidence of preterm delivery in women with complete than in those with incomplete placenta previa [45.1% versus 8.8% ; odds ratio (or) 8.51 ; 95% confidence interval (ci) 3.59 - 20.18 ; p < 0.001 ]. in complete placenta previa, incidence of antepartum hemorrhage did not significantly differ between the anterior and the posterior groups. however, gestational age at bleeding onset was lower in the anterior group than in the posterior group, and the incidence of preterm delivery was higher in the anterior group than in the posterior group (76.2% versus 32.0% ; or 6.8 ; 95% ci 2.12 - 21.84 ; p = 0.002). in incomplete placenta previa, gestational age at delivery did not significantly differ between the anterior and posterior groups. conclusion : obstetricians should be aware of the increased risk of preterm delivery related to antepartum hemorrhage in women with complete placenta previa, particularly when the placenta is located on the anterior wall.
edcs are chemicals that interfere with the biosynthesis, metabolism, or action of endogenous hormones resulting in deviation from normal developmental programming and reproductive function. the male sexual differentiation is entirely androgen - dependent and therefore highly susceptible to edcs that disrupt androgen action. androgens such as testosterone and its metabolite 5--dihydrotestosterone (dht) exert their effect through the ar which is a ligand - induced transcription factor. androgen binding causes the cytosolic ar to translocate into the nucleus, bind to the target regions of androgen - responsive genes, and influence their transcription. antiandrogens, on the other hand, may bind to the ar but do not promote nuclear translocation or gene transcription. recent findings indicate that an increasing number of natural products such as legumes, soybeans, flax, yams, and industrial chemicals, such as pesticides and fungicides, influence the activity of androgen and estrogen receptors. these edcs may have a profound impact on male reproductive health and androgen action including deterioration of sperm quality, increase in cryptoorchidism and hypospadias cases, alteration in sex ratio, and testicular dysgenesis syndrome. chemicals currently known to interfere with the androgen signalling pathway include dicarboximide fungicides such as vinclozolin, organochlorine - based insecticides such as p, p-ddt and p, p-dde, conazole fungicides such as prochloraz, phthalates, and urea - based herbicides such as linuron. the toxicity induced by these and other chemicals can be minimized only through thorough screening and early detection of their hazardous nature. the hazards of edc accumulation were first revealed by studies which demonstrated changes in sex lives of fish in duluth - superior harbor. the chemicals in waste water accumulate in fish liver and also change egg production of female fish and mating behavior of male fish. masculinized female mosquito fish was detected in rivers in the neighbourhood of pulp and paper mills. changes in characteristics of fish have been observed in both developed and developing countries of the world [8, 9 ]. to prevent edc - induced toxicities, a list of regulatory agencies from different countries involved in monitoring and controlling edc exposure is provided in table 1. typically, two levels of screens are conducted, a tier 1 screening (t1s) to act as a gate keeper and a tier 2 study (t2s) which is in vivo and more definitive. the first screen establishes whether a compound has potential for endocrine disruption and should be subjected to t2s. the t1s therefore emphasizes achieving maximum sensitivity, even at the cost of getting a few false positives. the t1s includes (a) cell free receptor binding, (b) functional assays such as transcriptional activation or cell proliferation, (c) steroidogenesis using minced testes assay, and (d) additional enzyme assays. in vivo assays in rats, mice, or rabbits (used in t2s) were developed a long time ago to determine the endocrine activity of compounds. important examples are the assessment of vaginal smear types to define estrogenicity and of the prostate, seminal vesicle, and musculus levator ani (mla) growth to determine androgenic and anabolic activities [12, 13 ]. the contribution of animal studies to edc detection is restricted due to the costs involved, the desire to limit animal use, and speed. currently, the androgen levels are measured in clinical practice in mainly two ways. immunoassays are based on the antibody 's ability to recognize a specific chemical structure of the steroid molecule. these assays have variable specificity and sensitivity and the overall androgenic bioactivity in the sample can not be correlated with the antibody binding detected because basis of antigen recognition is only structural and not functional. an alternative method of detection is gas chromatography - mass spectrometry (gc - ms). ms - based methods are powerful and very useful for use in sports doping laboratories as they are both specific and sensitive. their major limitation is that they can not identify compounds of unknown structure and rely on prior knowledge of structure of steroid. the cell based reporter assays provide quantitative and functional information within a short span of time making them one of the most relevant and important assays for compound profiling and drug discovery. they measure the relative activity of a substance (or a mixture of substances) without the requirement of prior information about the chemical structure of the ligand. in vitro androgen receptor assays exploit the natural signaling pathway of androgens and compounds that bind to the ar. when ligands are added to the system, the receptor is activated and there is consequent production of reporter protein which can be measured. the routinely used reporter genes whose products can be assayed easily include luciferase, -galactosidase, or green fluorescent protein. the commonly used reporter genes, their source, and functions are listed in table 2. the selection of an appropriate cell line is very important for the sensitivity and specificity of the reporter assay. in this review we present an analysis of the currently used in vitro reporter assay systems that can be developed further as first line of screening (t1s) for detection of androgenic and antiandrogenic activity. the cells used for developing in vitro ar transcription assays must fulfill two requirements : (a) express the ar and (b) carry a reporter system that allows measurement of androgen response. the reporter gene assays are based on the principle that when an androgen or antiandrogen enters the cell it binds to the ar in the cytoplasm ; the androgen - ar complex enters the nucleus and binds to the androgen response element coupled to a reporter gene whose expression can be monitored (figure 1). transient transfection assays in which both the ar and an ar - responsive reporter are cotransfected into native cells have been used for the purpose [1618 ]. however, transient transfection assays may not reflect the endogenous level of receptors as the number of receptors may vary greatly in each system and from assay to assay. moreover the response may be observed for a limited time since the transgenes are lost within 72 hours. because of their robustness and consistency they are being discussed in this review. in a typical ar assay, a cell line such as cho or mcf7 is transfected using a plasmid carrying the ar gene and another carrying a reporter gene such as luciferase, downstream of a sequence regulated by the ar. in stable transfection experiments, approximately 10,000 cells per well are plated on a 96-well plate, in 200 l of dmem - f12 medium without phenol red and 10% fcs. the cells are washed with pbs on the following day and replaced by fresh medium. after about 3 h, the test compounds are added to the cells in a volume of 10 l in medium to achieve final concentrations of around 1 mm in ethanol. they are then further diluted in the medium in the final concentration of 0.01% before incubating them for another 24 h. luciferase activity is measured using a kit. compounds with androgenic activity show a luciferase activity that is significantly higher than that of control. for checking antiandrogenic activity, the test compound needs to be added to the stable integrated cells in the presence of an ar agonist such as r1881 or dht. a significant decrease in r1881-induced luciferase reading in the presence of test compound indicates the presence of antiandrogenic activity. two types of cell lines have been routinely used for developing androgen transcription assays : mammalian cell lines and the laboratory yeast strain, saccharomyces cerevisiae. the yeast cells have the advantage of rapid growth, low cost, and reproducibility. however, using yeast systems to express mammalian proteins can pose problems such as incorrect phosphorylation, glycosylation, folding, or other posttranslational modifications. also, yeast systems lack the appropriate chaperone and coregulator proteins which are necessary for proper ar mediated transactivation. when creating mammalian reporter cell lines, it is essential to express exogenous steroid receptors in cell lines with low background activity of other members of this receptor class. unfortunately many of the cell lines traditionally used in the individual steroid receptor research do not fulfill this condition, and there is endogenous expression of more than one steroid receptor at a given time. many reporter plasmids and cell line specific assays have been developed in various laboratories within the last decade. cho - k1 cells were stably transfected using the ar and the luciferase reporter gene regulated by the hormone response element (hre) present in the mouse mammary tumor virus (mmtv) promoter. the system has a high sensitivity (0.1 nmol / l) for androgens such as testosterone and can distinguish androgenic and antiandrogenic activities. however, low levels of endogenous glucocorticoid receptor (gr) expression in cho - k1 cells can interfere with the androgen assay. the use of mmtv promoter may also add to the ambiguity of results as the hre is responsive to both ar and gr. being a high throughput system it is able to assess multiple samples at the same time. cell lines with endogenous expression of ar have also been used for ar reporter assay [19, 20 ]. the mda - kb2 cell line developed from mda - mb-453 breast cancer cells endogenously expresses ar and has been stably transfected with the mmtv - luciferase plasmid. the expression level of ar in these cells was 240 fmol per mg protein and the lowest observed concentration that produced a response was 0.1 nm dht. although this is a sensitive test system, yet, expression of gr in the cells and use of mmtv hre makes the assay less specific. some compounds gave mixed response in this system, including hydroxyflutamide which acted as an antagonist at lower concentrations and agonist at higher concentrations. used a monkey kidney cell line cv1 and the mda - mb-453 breast cancer cell line, expressing endogenous ar, for developing reporter assays by adenovirus mediated transduction. the mda - mb-453 based cells suffered from the same problems encountered with the mda - kb2 cells as they expressed the gr. the cv1 cells, however, showed forty - five - fold activation in the presence of 0.1 nm dht and the interference due to other receptors was minimal. by fusing multiple copies of a hormone response element to a minimal promoter containing only the tata box, sonneveld. have developed a series of highly sensitive and specific reporter cell lines called the calux (chemically activated luciferase expression) cell lines. they stably transfected a human bone cell line u2-os using the ar and the hre associated minimal promoter linked to luciferase gene. the cells did not show significant response to androgen precursors or gr ligands, though a response was induced upon exposure to high concentration (0.1 m) of dexamethasone. this was one of the most sensitive and specific reporter assays developed in a mammalian cell line. xu. developed an androgen reporter system using african monkey kidney cell line cv-1 [22, 23 ]. their use of cat reporter was an improvement over the original -galactosidase reporter system and resulted in an ec50 of 0.39 nm for dht. this was however a transient reporter assay system and therefore prone to variations in different batches of transfections. a comparative analysis of advantages and disadvantages of all the mammalian reporter systems discussed above has been presented in table 3. yeast cells have the advantages of fast growth, easy handling, cheap media components, and robustness towards toxic effects of test chemicals or solvents. also, in yeast, activity of substances towards ar can be determined without the presence of any other mammalian proteins influencing the ar pathway. many different groups have therefore used the yeast reporter system for screening ar agonists and antagonists. many yeast based detection systems involve either the colorimetric detection [24, 29 ] or the firefly luciferase reporter. chatterjee. have developed a yeast based reporter system using human ar and are driven -galactosidase. the use of lacz reporter in this assay system required long exposure times for development of signal. recently the photorhabdus luminescens lux operon has been substituted for the lacz gene in yeast androgen reporter screen (yas) assay (s. cerevisiae blyas),. androgen - responsive elements were present in plasmids that also contained constitutively expressed luxa and luxb genes. this offers greater sensitivity (1.1 0.5 10 for dihydrotestosterone) as compared to the original lacz reporter. quantifiable bioluminescence is observed in 60 seconds with maximum signal detection in 3 - 4 hours. an obstacle in the use of blyas assays is chemical solubility as chemicals insoluble in methanol could not be evaluated. adding hydrophobic chemicals directly to yeast medium may increase its usefulness ; however, nonspecific solvent effects on bioluminescence and potential yeast toxicity need to be monitored. another reporter system which has recently come to use is the green fluorescent protein, gfp [24, 25 ]. the reporter gfp emits green light that can be measured directly from culture without disintegrating the cells. also chromophore formation can occur without any other cofactor. in the ar transactivation assay by beck., using gfp reporter, the source of ar was human ar from psvaro plasmid. androgen response element containing a consensus ar binding sequence composed of two 6 bp asymmetrical elements separated by a 3 bp spacer was used. the potencies obtained with -galactosidase and gfp in the presence of testosterone were 27 nm and 23 nm, respectively, and 16 nm for both in case of dihydrotestosterone. the high backgrounds of gfp fluorescence made detection of gfp signals slightly difficult in their system. a comparative analysis of all the yeast based ar reporter assay systems has been provided in table 3. numerous reports and human studies have provided evidence for the existence of edcs of natural and industrial origin that can specifically alter androgen signaling. these may affect normal male developmental programming by interfering with androgen biosynthesis, metabolism, or action. identification of these compounds by rapid, robust, inexpensive, and sensitive screening tests is essential for minimizing handling and exposure to these chemicals. in this review the in vitro reporter assay systems based on androgen receptor transcription have been analyzed and their advantages and disadvantages have been highlighted. androgen reporter assays can easily detect edcs that alter androgen signaling by mimicking androgens or by blocking the classical androgen receptor transcription pathway. sensitivity of the reporter systems is important and the first level screening emphasizes sensitivity more than anything else. have used a novel method for increasing sensitivity by introducing the ar - interacting protein 3 coactivator. other ar coactivators such as p160, p300, and/or carm1 could also be incorporated into reporter systems for increasing the sensitivity of ar reporter assays. sensitivity and ease of screening are also boosted by using different reporters such as gfp and lux [27, 28, 30 ] instead of the traditional -galactosidase or luciferase based systems. although yeast systems are inexpensive and robust, yet yeast does not contain all the mammalian enzymes, activator, and coregulators and hence may not support transcription of all compounds that would otherwise influence transcription in a mammalian system. also, the yeast based assays are typically less sensitive than the mammalian cell based assays. however since some coregulators are tissue or cell specific, cell lines from androgen - responsive tissues such as prostate, testes, and fibroblasts may be more appropriate for these studies. kim. have used three different prostate cancer cell lines, in a transient androgen transfection assay. in their studies pc3/ar cells showed a 14-fold response in the presence of 10 m dht and are one of the most sensitive androgen reporter assays. the commonly used enhancer region used in the mammalian cell line based assays is the mmtv - ltr promoter [4, 15, 19 ]. a major disadvantage of this enhancer system is its response to glucocorticoids and progesterone apart from androgens. a natural androgen - responsive transcriptional enhancer from the rat probasin gene regulatory region has also been used [21, 26 ]. however, the hre within this enhancer too can be recognized by glucocorticoid and progesterone receptors. thus there is a need to identify and use an enhancer that is specific to androgen receptors in the mammalian systems. in this regard, the yeast cells represent a great advantage compared with mammalian cell lines as there is a lack of known endogenous receptors in yeast. have made comparisons of relative agonistic activities of 34 chemical compounds by in vitro reporter assays versus in vivo hershberger assay in orchidectomized male rats. the correlation of ar calux data with hershberger assay resulted in a correlation coefficient of r = 0.46 (p < 0.0001) indicating that correlation was not strong. however, the response of individual compounds in vitro was almost always able to predict the outcome in vivo, in their studies. this discrepancy between the two studies could be due to the fact that the physiological concentration of androgen required to elicit a response in the hershberger assay is high (160 g / kg of testosterone) and therefore weaker androgens do not reach the activating concentration. their study highlights that though cell based reporter assays are overall good indicators of agonist or antagonistic activity in vivo, yet considering the complex physiology of whole animals, more studies need to be performed to verify the correlation between in vitro reporter assay systems and in vivo animal test systems.	endocrine disruptive chemicals (edcs) modulate hormone signaling and cause developmental and reproductive anomalies. today, there is a global concern regarding endocrine disruption effects, particularly those mediated by the androgen receptor (ar). androgen or male hormones are critical for the development and maintenance of male characteristics and numerous edcs exist in the environment with the potential to disrupt androgen action. the threat is more during critical developmental windows when there is increased sensitivity to these compounds. timely screening and detection of the edcs is essential to minimize deleterious effects produced by these toxic chemicals. as a first line of screening, in vitro transcription assays are very useful due to their speed, convenience, and cost effectiveness. in this paper, recent in vitro reporter assays for detecting androgenic or antiandrogenic activity of edcs have been reviewed. two important cell systems used for this purpose, namely, the mammalian or yeast cell systems, have been discussed. use of reporter genes such as bacterial luciferase (lux) and green fluorescent protein (gfp) has significantly improved speed and sensitivity of detection. also, many of the current reporter assay systems can be used in a high throughput format allowing speedy evaluation of multiple potential edcs at a lower price.
myostatin, encoded by the mstn gene (previously referred to as gdf8), is a member of the transforming growth factor superfamily that normally acts to limit skeletal muscle mass by regulating both the number and growth of muscle fibres [1, 2 ]. mstn is synthesized as precursor and upon proteolytic processing gives an n - terminal latency - associated peptide, termed myostatin propeptide or lap - fragment, and a smaller mature peptide at the c - terminus. the mstn gene, composed of three exons and two introns, has been characterized in rodents, humans, and several livestock species [3, 58 ]. natural mutations that decrease the amounts of myostatin and/or inhibit its function have been identified in a human subject and in several cattle [2, 3, 1013 ], sheep [1416 ], and dog breeds. in belgian blue, piedmontese, marchigiana, and other cattle breeds, loss - of - function mutations within the coding sequence of the mstn gene determine increased skeletal muscle mass, relevant in shoulders and thighs, and the produced phenotype is known as these polymorphisms have, in several cases, effects on growth, reproductive, performances, and carcass quality traits [3, 18, 19 ]. in the whippet dog breed a mutation in the third exon determining a premature stop codon causes an increased muscle mass phenotype in homozygous state and enhanced racing performance in heterozygous dogs. in two norwegian sheep breeds, two different mutations in the mstn coding region are associated with carcass conformation and fatness [15, 16 ]. in addition, in other sheep and in pigs, mutations identified in non coding regulatory regions affect the level of mstn gene expression and/or are associated with growth, muscle mass, and other carcass traits [8, 14, 20, 21 ]. in horse (equus caballus), different horse breeds present a variety of morphological phenotypes that have been used to group breeds into a few classes. however, no system provides a robust classification in which each breed could have an unequivocal assignment. based on size traits and build, horse breeds are categorized in draught (or heavy), light, and pony (or animals that mature at less than 148 cm high, usually used as riding school and children 's mounts). considering skeletal structure, proportions, zoometrical indices, length, and volume of muscling, that, in turn, reflect the selective goals and uses of the horse breeds, they are categorized in brachymorphic, mesomorphic, dolichomorphic, and intermediate types (such as meso - dolichomorphic). brachymorphic horses (corresponding to draught horses), traditionally referred to as cold - blooded horses in relation to their quiet and calm temperament, are tall in stature, heavy boned, and extremely muscular with short and thick muscles and slow twitch oxidative fibers for slow contraction. they most likely develop strength and power, and their conformation is well suited for pulling carriage, draught power and meat production. dolichomorphic horses (corresponding to light horses) are characterized by longer bodies and long and thin muscles mainly constituted by fast twitch glycolytic fibers. examples of italian breeds representative of these two extreme phenotypes are reported in figure 1. mesomorphic type is characterized by a lighter physical structure than brachymorphic but still powerful and compact with massive muscling. this group also includes some breeds with draft - type qualities and classified as ponies based on their withers height (such as bardigiano and haflinger breeds). in addition, several breeds (like local breeds with influence of oriental, thoroughbred, and iberian halfbreed and descendents) have characteristics of both mesomorphic and dolichomorphic types (referred to as meso - dolichomorphic). for the important pleiotropic effects of the msnt gene, including its role on muscle mass development, polymorphisms in this gene could contribute to explain the morphological variability among horse breeds. here we sequenced the mstn gene, including regulatory regions, in several horse breeds and identified a few polymorphisms that were used to evaluate their potential association with different morphological types. a total of 396 minimal related horses belonging to 16 breeds were sampled in different farms or stables. details of the horse breeds involved in the analysis are given in table 1. these horse breeds were classified as brachymorphic (b), mesomorphic, (m), meso - dolichomorphic (m - d), and dolichomorphic (d) (table 1) as indicated in the homepage of their own breed national associations based on linear measures (height at withers, chest girth, and cannon circumference), structure and anamorphosis index (ai= (chest girth)100/height at wither), and based on bibliographic data [2730 ]. all horses were registered in the stud books or in the italian anagraphic register constituted for local ethnic groups (noric, salernitano, tolfetano, and ventasso). the lipizzan samples (lipizzan italian stud, monterotondo, italy) included all six classical stallion lines : conversano, favory, maestoso, neapolitano, pluto, and siglavy. ten primer pairs (table 2) that amplify different mstn regions were designed using primer 3 (http://frodo.wi.mit.edu/primer3/input.htm) software. pcr reactions were performed in a final volume of 20 l containing 1080 ng of equine genomic dna, 250 mm of each dntp, 10 pmol of each primer, 1 u of eurotaq dna polymerase (euroclone ltd., paington, devon, uk), or 1 u of takara ex taq dna polymerase (takara bio inc., shiga, japan) and 1 pcr buffer with mgcl2 concentration specific for each primer pair (table 2). pcr conditions were : an initial step at 95c for 5 minutes, 35 cycles of 95c for 30 s, specific annealing temperature for each primer pair for 30 s, 72c for specific reaction times for different primer pair (table 2), and a final step at 72c for 9 minutes. genomic dna obtained from 12 horses of 10 breeds (1 bardigiano, 1 haflinger, 1 italian saddle, 2 italian trotter, 1 noric, 2 rapid heavy draft, 1 salernitano, 2 throroughbred, and 1 ventasso) constituted the sequencing panel. pcr fragments obtained from the sequencing panel with primer pairs 110 were purified using the qiaquick pcr purification kit (qiagen, dsseldorf, germany) and sequenced on both strands using the bigdye cycle sequencing kit v.3.1 (applied biosystems, foster city, ca, usa). polymorphisms were identified by visual inspection of the electropherograms and sequences were aligned with clustalw2 program (http://www.ebi.ac.uk/tools/clustalw2/index.html) and using blastn (http://blast.ncbi.nlm.nih.gov/blast.cgi). the horse mstn promoter sequence was analysed in silico for the presence of putative transcription factor binding sites using matinspector (http://www.genomatix.de/) bioinformatics tool. this region of horse mstn gene was aligned with that of cattle (aj310751), goat (ay827576), human (ax058992), mouse (ay204900), pig (ay8641281), and sheep (dq530260) to identify evolutionary conserved motifs. pcr - rflp protocols were designed to genotype two identified snps (g.26t > c and g.156t > c) in the sampled horses. to genotype the g.26t > c snp, the amplified products of 484 bp obtained with primer pair 1 (table 2) were digested with rsai (recognition sequence : gtac). briefly, 510 l of pcr reaction was restricted with 2.5 u of rsai (fermentas, vilnius, lithuania) at 37c overnight and the resulting fragments (g.26 t allele=484 bp ; g.26c allele=437 bp + 47 bp) were resolved on 2.0 % agarose gels stained with ethidium bromide. the g.156t > c snp was genotyped amplifying a fragment of 204 bp with primer pair 11 (table 2) that inserted an artificial restriction site (with a mismatched reverse primer) for sspi (recognition sequence : aatatt) when allele g.156 t occurred. the obtained fragments (g.156 t allele=179 bp + 25 bp ; g.156c allele=204 bp) resulting from digestion of 510 l of pcr reaction with 2.5 u of sspi (fermentas) at 37c overnight were electrophoresed in 3.5% agarose gels and visualized with ethidium bromide. allele and genotype frequencies, observed and expected heterozygosity, and fst were calculated using popgene software v. 1.32. allele frequencies among the four groups (b, m, m - d, and d) were compared using fisher 's exact test. arlequin software v. 3.1 (http://cmpg.unibe.ch/software/arlequin3) was used for the analysis of molecular variance (amova) testing the effect of the morphological types in population differentiation with a model including types (four levels : b, m, m - d and d ; and two levels : b + m and m - d + d), types / breeds, individuals / breeds, and individuals. sequenced fragments of the horse mstn gene were assembled into one sequence of 5724 bp (submitted to genbank under accession number gq183900) that resulted 100% identical with that that was, in the meantime, annotated in the equcab2 horse genome assembly derived from a thoroughbred horse (http://www.ensembl.org/equus_caballus/search/, ensembl release 52-dec 2009). our sequence contained 671 bp upstream from the atg start codon, 538 bp of the promoter, and the entire 5-untranslated region (utr) of 133 bp, the three exons (except 33 bp of exon 1), the two intervening introns, and 80 bp of the 3-utr (figure 2). the transcription start site of the first exon was deduced from human and bovine mstn exon 1 sequences [4, 6 ]. the coding regions of exons 1, 2, and 3 of the horse mstn gene contained 373, 374, and 381 bp, respectively. introns 1 and 2 included 1829 bp and 2016 bp, respectively, almost the same length reported in cattle (1840 bp and 2033 bp, respectively) and pig (1809 bp and 1980 bp, respectively) [6, 8 ]. intron 1 is a type 1 intron as it interrupts a codon between the first and second exon whereas intron 2 is a type 0 intron as it divides the coding sequence between two codons as in other species [6, 8 ]. the analysed proximal promoter region and the 5-utr of the horse mstn exhibited a degree of identity with the corresponding regions of other species ranging from 77% (mouse) to 90% (pig). putative consensus dna sequences known as transcription factor binding sites, dna - binding motifs, or cis - regulatory elements were identified in the positive strand of horse promoter (figure 3). considering the general transcription factors, three different putative tata boxes (tata-1, tata-2, and tata-3) and one ccaat box were detected. among muscle - specific transcription factors, four e - boxes (named e1, e2, e3, and e4 boxes, figure 3), one putative site for myocyte specific enhancer factor 2 (mef2 or meb1) and consensus sequences for foxo and smad binding sites (caaaata and cagaca, respectively) family sequences were identified. the alignment of mstn promoter sequences across different species (horse, cattle, goat, human, mouse, pig, and sheep) revealed that these dna - binding motives, particularly close to the tata-1 surrounding sequence, were highly conserved across species. in particular, tata-1 was conserved in all examined species except mouse, the second tata sequence (tata-2) was conserved across all seven species, and tata-3 was conserved in all species except pig and mouse. the mef2 and e - boxes were conserved in all the considered mammals except in human and mouse for e - box4. the e - boxes can be activated by the myogenic regulatory factors (mrfs : myod, myf5, myogenin, and mrf4). myod upregulates mstn transcription and at the same time mstn inhibits myod expression and activity regulating the differentiation of myoblasts into myotubes. myod and mrf4 play competitive roles in myogenesis and might act as molecular switches to determine myogenic differentiation and cell proliferation, respectively. additional e - boxes were identified in the analysed region (such as an e - box located near the tata-2 in pig and an additional e - box in all mammalian but cattle) and in the distal region of the promoter of the other mammals (not included in figure 3). in cattle, spiller. showed the importance of three functional e - boxes (e3, e4, and e6) of which the e6, occupied by myod in vitro and in vivo, resulted crucial for the mstn promoter activity. the close position of functional e - boxes suggests that they might function as a cluster to better sustain the stability of dna - protein. across the mstn promoter sequences of all considered livestock species we identified the conserved position of sites matching the consensus for foxo binding and the adjacent smad box whose presence was not evidenced in previous works [8, 33, 36 ]. recent data demonstrated that these factors appear to act through independent pathways but additively to regulate the expression of mstn and contribute to control muscle cell growth and differentiation [37, 38 ]. in addition, foxo transcription factors plays a critical role in development of muscle atrophy by stimulating proteolysis and by increasing myostatin expression. putative e - boxes were identified both in intron 1 (six boxes) and in intron 2 (six boxes) and one putative e - box was located in the 3-utr at seven nucleotides downstream of the tga stop codon (data not shown). the presence of e - boxes in the introns and 3-utr of equine mstn gene has not been described yet even if their occurrence has been highlighted recently in introns of porcine mstn gene. sequencing of the panel of horses of different morphological types revealed a total of seven single nucleotide polymorphisms (snps) (figure 2). two transitions were located in the promoter region at -646 (gq183900:g.26t > c) and -516 (gq183900:g.156t > the g.26t > c snp was within a conserved position (except in mouse) but not within an identified known functional motif while the g.156t > c polymorphism was within a tata box - like (tata-3 ; yataaa, figure 3). sequence alignments of the mstn promoter regions of different species indicate that the g.26 t and g.156 t alleles derive from an ancestral mstn sequence as most close species present the indicated nucleotides (figure 3 and data not shown). the other five snps were in intronic regions : four were localized in intron 1 and one in intron 2 (figure 2). three of the snps of intron 1 (g.1634t > g, g.2115a > g, and g.2327a > one of which (g.2115a > g ; indicated by as g.66493737c > t) has been associated with sprinting ability and racing stamina in thoroughbred horses. the remaining snps were not reported by others and represent new polymorphisms of the horse mstn gene. none of these intronic snps resided within splice sites or within particularly conserved sequence elements. allele frequencies for the two snps located in the promoter region (g.26t > c and g.156t > the g.26t > c snp was polymorphic in 6 out of 16 breeds with higher observed frequency of the g.26c allele in the lipizzan breed (0.21). c polymorphism, the mutant g.156c allele, which changes the predicted tata box3-like, was detected in 11 out 16 breeds and was identified in homozygous condition in a few bardigiano, haflinger, noric, rapid heavy draft, and uruguayan creole horses. haplotype analyses of the two mutations showed the presence of three haplotypes : [g.26t : g.156 t ], [g.26t : g.156c ], and [g.26c : g.156 t ] (table 3). the [t : t ] haplotype could be the wild type according to its presence in all breeds and higher frequency (from 0.54 to 1.00). the [t : c ] haplotype was observed in 10 breeds (frequency from 0.05 to 0.40), whereas the [c : t ] haplotype was identified only in 6 breeds (frequency from 0.01 to 0.21) (table 3). in order to evaluate if the two snps in the promoter region could account for a quote of variability related to morphological types, we classified the analysed horse breeds in four groups (brachymorphic, b ; mesomorphic, m ; meso - dolichomorphic, m - d ; and dolichomorphic, d) (see materials and methods). several descriptive statistics summarizing the genetic diversity of these groups are reported in table 4. the b group showed the highest observed and expected heterozygosity (0.24 0.09 and 0.26 0.10, respectively), whereas the d group had the lowest values (0.02 0.01 for both measures). c snp, differences in allele frequencies were significant between b and the other three groups (p c snp and 7.0% for the g.156t > c snp) of the genetic variation. the amova on haplotypes confirmed that a proportion of the total molecular variance was associated to morphological types of the horses. using the four morphological types the molecular variance explained was 6.40% (p <.05). grouping these four types into two groups (b + m and m - d + d) according to their similarities on morphological types the quote of explained molecular variance was 10.6% (p <.01). it could be possible that differences of allele and haplotype frequencies among types are influenced by phylogenetic closeness rather than any association with morphological types. this issue should be further investigated as, to our knowledge, there are no studies analyzing this question that include most of the breeds we investigated. analysed genetic relationships among only three breeds included in our study and evidenced significant genetic differentiation among bardigiano, haflinger, and maremmano, suggesting that the results we obtained might not be biased by a putative common origin of the breeds. the association of the two promoter snps with morphological types could be due to linkage disequilibrium with alleles in other chromosome 18 loci that affect the variability of morphological traits in horses. however, based on our results it can not be excluded that mstn snps could influence morphological traits, that are indirectly related to muscle mass. a few snps in the promoter region of the swine mstn gene were associated with muscularity, growth, and meat quality traits [8, 20, 21 ]. one of them, with high frequency in the muscled belgian pietrain breed, was associated with mstn expression level, suggesting that promoter polymorphisms could contribute to muscle mass in this pig breed. to demonstrate the putative functional role of the identified horse mstn promoter snps, expression studies in skeletal muscle of animals with different genotypes should be performed. however, it is worth to point out that in vivo rna expression studies in horses are very complicated as it is quite difficult to standardize temporary and permanent environmental factors (i.e. age, sex, management, feeding, etc.) that are major sources of variability in such experiments. for these reasons in vitro assays might be needed to clarify if the identified snps could alter mstn gene expression. in addition association analysis in breeds segregating for the two promoter snps and for which estimated breeding values for several conformational and performance traits are available could be useful to further evaluate the association of these polymorphic sites with phenotypic traits.	myostatin (mstn) is a negative modulator of muscle mass. we characterized the horse (equus caballus) mstn gene and identified and analysed single nucleotide polymorphisms (snps) in breeds of different morphological types. sequencing of coding, untranslated, intronic, and regulatory regions of mstn gene in 12 horses from 10 breeds revealed seven snps : two in the promoter, four in intron 1, and one in intron 2. the snps of the promoter (gq183900:g.26t > c and gq183900:g.156t > c, the latter located within a conserved tata - box like motif) were screened in 396 horses from 16 breeds. the g.26c and the g.156c alleles presented higher frequency in heavy (brachymorphic type) than in light breeds (dolichomorphic type such as italian trotter breed). the significant difference of allele frequencies for the snps at the promoter and analysis of molecular variance (amova) on haplotypes indicates that these polymorphisms could be associated with variability of morphology traits in horse breeds.
small cell lung cancer (sclc) represents 1320% of all new lung cancer diagnoses. it is the most aggressive histological subtype of lung cancer, with a strong predilection for early metastases. the brain is a common site of metastasis in sclc. at the initial diagnosis, at least 10% of the patients with sclc already have brain metastases, brain metastases signal stage iv disease and generally herald an ominous prognosis, but neuro- and radiosurgical therapeutic evolution has resulted in effective therapeutic approaches, leading to improvements in neurological status and survival [2, 3 ]. a 69-year - old caucasian man was admitted to the emergency unit, complaining of progressive exophthalmos over the past 15 days (fig. his medical history included heavy smoking (108 pack - years, until the day of admission). the patient reported fatigue without loss of weight for the last 6 months. on physical examination, auscultation of the lungs revealed diminished breath sounds and dullness to percussion in the upper left lung field. blood tests disclosed anemia, hematocrit 33.1% and hemoglobin 10.4 g / dl, with a pattern of chronic diseases. the serum chemistry findings were normal. 2a) showed a sizable mass in the left upper lobe of the lung in contact with the pleura. chest computed tomography (ct) revealed a large round solid tumor with hilar and pre - vascular lymph node enlargement. the patient underwent magnetic resonance imaging (mri) of the brain and orbits to enable further evaluation. the mri revealed a soft - tissue mass in the outer posterolateral wall of the right orbital cavity with infiltration of the subcutaneous fat, muscles and skin (fig. a ct of the upper and lower abdomen also showed no metastatic lesions. in an attempt to determine the exact histopathological nature of the lesion the findings included a bleeding multilobar mass infiltrating the main carina and projection of the adjacent bronchial mucosa due to external pressure at the rising of the right main bronchus. the patient additionally underwent an orbital biopsy (ct - guided fine needle aspiration biopsy) [4, 5 ]. the patient was referred to the pulmonary department (oncology unit) for first - line chemotherapy with six regimens of cisplatin and etoposide, showing an initial complete response both at the primary site and the orbital metastasis (fig. due to subsequent relapse to the lung, after the 4th cycle the patient underwent second - line chemotherapy with topotecan and carboplatine. at his last follow - up, a complete resolution of the exophthalmos he concluded six cycles with an initial partial response, but died 2 months after the last session. written informed consent was obtained from the patient upon discharge for publication of this case report and all accompanying images. sclc represents 1320% of all new lung cancer diagnoses. it is the most aggressive histological subtype of lung cancer, with a strong predilection for early metastases. the brain is a common site of metastasis in sclc, accounting for approximately 70% of cases [2, 3 ]. at diagnosis, at least 10% of the patients already have brain metastases, and the majority of these will be symptomatic. central nervous system metastases signal stage iv disease and generally herald an ominous prognosis, but neuro- and radiosurgical advances have resulted in effective treatments of brain metastases, leading to improvement in neurological status and survival [6, 7, 8 ]. orbital metastases are a rare manifestation of systemic malignancies and account for only 113% of all orbital tumors [9, 10, 11 ]. however, the precise incidence of these lesions is difficult to estimate. it has increased in recent years because improvements in treatment modalities have resulted in improved survival in cancer patients. published reports indicate breast and lung tumors to be the most common primary neoplasms leading to eye metastasis, and metastases to the eye or orbit develop in approximately 0.712% of patients with lung cancer [9, 10, 11 ]. ophthalmologic symptoms may be preceded by systemic symptoms, especially if the primary site is the lung, gastrointestinal tract, thyroid or kidney. the most common manifestations of orbital metastases are diplopia, exophthalmos, inflammation, decreased visual acuity, pain, chemosis and eyelid swelling, depending on the site affected. symptoms usually occur acutely and progress rapidly, over the course of weeks to months [9, 10, 11 ]. regardless of the primary tumor type, prognosis is poor because patients with orbital metastases are usually at an advanced stage of the disease. in one report, the median survival time was 1.3 years, and the two - year survival rate was 27% [4, 5 ]. the survival duration was not significantly different among patients with different types of primary neoplasms. available treatment options of orbital metastasis are external beam radiotherapy, plaque radiotherapy and newer methods like surgical resection, transpupillary thermotherapy and intravitreal chemotherapy. additionally, anti - vascular endothelial growth factor therapy can be used to slow the progress of maculopathy and neuropathy as well as spare vision after local radiotherapy [12, 13, 14 ]. systemic chemotherapy alone can also be used to treat metastatic tumors to the eye and orbit. however, chemotherapy of the primary cancer alone is not recommended in patients in whom the orbital lesion does not resolve with chemotherapy alone. in this case report, a thorough follow - up of the orbital lesion is presented radiographically, in combination with chemotherapy administration. even thought reduction in visual acuity due to orbital metastasis is rarely the first sign of lung cancer, the clinician should be alert. routine annual or biannual ophthalmic examination is recommended for patients with underlying primary cancers to allow early detection of metastasis and early intervention to protect vision and maintain quality of life.	small cell lung cancer is characterized by rapid growth and early metastasis. despite its sensitivity to cytotoxic therapy, until now treatments have failed to control or cure this disease in most patients. orbital metastases are a rare manifestation of systemic malignancies. breast and lung cancers represent more than two thirds of the primary cancer sites. metastases to the eye and orbit develop in approximately 0.712% of patients with lung cancer. here, we report a rare case of exophthalmos as the first manifestation of a metastatic carcinoma due to small cell lung cancer, and a 6-months follow - up with complete exophthalmic response to chemotherapy.
in partnership with the government of bangladesh, the us centers for disease control and prevention (cdc) and the international centre for diarrhoeal disease research, bangladesh (icddr, b) established nationwide hospital - based surveillance to identify clusters of persons with life - threatening influenza virus infections (6). additionally, icddr, b has had an urban field site in dhaka (kamalapur), where population - based respiratory disease surveillance was begun in 1998. in april 2004 the site and its surveillance system have been described (8). as part of this surveillance, a blood culture for bacterial pathogens was collected from every child with acute respiratory or febrile illness, and from 1 in 5 (20% sampling frame) a nasopharyngeal wash specimen was collected for influenza virus culture in mdck cells, and acute - phase and convalescent - phase serum samples were collected for detecting other respiratory viruses. on january 29, 2008, a 16-month - old boy was brought to the kamalapur clinic with a history of 7 days of fever, 5 days of cough and rhinorrhea, and 3 days of difficult / fast breathing and loss of appetite (table). she said he had not exhibited diarrhea, convulsions, or other signs of illness. the child had been hospitalized 1 year earlier for acute watery diarrhea that resolved uneventfully. no underlying illnesses had been diagnosed, and he had not received any medications before this clinic visit. examination showed that the child had a fever, a mildly elevated respiratory rate, and a clear nasal discharge (table). blood for bacterial culture and viral serologic testing and a nasopharyngeal wash sample were collected according to accepted routine. a chest radiograph showed scattered bilateral alveolar infiltrates. because of the duration of his fever, he received a diagnosis of suspected typhoid fever, which is endemic to this community (9), and was given oral amoxicillin and nystatin for oral thrush. at a follow - up visit to the clinic on january 31, the patient was afebrile ; he was in no distress and had a lower respiratory rate (36 breaths / min). the patient again visited the clinic on february 5 and february 10 and was afebrile on both occasions with a mildly elevated respiratory rate (38 breaths / min) and clear lungs. the mother reported that the child had had loose stools (possibly associated with amoxicillin) on february 10, but she denied that he had diarrhea. the child was never hospitalized ; he completed a 14-day course of amoxicillin for suspected enteric fever and recovered fully. his blood culture was negative for any organism, and his final diagnosis was upper respiratory tract infection. on february 13, a convalescent - phase serum sample was collected as part of routine surveillance. culture of the child s nasopharyngeal wash sample showed cytopathic effects consistent with influenza virus infection ; an aliquot reacted to influenza virus a antiserum but not to antiserum to subtypes h1 or h3. an aliquot of the viral culture material was shipped frozen on april 22, 2008, to cdc, where the isolate was identified as hpai (h5n1) virus by real - time reverse transcription pcr. the virus was identified as an h5n1 clade 2.2 strain on the basis of the hemagglutinin sequence (figure). after identification of the influenza virus isolate as hpai (h5n1) in may 2008, an epidemiologic investigation was initiated, and serum samples were collected from the child and 3 family members. the child lived with both parents and a sister in a 1-room residence. in late january 2008, the father had brought home a well - appearing live chicken from a local market located 50 m from the house. the mother slaughtered the chicken inside the bathroom while the child slept ; she did not report having washed her hands before she handled the child. the waste materials from the slaughter were then stored in a tied polyethylene bag near the house entrance for 2 hours before disposal. microneutralization assay, using the child s subtype h5n1 isolate at cdc, demonstrated a 4-fold rise in subtype h5n1 neutralizing antibodies between the child s january 2008 serum specimens (titer < 20/20) and may 2008 (titer 160/80) serum specimens. serum specimens from the child s family members tested seronegative for subtype h5n1 neutralizing antibodies (the sister was away from the household in january). the virus found in the child, a / bangladesh/207095/2008, is indicated in boldface. we report hpai (h5n1) in a child in bangladesh ; the infection was confirmed by virus isolation from an upper respiratory specimen and by serologic testing. one potential exposure was the healthy - appearing chicken that was brought inside the home. the child did not have direct contact with the chicken, although indirect contact was suggested because his mother handled him after slaughtering the chicken. the owner of the poultry shop where the chicken was purchased reported that 5%10% of chickens had died each day during january 2008 (10). because the shop was located 50 m from the home, environmental subtype h5n1 exposures can not be ruled out. this virus was of the same clade and phylogenetic subgroup reported in poultry in bangladesh during this period (5). no other household members or neighbors reported illness, and no other family members had serologic evidence of subtype h5n1 infection. in nearly 25% of reported subtype h5n1 cases worldwide, the exposure source is unclear (2). in bangladesh and other countries with influenza (h5n1) outbreaks among poultry, surveillance for human subtype h5n1 cases is focused on hospital - based case finding for febrile patients with severe acute respiratory illness. this child was not suspected of having subtype h5n1 infection and had had no known poultry contact ; his illness would not have met standard criteria for subtype h5n1 testing (11). instead, an upper respiratory tract specimen was collected from the child as part of routine influenza surveillance among pediatric outpatients. similar clinically mild cases of subtype h5n1 infection in children have been identified in turkey (12), indonesia (13), and egypt (2). the 1 in 5 sampling frame, a major limitation of this study, raises the possibility that undetected mild cases of subtype h5n1 infection have occurred in children in this population. other limitations include the elapsed time between illness onset and investigation and the identification of only 1 case. the public health value of identifying the cause of severe acute respiratory illness clusters with pandemic potential is clear. this case highlights the value of routine outpatient surveillance for detecting both seasonal and novel influenza a viruses, particularly in settings in which subtype h5n1 strains circulate among poultry. because exposure of subtype h5n1 to humans increases its opportunities for genetic mutation or reassortment, or both, with human influenza a viruses (3), other surveillance strategies, including cross - sectional and longitudinal serosurveys among potentially exposed persons, can help inform the extent of, and risk for, asymptomatic and clinically mild subtype h5n1 infection.	we identified avian influenza virus a (h5n1) infection in a child in bangladesh in 2008 by routine influenza surveillance. the virus was of the same clade and phylogenetic subgroup as that circulating among poultry during the period. this case illustrates the value of routine surveillance for detection of novel influenza virus.
it is estimated that 4% to 7% of adults in the unites states have palpable nodules upon examination. with the advent of ultrasonographic (us) techniques for assessment of the thyroid gland, it is now believed that a nodule can be detected in as many as 67% of the normal population. the first and foremost obstacle for the clinician is to determine whether the nodule is of a benign or malignant nature, albeit malignant nodules are quite rare, comprising approximately 5% of all nodules. fine needle aspiration (fna) of the thyroid nodule has become the standard procedure for evaluation of nodule histopathology and is recommended as the main diagnostic strategy in several guidelines and published consensus agreements. nevertheless, fna has multiple drawbacks inherent in the procedure itself, including the technique employed and the experience of the physician performing the aspiration [5, 6 ]. in an analysis of 4 703 fnas performed in centers in new york and texas, 10.4% of the fnas a considerable number of patients with equivocal findings are referred for surgery despite histopathological evaluation of the nodule after surgery revealing no malignancy. it is estimated that around 75 000 surgeries for nodules with undetermined diagnoses are performed each year in the united states alone ; therefore, with a sound systematic approach, at least one third of these operations could be avoided. decision support systems that take advantage of computerized learning algorithms have been successfully applied in many areas of medicine and these have yielded diagnostic rates comparable or sometimes exceeding sophisticated diagnostic techniques and the clinical judgment of the physician [1013 ]. decision trees extracted from machine - based data mining techniques offer an unprecedented utility by translating large datasets into algorithms that can be directly applied in clinical settings. in the present study, we sought to investigate the utility of classification and regression trees (cart) classifier in differentiating benign from malignant pathologies in a group of patients referred for evaluation. we hypothesized that a decision tree that has a high negative predictive value (npv) could aid physicians to identify patients at low risk of thyroid carcinoma which could spare the patient from unnecessary surgery. over a period of six years (20062011), all records and pathology slides of patients (n = 368) referred to the sadoughi hospital (yazd, iran) for surgery with a primary diagnosis of thyroid nodules were analyzed retrospectively. evaluation of us variables of 68 patients was not possible (us examination was not performed before the operation or the us report was not available or was incomplete), and fna results for 29 patients were inaccessible. finally, the complete data of 271 subjects was collected and a final analysis was performed on this group. clinical and demographic data, including patient 's age, sex, clinical examination of the thyroid nodule, us reports, and laboratory evaluation of thyroid function test (tft), were retrieved from the hospital archives. to create an unanimous presentation of us data, the following variables which were available in all reports were extracted : size of the nodule (if multiple nodules were detected, the size of the largest nodule), number of nodules (solitary, multiple), content (solid, cystic, or mixed), echogenicity (hyperechoic, isoechoic, or hypoechoic), microcalcifications (present or absent), and poorly defined margins (present or absent). fna biopsies were performed with the use of 2527 gauge needles with either capillary action or aspiration techniques. cytology samples were processed via a direct smear on a glass slide or by liquid - based preparations. for those thyroid nodules that were nonpalpable, predominantly cystic, or located posteriorly in the thyroid, a us guided fna was performed. in patients with multiple thyroid nodules, only the largest and most solid - appearing nodule was selected for fna biopsy, and the final diagnosis was based on histopathological examination of the surgical pathology of the selected nodule which had undergone fna biopsy. cytological diagnoses were reclassified into five categories : nondiagnostic, malignant, suspicious, indeterminate, and benign, according to the guidelines decided by the american thyroid association. the specimen was considered to be sufficient if it contained a minimum of six groupings of well - preserved thyroid epithelial cells, consisting of at least 10 cells per group. in cases with ambiguity in the reported diagnosis, surgical specimens were reevaluated by a single experienced board - certified pathologist (shokouh taghipour), who was unaware of the clinical assessment, us results, or fna findings of the patient. well - differentiated neoplasms without capsular invasion or definite nuclear changes were classified as benign, while minimally invasive follicular neoplasms were considered to be malignant. continuous variables are expressed as means standard deviations and categorical ones as numbers followed by percentages in parenthesis. continuous variables between patients with benign and malignant nodules were compared using an independent t - test. to compare categorical variables between the two groups, a pearson 's chi square (or fisher 's exact test where necessary) was employed. continuous variables, age and nodule size, were categorized into distinct groups according to optimal cut - off values provided by the decision tree. to further examine the probability of thyroid malignancy across the spectrum of age and size of the nodule, generalized additive models (gam) were constructed. binomial distribution was assumed for the target variable (diagnosis : benign / malignant), with logit as the link function. the degree of freedom was automatically calculated according to the generalized cross - validation rule. to create a decision tree incorporating relevant clinical, laboratory, and us features of the thyroid nodule, cart which is a rule - based recursive partitioning method was employed. the larger sample, dubbed the learning sample, was used to extract the optimal decision tree. the sample containing 25% of the participants, dubbed the validation sample, served as the validation set. based on theoretical background, a two - step approach for the identification of patients that can safely avoid surgery with a minimum risk of malignancy was established. the first step served as the screening procedure and was tailored in a manner to produce as few false negatives as possible. therefore, allocation of the misclassification costs for false negatives was determined to be three times as high as false positives. this procedure directed the initial tree to exert an excellent sensitivity but yielded low specificity. variables entered in this step were as follows : age, sex, nodule size, number of nodules, presence of goiter, tft, and presence of alarm signs, including hoarseness, weight loss, family history of thyroid cancer, and lymphadenopathy. the optimal tree was selected on the basis of a trade - off between parsimony and cross - validation costs. therefore, in the first step, the optimal tree was the most clinically sound parsimonious tree with cross - validation costs within 0.1 standard error of the tree automatically selected by the system. if such a tree was not available within the system - derived nested set of trees, the optimal tree was extracted using pruning of the system - generated optimal tree. however, the second step was directed in the opposite manner in order to identify those with the lowest risk of malignancy, chosen from a high risk population. these subjects are often the ones that undergo unnecessary surgery in clinical practice, with no malignancy detected on histopathological examination despite equivocal or suspicious findings on the fna. in the second step, these variables included nodule content (cystic, solid, mixed), echogenicity (hypoechoic, isoechoic, hyperechoic), poorly defined margins (present, absent), microcalcification (present, absent), and combined diads or triads of these variables using logical terms and/or. in addition, it was also validated on a subset of test samples which had fna results labeled nondiagnostic, indeterminate, or suspicious, to see if the derived algorithm would be useful in discriminating benign from malignant in cases where fna findings are not conclusive. for the learning set, test set, and unsatisfactory fna set, the sensitivity, specificity, positive predictive value (ppv), and npv, along with their 95% confidence intervals (95% ci), were calculated., ny, usa). for gam and cart, statistica version 8 (statsoft inc. patients ' age ranged from 23 to 78 years (mean : 45.4 13.9), and women comprised 81.5% of the subjects. baseline characteristics of the study participants according to their thyroid nodule pathology are summarized in table 1. mean age of the subjects with benign and malignant pathologies did not differ significantly (44.6 12.3 in the benign, and 46.9 17.0 in the malignant group, p = 0.218). however, after classification of age into categories it was revealed that subjects in the malignant group are more likely to be younger than 30 or older than 60 years when compared with individuals in the benign group (p = 0.008). the female to male ratio was 4.5 : 1 ; men were more likely to present with malignant nodules (p = 0.011). on the other hand, subjects in the two groups did not differ significantly with respect to the presence of thyroid enlargement on examination, number of thyroid nodules, and tft (table 1). the sizes of the thyroid nodules were significantly different between the two groups ; nodules of 5 cm were usually of benign pathology. gam showed that the association between age and thyroid cancer is better fitted using a curvilinear vector (nonlinear p = 0.004). based on the drawn curve, a medium to high risk for malignancy is expected in the early 20s with a steady decline towards older age. after reaching the lowest point at around 40 years, the risk of malignancy then increases steadily, finally slowing after 70 years (figure 1). drawn spline of the nodule size also showed a complex curvilinear pattern, although this did not reach statistical significance (non - linear p = 0.220, figure 2). the fna categorized thyroid nodules into nondiagnostic (23 subjects, 8.5%), benign (52 subjects, 19.2%), malignant (45 subjects, 16.6%), suspicious (58 subjects, 21.4%), and indeterminate (93 subjects, 34.3%). of note, four cases (8.9%) that were initially diagnosed by fna as malignant turned out to be false positives. moreover, eight cases (15.3%) that were classified as benign in fna were in fact false negatives that turned out to be malignant carcinomas (seven papillary cell carcinomas, one follicular carcinoma). the majority of indeterminate fna results proved to be multinodular goiter (49 subjects, 52.7%), follicular adenoma (39 subjects, 41.9%), and lymphocytic thyroiditis (4 subjects, 4.3%). the results of the histopathological diagnoses obtained following surgery are summarized in table 2. in the majority of cases (195 subjects, 72%), the most frequent diagnostic category reported was multinodular goiter (133 subjects, 68.3%), followed by follicular adenoma (40 subjects, 20.5%), lymphocytic thyroiditis (nine subjects, 4.6%), and hashimoto 's thyroiditis (eight subjects, 4.1%). furthermore, the most frequent type of malignancy comprising more than three quarters of all identified malignancies was papillary cell carcinoma. other types of malignancy, in order of frequency, were follicular cell carcinoma, medullary cell carcinoma, hurthle cell carcinoma, and carcinoma of anaplastic nature (table 2). sensitivity, specificity, ppv and npv of the optimal trees in steps 1 and 2, and combined in learning and test samples, and inconclusive fna of all the entered variables in the first step, only three, namely age, sex, and nodule size, contributed to construction of the optimal tree, with age having the highest discriminatory ability, followed by nodule size and sex. all us variables were able to significantly discriminate between low versus high risk patients in a univariate analysis (solid content p = 0.033, hypoechogenicity p years). previous studies have shown that hypoechogenicity and microcalcifications are present in 26%87% and 26%59% of all thyroid cancers, respectively. our findings also support the notion that us features are highly specific for differentiating between benign and malignant thyroid nodules [3437 ]. in a multicenter study of 831 patients with thyroid nodules, marked hypoechogenicity and microcalcification demonstrated excellent specificity (92.2% and 90.8%, resp.), although it revealed low sensitivity (41.4% and 44.2%, resp.) for diagnosis of malignant thyroid nodules. first, only patients referred for surgical interventions were included in our study, and this selection bias may have resulted in overpresentation of patients in whom thyroid nodules turned out to be of a malignant nature. however, it should be noted that our derived model was specifically tailored to identify low risk patients who would not benefit from surgery, despite being nominated for other reasons. therefore, the optimal tree developed in this study should be applied to clinical settings similar to ours. indeed, physicians in their daily clinical practice usually find the question of whether to refer suspicious patients to surgery or not second, the retrospective nature of our study might have resulted in preferential inclusion of patients who have complete clinical, us, and histopathological assessments. it should also be noted that while our decision system yielded promising results when applied to the subset of patients with inconclusive fna findings, since it was built on the general population of patients referred for thyroid nodule evaluation, it should only be applied in settings with similar clinical pictures and patient profiles. collectively, our study provides further evidence that machine - based decision support systems can accurately distinguish benign from malignant thyroid nodules. optimal trees derived from a cart classifier are capable of using available clinical and us data in a multivariate manner and could help physicians reach a clinical decision in cases where ambiguity exists.	purpose. we sought to investigate the utility of classification and regression trees (cart) classifier to differentiate benign from malignant nodules in patients referred for thyroid surgery. methods. clinical and demographic data of 271 patients referred to the sadoughi hospital during 20062011 were collected. in a two - step approach, a cart classifier was employed to differentiate patients with a high versus low risk of thyroid malignancy. the first step served as the screening procedure and was tailored to produce as few false negatives as possible. the second step identified those with the lowest risk of malignancy, chosen from a high risk population. sensitivity, specificity, positive and negative predictive values (ppv and npv) of the optimal tree were calculated. results. in the first step, age, sex, and nodule size contributed to the optimal tree. ultrasonographic features were employed in the second step with hypoechogenicity and/or microcalcifications yielding the highest discriminatory ability. the combined tree produced a sensitivity and specificity of 80.0% (95% ci : 29.998.9) and 94.1% (95% ci : 78.999.0), respectively. npv and ppv were 66.7% (41.185.6) and 97.0% (82.599.8), respectively. conclusion. cart classifier reliably identifies patients with a low risk of malignancy who can avoid unnecessary surgery.
tullus. recently published an algorithm for the orderly investigation of renovascular hypertension in children, in which ultrasonography is one of the primary studies. doppler ultrasound non - invasively assesses renal artery flow, but is less sensitive than angiography. computed tomographic (ct) angiography and magnetic resonance angiography (mra) offer intermediate sensitivity. digital subtraction angiography is the gold standard investigation for renovascular causes. in some children, hypertension accompanies congenital renal anomalies or an ectopic renal position. in some reports, magnetic resonance imaging (mri) or retrograde pyelography led to the diagnosis when ultrasound failed to do so [2, 3 ]. when ectopia does occur, the thorax is an unusual location to find the kidney. hahn. described an intrathoracic kidney and postulated that contact with the diaphragm was the direct cause of malformation of the diaphragm. the obstruction of urinary drainage is believed to cause dysplasia and is associated with well - described pathological findings. obstruction, however, is not believed to play a role in ectopia ; yet, malformations often accompany ectopia. here, we report a child with hypertension and a malformed kidney in an unexpected location. we describe the use of new modalities for imaging and surgical correction, as well as pathologic findings that have not previously been described in this context. the 95th percentile pressure for her height and age were 108/70. over the next few weeks, auscultated pressures ranged between 108128 mmhg (systolic) and 7688 mmhg (diastolic). the second, a twin gestation, was terminated at 17 weeks due to neural tube defects in both fetuses and cardiac anomalies in one of them. to treat a hypercoagulable state during this and a fourth pregnancy, the mother received low - molecular - weight heparin and aspirin. growth and development were normal, with a height and weight at the 50th percentile. peripheral renin activity was 3.5 ng / ml / h (< 15 ng / ml / h). her urine - specific gravity was 1.010, ph 7, with no heme, protein, nitrite or glucose. a renal ultrasound revealed the left kidney to be 8.1 cm in length (between the 50th and 95th percentiles). a nuclear renal scan demonstrated the normal uptake of nucleotide within the left kidney (figure 1). however, synchronous with activity in the left kidney, a focus of abnormal activity appeared superiorly in either the lower aspect of the right hemithorax or the uppermost aspect of the abdomen. though displacement of the ectopic kidney and bowel into the thorax was noted, imaging did not clarify whether a bochdalek hernia existed or an eventration of the hemidiaphragm. 2.time-resolved, dynamic contrast - enhanced mra of the chest and abdomen. fig. a small right renal artery (solid arrow) arises from the aorta (a), coursing first laterally, then cranially. an aneurysm (open arrow) is seen near the upward inflection of the vessel. a small right renal artery (solid arrow) arises from the aorta (a), coursing first laterally, then cranially. an aneurysm (open arrow) is seen near the upward inflection of the vessel. echocardiography revealed dilation of the aortic root and ascending aorta, with a small patent ductus arteriosus. left ventricular mass / height was 41.8 g / m (normal 19.438.6). enalapril was begun at 0.08 mg / kg and gradually increased to 0.35 mg / kg, while monitoring serum electrolytes and creatinine. noting no change in blood pressures (118122 mmhg systolic), the patient began losartan, which was increased gradually from 0.9 to 1.8 mg / kg. enalapril was discontinued due to sleepiness, resolving this symptom. though pressures improved somewhat (average systolic pressure of 115 mmhg), she still did not maintain pressures below the 90th percentile (104 mmhg). amlodipine was begun and titrated up to 0.5 mg / kg / day. though the patient remained asymptomatic, it appeared unlikely that pressures could be normalized on a simple regimen without adverse effects. a right - sided diaphragmatic eventration was present with a very thin connective tissue sac that functioned as an elevated diaphragm, keeping the abdominal contents separate from the chest. (a very thin hernia sac functioned as an elevated diaphragm, keeping the abdominal contents separate from the chest.) intraoperatively, the surgeons considered whether to place a synthetic patch in place of the missing diaphragm. noting her normal pulmonary function tests, they elected to defer action on the diaphragm until a later time. both anti - hypertensives were held on the evening prior to surgery. in the immediate post - operative period, four hours post - operatively, resting blood pressures were 125/75, and she received 0.25 mg / kg amlodipine. she vomited 20 min after the dose, but pressures improved to 102/52. at discharge (18 h later), this dose was continued once daily. the drug was weaned and discontinued within 3 weeks. pathology revealed a hypoplastic immature kidney measuring 5 3 2 cm and weighing 15 g (expected weight for age 60 g). the collecting system and medullary pyramids showed no evidence of obstructive uropathy. the renal cortex showed hypoplasia with some glomerular immaturity and moderate glomerulosclerosis and patchy tubulo - interstitial atrophy (figure 4). the main renal artery was small and the wall showed moderate medial hypertrophy. also noticed was the presence of prominent smooth muscle nodules surrounding the artery and some of its main branches (figures 46). although blood pressures in our patient were modestly elevated, such changes can be found within end - stage kidneys and are attributed to severe hypertensive damage to arteriolar walls. this suggests the presence of intermittent unkinking of the proximal artery with high pressures reaching the distal renal artery. the renal cortex showed hypoplasia with some glomerular immaturity and moderate sclerosis and patchy tubulo - interstitial atrophy (figure 6). intrarenal arteries and arterioles displayed moderate luminal narrowing due to medial hypertrophy ; however, fibrinoid necrosis, onion - skinned arterioles and juxtaglomerular apparatus abnormalities were absent. 4.a cross - section view of the distal renal artery which shows medial hypertrophy and florid peri - arterial fibroid - like smooth muscle nodules (he 40). 5.bundles of smooth muscle cells streaming from the artery wall (a) to form peri - arterial fibroid - like nodule (n). focal lymphocytes and fibrous tissue were also noted (open star) (he 100). 6.light microscopy of the renal cortex showing medial arteriolar hypertrophy with luminal narrowing (oval). glomeruli vary from normal (n) to sclerosed (circle), while others show immaturity with persistent epithelial cell prominence (i m) (he 200). a cross - section view of the distal renal artery which shows medial hypertrophy and florid peri - arterial fibroid - like smooth muscle nodules (he 40). bundles of smooth muscle cells streaming from the artery wall (a) to form peri - arterial fibroid - like nodule (n). focal lymphocytes and fibrous tissue were also noted (open star) (he 100). light microscopy of the renal cortex showing medial arteriolar hypertrophy with luminal narrowing (oval). glomeruli vary from normal (n) to sclerosed (circle), while others show immaturity with persistent epithelial cell prominence (i m) (he 200). this patient 's ultrasound did not reveal a small, scarred or dysmorphic kidney to suggest an explanation for the hypertension. analyzing this case prospectively captopril - augmented renal scanning or angiography can assess for vascular abnormalities, but the sensitivity of captopril scans has been criticized. the left kidney 's large size was thought to indicate compensatory growth, suggesting that the right kidney had been abnormal or absent for most or all of her life. since an ectopic kidney might not appear reniform nor be of normal size, a functional nuclear medicine study was performed. valentini. described hypertension attributed to a unilateral, malformed kidney. in that case, the defect was detected by mri when control of pressures proved to be suboptimal after 1 year of pharmacologic therapy. ilyas and tolaymat described a patient in whom only retrograde pyelography enabled the detection of the abnormal kidney. in our patient, an initial renal ultrasound failed to detect the right kidney, and therefore, looking for an abnormal kidney within the physiologic location would not have succeeded. in this case, the abnormal kidney had sufficient function to enable detection by nuclear imaging, evident from her peripheral renin activity and aldosterone levels. scintigraphic uptake in the right chest was amorphous, making it impossible to define the limits of the organ or to measure differential function. in this case, nuclear imaging attracted attention to an unlikely place in which a missing kidney could be found. though angiography is the gold standard for defining renal arteries and collateral vessels, it is infrequently used in pediatrics due to its invasiveness. mra has become more useful as it becomes possible to visualize smaller vessels. in children, ct angiography permits more rapid image acquisition, sometimes enabling studies without sedation, but with significant radiation exposure. prior to 2007, it was not possible to obtain the dynamic, contrast - enhanced time - resolved angiography used in this case. prenatal ultrasounds did not prospectively detect the diaphragmatic eventration, ectopic renal position nor the abnormal renal size. these were reviewed after the diagnosis was known, and in retrospect, although both kidneys appeared in the normal position, the right hemidiaphragm was not definitively identified. preoperative mri images of the ectopic kidney were suggestive of a bochdalek hernia, demonstrating the bowel and the kidney within the thorax. the complete hernia sac mimicked an eventration, or high - riding diaphragm on x - ray and intraoperatively. the patient 's pulmonologist elected not to recommend diaphragmatic reconstruction. when the small, ectopic kidney was found, physicians discussed nephrectomy with the family. normalization of the pressure, however, was a priority, especially in light of mild left ventricular hypertrophy on echocardiography. bilateral renovascular hypertension is a contraindication to the use of an acei. some consider suspicion of renovascular hypertension as a general contraindication, even when unilateral. a non - invasive, pharmacological destruction of the affected kidney was desired in this case, and suspicion of disease in the contralateral kidney was low. despite drug - related fatigue attributable to the acei, the family still hoped to find a tolerable pharmacologic strategy. an angiotensin receptor blocker and a calcium channel blocker reduced pressures without adverse effects, but not below the 90th percentile. pain in the post - operative period might have elevated her pressures, though her examination suggested that pain was well controlled. levels of renin and aldosterone are not interpretable while receiving antihypertensives, and the pressures remained normal as doses were weaned. removal of a unilateral poorly functioning kidney eliminates the need for medications in 75% of children and reduces the number of drugs required in almost all [10, 11 ]. among those who benefit, hypertension can continue for a few months, but the median time to normalization is 1 week. even if, before surgery, the abnormal kidney provides more than 13% of total function, blood pressure and glomerular filtration remain excellent 516 years after removal. few cases of such ectopic kidneys have been occasionally reported previously, but not with peri - arterial smooth muscle nodules. this pathology has been described in arterioles of end - stage renal disease with marked hypertension. though this child 's blood pressures were higher than the 95th percentile for her age, they were much lower than the pressures typically associated with threats to vessel integrity. we also found none of the pathologic changes to be associated with the obstruction of urine flow. many reports of renovascular hypertension in children describe the restoration of renal blood flow using endovascular or percutaneous transluminal angioplasty. compared nephrectomy with pharmacologic treatment in a unilateral multicystic dysplastic kidney (mcdk), where spontaneous involution is almost universal. comparing 21 children who underwent nephrectomy with 20 who did not, outcomes were identical within 6 years. but when the malformation is not mcdk, discrete arterial stenosis or part of a recognized syndrome, we have little information with which to predict the natural course. well - known limitations of pharmacologic management include non - adherence, medication side effects and medication failure. although pharmacologic nephrectomy is an attractive idea to parents and caregivers, after the review of the literature, we conclude that new techniques make nephrectomy the preferable solution for hypertension in the context of a malformed, poorly functioning kidney.	standard initial assessment via ultrasound of a 4-year - old girl with hypertension revealed the absence of one kidney. instead of cross - sectional imaging of the retroperitoneal space, a functional (nuclear) study was performed. this revealed a malformed kidney within the chest. though systemic levels of renin and aldosterone were not elevated, removal of the malformed kidney normalized the blood pressure. the presence of prominent smooth muscle nodules surrounding the arteries was seen in the malformed kidney. initial attempts to avert surgery by pharmacologically reducing blood flow to the malformed kidney were unsuccessful. the review of the literature offers little evidence to support such a strategy.
the spectrum of age - related, ebv - positive lymphoproliferative disorders (aebvlpd) was first described by oyama and coworkers and distinctively occurs in elderly patients without any history of immunosuppression 1. further analysis of aebvlpd cases revealed a heterogeneous group of diseases with very different clinical outcomes, leading to the subclassification into : reactive hyperplasia (rh), mucocutaneous ulcer (ebvmcu)/polyclonal extranodal (polye), polyclonal nodal (polyn), and diffuse large b - cell lymphoma (dlbcl) 2,3. in this report, we present a case of age - related ebv - positive mucocutaneous ulcer that regressed completely in the course of 4 months without treatment. an 81-year - old lady presented to her dentist with a 3-month history of a painful, nonhealing ulcer on the left hard palate. there was no history of trauma and the ulcer did not improve after her complete upper denture was removed. she was a nonsmoker and did not consume alcohol. besides the presence of a painful oral ulcer, she was well and had no systemic complaints. clinical examination revealed a round, well - circumscribed, deep ulceration measuring 3.5 3.5 cm located on the posterior left hard palate extending laterally from midline to alveolar ridge and posteriorly to the hard and soft palate junction. the ulcer had a slightly raised indurated border and a tan - white granular base (fig.1a). the differential diagnoses of the ulcer included necrotizing sialometaplasia, squamous cell carcinoma, malignant salivary gland tumor, and lymphoma. an incisional biopsy was performed and sent to the faculty of dentistry, university of toronto for oral pathology consultation. the initial biopsy showed pieces of oral mucosa with large areas of predominantly necrotic tissue (fig.2a). there were scattered areas of viable tissue consisting of small blood vessels with fibrin deposits surrounded by a polymorphous infiltrate that included atypical cells (fig.2b). the atypical cells had a large vesicular nucleus and 1 to 2 prominent nucleoli and were positive for cd20, cd30, and lmp1 (fig.2c). in situ hybridization for epstein barr virus - encoded rna (eber) was done at sunnybrook health sciences center and revealed scattered positive cells throughout the specimen (12% of the cellular infiltrate), particularly at the interface between the necrotic areas and inflamed mucosa (fig.2d). clinical photographs over a 4-month period showing a large palatal ulcer that migrated posteriorly and then completely resolved. (a) squamous mucosa with dense lymphoid infiltrate partly covering a large area of necrosis. (b) small area of viable tissue within the necrotic tissue showing a polymorphous infiltrate that included atypical lymphoid cells. (c) immunohistochemical staining demonstrated that the atypical lymphoid cells were lmp1-positive (shown here) and cd30-positive (not shown). (d) in situ hybridization for eber showed scattered positive cells throughout the lesion. in a follow - up visit 6 weeks after incisional biopsy, the original ulceration had extended posteriorly, encompassing parts of the soft palate. the anterior aspect of the ulcer has healed but the mucosa showed a slightly raised, irregular surface (fig.1b). the second biopsy of the ulcer showed a similar histological appearance as the first biopsy, again with extensive necrosis and an atypical lymphoid infiltrate (not shown). the biopsy of the healed area showed a piece of oral mucosa with a mild focal inflammatory infiltrate and no evidence of an atypical lymphoid infiltrate. based on the clinical and histological appearance the patient implemented diet modifications and vitamin supplementation only, and no prescription medication or active treatments were used. at a follow - up visit 2 months after the second biopsy, the ulcer had healed completely (fig.1b). at the most recent follow - up, 12 months after the second biopsy ebv - positive mucocutaneous ulcer is a recently described lesion. in a comprehensive review of the clinical and histopathological features of ebvmcu, 17 cases were due to age - related immunosenescence (aebvmcu) and nine cases were related to immunosuppressive therapy 3. the clinical presentation was that of ulceration of skin or mucosa with no evidence of systemic lymphadenopathy, hepatosplenomegaly, or bone marrow involvement. the localized nature of the ulceration was thought to reflect a minimal lapse in immunosurveillance over ebv 3. histologically, ebvmcu regardless of cause of immunosuppression was characterized by well - circumscribed ulceration with an underlying polymorphous infiltrate of lymphoid cells that included atypical, reed - sternberg, and hodgkin - like cells. in situ hybridization for eber showed a band - like distribution of positive cells underlying the ulcerated mucosal epithelium. overall, the clinical course of ebvmcu was indolent and most of the age - related cases regressed spontaneously or had remitting and relapsing, localized disease. the lesions that were treated with radiotherapy or chemotherapy all underwent complete remission. in a follow - up study, the same group reviewed 122 cases of aebvlpd including reactive hyperplasia (rh), polyclonal extranodal (polye), polyclonal nodal (polyn), and diffuse large b - cell lymphoma (dlbcl) 2. the majority of cases of polyclonal extranodal lpd (16 of 21 cases) were classified as ebv - positive mucocutaneous ulcer (aebvmcu). in striking contrast with polyn and dlbcl cases, aebvmcu had an excellent prognosis and there were no disease - specific deaths reported in this group. there are few published reports of aebvlpd in the oral cavity concerning patients with no history of immunosuppression 2,4,5 and there is only limited information on clinical outcome. to the best of our knowledge, there is only one report in the english published literature of aebvlpd presenting as a palatal ulcer. in the largest series of ebvmcu 3, there was one case of a palatal lesion described as an ulcerated mass in the palate in an 80-year - old woman. it is possible that there are unrecognized cases of aebvmcu of the oral mucosa since the clinical appearance can be nonspecific and diagnosis requires the demonstration of ebv in the lesion. the absence of ebv excludes the diagnosis of aebvmcu and requires further investigations to rule out malignant disease. the treatment for reported cases of ebvmcu has varied from observation to radiotherapy and/or chemotherapy and the published literature does not provide conclusive guidelines for treatment 3. 3 showed that 57% of ebvmcu patients achieve spontaneous remission while 36% received aggressive therapy with all patients achieving remission. radiotherapy and chemotherapy were avoided because the lesion remained localized and did not compromise the ability to eat or speak. also, the ulceration did not follow a progressive destructive course typical of lymphomas but rather started healing after the biopsy. since the patient was not taking immunosuppressive medications, there was no opportunity to relieve immunosuppression. increased awareness of aebvmcu is important for correct diagnosis and management of these lesions that can mimic malignant disease requiring aggressive treatment., further systemic investigations including imaging, bone marrow biopsy, and serology may be needed to rule out a systemic lymphoproliferative disorder 6,7. at 14 months after the initial presentation to the dentist she is being monitored for recurrence of the palatal ulcer or development of other areas of ebv associated lymphoproliferative disease. elderly patients who develop an unexplained, persistent ulcer of the oral mucosa should have the lesion examined for ebv. a medical history should be taken to determine if the patient is on immunosuppressive medications 7. additional reports of aebvmcu will help to understand the factors that control the extent of ebv associated lymphoproliferative disease.	key clinical messagethe oral manifestations of ebv - positive mucocutaneous ulcers have a worrisome clinical appearance but relatively benign clinical course, responding well to conservative treatment. elderly patients who develop an unexplained, persistent ulcer of the oral mucosa should have the lesion examined for ebv.
intracranial germ cell tumors (gcts) are rare neoplasms that typically arise in the pineal and suprasellar regions. they account for 0.5 - 3% of all pediatric tumors of the central nervous system (cns), germinomas being the most common histological type. although the production of tumor - associated human chorionic gonadotropin (hcg) by a germinoma is a rare occurrence, it may lead to precocious puberty (pp) due to it 's structural and functional similarity to luteinizing hormone (lh). we report a case of hcg - producing tumor located in the suprasellar region and associated with sexual precocity. a 10-year - old male patient was brought to our department with premature pubarche and onset of facial acne at the age of 8 years and increase in penis size at the age of 9 years. concomitantly, he had a progressive, gradually worsening holocranial headache associated with drowsiness and loss of appetite. previously, he was a healthy patient, born by spontaneous vaginal delivery at term weighing 3510 g and measuring 50 cm. the patient had no family history of endocrine disorders, sexual precocity, or consanguinity. the mother 's and father 's self - reported height was 155 cm and 175 cm respectively. physical examination revealed height of 148 cm (90 - 95 percentile), weight of 39 kg (75 - 90 percentile), blood pressure of 90/60 mmhg, heart rate of 60 beats per minute, facial acne, abdominal fat deposition in the periumbilical region, bilateral, symmetrical and prepubertal sized (3 ml) testes within the scrotum, 8-cm long penis, and tanner stage p3-g2. magnetic resonance imaging (mri) of the brain showed a large, hyperintense tumor in the suprasellar region, with hypodense areas inside the tumor, which was located in the anterior third ventricle, measuring 3 cm in the largest diameter and causing triventricular dilatation [figure 1 ]. radiographs of the hands and wrists revealed significant acceleration of bone age (ba) in relation to chronological age (ca) (ba : 13 years ; ca : 10 years and 8 months ; standard deviation : 10 months). mri of the abdomen yielded normal results. laboratory tests revealed that the values for serum glucose, albumin, calcium, sodium, potassium, renal function, and liver function were within the normal limits. hormonal tests showed increased hcg levels in both blood and cerebrospinal fluid (csf), increased total testosterone levels, and hypopituitarism (unresponsiveness to gonadorelin stimulation test) [table 1 ]. large, hyperintense suprasellar tumor, with hypodense areas inside, located in the anterior third ventricle, measuring 3 cm in the largest diameter (arrows) and causing triventricular dilatation results from hormonal tests and tumor marker tests the patient was diagnosed with an hcg- and testosterone - producing tumor associated with hypopituitarism and intracranial hypertension. hormone replacement therapy was initiated with levothyroxine and hydrocortisone, and transcranial surgery was performed. the patient showed complete regression of sexual characteristics and acne, with normal laboratory tests post - operatively. uniform large tumor cells with large nuclei, prominent nucleoli, and abundant glycogen - rich cytoplasm are noted among reactive inflammatory cells and bands of connective tissue, supporting the diagnosis of germinoma pp is defined as the presence of signs of puberty before the age of 8 years in girls and 9 years in boys. pp is more frequently found in girls, with a female - to - male ratio of 12.3:1. it is important that pp be properly investigated in boys because, unlike girls, the onset of idiopathic pp is uncommon among boys, having an organic cause in most cases. gonadotropin - independent pp (gipp) results from an increased secretion of sex hormones, regardless of the maturation of the hypothalamic pituitary gonadal axis. hcg - producing tumors, including gonadal and extragonadal gcts may lead to gipp. in the present case, which reported premature pubarche, increased penis size and small testicular size compared to the overall pubertal development, high testosterone levels associated with suppressed lh and follicle - stimulating hormone (fsh) levels and an unresponsiveness to a gnrh analog - stimulation test confirmed the diagnosis of gipp. gcts account for 3 - 11% of all childhood tumors in the united states and western europe, whereas in japan they account for 12.5 - 16% of the cases. among the gcts, extragonadal gcts often occur in the pineal and suprasellar regions, as in the case described here. the clinical presentation of suprasellar gcts may include panhypopituitarism, diabetes insipidus, and visual disturbances, with a long pre - diagnosis period, generally longer than 1 year. in the present case, the effects of tumor compression led to hypopituitarism and manifestations of intracranial hypertension, such as headache and papilledema. data from the literature have demonstrated the presence of hcg and its subunits in tumor cells of different origins, including cns neoplasms. according to reports on hcg - producing germinomas, including a japanese series of 111 cases of intracranial gcts, these tumors account for 18% of all germinomas. it is known that these lesions have a worse prognosis compared to non - secretory germinomas, with a higher recurrence rate and shorter survival. however, detection of hcg is not a marker of metastasis or tumor size, and its presence often indicates the activity of syncytiotrophoblastic elements within the tumor. both serum and csf hcg measurements in our patient were well above the normal limits, a finding that, together with the mri scans, is consistent with the diagnosis of an hcg - producing tumor, which after biopsy was classified as a germinoma. increased stature, advanced ba, presence of pubic hair and acne, and early genital development were caused by the increase in serum testosterone levels. hcg is structurally similar to lh, and excessive increases may stimulate the leydig cells of the testes to produce testosterone. as a result, the patient also showed pituitary - axis suppression, with reduced levels of gonadotropic hormones. reduced fsh levels may explain the lack of correlation between testicular growth and other sexual characteristics presented by the patient, since testicular maturation depends upon this hormone. characteristics on computed tomography or mri images often do not provide sufficient information for a histological diagnosis. therefore, given the diversity of the tumor subtypes found in the suprasellar region, obtaining adequate biopsy specimens is of paramount importance. for this purpose, open surgery is preferable, as performed in this case, and the histological examination should define the approach that will be used.	this study aims to report a rare case of precocious puberty (pp) due to a human chorionic gonadotropin (hcg)-producing germinoma located in the suprasellar region. a 10-year - old male patient presented with sexual precocity, headache, drowsiness, loss of appetite, and papilledema. significant acceleration of bone age in relation to chronological age, high serum total testosterone levels, and hypopituitarism (unresponsiveness to stimulation test) were observed. magnetic resonance imaging (mri) of the brain showed a large suprasellar tumor and triventricular dilatation. high hcg levels were found in both blood and cerebrospinal fluid. hormone replacement therapy and transcranial surgery associated with radiotherapy were performed, with complete regression of sexual characteristics and normal laboratory tests post - operatively. clinical and laboratory findings, in addition to mri scans, led to the diagnosis of an hcg - producing tumor and pp, which represents a rare report in the literature.
bacterial, parasitic, viral infections and almost all of the immunosuppressive drugs used can produce diarrhea ; however, inflammatory bowel disease (ibd) is rare in the transplant recipient. a 46-year - old man who developed end - stage renal disease (esrd) of unknown etiology underwent live related renal transplantation, with his sister as the donor in 1996. he was started on cyclosporine, azathioprine, and prednisolone, with cyclosporine being withdrawn 1 year after transplantation because of financial constraints. subsequently, he was only on azathioprine (125 mg daily) and prednisolone (15 mg on alternate days). he had no episodes of graft dysfunction, post - transplant diabetes mellitus, malignancies, or opportunistic infections. he developed diarrhea in 2005, with four to five episodes of semi - formed stools a day. he took symptomatic treatment for the same for two years. in 2007, he noticed blood streaking of stools and lost about 5 kg of weight. multiple stool cultures and examinations were negative for salmonella, shigella, campylobacter, clostridium difficile toxin, yersinia, enterotoxigenic e. coli, cryptosporidium, giardia, and strongyloides larvae. colonoscopy revealed multiple 5 to 8 mm size superficial ulcers with edematous surrounding mucosa, with clean base and hyperemic margins up to 20 cm from the anal margin. on histological examination, the rectal and sigmoid mucosa showed mucosal hyperplasia with crypt abscesses and evidence of acute and chronic inflammation [figures 1 and 2 ]. a diagnosis of ulcerative colitis was made and he was started on mesalamine 2 gm / day. the frequency of stools decreased to 1 to 2 a day, with no blood or mucus. active colitis with muco - depletion, cryptitis with crypt abcessess (arrow) (h and e, 40) crypt distortion, crypt loss (arrow), and interstitial inflammation with lymphomononuclear and eosinophilic infiltration (chronic colitis) (h and e, 20) diarrhea is a common complication after transplantation, the incidence being as high as 12%. an etiology for the diarrhea can be identified in 80% of the cases, with infections being the most common cause (41.5%) followed by immunosuppressive medication (34%). two - third of the diarrhea episodes develop in the late post - transplant period (> 6 months after transplantation) and 14% of the episodes are of chronic diarrhea. the incidence of diarrhea is higher with mycophenolate mofetil (mmf) compared to azathioprine, tacrolimus compared to cyclosporine, and with sirolimus compared to azathioprine. the dose dependence of diarrhea has been demonstrated with mmf and sirolimus, with higher doses associated with greater incidence of diarrhea. combinations of immunosuppressive agents, while improving efficacy, may increase risk of diarrhea. for example, the incidence of diarrhea was increased but the rate of acute rejection was significantly less with the combination of mmf with tacrolimus, compared with the combination of mmf with cyclosporine. similarly, the combination of mmf with sirolimus was associated with three - fold increase in the incidence of diarrhea compared with its combination with cyclosporine. a stepwise increase in diarrhea is noted from renal to cardiac to liver transplantation, and an overall higher incidence of diarrhea is seen in the white population. ibd is an uncommon cause of diarrhea after transplantation and there are only few case reports of ibd developing de novo after kidney transplantation.[1315 ] passfall. in 1992 reported the first case of ulcerative colitis in a kidney transplant recipient while on monotherapy with cyclosporine. this 60-year - old patient on cyclosporine alone after methylprednisolone being withdrawn 6 months post - transplantation presented with rectal bleeding 6 years after kidney transplantation. the colonoscopy and histological features were consistent with ulcerative colitis and infectious causes were ruled out with extensive investigations. the patient responded to re - introduction of methylprednisolone and cyclosporine was continued. in 1997, riley. reported a case series of transplant recipients who developed ibd. only two of the 14 cases reported in the series were kidney transplant recipients, the rest being liver transplant recipients. the cause of esrd was obstructive uropathy in one and adpkd in the other patient. both the patients were on cyclosporine and prednisolone and the dose of prednisolone at the onset of symptoms was less than 10 mg / day. although one of the patients responded to treatment with azulfidine, the other continued to have intermittent flares despite increased doses of prednisolone. the mean duration to the onset of symptoms after transplant in this series was 4 years and the presenting symptoms, in order of frequency, were bloody diarrhea (seven), diarrhea (five), abdominal cramping (five), and bright red blood per rectum (three). reported a case of ulcerative colitis developing in a renal transplant recipient 4 years after transplantation. the cause of esrd in this male child was anti - gbm disease and he received triple immunosuppression with cyclosporine, prednisolone, and azathioprine. four years after transplantation, he developed bloody diarrhea which was presumed to be cmv enterocolitis as he was cmv seropositive after transplantation and colonic biopsy showed cmv inclusions. he failed to respond to ganciclovir and required pancolectomy, which on histologic examination did not show any evidence of cmv but had features consistent with ulcerative colitis. development of ibd while the patient is on immunosuppression is unexpected, because ibd is believed to be the result of inappropriate and ongoing activation of the mucosal immune system and immunosuppression is used in the treatment of ibd. the most common situation in which association of transplantation with ibd is seen is with liver transplantation in primary sclerosing cholangitis(psc). about 70% of patients with psc will develop ibd, which may be before transplantation or as de novo disease after liver transplantation. in the case series by riley., the average time to ibd diagnosis after transplantation (liver or kidney) was four years and none of them presented in the first post - transplant year. the authors hypothesized that this delay in presentation may be the result of lesser use of corticosteroids in the late post - transplant period. a number of hypotheses have been put forward to explain the unexpected development of ibd while on immunosuppression. the allograft may reconstitute a competent immune system in the recipient, and immunosuppressive therapy makes the patient susceptible to opportunistic infections which may trigger ibd manifestations. both tacrolimus and cyclosporin a inhibit the peptidyl - prolyl isomerase enzyme activity and interfere with effective t cell intracellular signalling. in some predisposed individuals, tacrolimus or cyclosporin a may lead to reduction of the cd8 suppressor cells to a greater degree than other t cell populations, increasing the helper - to - suppressor ratio. such a t cell imbalance has been reported to be an etiological factor in ibd.[142022 ] riley. first is a case report of an hiv - positive patient with crohn 's disease whose ibd improved with decline in cd4 + cell count, thus decreasing the helper - to - suppressor ratio. the second example mentions two patients with renal cell cancer who received exogenous interleukin-2 (usually produced by activated t cells) and developed a flare in their preexisting ibd. these hypotheses explaining the development of ibd while on immunosuppression require further evaluation and validation. our case is unique in that the patient was not receiving calcineurin inhibitors (cnis) for 8 years preceding the development of symptoms ; he was only on azathioprine and prednisolone and the above hypothesis do not apply in our case. mechanisms other than the specific action of cnis on t cell function thus appear to play a role in pathogenesis of ibd while on immunosuppression.	diarrhea is common after kidney transplantation and is usually related to immunosuppressive medication or is infective in etiology. inflammatory bowel disease (ibd) is rare after kidney transplantation and is unexpected because the patient is already immunosuppressed. specific immunomodulatory actions of calcineurin inhibitors have been hypothesized to play a role in the development of ibd in such patients. we report a case of ibd developing de novo after kidney transplantation. our case is unique in that the patient was not on calcineurin inhibitors for 8 years prior to the development of ibd.
the increasingly expanding biomedical and biophysical research areas trace back to the human genome project (hgp) founded and started in 1990 as a manhood 's big challenge for providing scientific findings to better understand biochemistry, molecular biology and medical sciences 1. in the year 2001 the human 's genome decryption was first documented by the international human genome sequencing consortium and by greg venter 's founded celera corporation 2, 3 simultaneously. with the release in 2003 of the genome 's complete decoding in 2003, the hugo was considered as finished 4, 5. it was then taken as the basis for the development of new diagnostic tools 6 - 8 and therapeutic approaches 9, 10 with a previously unreached precision in sensitivity and sensibility. this led to the gene ontology annotation (goa) project and the proteome 11, 12. also important is on the combination of both which describes the new expanding research field in the development of theranostic tools 13 enabling a successful pharmacotherapy with a minimum of adverse reactions, realizing a perfect fit to the patient 's differential gene expression profile.. due to the lack of stability of natural dna and rna against nucleases their use as a drug is not possible till now, and modifications are inevitable. derivatives like peptide nucleic acids (pnas) however, are not a substrate for the cell immanent enzymes and therefore they are resistant, highly sensitive and specific tools for antisense strategies 14 - 16 and can be applied both in cancer diagnostics and in therapy 23 - 25. to increase their efficiency further they can be conjugated with cell penetrating peptides (cpp) and peptide - based sequences for subcellular targeting 17 - 19 and this is carried out by coupling of building blocks combined with protection group chemistry 20 - 22. despite the improvement in the pna syntheses, the success of synthesis strongly depends on different parameters, like activator 's quality and deproctection kinetics which also correlate with the length of the pna spps polymer. modifications of the solid phase pna synthesis 's methods like micro wave 26 and the use of suitable deprotection reagents, like piperidine and pyrrolidine 27 which optimize yield and quality, were established and documented. it became increasingly apparent, that the choice of resin matrices 28 with physical properties especially for a high quality pna synthesis is pivotal to a considerable extent and additional investigations in the resin development are required 29. here we report how we synthesized a pna (see figure 5) targeted to the translation initiation region which is part of the complementary coding sequence of the human c - myc exon ii 30. we compared, analyzed and optimized the synthesis strategy for forthcoming functional pna studies dealing with the cell cycle behavior, apoptosis, alterations of the cell phenotype and differential gene expression. the synthesis of the human c - myc specific pna tacggggagttgcaa - nh2 shown in figure 5, was performed on the abi synthesizer 433a (applied biosystems, foster city, usa). we used 9-fluorenylmethoxycarbonyl (fmoc)-building blocks with blocked side chains of adenine a, cytosine c, and guanine g by benzhydroxylcarbonyl (bhoc) groups. the syntheses were performed in a 5 mol scale on a h - rink - amide - chemmatrix resin (pcas biomatrix, saint - jean - sur - richelieu, canada) loading 0.52 mmol / g and on a tentagel r ram high swell resin (rapp polymers, tuebingen, germany) loading 0.62 mmol / g. in the first step the fmoc - groups were cleaved with 20% piperidine in n, n'-dimethylformamide (dmf) and 20% pyrrolidine in n - methylpyrrolidone for 10 min at 20c. the coupling reaction was performed with 2-(1h-7-azabenzotriazole-1-yl)-1,1,3,3-tetramethyl uronium hexafluorophosphate (hatu) and n, n'-diisopropylethylamine (dipea) for 40 min. after the coupling all residual free amino groups were capped with acetic acid anhydride in dipea (1eq:2eq) in dmf and the resin was washed with dmf. at the end of the synthesis the n - terminal protecting group was removed with piperidine or pyrrolidine respectively and the reaction product was finally cleaved from the resin with tfa (95%) and scavanger triisopropylethylsilane / water (2.5%/2.5%) for 2.5 h at room temperature. the crude material was characterized with analytical hplc on a kromasil 100 - 5 m c 18 reverse phase column (30 250 mm) using an eluent of 0.1% trifluoro acetic acid in water (a) and 80% acetonitrile in water (b). the pna product was eluted with a successive linear gradient of 10% b to 80% b in 30 min at a flow rate of 1 ml / min. (figure 1 and figure 2) and mass spectrometry (esi - ms, finnigan tsq 7000) (figure 3). the chemical formula is c163h201n93o44 ; exact mass : 4164.63 ; molecular weight : 4166.93 ; found mass : 4166.3. the nucleobase sequences derived from human - hsmmycc genbank ac no. : x00364). the solid phase peptide synthesis (spps) introduced by merrifield is considered as the key technology in the automatized technique for the synthesis of functional peptides as well as for dna derivatives like the peptide nucleic acids based on amino acids and peptide nucleic acid building blocks. whereas at the beginning of the spps age time and efforts were immense, the progress in the synthesis ' development led to reaction products with high puritiy and yield. the use of different modifications like microwaves 31, 32 and ultrasound 33 resulted in a clear diminishment of the time rate in the reaction steps and resulted in simultaneously improvement of the quality. the resin acts as the solid phase platform originally described as merrifield - resin 34, 35. its enormous advantage is shown in the following data which highlight different aspects of a pna spps. the diagrams (left & right) document the hplc analysis (figure 1 and 2) and the corresponding mass (figure 3) of the pna product. it was exemplarily synthesized by spps dependent on the resin chosen 22 either tentagel r ram high swell rapp polymers (figure 1) or h - rink amide - chemmatrix polymer (figure 2) and the basicity of the protection reagent. the hplc diagrams in figure 1 and in figure 2 show the peaks of the pna synthesis products synthesized on tentagel r ram high swell rapp polymer and h - rink - amide - chemmatrix resin as a solid phase. the higher number of peaks in the diagrams after using the piperidine - step (left diagrams) indicates a higher number of truncated products. the esi - ms diagrams in figure 3 show the correct mass peaks after deprotection with pyrrolidine but independent from the used resins. more or less conspicuous but mentionable is the detection of the fivefold loaded [m+5h ] substance peak in the tentagel r ram high swell rapp polymer representing diagram (right picture). the slight differences of the purities could be explained by the resins ' different spatial patterns and surface characteristics which influence the syntheses : the tentagel r ram high swell rapp polymer synthesis occurs spacer - mediated, whereas the synthesis runs directly at the chemmatrix resin 's backbone. furthermore, the graphs (figure 4 a and b) highlight the discrepancies of the dissociated pna building blocks as a function of the deprotection potential. since the liberated fluorenyl group is a chromophore, a deprotection by fmoc can be monitored by uv absorbance of the fractions, a strategy which is employed in automated synthesizers. in the chart diagrams the bars represent the extent of the uv absorption at 301 nm of the separated fluorenyl groups. if a middle bar (as shown in b) occurs, a third deprotection step is carried out by the synthesizer 's program routinely. as shown in the left diagrams in the part a and b of figure 4, we observed a more efficient deprotection behavior by pyrrolidine as a cleavage agent. whereas one cleavage step was here sufficient, the use of piperidine as agent required three deprotection steps at all purines and also at the thymine. additionally, the tentagel r ram high swell resin seems to be more suitable for the deprotection steps during the pna synthesis. with this experience we could achieve the best reaction product 's purity on the tentagel r ram high swell resin with pyrrolidine as cleaving reagent. this result can be explained with the different physical properties of the tentagel r ram high swell resin and the chemmatrix resin. namely, in the first case we performed the synthesis on a spacer and in the second case the synthesis occurred on the backbone of the resin and these properties gave rise to different swelling conditions 36. modern drugs consist of combined peptide - based functional modules with delivery and targeting properties. they are designed for use as a cargo of genetic material 38, 39, highly pharmacologically active substances like temozolomide (tmz) 40, 41 or components for imaging of morphologic structures and metabolic processes in pet, spect 42, mrt 43, and ct 44 as well as for optical imaging (oi) 45 - 48. in case of theranostic agents 13, 49 - 51 both groups of cargos (therapeutic and diagnostic) may be combined and a monitoring of the therapeutic success is much easier. the efficacy of the delivery and the specificity of the targeting allow a successful therapy and medical diagnosis by application of drastically reduced doses resulting in minimized adverse reactions which then would lead to discontinuation of the therapy. the criteria for therapeutic and diagnostic use of these new conjugates pose highest requirements on the synthesis as well as on optimized ligation procedures 52 - 55. the spps can be considered as an excellent technology and the choice of appropriate resins and deprotection chemicals is indispensable.	the personalized medicine, also documented as individualized medicine, is an effective and therapeutic approach. it is designed to treat the disease of the individual patient whose precise differential gene expression profile is well known. the trend in the biomedical and biophysical research shows important consequences for the pharmaceutical drug and diagnostics research. it requires a high variability in the design and safety of target - specific pharmacologically active molecules and diagnostic components for imaging of metabolic processes. a key technology which may fulfill the highest demands during synthesis of these individual drugs and diagnostics is the solid phase synthesis which is congenial to automated manufacturing. additionally the choice of tools like resins and reagents is pivotal to synthesize drugs and diagnostics in high quality and yields. here we demonstrate the solid phase synthesis effects dependent on the choice of resin and of the deprotection agent.
recent technological advances allow the rapid generation of vast quantities of molecular biological data. at the same time, the sequencing of the human genome and subsequent efforts to catalogue the variation within it have created opportunities for testing thousands of sequence variations for association with disease, behavioural traits and physiological markers. such applications are appealing because of the relative lack of success, to date, of positional cloning strategies that start with family - based linkage mapping, most likely due to insufficient sample sizes to detect genes of modest effect. the whole - genome association scan is an increasingly feasible study design in which the genotyped markers are sufficiently closely spaced to detect linkage disequilibrium (ld) with all aetiological variants, and well - powered sample sizes are more attainable. some initial studies have been performed in special populations and in small samples of outbred populations ; genome - wide admixture scans are imminent and, ultimately, routine scans will be performed for common diseases in large cohorts of outbred populations. array experiments measuring large numbers of transcription or expression levels are another form of genome - wide analysis that have become widespread. although the effect sizes expected in these studies are large by comparison with disease association studies, the sample sizes are constrained by cost to be relatively small, so that both types of study encounter problems of statistical power (table 1). expression levels can be regarded as quantitative traits under genetic control, so that both kinds of large - scale exploration can occur in genome scans for loci influencing expression levels, or phenome scans demarking the influence of genetic pathways. primarily, there is the multiple testing problem, whereby the chance of an exceptional result increases with the number of tests performed, even when there is no true association. to alleviate this problem, two broad strategies have emerged : first, to devise more sensitive tests, so that the penalty for multiple testing is less severe ; and, secondly, to propose different measures of experimental error for which the interpretation of multiple testing is less serious. furthermore, genome - wide analysis creates problems of computational and cost efficiencies on account of the large volume of data to be generated and analysed. here, some recent work addressing these problems is reviewed. for the study design, work is summarised that minimises the cost of a study, while maintaining its power. for the analysis, methods are reviewed for improving sensitivity in the presence of multiple gene effects, by combining evidence across tests, and some methods for reducing the computational burden of permutation tests are discussed. this review is mainly concerned with a whole - genome association scan, using single nucleotide polymorphisms (snps), for a dichotomous disease status. it will be clear, however, that many of the methods apply in other situations, in particular to array expression studies. although there are important differences between these two applications -- including the number of expected true associations, sample size and effect size (table 1) -- their common exploratory character suggests that further advances may arise from crossapplication of ideas between these areas. for this reason, some methods developed for expression studies are reviewed ; there is also a discussion on whether they may be suitable for genetic association scans. the objects of inference used will be ' genes ', with the understanding that, in this context, this can mean snps, whole genes, haplotype blocks, transcript levels or other features. large samples of unrelated individuals have become the design of choice for genome - wide association scans, because earlier concerns about population stratification have been largely allayed by empirical methods. estimates of the total sample size are in the order of thousands. because the majority of genes are not associated with disease, it is uneconomical to genotype the whole sample for all genes. sequential study designs, in particular a two - stage block design, have been proposed for reducing the total cost of a genome - wide experiment, which remains the main limiting factor preventing large - scale application. in a two - stage design, all of the genes are typed in a subset of the sample, with only the genes showing a trend of association being taken forward for genotyping in the remainder. this directs resources towards true associations at an earlier stage, so that the available sample size is larger for genes with true effects. the design parameters for a two - stage study include the total cost, total sample size, size of the first and second sub - samples and rejection criterion at the end of the first stage. some of these parameters are constrained in advance, with the others then chosen to optimise some objective. one approach is to consider the genotyping cost as fixed and then find parameters that give the most power. a general rule of thumb, considering a number of disease models and correlation structures between markers, is to allocate 75 per cent of resources to the first stage and then carry the most promising 10 per cent of markers to the second. here, the sample size is a function of the genotype unit cost and the number of markers, within the overall cost constraint. it is more likely that the sample size is fixed (say, to provide sufficient power to detect a single association) and the goal is to minimise costs while achieving power close to that of the one - stage design. in many situations, the cost can be halved while keeping power within 1 per cent of the one - stage design ; thus, the total sample size can be calculated to achieve a certain power (say 81 per cent) in the one - stage design and parameters then optimised for a two - stage design. considering a range of genetic models, a general guideline is to set the sample size of the first stage to have 97 per cent power for individual tests and carry forward all markers with nominal p - values less than 0.15. the sample size for the first stage can not be calculated without knowledge of the true effects, however, so a more practical approach is to consider the ranks of test statistics of the true effects. here, it is shown that similar information to the one - stage design is obtained by genotyping all markers on 50 per cent of the sample and then genotyping the 10 per cent most promising on the remainder, resulting in a decrease of about 45 per cent in the number of genotypes. again, the total sample size can be calculated for a one - stage design ; this last guideline is currently the most practical available and applies over a wide range of genetic models and correlation structures between markers. an application of this strategy has been reported in which the primary constraint is the quantity of dna available for study subjects. about 44 per cent of the sample had sufficient dna to be typed for all markers, with the remaining 56 per cent used for the second stage. an important feature of this study is that the test statistics are calculated over the full sample, with adjustment made for the interim test. this is in contrast to the simpler approach used in the simulation studies, in which test statistics were calculated separately for the two stages and their p - values combined into an overall significance. analysing both stages at once makes more efficient use of information and will be the more powerful method for computing significance in the whole sample. these can result in substantial cost savings, on average, but have yet to become widely adopted, owing mainly to logistical difficulties. for example, the stopping criteria must be applied to each gene separately, but genotypes are often obtained in bulk in array format, which makes it difficult to apply sequential designs efficiently across many genes. the two - stage designs are a compromise solution using frequentist inference, which also avoid the uncertainty in actual sample size that occurs with sequential inference. for example, different genotyping technologies may be used in the two stages, with different unit costs, perhaps using dna pooling. many analysis methods are available for genetic data, but a first pass through a genome - wide scan may normally consist of single - locus tests for trend, perhaps additionally with two - locus interaction tests. several methods are now available that exploit the important feature that the majority of tested genes are not associated, but there are a small number of true, but weak, associations to be found. these methods are useful both for establishing statistical significance more strongly than single - locus tests, and for informally suggesting sets of genes for follow - up study. in the traditional hypothesis - testing framework, each gene is tested individually and then a stepwise adjustment procedure is applied both to control the family - wise type-1 error rate (fwer) and to declare individual genes associated. this approach, related to the bonferroni correction, achieves strong control of the fwer, which is the probability of at least one false positive being within the desired rate when there are any number of true positives. this is generally considered to be too conservative for genome - wide studies, however, because we can tolerate a small number of false positives if most true positives are detected. more preferable is weak control of fwer, which ensures that the probability of at least one false positive is within the desired rate only when there are no true positives. this is desirable, because we must defend against the possibility of there being no true associations in the sample, but it allows us to tolerate some false positives if some true positives are present. a joint test of multiple genes can maintain weak control of fwer and should reveal greater evidence for association from a set of genes, although perhaps with less specificity for individual genes. this argument motivates the partial sum statistics, which are formed by obtaining test statistics (typically tests from a contingency table) for each individual gene and then forming the sum of the k largest statistics, where k is a fixed number called the length. the significance of the sum can be assessed by a permutation test and an overall significance estimated over a range of lengths. a more flexible alternative to the sum statistic is the truncated product of p - values. here, the product is formed of all the p - values lower than a preset threshold, or the k smallest p - values. when the individual tests have the same distribution, the rank truncated product has equivalent power to the sum statistic, but is more balanced when the tests have different distributions. this will occur, for example, when conducting haplotype - based tests on regions of different sizes, leading to tests with different degrees of freedom. analytic distributions are known for independent tests, which have been used in simulation studies to show improved power for combined evidence methods compared with traditional corrections. the present authors prefer the truncated product to the sum statistic on account of its balanced combination of different test, and also prefer to truncate on rank rather than threshold because the number of true gene effects is fixed across studies, whereas their p - values are random. the length k should be close to the actual number of true associations, but this is generally unknown. a range of lengths could be tested, with the most significant length used to select genes for follow - up analysis ; but there is no formal basis for this strategy, and simulation studies show that it is capable of grossly over - or under - estimating the number of true associations. a judicious choice of a fixed length, say k 0)prr>0. subsequently, storey and colleagues have argued that the choice of the appropriate rate depends on how many positive results there are, and, furthermore, that the rate is only meaningful when there is at least one positive. this motivates the positive fdr (pfdr), defined as the expected proportion of false positives among all positive results, conditional on at least one positive at a given significance level : rather than setting a fixed pfdr rate to control, storey and colleagues suggest giving a value to each test that indicates what pfdr would result from declaring that test significant. the follow - up tests can then be chosen based on joint consideration of the number of tests selected and the pfdr associated with them. formally, the q - value associated with an individual test is defined as the minimum pfdr achieved when declaring all tests significant at the level of the test 's p - value. a q - value can be estimated for each test in a genomewide experiment and follow - up tests selected from those with the lowest q - values. this last stage is somewhat informal and may be driven by logistic and financial constraints. a difficulty with fdr methods is that they control an expected proportion, whereas an investigator will be more concerned with the actual proportion of false positives within a study. some insight is gained by considering the variation in within - study false discovery proportion or false discovery variance. let i be an integer with p(i) the i - th smallest p - value from a set of m tests. if the i most significant tests are declared positive, then mp(i) estimates the maximum number of false positives. the associated variance is mp(i)(1 - p(i)) (because the truth of a positive test is a binomial outcome) and the coefficient of variation is 1-p(i)p(i) for the within - study false discovery proportion. this is greatest when p(i) is small, so, for a fixed set of p - values, this coefficient of variation is greatest when the fewest tests are declared significant. this will occur when a low error rate is set, or when there are few true associations, or when the power is low. in genome - wide association scans, the number of true associations is expected to be small by comparison with the number of tests, so that the false discovery variance is relatively high in relation to the target rate, and the fdr approach may not be reliable for controlling the error rate within studies. in gene expression experiments, however, the number of true associations is somewhat higher and fdr methods are more appropriate for those studies. study the within - study proportion of false discoveries and give procedures that keep the number (or proportion) of false discoveries within an upper bound with given probability. the attraction of this approach is that one can limit the number of false positives with reasonable confidence, with the main disadvantage being increased computation. it is uncertain how the false discovery proportion behaves when it falls outside the upper bound and, although this approach is attractive, further operating characteristics may be needed before it becomes more widely used. the most significant tests are most likely to be the true positives, but fdr and q - values ignore this in favour of averaging the error rate across all significant tests. efron and colleagues propose the local fdr as the posterior probability that a null hypothesis is true, given an observed statistic. the local fdr is calculated as 0f0t0f0t+(1-0)f1 t, where 0 is the prior probability that the null hypothesis is true, t is a test statistic and f0 and f1 are the probability densities of t under the null and alternative hypotheses, respectively. 0 and note, however, that when the true value of 0 is near one, as is likely in disease association scans, empirical estimates of 0 may be greater than one, which leads to a downward bias if these estimates are truncated at one. thus, it is better to fix a prior estimate of 0 from genomic considerations such as the number of expected disease genes (o(10)) and the number of genes in the genome (o(10)). the q - value should be preferred if all positive tests will be followed up with roughly equal priority, which may be the case for a moderately powered study in which true and false positives are not well separated. the local fdr is preferable if decisions to follow up positive tests are taken on a case by case basis, because it is a property of single tests rather than the whole set of positive tests. this applies if there are a few very strong associations, together with some moderate ones, or if additional sources of evidence, such as biological plausibility, are taken into account, together with the statistical association. this is the posterior probability that a null hypothesis is true, given a statistic at least as extreme as that observed. it is calculated as where now f0 and f1 are the cumulative distributions. for known 0 and f1 and large number of multiple tests, the fprp is the same as the q - value, the main difference being one of context. fprp is intended to be applied across multiple studies and calculated from prior models, whereas q - values are motivated by the within - study fdr and are usually estimated from data. fprp is also mathematically complementary to the positive predictive value of a discriminant, again differing in context. because fprp is a property of a range of test statistics, it is appropriate for setting guidelines for the reporting of significant results, based on assumed models for 0 and f1. this means that results can continue to be reported according to their p - values, but with modified thresholds of significance. a known proportion of reported results will then be false ; however, for assessment of specific tests for follow - up, the local fdr is more relevant to investigators. posterior error rates such as local fdr and fprp are gaining support because informed proposals can now be made for the prior probability of the null being true, based on genomic considerations. which of the various measures to use depends on the context. error control ' indicates whether a method provides some measure of error : (1) type - i error ; (2) posterior probability of association ; (3) expected proportion of false discoveries in a series of tests. ' appropriate for ' indicates whether, in the view of the authors, a method is suitable for genome - wide association or expression studies, based on the factors in table 1. several aspects of the analysis of genome - wide studies have been discussed, including study design, analysis method and error control, all of which bear on the likelihood of successfully identifying gene effects. there are some key aspects that have not been considered here, including selection and grouping of markers to be tested, population choice and data quality control. to some extent, these issues are specific to the type of study ; this review has focused on the more general statistical issues that apply to most studies. the field will continue to develop rapidly as more studies are completed and there is much scope for new methodology. in particular, combinations of the current methods may prove to be fruitful -- for example, including combined evidence tests within a two - stage design. there is no best method for all studies, because of their differing properties and aims, but this review has identified some of the questions that should guide the choice of analysis method. another important area for development, which has not been discussed here, will be the incorporation of evidence from several sources, including association studies, gene ontology annotation, information from model organisms and structural bioinformatics, to give a holistic appraisal of the effects of genetic variation. is supported by the dutch diabetes research foundation, the netherlands organisation for health research and development and the juvenile diabetes research foundation international (2001.10.004).	recent developments in the statistical analysis of genome - wide studies are reviewed. genome - wide analyses are becoming increasingly common in areas such as scans for disease - associated markers and gene expression profiling. the data generated by these studies present new problems for statistical analysis, owing to the large number of hypothesis tests, comparatively small sample size and modest number of true gene effects. in this review, strategies are described for optimising the genotyping cost by discarding promising genes at an earlier stage, saving resources for the genes that show a trend of association. in addition, there is a review of new methods of analysis that combine evidence across genes to increase sensitivity to multiple true associations in the presence of many non - associated genes. some methods achieve this by including only the most significant results, whereas others model the overall distribution of results as a mixture of distributions from true and null effects. because genes are correlated even when having no effect, permutation testing is often necessary to estimate the overall significance, but this can be very time consuming. efficiency can be improved by fitting a parametric distribution to permutation replicates, which can be re - used in subsequent analyses. methods are also available to generate random draws from the permutation distribution. the review also includes discussion of new error measures that give a more reasonable interpretation of genome - wide studies, together with improved sensitivity. the false discovery rate allows a controlled proportion of positive results to be false, while detecting more true positives ; and the local false discovery rate and false - positive report probability give clarity on whether or not a statistically significant test represents a real discovery.
asbestos causes lung fibrosis known as asbestosis, a few benign pleural diseases such as pleural plaque and effusion, and malignant diseases such as mesothelioma and lung cancers [15 ]. furthermore, cancers in other organs such as the gastrointestinal tract, larynx, kidney, liver, pancreas, ovary, and hematopoietic systems show ahigh prevalence in asbestos - inhaled people [69 ]. this issue has been tackled as a major medical and social problem throughout the world, especially since asbestos is very useful in various industries for its mineral characteristics such as resistance to heat, cold, chemicals, cheapness, easiness to obtain and weave, and so on [8, 9 ]. in japan, the quantity of asbestos produced has increased since the mid-1950s and reached a peak in 1974 (over 350,000 tons) [1012 ]. the peak level of usage continued until the late 1980s in construction, car, and other industries. in the summer of 2005, kubota corporation, which mainly used asbestos to make water pipes in amagasaki city, hyogo prefecture, japan, acknowledged the prevalence of asbestos - related diseases among their workers, including several patients living near kubota 's asbestos - handling factory in amagasaki city [1012 ]. citizens in japan were suddenly made aware that asbestos causes malignancies in asbestos - handling workers and in residents living near these factories. they were informed that mesothelioma is difficult to diagnose and cure and were angered that workers and neighborhood residents had not been notified that these factories had been handling this silent bomb, asbestos [1012 ]. to reduce the anxieties of the japanese people, epidemiological analyses commenced regarding the amagasaki area, and clinical and basic research was conducted on the biological effects of asbestos and the early detection of mesothelioma. comprehensive approach on asbestos - related diseases, supported by the special coordination funds for promoting science and technology (headed by dr. takemi otsuki, department of hygiene, kawasaki medical school, kurashiki, japan) from 2006 to 2010. a feasible clinical trial was established and involved a combined trimodality therapy using anticancer chemotherapy with cisplatin and pemetrexed, followed by extrapleural pneumonectomy and postoperative radiation therapy for early - stage mesothelioma patients [13, 14 ]. furthermore, early detection procedures were developed using serum or pleural effusions to measure soluble mesothelin - related peptide (smrp) and other markers such as osteopontin, vascular endothelial growth factor (vegf), and angiopoietin-1 as well as procedures for detection of circulating mesothelioma cells and circulating epithelial cells using peripheral blood [1519 ]. comprehensive approach on asbestos - related diseases included three subgroups : (1) analyses of cellular and molecular characteristics using mesothelioma cell lines, (2) an investigation of asbestos - induced carcinogenesis using an animal model, and (3) a study of the immunological effects of silica / asbestos. the basic research project (3) was performed by us, and in this paper, we introduce our viewpoint that asbestos may cause alteration of immunocompetent cells resulting in chronic inflammation as well as tumor development. asbestos is a mineral silicate containing iron, magnesium, and calcium, with a core of si and o [6, 7 ]. individuals exposed to silica and asbestos develop lung fibrosis known as silicosis and asbestosis, respectively [15, 20 ]. silicosis is a form of occupational lung disease caused by inhalation of crystalline silica dust, and is marked by inflammation and scarring in the form of nodular lesions in the upper lobes of the lungs. however, asbestosis developsin patients who inhale a relatively high dose of asbestos (compared with patients with pleural lesions such as mesothelioma and plaque). in addition, the pathology of asbestosis differs from that of silicosis [15 ]. asbestosis involves the scarring of lung tissue (around the terminal bronchioles and alveolar ducts). there are two types of fibers : amphibole (thin and straight) and serpentine (curved). the former are primarily responsible for human disease as they are able to penetrate deeply into the lungs. when such fibers reach the alveoli in the lung, where oxygen is transferred into the blood, the foreign bodies (asbestos fibers) cause the activation of the lung 's local immune system and provoke an inflammatory reaction [15 ]. this inflammatory reaction can be described as chronic rather than acute, slow ongoing activation of the immune system in an attempt to eliminate the foreign fibers. macrophages phagocytose the fibers and stimulate fibroblasts to deposit connective tissue. due to the natural resistance of asbestos fibers to digestion, the macrophage dies off, releasing cytokines and attracting further lung macrophages and fibroblastic cells to lay down fibrous tissue, which eventually forms a fibrous mass [21, 22 ]. the fibrotic scar tissue causes alveolar walls to thicken, which reduces elasticity and gas diffusion, reducing oxygen transfer to blood as well as the removing of carbon dioxide. furthermore, the complications in silicosis and in people who have inhaled asbestos are also different. patients with silicosis often present with complications involving autoimmune diseases such as rheumatoid arthritis (known as caplan 's syndrome) [2325 ], systemic sclerosis [26, 27 ], systemic lupus erythematosus [28, 29 ], and antineutrophil cytoplasmic antibody (anca)-related vasculitis / nephritis [3032 ]. although these have been considered adjuvant effects of silica, we have assumed that silica may influence circulating immunocompetent cells, particularly t lymphocytes, and have reported that silica can activate cd4 + 25 + foxp3 (forkhead box p3) + regulatory t cells (treg) and responder t cells (tresp) [3338 ]. these activations induce overexpression of cd95/fas in treg, resulting in early loss and contamination of activated tresp, which express cd25 as the marker for activation into a peripheral cd4 + 25 + subpopulation of t cells. regarding silica - induced fibrosis (lung and skin), the idea proposed previously is that silica affect alveolar macrophages, endothelial cells, and fibroblasts to modify cytokine production and disturbance of collagen synthesis and degradation, subsequently forming fibrosis of lung and skin lesion. in addition, our findings suggested that silica may influence and alter circulating lymphocytes to disturb autoimmune tolerance [37, 38 ]. on the other hand, a consideration of the complications of asbestos exposure indicates that the development of cancers is the most important aspect [15 ]. as silica can affect immunocompetent cells, asbestos may possess a similar influence on various immune cells, and the results should be the reduction of tumor immunity. as mentioned above, in addition to lung cancer and mesothelioma, there may be a relatively high prevalence of other cancers among asbestos - inhaled patients [6, 7 ]. we have reported that the natural killer (nk) cell line and freshly isolated nk cells derived from healthy donors (hds) exposed to asbestos (chrysotile) for a long period (more than half a year in vitro for the cell line and approximately two weeks for the fresh nk cells) showed a reduction of cytotoxicity with decreased expression of their activating receptors, such as nkg2d and 2b4 in the cell line and nkp46 in the fresh nk cells. the nk cell line exposed to asbestos also showed suppressed signaling such as extracellular signal - regulated kinas (erk) 1/2 in the mitogen - activated protein kinase (mapk) cascade from activating receptors and also producting of granzyme and perforin [40, 41 ]. at present, the effects of chrysotile on cd8 + cytotoxic t lymphocytes (ctl) are also being analyzed, and findings show reduction of differentiation from nave ctl to effector / memory ctl and proliferation. recently, the role of a nod - like receptor family, the pyrin domain containing 3 (nlrp3) (nacht, lrr, and pyd domains - containing protein 3 ; nalp3) inflammasome, has received attention regarding the handling of these foreign bodies as well as various crystalline substances such as uric acid and cholesterol crystalline causing atherosclerosis [4347 ]. (2) activation of nlrp3 inflammasome to cleave procaspase 1 to an active form. (3) cleavage of prointerleukin (il)-1 to an active form for release to form fibrotic nodules. (4) production of reactive oxygen species (ros) and reactive nitrogen species (rns) in the macrophages. (5) induction of cellular and tissue damage due to the production of ros and rns. (6) apoptosis of the alveolar macrophages. (7) production of various cytokines / chemokines such as il-1 tumor necrosis factor (tnf)-, macrophage inflammatory protein (mip)-1/2, monocyte - chemoattractant protein-1, and il-8 to cause chronic inflammation and proliferation of collagenic fibers. (8) release of silica particles and asbestos fibers from alveolar macrophages and the repetition of similar cellular reactions described above by newly recognized nearby macrophages. (9) transfer of silica particles and (partially cleaved) asbestos fibers to regional lymph nodes. (10) as these cellular and molecular reactions are continuously repeated, pulmonary fibrosis will appear gradually and progressively [48, 49 ]. as a result of these cellular and molecular events, cleaved asbestos fibers will accumulate in regional lymphonodes, the distal end of the alveolus, and the pleural cavity, particularly at the opening of lymphatic vessels (figure 1) [15 ]. circulating and local immunocompetent cells may encounter asbestos fibers repeatedly, recurrently, and continuously. asbestos, particularly amphibole in the form of crocidolite and amosite, includes iron and is considered responsible for the production of reactive oxygen and nitrogen species (ros and rns) that may cause dna damage to nearby cells and induce the development of cancers [5052 ]. it has been thought that chronic inflammation contributes to a substantial part of environmental carcinogenesis [5355 ]. various infectious diseases and physical, chemical, and immunological factors participate in inflammation - related carcinogenesis [5055 ]. for example, hepatocellular carcinoma, cervical cancer of uterine, and bladder cancer are known to be caused by infection of hepatitis c virus, human papilloma virus (hpv), and schistosoma haematobium, respectively. in addition, helicobacter pylori infection causes gastric cancer, extranodal marginal zone lymphoma of mucosa - associated lymphoid tissue type (malt lymphoma), and diffuse large b - cell lymphoma. regarding incidences of these diseases, who reported about hepatitis c virus. as many as 2 to 4 million persons may be chronically infected in the united states, 5 to 10 million in europe, and about 12 million in india, and most do not know that they are infected. about 150,000 new cases occur annually in the usa and in western europe and about 350,000 in japan. of these, about 25% are symptomatic, but 60 to 80% may progress to chronic liver disease, and 20% of these develop cirrhosis. in addition, hpv causes cervical cancer which is the second most common cancer in women worldwide. in 2008, there were an estimated 529,000 new cases and 274,00 deaths due to cervical cancer. it was reported that 8-nitroguanine was formed at sites of carcinogenesis in animal models and patients with various cancer - prone infectious and inflammatory diseases, caused by parasites, viruses, and asbestos exposure. in asbestos - exposed mice, 8-nitroguanine was formed in bronchial epithelial cells, and it is noteworthy that crocidolite induced significantly more intense 8-nitroguanine formation than chrysotile, findings that are inconsistent with their respective carcinogenic potentials. from the above - mentioned basic research (2) concerning investigation of asbestos - induced carcinogenesis using an animal model in the comprehensive approach on asbestos - related diseases project, the importance of iron is supposed even in the development of mesothelioma caused by iron - free chrysotile because of its easy binding to hemoglobin and the induced hemolysis [5961 ]. immunocompetent cells may show some alteration as characteristics of chronic inflammation and features involving reduced tumor immunity. from this viewpoint, even though we do not observe cellular and molecular changes for immunocompetent cells, we reported interesting findings regarding the reduction of tumor immunity in t cells. we then introduce the findings concerning reduction of cxc chemokine receptor (cxcr) 3 and interferon (ifn)- with the activated potential expression of il-6. similar to analyses of nk cells, we adopted a human t - cell line, mt-2, as the chronic and continuous exposure model of t cells. although the altered features of continuously exposed (to chrysotile) sublines (we established six sublines independently exposed to chrysotile) of mt-2 were reported previously [6264 ], one of the interesting molecular changes regarding tumor immunity is the reduction of cxcr3 expression and ifn- production [6568 ]. cxcr3 is thought to be important for inflammation, since cxcr3 is known as the receptor for cxcl9, 10, and 11 which induce inflammation. in addition, cxcr3 expressing t cells in the tumor - localized region recruit ifn--producing cells to kill the tumor cells. results using the mt-2 cell line model, as shown in the left upper panel of figure 2, indicated that continuously exposed sublines of mt-2 showed reduced cxcr3 expression on their surface and mrna expression levels, with reduced production and expression of ifn-. production of the th1 type cxcr3 ligand cxcl10/ip10 was also significantly reduced in sublines compared with the original line. in addition, another th1-type chemokine, ccl4/mip-1 mrna, was also expressed at low levels in all six sublines compared with the mt-2 original line as previously reported [69, 70 ]. however, ccr5, the th1-type receptor for ccl4/mip-1, was not reduced significantly through mrna expression in mt-2rsts cells. these results indicated that continuous exposure of mt-2 original cells to asbestos altered the expression of th1-related chemokines (cxcl10/ip10 and ccl4/mip-1) and chemokine receptors (cxcr3) [69, 70 ]. similar to analyses regarding the effects of asbestos on nk cells, we then tried to determine whether freshly isolated human peripheral cd4 + t cells show a similar alteration ex vivo when proliferation is maintained by il-2-containing medium in the presence of chrysotile as shown in the left lower panel of figure 2 [69, 70 ]. after several weeks of coculture supplemented with il-2 in the presence or absence of chrysotile, cell surface cxcr3 expression decreased in a dose - dependent manner. thus, we examined cell surface expression of cxcr3 and ccr5 in cd4 + t cells derived from six healthy donors, since both receptors are preferentially expressed in th1/effect or t cells. the expression of cxcr3 was significantly reduced following exposure to 10 g / ml of chrysotile for 28 days, although this difference seemed to depend on one case in which the expression decreased remarkably [69, 70 ]. even if the culture conditions for the cd4 + t cells was limited to a period of around four weeks, four of the six hds showed a decrease of cxcr3 expression to various degrees, and it might be concluded that asbestos exposure potentiates reduction of cxcr3 expression in cd4 + t cells. in addition, these experiments revealed decreased ifn- expression and production when cd4 + t cells from hds were cultured with chrysotile for 28 days [69, 70 ]. finally, analyses of changes in surface cxcr3 expression on freshly isolated cd4 + t cells from asbestos - exposed patients such as those with pleural plaque (pp) or malignant mesothelioma (mm) were compared with those from hds. in addition, ifn- and il-6 expression of cd4 + t cells from these patients and hds was measured with stimulation using anti - cd3/cd28 antibodies with il-2 [69, 70 ]. as summarized in the right panel of figure 2, cxcr3 expression was reduced in cd4 + t cells from asbestos - exposed patients. a comparison of pp and mm patients showed that the expression level of cxcr3 on cd4 + t cells from mm was decreased, although the difference was not statistically significant. moreover, although ifn- expression was only reduced in stimulated cd4 + t cells from mm patients and not in those with pp, il-6 expression was gradually enhanced in hds and to a lesser extent in pp, followed by mm. as we reported previously, the plasma level of il-6 was significantly higher in mm compared to hds, pp, and silicosis. although this may depend on the tumor - producing il-6 [7274 ], our findings indicated that part of the increased il-6 may be produced by t cells with altered potentials to express cytokines due to continuous exposure to asbestos. furthermore, il-6 is an interleukin that acts as a proinflammatory and anti - inflammatory cytokine. it is secreted by t cells and macrophages to stimulate an immune response, for example, during infection and after trauma, especially in the case of burns or other tissue damage leading to inflammation [7578 ]. for these reasons, it can be assumed that immunocompetent cells possess cellular characteristics of chronic inflammatory alterations during continuous exposure to asbestos, and they then proceed to result in the reduction of tumor immunity as shown in figure 3. in addition, the supposed difference of immunological effects between silica and asbestos is shown in figure 4. however, although there is insufficient evidence for all of these sequential modifications of immunocompetent cells, an investigation of their long - term alteration may lead to the development of preventive tools for asbestos - induced malignancies. for example, it may be possible to find some physiologically active substances in the plants or microorganisms to modify or recover the altered function of immunocompetent cells to reconstitute the tumor immunity in asbestos - exposed people, and discriminate iron from bodies exposed to asbesots. as shown in figure 3, the carcinogenic activity of asbestos encompasses the following phenomena : (1) dna damage caused by ros / rns production due to the iron presentin asbestos fibers, (2) chromosome tangling to result in dna damage due to the physical features of asbestos fibers, and (3) adsorption of various carcinogensaround the asbestos fibers [5961 ]. in addition, the molecular events regarding carcinogenesis found in mesothelioma cells include (1) homogenous deletion of p16/p19 found in more than 90% of cases, (2) inactivation of neurofibromatosis 2 (nf2)/merlin found in approximately half of the cases, (3) inactivation of the serine / threonine - protein kinase (lats2) gene in approximately one - third of mesothelioma cell lines and representinga candidate for a novel tumor suppressor in mm, and (4) transcription factor, yes - associated protein (yap) involved in the nf2/merlin - hippo signaling pathway and constitutively dephosphorylated by lats, and usually acting as an oncogene to bind with the tead transcription factor to enhance the cell cycle and resistance to apoptosis [7981 ]. asbestos fibers and the cellular and molecular characteristics of mesothelioma cells may lead to the gradual alteration of immunocompetent cells and subsequent development of chronic inflammation and later reduction of tumor immunity. investigation of the progression of modification in immunocompetent cells caused by exposure to asbestos may lead to the development of novel methods for the prevention of mesothelioma and other asbestos - related cancers.	asbestos causes lung fibrosis known as asbestosis as well as cancers such as malignant mesothelioma and lung cancer. asbestos is a mineral silicate containing iron, magnesium, and calcium with a core of sio2. the immunological effect of silica, sio2, involves the dysregulation of autoimmunity because of the complications of autoimmune diseases found in silicosis. asbestos can therefore cause alteration of immunocompetent cells to result in a decline of tumor immunity. additionally, due to its physical characteristics, asbestos fibers remain in the lung, regional lymph nodes, and the pleural cavity, particularly at the opening sites of lymphatic vessels. asbestos can induce chronic inflammation in these areas due to the production of reactive oxygen / nitrogen species. as a consequence, immunocompetent cells can have their cellular and molecular features altered by chronic and recurrent encounters with asbestos fibers, and there may be modification by the surrounding inflammation, all of which eventually lead to decreased tumor immunity. in this paper, the brief results of our investigation regarding reduction of tumor immunity of immunocompetent cells exposed to asbestos in vitro are discussed, as are our findings concerned with an investigation of chronic inflammation and analyses of peripheral blood samples derived from patients with pleural plaque and mesothelioma that have been exposed to asbestos.
this condition was defined by the international elbow working group (iewg) in 1993 to include fragmented medial coronoid process (fmcp), osteochondrosis of the humerus (oc), ununited anconeal process (uap), articular cartilage injury, and incongruity of the elbow joint. these disorders are associated with varying degrees of joint instability, inflammation, and loose fragments within the joint that result in lameness and osteoarthrosis (oa). several epidemiological studies have examined the genetic basis of ed, a condition that appears to be inherited differently among different breeds. most cases of ed first present at 6 - 12 months of age as forelimb lameness although some dogs present later in life (< 6 years old). under normal circumstances, radiography has been the standard - of - care imaging modality for the diagnosis, grading, and registry of ed. because radiography is widely available, efficient, and cost - effective, comprehensive radiographic assessment will likely continue to be a valuable component for diagnosing ed. classification of ed cases according to the iewg protocol is based on the existence and severity of arthritic changes on the joint surfaces as well as the presence of one or more of the following changes : uap, oc, fmcp, and joint malformation or incongruity. treatment of ed should ideally involve correcting the underlying causes before significant joint damage has occurred. during the early stages of the disease different non - surgical therapeutic measures such as analgesic therapy (nsaids), weight loss, exercise restriction, functional food consumption, nutritional supplements, physiotherapy, and other complementary modalities can be considered. in addition, numerous surgical procedures and chondroprotective formulations for managing established cases and the accompanying symptoms have been developed. taking into account the data presented above, the current investigation focused on two different objectives. first, an oral supplement as a preventative measure was evaluated by comparing the number of dogs that developed ed in treated versus untreated groups. secondly, effect of the treatment on symptoms of ed once the illness has been diagnosed was assessed. this randomised, controlled, prospective, phase iv pilot study was approved by the animal welfare committee of the organizacin nacional de ciegos espaoles (once) guide dog foundation. the investigation was conducted at the once guide dog foundation training centre (spain). animal care was conducted according to the protocols of the centre. clinical evaluation and continuous monitoring of the animals the dogs had to be healthy, at least 3 months old, purebred labrador retriever or golden retriever mix, and from internal litters (these litters were born at the animal facility where the study was conducted). all the dogs were vaccinated (eurican pneumo and eurican mhppi2-l ; merial, france). canines were excluded from the study if they had any disease that could confound or interfere with the evaluation, had sustained a previous bone fracture or trauma, were taking concomitant chondroprotective medication, or had been selected for breeding. all the dogs were divided into two groups using random number generator software before the start of the study. the control group was fed a specific diet (puppy ; eukanuba, canada) without supplementation while the treatment group received the same diet in addition to oral supplement tablets (hyaloral ; pharmadiet, spain) during all the study. the supplement contained 20 mg of hyaluronic acid, 2.2 g of enzymatically hydrolysed collagen, 312.5 mg of crystallised glucosamine, 200 mg of chondroitin sulphate, and 100 mg of gamma oryzanol per tablet. dosage was based on body weight (dose : tablet / day for each 10 kg of body weight, 1 tablet / day for each 20 kg of weight, 1.5 tablets / day for each 30 kg of weight, and 2 tablets / day for each 40 kg of weight). clinical evaluation was performed during four follow - up visits when the animals were 3, 6, 12 and 20 months old. the following outcomes were evaluated by two different veterinarians (sma and adr) : physical examination results (medical history and vital signs), orthopaedic evaluation of the elbow joints (lameness, range of motion, and swelling), radiographs, serology and blood analysis data, and subjective veterinarian assessment of clinical signs and symptoms of dysplasia for each joint (palpation, pain, and gait). scoring was based on a scale from 0 to 3 for the following characteristics : lameness : 0 = none ; 1 = mild ; 2 = moderate ; 3 = severerange of motion : 0 = normal ; 1 = slightly reduced ; 2 = moderately reduced ; 3 = severely reducedswelling : 0 = none ; 1 = mild ; 2 = moderate ; 3 = severe lameness : 0 = none ; 1 = mild ; 2 = moderate ; 3 = severe range of motion : 0 = normal ; 1 = slightly reduced ; 2 = moderately reduced ; 3 = severely reduced swelling : 0 = none ; 1 = mild ; 2 = moderate ; 3 = severe we have used this modified orthopaedic scale as a tool at the once guide dog foundation for routine clinical evaluation without anaesthesia or sedation. based on our experience, this scale can be used to identify positive correlations between radiograph findings and clinical signs of the disease. for the radiological examination, we evaluated two different x - ray images for the elbow joint : one taken in the medio - lateral position with forced flexion (ml) and the other in a cranio - caudal position with the animals under general anaesthesia or deep sedation. the current iewg elbow screening protocol includes submission of these specific quality flexed ml radiographs of both elbows for osteophyte evaluation. next, we classified the degree of dysplasia according to the iewg protocol : normal (grade 0), mild (grade 1, mild joint incongruity, osteophytes less than 2 mm high), moderate (grade 2, clear incongruity, osteophytes 2 - 5 mm high), or severe (grade 3, evidence of primary pathology, osteophytes higher than 5 mm) dysplasia. current, three - dimensional imaging techniques such as computed tomography (ct) and magnetic resonance imaging (mri) are the most reliable diagnostic methods. due to financial considerations, radiographs remain the most cost - effective method of diagnosing ed. optimal radiographic detail is essential to accurately evaluate elbow pathology, and we used the same technique and independent radiologist (jps) to perform and evaluate all radiographs. however, we only evaluated radiographic changes and their evolution given that the imaging modality used relies on the progression of oa signs for ed to be detected. the study was divided in two phases. during the first phase (when the animals were 3 to 12 months old), we evaluated the oral supplement as a preventative measure by comparing the number of dogs that developed ed in each group. after the animals were old enough (12 months) to confirm a diagnosis of ed, radiological control was performed. then the second phase of the study was initiated (until the animals were 20 months old). animals in both groups with radiological signs of dysplasia were considered to be unsuitable and were withdrawn from being guide dogs, but remained in the study until the last follow - up visit to evaluate the effect of the supplement on ed signs and symptoms. all the animals were also closely monitored for the possible appearance of undesirable side effects. baseline characteristics were compared to verify that both groups were similar before starting the study. normal distribution was monitored for all parameters in order to perform the correct inferential statistical analysis. fisher 's exact test was used to compare differences in the incidence of dysplasia and symptoms between groups. mann - whitney u and friedman and wilcoxon tests were performed to compare values between or within groups, respectively, for the orthopaedic controls and supplement efficacy. an intention - to - treat analysis was conducted. if a dog dropped out in both groups the latest values were carried forward. the confidence interval (1-) was set at 95% with a significance cut - off value of 0.05 and power of 90%. the dogs had to be healthy, at least 3 months old, purebred labrador retriever or golden retriever mix, and from internal litters (these litters were born at the animal facility where the study was conducted). all the dogs were vaccinated (eurican pneumo and eurican mhppi2-l ; merial, france). canines were excluded from the study if they had any disease that could confound or interfere with the evaluation, had sustained a previous bone fracture or trauma, were taking concomitant chondroprotective medication, or had been selected for breeding. all the dogs were divided into two groups using random number generator software before the start of the study. the control group was fed a specific diet (puppy ; eukanuba, canada) without supplementation while the treatment group received the same diet in addition to oral supplement tablets (hyaloral ; pharmadiet, spain) during all the study. the supplement contained 20 mg of hyaluronic acid, 2.2 g of enzymatically hydrolysed collagen, 312.5 mg of crystallised glucosamine, 200 mg of chondroitin sulphate, and 100 mg of gamma oryzanol per tablet. dosage was based on body weight (dose : tablet / day for each 10 kg of body weight, 1 tablet / day for each 20 kg of weight, 1.5 tablets / day for each 30 kg of weight, and 2 tablets / day for each 40 kg of weight). clinical evaluation was performed during four follow - up visits when the animals were 3, 6, 12 and 20 months old. the following outcomes were evaluated by two different veterinarians (sma and adr) : physical examination results (medical history and vital signs), orthopaedic evaluation of the elbow joints (lameness, range of motion, and swelling), radiographs, serology and blood analysis data, and subjective veterinarian assessment of clinical signs and symptoms of dysplasia for each joint (palpation, pain, and gait). scoring was based on a scale from 0 to 3 for the following characteristics : lameness : 0 = none ; 1 = mild ; 2 = moderate ; 3 = severerange of motion : 0 = normal ; 1 = slightly reduced ; 2 = moderately reduced ; 3 = severely reducedswelling : 0 = none ; 1 = mild ; 2 = moderate ; 3 = severe lameness : 0 = none ; 1 = mild ; 2 = moderate ; 3 = severe range of motion : 0 = normal ; 1 = slightly reduced ; 2 = moderately reduced ; 3 = severely reduced swelling : 0 = none ; 1 = mild ; 2 = moderate ; 3 = severe we have used this modified orthopaedic scale as a tool at the once guide dog foundation for routine clinical evaluation without anaesthesia or sedation. based on our experience, this scale can be used to identify positive correlations between radiograph findings and clinical signs of the disease. for the radiological examination, we evaluated two different x - ray images for the elbow joint : one taken in the medio - lateral position with forced flexion (ml) and the other in a cranio - caudal position with the animals under general anaesthesia or deep sedation. the current iewg elbow screening protocol includes submission of these specific quality flexed ml radiographs of both elbows for osteophyte evaluation. next, we classified the degree of dysplasia according to the iewg protocol : normal (grade 0), mild (grade 1, mild joint incongruity, osteophytes less than 2 mm high), moderate (grade 2, clear incongruity, osteophytes 2 - 5 mm high), or severe (grade 3, evidence of primary pathology, osteophytes higher than 5 mm) dysplasia. current, three - dimensional imaging techniques such as computed tomography (ct) and magnetic resonance imaging (mri) are the most reliable diagnostic methods. due to financial considerations, optimal radiographic detail is essential to accurately evaluate elbow pathology, and we used the same technique and independent radiologist (jps) to perform and evaluate all radiographs. however, we only evaluated radiographic changes and their evolution given that the imaging modality used relies on the progression of oa signs for ed to be detected. the study was divided in two phases. during the first phase (when the animals were 3 to 12 months old), we evaluated the oral supplement as a preventative measure by comparing the number of dogs that developed ed in each group. after the animals were old enough (12 months) to confirm a diagnosis of ed, radiological control was performed. then the second phase of the study was initiated (until the animals were 20 months old). animals in both groups with radiological signs of dysplasia were considered to be unsuitable and were withdrawn from being guide dogs, but remained in the study until the last follow - up visit to evaluate the effect of the supplement on ed signs and symptoms. all the animals were also closely monitored for the possible appearance of undesirable side effects. baseline characteristics were compared to verify that both groups were similar before starting the study. normal distribution was monitored for all parameters in order to perform the correct inferential statistical analysis. fisher 's exact test was used to compare differences in the incidence of dysplasia and symptoms between groups. mann - whitney u and friedman and wilcoxon tests were performed to compare values between or within groups, respectively, for the orthopaedic controls and supplement efficacy. an intention - to - treat analysis was conducted. if a dog dropped out in both groups the latest values were carried forward. the confidence interval (1-) was set at 95% with a significance cut - off value of 0.05 and power of 90%. three left the study for reasons unrelated to the experiments, two left due to behaviour not compatible with training, and one died due to a clotting disorder. since most of the animals were affected bilaterally by ed, the most affected joint was always considered when assessing signs and symptoms. the animals were randomly divided into two groups. at the start of the study, the groups were homogeneous in terms of weight and data for all physical examinations performed (this homogeneity was maintained throughout the study). no differences were observed between the groups for any of the findings from the physiological or joint evaluations. none of the animals included in either group presented signs or symptoms of dysplasia at 3 months of age (baseline). for the primary endpoint of prevention, we analysed outcomes relating to the incidence of dysplasia (radiologically confirmed) at 12 months and found that 33.3% of dogs in the control group had dysplasia compared to 18.5% in the treatment group (table 1). all cases of ed were classified as grade 2 (moderate) with 100% (n = 13) in the control group being oc while 75% (n = 6) of the cases in the treatment group were oc and 25% (n = 2) were fmcp. to evaluate the therapeutic efficacy (the secondary endpoint) of the supplement, all the analyses were performed for animals with radiologically confirmed diagnoses of ed both from the treatment and control groups. 1), differences were found between the treatment group (12.5%) and control group (61.5% ; p = 0.067). these differences were found to be significant at the last visit (p < 0.05). when the animals were 20 months old, none of the treated dogs had joint symptoms associated with joint dysplasia while these symptoms persisted in the control group (fig. changes in orthopaedic evaluation findings (lameness, range of motion, and swelling) over time were significantly different only in the control group for which symptom severity increased throughout the study (table 2). in the treatment group, symptoms occurred to a lesser extent or were not observed, and there were no significant differences over time since the symptoms improved (table 3). differences in orthopaedic evaluation data for the most affected joints were found when comparing the groups (p < 0.05) at 12 months. the control group had mainly left - sided lameness as well as a lesser range of motion and swelling both on the right and left. at the last follow - up visit, differences between the two groups increased and were significant (p < 0.05) for all the parameters evaluated : lameness, range of motion, and swelling in the right and left elbows (table 4). however, radiographic signs of dysplasia were still observed in animals from both groups at 20 months of age. for the veterinarian clinical evaluation during which the general state of the elbow joints was analyzed, we observed that there was a statistically significant difference within the treatment group between visits 4 and 3 for the right joint in which symptoms significantly improved. the left joint also improved but not significantly. in the control group, statistically significant differences between visits 3 and 4 compared to visit 2 were identified. in both cases, symptoms for both the right and left joints worsened. when we compared the veterinarian assessment data between groups for each visit, we observed statistically significant differences for both joints at visits 3 and 4. no differences were found between the study groups for the additional control parameters (blood and serology analyses). finally, no adverse events were observed for either of the study groups. ed is a joint development disorder associated with visible clinical signs that present in the animal between 6 and 12 months of age. this is important because dogs that are most appropriate for guide work are nowadays golden retrievers, labradors, and german shepherds that have a high genetic disposition for ed. the use of oral chondroprotective agents for treating joint diseases such as osteoarthritis (oa) in humans and animals has been widely studied, and the synergistic effects of different nutraceuticals is a step forward in the management of oa. some research has been done in animals to study the effects of chondroprotective agents for oa, but few studies have investigated the use of these reagents as prophylactics or for treating ed. considering that joints with dysplasia usually show signs of oa and administration of a chondroprotector may ameliorate the progression of clinical osteoarthritis symptoms, this study was designed to evaluate an oral supplement. as one of the objectives, efficacy of the supplement was analyzed by comparing the development of ed in each group (treated versus control). according to the protocols for animal use and management established by the once guide dog foundation training school, the dogs included in our study were followed up at 3, 6, 12, and 20 months of age. mild signs appeared in some animals and cases of dysplasia were radiologically confirmed in both groups at 12 months as described in several previous studies. we observed that the number of dogs developing radiographic evidence of ed decreased in the treatment group to 18.5% compared to 33.3% in the control group. in europe, the prevalence of elbow dysplasia in labrador dogs is 20~30%. at our training centre, however, litters selected from parents chosen according to behavioural criteria had a somewhat higher incidence rate. thus, our results suggest that the treatment modality we developed represents a probable way to prevent the progression of osteoarthritic changes associated with joint dysplasia. once joint dysplasia has been detected, treatment modalities should be designed to prevent the progression of the disorder (whenever possible) or minimise symptoms. most studies conducted to date have evaluated the efficacy of different surgical treatments for a middle stage of elbow dysplasia when there is articular damage. in contrast, we evaluated the effects of a daily supplement on symptoms and signs of ed over a 17-month period. the results demonstrated that the treatment group showed significant improvement in terms of lameness and range of motion compared to the control animals. all symptoms of dysplasia had improved by 20 months of age in the treatment group compared to the control dogs although radiological signs persisted in both groups. these results suggest that using a daily supplement containing hyaluronate, collagen, and other glycans could be an option for treating the signs and symptoms of joint dysplasia as an alternative to surgery. our data coincide with those obtained from a study on the efficacy of pharmacological treatment compared to traditional surgical techniques for fmcp and oc of the elbow. dogs assigned to the medical treatment group received 3 mg / kg pentosan polysulfate once a week for 4 weeks. the other group underwent medial arthrotomy and partial collateral desmotomy. at the end of the study, lameness and pain additionally, another study investigated the effect of different doses of glycosaminoglycans for treating various signs of hip dysplasia. the dogs that received 4.4 mg / kg glycosaminoglycans showed the greatest effects in terms of improved orthopaedic scores as opposed to the placebo group that showed the least improvement. long - term and blinded clinical trials are required to confirm whether the results of our study could be replicated in other training schools and regular veterinarian practice. this is because most breeders do not currently evaluate the elbows of all of their dogs. furthermore, reductions of clinical signs associated with ed are judged based on subjective veterinarian analyses. a number of important limitations also need to be considered. limitations of the present study included restrictions associated with radiography versus ct and mri as a method of diagnosing ed, a lack of blinding of the investigators (only the radiologist was independent and blinded), and the inclusion of breeds that have an unusual prevalence of oc compared to fcp. these limitations, especially interpretation of the radiographic data, could have influenced the results of this investigation. more research and clinical consensus is needed to more reliably verify the use of chondroprotective substances for preventing and treating ed. however, results obtained in our study enable us to conclude that administration of hyaluronic acid, enzymatically hydrolysed collagen, glucosamine, chondroitin sulfate, and gamma oryzanol (hyaloral) to animals diagnosed with ed significantly reduces clinical signs and symptoms. moreover, we concluded that the results of this study indicate that giving this dietary supplement to labradors starting at the age of 3 months may have a potential cumulative action that confers protection against the progression of radiographic osteoarthritic changes associated with ed. this is particularly important considering that the breeds used as guide dogs are most often labrador retrievers whose main obstacle for being accepted for training is the prevalence of ed. finally, we were able to confirm the safety and tolerability of the hyaloral supplement.	one hundred and five labrador dogs were randomly divided into two groups to determine the number of animals that develop elbow dysplasia when treated with an oral supplement compared to untreated ones. efficacy of the oral treatment was also evaluated once illness was diagnosed. the supplement (hyaloral) contained hyaluronic acid, hydrolysed collagen, glucosamine, chondroitin sulphate, and gamma oryzanol. clinical evaluation of the elbow joints was completed at months 3, 6, 12, and 20 by orthopaedic evaluations, radiography, serologic and blood analysis, and veterinarian evaluation of dysplasia symptoms. all side effects were recorded. in the control group, 33.3% of the dogs developed radiographic evidence of elbow dysplasia compared to 18.5% in the treated group. symptoms of dysplasia at 12 months differed between the treated (12.5%) and control (61.5%) animals, and were significantly different at 20 months (p < 0.05). differences in lameness along with movement and swelling of the elbows between groups were observed after 12 months. the treated group had improved significantly by the last visit (p < 0.05). no adverse side effects were reported. in conclusion, oral treatment with hyaloral may have a potential cumulative action that provides protection against dysplasia and significantly improves symptoms of elbow dysplasia.
primary biliary cirrhosis (pbc) is an autoimmune disease in which the intrahepatic bile ducts are targeted by an immunemediated injury. pbc is associated with a range of conditions, including sjgren 's syndrome in 70% of patients 2, autoimmune thyroid disease in approximately 10%, and systemic sclerosis in 15% 3. however, pbc is suggested to only rarely be associated with rheumatoid arthritis (ra), and the true prevalence of pbc in ra is not well known 4. in this article, we report an unusual case of a patient with pbc and ra, and discuss the association between these two diseases. in 2013, a 71yearold man with rheumatoid arthritis (ra) was admitted to our hospital with elevated transaminase levels. he had been taking prednisone (6 mg / day) and salazosulfapyridine (1000 mg / day) for ra since 2012 (fig. 1). he reported no consumption of alcohol, recent travel, or sexual contact., he was icteric with mild pruritus. an abdominal ultrasound scan, computed tomography (ct), and magnetic resonance cholangiopancreatography (mrcp) revealed neither biliary obstruction nor spaceoccupied lesions. blood test results (table 1) revealed the following : total bilirubin (tbil), 3.76 mg / dl ; direct bilirubin (dbil), 3.12 mg / dl ; aspartate aminotransferase (ast), 167 iu / l ; alanine aminotransferase (alt), 435 iu / l ; alkaline phosphatase (alp), 2539 iu / l ; glutamyltranspeptidase (gtp), 590 iu / l ; immunoglobulin g (igg), 1322 mg / dl ; immunoglobulin m (igm), 705 mg / dl ; antinuclear antibodies (ana), 40 ; antimitochondrial antibodies (ama), 20 ; amam2 antibodies, 34.1 (normal ; < 6) ; antigp210 antibodies, 0.2 u / ml (normal ; < 6) ; anticentromere antibodies, 55.6 u / ml (normal ; < 9.9). a liver biopsy at day 4 showed marked inflammatory cell infiltration surrounding and destroying the interlobular bile ducts in the portal area (fig. on the basis of these results, a diagnosis of pbc corresponding to sheuer 's stage i was confirmed. treatment with ursodeoxycholic acid (udca) (600 mg / day) was started 3 days after admission. the patient 's clinical findings and biological data showed improvement and the patient was discharged 19 days after admission. he has been followed up in our outpatient clinic. a second biopsy after 445 days of udca treatment showed marked improvement of inflammation in the portal area (fig. 2b). ast, aspartate aminotransferase ; alt, alanine aminotransferase ; alp, alkaline phosphatase ; gtp, glutamyltranspeptidase ; crp, creactive protein ; hbsag, hepatitis b surface antigen ; hcvab, hepatitis c virus antibody ; ebvvca, epstein barr virus viral capsid antigen ; ebna, epstein barr virus nuclear antigen ; ana, antinuclear antibodies ; asma, antismooth muscle antibodies ; ama, antimitochondrial antibodies ; antitg ab, antithyroglobulin antibody ; antitpo ab, anti thyroid peroxidase antibody. (a) a liver biopsy at day 4. marked inflammatory cell infiltration is observed surrounding and destroying the interlobular bile ducts with ductular proliferation in the portal area. hepatic involvement is common in rheumatic diseases and is usually related with nonspecific findings such as drugrelated liver dysfunction. however, more serious hepatic involvement, including nodular regenerative hyperplasia, vasculitis, and pbc, have been observed in specific rheumatic diseases, such as ra 3, 5. ra is present in about 1% of the population and pbc is even rarer, with an estimated prevalence of 0.02% in females and 0.002% in males. however, there are some reports that describe their association with individuals or families 4, 7. pbc patients often have concomitant autoimmune diseases, such as sjgren 's syndrome (70%), systemic sclerosis (15%), and thyroiditis (10%). the association of pbc and ra is unclear, although previous studies on large series of pbc patients have suggested that the prevalence of ra in pbc is 1.85.6% 4, 8, 9. meanwhile, several previous studies have indicated the presence of pbcrelated features in ra patients. one autopsy series of ra patients found that 65% of 182 ra cases had evident liver pathology, including chronic inflammatory infiltration of the portal tracts and small foci of necrosis, as well as steatosis 10. however, it is unclear whether any of these patients were diagnosed with pbc. a japanese study by takahashi. furthermore, another study indicated ama positivity in ra patients to be 18% 12. in our case, ama testing was not performed at the diagnosis of ra because liver dysfunction was not observed. although the etiologic and pathologic mechanisms of these diseases are not yet understood, several factors have been suggested, such as genetic factors, epigenetic factors, and infectious agents. genomewide association studies (gwas) have shed light on the genetic background of pbc and ra recently. genetic studies have indicated that several genes implicated in pbc lay within nonhla and hla regions 13, 14. several common genes have been identified in pbc and ra, although the majority of implicated genes in both diseases do not overlap. overlapping genes include hladqb1, ctla4, mmel1, irf5, stat4, and possibly cxcr5. among these genes, stat4 is essential for il12 signal transduction via the il12 receptor (il12r) for ifn production and th1 polarization. in a gwas for pbc in the japanese population, 15 reported that, in addition to possessing two significant susceptibility loci (tnfsf15 and pou2af1), stat4 showed a suggestive association with pbc in japanese and european patients. in our case, we did not perform a genetic analysis ; however, individuals with a common genetic profile may be more susceptible to developing concomitant ra and pbc. assuming that several common genes exist in ra and pbc patients, it has been suggested that common infectious triggers may be involved in the induction of both diseases. most studied infection trigger of pbc is escherichia coli (e. coli) 16 ; due to the high incidence of recurrent urinary tract infections (rutis) in pbc patients 17. several infectious agents (including e. coli) have also been linked to ra 18, 19. of note, in rfpositive patients, antie. no symptoms of bacterial infection, including rutis, were observed during the clinical course. however, a possible role of e. coli has been suggested in the early pathogenesis of ra. in our case, the patients showed rapid elevation in alt as well as alp and gtp., druginduced liver injury (dili) and overlap syndrome between pbc and auto immune hepatitis (aih) were suspected at first. however, the patient was finally diagnosed as pbc by laboratory data, histology findings, and clinical course. in our case, overlap syndrome between pbc and aih was also suspected, however, serum level of alt was normalized after 2 months of udca treatment. for these findings, we thought that the diagnosis in our case was also closer to pbc than overlap syndrome. in conclusion, concomitant pbc in patients with ra is rare ; however, pbc should be ruled out in the differential diagnosis of any patients with ra having abnormal liver function tests. to determine the relationship between these two diseases, further studies are needed, in particular cohort studies related to pbc occurrence in a large cohort of ra patients.	key clinical messagethe true prevalence of pbc in ra is not well known. herein, we report an unusual case of a patient with pbc and ra, and discuss the association between these two diseases. pbc should be ruled out in the differential diagnosis of patients with ra having abnormal liver function tests.
exercise - induced bronchoconstriction (eib), also referred to as exercise - induced asthma (eia), is a manifestation of bronchial hyperresponsiveness (bhr) that occurs in the majority of patients with current symptomatic asthma, especially in the patients with moderately to severely increased responsiveness [13 ]. the current thinking about mechanisms by which eib develops emphasizes the loss of heat and/or water from the airways during exercise that leads to release of proinflammatory mediators. airborne particles and pollutants, as well as airborne allergens, are considered as stimulants that contribute to eib. a fish oil supplementation may have a protective effect on eib, which is probably attributed to its anti - inflammatory properties. results from several studies indicated that bhr prevalence is higher in females than in males [7, 8 ]. the mechanisms responsible for a higher susceptibility of the airways in females to nonspecific stimuli include lower airway calibre, lower body weight, greater cholinergic irritability, and hormonal factors. on the other side, data from the studies carried out in the last two decades suggest an increased risk for asthma among health care workers, yet only a few specific determinants have been elucidated [1013 ]. as delclos. have suggested, the contribution of occupational exposures to respiratory impairment and asthma in health care professionals is not trivial, meriting both implementation of appropriate controls and further studies. to our knowledge, so far, there is no study assessing exercise - induced respiratory symptoms (eirss) and eib in health care professionals. in the present study, we assessed effects of occupational exposure on eirss and eib among health care workers by comparison of their prevalence and characteristics between females working as nurses in primary care settings and female office workers. a cross - sectional survey was carried out in a university research laboratory, that is, department of cardiorespiratory functional diagnostics at the institute for occupational health of r. macedonia, skopje who collaborating center for occupational health and galen collaborating center. we examined 48 females aged 24 to 51 years (mean age 37.8 7.4) working as nurses in primary care settings with duration of employment 5 to 25 years (mean duration 14.7 5.7). the work shifts of the nurses lasted 8 hours per day, and their working tasks included completion of the medical documentation, assistance in medical interventions, administration of parenteral and aerosolized medications, and medical instruments cleaning. the workplace exposure included several types of cleaning products, disinfectants, adhesives, solvents, latex, and medications, some of which are in spray form. according to the classification of occupational muscular work, in addition, an equal number of female office workers matched to nurses as a group by age and smoking status were studied as a control group. according to the classification of occupational muscular work,, there were no subjects in whom exercise challenge or histamine challenge were contraindicated [16, 17 ], nor there were subjects with the upper respiratory viral infection within three weeks before the challenge test was performed. none of the subjects took asthma medications or antihistamines at least one month before the challenge tests and skin - prick tests. the questionnaire was designed using the proposed model of the national jewish medical and research center, denver, usa. subjects were considered having exercise - induced respiratory symptoms (eirss) if one or more symptoms were reported : coughing during or after exercise, wheezing during or after exercise, inability to get deep breath after exercise, noisy breathing after exercise, and chest tightness after exercise. detailed smoking history, asthma diagnosed by physician, family history of asthma and allergic diseases (taking into account the first - degree relatives), accompanying disease, and medication use were also evaluated. classification of smoking status was done according to the world health organization (who) guidelines on definitions of smoking status. daily smoker was defined as a subject who smoked at the time of the survey at least once a day, except on days of religious fasting. in daily smokers, pack years smoked (one pack year denotes one year of smoking 20 cigarettes per day) were calculated according to the actual recommendations. ex - smoker was defined as a formerly daily smoker who no longer smokes. passive smoking or exposure to environmental tobacco smoke (ets) was defined as the exposure of a person to tobacco - combustion products from smoking by others. skin - prick tests (spts) to common inhalant allergens were performed in all subjects on the volar part of the forearm using commercial allergen extracts (torlak, serbia, and montenegro) of birch (5000 pnu), grass mixed (5000 pnu), plantain (5000 pnu), fungi mixed (4000 pnu), dermatophagoides pteronyssinus (3000 pnu), dog hair (4000 pnu), cat fur (4000 pnu), and feathers mixed (4000 pnu). all tests included positive (1 mg / ml histamine) and negative (0.9% saline) controls. prick tests were considered positive if the mean wheal diameter 20 min after allergen application was at least 3 mm larger than the size of the negative control. spirometry, including measures of forced vital capacity (fvc), forced expiratory volume in one second (fev1), fev1 / fvc ratio, and maximal expiratory flow at 50%, 25%, and 2575% of fvc (mef50, mef25, and mef2575, resp.), was performed in all subjects using spirometer ganshorn sanoscope lf8 (ganshorn medizin electronic gmbh, germany) with recording the best result from three measurements the values of fev1 of which were within 5% of each other. the results of spirometry were expressed as percentages of the predicted values according to the european community for coal and steel (eccs) norms. the histamine challenge test was performed according to the actual european respiratory society (ers)/american thoracic society (ats) recommendations [16, 17 ]. concentrations of 0.5, 1, 2, 4, and 8 mg / ml histamine (torlak, beograd) were prepared by dilution with buffered saline. the doses of aerosol generated by pari lc nebulizer with output rate 0.17 ml / min were inhaled by mouthpiece. subjects inhaled increasing concentrations of histamine using a tidal breathing method until fev1 fell by more than 20% of its base value (provocative concentration 20pc20) or the highest concentration was reached. according to the ats recommendations, bronchial hyperresponsiveness (bhr) was categorized as moderate to severe bhr (pc20 4.0 mg / ml). the test was considered positive if pc20 was equal or less than 4 mg / ml [16, 17 ]. the constant submaximal exercise challenge test (ect) was performed in all subjects using cycle ergometer hellige - dynavit meditronic 40 (hellige gmbh, germany). ect was conducted in an air - conditioned room with ambient temperature of 2025c and relative air humidity of 50% or less. according to the actual recommendations, subjects exercised 810 min achieving 90% of predicted maximal heart rate (hrmax = 220 age) in the last 4 min of exercise [16, 17 ]. heart rate was monitored continuously throughout the exercise and for 5 minutes after its completion from a three - lead electrocardiographic configuration. the measurements of fev1 were performed before and 1, 3, 5, 7, 10, and 15 min after the exercise with inhaled bronchodilator (200 mcg salbutamol) application upon completion of the protocol. the response to exercise was expressed as fall index fev1 (100 [pre - exercise fev1 lowest postexercise fev1]/pre - exercise fev1). continuous variables were expressed as mean values with standard deviation (sd) whereas the nominal variables as numbers and percentages. analyses of the data involved testing the differences in prevalence, comparison of the means, and testing the association between eirss and eib and studied variables. chi - square test was used for testing difference in the prevalence. comparison of spirometric measurements and fall index fev1 values was performed by independent samples t - test. chi - square test (or fisher 's exact test where appropriate) was used for testing association between eirss and eib and studied variables. statistical analysis was performed using the statistical package for the social sciences (spss) version 11.0 for windows. demographic characteristics of the study subjects were similar in both examined groups (table 1). inability to get deep breath after exercise and cough during or after exercise was the most frequent eirss in either group (table 2). prevalence of subjects with positive spt to common inhalant allergens was similar in both nurses and controls (33.3% versus 37.5%, p =.670 ; chi - square test). mite sensitization was the most important individual common allergen with no statistical difference between sensitized subjects in both groups (22.9% versus 25.0%, p =.811 ; chi - square test). spirometric parameters were lower in nurses, but statistical significance was not found for any parameter (table 3). spirometric parameters were nonsignificantly lower in the subjects with asthma diagnosed by physician as compared to nonasthmatics in both nurses and controls. prevalence of overall subjects with bhr was nonsignificantly higher in nurses (12.5% versus 8.3% ; p =.740), whereas the prevalence of subjects with moderate to severe and mild bhr, that is, prevalence of subjects with positive histamine challenge, was similar in both examined groups (table 4). we found similar prevalence of eib in both nurses and controls (8.3% versus 6.3%, p = 1.000 ; fisher 's exact test). the eib severity, expressed as fall index fev1, was significantly higher in nurses (28.1% versus 22.7%, p =.033 ; independent - samples t - test). eib in both examined groups was significantly related to asthma diagnosed by physician, positive family history for asthma and allergies, and positive histamine challenge, whereas association with other variables was nonsignificant. association between eib and daily smoking in nurses was of borderline statistical significance (p =.062 ; fisher 's exact test), while association between eib and pack years smoked (less or more than 12) was nonsignificant (p =.097 ; fisher 's exact test). association between eib and exercise - induced respiratory symptoms, with exception of exercise - induced wheezing in both nurses (p =.037 ; fisher 's exact test) and controls (p =.034 ; fisher 's exact test), was statistically nonsignificant. the frequency of false positive results was high in both nurses (84.3%) and controls (88.2%). according to the recent data, occupational exposures in health care professionals increase the risk of work - related asthma. medical instruments cleaning, general cleaning, use of solvents / adhesives in patient care, use of powdered latex gloves, and aerosolized medication administration were identified as occupational risk factors associated with the development of asthma in nurses [10, 14, 25 ]. on the other hand, eib is a common condition close related to asthma that is often unrecognized and uncontrolled leading affected subjects to avoid general and occupational physical activities and sports. we performed the present study on eib among nurses in primary care settings as a continuum of our investigations on the effects of specific occupational exposures on the eib occurrence and characteristics [2628 ]. according to the results of several studies [1113 ], the lowest risk of respiratory impairment and asthma was found in administrative workers, so this unexposed occupation was used as a control group. in the present study, both examined groups included subjects with similar demographic characteristics. in either group, there was a large proportion of daily and passive smokers similar to its prevalence among females in r. macedonia documented in our previous studies [29, 30 ]. the prevalence of ex - smokers in both groups was low, suggesting insufficient smoking cessation activities. the situation in the developed countries seems to be somewhat different. in the study conducted in 12 european countries as well as australia and the usa, janson. reported that both active and passive smoking rates have declined since the early 1990s but indicated lower quitting rates and higher risk of passive smoking among people with fewer qualifications and less skilled occupation groups. we found high prevalence of eirss in both examined groups that is similar to the findings of several studies which investigated eib in different subpopulations of both sexes [32, 33 ] as well as to the findings of our studies among workers with different occupational exposures [2628 ]. the prevalence of atopy and the pattern of allergic sensitization to common aeroallergens in both examined groups was comparable to that we had previously observed among adults in r. macedonia [34, 35 ]. all spirometric parameters were lower in nurses, but statistical significance was not achieved for any of them. the prevalence of bhr was nonsignificantly higher in nurses than in office workers that is similar to the findings obtained in our previous studies on bhr prevalence among workers with specific occupational exposures (herbal tea processors, cooks, and cleaners) and office workers as a control group [36, 37 ]. several studies indicated that the occurrence of eib depends on degree of bronchial hyperresponsiveness (alias underlying chronic inflammation), exercise intensity, and ambient conditions [38, 39 ]. there are many studies about eib occurrence in selected groups of general population (children, school children, adolescents, and recruits) as well as in recreative and elite athletes. on the contrary, there is a limited number of studies on eib associated with specific workplace exposures. the eib prevalence in elite athletes varies from 12% of basketball players to 55% of cross - country skiers [40, 41 ]. in the present study, we found similar eib prevalence in both nurses and controls (8.3% and 6.3%, resp.). according to the results of our previous studies, the eib prevalence among workers with specific occupational exposures ranged from 6.4% in herbal tea processors, 6.9% in bakers, 7.1% in agricultural workers, 8.9% in textile workers, to 9.3% in agricultural workers. bronchial reaction to exercise in the subjects with eib was significantly higher in nurses than in controls. significantly higher bronchial reaction to exercise in comparison to office workers we also found in ect - positive female cleaners, whereas the difference in mean fall index fev1 did not differ significantly between workers exposed to organic dusts and office workers with eib [2628 ]. this difference may be due to the presence of the study subjects of both sexes among workers exposed to organic dusts as well as to the different occupational exposures (i.e., dominant exposure to chemical compounds in cleaners and nurses). we found significant association between eib and asthma, family history of asthma, and atopy in both examined groups. contribution of genetic factor in the eib development is confirmed in a number of studies [39, 42, 43 ]. we also found a significant association between positive ect and positive histamine challenge in both examined groups. data from the studies which compared results of two bronchial challenge types are somewhat inconsistent. some authors reported significant association between the results of exercise and histamine challenge [2628, 44 ]. on the contrary, other authors reported a weak association, which was explained by different pathomechanisms of bhr to histamine and eib. correlation between eib and daily smoking was nonsignificant in controls, whereas in nurses, it was of borderline statistical significance. a similar finding, suggesting possible interaction of tobacco smoke and occupational exposure in eib development, was obtained in our previous study on eib in female cleaners. in the present study, there was no positive association in both examined groups between eib and overall and individual eirss with exception of exercise - induced wheezing. this finding, confirmed in a number of studies, was not unexpected, as the eirss may be triggered by many conditions and diseases other than bhr (e.g., physical unfitness, medical side effect of angiotensin - converting enzyme inhibitors and beta - blockers, anxiety, vocal cord dysfunction, arterial hypertension, gastroesophageal reflux, etc.) first, relatively smaller number of the subjects in the study groups could have certain implications on the data obtained and its interpretation. second, we did not perform spt to workplace allergens (e.g., latex), so we could not document relationship between sensitization to workplace allergens and eib. third, environmental measurements were not performed, so we could not document the effect of the type and the level of exposure on eib. the strength of the study is the extensive examination of lung function in the study subjects with the possibility for comparison of the results of different tests. in conclusion, in a cross - sectional study including nurses and office workers, we found a similar prevalence of eirss and eib in both examined groups. in addition, eib was closely related to atopy, family history of asthma, and positive histamine challenge in either group as well as to daily smoking in nurses. bronchial reaction to exercise in ect - positive nurses was significantly higher than in ect - positive controls. eirss were weakly associated with eib in both examined groups, with a large proportion of false positive results. our study confirms the need of regular medical examinations in order to identify affected workers and to implement adequate preventive measures.	in order to assess prevalence and characteristics of exercise - induced respiratory symptoms (eirss) and exercise - induced bronchoconstriction (eib) in health care workers, we performed a cross - sectional study including 48 female nurses from primary care settings and an equal number of female office workers studied as a control group. the evaluation of examined groups included completion of a questionnaire, skin prick tests to common inhalant allergens, spirometry, and exercise and histamine challenge. we found a similar prevalence of eirss and eib in both groups. eib was closely related to asthma, atopy, family history of asthma, and positive histamine challenge in either group, while the association between eib and daily smoking in nurses was of borderline statistical significance. bronchial reaction to exercise was significantly higher in nurses than in controls with eib. with the exception of exercise induced wheezing, eirss were weakly associated with eib in both groups with a large proportion of false positive results.
a 74-year - old man presented with mild dyspnea and chest discomfort for 30 months. trans - thoracic echocardiographic findings showed a left atrial echogenic mass (21.5 cm) (fig. 1). a provisional diagnosis of a left atrial (la) myxoma was made, and the patient was admitted for the surgical excision of the tumor. coronary angiography revealed a 50% stenosis on the mid - portion of the left anterior descending artery (lad). we planned the concomitant operation with mass excision and coronary artery bypass. under general anesthesia with supine position, conventional cannulation was performed, and the right atrial wall and the interatrial septum were incised. further, we anastomosed the left internal thoracic artery to the distal portion of the lad. the resected mass was oval and was made of a white jelly - like material. we resected the mass including the myocardium, and the la wall was closed by a prolene suture. hemangioma of the heart presenting as a primary cardiac tumor is extremely rare ; it accounts for approximately 2.8% of all primary resected heart tumors. its histological subtypes are as follows : 1) cavernous hemangioma, 2) capillary hemangioma, and 3) arteriovenous hemangioma or cirsoid aneurysm. the capillary hemangioma has lobules of endothelial cells forming small, capillary - like vessels. the arteriovenous hemangioma consists of dysplastic thick - walled arterioles, venous - like vessels, and capillaries. in our case, the tumor is a capillary hemangioma that shows ill - defined aggregates of closely packed, thin - walled capillaries filled with blood cells (fig. further, tumors may be located in any heart chamber, the pericardium, the endocardium, or the myocardium., and the localization of cardiac hemangiomas was the right ventricle in 20 cases (35.7%), the left ventricle in 19 cases (33.9%), the right atrium in 13 cases (23.2%), the interatrial septum in 6 cases (10.7%), the interventricular septum in 6 cases (10.7%), and the left atrium in 4 cases (7.1%). very few cases of cardiac hemangiomas have been reported to be arising from the la wall, mimicking the classic presentation of a myxoma. in our patient, the tumor was located in the orifice of the right lower pulmonary vein. however, venous flow obstruction was not observed. some cardiac hemangiomas are asymptomatic and are discovered during cardiac surgery or upon autopsy. in symptomatic patients, cardiac hemangiomas cause arrhythmia, pericardial effusion, congestive heart failure, right ventricular outflow tract obstruction, coronary insufficiency, and sudden death. diagnosis can be made by echocardiography, computed tomography (ct), or magnetic resonance imaging (mri). coronary angiography is sometimes useful in revealing how the tumor is fed and its characteristic tumor blush. however, we can not find any feeding vessel or tumor blush in preoperative coronary angiography. in the opinion of a cardiologist, the tumor had a myxoma - like shape and exhibited echogenicity. atrial hemangiomas, particularly those attached to the la wall, may be erroneously diagnosed as myxomas. however, there are no myxoma cells or lepidic cells that can be found usually in cardiac myxomas, and cellular areas with numerous capillaries are usually present. patients with a resectable tumor usually have a good prognosis, but those with an unresectable tumor may have a poor prognosis because of ventricular tachycardia, sudden death, local progression, or systemic dissemination of the malignant tumor. therefore, we believe that if surgical resection is possible, surgery is the best way to treat cardiac hemangioma. cardiac hemangioma is a rare disease ; furthermore, a tumor arising from the la wall and misconceived as a myxoma is extremely rare. we removed the mass misdiagnosed as a myxoma and pathologically confirmed it to be a cardiac capillary hemangioma. in order to share our experience	hemangioma of the heart, presenting as a primary cardiac tumor is extremely rare ; it accounts for approximately 2% of all primary resected heart tumors. in our patient, the tumor was located in the orifice of the right lower pulmonary vein. few cases of cardiac hemangiomas have been reported to arise from the left atrial (la) wall. left atrial hemangiomas, especially those attached to the la wall, may be erroneously diagnosed as myxomas. cardiac hemangioma is a rare disease ; furthermore, a tumor arising from the la wall and misconceived as a myxoma is extremely rare. we removed a mass misdiagnosed as a myxoma ; it was pathologically confirmed to be a cardiac capillary hemangioma. therefore, we report a rare case of a cardiac hemangioma misconceived as a myxoma ; the tumor was removed successfully.
blunt trauma of the abdominal wall can lead to a traumatic abdominal wall hernia (tawh). defined tawh as the herniation through disrupted musculature and fascia associated with adequate trauma, without skin penetration, and no evidence of a prior hernia defect at the site of injury. although this type of hernia is unusual, it has been described in some reviews [27 ]. two reviews studied tawh, especially in the lumbar position [8, 9 ]. the increased abdominal pressure and shearing forces likely cause disruption of the abdominal wall muscles and fasciae. we describe the history and imaging of a patient with a traumatic abdominal wall hernia and the operative treatment. a 59-year - old male sustained a fall from a height of 9 m onto a pile of steel bars, landing on his right flank. upon arrival of helicopter emergency medical services, the patient was alert and complained of pain in the abdomen. an advanced trauma life support (atls) survey revealed a right - sided pneumothorax, which was treated with a chest tube. after this intervention, the patient was respiratorily and haemodynamically stable and transported to the emergency department. upon arrival, the initial assessment according to the atls protocol was performed without any new findings according to the a, b, c and d approaches. during the secondary survey, inspection revealed a large swelling at the right side of the abdomen, with abrasions of the overlying skin (fig. 1). focussed assessment with sonography for trauma identified the presence of free intraperitoneal fluid around the spleen. 1patient after blunt abdominal trauma with swelling of the right hemi - abdomen patient after blunt abdominal trauma with swelling of the right hemi - abdomen in addition, a computed tomography (ct) scan of the abdomen showed a traumatic hernia of the right lateral abdomen, with protrusion of bowel and laceration of the spleen (fig. 2). the patient was transported to the operating theatre, and exploration of the abdomen through a median incision revealed a transverse rupture of the total abdominal wall, including rectus muscle and external, transverse and internal abdominal muscles, with a length of 30 cm from the midline to the vertebral column on the right side (fig. 3). the small bowel, ascending colon and the right lobe of the liver were herniated due to this defect. a non - vital part of the small bowel (10 cm) was resected, and haemorrhages from the mesentery and spleen were treated. this anatomical reconstruction was reinforced with an intra - abdominal polyester composite mesh (parietex) with at least 4 cm overlap and fixed with sutures and taggers. after closure of the linea alba, the overstretched median fascia below the umbilicus was protected by an absorbable polyglactin mesh (vicryl). post - operatively, the patient developed superficial skin necrosis in the area of the abdominal wall with deglovement, which healed by secondary intention assisted by a vacuum assisted closure system. a ct scan of the abdomen 4 months after the operation showed the anatomical reconstruction of the right abdominal wall with the use of an intra - abdominal mesh fixed with taggers (fig. 4). 2preoperative abdominal computed tomography (ct) scan demonstrating three ruptured muscle layers on the right sidefig. 3intra - operative picture of the right inner abdominal wall with rupture of all muscle layers.. 1 parietal peritoneum, 2 rupture of abdominal muscle layers, 3 liverfig. 4post - operative abdominal ct scan demonstrating anatomical restoration of the right abdominal wall with the use of an intra - abdominal mesh fixated with taggers preoperative abdominal computed tomography (ct) scan demonstrating three ruptured muscle layers on the right side intra - operative picture of the right inner abdominal wall with rupture of all muscle layers.. 1 parietal peritoneum, 2 rupture of abdominal muscle layers, 3 liver post - operative abdominal ct scan demonstrating anatomical restoration of the right abdominal wall with the use of an intra - abdominal mesh fixated with taggers our patient sustained a high - energy trauma caused by a fall from a large height. this trauma gave rise to the tawh and associated devascularisation of the small bowel, necessitating bowel resection. low energy trauma can lead to smaller tawhs, which can easily be missed on physical evaluation. handlebar injury is an example of a low energy trauma that can lead to tawh [2, 11, 12 ]. the diagnosis of a tawh on physical examination can be difficult ; because of its rare occurrence, a diagnosis of tawh is not often considered. the tawh was not diagnosed by physical examination, and the very tender right hemi - abdomen was thought to be associated with intra - abdominal lesions. because life - threatening intra - abdominal injuries can occur after high - energy trauma, a ct scan should be used as a diagnostic method. the ct scan in this case led to the diagnosis of tawh after careful examination of the abdominal wall and also to multiple haematomas in the mesentery and a spleen laceration. the strong shear forces had split the three layers of the lateral abdominal wall and the peritoneum. with the routine use of ct scans after blunt trauma tawh can be operated on by an incision overlying the defect, but in this case, a midline exploratory laparotomy was necessary for the associated intra - abdominal injuries. in addition, because of the associated intra - abdominal injuries, delayed exploration of the tawh was not a treatment option in our case. we combined the primary closure in the anatomical layers with an intraperitoneal mesh because the fascia was stretched out by the trauma and the hernia was very large. we used a composite mesh because the inner side was in direct contact with the bowels. in a recent review of the open treatment of incisional hernia, also, in a recent retrospective study of 206 open sublay mesh repairs with intraperitoneal placement of a composite mesh, the infection rate was 10.2% in a 9.5-year period. in our case, resection of a small bowel section could have increased the risk of a mesh infection. the high infection rate has to be weighed against the risk of recurrence. in a series of eight acutely repaired tawhs without mesh, three developed a recurrent hernia after 8 months. in another series of seven acute repairs of tawhs, thus, the acute repair of a large tawh should not be underestimated because of the associated injuries and the risk of a recurrence.	although blunt abdominal trauma is frequent, traumatic abdominal wall hernias (tawh) are rare. we describe a large tawh with associated intra - abdominal lesions that were caused by high - energy trauma. the diagnosis was missed by clinical examination but was subsequently revealed by a computed tomography (ct) scan. repair consisted of an open anatomical reconstruction of the abdominal wall layers with reinforcement by an intraperitoneal composite mesh. the patient recovered well and the results of a post - operative ct scan are presented.
the online version of this article (doi:10.1007/s00417 - 011 - 1700 - 2) contains supplementary material, which is available to authorized users. silicone intubation of the lacrimal system has become very popular in the treatment of congenital nasolacrimal duct obstructions (cnldo) resistant to conservative therapy and/or probing [16 ]. bicanalicular intubation (bci) has been used since the 1970s, and various techniques have been described, whereas monocanalicular intubation (mci) was not popular until the early 1990s [1, 68 ]. each of these intubation systems has advantages and disadvantages [2, 3, 57, 9 ]. whereas the bicanalicular system requires passing a tube through the inferior and superior puncta and through the lacrimal system into the nose, the monocanalicular system requires a single pass of the tube through the system [1, 2, 4 ] nevertheless, a comparison of the two kinds of intubation to determine which is optimal has not been well - performed so far. the objective of this study was to compare the success rate and complications of mci and bci in children treated for cnldo. the aim of this prospective study was to compare the success rate of mci and bci silicone intubations in the treatment of children with cnldo. the study was performed in accordance with the declaration of helsinki, good clinical practice, and applicable regulatory requirements. informed written consent was obtained from all parents / guardians before the initiation of any procedure. children aged between 12 and 36 months with severe cnldo symptoms resistant to conservative therapy and two probings were included in the study. the diagnosis of cnldo was based on a history of tearing, the fluorescein dye disappearance test (fdt), and diagnostic probing and/or irrigation tests. the study was carried out from january 2006 to november 2009, and a total of 70 eyes (in 53 children) were included. children younger than 10 months of age were excluded because of known self - resolution during maturation of the nasolacrimal duct. patients with previous eyelid and/or lacrimal surgery, punctal and/or canalicular obstructions, eyelid malpositioning, and less than 6 months follow - up were also excluded. the study started with 35 consecutive cases of bci (group i) followed by 35 consecutive cases of mci (group ii). the silicone tubes were removed 3 to 4 months after the surgery, and the children were followed up for 6 months. the drainage function of the lacrimal system was assessed using a combination of the fdt, medical history and clinical examinations (tear retention and conjunctival sac evaluation, medial canthus observation and/or palpation), as well as syringing of the system in some cases, as required. complete therapeutic success was defined as fdt grade 01, and this result had to correspond with a complete resolution of previous symptoms. failure was defined as the absence of improvement or the worsening of the symptoms. for the statistical analysis -test, fisher 's exact test, and the two - sample t - test were used, with the level of significance set at p < 0.05. after probing the lacrimal pathways with the help of a bowman probe, endoscopy of the inferior meatus with the help of a rigid hopkins endoscope, 30 and 2.7 mm in diameter, was performed after infraction of the inferior concha. if the probe was placed submucously, a focused incision of the mucous membrane was made, and the end of the probe was released in the inferior nasal meatus. for intubations, bicanalicular and monocanalicular silicone sets were used (ella - cs, m. horkov 504, 500 06 hradec krlov, czech republic, phone + 420 495 279 111, www.ellacs.cz). after probing the lacrimal system through the inferior canaliculus with a metal probe in the bicanalicular set, a titanium sling was then put on the tip of the probe into the inferior meatus under endoscopic control, and the metal probe was pulled out of the nose by pulling the handle of the sling and pressing down on the ocular end of the probe. after introducing the other probe of an intubation set into the lacrimal pathways through the upper lacrimal punctum, the probe was also pulled out of the inferior nasal meatus in the same way. the whole procedure was completed by knotting both tubes and placing the knot into the inferior nasal meatus. for the monocanalicular intubation setting, the silicone tube (with the ocular anchor and flange) atraumatically connected with the metal rod was inserted through the lower canaliculus in a similar way (fig. 1). the nasal end of the metal rod was then pulled into the nose and the ocular end of the tubing was fixed in the punctual ampulla and secured with a punctual anchor, while the tube was gently tracted on the distal (nasal) end. after punctual footplate placement, the distal end of the tubing was cut and left to dangle freely in the inferior nasal meatus. 1monocanalicular intubation set (ella - cs, czech republic) in detail monocanalicular intubation set (ella - cs, czech republic) in detail when removing the bci while the patient was under local anaesthesia, the silicone tube was removed after the knot had been drawn up through the lacrimal pathways into the conjuctival sac. the mci was removed by pulling it out with forceps at the lacrimal punctum while the patient was under local anaesthesia. the aim of this prospective study was to compare the success rate of mci and bci silicone intubations in the treatment of children with cnldo. the study was performed in accordance with the declaration of helsinki, good clinical practice, and applicable regulatory requirements. informed written consent was obtained from all parents / guardians before the initiation of any procedure. children aged between 12 and 36 months with severe cnldo symptoms resistant to conservative therapy and two probings were included in the study. the diagnosis of cnldo was based on a history of tearing, the fluorescein dye disappearance test (fdt), and diagnostic probing and/or irrigation tests. the study was carried out from january 2006 to november 2009, and a total of 70 eyes (in 53 children) were included. children younger than 10 months of age were excluded because of known self - resolution during maturation of the nasolacrimal duct. patients with previous eyelid and/or lacrimal surgery, punctal and/or canalicular obstructions, eyelid malpositioning, and less than 6 months follow - up were also excluded. the study started with 35 consecutive cases of bci (group i) followed by 35 consecutive cases of mci (group ii). the silicone tubes were removed 3 to 4 months after the surgery, and the children were followed up for 6 months. the drainage function of the lacrimal system was assessed using a combination of the fdt, medical history and clinical examinations (tear retention and conjunctival sac evaluation, medial canthus observation and/or palpation), as well as syringing of the system in some cases, as required. complete therapeutic success was defined as fdt grade 01, and this result had to correspond with a complete resolution of previous symptoms. failure was defined as the absence of improvement or the worsening of the symptoms. for the statistical analysis -test, fisher 's exact test, and the two - sample t - test were used, with the level of significance set at p < 0.05. after probing the lacrimal pathways with the help of a bowman probe, endoscopy of the inferior meatus with the help of a rigid hopkins endoscope, 30 and 2.7 mm in diameter, was performed after infraction of the inferior concha. if the probe was placed submucously, a focused incision of the mucous membrane was made, and the end of the probe was released in the inferior nasal meatus. for intubations, bicanalicular and monocanalicular silicone sets were used (ella - cs, m. horkov 504, 500 06 hradec krlov, czech republic, phone + 420 495 279 111, www.ellacs.cz). after probing the lacrimal system through the inferior canaliculus with a metal probe in the bicanalicular set, a titanium sling was then put on the tip of the probe into the inferior meatus under endoscopic control, and the metal probe was pulled out of the nose by pulling the handle of the sling and pressing down on the ocular end of the probe. after introducing the other probe of an intubation set into the lacrimal pathways through the upper lacrimal punctum, the probe was also pulled out of the inferior nasal meatus in the same way. the whole procedure was completed by knotting both tubes and placing the knot into the inferior nasal meatus. for the monocanalicular intubation setting, the silicone tube (with the ocular anchor and flange) atraumatically connected with the metal rod was inserted through the lower canaliculus in a similar way (fig. 1). the nasal end of the metal rod was then pulled into the nose and the ocular end of the tubing was fixed in the punctual ampulla and secured with a punctual anchor, while the tube was gently tracted on the distal (nasal) end. after punctual footplate placement, the distal end of the tubing was cut and left to dangle freely in the inferior nasal meatus. 1monocanalicular intubation set (ella - cs, czech republic) in detail monocanalicular intubation set (ella - cs, czech republic) in detail when removing the bci while the patient was under local anaesthesia, the silicone tube was removed after the knot had been drawn up through the lacrimal pathways into the conjuctival sac. the mci was removed by pulling it out with forceps at the lacrimal punctum while the patient was under local anaesthesia. bicanalicular intubation was performed in 35 eyes (24 children ; group i) and monocanalicular in 35 (29 children ; group ii). the youngest patient was 10 months of age and the oldest was 32 months of age (fig. 2). tubes were usually removed between 3 and 4 months after the surgery in an office setting (figs. 3, 4). 2monocanalicular intubation showing the position of the flange on the eyelid margin after tube fixationfig. 4monocanalicular intubation in cnldo ; success rate according to age monocanalicular intubation showing the position of the flange on the eyelid margin after tube fixation bicanalicular intubation in cnldo ; success rate according to age monocanalicular intubation in cnldo ; success rate according to age in group i, complete resolution of symptoms was observed in 29/35 cases (82.86%), partial resolution in 2/35 (5.71%), and failure in four cases (11.43%) (table 1). in group ii, the complete resolution of symptoms was observed in 31/35 eyes (88.57%), partial success in 3/35 eyes (8.57%), and failure in 1/35 eyes (2.86%). therefore, complete and partial success was achieved in 31/35 (88.57%) in group i and in 34/35 (97.14%) in group ii. the success rate (complete + partial success) in group ii (mci) was not significantly higher than that of group i (bci) (p = 0.584). table 1comparison of the bicanalicular and monocanalicular intubation resultsoutcomegroup i : bicanalicular intubation (35 cases)group ii : monocanalicular intubation (35 cases)complete resolution29 (82.86%)31 (88.57%)partial resolution2 (5.71%)3 (8.57%)failure4 (11.4%)1 (2.86%)total31/35 (88.57%)34/35 (97.14%) comparison of the bicanalicular and monocanalicular intubation results dislodging of the tube and premature removal was observed in four cases in group i (1, 2, 4, and 8 weeks after intubation respectively), whereas loss of the tube was observed twice (1 week after intubation in one case, and in one case the parents did not specify the time of the loss) in group ii (table 2). in children with premature tube removal, improvement of symptoms was observed in 3/4 eyes in group i (75.0%), and in 2/2 eyes in group ii (100.0%). table 2comparison of the complications observed with bicanalicular (bci) and monocanalicular intubation (mci)complications / numbergroup i bcigroup ii mcidisplacement and premature removal4-loss-2granuloma pyogenicum-2corneal abrasion / ulcer-1canalicular slitting5-inflammation of the lacrimal system-- comparison of the complications observed with bicanalicular (bci) and monocanalicular intubation (mci) slitting of the punctum and canaliculi were observed in five eyes with bci (group i) and none with mci (group ii). granuloma pyogenicum was found in two cases with mci and completely revealed during 2 months after tube removal without any specific treatment. corneal erosion in the inferior medial quadrant was observed in one eye treated with mci shortly after tube placement, and resolved within a few days after local treatment ; it was not necessary to remove the tube prematurely. dislodging of the tube and premature removal was observed in four cases in group i (1, 2, 4, and 8 weeks after intubation respectively), whereas loss of the tube was observed twice (1 week after intubation in one case, and in one case the parents did not specify the time of the loss) in group ii (table 2). in children with premature tube removal, improvement of symptoms was observed in 3/4 eyes in group i (75.0%), and in 2/2 eyes in group ii (100.0%). table 2comparison of the complications observed with bicanalicular (bci) and monocanalicular intubation (mci)complications / numbergroup i bcigroup ii mcidisplacement and premature removal4-loss-2granuloma pyogenicum-2corneal abrasion / ulcer-1canalicular slitting5-inflammation of the lacrimal system-- comparison of the complications observed with bicanalicular (bci) and monocanalicular intubation (mci) slitting of the punctum and canaliculi were observed in five eyes with bci (group i) and none with mci (group ii). granuloma pyogenicum was found in two cases with mci and completely revealed during 2 months after tube removal without any specific treatment. corneal erosion in the inferior medial quadrant was observed in one eye treated with mci shortly after tube placement, and resolved within a few days after local treatment ; it was not necessary to remove the tube prematurely. silicone intubation was first described by quickert and dryden in 1970 and the procedure has become part of the standard management of cnldo [2, 3, 6 ]. among the factors that affect the treatment success of cnldo are age, severity of symptoms, the history of previous interventions, time of the interventions, and compliance with treatment. however, there are no generally accepted and defined rules concerning age, length of intubation, and/or different variations in intubation systems [6, 11 ]. although tube placement in children requires general anesthesia, the normal anatomy of the lacrimal system is not destroyed, and the success rates range from 80% to 100% [13, 6, 12 ]. bci has been used more frequently, not only for treatment of cnldo, but also for dacryocystorhinostomy, canalicular stenose, etc. [2, 6 ]. one of the factors that may determine whether or not to use bci or mci is the number of complications [13, 6 ]. one of the main advantages of bci is that bci is generally very well - tolerated by the cornea because it is significantly smoother than mci [1, 7, 9 ]. if mci is used, corneal abrasions or ulcers can be caused by the ocular end of the mci. the abrasions usually occur in the inferior nasal quadrant (if the tube is fixed in the the inferior canaliculus), and usually heal in a few days after local treatment. observed only three (1.5%) corneal ulcers in 223 eyes with mci, whereas no corneal ulcers were observed in 1,620 bci placements. they assumed that the placement of the mci in the superior canaliculus is a predisposing factor for corneal irritation, especially if the size and length of the collarete is larger. on the other hand, engel. recommend performing mci through the superior canaliculus, and found only a 2% risk of conjunctival or corneal abrasions in their series of 635 eyes. in our study, in which monocanalicular tubes were inserted into the inferior canaliculus, corneal abrasion was observed in only one child (2.8%) a few days after the surgery. our experience confirms that it is necessary to use tubes of an appropriate size with a small flange (collar) that does not exceed the eyelid margin and does not irritate the cornea, so that corneal abrasion and ulceration is prevented. conversely, fayet. found the diameter of the collar to be unimportant and without influence on the rate of corneal erosions. mci offers a chance to achieve better success rates than simple probing, and requires only a single pass through the nasolacrimal system. the technical insertion of mci as well as its removal is easy, and the difficulties associated with bci are minimized [1, 4 ]. based on our 17 years of experience with lacrimal surgery, we agree that the manipulation in only one canaliculus may be advantageous because the risk of possible iatrogenic traumatisation of the lacrimal system is lower. unexpected side - effects should be taken into consideration, too. while we observed no granuloma pyogenicum in the bci group, we observed two granulomas in children who had mci. though these occurences resolved a few weeks after removal of the tube, they seem to be related to the ocular end of mci. fayet. recommended not leaving a mci in for longer than 3 months to decrease the likelihood of complications. while we usually removed mcis within 3 to 4 months after placing the tubes, the question of whether or not the number of complications would increase with longer mci placement is unclear. in our study, there were only two children with a longer (5 and 11 months respectively) tube placement (they did not return for removal of the tube until these times) ; however, no complications were observed in these two cases, and full success was achieved. in order to prevent damage to the punctum and fibrous meatal ring while inserting the mci, fayet, who developed the monoka system (fci, france), recommends only gentle traction on the distal end at the time of insertion and gentle dilation of the punctum [7, 9 ]. a special dilator for inserting the tube can help to avoid inadvertent damage to the puntal and canalicular systems. although we did not use this dilator, no difficulties during the time of tubing were observed. on the other hand, excessive dilation might increase the incidence of some complications, especially spontaneous loss of the tubing. this complication was observed in 35.4% in a study of 48 eyes with cnldo treated with mci reported by kaufman and guay - bhatia, where premature removal was observed in 21 of 48 eyes (43.7%). dislodgement of bci causing premature removal was observed in four eyes, whereas premature loss of the monocanalicular tube was observed twice. the success rates of bcis for the treatment of cnldo range from 83% to 100% [2, 6, 11, 12 ]. observed complete resolution of epiphora in 67.7% with monoka and 62.4% with bci in their study of 120 cases. in their study comparing mci and bci in 48 eyes of adults, kashkouli. achieved nearly the same complete success rate (mci 61.5%, bci 59.0%) ; moreover, higher partial success and lower failure rate was achieved than in the group with bci. in our study, we found no significant differences in the sucess rates between the bci (88.5%) and mci (97.1%) groups. on the other hand, in the study by kaufman. of 48 eyes with mci, full and partial success was achieved in only 30 cases (78.0%), and 21 cases of premature tube removal occurred (43.7%). in the study by engel. of 635 children with probing and mci, the success rate was 97%, declining to 90% when surgery was performed in infants older than 24 months of age. that, for those patients with cnldo requiring general anesthesia, mci may reduce recurrence and reoperations, and is an appropriate alternative in the treatment of cnldo. our results raise the question of whether or not it would be better to prefer mci over bci in the treatment of cnldo. although our study supports a preference for mci, further prospective, randomised studies would better determine the advantages and disadvantages of the two intubation methods. mci is very effective in the treatment of cnldo, and is an appropriate alternative procedure with a minimum of complications. the success rates of mci and bci were not significantly different. the use of monocanalicular intubation is easier to perform ; thus, it is a useful method for the treatment of cnldo resistant to conservative therapy and probing.	backgroundto compare the success rate of monocanalicular intubation (mci) compared with bicanalicular silicone intubation (bci) in congenital nasolacrimal duct obstruction (cnldo) in infants and toddlers.methodsin a prospective, nonrandomized, comparative study, mci (n = 35 eyes) through the inferior canaliculus or bci (n = 35 eyes) were performed under general anaesthesia in children aged 10 to 36 months with cnldo. the tubes were removed 34 months after tube placement, and the children were followed up for 6 months after the removal of tubes. therapeutic success was defined as the fluorescein dye disappearance test grade 01, corresponding with a complete resolution of previous symptoms. partial success was defined as improvement with some residual symptoms.resultscomplete and partial improvement was achieved in 31/35 (88.57%) in the bci group and 34/35 (97.14%) in the mci group. the difference between the two groups was not significant (p = 0.584). complications occurred in both groups. dislodgement of the tube and premature removal was observed in four bci cases, and loss of the tube was observed twice in the mci group. canalicular slitting was observed in five eyes in the bci group. granuloma pyogenicum observed in 2 cases with mci revealed a few weeks after the tube removal. corneal erosion in the inferior medial quadrant was observed in one mci eye and revealed in a few days after the local treatment without tube removal.conclusionsboth mci and the bci are effective methods for treating cnldo. mci has the advantage of a lower incidence of canalicular slit and easy placement.electronic supplementary materialthe online version of this article (doi:10.1007/s00417 - 011 - 1700 - 2) contains supplementary material, which is available to authorized users.
it is the most common surgical operation throughout the world, and is one of the most common rituals in jewish and islamic cultures. most circumcisions are performed for religious reasons as in islamic countries and few are performed for medical reasons. although circumcision is considered to be a technically simple and safe surgical procedure, it can occasionally lead to serious complications such as partial or total penile amputation. glans penis amputation is an extremely rare condition and its reconstruction is a challenge for surgeons. amputation has resulted from incidents such as during circumcision, strangulation by hair coil, self- or non - self - mutilation, surgical resection for malignancy, and iatrogenic ischemia during hypospadias repair owing to vigorous dissection or tight bandaging. immediate reconstruction at the time of amputation can be done by reattachment or replantation. the first successful microsurgical replantation of an amputated penis was reported in 1977 by cohen and colleagues. some authors reported proximal lengthening by use of gracilis muscle and scrotal and suprapubic flaps to cover the advanced penis. others have reported distal lengthening by use of a rectus abdominis inferiorly based island fascial flap covered by a skin graft or a scrotal flap in two stages followed by depilation and a radial forearm free flap by use of a microvascular technique. in this study, we describe a novel technique for reconfiguration of the glans penis by use of a buccal mucosal graft to cover the distal part of the penis to improve appearance and function in a patient who suffered from an amputated glans during circumcision. a 2-year - old infant presented to our urology clinic at mayo hospital in hodiedah, yemen, with a lost glans penis that had occurred 1 year previously (fig. the parents complained that their infant could not pass urine freely and that the penis was disfigured. examination of the penis revealed an outstretched length, normal consistency, and no palpable fibrous plaques. the skin of the shaft was normal in appearance, but the tip showed scar tissue and a stenosed external urethral meatus. the parents requested improvement of the cosmetic appearance of the glans and relief of the urinary flow obstruction. the procedure was discussed with the parents and written informed consent was obtained before surgery. with the infant under general anesthesia, a tourniquet was applied around the base of the penis. a circumferential incision was made at the distal end of the remaining penis around the urethral meatus. the urethral meatus was freed from the scar tissue at the tip of the penis. the urethra was dissected for a distance of about 5 mm to free the end of the urethra and was stented with a silicon 8-fr foley catheter. next the oral cavity was opened, and the cheek and lower lip were exposed. the opening of the stensen duct was identified and protected. a buccal mucosal segment (5 mm 15 mm) was marked on each side that extended from the interior of the cheek to the inner aspect of the lower lip. the submucosa was elevated by injection of saline and was then incised and dissected on both sides. the graft was defatted and fenestrated like a mesh to move easily in different directions during its application to the distal part of the remaining penis and to prevent hematoma formation behind the graft (fig. the graft was anastomosed with the urethral mucosa and penile skin by use of vicryl 6/0 interrupted sutures. follow - up demonstrated healthy - appearing buccal mucosa that appropriately simulated the glans penis. 3b) and 6 months. follow - up revealed success of the surgery and the infant 's parents were satisfied. circumcision is the most common surgical procedure in our community. however, because circumcisions are also commonly performed by experienced individuals at home and in hospitals, complications are reported. we believe that major complications can be prevented when circumcisions are performed by people other than authorized health workers. we also suspect that antiseptic rules are easily broken during communal circumcisions. as a result, the risk of wound infection and transmission of hepatitis b virus infection might increase in these communities. we think that educating communities about the risks of this matter is important and would be more effective than legislation. reported serious complications such as partial or total glandular amputation, urethral injury, glandular necrosis, and preputio - glandular fusion. amputation has also resulted as a complication of hypospadias repair and bladder exstrophy repair. during circumcision, glans injury is mostly due to trapping in the circumcision clamp, which usually results in partial or total amputation of the glans penis. this type of trauma is really uncommon, but may be relatively common in our residential area owing to the large number of circumcisions being done by nonprofessional doctors or paramedicals. pippi salle. reported the possible mechanism of amputation during circumcision in 6 cases. they suggested that the amputation is likely due to incomplete release of the physiological balano - preputial adhesions around the frenulum, which would produce traction of the ventral aspect of the glans when the foreskin is pulled in order to secure the clamp. therefore, they proposed that glans amputations during circumcision may be prevented by careful and complete release of the inner perpetual mucosa from the glans before the placement of the clamp. in our report, total loss of the glans occurred during clamp - assisted circumcision. this boy was neglected at the time of injury, although immediate reattachment or replantation can be successful because the glans tissue is well vascularized. the complications of hypospadias repair resulting from a neglected postoperative tight bandage have been well described in several reviews. loss of the glans can lead to significant long - term psychological and sexual morbidity. the purpose of treatment is to create a cosmetically and functionally acceptable penile shaft and glans. when the amputation is at the penile shaft, microvascular replantation has proven to be superior to other methods. at this level, two arteries and a venous anastomosis can be carried out, which leads to an adequate vascular supply to the distal replant. ince and gundeslioglu reported that for distal penis amputations in which the repair can not be achieved by replantation, burying the penis underneath the inguinal area may be an alternative salvage operation to replantation. a buccal mucosa graft has several advantages over other grafts ; hence, it has become the graft of choice in hypospadias repair. the process of harvesting is simple and does not create a visible donor site scar. the boy had a loss of the coronal sulcus after reimplantation owing to extensive scarring. the toronto group advised using buccal mucosa grafting in similar situations such as after severe epithelial denudation associated with balano - preputial scarring. we believe that a buccal mucosal graft is a good option for reconfiguration of the glans penis when penile length is acceptable. it is an easy and safe procedure that provides acceptable cosmetic results with a good urinary flow with an orthotopic urethral opening, normal erectile function, and normal urinary flow.	penile amputation is a rare catastrophe and a serious complication of circumcision. reconstruction of the glans penis may be indicated following amputation. our report discusses a novel technique for reconfiguration of an amputated glans penis 1 year after a complicated circumcision. a 2-year - old male infant presented to us with glans penis amputation that had occurred during circumcision 1 year previously. the parents complained of severe meatal stenosis with disfigurement of the penis. penis length was 3 cm. complete penile degloving was performed. the distal part of the remaining penis was prepared by removing fibrous tissue. a buccal mucosal graft was applied to the distal part of the penis associated with meatotomy. the use of a buccal mucosal graft is a successful and simple procedure with acceptable cosmetic and functional results for late reconfiguration of the glans penis after amputation when penile size is suitable.
they have significant effect on the synthesis, mobilization, and metabolism of lipids and lipoproteins. dyslipidemia is a common metabolic abnormality in patients with thyroid disease, in either the overt or the subclinical forms of the disease. it has been known that overt hypothyroidism is associated with premature coronary heart disease and one of the components of this assumed to be a deteriorated metabolism of atherogenic lipoproteins. lipoprotein(a) (lp(a)) is a very large protein molecule wrapped around, and linked by a disulphide bond to, a ldl - like particle. there is a strong relationship with lp(a) and coronary heart disease, independent of the standard vascular risk factors. autoimmune thyroiditis (hashimoto thyroiditis) is a very common disorder and it is the main reason for hypothyroidism. there are considerable sufficient data between the overt hypothyroidism, dyslipidemia, and coronary heart disease, although there are conflicting reports on whether subclinical hypothyroidism or euthyroid autoimmune thyroid disease has any influence on the lipoprotein metabolism. recently it was reported that thyroid autoimmunity may be an important mechanism for the occurrence of atherosclerosis and it is well known that lp(a) is one of the main risk factors for the atherosclerosis. the aim of this study was to investigate the relationship of lipid parameters, lp(a) levels, and thyroid hormones in hashimoto thyroiditis patients. one hundred and fifty - four premenopausal female hashimoto patients with a mean age of 37.19 7.98 sd years, followed up and treated in our outpatient clinic between july 2013 and october 2013, were enrolled in this study. forty - eight patients had overt hypothyroidism (age : 35.79 7.29 sd years), fifty patients had subclinical hypothyroidism (age : 36.8 8.19 sd years), and fifty - six patients were euthyroid (36.3 8.11 sd years). the control group consisted of 50 healthy volunteers with a mean age of 35.42 7.64 sd years. the diagnosis of overt hypothyroidism (oh) was based on clinical findings, low serum free thyroxine (ft4) levels, and high serum thyroid stimulating hormone (tsh) concentrations. subclinical hypothyroidism (sh) was established in terms of tsh levels 4.2 miu / ml and normal ft4 levels. euthyroid hashimoto (eh) was established as normal ft4 and tsh levels with only positive thyroid autoantibodies. patients and controls with diabetes mellitus, current and ex - smokers, obesity (body mass index (bmi) > 30 kg / m), liver disease and systemic illness, excessive alcohol consumption, and a known family history of primary hyperlipidemia were excluded from the study. none of the subjects were receiving treatment with estroprogestin therapy, diuretics, blockers or lipid lowering drugs, or other medications that might alter serum lipid parameters and thyroid functions. none of the patients were receiving thyroid treatment and lipid level determinations were done on initial presentation, before the treatment. the simple index to determine insulin resistance [i.e., homeostasis model assessment (homa - r) > or = 2.5 ] was used, and subjects who were determined to be positive for insulin resistance according to this index were also excluded. the study was approved by local ethical committee. written informed consent was obtained from all the subjects. chemiluminescence immunoassay was done to assess tsh (normal 0.4 to 4.2 miu / ml), free thyroxine (normal : 0.93 and 1.7 ng / dl), free triiodotironin (normal : 2.54.3 ng / ml), and serum autoantibodies against thyroglobulin (tgab) (normal : 0115 iu / ml) and thyroid peroxidase (tpoab) (normal : 034 iu / ml eclia (modular analytics e170 ; roche diagnostics)). the measurements of total cholesterol (total - c) (normal : 130200 mg / dl), high density lipoprotein (hdl - c) (normal : > 50 mg / dl), low density lipoprotein (ldl - c) (normal : 70130 mg / dl), and triglyceride (tg) (normal : 60150 mg / dl) levels were determined by enzymatic methods. lipoprotein(a) (normal 030 mg / dl) was measured in turbidimetric method by spectrophotometry (crony, jooly 100). continuous data were expressed as the mean sd and median and interquartile ranges, when appropriate. one - way anova, mann - whitney u, and kruskal wallis tests were used to compare the parametric and nonparametric data of the groups. the demographic data and the laboratory results of the entire study group are summarized in table 1.. however bmi was found higher in oh group than eh and controls as expected. tsh levels were higher in oh group than the other groups (p 30 mg / dl, was more frequent in oh group compared to other groups. moreover the interesting point in this study, lp(a) excess, was also more frequent in sc and even eh than the control group. according to this finding, we may speculate that autoimmunity may have an influence on the lp(a) metabolism, even with the normal tsh levels. in conclusion, this study shows that, in hashimoto thyroiditis even in normal tsh values, dyslipidemia may occur and increased total - c, tg, ldl - c, and lp(a) excess may occur, which are the potential risk factors for atherosclerosis, considering the fact that these patients should be closely followed up in terms of cardiovascular events.	objective. the risk of atherosclerotic heart disease is increased in autoimmune thyroiditis, although the reason is not clear. lipoprotein(a) (lp(a)) excess has been identified as a powerful predictor of premature atherosclerotic vascular diseases. the aim of this study is to investigate the relationship between lp(a) levels and thyroid hormones in hashimoto patients. method. 154 premenopausal female hashimoto patients (48 patients with overthypothyroid (oh), 50 patients with subclinical hypothyroid (sh), and 56 patients with euthyroid hashimoto to (eh)) were enrolled in this study. the control group consists of 50 age matched volunteers. in every group, thyroid function tests and lipid parameters with lp(a) were measured. lp(a) excess was defined as lp(a) > 30 mg / dl. results. total - c, ldl - c, tg, and lp(a) levels were increased in hashimoto group. total - c, ldl - c, and tg levels were higher in sh group than in the control group. total - c and ldl - c levels were also higher in eh group compared to controls. lp(a) levels were similar in sh and eh groups with controls. however, excess lp(a) was more common in subclinical hypothyroid and euthyroid hashimoto group than in the control group. conclusion. the total - c and ldl - c levels and excess lp(a) were higher even in euthyroid hashimoto patients. thyroid autoimmunity may have some effect on lp(a) and lipid metabolism.
parathyroid carcinoma is the least common endocrine malignancy, and accounted for only 0.005% of cases reported to the national cancer database (ncdb) between 1985 and 1995. roughly half of cases are diagnosed between ages 45 and 60 years, but the tumor arises over a wide age range. in the ncdb case series, overall 5- and 10-year survival rates were 85.5 and 49.5%, respectively. most patients (> 90%) present with symptoms of hyperparathyroidism, including severe hypercalcemia, an elevated serum parathyroid hormone (pth) level, nephrolithiasis or nephrocalcinosis, osteopenia, gastrointestinal disturbances, depression, fatigue, or memory disturbance. despite this, parathyroid carcinoma remains a rare cause of primary hyperparathyroidism, accounting for only 0.52% of cases. in comparison, benign parathyroid adenomas account for approximately 85% of cases, with diffuse hyperplasia comprising the remainder. parathyroid carcinoma has been associated with hyperparathyroidism - jaw tumor (hpt - jt) syndrome, familial isolated primary hyperparathyroidism, and multiple endocrine neoplasia syndromes (men-1 and men-2a) ; patients with hpt - jt have a 15% prevalence of the tumor. the management of parathyroid carcinoma is primarily surgical, with en bloc resection of the tumor with involved adjacent structures being the recommended primary mode of therapy. indeed, at least one report indicates that survival is largely dependent on margin status of the primary resection. there has been a long debate in the literature about the effectiveness of adjuvant therapy, largely fueled by the paucity of cases. however, three recent reports suggest that adjuvant radiation therapy may reduce tumor recurrence after resection [35 ]. there is no systematic data to suggest a role for adjuvant chemotherapy. despite therapy, between one - third and three - quarters of patients have recurrence or metastasis of their tumors, causing recurrent hyperparathyroidism. re - resection is the accepted therapy for palliative control of hypercalcemia, but seems to become less effective with continued iterations. calcimimetic agents, such as cinacalcet, have recently been used with success in the cases of primary hyperparathyroidism, and may also play a role in palliative management of inoperable parathyroid carcinoma. despite this, most patients who die of disease do so as a result of complications of hypercalcemia. while functional parathyroid carcinoma is an uncommon tumor, non - functional parathyroid carcinoma is an exceedingly rare disease, with less than 20 reported cases in the last 80 years. as the name implies, patients with non - functional tumors have normal serum calcium and pth levels, and do not present with symptoms of hypercalcemia. they typically present with a neck mass, and patients who die of disease eventually succumb to systemic tumor burden. here we report a recent case of non - functional parathyroid carcinoma from our institution necessitating extensive surgery to obtain negative margins, review the past literature on this rare entity, and discuss recent and new advances in the diagnosis of both functional and non - functional parathyroid carcinomas. the patient is a 59-year - old white man who presented to his primary care physician in july 2008 with a chief complaint of dysphagia. his past medical history was notable for diabetes mellitus type ii, hypertension, and obstructive sleep apnea. he had previously undergone cervical spine surgery in 2002, and shoulder surgery at an unknown time. his family history was notable for a half - sister with a history of breast and gastric cancer, and an uncle with a history of an unknown head and neck cancer. he is married and works as a mechanic, rarely used alcohol, and had previously smoked cigarettes but quit in 1975. on review of systems, he endorsed dysphagia and hoarseness, but denied other symptoms. physical examination showed a 6-cm firm mass in the left neck. the mass extended anteriorly to the left sternocleidomastoid and inferiorly below the clavicle. computed tomography, performed at an outside hospital in july 2008, was interpreted as a 6-cm left thyroid mass. the patient was subsequently referred to barnes - jewish hospital for fine - needle aspiration of the mass, and evaluation by an otolaryngologist. under ultrasonographic guidance, a fine - needle aspiration of the presumed left thyroid lobe tumor was performed by radiology. a diagnosis of positive for thyroid carcinoma was returned at the end of july 2008, with a comment that the cytologic features raised the possibility of a poorly differentiated or insular variant of thyroid carcinoma ; the cytologic differential diagnosis at that time included follicular variant of papillary thyroid carcinoma (fig. 1). on the basis of findings, 1fine - needle aspirate smears of non - functional parathyroid carcinoma (600). a ethanol - fixed, papanicolaou stained preparation ; b air - dried, diff - quik stained preparation fine - needle aspirate smears of non - functional parathyroid carcinoma (600). a ethanol - fixed, papanicolaou stained preparation ; b air - dried, diff - quik stained preparation he was then examined by one of our head and neck surgeons, who was concerned that the physical and radiographic characteristics of the tumor seemed more aggressive than that seen in the types of thyroid carcinoma given in the cytologic differential diagnosis. indeed, magnetic resonance imaging of the mass, performed at barnes - jewish hospital in early august 2008, showed a large left cervical mass that displaced the trachea to the right, extended between the trachea and esophagus in the neck, and inferiorly into the superior mediastinum (fig. 2). of note, the serum calcium was 10.1 mg / dl (nl = 8.610.3 mg / dl), and a serum thyroid function panel, including thyroid - stimulating hormone, triiodothyronine, thyroxine, thyroglobulin, anti - thyroglobulin antibody, and calcitonin, was within normal limits. in light of these incongruous findings, the patient was scheduled for a needle biopsy of the tumor prior to further management.fig. 2pre - operative magnetic resonance imaging of non - functional parathyroid carcinoma. a t2-weighed transverse section, with carcinoma (arrowhead) displacing the trachea (single arrow) and compressing the esophagus (double arrow) ; b thrive sequence frontal section, with carcinoma extending across the midline and into the superior mediastinum pre - operative magnetic resonance imaging of non - functional parathyroid carcinoma. a t2-weighed transverse section, with carcinoma (arrowhead) displacing the trachea (single arrow) and compressing the esophagus (double arrow) ; b thrive sequence frontal section, with carcinoma extending across the midline and into the superior mediastinum as in the prior cytology specimen, the needle biopsy showed a poorly differentiated tumor with morphological and immunohistochemical features suggestive of neuroendocrine differentiation (fig. 3 ; see section pathologic summary). the diagnosis was initially reported as poorly differentiated carcinoma with neuroendocrine features ; the differential diagnosis included poorly differentiated / insular thyroid carcinoma, medullary carcinoma, parathyroid carcinoma, carcinoma with thymus - like elements, and neuroendocrine carcinoma. the common types of thyroid carcinoma (papillary and follicular), as well as anaplastic carcinoma, were ruled out. a subsequent immunostain for pth showed diffuse reactivity in tumor cells, and a diagnosis of parathyroid carcinoma was rendered. the patient had no symptoms of hyperparathyroidism, and a serum intact pth was 20 pg / ml (nl = 1472 pg / ml). he was scheduled for en bloc resection of a non - functional parathyroid carcinoma at the beginning of september 2008.fig. a c hematoxylin and eosin - stained sections at a low (20), b intermediate (100), and c high magnification (600), d f representative high - magnification images (600) of immunohistochemical stains for d cytokeratin ae1/ae3, e cd56, and f pth needle core biopsy of non - functional parathyroid carcinoma. c hematoxylin and eosin - stained sections at a low (20), b intermediate (100), and c high magnification (600), d f representative high - magnification images (600) of immunohistochemical stains for d cytokeratin ae1/ae3, e cd56, and f pth at operation, a large left cervical tumor was found, intimately involved with the left thyroid lobe. dissection of the anterior pretracheal tissues showed tumor adhesion to the anterior trachea ; frozen section analysis of this material was reported as rare atypical cells ; recommend additional tissue. dissection of the tumor proceeded posteriorly from this point to the tracheoesophageal groove, where it appeared to invade the trachea and esophagus. at that point, it was deemed impossible to completely resect the tumor without sacrificing these structures. eventually, the tumor was resected en bloc with the left thyroid lobe and isthmus, anterior cervical soft tissue, larynx, hypopharynx, superior esophagus, and first eight tracheal rings. a completion esophagectomy was performed, a gastric conduit was brought up to re - establish continuity, and a jejunostomy tube was placed for feeding. portions of the manubrium, left clavicle, and left first rib were also excised to create access for a mediastinal tracheostomy. post - operatively, the patient was extubated and taken to the cardiothoracic intensive care unit, where he had a relatively uncomplicated course. he was able to transfer to an observation unit on post - operative day 2, and eventually to the floor. after discharge, he was seen by our department of radiation oncology, and initiated adjuvant radiation therapy in mid - october 2008. this has been complicated by an episode of hemoptysis requiring inpatient observation about 1 month after initiating therapy. at the time of this report, the patient is approximately 7 months post - operative and has completed adjuvant radiotherapy. he tolerates oral intake and exercise, and has gained 5 pounds in the last few months. although a computed tomogram of the chest performed february 20, 2009 showed two ill - defined ground glass opacities in the right and left upper lung lobes, he has no definitive evidence of tumor recurrence. his next scheduled clinical follow - up is at 910 months post - operative. 1) were cellular and composed of crowded groups of tumor cells in a clean background. at high magnification, individual tumor cells showed round to oval nuclei, granular chromatin with occasional small nucleoli, and scant cytoplasm. the groups appeared cohesive and showed striking uniformity of size and shape. the needle biopsy material (fig. 3) showed solid nests of tumor cells separated by a dense fibrotic stroma, with tumor cells accounting for about one - quarter of the tissue examined. as in the cytology preparation, individual tumor cells were fairly uniform, with round to oval hyperchromatic nuclei, granular chromatin with inconspicuous nucleoli, and a small amount of eosinophilic cytoplasm. they also showed weak or focal reactivity for the neuroendocrine markers synaptophysin, chromogranin a, and cd56. stains for thyroglobulin, thyroid transcription factor-1, calcitonin, carcinoembryonic antigen, cd45/leukocyte common antigen, and cd5 were uniformly non - reactive. as previously mentioned, a subsequent send - out immunostain (gen - path ; cell marque pth antibody clone mrq-29, prediluted ; antigen retrieval with ventana standard cc1 solution at 37c for 32 min) showed diffuse and moderately strong staining for pth, leading to the diagnosis of parathyroid carcinoma. at operation, we received a composite en bloc resection of tumor and left thyroid lobe, larynx, superior trachea, hypopharynx, and superior esophagus (figs. 4 and 5). the tumor and thyroid lobe was measured as 9.5 6.5 6.5 cm. gross sections of the specimen showed extension of a tongue of tumor into the tracheoesophageal groove, as suggested by pre - operative imaging (fig. 2) and operative findings. microscopic sections of the tumor again showed large solid nests of tumor cells separated by broad bands of dense fibrosis. at high magnification, tumor cells showed a crowded architecture, with focal areas of individual tumor cell necrosis. nests of tumor extensively involved the thyroid gland and anterior cervical soft tissues, with extensive lymphvascular space invasion. in addition, tumor cells extended through the membranous posterior trachea and approached the tracheal submucosal glands. areas of the anterior trachea, near the area sampled by frozen section, also showed involvement by tumor. although tumor approached the inked resection margins of the anterior cervical soft tissues, no tumor was seen at ink, and the sampled resection margins were free of tumor. a biopsy of the left recurrent laryngeal nerve submitted for frozen section analysis showed rare atypical cells, suspicious for carcinoma, only on the permanent sections. the separately received inferior esophagus and bones removed for tracheostomy access were free of tumor.fig. a anterior view of inked and sectioned gross specimen, with tumor in relation to contiguous structures ; b low - magnification image of tumor (20) ; c low - magnification image of tumor invading left thyroid lobe (20) ; d high - magnification image of tumor (600)fig. 5en bloc resection of non - functional parathyroid carcinoma. a transverse section of gross specimen, with tumor invading tracheoesophageal groove ; b low - magnification image of tumor (arrow) invading membranous posterior trachea (20) ; c low - magnification image of tumor (double arrow) invading lymphvascular space of anterior trachea (20) ; d high - magnification image of tumor deposit from previous panel (400) en bloc resection of non - functional parathyroid carcinoma. a anterior view of inked and sectioned gross specimen, with tumor in relation to contiguous structures ; b low - magnification image of tumor (20) ; c low - magnification image of tumor invading left thyroid lobe (20) ; d high - magnification image of tumor (600) en bloc resection of non - functional parathyroid carcinoma. a transverse section of gross specimen, with tumor invading tracheoesophageal groove ; b low - magnification image of tumor (arrow) invading membranous posterior trachea (20) ; c low - magnification image of tumor (double arrow) invading lymphvascular space of anterior trachea (20) ; d high - magnification image of tumor deposit from previous panel (400) table 1 lists the 19 cases of non - functional parathyroid carcinoma reported in the literature since 1929, including the present case [826 ]. one case previously considered a non - functional carcinoma is in fact a non - functional recurrence of a primary functional parathyroid carcinoma and so is not considered here. to summarize, most patients presented in the sixth or seventh decade with a neck mass, with an age range of 27 to 71 years. all patients were considered normocalcemic at the time of diagnosis, and had normal serum levels of pth in cases where this was measured. tumor size was variable, but almost half of the cases had tumors between 5 and 11 cm in size ; in comparison, the ncdb case series reported a median tumor size of 3.3 cm. the primary spread of tumor was locoregional invasion into the thyroid gland, cervical soft tissues, or superior mediastinum. slightly over half of patients had recurrence of their tumors by the time of case report. sixteen of 19 patients were alive at the time of case report, although most cases reported a relatively short follow - up period ; only three of the cases have data beyond 5 years from the date of initial therapy.table 1reported cases of non - functional parathyroid carcinomareferenceage / sexclinical presentationpre - operative dxserum ca (mg / dl)serum pth (nl)tumor size (cm)ln involvementcurrent study 59/mdysphagia, hoarseness, neck massyes (ihc)10.1 (nl 8.6 - 10.3)20 pg / ml (14 - 72)9.5x6.5 x6.5nofernandez - ranvier. 67/fmultinodular goiterno (mng)9.119 ng / dl (12 - 65)4.5x2 xo.8nokirkby - bott. 39/mneck mass, hoarseness, nephrolithiasisyes (parathyroid scan)9.20.4 ng / nl (0.3 - 2.9)7.5x5.5 x5?collins. 59/mneck mass, vcp, dysphagia, axillary lnno (adenoma w / high ml)normalnormal8x6x4yesyamashita. [1618]27/mneck massno (cystic thyroid mass)9.2 - 9.8?5.5?49/mneck massno????59/mneck massno (follicular thyroid ca)9.5?2.5yeschahinian. 69/fneck mass, pleural effusionnonormalnormal2x2, 14?dhom and hohbach 38/mneck massno (thyroid nodule)normal?2.5x1.5?altenahr and saeger 50/mneck massno (thyroid tumor)normal??yespachter and lattes 50/fchest painnonormal?diffuseyessieracki and horn 43/fneck mass, pain, dysphagk vcpno9.1?5x4?mcquillan 53/fneck massnonormal?golf ball?armstrong 71/fneck massno (hodgkin lymphoma)11.9?11x11 x4?guy 29/fneck mass, dysphagia, painno (thyroid adenoma)8?8x6x4yesreferencevascular invasionclear marginslocal invasionlocal recurrencedistant metastasistreatment (initial s)survivalcurrent studyyesyesyes (thyroid, trachea, hypopharynx)nonos + r (en bloc resection)alive at 7 monthsfernandez - ranvier. yes?yes (thyroid)yes (neck, mediastinum)yes (lung)s + r (total thyroidectomy)alive at 2 years and 7 monthskirkby - bott. ? ? yesyes (neck)yes (bone, lung)s + r (neck exploration, incomplete exc)dead at 8 years and 2 monthsyamashita. no?yes (thyroid)nonos + r (mass + thyroid lobe)alive at 10 monthsklink. yesnoyes (mediastinum)yes (incomplete resection)nos + r + c (incomplete resection)alive at 11 monthsmerlano. ? ? yes (mediastinum)yes (mediastinum)yes (axillary ln, liver, supraclavicular ln)pre - operative r + s + r (biopsies)alive at 4 yearsyamashita. ? ? yes (thyroid)nonos + r (completion l thyroid lobectomy)alive at 20 monthshickey. [1618]??yesyesyes (axillary ln, lung, brain)s + r + c (simple excision)dead at 2 years and 4 months??yes (neck, mediastinum)yes (mediastinum)yes (lung, bone)calive at 9 months??yesyes (mediastinum)yes (lung, bone, ln)s + c (total thyroidectomy, l radical neck dissection)dead at 1 years and 8 monthschahinian. ? ? yes (neck, mediastinum)yes (neck, mediastinum)yes (lung)s + calive at 8 yearsdhom and hohbach yes?yes (thyroid)??s (radical thyroidectomy)?altenhr and saeger ? ? yes (thyroid)yes (neck)yes (cervical ln)s + r (l thyroid lobectomy)alive at 7 yearspachter and lattes no?yes (mediastinum)yes (incomplete resection)yes (ln, skin)s (partial excision)alive at 5 yearssieracki and horn yes?yes (neck, thyroid)suspicious (pericardium)suspicious (paratracheal ln)s + r (subtotal resection)alive at 3 yearsmcquillan ? ? yes (thyroid)yes (neck)nos + r (r thyroid lobectomy)alive at 2 years and 4 monthsarmstrong ? ? yes (neck, mediastinum)nonos (en bloc resection)alive at 2 monthsguy ? ? yes (neck)yes (neck)yes (lung)s + r (simple excision)alive at 2 years and 4 monthsan entry of ? indicates that the information was not provided in the original case reportihc immunohistochemistry, mng multinodular goiter, vcp vocal cord paralysis, mi mitotic index, ca carcinoma, s surgery, r radiation therapy, c chemotherapy reported cases of non - functional parathyroid carcinoma an entry of ? indicates that the information was not provided in the original case report ihc immunohistochemistry, mng multinodular goiter, vcp vocal cord paralysis, mi mitotic index, ca carcinoma, s surgery, r radiation therapy, c chemotherapy more striking than the data presented in the above cases, however, is the data not reported. as noted in the section introduction, the recommended mode of therapy for parathyroid carcinoma (both functional and non - functional) is en bloc resection of tumor with involved adjacent structures, and that overall survival directly correlates with the margin status of the initial resection. indeed, our present case report is the first non - functional parathyroid carcinoma to report negative margins after en bloc resection. although most case reports do not comment on final margin status, we believe it is likely that many of these cases may have had tumor at or closely approaching the resection margins. this assumption is based on the fact that only 4 of the 19 patients received an en bloc or radical procedure as initial therapy. however, as listed in table 1, only 2 of the 19 patients had a pre - operative diagnosis of parathyroid carcinoma ; many more carried diagnoses that would not have indicated an extensive resection. if not definitely the case, it is likely that this diagnostic uncertainty also contributed to the surgical management of these patients. to summarize, non - functional parathyroid carcinoma is a rare endocrine malignancy that presents with mass symptoms. due to the paucity of cases and often limited clinical follow - up, it is difficult to compare survival to patients with functional parathyroid carcinoma. non - functional parathyroid carcinoma is larger at presentation, appears to be best managed surgically, is often incompletely excised, and shows frequent locoregional recurrence and metastasis. it is likely that improvements in the accuracy of diagnosis will improve the management and outcomes for patients with both functional and non - functional carcinomas. clinically, a patient with primary hyperparathyroidism is most likely to have a parathyroid adenoma. clues that the patient may have parathyroid carcinoma include a markedly elevated serum calcium (> 14 mg / dl) or pth (> 5 the upper limit of normal), a palpable neck mass, or hoarseness (indicating involvement of the recurrent laryngeal nerve). intraoperatively, a firm grey - white gland with adherence to, or invasion of, adjacent structures is suggestive of malignancy. much like other endocrine malignancies, the gold standard for diagnosis of carcinoma is distant metastasis. the histological criteria for the diagnosis of parathyroid carcinoma were published by schantz and castleman in 1973, and are still valid today. they include : sheets or lobules of tumor cells separated by dense fibrous bands, mitotic figures, necrosis, capsular invasion, or vascular invasion. all of these features are seen in the present case. however, over 80% of parathyroid carcinomas are well - differentiated tumors, and some of these histologic features can be seen in atypical parathyroid adenomas. are there any other criteria to distinguish benign adenomas from their malignant counterparts ? recent data have suggested that molecular testing may be useful in the cases of parathyroid tumors with equivocal histologic features. the first step in this process was the identification of hrpt2, located on chromosome 1q, as the gene mutated in hpt - jt. germline mutations were found in patients with hpt - jt, and sporadic mutations were also discovered in non - hpt - jt - associated parathyroid carcinomas. additional studies also showed hrpt2 mutations in hpt - jt parathyroid adenomas and carcinomas, and sporadic carcinomas, suggesting that the gene may act as a tumor suppressor, and that its loss may be an initiating event in carcinogenesis [32, 33 ]. expression of the gene product, termed parafibromin, has also been investigated in parathyroid neoplasia. two studies suggest that sporadic adenomas show expression of parafibromin by immunohistochemistry, whereas most sporadic carcinomas and all hpt - jt - associated parathyroid tumors display loss of expression, in parallel with the gene mutation studies [34, 35 ]. the exact mechanism of carcinogenesis induced by the loss of parafibromin remains to be elucidated. recent data suggest that the protein associates with rna polymerase, regulates genes involved in cell growth and survival, acts as a cell cycle regulator, and plays a role in transducing transcriptional output from the wnt pathway [3640 ]. in addition to hrpt2, data also show that parathyroid carcinomas lose a greater proportion of tumor suppressor alleles as compared to benign causes of primary hyperparathyroidism, indicating genomic instability. testing for loss of these markers may supplement hrpt2/parafibromin analysis for diagnosis of borderline parathyroid neoplasms. the status of hrpt2/parafibromin in non - functional parathyroid carcinomas has not been investigated. parathyroid carcinoma is a rare cause of primary hyperparathyroidism, and < 20 cases of it have been reported in the literature. in this study, we have reported the first case of non - functional parathyroid carcinoma with negative surgical margins after en bloc resection. diagnosis of parathyroid carcinoma, whether functional or non - functional, is based on a number of clinical and histological criteria but can be challenging to differentiate from benign adenoma in many cases. in addition to traditional criteria, new advances in molecular diagnosis, including evaluation of hrpt2/parafibromin, may aid in improving diagnostic accuracy.	parathyroid carcinoma is a rare malignancy, and only accounts for 0.52% of cases of primary hyperparathyroidism. less than 10% of parathyroid carcinomas are non - functional, and as such, they have been rarely reported in the literature. importantly, margin status at resection is related to prognosis, and only a handful of case reports of non - functional carcinoma note this important parameter. here we report the first case of non - functional parathyroid carcinoma with negative margins, and review the literature on this rare entity. whether functional or non - functional, parathyroid carcinoma can often be difficult to differentiate from benign parathyroid adenoma. while diagnosis has been based on clinical and histological criteria, recent data concerning the molecular underpinnings of parathyroid carcinoma may allow for improved accuracy in distinguishing benign and malignant parathyroid tumors.
furthermore, these molecules are involved in modulation of adhesion processes at the endothelium and thus promote the transendothelial migration of leukocytes (haptotaxis). in addition, some chemokines stimulate angiogenesis or angiostasis and thus may play a further role in the suppression of tumor growth or the establishment of an inflammatory response. traditionally, chemokines and chemokine receptors have been classified into four families (cxc, cc, c and cx3c). several years ago, a new nomenclature was introduced in which each ligand and each receptor is identified as a member of a sub - family and carries a special number. for example, a chemokine designated ccl5 is a member of the cc sub - family with the number 5. this special chemokine was formerly known as rantes. despite their essential importance for the immune system chemokines and chemokine receptors these include autoimmune diseases, cancer, lung, and vascular diseases as well as transplant rejection [7 - 10 ]. in addition, the human immunodeficiency virus (hiv) uses different chemokine receptors as co - receptors for entry into the cell. they activate specific inflammatory cells such as monocytes or t lymphocytes and recruit them to the site of inflammation. these cc chemokines bind to specific g protein - coupled receptors, thereby initiating activation and migration of cells. the cc chemokines ccl3 (mip-1), ccl4 (mip-1), ccl5 (rantes), and ccl3l1 are the natural ligands of the cc - chemokine receptor ccr5 (ccckr5, chemr13 or cmkbr5). the coding sequence for this receptor is located at position 21 on the short arm of chromosome 3 and has a coding sequence of 1056 base pairs, which is translated into a protein of 352 amino acid length. based on their cytokine profile cd4-positive t - cells can be divided into different subclasses : th1 cells (t helper cells type 1) secrete il-2, ifn- and lymphotoxin, whereas th2 cells produce il-4, il-5, il-6, il-9, il-10, and il-13. th1 cells primarily control the cellular immune response and appear to be involved in chronic inflammatory processes. th2 cells support the formation of specific antibodies by increasing the b - cell proliferation and their differentiation into plasma cells and play an important role in the development of allergic reactions due to the promotion of ige production. interestingly, the expression of specific chemokine receptors is closely associated with the differentiation and activation of specific inflammatory cells. thus, the ccr5 receptor is expressed on th1 lymphocytes but not on th2 lymphocytes, which primarily express ccr3, and ccr8 and ccr4. beyond th1 cells, ccr5 has also been detected on monocytes, memory t cells (cd45ro), stem cells, dendritic cells, microglia, and on a main group of cytotoxic cd8 (+) t lymphocytes. infiltration of mononuclear inflammatory cells is a central feature of hepatitis c virus (hcv) infection. here, many of the liver - infiltrating cells express high levels of the ccr5 receptor. moreover, high levels of the chemokines ccl3, ccl4 and ccl5 can be found in the hcv - infected liver. in vitro data for instance, it could be shown that binding of the hcv e2 envelope protein to the tetraspanin cd81, which serves as a co - receptor for hcv, induces release of the ccr5 ligand ccl5 by cd8 (+) t cells. in addition, the hcv core and ns5a proteins have been demonstrated to affect ccl5 secretion by modulating ccl5 promoter activity. of note, ccr5 has been shown to promote hepatic fibrosis in mice and marked up - regulation of ccl5 and ccr5 has been found in patients with hepatic cirrhosis, confirming activation of the cc chemokine system in human fibrogenesis. in contrast to the infected liver significantly reduced numbers of ccr5-expressing lymphocytes can be found in the peripheral blood of hcv - infected patients. this may be due to hcv - induced intrahepatic chemokine secretion mediating the hepatic recruitment of ccr5-mediated hepatic (+) t - cell and thus reflect altered compartmentalization of ccr5(+) lymphocytes. a strong anti - viral type 1 immune response has been shown to be associated with a successful elimination of the virus, both during the acute phase of infection and an antiviral therapy [18 - 20 ]. this would suggest that accumulation of ccr5 (+) th1 cells in the hcv - infected liver contributes to an effective antiviral immune response. however, these relationships appear to be more complex. we recently showed that ccr5 (+) lymphocytes are characterized by a high expression of the inhibitory nk cell receptor nkg2a. therefore, these cells are very sensitive to nkg2a - mediated inhibition of cytotoxic function. as hepatitis c is associated with a high intrahepatic expression of the nkg2a ligand hla - e, intra - hepatic accumulation of ccr5(+)nkg2a(+) lymphocytes could interfere with an effective immune response. in addition, ccr5 (+) t cells may have a role in immune - mediated liver cell damage during chronic hepatitis c. the ccr5 gene is subject to various mutations, including a deletion of 32 base pairs. this mutation, called ccr532, leads to a shift in the reading frame, resulting in the formation of a truncated, non - functional protein, which is not expressed on the cell surface. in a caucasian population thus, it is believed that this mutation first occurred in northern europe not so long ago. individuals who are homozygous for the mutation and thus " genetically negative " for ccr5, develop normal and are healthy. therefore, it was originally presumed that the ccr5 receptor has no relevant importance to the immune system. in further studies, however, it could be shown that lack of ccr5 is associated with a significantly altered immune response in mice. for example, infection with cryptpcoccus neoformans is often fatal in ccr5-deficient mice, whereas wild - type mice survive. furthermore, experiments using ccr5 knockout demonstrated that lack of ccr5 is associated with an increased t - cell immune response in various infectious diseases [25 - 27 ]. even in non - infectious inflammatory reactions ccr5 recently, it has been reported that ccr5-deficient mice, in which a t cell - mediated autoimmune hepatitis had been induced, displayed a significantly greater liver damage in comparison to ccr5-positive mice. studies on the clinical relevance of ccr532 mutation in humans indicated that absence of the ccr5 receptor may, under certain circumstances, have either a positive or a negative effect. patients carrying a homozygous ccr532-genotype have a higher risk of death during infection with west nile virus. on the other hand, it is presumed that the absence of ccr5 confers some protection against infection with smallpox (or the plague), which is reflected by the relatively high prevalence of this mutation in central and northern europe. moreover, ccr5 has been suggested to play a role in transplant rejection [7 - 10,30 ]. for instance, a prospective, biopsy - controlled study suggested that the local expression of the ccr5-ligand rantes (ccl5) leads to the directional movement of activated ccr5 bearing t cells into the renal allograft thereby mediating acute rejection. reported patients homozygous for ccr532 to show longer survival of renal transplants than those with other genotypes. in contrast, bickerstaff and coworkers found rapid rejection of renal allografts in ccr5-/- mice with many histopathologic features observed during ahr of human renal allografts. with respect to hcv infection data regarding the importance of ccr532 mutation are conflicting. woitas. reported that patients with chronic hcv infection were significantly more likely to exhibit the homozygous ccr5-32/ccr5-32 genotype compared to a healthy control group. moreover, ccr532 homozygosity in this study was associated with significantly increased hcv viral loads and cd8 + t lymphocyte counts in the peripheral blood. thus, the results of this study would suggest that individuals with a ccr532/ccr532 genotype display an increased susceptibility to hcv infection., it has been speculated that increased ccr532-frequency may be a specific characteristic of haemophilic patients with chronic hepatitis c but without hiv infection - and rather reflects resistance to hiv-1 than increased susceptibility to hcv. however, a detailed statistical analysis showed that the high frequency of ccr532 in chronic hepatitis c reported by woitas. could not be explained by the hiv - mediated selection pressure alone. alternatively, the strategy of patient selection in the woitas study (haemophilia versus chronic liver disease) or the analysis of heterogeneous cohorts (stage and duration of infection, infecting hcv genotype, demographic factors) might explain these discrepant results. this was examined in two independent largely homogeneous cohorts of hcv - infected women with a known source of infection. in the late 70s these women were infected by anti - d immunoglobulin contaminated with hepatitis c virus (hcv) genotype 1b from a single erythrocyte donor administered for prophylaxis of rhesus isoimmunization throughout east germany and ireland, respectively. in contrast to the data published by woitas and co - workers the ccr532 mutation was associated with spontaneous elimination of the virus in the irish anti - d cohort. however, in the eastern german " anti - d cohort, " we found carriers of the ccr532 polymorphism to be significantly more likely to develop chronic infection than women with a homogeneous wild - type genotype (nattermann., aasld 2009). similar discrepant results have been published regarding a possible association between the ccr532 polymorphism and the degree of the hcv - associated hepatitis. data obtained in the irish " anti - d cohort " and in two other studies showed a less pronounced hepatic inflammation in carriers of the ccr532 mutation as compared to patients with a homozygous wild type. however, these results could not be confirmed in other publications [36 - 38 ]. in contrast to these controversial data, it is widely accepted that the ccr532 mutation does not affect response to standard combination therapy with pegylated interferon and ribavirin. although the ccr532 polymorphism was associated with a significantly poorer response to monotherapy with standard interferon, no study could confirm a similar effect for patients treated with pegylated interferon in combination with ribavirin. recently, dolan. published a very elgant and comprehensive study which might provide some explanations regarding the controversial data on the role of ccr5 in hepatitis c as this work shed light on the complexity of such associations. in this study different cohorts of hiv - positive and hiv - negative persons were analyzed with regard to polymorphisms in the ccr5 gene and the gene of the ccr5 ligand ccl3l1. ccr5 is an important co - receptor for hiv and earlier studies demonstrated that the ccr5d32 mutation blocks infection of cd4 lymphocytes. dolan. identified another mechanism by which ccr5 in association with its ligands affect the course of hiv infection. in this work the study subjects were classified into three genetic risk groups ' (grgs) based on variation in ccr5-ccl3l1 genotypes that are associated with risk of acquiring hiv infection and on hiv replication. interestingly the authors could show a direct association of these grks with the cell - mediated immune response. as a marker they determined the delayed - type immune response (type iv), which is a common ' readout ' of cellular immunity. this immune reaction is based on activation of th1 lymphocytes induced by a soluble antigen which in turn results in activation of macrophages. a typical example is the tuberculine test which induces an immune reaction of pre - sensitized t - lymphocytes after inoculation of tuberculine into the skin. dolan and co - workers showed an increased type - iv immune response in those grgs associated with a delayed disease progression. thus, the authors concluded that ccr5 and its ligands not only interfere with viral entry of hiv into the cell but also affect anti - viral responses via modulating cellular immunity. the complexity of these associations was further emphasized by the observation that the ccr5 haplotype (hhg2) comprising the 32-mutation (both homozygous or in combination with another specific haplotype (hhe)) is a predictor of a weak cell - mediated immune response and a rapid progression of hiv infection. however, the same ccr5 hhg2 haplotype in combination with the ccr5 hhc haplotype was associated with a slower progression of infection and possibly with a stronger immune response. for instance, variations of the ccl3l1 gene have recently been shown to affect hcv infection. moreover, ahlenstiehl. could show a significantly decreased hcv - specific ifn- response of cd8(+) t - cells in carriers of the ccr532 allele as compared to cells from patients with a homozygeous wildtype genotype. this finding suggests the ccr532 polymorphisms to possibly affect cellular immune responses in hcv infection. in summary there is clear evidence for a critical role of the ccr5 receptor and its ' ligands for the regulation of immune response which might also play a role in hcv infection. however, further studies with larger number of patients and a more detailed genetic analysis are necessary to precisely define the role of ccr5 in hcv infection. the authors have no commercial or other association that might pose a conflict of interest. this work was supported by the h. w. and j. hector foundation [grant number m42 ].	efficient recruitment and activation of immuno - competent cells is crucial for an effective immune response to hepatitis c virus (hcv) infection. chemokines and chemokine receptors have been shown to be critically involved in these processes.the ccr5 chemokine receptor is expressed on several cells of the immune system and has been suggested to influence the susceptibility to hcv infection as well as natural course and progression of hepatitis c. however, these reports are still controversial.this review will summarize and discuss the available data regarding the potential role of ccr5 and its ligands in hepatitis c.
echinococcosis in an important parasitic infection that is still a common health problem in undeveloped and developing countries (1). the right atrium, right ventricle, and liver have been reported as embolic origins of such cysts (4). here, we present a case of embolism of a hydatid cyst inside the left main pulmonary artery. the cyst was in the upper segmental branch of the lingular artery, and segmental and sub segmental branches of the lower lobe artery. however, no hydatid cysts were found in other organs. this case is interesting because there are only a few cases in which isolated pulmonary artery hydatid cyst without other organ involvement has been reported in the literature. we believe that this case is the first example of pulmonary artery hydatid cyst diagnosed by ebus. she had no complaints of sputum, chest pain, or dyspnea, but she had a suspicious history of hemoptysis she had a dog in her childhood and she also lived in the rural area. no abnormal signs were observed on her chest radiograph. pulmonary function tests and laboratory test results were within normal limits except for eosinophilia and minimally elevated d - dimer in the blood test. d - dimer level of the patient was 600 ng / ml, while normal limits are 0 - 500. a negative d - dimer result may exclude pulmonary embolism, but there are many reasons that cause d - dimer elevation such as infection, trauma, deep venous thrombosis, and disseminated intravascular coagulation. in this case, the reason of elevated d - dimer was parasitic infection. the patient was treated with 250-mg fluticasone dry powder twice daily in an inhaler and montelukast once daily under a suspicious diagnosis of allergic asthma ; she asked for a control examination 2 weeks later. at the control examination thoracic computed tomography (ct) was performed to investigate the etiology of cough and her minimally elevated d - dimer level. filling defects were observed inside the left main pulmonary artery, upper segmental branch of the lingular artery, and segmental and subsegmental branches of the lower lobe artery on her thoracic ct angiogram (figure 1 a - d). this finding at the main and superior branch of the lingular artery showed continuity with an 18 16 mm nodular opacity considered likely to be a cystic embolism. the right pulmonary artery and its branches were clear. subcutaneous low - molecular - weight heparin anticoagulant therapy was administered on the basis of the suspicious diagnosis of pulmonary thromboembolism. left and right ventricular parameters on echocardiographic evaluation were normal. no intracardiac thrombi, or any thrombosis in the deep veins of the lower extremities were observed. clinical and radiological findings were not completely compatible with thromboemboli. because pulmonary artery filling defects appeared more well - circumscribed and smooth, and they showed continuity with an 1816 mm nodular cystic opacity different from usual features of emboli, the other reasons such as pulmonary artery sarcoma and hydatid cyst causing filling defects in the pulmonary artery on ct were investigated. so for assessment of the other differential diagnoses, the patient underwent endobronchial ultrasound (olympus evisexera ii cv180). an anechoic cystic area was visualized inside the left pulmonary artery (figure 2). we performed endobronchial doppler ultrasound to investigate whether it was a cystic lesion that was causing the filling defects inside the pulmonary artery. doppler ultrasonography revealed a cystic formation that made the vascular filling defect inside the left pulmonary artery. thoracic magnetic resonance angiography was performed to investigate the cyst in more detail and it revealed cystic formations in the left pulmonary artery (figure 3 a - d). the lesions were hyperintense both on t1-w and t2-w mri images that showed the liquid within the cyst was rich of protein. on mri examination, either distal branches of the pulmonary artery were not filled with contrast and showed cystic lesions in them. the nature was the same in the lesions on the proximal branches of the pulmonary artery. indirect hemagglutination and specific ige tests were performed to confirm the diagnosis of hydatid cyst ; both results were positive. the patient was scanned for frequent locations of organ involvement of hydatid cysts, but no other cysts were observed. the diagnosis of pulmonary artery hydatid cyst was decided by the patient s history of living in an endemic area, thoracic ct, mri and ebus findings and also positive serology tests. the size of the cyst in the left pulmonary artery on control thoracic ct scans shrunk 7.9 mm in diameter after one year of albendazole treatment (figure 4 a and b). the liver (70%) and lungs (25%) are the organs most often affected. although cardiac involvement is observed in only 0.2 - 3% of cases, early diagnosis and treatment are important (5). in primary cardiac hydatidosis, larvae usually reach the myocardium via the coronary circulation, the pulmonary circulation, or a patent foramen ovale. intestinal lymphatic vessels, thoracic duct, superior and inferior vena cava, and hemorrhoidal and pulmonary veins may be involved (6). a variety of cardiac sequelae including sudden cardiac death, massive pulmonary embolism, and pulmonary hypertension may be encountered clinically. echocardiography, ct, and magnetic resonance imaging (mri) can be used to identify cardiac hydatidosis (7). hydatid cysts located in the pulmonary arteries are frequently the consequence of embolisms from primary cardiac locations (8). in the present case, a hydatid cyst was located inside the left pulmonary artery and its branches, without any cyst in the heart or other organs. intra - arterial hydatid cysts grow slowly into the lumen, ultimately occluding it. in the pulmonary arteries, this process may occur over a long period. because pulmonary arteries have adequate pulmonary perfusion through the bronchial arteries symptoms can be observed when the cysts compress a vital structure or interrupt blood circulation, which may also lead to anaphylactic shock (9)., the cough might be the result of compression of the left lower bronchus by the cyst. hydatid cysts usually have a characteristic appearance on mri ; an oval lesion hypo intense and hyper intense on t1-and t2-weighted images, respectively. in this case, the lesions were hyper intense both on t1-w and t2-w mri images that shows the liquid within the cyst was rich of protein (10). in the differential diagnosis of pulmonary artery hydatid cyst, pulmonary thromboembolism (fat, amniotic fluid, septic emboli, particulate material) and primary arterial tumors such as sarcoma should be considered since they also make intraluminal defects (11). radiological findings and the patients clinical features help to make the differential diagnosis since patients with disseminated pulmonary artery thrombosis show a more aggressive clinical manifestation. hydatid disease may involve the heart, including the left ventricle (60%), right ventricle (10%), pericardium (7%), pulmonary artery (6%), and interventricular septum (4%) (12). because of the significant risk of cyst rupture and anaphylactic shock, surgery should be performed promptly after diagnosis. echocardiography, spiral ct, mri, ct angiography, magnetic resonance imaging angiography, and conventional pulmonary angiography can be used for the diagnostic investigation of patients suspected of hydatid pulmonary embolism. if there is no history of hydatid disease, its existence can be suspected based on the presence of anti - echinococcal antibodies and eosinophilia in blood tests (14). the present case had eosinophilia and positive indirect hem agglutination and specific ige test results. imaging methods are sometimes limited by the small size of the lesion and the atypical images that are difficult to distinguish from abscesses or neoplasms. routine laboratory diagnosis of hydatid cysts depends on detection of specific antibody response. according to who manual for hydatid cysts, ct findings alone allow a correct diagnosis of 61% hydatid cysts of the liver, lung, kidney, spleen and some other sites and the correct diagnosis rate is 94% if ct is combined with serology (15). according to a comma, the sensitivity and specificity of iha was 100% and 83.3 - 99%, respectively (16). however, it should be kept in mind that embolectomy of the hydatid cyst from the main pulmonary truncus increases morbidity and mortality (16). symptoms are usually absent or nonspecific and include chest pain, dyspnea on exercise, and fever. eosinophilia occurs in 20% of the cases and may be associated with recent rupture (18). hydatid cysts can be solitary or multiple and vary in size (16). in the present case, a cystic filling defect was found inside the main pulmonary artery and a solid defect was found inside the left lower intermediate artery. rupture into the cardiac chambers occurs most often in the right ventricle and can cause anaphylaxis, or pulmonary or systemic embolism of the daughter cysts (19). repeated pulmonary emboli may produce pulmonary arterial hypertension and multiple lung cysts (20). in the present case, left ventricular systolic function, the right atrium, and the systolic pulmonary artery pressure were normal and no intracardiac thrombus was found. ebus is increasingly used for lung cancer staging and the assessment of sarcoidosis (21). it is useful for producing real - time images of both lymph nodes and pulmonary arteries (22). after one year of treatment with albendazole, in the follow - up thoracic ct scan, there was a decrease in the size of the cystic lesion in the left pulmonary artery. as a result, albendazole treatment can be an alternative therapy for surgery especially for patients who reject operation.	hydatid cyst (hc) is a parasitic disease that may involve many organs, especially the lung and the liver. pulmonary artery location of the hydatid cyst is extremely rare, but it may cause life - threatening complications. we report a case of a hydatid cyst that completely filled the left main pulmonary artery and its distal part without cardiac involvement. thoracic computed tomography showed filling defects in the pulmonary arteries. endobronchial ultrasound was performed for differential diagnosis and it showed a cystic lesion. hydatid cyst - specific ige and hem agglutination test results were positive. in the literature, cases like this in which the diagnosis of pulmonary hydatid cyst is made by endobronchial ultrasound are not usually seen. although many imaging modalities such as plain chest radiography, cross - sectional imaging (mdct and mri), echocardiography and conventional pulmonary angiography have been used in the diagnostic approach, we recommend endobronchial ultrasound for the differential diagnosis of cases with cystic formation.
they are usually originates from the frontal and ethmoid sinus and much less frequently seen in the maxillary and sphenoid sinuses. although the lamina papyracea is a part of ethmoid bone, a giant osteoma originated from the lamina papyracea is very uncommon. headache, proptosis, epiphora, diplopia, dizziness, facial deformity, face pain and cerebral complications are possible symptoms. paranasal sinus tomography showed an osseous lesion, the size of 4x 3 cm, arising from the right lamina papyracea. they can be treated successfully by endoscopic approaches without any recurrence and complication despite its size. they are usually originates from the frontal and ethmoid sinus and much less frequently seen in the maxillary and sphenoid sinuses (2). however the giant osteomas of the ethmoid and frontal sinuses are very rare, with only a few dozen cases reported in the literature (4). an osteoma of the paranasal sinus is usually asymptomatic and found incidentally on imaging examinations. ethmoid sinus osteomas often show symptoms at an early stage while osteomas range in size from 2 to 30 mm because of the limited anatomical space (4). most common symptoms are ; blunt face pain, congestion, rhinorrhea, anosmia, sinusitis and orbital symptoms include diplopia, proptosis, exophthalmos and changes in vision (5). osteomas may be associated with rhinosinusitis and mucoceles and these can increase the cranial and orbital complications (5). while osteomas usually range in size from 2 to 30 mm, an osteoma with a diameter > 30 mm or weighing > 110 g is considered a the symptomatic osteomas are treated surgically by external approach, endoscopic or both (1, 2). endoscopic approaches are preferred recently because of its advantages. we report a case of a giant osteoma of ethmoid sinus and its treatment by endoscopically. a 65 year old woman, presented with stuffiness and headache, referred to our clinic. she has had these symptoms for three years and increasing for three months especially at the right side of her face. the patient had no associated symptoms such as ; epistaxis, rhinorrhea, diplopia, cerebral or the other opthalmologic symptoms. anterior rhinoscopy showed bilateral inferior conchal congestion and a mass at posterior of the right inferior concha. a solid mass with smooth surface that extend to the choana was found in right nasal cavity on endoscopic examination (figure 1). other physical examinations were normal. a paranasal sinus computerized tomography (ct) scan revealed a 4x3 cm lesion of osseous density arising from the right lamina papyracea and extending to the choana, posterior ethmoid air cells and frontal reses (figure 2). except from the lamina papyracea, there were no insertion of the mass to the lateral wall. there was a soft tissue density in the right maxillary sinus secondary to the ostium obstruction. pre - operativ endoscopic view pre - operative computerized tomography an endoscopic excision planned under general anesthesia. the bony medial orbital rim were cut by a drill without excision of the lamina papyracea and the mass was mobilized. after removal, the giant osteoma was found to measure ~ 432 cm (figure 3). meroceles were got out two days later, there was no hemorrhage and the patient was discharged. the histopathologic report confirmed a diagnosis of osteoma with osteoblastic and osteoclastic activity. an endoscopic examination and ct showed that the patient was disease - free 9 months postoperatively (figure 4). osteomas are the most common benign tumors of the paranasal sinuses, usually found in the frontal sinus (57 - 80 %) and less often in the ethmoid sinus, also lamina papyracea, (20 %), maxillary sinus (6.3 %) or sphenoid sinus (4.9 %) (1, 2, 4). osteomas are slow - growing neoplasms and affect 0.43 - 1 % of the population with a male dominance and in fourth decade (2, 7). the tumors larger than 30 mm in diameter are considered giant tumors (6). our patient was 65 year old, female and the size of the tumor was 4x3x2 cm. we thought that the osteoma was originated from the lamina papyracea because of the insertion of the mass. cortical variant, sponge variant and mixed type (both cortical and sponge) (8). there was no trauma or infection history in our patient. because of the large size of the tumor, the embriologic theory is considered in our patient. when they become symptomatic, it is often related to the location of the tumor. proptosis, epiphora, diplopia, dizziness, facial deformity, face pain and cerebral complications are the other possible symptoms (4, 5, 6). although some studies suggest that asymptomatic static lesions may be observed, surgical removal is indicated in cases with orbital matrix compression and displacement (10). if the mass localised near the nasofrontal ductus or filled the 50% of the frontal sinus, they operated the patients even asymptomatic (11). according to savic and djeric, asymptomatic osteomas should be operated if they extend beyond the frontal sinus boundaries, if they can be demonstrated to be enlarging on repeated radiological examinations, or if they are located near the frontonasal duct (12). endoscopic surgery, external approach or both are the main treatments for symptomatic osteomas of the sinuses. the choice must consider several factors such as tumor location, extension, dimension and the experience of the surgeon. yiotakis and cheng reported that the main treatment is external approach but endonasal surgery may performed (4, 13). reported that a transcutaneous paranasal approach offers the advantages of increased exposure of affected structures as well as accurate recognition and preservation (14). savic and djeric used the ostoplastic flap technique at 34 patients, external ethmoidectomy at 4 patients and lateral rhinotomy at 3 patients (12). lund. reported a combined approach was chosen in seven cases (15.6%) and osteomas in three cases (6.7%) were resected completely via endoscopic intranasal surgery (15). first time, menezes and davidson used the endoscopic approach in these tumors (9). after that, there are several reports of successful removal of large ethmoid osteomas with intraorbital extension, treated endoscopically. huang. have presented a case of ethmoid osteoma extended into the orbit, which was removed endoscopically after drilling and elevation (1). naraghi. have described a case of large ethmoido - orbital osteoma dissected via endoscopic approach without drilling, with minimal complications (16). more researchers reported the endoscopic treatment of paranasal sinus osteomas and its advantages (17, 18). in our patient ; we performed transnasal approach despite its large size. the limitation of blood loss, reduced postoperative morbidity with a shorter hospitalization time and no incision scar are the advantages of an endoscopic surgery. giant osteomas of paranasal sinuses, especially originated from the lamina papyracea, are rare. they can be treated successfully by endoscopic approaches without any recurrence and complication. the minimal blood loss, short hospitalization and excellent cosmetic view are the choice of endoscopic approach.	introduction : osteomas are slow- growing, benign tumors. they are the most common neoplasms of the paranasal sinuses. they are usually originates from the frontal and ethmoid sinus and much less frequently seen in the maxillary and sphenoid sinuses. although the lamina papyracea is a part of ethmoid bone, a giant osteoma originated from the lamina papyracea is very uncommon. an osteoma of the paranasal sinus is usually asymptomatic. headache, proptosis, epiphora, diplopia, dizziness, facial deformity, face pain and cerebral complications are possible symptoms. the treatment of the paranasal osteomas are controversial.case report : a 65 year old patient that applied with stuffiness and headache to our clinic. she has had a smooth mass in the right nasal cavity. paranasal sinus tomography showed an osseous lesion, the size of 4x 3 cm, arising from the right lamina papyracea. the mass excised endoscopically and reported as osteoma histopathologically. there was no complication. after 9 months, there was no recurrence.conclusion:giant osteomas of paranasal sinuses, especially originated from the lamina papyracea are rare. they can be treated successfully by endoscopic approaches without any recurrence and complication despite its size.
it is generally believed that nano - grained ceramics have their unique mechanical characteristics that are not commonly found in their coarse - grained counterparts. strength is an important aspect of material for mechanical and particular applications under loading and static pressure. in some case, it is desirable to optimize strength to improve performance. transparent mgal2o4 ceramic has received considerable attention and has been widely studied [3 - 6 ] because of its high melting point, good mechanical strength, high resistance against chemical attack, and extraordinary optical properties [7 - 11 ]. presently, extensive work has been performed in studying the fabrication, micro - morphology and transparent mechanism of transparent mgal2o4 nano - ceramic. however, there is limited research on investigating one of the fundamental parameters of transparent mgal2o4 nano - ceramic the yield strength at high pressure and temperature. the aim of this work is to study the yield strength of transparent mgal2o4 nano - ceramic at pressure up to 5 gpa and temperature up to 900c through the analysis of the shape of x - ray diffraction lines. we carried out x - ray diffraction experiments on transparent mgal2o4 nano - ceramic using x - ray (cuk) diffractometer (model dx-2500). the nano - mgal2o4 powder, with a median particle size of 30 nm, was prepared by a low - cost melted - salt technique. two separated layers of nano - mgal2o4 and nacl cylinder were loaded inside a cubic pyrophyllite cell, which is a pressure - transmitting medium, and assembled to the press - standing piece with other modules including a carbon heater. the temperature was measured by a nichrome - nisi thermocouple, which was passed through the press - standing piece in advance of calibrating the sintering temperature. the samples were compressed from 1 to 5 gpa at room temperature and then heated from 300 to 900c under 4 gpa. the samples peaks broaden asymmetrically, with a much more severe broadening on the large angular dispersive (2) side of the peak, as shown in the bottom two curves of fig. 1. the results reveal that the applied pressure only affects the bridge parts of the grains. meanwhile, the generated stress is not enough to cause any yielding at this stage. as pressure increases gradually, differential strain and small grain size are two major causes of peaks broadening. during heating at constant pressure (4 gpa), the overall peaks remained almost unchanged up to 400c. the peaks are significantly sharp and become more symmetric at temperatures above 400c, which is a clear proof of stress relaxation accompanied by stress redistribution over the entire sample (fig. it is interesting to note that the peaks shift to lower 2. this shift is apparently due to the effect of heating. the profile of the observed diffraction peaks is a convolution of integrated effect of instrument response, grain size, and differential strain () because of stress heterogeneity, lattice deformation, and dislocation density at high pressure and temperature. we express that the observed full width at half maximum (fwhm) can be denoted as dobs. according to the classic williamson - hall method and its subsequent variations, the differential strain () of samples is defined as (221), (013) and (222) diffraction lines of mgal2o4 at selected pressure and temperature conditions : a 1 gpa, room temperature, b 2 gpa, room temperature, c 3 gpa, 600c and d 4 gpa, 600c here, dins is the peak width at a stress - free state and d(p, t) is the d spacing of a given lattice plane. in our calculations, we subtract the instrument resolution, but we can not disjoin the various contributions to the peak width changes. therefore, we determined the strain by the ratio of the peak width to the peak position according to d spacing such defined strain can be derived from the slope of d versus d(p, t) plot (fig. 2), which is an image of the complex contributions to the overall peak width changes. figure 2 shows the significant slope changes associated with six selected pressure temperature conditions. with increasing pressure from 1 to 5 gpa at room temperature, the derived differential strains increased dramatically, such as = 0.0766 10 at p = 1 gpa and = 0.4466 10 at p = 5 gpa, respectively. the strains described here are derived from the peak broadening, which are different from the regular strains. as temperature (above 400c) is increased at constant pressure (4 gpa), there is a rapid reduction in the differential strain, which is probably caused by thermally induced strain relaxation because of a small increase in the internal cell pressure. the slopes of straight lines provide differential strain information for the sample the grain size, especially when it goes down to nano - meter, contributes significantly to the diffraction line broadening. hence, we investigated details about the dependence of the differential stress as a function of pressure, and temperature could be revealed by introducing the grain size in the same plot. the strains have been derived for sample and for all high pressure / temperature observed. we obtain the young s modulus values of 294 gpa for samples by nano - indentation experiment. the calculated differential stresses and average grain size at various pressure and temperature conditions as blank - squares and solid - circles plots, respectively (fig. 3). as pressure increases, we observed two obvious yield points for samples, one at p = 3 gpa in the elastic deformation stage and the other at p = 4 gpa. we think that the first yield represents micro / local due to the grain - to - grain contacts and thus local plastic deformation because of high stress concentration, and the second yield represents the onset of macro / bulk plastic deformation of the entire sample. moreover, there is a slight addition of differential stress after the yielding when pressure changes from 4 to 5 gpa. meanwhile, the diffraction peak widths do not vary as much after the entire sample yields. our experiment results show that the dislocation density of the sample reaches certain saturation. the yield strength and average grain size as function of pressure (left panel) and temperature (right panel). the lines are meant to guide the eye only we studied temperature effects on the yield strength of sample at 4 gpa. 3, right), there is a dramatically addition in the differential stress, which can be explained on the basis of our early discussion. above 400c, the stress drops drastically with heating to 700c due to thermally induced stress relaxation. on the other hand, there is a slight negative slope in the differential stress with the temperature above 700c, which indicates that the sample gradually approaches a stress - free state. the plot still shows grain size effects on the sample at this high pressure and temperature (fig. 3, blue - solid - circles). figure 3, left reveals that there is no apparent grain growth at different high pressure. the results show that both stress relaxation and grain growth occur simultaneously during the temperature increases. to further take this interpretation, palosz and gleiter developed a model for nano - crystals, which are generally viewed to consist of two structurally distinct components, a crystalline core and a surface layer. the differential strain may also be due to the difference in elastic properties between these two components. as grain size gradually grows with increasing temperature, the distinction between these two components is expected to diminish, which may also explain the more rapid decrease in the strength with increasing temperature. in summary, yield strength is an important constitutive property of materials to define the onset of plastic deformation. and we have shown the yield strength of transparent mgal2o4 nano - ceramic as a function of high pressure / temperature. the excellent data reveal that the differential stress in nano - ceramic decreases as defects decrease during temperature increase, while grain growth further sharpens the diffraction peak. more importantly, the low temperature (400c) for the onset of stress relaxation has attracted attention regarding the performance of transparent mgal2o4 nano - ceramics as an engineering material. this work was supported by nsfc of p. r. china under grant no 50272040, fok ying tong education foundation under grant no 91046, youth foundation of science and technology of sichuan province under grant no 03zq026 - 03, nsfc of p. r. china under grant no 50742046 and nsfc of p. r. china under grant no 50872083. this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited. this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.	we report here experimental results of yield strength and stress relaxation measurements of transparent mgal2o4 nano - ceramics at high pressure and temperature. during compression at ambient temperature, the differential strain deduced from peak broadening increased significantly with pressure up to 2 gpa, with no clear indication of strain saturation. however, by then, warming the sample above 400c under 4 gpa, stress relaxation was obviously observed, and all subsequent plastic deformation cycles are characterized again by peak broadening. our results reveal a remarkable reduction in yield strength as the sintering temperature increases from 400 to 900c. the low temperature for the onset of stress relaxation has attracted attention regarding the performance of transparent mgal2o4 nano - ceramics as an engineering material.
	abstractthe prevalence of diabetic nephropathy (dn) among diabetic patients seems to be overestimated. recent studies with renal biopsies show that the incidence of non - diabetic nephropathy (ndn) among diabetic patients is higher than expected. renal impairment of diabetic patients is frequently attributed to dn without meeting the kdoqi criteria or performing renal biopsy to exclude ndn. in this editorial, we update the spectrum of renal disease in diabetic patients and the impact on diagnosis, prognosis and therapy.
a 56-year - old korean woman presented with blurred vision in the right eye of two months duration. she received a pdt treatment for cnv with angioid streaks in her right eye at another medical center one month before presentation. she also had a history of two pdt treatments for cnv with angioid streaks in her other eye at another medical center four years prior. ocular examination revealed a best corrected visual acuity (bcva) of 20 / 125 in the right eye and 20 / 800 in the left eye at the initial visit. fundus examination revealed peripapillary angioid streaks in both eyes, a grayish subfoveal lesion with mild subretinal exudates in the right eye, and a large disciform scar at the macula in the left eye. fluorescein angiography (fag) and icga were performed with a heidelberg retina angiograph using a scanning laser ophthalmoscope after an intravenous injection of 5 ml of 10% fluorescein sodium (fluorescite injection ; alcon, fort worth, tx, usa) and 25 mg of indocyanine green (dong in dang pharm., the last images were obtained at least 30 minutes after the injection of the dye. fag showed subfoveal classic cnv associated with leakage and peripapillary hyperfluorescence corresponding to the angioid streaks in the right eye. icga showed a more distinct margin of subfoveal cnv in early phase than fag and a peau d'orange appearance in the posterior pole with hyperfluorescent angioid streaks connected to the cnv lesion in late phase, which were not seen in fag. both fag and icga of the right eye revealed an increased cnv lesion size and progression to the center of the fovea despite the previous pdt treatment that was performed at another medical center. optical coherence tomography (oct) was performed using oct 3 (carl zeiss meditech, dublin, ca, usa), and a central macular thickness (cmt) was obtained using a fast macular map protocol. oct scans of the right eye revealed a hyperreflective subfoveal choroidal neovascular membrane with cystoid macular edema and neurosensory serous detachment. follow - up visits were carried out one week after intravitreal bevacizumab injection and then monthly for 12 months. for each visit, the bcva using a snellen chart, intraocular pressure and any complications were assessed. fag, icga and oct were performed one month after each injection to evaluate the effect of the intravitreal bevacizumab injection. additional treatment was administered when the lesion exhibited persistent leakage or growth on fag and icga and when the presence of subretinal or intraretinal fluid on oct combined with decreasing visual acuity was detected. after four consecutive monthly intravitreal injections of bevacizumab (1.25 mg / 0.05 ml) in the right eye, bcva improved from 20 / 125 at baseline to 20 / 50 at four months. a color fundus photograph at this time indicated resolution of subretinal exudates and a contracted subfoveal lesion in the right eye. fag and icga revealed a minimal amount of persistent leakage at one, two and three months, although cnv size and leakage decreased markedly. both fag and icga indicated that there was no leakage of cnv and the greatest linear diameter of the lesion decreased from 1,280 m at baseline to 730 m at 4 months. however, icga displayed a more distinct margin of cnv than fag despite the presence of diffuse pigment migration at the fovea. oct showed that cmt decreased from 311 m at baseline to 210 m and was absent of subretinal fluid at 4 months. nevertheless, complete resolution of intraretinal fluid on oct did not occur by 4 months. bcva decreased from 20 / 50 at 4 months to 20 / 63 at 8 months. a color fundus photograph exposed a newly developed subretinal hemorrhage and exudates at 8 months. fag and icga revealed that a new cnv lesion developed at the superior margin of the previous lesion at 8 months. therefore, two additional, consecutive, monthly intravitreal bevacizumab injections were required. after a total of six intravitreal bevacizumab injections, bcva improved from 20 / 125 at baseline to 20 / 50 at the final visit. a color fundus photograph showed that the cnv area had changed into a contracted fibrotic scar with complete resolution of subretinal hemorrhage and exudates at the final visit. oct demonstrated cmt decreased from 311 m at baseline to 203 m with complete resolution of intraretinal fluid at the final visit (fig. 2). no injection - related complications or drug - related side effects were observed. in the present study, pdt was performed for cnv due to angioid streaks in the right eye of the patient at another medical center one month before presentation. however, visual acuity deteriorated after pdt, and juxtafoveal cnv progressed to the subfoveal area with lesion enlargement. in addition, her left eye revealed disciform scarring with low visual acuity despite two pdt treatments. these findings correspond to earlier results that reported disease progression with a decrease in visual acuity after pdt for cnv in angioid streaks [9 - 12 ]. however, visual acuity improved with no angiographic evidence of leakage and a decrease in cmt at four months after four consecutive monthly intravitreal bevacizumab injections. these findings correspond with earlier studies reporting that intravitreal bevacizumab stabilized or improved visual acuity with favorable anatomic outcomes in either nave eyes or eyes that had failed previous pdt treatment. a new cnv lesion was noted at the superior margin of the previous cnv area at eight months (four months after the last intravitreal bevacizumab injection) in the present study. fortunately, visual acuity increased with no leakage on angiography or flattening of retinal edema on oct after two additional consecutive monthly intravitreal bevacizumab injections. these results are consistent with long term follow - up studies that reported that the mean interval between retreatments was about four months and intravitreal bevacizumab injections had to be repeated in all patients. in a retrospective study of nine eyes in six patients, wiegand. reported that visual acuity stabilized or improved in eight eyes (88.8%) with a reduction in retinal thickness in all eyes after a mean follow - up of 19 months. in a prospective study with eleven patients, neri. reported that visual acuity stabilized or improved with reduced or stable cnv size in all eyes at 20 months. these long term follow - up results suggest that early retreatment may ensure favorable functional and anatomical outcomes and prevent disease progression. anatomical improvement was associated with a concomitant increase in visual acuity in the present study. our result are consistent with previous studies reporting improvement of functional results correlated with a decrease in the greatest lesion height on oct. in addition, the visual acuity deterioration was followed by an increase of cmt in the present study. therefore, regular follow - up with visual acuity testing and close observation of the macula using oct may inform decisions for early intervention in order to prevent disease progression. in contrast to previous therapeutic regimens, such as laser photocoagulation and pdt, that often result in disciform scarring and irreversible loss of function of the retinal pigment epithelium (rpe) and overlying retina, intravitreal bevacizumab injection in the present study resulted in improvement of visual and anatomic outcomes without scar formation. intravitreal bevacizumab injection may have antiexudative and antiproliferative effects while preserving the rpe and overlying retina. the results obtained from our patient indicate that intravitreal bevacizumab for cnv associated with angioid streaks may prevent the progression of disease and result in the improvement of visual acuity.	a 56-year - old korean woman presented with decreased visual acuity of the right eye. she had a history of two photodynamic therapy treatments for choroidal neovascularization (cnv) due to angioid streaks in her left eye with central scarring and low visual acuity. she was diagnosed with subfoveal cnv due to angioid streaks in her right eye and treated with six intravitreal bevacizumab (1.25 mg / 0.05 ml) injections over one year. best corrected visual acuity improved from 20 / 125 at baseline to 20 / 50 at the final visit. the area of cnv had changed into a fibrotic scar by the final visit, and fluorescein angiography and indocyanine green angiography revealed no evidence of leakage. optical coherence tomography showed that central macular thickness decreased from 311 m at baseline to 203 m with complete resolution of subretinal and intraretinal fluid at the final visit. intravitreal bevacizumab for cnv associated with angioid streaks prevented the progression of disease and resulted in the improvement of visual acuity after one year of follow - up in our patient.
to replace a missing tooth with a dental implant, existence of the adequate bone is an essential prerequisite. sometimes, there is a lack of available bone as a consequence of atrophy, trauma, failure to develop or surgical resection. several grafting materials including autografts, allografts, xenografts and alloplasts have been used for bone augmentation. while autogenous bone is called as a gold standard anorganic bovine bone (abb) has osteoconductive properties and is documented as a bio - compatible material. although several clinical investigations have demonstrated its favorable results, [1, 4 ] histological studies have shown variable degrees of residual material even after 3 years. -tricalcium phosphate (-tcp) is a synthetic calcium phosphate ceramic used in regenerative therapy as an alloplastic material. a number of reports have indicated good biodegradability and biocompatibility, while others have shown rapid degradation and weak mechanical properties [610 ]. to the best of our knowledge, there is limited data comparing these two materials with regard to the amount of bone formation and graft resorption properties. the aim of this study was to compare these two materials in experimentally induced defects in rabbit calvaria. this study was approved by the animal care and use committee of tehran university of medical sciences and was performed strictly in accordance with the recommendations of the helsinki convention for the use and care of animals. six white male new zealand rabbits weighing 2.53.5 kg were maintained on standard laboratory chow with free access to water for 2 weeks prior to the first day of the experiment. the animals were anesthetized with intramuscular injections of 2% (5mg / kg) xylazine and 10% (40mg / kg) ketamin (alafason, woeden - holland). the surgical sites on the calvaria were shaved and scrubbed with 7% betadine for 5 minutes. after isolation, an anterior - posterior (craniocaudal) incision was made with a no. 15 surgical blade and dermal and subdermal tissues along with the periosteum were retracted with a periosteal elevator. three identical holes (3.1 6 mm) were created on the frontal and parietal bones by a round bur. for standardization, anatomical landmarks including the occipital process and craniocaudal suture were used. these two landmarks cross in the middle and form a plus sign (+). the defects were oriented on the right anterior, right posterior and left posterior aspects of the intersection of these landmarks. abb (bio - oss, geistlich biomaterials, wolhusen, switzerland ; particle size : 2501000 m) and -tcp (bioresorb, oraltronics, bremen, germany ; particle size : 5001000 m) were used to fill two of the defects, leaving one hole unfilled which served as control. then, the periosteum and skin were sutured. after transferring the rabbits to their cages, enrofloxacine (0.7 ml / day) and florbiprofen (0.3 ml / day) all animals were sacrificed after a 1-month healing period by an overdose of pentobarbital (100mg / kg), injected intravenously. after sacrifice, dermal and mucosal tissues of the calvarium were separated with a # 15 surgical blade and the entire calvarium was removed using a reciprocating saw. the specimens were fixed in 10% formalin for 14 days and immersed in 10% formic acid for another two weeks until decalcified. ten histologic sections with a thickness of 5 m were prepared from each defect and stained with hematoxilin and eosin. inflammation, foreign body reaction, bone vitality, bone quality, thickness of bone trabeculae, percentage of residual biomaterial and newly formed bone were assessed in the bases of the defects by a light microscope (bx41, olympus co., tokyo, japan) at a magnification of 40. inflammation was graded using a five - tiered grading system as follows : 0, no inflammatory cells ; i, little and scattered inflammation ; ii, focal inflammation with 5 to 10 inflammatory cells ; iii, focal inflammation with 10 to 50 inflammatory cells ; and iv, focal inflammation with more than 50 inflammatory cells. foreign body reaction was determined by the presence of multinucleated giant cells in granulomatous response. bone quality was recorded as woven bone alone, both woven and lamellar bone, and lamellar bone alone. trabeculation thicknesses of > 60 m, 2060 m, and 120 m were considered as grades i, ii and iii, respectively. digital photograph was taken for each sample at a magnification of 40 and the percentage of residual material and newly formed bone were calculated using adobe photoshop 7.0 software. all of negative controls, 75% of the abb, and 16.7% of the -tcp specimens demonstrated grade i inflammation and other samples showed grade ii inflammation. overall, -tcp showed more inflammatory infiltration compared to the control group (p=0.025). however, this reaction was observed in 2 out of 6 defects of the abb group and none of the control group as expected. the newly formed osseous tissue was consisted of both woven and lamellar bone in all specimens. regarding the thickness of bone trabeculae, 16.7% and 83.3% of the negative controls were grade i and ii, respectively ; 33.3% and 66.6% of the abb samples were grade i and ii, respectively ; and 50%, 33.3% and 16.7% of the -tcp specimens were grade i, ii and iii, respectively. however, according to friedman test the differences were not statistically significant (p=0.846). according to repeated measure anova test, the mean percentage of new bone formation was 16.8311.07% in abb group, 30.8314.29% in -tcp group, and 14.008.17% in the control group (figure 1). the mean percentage of residual material in the defects filled with abb and -tcp was 36.508.43% and 24.1714.01%, respectively. however, the difference between groups was not statistically significant (p>0.05) (figure 2). this study was designed to compare bone healing after application of two osteoconductive graft materials (abb and -tcp) in experimentally induced bone defects in rabbit calvaria. since the embryonic process of development of both alveolar bone and calvaria vault are through intramembranous bone formation, calvaria of the rabbit was selected as the experimental site to make a more proper comparison. biomaterials used in bone grafting procedures have been shown to influence modeling, remodeling and healing of osseous tissues. these substances are also known to enhance and stimulate bone formation via osteogenesis, osteoconduction or osteoinduction. the remodeling process lasts for 3 to 6 months in humans and 6 weeks in rabbits. according to schallhorn, the essential properties of an ideal grafting material is biologic acceptability, predictability, clinical feasibility, minimal operative and postoperative complications and patient acceptance. the results obtained in the present investigation demonstrated no adverse inflammatory consequences following application of -tcp and abb. although the inflammatory infiltration was more in defects filled with -tcp, inflammatory reactions were slight in all specimens. in this study, foreign body reaction was observed in 16.7% and 66.7% of the abb and -tcp cases, respectively. this was in accordance with the findings reported by ogose. who evaluated the histologic characteristics of -tcp in the human femur and found osteoclast - like giant cells surrounding -tcp particles. degradation of graft materials may be considered as a positive characteristic if replaced by newly formed vital bone. previous investigations have shown that -tcp has prominent bioresorbable properties. in the current study, the resorption and bone formation induced by -tcp was slightly greater than abb, but a significant difference was not found between the two materials. the results of this study are in accordance with the study of tamimi. the amount of newly formed bone in osseous defects is probably one of the most important factors for determining regeneration. considering that both materials showed desirable healing properties, -tcp and abb ogose observed a considerable amount of newly formed bone on -tcp particles, 4 weeks after grafting. used fresh autogenous bone, allogenic decalcified freeze - dried bone, and -tcp for the treatment of experimental furcation defects. regeneration was more prominent following application of autogenous bone as compared to the other two substances. according to the results of the present study, -tcp and abb may have similar osteoconductive properties and there are no significant differences between these two materials with regard to the quantity and quality of newly formed bone.	objective : both anorganic bovine bone (abb) and -tricalcium phosphate (-tcp) are used in clinical practice as bone substitute materials, but there is limited data comparing these two materials in standardized defects.the aim of this study was to histologically evaluate the effectiveness of abb and -tcp in the healing of experimentally induced bone defects.materials and methods : eighteen bone defects were created on the calvaria of six rabbits. in each animal, one defect was left untreated and the other two were filled with abb and -tcp. after one month, histological sections were prepared. type and vitality of newly formed bone, percentage of new bone formation and residual material, thickness of trabeculae, inflammation and foreign body reaction were assessed.results:the newly formed osseous tissue was vital in all defects and consisted of woven and lamellar bone. mean percentages of new bone formation were 30.8314.29%, 16.8311.07% and 14.008.17% in -tcp, abb and control groups, respectively and the mean percentages of residual biomaterial were 24.1714.01% and 36.508.43% in -tcp and abb groups, respectively. however, the differences were not statistically significant (all ps>0.05). inflammatory infiltration was statistically higher in -tcp compared to the control group (p=0.025), but the difference was not significant between -tcp and abb groups (p=0.083). trabeculation thickness and foreign body reaction were not statistically different between -tcp and abb groups.conclusion:-tcp and abb were not different with regard to the quantity and quality of newly formed osseous tissue. however, inflammatory infiltration was higher in sites filled with -tcp.
mycetoma pedis, or madura foot, was first described as a clinical entity by gill in 1842, from a clinic in madurai, india. in 1880, carter coined the term mycetoma. the disease can be caused by one of two organisms, the eumyces, or true fungi (eumycetoma), or actinomyces, filamentous bacteria of the order actinomycetales (actinomycetoma). it is a localized, chronic, suppurative infection characterized by exuberant granulation tissue and discharging sinuses and bone involvement later in the course of the disease. early clinical diagnosis before the appearance of discharging sinuses is difficult as the entity may clinically mimic a low grade neoplasm or a chronic bacterial or tubercular infection. the recently described dot in circle sign on magnetic resonance imaging (mri) is easy to recognize and specific to this condition and establishes the role of mri in early diagnosis.[35 ] we present a case of mycetoma foot that demonstrated the dot - in - circle sign on mri. a 48-year - old man complained of painless swelling in the left foot that had been present for the past 6 years. the patient had been treated with multiple courses of oral and intravenous antibiotics in a primary health center. the patient did not respond to the treatment. at the peripheral hospital two attempts were made to incise and drain the lesion. for the past 1 month, the patient had experienced mild dull aching pain in the foot, mainly during the night. the patient did not mention a history of past discharge of granules from any area of the foot. plain radiograph of the left foot showed mild soft tissue swelling with changes of chronic osteomyelitis involving the tarsal and metatarsals [figure 1 ]. mri was performed to characterize the lesion and to evaluate the extent of the disease. multiple discrete, as well as, conglomerate small spherical hyperintense lesions with peripheral hypointense rim were seen. few of these lesions showed a central tiny hypointense focus suggestive of dot in circle sign [figure 2 ]. t2-weighted fat saturated (t2w fs) and t1-weighted fat saturated (t1w fs) postcontrast images depicted the proximal extent of the lesion up to the distal half of the leg with ankle joint effusion and synovial thickening [figure 3 ]. on the basis of mri findings, the diagnosis of mycetoma was considered and a biopsy was performed. the final microbiological test showed the presence of curvularia lunata (eumycetoma sp.) [figure 4 ]. the patient was amputated 10 inches below the knee joint and put on 400 mg oral itraconazole daily for 6 months. frontal radiograph shows moth eaten area of destruction involving tarsal (white arrow) and metatarsals (black arrow) with patchy erosions and mild soft tissue swelling (yellow arrow). mri t2 weighted coronal images show inflammatory changes with multiple soft tissue and osseus small hyperintense lesions with peripheral hypointense rim corresponding to mycetoma grains (yellow arrows). few of them showing dot in circle sign (thicker white arrow). (a) t2 weighted fat suppressed sagittal and (b) t1w fat suppressed postcontrast sagittal images show extension of inflammation proximally up to distal leg with ankle joint effusion (yellow arrow) and synovial thickening. dot in circle sign (white arrow) is seen in postcontrast image. histopathology slide prepared using lactophenol cotton blue shows septated conidia which is curved at 3rd cell from the base (yellow arrow) confirming the diagnosis of curvularia lunata (eumycetoma sp.) 1500. mycetoma is a chronic debilitating granulomatous disease that is prevalent in tropical and subtropical regions. the term mycetoma is a clinical entity, which applies to a chronic inflammatory process of soft tissue, usually of the foot, resulting from infection by one or more fungi or actinomycetes (a gram - positive bacillus). initially, there is formation of soft tissue swelling with induration due to underlying granulation tissue, which progresses to the formation of discharging sinuses. the lesion may be confined to the soft tissue for years before bone involvement occurs. the diagnosis of mycetoma should be considered when a patient presents with soft tissue lesion and discharging sinuses with or without bone involvement. although various radiographic bone changes have been described in cases of mycetoma, bone involvement usually occurs late in the course of the disease. noninvasive imaging with mri can characterize the soft tissue lesion of mycetoma and aid in early diagnosis. mycetoma is characterized by the formation of aggregates of the organism, known as grains this could account for the appearance observed on mri of conglomerates of small (25 mm) round hyperintense lesions, representing the granulation tissue, surrounded by low - signal intensity rim, representing intervening fibrous septa. the central low - signal intensity dot is the result of susceptibility effect caused by the presence of fungal grains. this unique appearance known as dot in circle sign appears to be highly suggestive of mycetoma.[35 ] this sign was first proposed by sarris., in 2003 on t2-weighted short - tau inversion recovery (stir), and t1-weighted fast spin gadolinium - enhanced images in a series of two cases. czechowski., described small t1 and t2 hypointense lesion on mri caused by the susceptibility effect of the fungal grains. however, they did not describe the dot in circle sign in their study. in our case, mri clearly depicted the conglomerate as well as discrete small round t2 hyperintense lesions with central hypointense foci in some of them. eumycotic lesions tend to form a few cavities in the bone 1 cm in diameter, while actinomycetes often form smaller, but more numerous cavities. in a study by lewall., a moth eaten appearance caused by a combination of irregular periosteal reaction, periosteal erosion, and small cavities within bone were seen in 25% of cases of actinomycetoma, but in none of the patients with eumycetoma. modern chemotherapeautic drugs are effective in early stage of the disease when combined with surgery. difficulty in accurately identifying the extent of the lesion during surgery is the chief cause of recurrence. mri can be helpful in early diagnosis and to monitor recurrence. in the absence of typical clinical features of discharging sinuses, mycetoma foot mri could aid in the early diagnosis of this chronic infection and may differentiate it from other clinically similar conditions. the demonstration of the organism in the lesion by biopsy and microbiological examination can be difficult. in india, the disease is still endemic and mri may help in early recognition and prevention of amputations that maybe required because of delayed diagnosis.	mycetoma or maduramycosis is a localized chronic suppurative infection characterized by exuberant granulation tissue, discharging sinuses, and bone involvement later in the course of the disease. early clinical diagnosis before the appearance of sinuses and grains (aggregates of organism surrounded by granulation tissue, which are discharged from the draining sinuses) is difficult. delay in diagnosis may lead to amputation of the affected part. definitive diagnosis is through biopsy and microbiological examination. however, at times diagnosis may still be difficult. the recently described dot in circle sign on magnetic resonance imaging (mri) is easy to recognize and highly specific. we present a case of mycetoma foot with characteristic mri features.
recent guidelines for the management of hypertension have recognized the relevance of albuminuria and an estimated glomerular filtration rate (egfr) value 35 kg / m)known renal, renovascular, malignant or endocrine hypertensionknown proteinuria and haematuriaprevious known nephritic diseases and hereditary renal diseasesheart failurepositive history or clinical signs of ischaemic heart diseasepositive history or clinical signs of cerebrovascular diseasesmajor non - cardiovascular diseasesunreliable 24-h urine collection. (that is, creatinine excretion 30 mg kg in men and>25 mg kg in women was considered as overcollection). age lower than 18 years and greater than 70 years known diabetes or fasting glycaemia126 mg per 100 ml grade ii iii (world health organization classification) obesity (body mass index (bmi)>35 kg / m) known renal, renovascular, malignant or endocrine hypertension known proteinuria and haematuria previous known nephritic diseases and hereditary renal diseases positive history or clinical signs of ischaemic heart disease positive history or clinical signs of cerebrovascular diseases major non - cardiovascular diseases unreliable 24-h urine collection. (that is, creatinine excretion 30 mg kg in men and>25 mg kg in women was considered as overcollection). endocrine and renovascular hypertension was ruled out by clinical examination, and determination of serum electrolytes, plasma renin activity, plasma aldosterone, plasma catecholamines and where appropriate, by performing renal echography, echo - doppler of renal arteries and renoscintigraphy. written informed consent was obtained from each subject and the study was approved by the local review board. in all subjects, body weight, height and waist circumference were measured by a nurse and clinic blood pressure was recorded by a doctor, following the recommendations of the 2007 european society of hypertension/ european society of cardiology guidelines. clinic blood pressure was considered as the mean of three consecutive measurements obtained by a mercury sphygmomanometer, after 5 min of rest in sitting position. serum and urine creatinine concentrations were determined by the kinetic picrate method using an autoanalyser (monarch 2000 autoanalyser ; instrumentation laboratories, lexington, ma, usa). the 24-h albumin excretion rate (aer) was assayed by radioimmunological analysis (techno genetics ria kit). in subjects with urinary tract infections, the patients were advised to avoid excessive physical efforts on the day before and during the 24-h urine collections. collections were postponed in female participants reporting menstruation or febrile illnesses at the time of collection. the gfr was estimated (egfr) by the abbreviated prediction equation of the modification diet in renal disease study (mdrd) : 186 serum creatinine (mg per 100 ml) age (years) (0.742 for women). the ethnicity factor of the equation was not used because our study population was exclusively white. microalbuminuria and macroalbuminuria were defined as 24-h aer 20199 g min and 200 g min, respectively. we used the classification proposed by the us nkf k / doqi guidelines for ckd to define the stages of renal function impairment. ckd stages were defined as follows : stage 1, egfr greater than 90 ml min per 1.73 m and 24-h aer>20 g min ; stage 2, egfr of 60 to 89 ml min per 1.73 m and 24-h aer>20 g min ; stage 3, egfr of 30 to 59 mlmin per 1.73 m ; stage 4, egfr of 15 to 29 ml min per 1.73 m ; stage 5, egfr less than 15 ml min per 1.73 m. a total of 402 subjects met the exclusion criteria., except for aer, which, because of its skewed distribution, was expressed as the median and interquartile range. comparisons of each stage of ckd with the group of subjects without ckd were performed, if the overall f - test was significant, by using the holm post hoc test. the relationship between egfr and aer was tested by the pearson 's correlation coefficients. to investigate the independent correlates of each stage of ckd, multiple logistic regression analyses were performed by calculating odd ratios and their 95% confidence limits, after adjustment for age, systolic (sbp) and diastolic (dbp) blood pressures, waist circumference, serum uric acid (sua), triglycerides, high - density lipoprotein (hdl) cholesterol, total cholesterol, duration of hypertension (included as continuous variables), gender, previous treatment for hypertension, smoking habit (included as categorical variables). for this analysis, patients of stage 4 and stage 5 were pooled in a single group because the low number of subjects belonging to the stage 5. in all multiple regression analyses, a backward stepwise procedure was used, with =0.15 as the cut - off for entry or removal of variables, which is the default value of the systat statistical package. the statistical analyses were performed using the systat data software package, version 5.2 (systat, evanston, il, usa). serum and urine creatinine concentrations were determined by the kinetic picrate method using an autoanalyser (monarch 2000 autoanalyser ; instrumentation laboratories, lexington, ma, usa). the 24-h albumin excretion rate (aer) was assayed by radioimmunological analysis (techno genetics ria kit). in subjects with urinary tract infections, the patients were advised to avoid excessive physical efforts on the day before and during the 24-h urine collections. collections were postponed in female participants reporting menstruation or febrile illnesses at the time of collection. the gfr was estimated (egfr) by the abbreviated prediction equation of the modification diet in renal disease study (mdrd) : 186 serum creatinine (mg per 100 ml) age (years) (0.742 for women). the ethnicity factor of the equation was not used because our study population was exclusively white. microalbuminuria and macroalbuminuria were defined as 24-h aer 20199 g min and 200 g min, respectively. we used the classification proposed by the us nkf k / doqi guidelines for ckd to define the stages of renal function impairment. ckd stages were defined as follows : stage 1, egfr greater than 90 ml min per 1.73 m and 24-h aer>20 g min ; stage 2, egfr of 60 to 89 ml min per 1.73 m and 24-h aer>20 g min ; stage 3, egfr of 30 to 59 mlmin per 1.73 m ; stage 4, egfr of 15 to 29 ml min per 1.73 m ; stage 5, egfr less than 15 ml min per 1.73 m. a total of 402 subjects met the exclusion criteria. therefore, the final analysis involved 1856 patients., except for aer, which, because of its skewed distribution, was expressed as the median and interquartile range. comparisons of each stage of ckd with the group of subjects without ckd were performed, if the overall f - test was significant, by using the holm post hoc test. the relationship between egfr and aer was tested by the pearson 's correlation coefficients. to investigate the independent correlates of each stage of ckd, multiple logistic regression analyses were performed by calculating odd ratios and their 95% confidence limits, after adjustment for age, systolic (sbp) and diastolic (dbp) blood pressures, waist circumference, serum uric acid (sua), triglycerides, high - density lipoprotein (hdl) cholesterol, total cholesterol, duration of hypertension (included as continuous variables), gender, previous treatment for hypertension, smoking habit (included as categorical variables). for this analysis, patients of stage 4 and stage 5 were pooled in a single group because the low number of subjects belonging to the stage 5. in all multiple regression analyses, a backward stepwise procedure was used, with =0.15 as the cut - off for entry or removal of variables, which is the default value of the systat statistical package. the statistical analyses were performed using the systat data software package, version 5.2 (systat, evanston, il, usa). the mean age of the 1856 patients enrolled in the study was 4714 years, 53% of whom were men. the median value and interquartile range of aer were 9 (518.5) g min. microalbuminuria and macroalbuminuria were detected, respectively, in 22.7 and 0.7% of the entire population. the mean values of serum creatinine and estimated gfr were, respectively, 0.970.58 mg per 100 ml and 89.726 ml min per 1.73 m. only 5.2% of the overall population had simultaneously albuminuria and an estimated gfr less than 60 ml min per 1.73 m. aer and egfr were weakly (r=0.13), but significantly (p60 ml min per 1.73 m. despite this limitation, it has been clearly documented that the gfr estimated by the mdrd formula is a powerful prognosticator for adverse cv outcomes. moreover, in the hypertensive population of the value trial, the mdrd study equation was a better predictor of cv events than the creatinine clearance rate calculated by the cockcroft the main limitation is the cross - sectional nature of our investigation that precluded assessment of the temporality of the observed associations and thus determination of causality. another possible weakness in our results could be represented by the influence of pharmacologic treatment, even if it was taken into account in the multivariate analyses. moreover, the percentage of subjects treated with ace inhibitors or at1-blockers or other classes of antihypertensive drugs did not differ significantly in the various groups. it is well known that there is a considerable intrapersonal variation of urinary albumin excretion. therefore, the measurement of only one value of aer may be another limitation of our study. however, as reported in the methods section, we adopted several precautions to reduce the variability of aer. we previously performed a study in 70 never - treated hypertensive subjects, which underwent two measurements of the 24-h aer at 1 week interval, using the same precautions employed in this study. we found a spearman 's correlation coefficient for these two measurements of 0.75 (p<0.0001). of those participants with microalbuminuria at the fist examination, 81% had microalbuminuria at the second evaluation. moreover, it is important to note that in several studies, in which a relationship between aer and cv prognosis was found, only one measurement was performed. in conclusion, in non - diabetic hypertensive patients without cv complications the factors associated with milder forms of renal dysfunction are, in part, different from those associated with more advanced stages of kidney dysfunction. the main limitation is the cross - sectional nature of our investigation that precluded assessment of the temporality of the observed associations and thus determination of causality. another possible weakness in our results could be represented by the influence of pharmacologic treatment, even if it was taken into account in the multivariate analyses. moreover, the percentage of subjects treated with ace inhibitors or at1-blockers or other classes of antihypertensive drugs did not differ significantly in the various groups. it is well known that there is a considerable intrapersonal variation of urinary albumin excretion. therefore, the measurement of only one value of aer may be another limitation of our study. however, as reported in the methods section, we adopted several precautions to reduce the variability of aer. we previously performed a study in 70 never - treated hypertensive subjects, which underwent two measurements of the 24-h aer at 1 week interval, using the same precautions employed in this study. we found a spearman 's correlation coefficient for these two measurements of 0.75 (p<0.0001). of those participants with microalbuminuria at the fist examination, 81% had microalbuminuria at the second evaluation. moreover, it is important to note that in several studies, in which a relationship between aer and cv prognosis was found, only one measurement was performed. in conclusion, in non - diabetic hypertensive patients without cv complications the factors associated with milder forms of renal dysfunction are, in part, different from those associated with more advanced stages of kidney dysfunction.	our study was aimed to assess the clinical correlates of different degrees of renal dysfunction in a wide group of non - diabetic hypertensive patients, free from cardiovascular (cv) complications and known renal diseases, participating to the redhy (renal dysfunction in hypertension) study. a total of 1856 hypertensive subjects (mean age : 4714 years), attending our hypertension centre, were evaluated. the glomerular filtration rate (gfr) was estimated by the simplified modification of diet in renal disease study prediction equation. a 24-h urine sample was collected to determine albumin excretion rate (aer). albuminuria was defined as an aer greater than 20 g min1. we used the classification proposed by the us national kidney foundation 's guidelines for chronic kidney disease (ckd) to define the stages of renal function impairment. in multiple logistic regression analysis, the probability of having stage 1 and stage 2 ckd was significantly higher in subjects with greater values of systolic blood pressure (sbp) and with larger waist circumference. sbp was also positively related to stage 3 ckd. stage 3 and stages 45 ckd were inversely associated with waist circumference and directly associated with serum uric acid. age was inversely related to stage 1 ckd and directly related to stage 3 ckd. the factors associated with milder forms of kidney dysfunction are, in part, different from those associated with more advanced stages of renal function impairment.
an 18-year - old male reported to outpatient department of deepa nursing home on december 13, 2013 with the complaint of fever, malaise, myalgia, and unilateral tenderness on the right side of the face with overlying facial edema since 2 days. the pain and swelling were associated with earache and difficulty to eat, swallow, and talk with difficulty in opening the mouth [figure 1 ]. swelling on the right side of the face (frontal view) general physical examination revealed a well - built stature. on intra oral examination, the orifice of stensen 's duct appeared red and swollen. past medical history revealed that the patient was hospitalized for malaria and treated without any complications 5 years back. the diagnosis was then confirmed with positive serologic test for igm antibody, and igg antibody with a 4-fold rise in titers. seven days following the initial symptomatic treatment for fever and parotid swelling, the patient was hospitalized for fever with a temperature of 100.7f, nausea, vomiting, and painful left scrotal swelling [figure 2 ]. swelling on the right side of the face (lateral view) the patient denied any urinary complaints of dysuria or urethral discharge. considering the patient 's age and the history, there was no record to suggest a sexually transmitted illness. on examination, the left testis was enlarged measuring 8 cm 7 cm 7 cm, tender and hard in consistency [figure 3 ]. right scrotal swelling the right testis and cord were normal. in the routine laboratory investigations, it was observed that white cell count was raised to 11,700/mcl, and c - reactive protein to 27 mg / l. blood and urine cultures showed no significant growth. considering the clinical examination of the scrotum which showed a swollen and edematous right testis and epididymis, features exhibiting of epididymo - orchitis, the patient was treated with anti - inflammatory medications, pain medications, and bed rest with an elevated scrotum and ice packs applied to the area. clinically, mumps can be defined as an illness with acute onset of unilateral or bilateral tender, self - limited swelling of the parotid and/or other salivary gland (s), without other apparent cause. hippocrates in 5 century b.c., described mumps as bilateral or unilateral swelling near the ears. mumps is caused by an rna virus of the genus rubella virus belonging to the family of paramyxoviridae. the mode of transmission of the viruses can be through the human reservoir by direct contact, airborne droplets, fomites infected by saliva, and possibly by urine. the possible complications of mumps are aseptic meningitis, encephalitis, hearing loss, orchitis, oophoritis, parotitis or other salivary gland swelling, mastitis or pancreatitis. they are the most common clinical manifestations after parotitis in adolescent boys and adult men, usually in the age group of 1529 years. 80% of all mumps orchitis cases, symptoms are first seen in the first 8 days of the parotid swelling but occasionally may precede it and rarely may manifest itself present even without the parotid swelling. it results in severe pain, swelling, and tenderness at the affected site and is often associated with high fever, nausea, vomiting, and abdominal pain. it resolves over a week, though, gonadal tenderness may persist for a long time. in about 2030% of cases it can lead to oligospermia, azoospermia, and asthenospermia (defects in sperm movement). unilateral orchitis can drastically, but only briefly diminish the sperm count and alter the mobility, and morphology of the sperm. impairment of fertility is estimated to occur in about 13% of patients while 3087% of patients with bilateral mumps orchitis experience infertility. studies by adamopoulos. on the levels of various hormones in mumps orchitis, have found low testosterone levels, elevated luteinizing hormone (lh) levels and an exaggerated pituitary response to lh - releasing hormone stimulation in the acute phase of mumps orchitis. after 1012 months of the acute phase of the disease the basal testosterone concentration returned to normal level but the mean basal follicle stimulating hormone (fsh) and lh concentrations remained significantly high. on the other hand, the link between mumps orchitis and anti - sperm antibodies has been unclear while the antibodies are suspected to impair fertility. histologically, it has been suggested that testicular atrophy is due to parenchymal inflammation due to virus in the testicular glands leading to separation of seminiferous tubules and perivascular interstitial lymphocyte infiltration. a barrier against edema if formed by tunica albuginea leads to rise in intratesticular pressure and pressure - induced testicular atrophy. the use of steroid in patients with mumps orchitis is not advised as, the steroids could further lower the level of testosterone and increase the level of fsh and lh, aggravating testicular atrophy. mumps can be prevented by immunization with measles, mumps, and rubella (mmr) vaccines for mmr into one shot. the majority children who receive the vaccine acquire immunity to all three diseases (over 99% for measles and 95% for mumps and rubella). the vaccination is recommended in two doses with the first dose given at 1215 months of age. as of today this is because the routine coverage by mmr is common which act like natural booster in vaccines. the second dose may be given 4 weeks after the first, but it is usually given at 46 years. a time may come in coming years when the routine coverage of mmr will go up and will lead to drastic reduction in natural infections and decrease the natural boosting, and at such a time booster of mmr at 5 years is recommended. mumps orchitis is a severe complication of mumps which can lead to sterility in postpubertal males. immunization and education regarding its complications is the best policy to avoid mumps - related complications.	mumps is a relatively mild short - term viral infection of the salivary glands that usually occurs during childhood. meningitis / encephalitis is a well - known complication of mumps, but involvement and infection of the testis in adolescent boys and adult men are rare. we report a case of an 18-year - old male patient with mumps associated epididymo - orchitis on the left side. the diagnosis was confirmed clinically and serologically by igg and igm titers. the symptoms were resolved after the administration of anti - inflammatory and pain medications with bed rest and ice packs applied to the area.
diabetic neuropathy is the most common neuropathy and is associated with a wide range of clinical manifestations. it tends to occur after 50 years of age, and mostly in patients with long - standing diabetes mellitus. it results from microvascular injury involving small blood vessels that supply nerves, but macrovascular pathogenesis is also involved. the pathogenesis of sensorimotor neuropathy in diabetes mellitus type 2 is multifactorial and related metabolic disturbances, such as hyperglycemia, dyslipidemia, oxidative and nitrosative stress, and growth factor deficiency all contribute to the development of this complication. several metabolic products, such as advanced glycated end products, activation of protein kinase c enzyme, and sorbitol aldose reductase (polyol) pathway flux are claimed to have a role in pathogenesis of neuropathy. dyslipidemia is a significant contributor to the development of diabetic neuropathy via inducing oxidative stress in root ganglia sensory neurons. reported that short - term glycemic control in patients with type 2 diabetes mellitus can improve vibratory sensation, metabolic changes in glucose and lipids (total cholesterol, triglyceride, and free fatty acids) being the factors responsible for impairment of peripheral nerve function. on the other hand, a previous study showed that there was no significant difference in serum cholesterol of type 2 diabetic patients with negative and positive sensorimotor neuropathy. atherogenic lipid indices including total cholesterol / high - density lipoprotein cholesterol, low - density lipoprotein cholesterol, triglycerides / high - density lipoprotein and other ratios are predictors for atherosclerosis in type 2 diabetes mellitus but not for neuropathy. this study aimed to explore the status of some atherogenic lipid indices in type 2 diabetes neuropathy assessed by neuropathy total symptom score (ntss), neuropathy impairment score in the lower leg (nis - ll), and electrophysiological studies of sensory and motor nerves. this study was conducted in the unit of neurophysiology, the university hospital of medical college, al - nahrin university in baghdad, iraq, from january 2002 to january 2003. the study is approved by the local scientific committee of medical college, al - nahrin university. a total number of 51 patients with a history of type 2 diabetes mellitus, presenting with subjective symptoms of peripheral neuropathy, as well as 31 healthy subjects, serving as control, were enrolled in the study. each patient and subject was clinically examined and the severity as well as the functional impairment were assessed using neuropathy total symptom score (ntss) and neuropathy impairment score in the lower leg (nis - ll). neuropathy total symptom score is a questionnaire that measures the frequency and intensity of numbness, pickling, aching pain, burning pain, lacinating pain, and allodynia). in this measure, the symptom frequency is graded as occasional, frequent, and continuous while the symptom intensity is graded as absent, slight, moderate, and severe. therefore, the score ranged between 0 (absent symptom) and 3.66 (severe continuous symptom). the neuropathy impairment score in lower limbs has 14 items and evaluates the muscle power, reflexes, and sensory modalities. electrophysiological measurements, using dantec counterpoint clinical four - channel electromyography system, included nerve conduction velocity, minimum f - wave latency and sensory refractory period. the electrophysiological study of sensory (ulnar and sural) and motor (ulnar and common peroneal nerves were assessed. none of participants was used lipid lowering agents, and patients with hypertension were on angiotensin converting enzyme inhibitors). a fasting venous blood sample were obtained from participants and sera were separated for determination of glucose and lipid profile, including serum total cholesterol (tc), triglycerides (tg), and high - density lipoprotein cholesterol (hdl c). very low density lipoprotein is equal to 1/5 tg level and the ldl (hdl + vldl)}. the following atherogenic lipid indices were calculated : (tc hdl c)/hdl, ldl / hdl, and log (tg / hdl).the later represented small dense ldl particles. the results are presented as number, percent, odds ratio, and mean se. the data were analyzed using two - tailed unpaired student 's t test, difference between percentages test and simple correlation test taking p 0.05 as the lowest limit of significance. the results are presented as number, percent, odds ratio, and mean se. the data were analyzed using two - tailed unpaired student 's t test, difference between percentages test and simple correlation test taking p 0.05 as the lowest limit of significance. table 1 shows the characteristics of the study participants. there is nonsignificant difference (p > 0.05) between nondiabetic and diabetic groups regarding the age. a history of high blood pressure was significantly reported more often in the diabetic group compared with nondiabetic participants (50.9% vs 22.6%, respectively, p < 0.01). fasting serum glucose and duration of illness of diabetic patients at the time of the study were ranged from 115 to 360 mg / dl and 3 months to 23 years, respectively. forty - six out of 51 diabetics scored tss (maximum score was 11.32) compared with 5 out of 31 healthy individuals (maximum score was 4.66) (odds ratio 47.8), and 39 out of 51 diabetics scored nis - ll (maximum score was 28) compare with 3 out of 31 healthy individuals (maximum score was 9.7) (odds ratio 30.33). the characteristics of the study table 2 shows the electrophysiological study of sensory component of ulnar nerve and sural nerve. the means of amplitude (29.37 2.789 v) and conduction velocity (44.38 1.114 m / s) of ulnar nerve impulse among diabetics were significantly (p < 0.01) less than those observed with healthy individuals (42.07 3.250 v and 48.340.93 m / s, respectively). the minimum value of refractory period of ulnar nerve impulse was significantly prolonged among diabetics compared with healthy participants (1.508 0.034 vs 1.34 0.038 ms, respectively, p < 0.01). the significant changes in the electrophysiological study ; decreased conduction velocity (41.4 0.940 vs 46.55 0.902 m / s, p < 0.001) ; and prolonged the minimum refractory period (1.523 0.047 vs 1.320 0.035 ms, p < 0.01) of sural nerve were observed [table 2 ]. electrophysiological findings of sensory nerves (ulnar and sural) in patients with type 2 diabetes mellitus compared with nondiabetic subjects the significant changes in terms of decreased conduction velocity and prolonged of minimum f latency were observed in both motor component of ulnar nerve and common peroneal nerve in diabetic patients compared with healthy individuals [table 3 ]. the prolonged distal motor latency (3.22 0.071 ms) and the reduction in the amplitude of nerve impulse (5.75 0.274 v) were significantly (p < 0.001) observed in motor component of ulnar nerve. electrophysiological findings of motor nerves (ulnar and common peroneal) in patients with type 2 diabetes mellitus compared with nondiabetic subjects although the changes in the lipid profile were in terms of high serum tc, triglycerides, ldl c, and vldl in diabetic patients, they did not reach to a statistically significant level [table 4 ]. the significant decrease in serum hdl c in diabetic patients was an approximated 14% of mean healthy participants, was observed. significantly high values of atherogenic lipid ratios were observed in diabetic patients compared with healthy participants [table 4 ]. the results reported in this study revealed the existence of disturbances in lipid metabolism in type 2 diabetic patients presented with peripheral neuropathy. the significant high ratios of atherogenicity in diabetic patients compared with healthy subjects explained the significant high frequency of diabetics having high blood pressure. this observation is in agreement with shera., who reported the association of microvascular complications with hypertension. neuropathic pain and other symptoms occur in about 6%7% of the general population and this explains the scoring of ntss and nic ll in healthy subjects. the nerve conduction study revealed a significant decrease in conduction velocities of both sensory and motor nerves and prolonged the minimum refractory periods of sensory nerves and minimum f - wave latency of motor nerves. it is important to mention here that using of multivitamins, including vitamin b12 as over - the - counter drugs may alter the nerve conduction study. moreover, patients on oral hypoglycemic agents notably metformin may develop vitamin b12 deficiency and vitamin b12 is effective in alleviating the symptoms of neuropathy. the patterns of lipid profile as well as the atherogenic lipid ratios reported in this study were in agreement with earlier and current studies. reported significant association of metabolic syndrome (tg and hdl c contributed in metabolic syndrome criteria) in type 2 diabetes mellitus with a high risk (odds ratio 1.77) of neuropathy, while serum cholesterol did not differ in diabetic patients with neuropathy compared with those without neuropathy. found that neuropathy did not have any significant correlation with lipid profile abnormalities in type 2 diabetes mellitus. it is unlikely that the observed results are related to the medications because none of our patients received lipid lowering agents and the concomitant use of angiotensin converting enzyme inhibitors did not alter the electrophysiological properties and lipid profile. diabetic peripheral neuropathy as well as diabetic autonomic neuropathy did not correlate with lipid profile. the significant high log(tg / hdl c) ratio, which indicates the presence of small - density low - density lipoprotein may herald the existence of atherosclerosis. shoji. demonstrated high levels of small dense, low - density lipoprotein in patients with type 2 diabetes mellitus and it can be used as marker in the risk assessment for atherosclerosis. therefore, the lipid profiles are not adequate in studying the metabolic disturbances in type 2 diabetes mellitus and should be supplemented with determination of atheogenic lipid ratios, which explore the hidden atherosclerosis. the findings of this study reinforce an important message to clinicians to assess the lipid profile, including lipid ratios and log(tg / hdl c) ratio and evaluate for, preclinical atherosclerosis in diabetic patients who complain of neuropathic signs and symptoms. we conclude that metabolic lipid disturbances in terms of atherogenicity co - exists with neuropathy in type 2 diabetes mellitus despite duration of disease and is a useful marker for preclinical atherosclerosis.	objectives : the pathogenesis of neuropathy in type 2 diabetes mellitus is multifactorial.dyslipidemia may contribute to the development of diabetic neuropathy. this study aimed to assess the atherogenic lipid indices in type 2 diabetic patients with neuropathy.material and methods : fifty - one patients with type 2 diabetes mellitus and 31 healthy subjects were studied in the unit of neurophysiology at the university hospital of medical college, al - nahrin university in baghdad, iraq, from january 2002 to january 2003. neuropathy total symptom score (ntss), neuropathy impairment score in the lower leg (nis - ll), and electrophysiological study of sensory (ulnar and sural) and motor (ulnar and common peroneal) nerves were used to assess nerve function. fasting venous blood was obtained from each participant for determination of lipid profile and atherogenic lipid ratios.results:the frequency of high blood pressure was significantly higher in neuropathic patients. the electrophysiology study revealed significant decrease in conduction velocity of ulnar (sensory and motor components), sural, and common peroneal nerves. the minimum f - wave latency of motor nerve was significantly prolonged. among the lipid fractions, only high - density lipoprotein cholesterol was significantly reduced by 14% of healthy participant 's value. atherogenic lipid ratios were significantly higher in diabetic patients than corresponding healthy ratios.conclusion:metabolic lipid disturbances in terms of atherogenicity co - existwith neuropathy in type 2 diabetes mellitus, irrespective of duration of disease.
the age - old model of observation followed by attempt (ie, see one, do one, teach one) still exists and is still considered common in residency and fellowship training.1 other modalities available to today s medical learner include formal didactic lectures and multimedia learning (eg, mobile devices, textbooks, and internet).24 traditionally, teaching methods have been introduced with minimal studies of efficacy, if any. today, new methods are often held to a higher standard and are required to demonstrate superiority over some existing comparator. those methods with proven efficacy may be integrated into medical education curricula, either individually or in combination with other methods as appropriate. simulation can be defined as something that is made to look, feel, or behave like something else especially when applied to research or education.5 the use of simulation to mimic real life in the educational setting has arguably many origins but is closely tied to kolb s experiential learning theory.6 the educational experience provided by simulation is often hands - on, practical, provides immediate feedback, and allows for repetition. training with simulation does no harm to patients ; errors can be allowed to occur, can even be scheduled, and can provide realistic experiences managing common and rare situations which differs to training by chance where exposure is limited to real life cases that may or may not occur for every trainee. in the medical education setting, simulation - based interventions are now mature with a wide variety of applications.7 for procedural skills, deliberate practice in a simulated - setting is one example of an effective teaching strategy that has been used for specific skills training in central venous catheter insertion, subarachnoid block placement, and laryngoscopy.8 medical residents trained to place central venous catheters in simulation improve their clinical performance in the intensive care unit.9 the translation of knowledge, skills, and attitudes from the simulation - based classroom to clinical care is important to show effectiveness or efficacy and drive curricular change.10 regional anesthesia inherently requires precise procedural performance due to target nerve locations near vital structures (eg, blood vessels, pleura, organs, and nerves themselves) and seems naturally suited for the incorporation of simulation within the training curricula. further, the recent evolution of ultrasound guidance in the practice of regional anesthesia has created great demand for training in this imaging modality for physicians who completed training more than a decade ago and are still in clinical practice.11 the american society of regional anesthesia and pain medicine (asra) and european society of regional anesthesia and pain therapy (esra) have published joint committee guidelines for training in ultrasound - guided regional anesthesia, and the asra esra guidelines suggest that simulation play an important role.12 although there is widespread use of the modality, the evidence basis for simulation in regional anesthesia training is not completely established.2 in this review, we provide an up - to - date summary of the literature related to the use of simulation in regional anesthesia education and assess its effectiveness. a search of the medline database (pubmed.gov ; united states national library of medicine, national institutes of health, bethesda, md, usa) using regional anesthesia, simulation, regional anesthesia simulator, regional anesthesiology simulation, regional anesthesiology simulator, nerve block simulator, and nerve block simulation, was conducted between january and march 2015, and resulted in 393 citations. three of the authors (tk, au, and em) excluded non - english language, veterinary, nerve conduction (without nerve blockade), and magnetic resonance imaging articles and eliminated any duplicate citations based on the search terms and phrases ; 64 articles remained. the reference lists of pertinent articles were also manually searched and revealed 15 additional articles not included in the original medline search. the final sample of 79 articles was critically reviewed for simulation - based educational interventions and their effectiveness. fourteen articles published to date study the effect on learners who underwent a simulation - based educational intervention in regional anesthesia (table 1).1326 out of the 14, only studies by niazi,15 baranauskas,20 and udani tested a simulation - based teaching strategy against an equivalent control group not receiving simulation ; all three studies enrolled anesthesiology trainees.14,15,20 based on the results of niazi, residents in anesthesiology who received 1 hour of simulation training on needling and proper hand eye coordination using ultrasound were more successful than a control group receiving no simulation, as assessed by blocks performed on real patients.15 baranauskas studied different durations of simulation training and the potential effect on learners, including 0 hours of simulation.20 students with 2 hours of simulation training in needling with ultrasound performed faster and with fewer technical flaws than students with 1 hour of simulation training. additionally, those with 1 hour of training performed better than those with 0 hours of simulation training. udani presented a randomized study in which residents are assigned to receive simulation - based deliberate practice teaching or a base curriculum without simulation to learn subarachnoid blocks.14 in this study, performance scores using a task checklist improved in the participants receiving simulation - based teaching. however, there may not be a translational benefit as there is no difference between groups in the time required for participants to place subarachnoid blocks in actual patients. table 1 includes other studies that on some level assess effectiveness of simulation - based educational interventions, but the ability to discern the impact of simulation alone in these studies is limited by methodology. woodworth, gasko, friedman, and liu describe controlled studies.13,17,19,22 however, the interventions under study are more complex than just incremental simulation - based teaching compared to a control group without simulation. for example, woodworth include a teaching video in addition to simulation training, which is then compared to a control group.13 gasko compare a combination of cd - rom teaching material with simulation versus cd - rom teaching alone versus simulation teaching alone.17 friedman compare a high - fidelity simulator versus a low - fidelity epidural simulator without a comparison to no simulator.19 although these studies demonstrate the benefits of enhanced and more rigorous training, the results can not be attributed entirely to the introduction of simulation. liu evaluate three different types of simulators for regional anesthesia and conclude that novice practitioners decrease the number of errors in a simulated block with each additional practice attempt in simulation, regardless of the type of simulator used.22 moore, garcia - tomas, ouanes, and bretholz describe comprehensive regional anesthesia curricula and demonstrate their effectiveness.16,18,21,25 these interventions all include simulation - based teaching but are combined with other teaching strategies (eg, web - based tutorials, journal clubs, anatomy labs, etc) ; thus it is not possible to identify the specific contribution of simulation. kim, cheung, and brenner use a single simulation - based teaching intervention, not in the context of a comprehensive curriculum, but do not include a control group comparison.23,24,26 due to the nature of all participants receiving some type of teaching, the reported effectiveness is mostly positive. participants report feeling more comfortable with proceedures, and post - intervention written test scores increase. the studies by garcia - tomas and ouanes show post - intervention objective structured clinical examination (osce) scores also increase.18,21 brenner report that interprofessional debriefings in their crisis management course lead to richer discussions.26 however, moore show that although written test scores improve after implementation of their educational curriculum, there is no difference in block accuracy or efficiency as assessed in a simulator.16 bretholz also report that the initial increase in comfort after their educational intervention is not sustained one month later.25 to date, 18 articles describe the design of a novel regional anesthesia simulator (table 2).2744 simulators used for part - task training (eg, phantoms) in ultrasound - guided regional anesthesia vary based on the materials used and indications (ie, tasks to be taught). inorganic materials are common in commercially available phantoms but often lack realistic tactile sensation and haptic feedback and do not allow for injection of liquid solutions as is common in regional anesthesia techniques (figures 1 and 2). these phantoms are useful for teaching procedural steps, dexterity, target identification, and needle guidance. in contrast, organic phantoms (ie, meat) arguably produce the most realistic sonoanatomy and tactile sensation and do allow for injection and even catheter insertion, but they are not reusable and must be replaced for subsequent training sessions (figure 3). since it is not possible to present every model used for regional anesthesia practice, for the purpose of this article we define a novel simulator design as a new, previously undescribed product employing innovative technology to represent the realistic scenario of performing a regional anesthesia procedure. the novel simulator design takes one of the following forms : 1) a physical model (ie, phantom) ; 2) virtual reality model ; 3) robot - assisted model ; or 4) environmental modification. only niazi,32 lim,34 lee,28 and morse report an effect on learners attributable to the use of their novel simulators. none of the studies that report an effect on learners include a control group against which simulation - based teaching is compared. rather, these studies focus on before and after test comparisons and show positive results associated with training on the novel simulators described. lim demonstrate that after using their virtual reality simulator, participants skills in identifying surface landmarks for block placement improve.34 lee demonstrate that participants time performing an epidural block decreases with 20 repetitions on their simulator.28 morse use a crossover study design to show that performance is more consistent and that learning is quicker using a robot - assisted regional anesthesia technique in simulation when compared to a traditional, manual technique using practitioner s hands.27 eleven articles present a new medical device or evaluate an established nerve block technique in a simulated environment (table 3).4555 examples include primarily case reports on devices or techniques such as luer connectors, echogenic needles, needle guides, air test for inferring perineural catheter tip location, and a hand - on - syringe technique.4750,52,53 only kilicaslan,49 whittaker,45 neal,46 johnson,47 and gupta provide effectiveness data. simulation itself is not evaluated for efficacy, and studies that include a control group expose both the control and intervention groups to the simulated environment. reported outcomes include improvements in knowledge, skills, and/or behaviors with the use of the new device or technique. neal evaluate the use of a treatment checklist for the management of local anesthetic systemic toxicity (last). the authors describe creating a simulated, clinical environment utilizing a mannequin to represent a clinical patient who receives an inadvertent toxic dose of intravascular local anesthetic. the learners, anesthesiology residents, and fellows, are inserted into the simulated crisis with or without a last treatment checklist. in their findings, the authors demonstrate that physician trainees using a treatment checklist make better medical decisions related to the critical management of last than trainees who do not use a checklist. the remaining articles span a broad range of topics, and none test the effectiveness or efficacy of simulation - based teaching in regional anesthesia. some authors collect the needs of training regional anesthesiologists and establish metrics to assess performance, using simulators.5660 others use a simulated environment to calculate procedural learning curves and observe practitioner ergonomics.6167 although these articles touch on the topic of medical education in regional anesthesia, we consider them outside the scope of the present review on simulation - based educational interventions and their effectiveness. although simulation - based medical education has been shown to be effective for specific applications, our review reveals that similar evidence in regional anesthesia training is limited. we especially note a lack of comparative evidence studying the effectiveness of a simulation - based teaching strategy versus a proper control : participants receiving identical teaching as the intervention group less simulation - based instruction. this would mean that control group participants should have an equal amount of time in an educational setting even when they are not receiving simulation - based instruction. medical education research is expected to show efficacy or comparative - effectiveness against an established method, or else educators may presume if you teach [students ], they will learn.68 we know that the addition of simulation - based instruction automatically means extra training, but we can not assume that this extra training automatically leads to the acquisition of new knowledge or skills. we encourage the development, implementation, and scientific investigation of comprehensive regional anesthesia training curricula. from the work published to date, we are unable to deduce the incremental effectiveness (or ineffectiveness) of simulation - based regional anesthesia education, although we acknowledge that it has face validity. the description of novel simulators and development of new regional anesthesia techniques in a simulated environment represent just the first step to fully assess the role of simulation in teaching the knowledge, skills, and behaviors necessary for regional anesthesia competency. recently, regional anesthesia has been evolving further into the medical subspecialty of regional anesthesiology and acute pain medicine (raapm), and guidelines have been established for fellowship training.69 however, teaching strategies are not clearly recommended or identified. learners are taught using various techniques, most commonly as observers who transition to active participants in the apprenticeship model. a mix of didactic, multimedia, and simulation - based learning would augment this apprenticeship. the effectiveness of the variations in the raapm curricula is largely unknown, and curricula may very well be institution - specific for many reasons (eg, faculty and resources available).70,71 we see many advantages to simulation - based education in raapm. the key elements of simulation - based education, namely repetitive practice, targeted feedback, self - reflection, and avoiding harm to patients make it a useful teaching strategy. the simulated environment is well - suited for providing learners with the time and means to gain effective feedback and reflect on their performance ; something that is difficult to obtain when taking care of real patients as time in the clinical setting is often limited and rushed. many aspects of raapm are procedure based, and practice in simulation can recreate a realistic experience. we believe raapm may be the ideal specialty to embrace hybrid simulation (figure 4), a combination of part - task training and mannequin - based simulation to facilitate procedural practice in the context of life - like scenarios (eg, the anxious patient, a vasovagal response, or even last). repetitive practice in a controlled, simulated environment has been shown to lead to better procedural performance in the clinical setting.9 this is one of the tenets of deliberate practice, an effective use of simulation - based medical education.14 as educators, we hope that a student s mistakes will be made in the simulated environment, and corrected prior to actual patient care. another advantage of simulation - based education is that it exemplifies principles of adult learning and kolb s experiential learning theory. in our review of published articles, it is clear that learners of all stages in medical school, residency, fellowship, and clinical practice react and enjoy participating in simulation - based education even though it may initially cause some anxiety.72,73 alternatively, there may be disadvantages to simulation - based education in raapm. first, one may assume that a large capital investment in equipment and time is required.74 in our review, we find that this may not be true as many novel low - cost simulator designs have been described to help keep costs to a minimum while maintaining fidelity and achieving learning objectives.30,33,36,75 time in simulation is time away from clinical care. however, training guidelines established by the accreditation council for graduate medical education for anesthesiology residents now require time in simulation annually, and simulation is included in the requirements for maintenance of board certification in anesthesiology. there is momentum to encourage novice physicians to practice in simulation prior to engaging in clinical care. the same may be said for physicians who have already completed their training and are trying to learn a new technique such as ultrasound - guided peripheral nerve blockade. simulation may provide a more effective alternative to other methods currently available (eg, continuing medical education or industry - sponsored workshops), and self - teaching is still widespread in this population.76 there may be costs involved for practicing physicians to participate in continuing education as well as loss of income. in our opinion, the time spent in simulation may be a solid investment since a complication prevented by practice in simulation may actually save time and decrease complications in clinical practice. the search terms related to regional anesthesiology, regional anesthesia, simulation, and simulation - based education have many pseudonyms that may have resulted in an incomplete literature search and inability to evaluate every study exploring the effectiveness of simulation - based education in regional anesthesia. each of the authors completed his own web - based and manual searches to generate as comprehensive a reference list as was feasible. we define simulation broadly in this review and have included published articles that describe any type of simulated environment or training, including as little as 5 minutes in simulated - training,13 for the sake of completeness. in reality, we believe effective simulation - based education in raapm necessitates stricter criteria including personal feedback, repetitive practice, and student reflection. we as educators see additional benefits of simulation - based education. as anesthesiologists who specialize in raapm, the scope is not limited to just performance of nerve blocks. while achieving mastery in a new technical skill is a measurable and achievable result with simulation, this should not ever be a physician s final goal. studies by neal investigating the use of emergency checklists during a simulated last crisis and brenner employing similar crisis management simulations for pain physicians demonstrate the potential role of simulation in teaching professional practice far beyond mere technical skills. in raapm, the frontier for simulation - based education should evolve to include teaching difficult patient interactions (eg, demented elderly with hip fracture), ethical dilemmas (eg, wrong side blocks), interdisciplinary team - based care, safety culture, and more. as technological advances in regional anesthesia and analgesia emerge, such as new robot - assisted procedures, medications, equipment, and techniques, they will require rigorous testing followed by an effective means to update training. the simulated environment is ideal for trialing these innovations, comparing them to current practices, and proving them effective prior to full implementation in clinical care. when there is sufficient evidence to support a change in clinical practice, simulation may even be able to facilitate dissemination and implementation. in summary, the emerging subspecialty of raapm represents an opportunity to critically evaluate the current methods of teaching regional anesthesia techniques and the practice of acute pain medicine. to date, there have been a wide variety of simulation applications in this field, and efficacy has largely been assumed. however, a thorough review of the literature reveals that effective teaching strategies, including simulation, are not yet established completely, in raapm. future research should be directed toward comparative - effectiveness of simulation versus other accepted teaching methods, exploring the combination of procedural training with realistic clinical scenarios, and the application of simulation - based teaching curricula to a wider range of learner from the student to the practicing physician.	the emerging subspecialty of regional anesthesiology and acute pain medicine represents an opportunity to evaluate critically the current methods of teaching regional anesthesia techniques and the practice of acute pain medicine. to date, there have been a wide variety of simulation applications in this field, and efficacy has largely been assumed. however, a thorough review of the literature reveals that effective teaching strategies, including simulation, in regional anesthesiology and acute pain medicine are not established completely yet. future research should be directed toward comparative - effectiveness of simulation versus other accepted teaching methods, exploring the combination of procedural training with realistic clinical scenarios, and the application of simulation - based teaching curricula to a wider range of learner, from the student to the practicing physician.
obesity is a well - established risk factor for obesity - related cancers, especially for crc. the prevalence of obesity has doubled world - wide 1980 and at least 500 million people are classified as obese (body mass index [bmi ] 30 kg / m). lifestyle - based behavioral and pharmacological interventions for weight loss remain the major approaches to obesity prevention and management [35 ], but with limited success. surgical treatment for obesity (bariatric surgery) should be considered in patients with bmi > 40 kg / m or for those have other significant obesity - related comorbidities but bmi 3540 kg / m. bariatric surgery has been shown to be successful in achieving significant sustained weight loss with low operative mortality and proven safety in older (> 55 years) obese patients [68 ]. weight loss after bariatric surgery yields important health benefits, including resolution of type 2 diabetes in most treated patients and lower total mortality, attributed mainly to reduced incidence of major cardiovascular events and cancer overall. a meta - analysis of 21 observational studies from ma. indicated that obesity is associated with increased thyroid cancer risk, except for medullary thyroid cancer. given the role of overweight and obesity in increasing obesity - related cancers risk, one might expect that weight loss achieved through bariatric surgery would result in reduced risk of obesity - related cancers. we performed a systematic review and meta - analysis aiming to summarize the relationship between bariatric surgery and incidence of obesity - related cancers. our systematic review was conducted according to cochrane and the centre for reviews and dissemination guidelines and is reported according to prisma guidelines [1214 ]. pubmed, embase, web of science, and google scholar were independently searched by 2 investigators (xiang - wu yang and shai - hong zhu) to identify potential eligible studies. in addition, the reference lists of relevant reviews and studies retrieved were manually searched to identify additional eligible studies. the above databases were searched using a combination of indexed terms and text word searches of title, abstract, and keywords. the following index words were used : overweight or obese, behavioral or lifestyle - based or pharmacological or bariatric surgery or weight loss and obesity - related cancer or cancer. this search strategy was adapted for use with other databases, and further details are available on request. two reviewers (peng - zhou li and li - yong zhu) performed the initial screening of titles and abstracts against the inclusion and exclusion criteria to identify potentially relevant papers. full - text versions of potentially relevant papers identified from the initial screening were retrieved. in cases of disagreement in the initial screening stage, full text of the articles involved was retrieved. where multiple articles from the same study were found, only the report with the longest follow - up period was included. both reviewers screened all full - text articles to generate the final list of articles to be included in the systematic review and meta - analysis. the following data were extracted using a standardized form : study design, country of origin, period of study, follow - up period, baseline characteristics of population, inclusion / exclusion criteria, description of the intervention, and any relevant outcome measures (as described above). quality assessment of non - randomized studies was performed using the newcastle - ottawa scale (nos). we combined studies reporting obesity - related cancers incidence using a random- or fixed - effects meta - analysis. heterogeneity levels in these studies were quantified using the i statistic, and the 95% confidence interval (ci) for i was calculated using the higgins. method. statistical analyses were performed using the review manager (revman) computer program, version 5.3. pubmed, embase, web of science, and google scholar were independently searched by 2 investigators (xiang - wu yang and shai - hong zhu) to identify potential eligible studies. in addition, the reference lists of relevant reviews and studies retrieved were manually searched to identify additional eligible studies. the above databases were searched using a combination of indexed terms and text word searches of title, abstract, and keywords. the following index words were used : overweight or obese, behavioral or lifestyle - based or pharmacological or bariatric surgery or weight loss and obesity - related cancer or cancer. this search strategy was adapted for use with other databases, and further details are available on request. two reviewers (peng - zhou li and li - yong zhu) performed the initial screening of titles and abstracts against the inclusion and exclusion criteria to identify potentially relevant papers. full - text versions of potentially relevant papers identified from the initial screening were retrieved. in cases of disagreement in the initial screening stage, full text of the articles involved was retrieved. where multiple articles from the same study were found, only the report with the longest follow - up period was included. both reviewers screened all full - text articles to generate the final list of articles to be included in the systematic review and meta - analysis. the following data were extracted using a standardized form : study design, country of origin, period of study, follow - up period, baseline characteristics of population, inclusion / exclusion criteria, description of the intervention, and any relevant outcome measures (as described above). quality assessment of non - randomized studies was performed using the newcastle - ottawa scale (nos). we combined studies reporting obesity - related cancers incidence using a random- or fixed - effects meta - analysis. heterogeneity levels in these studies were quantified using the i statistic, and the 95% confidence interval (ci) for i was calculated using the higgins. method. statistical analyses were performed using the review manager (revman) computer program, version 5.3. the searches generated a total of 142 publications, of which titles and abstracts were screened. five studies that met our inclusion criteria were included in the present review and meta - analysis [1822 ]. no studies reporting on obesity - related cancers outcomes after bariatric surgery were excluded on the basis of study design or quality. they reported on obesity - related cancers incidence in a total study population of 26 331 individuals after bariatric surgery and 82 903 obese controls (table 1) [1822 ]. all studies had a predominance of female subjects (mean 79% and 66.8% in the bariatric surgery and control groups, respectively). adams. identified controls with a self reported bmi 35 kg / m on their driver s license identification application. the other 4 included studies identified the control population using the diagnosis of morbid obesity as recorded on respective data registries [1822 ]. the study by adams. was unique in reporting baseline bmi data and using bmi to match the bariatric surgery and control groups. none of the studies specified the treatment (if any) given to the control groups. gastric bypass was either the sole or the most commonly employed surgical procedure used in the included studies (table 1). follow - up bmi data was reported in only 1 study and this was for the bariatric surgery group only (mean bmi reduction 31.9% ; 95% ci, 31.132.2). reported a lower crc risk in the bariatric surgery group compared with the non - surgically treated controls (unadjusted rr 0.32 ; 95% ci, 0.0761.313, p=0.063). adams. also reported reduced crc risk in the bariatric surgery group (hr 0.70 ; 95% ci, 0.431.15, p=0.15). four of the studies had high scores (79, max score=9) using the nos tool, whereas the other had a lower score (4). there were too few studies to perform a funnel plot analysis of potential publication bias. data from the 5 bariatric surgery studies were included in a meta - analysis to estimate the overall effect of surgery on obesity - related cancers diagnosis using a random - effects model (figure 2). subgroup analysis was carried out to explore the potential influence of different cancer types and found that the estimated data were significantly altered by colorectal cancer (p=0.57) (figure 3). the meta - analysis revealed that weight loss after surgery was associated with significantly (p=0.0004) lower risk of subsequent obesity - related cancers diagnosis (or 0.43 ; 95% ci, 0.270.69) (figure 2). the meta - analysis also showed that weight loss after surgery was associated with significantly (p=0.02) lower risk of subsequent crc diagnosis (or 0.76 ; 95% ci, 0.610.95) (figure 4). they reported on obesity - related cancers incidence in a total study population of 26 331 individuals after bariatric surgery and 82 903 obese controls (table 1) [1822 ]. all studies had a predominance of female subjects (mean 79% and 66.8% in the bariatric surgery and control groups, respectively). adams. identified controls with a self reported bmi 35 kg / m on their driver s license identification application. the other 4 included studies identified the control population using the diagnosis of morbid obesity as recorded on respective data registries [1822 ]. the study by adams. was unique in reporting baseline bmi data and using bmi to match the bariatric surgery and control groups. none of the studies specified the treatment (if any) given to the control groups. gastric bypass was either the sole or the most commonly employed surgical procedure used in the included studies (table 1). follow - up bmi data was reported in only 1 study and this was for the bariatric surgery group only (mean bmi reduction 31.9% ; 95% ci, 31.132.2). reported a lower crc risk in the bariatric surgery group compared with the non - surgically treated controls (unadjusted rr 0.32 ; 95% ci, 0.0761.313, p=0.063). adams. also reported reduced crc risk in the bariatric surgery group (hr 0.70 ; 95% ci, 0.431.15, p=0.15). four of the studies had high scores (79, max score=9) using the nos tool, whereas the other had a lower score (4). there were too few studies to perform a funnel plot analysis of potential publication bias. data from the 5 bariatric surgery studies were included in a meta - analysis to estimate the overall effect of surgery on obesity - related cancers diagnosis using a random - effects model (figure 2). subgroup analysis was carried out to explore the potential influence of different cancer types and found that the estimated data were significantly altered by colorectal cancer (p=0.57) (figure 3). the meta - analysis revealed that weight loss after surgery was associated with significantly (p=0.0004) lower risk of subsequent obesity - related cancers diagnosis (or 0.43 ; 95% ci, 0.270.69) (figure 2). the meta - analysis also showed that weight loss after surgery was associated with significantly (p=0.02) lower risk of subsequent crc diagnosis (or 0.76 ; 95% ci, 0.610.95) (figure 4). to the best of our knowledge, this is the most complete systematic assessment and meta - analysis of the effects of bariatric surgery on the subsequent risk of obesity - related cancers. our meta - analysis of data from 5 observational studies involving 109 234 individuals followed for 512.3 years (where reported) revealed that bariatric surgery is associated with a 57% lower (p=0.0004) subsequent risk of obesity - related cancers diagnosis. no studies reporting on obesity - related cancers outcomes after bariatric surgery were excluded on the basis of study design or quality ; therefore, these results summarize the evidence currently available. our meta - analysis also revealed that bariatric surgery is associated with a 24% lower (p=0.02) subsequent risk of crc diagnosis. no studies reporting on crc - related outcomes after bariatric surgery were excluded on the basis of study design or quality ; therefore, these results summarize the evidence currently available. obesity is a complex multi - system health problem and it is acknowledged that a one system fits all mechanism is unlikely. given that bariatric surgery reduces inflammatory markers, reduces genomic damage, and/or enhances antineoplastic responses, one would expect a reduction in obesity - related cancers risk after bariatric surgery [2426 ]. the major limitation of this review is the small number of studies that met our inclusion criteria. the studies reviewed here, all on bariatric surgery, were observational and results from meta - analyses of observational studies should be treated with caution. such rcts would be difficult to conduct due to requiring many participants with lengthy follow - up to achieve sufficient power to detect any effect. the studies included in our meta - analysis had different lengths of follow - up. because of insufficient data in the primary studies, we were unable to perform regression analysis to investigate the effect of length of follow - up. however, the consistency in outcomes across the 5 studies suggests that the heterogeneity in duration of follow - up is unlikely to have biased the outcome. overweight or obese patients undergoing bariatric surgery are more likely to be motivated to lead a healthier lifestyle than untreated obese controls. in addition, 4 of the 5 studies included in our meta - analysis identified controls using the diagnosis of morbid obesity, which is an approach that could have selected less healthy obese individuals as controls. many environmental and lifestyle factors influence the risk of obesity - related cancers ; therefore, it is possible that factors other than weight loss following bariatric surgery are responsible for the apparently protective effect against obesity - related cancers observed in the present study. despite attempts to adjust for some confounders by design in some of the included studies (e.g., use of age- and sex - matched controls), potential confounding factors such as cigarette smoking and alcohol drinking were not adjusted for in any of the included studies. despite the inability to adjust for smoking or alcohol use because of a lack of direct data, derogar. attempted to examine possible effects by performing a sensitivity analysis in which those with smoking- and alcohol - related diagnoses were excluded from the analysis. a lower proportion of individuals had such a diagnosis in the bariatric surgery than in the control group (9.7% vs. 15.0%, respectively), but this exclusion did not change their findings. a study by the same group has shown a hyperproliferative state in rectal mucosal biopsies 6 months after rygb when compared to obese controls. the hypothesis states that the predominantly malabsorptive bariatric procedures, such as rygb, may expose the colorectal mucosa to harmful luminal contents and, given the latency in crc carcinogenesis, this effect becomes more apparent with time after surgery. there is a lack of high - quality evidence about the effects of bariatric surgery on the subsequent risk of obesity - related cancers. to date, all relevant data are from non - randomized observational studies. our meta - analysis of observational studies has shown that bariatric surgery (predominately using roux - en - y gastric bypass) was associated with 57% lower obesity - related cancers risk and 24% lower crc risk. well - designed prospective clinical studies of the long - term effects of weight loss interventions, including bariatric surgery, on obesity - related cancers risk are required.	backgroundthe aim of this meta - analysis was to investigate possible relationships between bariatric surgery and incidence of obesity - related cancers. obesity is an established risk factor for obesity - related cancers but the effects of bariatric surgery on incidence of obesity - related cancers are uncertain.material/methodswe searched 4 electronic databases to identify eligible studies : pubmed, embase, web of science, and google scholar. five observational studies were eligible and included in this meta - analysis. random - effects or fixed - effects odds ratio (or) and its corresponding 95% confidence interval (ci) were pooled.resultsmeta-analysis of these 5 observational studies revealed that bariatric surgery was associated with a significantly (p=0.0004) reduced incidence of obesity - related cancers (or=0.43, 95%ci, 0.270.69) when compared with control individuals. pooled estimated data showed that bariatric surgery is associated with a 24% lower colorectal cancer (crc) risk. no publication bias was detected by egger s or begg s tests.conclusionsalthough bariatric surgery may significantly reduce incidence of obesity - related cancers, considering the limitations of these included studies, these findings should be confirmed by further well - designed studies.
acyclovir and its congeners can rarely result in psychosis, mania and neurotoxicity in elderly, immunocompromised individuals.[14 ] however, there are no reports of acyclovir - associated hypomania in psychiatric population. mrs a is a 55-yr - old lady with bipolar affective disorder for the last 33 years with hypothyroidism since 2 years. her last episode was 10 months back, when she was diagnosed as mania with psychotic symptoms and subsequently was on treatment with tab. she presented to us with a 3-day history of irritability, increased talkativeness and decreased need for sleep. five days before the onset of these symptoms, patient had vesicular lesions over the body which was diagnosed as chicken pox by dermatologist (she did not have past history of chicken pox). the hypomanic symptoms were reported to have started after 24 hrs of starting acyclovir. on mental status examination, she was distractible, had irritable mood, emotional liability, increased psychomotor activity and decreased attention span. she did not have any psychotic symptoms. on young mania rating scale (ymrs) her thyroid profile showed mild elevation of tsh-9.28 mciu / ml (normal : 0.28 - 6.82 mciu / ml) with normal t3, t4 levels. she was diagnosed as having bipolar affective disorder, current episode hypomania (icd-10). she showed improvement in symptoms after 1 week (ymrs score 7) and was discharged from hospital. index patient had an episode of hypomania within a week of developing chicken pox and 24 hours after starting acyclovir. previous reports have documented psychiatric manifestations due to acyclovir and its congeners in elderly individuals with immunocompromised state or physical illness.[25 ] although an earlier report reported resolution of symptoms after stopping acyclovir, we started her on olanzapine in view of her past history of severe manic episodes. on naranjo adverse drug reaction probability scale she had a score of 4 indicating a possible association. we did not find any previous report of varicella zoster infection resulting in mania or hypomania, thus making it unlikely to be associated with the index episode. however, index episode being secondary to stress associated with chicken pox though, less likely, is still possible. in conclusion, our report suggests that acyclovir is a risk factor for mood episode in vulnerable individual and one need to be cautious while using antiviral agents in patients with psychiatric disorders.	acyclovir, a commonly used antiviral drug can rarely result in neuropsychiatric complications especially in elderly. we for the first time report acyclovir associated hypomania in an elderly woman. our report suggests that acyclovir is a risk factor for mood episode in vulnerable individual and one need to be cautious while using antiviral agents in patients with psychiatric disorders.
diabetes mellitus is one of the main endocrine diseases, which is more prevalent in the worldwide. cardio - vascular disease, as one of several chronic disorders, is the major complication of type 2 diabetes mellitus (t2 dm). cardio - vascular disease may result from associated abnormalities of plasma lipid and lipoprotein metabolism. there are some reports in literature suggesting that the insulin resistance has a central role in the development of dyslipidemia in diabetic patients. in insulin resistance status, free fatty acids flux from adipose tissue to liver and subsequently increase synthesis of very low density lipoprotein cholesterol and low density lipoprotein cholesterol (ldl - c) and decrease high density lipoprotein cholesterol (hdl - c) levels. moreover, hyperglycemia in insulin resistance can lead to increase of advanced glycation end products density. these products may directly promote atherosclerosis through changes in endothelial, macrophage, and smooth muscle cells functions. therefore, improving dyslipidemia would be effective to prevent complications of diabetic patients. several treatments including consumption of herbal medicines, soy protein, w-3 fatty acids, and fiber it is suggested that consumption of probiotics would be a novel approach to reduce the elevated levels of cholesterol. probiotics are defined as live microorganisms which have beneficial health effects on their host, when enter the intestine with an adequate amount. some of these health effects include : lowering hypercholesterolemia, prevention or management of diarrhea, constipation, lactose intolerance, diabetes mellitus, and colon cancer two main groups of probiotic bacteria, which are most commonly used, involve lactobacilli and bifidobacteria. some studies indicated that probiotics may be able to prevent increased levels of total cholesterol (tc), ldl - c and balance the ratio of ldl - c / hdl - c by de - conjugating of bile, hydrolysis of bile salts and increase cholesterol absorption, which consequently prevent and reduce the prevalence of cardio - vascular disease. consumption of probiotics in healthy men increased in serum levels of hdl - c and reduced in ldl - c / hdl - c indices. decreased serum ldl - c levels have been reported in hyper - lipidemic subjects by probiotic. nevertheless, intake of lactobacillus rhamnosus and propionibacterium freudenreichii in hypercholesterolemia volunteers had no affect on lipid profile. as was mentioned, available evidences about the effects of probiotic bacteria on lipid profile are controversial. therefore, this study with different type of probiotic bacteria was designed to evaluate the hypocholestrolemic effect of probiotic yogurt on lipid profile in patients with type 2 diabetes. this study was conducted in 44 patients with t2 dm were participated in this double - blind, randomized controlled clinical trial. the inclusion criteria included males and females, body mass index (bmi) > 25, serum ldl - c level of 100 mg / dl (normal range for men and women 25, serum ldl - c level of 100 mg / dl (normal range for men and women 0.05). for anthropometric parameters, no significant differences were seen between intervention and control groups at baseline and postintervention (p > 0.05). anthropometric characteristics of subjects at baseline and postintervention regarding with dietary intake analysis, the differences in mean energy and nutrient intake were not significant (p > 0.05) between two groups at baseline. calcium intake was increased in both groups after conventional and probiotic yogurt consumption, but not significantly (p = 0.061 and p = 0.057, respectively). protein intake was significantly (p = 0.008) elevated in control group at the end of study. however, the intakes of other nutrients did not significantly change from baseline to the postintervention in both groups [table 3 ]. dietary intakes of subjects at baseline and postintervention in this study, the levels of hba1c were significantly reduced in the intervention group compared with the control group at the end of study (7.09 1.23 vs. 8.09 1.58, p = 0.038). after adjusting for confounding factors (age, gender, physical activity, waist to hip ratio, and energy intake), the effects of probiotic and conventional yogurt consumption on lipid profile in patients with t2 dm have been shown in table 4. serum levels of ldl - c were decreased in subjects in the intervention group post probiotic consumption, but not significantly (p = 0.059). moreover, the ldl - c / hdl - c ratio was significantly reduced in the intervention group compared with the control group at the end of study. hdl - c levels were also significantly higher in the intervention group than in the control group postintervention (p = 0.023). however, no significant differences were observed in tc and tg levels between two groups at the end of study (p = 0.104 and p = 0.108 respectively). in the intervention group serum levels of tg were also diminished in the intervention group, but not significantly (p = 0.18). diabetes mellitus is an endocrine disorder that characterized by hyperglycemia and associated with disorders in lipid metabolism. dyslipidemia is a major risk factor for cardio - vascular disease in patients with diabetes. therefore, this study was carried out to evaluate probiotic effects on lipid profile in patients with t2 dm. in the present study, none of the subjects reported any adverse effect during the study related to yogurt consumption and it was reported that both kinds of yogurts were well - tolerated, therefore it is suggested that the compliance rate was satisfied. there were no significant differences observed in dietary intake, anthropometric indices and physical activity level between probiotic and conventional consumers during the study. hence, it is suggested that these possible confounders did not affect on the results of lipid profiles in this study. in another study, sadrzadeh - yeganeh. indicated that use of l. acidophilus la-5 and b. lactis bb-12 did nt significant changes anthropometry indices in hypercholestrolemic patients. results of the study by fuentes. also indicated that 12 weeks consumption of lactobacillus plantarum has no effect on weight, bmi, body fat mass in hyper - cholesterolemic subjects. in other experiments shown that body weight and weight of liver were not affected by b. lactis bb-12 in wild type mice. in this study, it was shown that consumption of probiotic yogurt significantly reduced hba1c levels. the results also showed that consumption of probiotic yogurt significantly reduced serum levels of ldl - c and ldl - c / hdl - c ratio, in patients with t2 dm patients. moreover, serum hdl - c levels were significantly increased after consumption of probiotic yogurt. ejtahed. found that consumption of probiotic yogurt in t2 dm patients significantly reduced hba1c concentration and serum levels of ldl - c and ldl - c / hdl - c ratio. decreased serum levels of ldl - c by lactobacillus reuteri ncibm30242 have been also reported by jones. in a study by wang., it was indicated that lactobacillus lip-1 and mg9 - 2 significantly decreased serum level of tg, tc and ldl - c in high - lipid diet fed mice. found that l. acidophilus and b. lactis significantly reduced ldl - c and tc level in hypercholestrolemic patients. consumption of a new symbiotic shake containing l. acidophilus, b. bifidum and fructo - oligosaccharides in older with type 2 diabetic patients significantly increased serum hdl - c, but did not impact on tc and tg in moroti. improvement of ldl - c / hdl - c ratio and increased serum level of hdl - c by probiotic have been reported in kiessling. trial. in another study, fabian and elmadfa found that daily consumption of probiotic yogurt significantly raised serum hdl - c and improved ratio of ldl - c / hdl - c. however, there are some other studies in contrast with our study regarding with the above - mentioned results. moreover, hattaka. indicated that intake of l. rhamnosus lc705 did not affect blood lipids in hyperlipidemic men. there are several possible mechanisms suggested about the effects of probiotic bacteria on lipid profile. it is indicated that different bacteria species may have different abilities to affect lipid profile.. showed that short chain fatty acids that are produced by lactic acid bacteria could inhibit the enzymatic synthesis of cholesterol. moreover, it is suggested that lactic acid bacteria may bind with cholesterol and inhibit its reabsorption in the body. in addition, lactobacilli and bifidobacteria cells are able to hydrolyze conjugated bile acids, excrete them faster and reduce its level to which they can be absorbed. the findings of this study also suggested that probiotic yogurt consumption might not affect on serum tc and tg levels in patients with t2 dm due to some possibilities that we suggest the type of microorganism used and some limitations of study including the number of subjects and short period of intervention in this study. this study indicated that consuming probiotic yogurt can improve lipid abnormalities in patients with t2 dm. therefore, it is suggested that eating probiotic yogurt may be used as an alternative prevention approach and treatment method to reduce diabetic complications. we also suggest further studies with larger sample size, longer period of intervention and various type of probiotic.	background : alteration in plasma lipid and lipoprotein profile has been documented in diabetic patients. the purpose of this study was to compare the effect of probiotic and conventional yogurt on lipid profile in type 2 diabetes mellitus patients.materials and methods : a total of 44 patients with type 2 diabetes aged 30 - 60 years old who had low density lipoprotein cholesterol (ldl - c) 100 mg / dl enrolled in this randomized, double blind controlled trial and were assigned to two intervention and control groups. the subjects in the intervention group consumed 300 g / d probiotic yogurt containing lactobacillus acidophilus la-5 and bifidobacterium lactis bb-12 and subjects in the control group consumed 300 g / d conventional yogurt for 8 weeks. anthropometric indices, dietary intake, and serum lipid profile were evaluated at the beginning and end of the intervention. independent - sample t - test, paired sample t - test, ancova, and repeated measures were used for statistical analysis.results:the consumption of probiotic yogurt caused significant decrease in ldl - c / high density lipoprotein cholesterol (hdl - c) ratio (3.13 1.00 - 2.07 0.71, p = 0.016). the levels of hdl - c were increased significantly (43.66 6.80 - 50.42 6.64, p = 0.023) in the intervention group postintervention. however, there were no significant differences in triglyceride and total cholesterol levels between two groups postintervention (p < 0.05).conclusion : it is suggested that probiotic yogurt consumption may be used as an alternative prevention approach and treatment method to improve dyslipidemia in patients with type 2 diabetes.
iron deficiency anemia was present in 1% to 2% of adults who according to the third national health and nutrition examination survey (nhanes iii).2 iron deficiency occurs in 11% of women, most often premenopausal, as well occurring in up to 4% of men. iron deficiency anemia is one of the common anemias and is usually associated with reactive thrombocytosis.3 thrombocytosis, when presented with iron deficiency anemia, is suggested to be due to the stimulation of platelet production. platelet production is induced by erythropoietin, whose levels are typically increased in patients with iron - deficiency anemia. augmented levels of iron deficiency the decline in platelets may be related to the variation in the activity of iron - dependent enzymes in megakaryocytosis and thromboiesis.4 the pathogenesis of itp is presumed to be related to increased platelet destruction along with inhibition of platelet production via the production of specific autoantibodies.5 chronic heavy or prolonged uterine bleeding is a common gynecologic problem and can be classified further as ovulatory or anovulatory. chronic heavy or prolonged uterine bleeding can result in severe anemia, where severe bleeding may lead to the necessity of immediate medical evaluation and treatment. furthermore, uterine leiomyomas, arising from the smooth muscle cells of myometrium, are the most commonly presented pelvic tumor in female patients.6 we report a rare case of anaemia and immune thrombocytopenia in a 34-year - old african american woman who presented with menorrhagia and metrorrhagia secondary to multiple uterine fibroids. her conditions were resolved with the introduction of packed red blood transfusion, platelets support, steroids, and iron therapy. few documented cases of thrombocytopenia associated with bleeding secondary to uterine fibroids have been reported previously. our case also establishes that thrombocytopenia can occur with anemia in a patient with menorrhagia and metrorrhagia. moreover, in similar cases, patients do respond to iron therapy and etiology treatments with positive results. a 34-year - old african american female patient was admitted to a medical intensive care unit (micu) presenting with symptoms of menorrhagia and metrorrhagia as a result of multiple uterine fibroids. the patient presented with little past medical history except chronic iron - deficiency anemia diagnosed in 1994 during oral surgery workup. the patient s anemia was attributed to heavy menses as a result of adenomyosis uteri and multiple uterine fibroids. she presented with a heavy vaginal bleed of 5-months duration along with lightheadedness palpitations, severe weakness, and fatigue. her physical exam was unremarkable and showed no sign of icterus, ecchymosis, and petechiae ; however, the patient had marked pallor. at the time of evaluation, the patient was hemodynamically stable with blood pressure of 120/70 mmhg, pulse of 110 beat per minute, temperature of 98.6 f and a respiratory rate of 19 breaths per minute. as part of a routine examination, a complete blood count was analyzed, which presented negative for any further medical complications. an ultrasound of the pelvis obtained as part of the evaluation for a heavy vaginal bleed revealed an anteverted uterus with heterogenous parenchyma, calcified anterior myoma, and a 0.54 cm ecchodense wall thickness exhibiting adenomyosis. laboratory studies on admission revealed the following values : white blood cell (wbc), 4200/mm ; hemoglobin, 5.6 g / dl ; hematocrit, 19.6% ; and platelet count, 16,000/mm. the differential counts were as follows : reticulocyte count, 0.031% ; polymorphnucleocytes (pnl), 62% ; lymphocytes, 28% ; and mono, 7%. moreover, iron deficiency anemia suggested as follows : ferritin, 3.85 ng / dl ; transferrin, 331.12 mg / dl ; b12, 695 pg / dl ; folate,18.6 ; methylmalonolic acid, 18 ; and homocysteine, 7.1. coagulation parameter values were within a normal range exhibiting a prothrombin time (pt) of 12 seconds, a partial thromboplastin ime (ptt) of 32 seconds, and international normalized ratio (inr) of 0.9. a peripheral blood smear from the patient with itp illustrates a decreased number of platelets, as well a normal appearing neutrophil and several erythrocytes. the absence of other findings from the peripheral smear was important in the diagnosis of itp more so than the observed findings. moreover, this smear demonstrateed an absence of immature leukocytes, as presented in leukemia and fragmented erythrocytes as typically exhibited in thrombotic thrombocytopenic purpura. furthermore, the peripheral blood smear did not indicate pseudothrombocytopenia, which is typically distinguish by clumps of platelets. the patient was given total of 3 units of packed red blood cells each with a volume of 350 ml, as well a high dose progesterone in the form of northindrone given 10 mg orally three times a day. iron therapy treatments consisted of intravenous iron in the form of ferrilicit 125 mg for 2 doses on 2 consecutive days followed by 325 mg of iron sulphate given three times a day orally preceeding intravenous therapy. in addition, 500 mg daily of vitamin c and 1 mg daily of folate were given orally. the patient continued to drop platelets to 9000/mm and received another unit of platelets, and then the platelet count gradually started to rise. the patient s complete blood count (cbc) was followed serially, and the last cbc on discharge showed resolution of anemia with hemoglobin 9.7 g / dl and platelets of 60,000/mm. in the meantime, a bone marrow biopsy was done, which confirmed immune thrombocytopenia. two months after the initial presentation, the patient had a hemoglobin of 12.2 g / dl and platelet count of 86,000/mm (fig. 3 and table 2). in this report, we noted that blood transfusion and iron therapy coincided with steroids is the cornerstone treatment in patients who present with iron deficiency anemia and immune thrombocytopenia. this case further illustrates that thrombocytopenia can present transiently with severe iron deficiency anemia ; however, this observation has rarely been reported. the exact mechanism of thrombocytopenia occurring with severe anemia in menorrhagic patients is not fully understood. however, it is suggested that thrombocytopenia may be related to the alteration in the activity of iron - dependent enzymes in thrombopoiesis. moreover, it is known that iron has both synthetic and regulatory roles in thrombopoeisis.7 low platelet counts are connected with decreased production and increased degradation, similarly noted in the red blood cell system. two additional mechanisms for low platelet count include dilutional or distributional thrombocytopenia as well as spurious or pseudothrombocytopenia. also, it may be noted that low platelet count may arise in immune thromcytopenia disorders. laboratory examination should start with cbc and a peripheral smear prepared from a freshly shed sample of nonanticoagulated blood. these laboratory procedures allow for estimation of platelet numbers, morphology, condition of platelet clumping, and any associated blood cell changes that may be exhibited. cbc and peripheral blood smear helped confirm the presence or absence of thrombotic thrombocytopenic purpura and acute leukemia as expeditiously as possible, since delay in these diagnoses and initiating therapy may be fatal.8 uterine leimyomas and adenomyosis are benign tumors that are mostly asymptomatic, yet can cause significant problems such as heavy uterine bleeding. this was evident in our case and was confirmed by pelvic and transvaginal ultrasound. furthermore, symptoms atypically presented relate to the number, size, and location of fibroid. there is unclear bleeding etiology with possibilities including both microscopic and macroscopic abnormalities of the uterine vasculature, impaired endometrial hemostasis, or molecular dysregulation of angiogenic factors.9 in our case of heavy uterine bleeding with severe iron deficiency anemia and thrombocytopenia, we had gradual normalization of platelet count and hemoglobin concentration after introduction of iron and supportive therapy. this platelet response to iron therapy suggests that there is a complex and potentially subtle mechanisms behind this process, which may be due to resetting of the erythrocyte and platelet - producing systems in the bone marrow coinciding with iron repletion.10 morris presented similar cases of four pediatric patients with iron deficiency anemia and severe thrombocytopenia at initial presentation. all four patients hemoglobin concentrations and platelet counts normalized within 1 to 3 weeks of initiating iron supplementation, similar to our results. however, these patients compared to our case had a platelet overshoot furthermore, in our case, the patient had a component of immune mediated thrombocytopenia, which is noted and confirmed by serology including coombs test. moreover, an initial drop of platelet count occurred despite blood transfusion and iron therapy regimens.11 perlman described six children with iron deficiency and thrombocytopenia. when treated with iron therapy, a response of significant thromocytosis had occurred within the first 24 hours of treatment. this was a phenomenon that was explained by the theory of bilic and bilicgthat suggests iron therapy in anemia - thrombocytopenia may result in normalization up to an overcorrection of platelet count due to erythropoietin and thrombopoietin homology.12,13 ganti, treated a 39-year - old female jehovah s witness with several months history of heavy irregular menses and severe iron deficiency. as blood transfusion was not possible, intravenous iron replacement therapy was given, which led to a transient leucopenia and thrombocytopenia. both leucopenia and thrombocytopenia had recovered upon continuing iron supplementation, while our case, which had a drop in platelet count after iron therapy and transfusion, was most likely due to immune thrombocytopenia. the pathogenesis of itp is presumed to be related to increased platelet destruction along with inhibition of platelet production via the production of specific autoantibodies which explains our disease course. furthermore, our case demonstrates of the vital role of iron therapy in restoration of red blood cell and platelet cell count in iron depleted individuals.14 due to the commonly encountered cases of severe anemia and thrombocytopenia with underlying gynecologic causes in females during there reproductive period, more research input must be geared towards exploring various associated etiologies. furthermore, an establishment of solid management guidelines must be proposed, especially if a concomitant pathogenesis such as immune thrombocytopenia is presented.	we report a rare case of anemia and thrombocytopenia as a result of uterine fibroid and adenomyosis, complicated by immune thrombocytopenic purpura (itp). symptoms were presented as menorrhagia and metrorrhagia in a 34-year - old african american woman, who was later treated with blood and platelet transfusion and iron therapy with steroids. uterine fibroids are commonly found to cause hematologic disturbances such as anemia and reactive thrombocytosis and, less commonly, thrombocytopenia. moreover, such hematologic disturbances are secondary to heavy and irregular uterine bleeding, which is typically presented. a previous uterine fibroid diagnosis was made and reconfirmed by pelvic and transvaginal ultrasound to exclude other locoregional pathologies. itp was suggested by coombs test and several other serologies, leading to confirmation via bone marrow biopsy. in a previous case study, we reported positive responses in hemotecrit and platelet count after the introduction of iron therapy to an iron - depleted middle - aged female presenting severe anemia and thrombocytopenia.1
computer - assisted surgery has been popularized in orthopedic surgery in the last 10 years. whilst a number of recent randomized control trials have shown some benefit in terms of implant position over conventional jig - based referencing,1 many navigation systems require the use of reference arrays, which are fixed to the tibia and femur with pins. a 58-year - old man with a diagnosis of varus osteoarthritis (oa) of the right knee underwent navigated total knee arthroplasty (tka) using standard technique. we use a passive reflector - based system (brainlab, feldkirchen, germany) with fixation of the femoral reference array using two 3-mm - diameter threaded pins. these are inserted anteriorly through stab incisions, with the knee in flexion, as proximally as the tourniquet will allow. tibial pins are inserted in the mid diaphysis into the subcutaneous surface of the tibia [figure 1 ]. all pins are bicortical in order to maintain secure fixation for the duration of surgery. peroperative photographs (a) insertion of tibial and femoral reference arrays (b) the styloid used to map out the tibia and femur computer registration is performed with digitalization of the hip and ankle centers and specific landmarks of the knee. a size 6 generation ii cemented femoral implant and a size 6 generationii cemented tibial component were implanted with an 11-mm polyethylene insert. the patient had some pain and thigh swelling postoperatively, but this was considered to be in keeping with recent surgery. he was discharged on the third postoperative day, having satisfied physiotherapy and occupational therapy goals. he reported 3 days later with increased right thigh pain, swelling, and a limited range of movement. an ultrasound guided diagnosis of a quadriceps hematoma at the site of the femoral pins was made. this was confirmed by computerized topography (ct) with intravenous contrast [figure 2 ], which showed a large quadriceps hematoma and active bleeding into the femoral canal from a branch of the superficial femoral artery as it entered linea aspera at the site of pin insertion. two ct scan images showing active bleeding into the femoral canal on day 10, the hematoma was evacuated and two 14-mm unicortical screws were inserted into the femur at the site of the bleed to tamponade the bleed. unicortical screws were used to reduce the risk of further arterial injury with bicortical screws and the ct scan also showed unicortical injury. at 2 weeks post presentation he then had a flexion of 090, but also had some persistent swelling and was prescribed a short course of diazepam. he showed continued improvement since the second operation and had no further complications at the final followup 6 months later [figure 3 ]. computer navigated tka has the potential advantage of improved implant position, which is known to reduce the rate of aseptic loosening. there have been a number of studies reporting complications of computer navigated tka among these. bhling.,9 chin.,10 and bthis.11 demonstrated longer tourniquet time with computer navigation. kalairajah.12 reported a longer tourniquet time as well as a statistically significant decrease in blood drainage. chauhan.13 and jenny.4 found that computerized navigation was associated with a longer operating time. stckl.14 reported one case of poor tibial tracker stability, related to osteoporotic bone, resulting in abandonment of computer navigation, from 64 patients. hernadez - vaquero15 reported four cases of failed pin fixation (three iliac crest and one femur) requiring abandonment of computer navigation from a total of 112 patients. our report is the only case of arterial injury in the literature related to navigation pin usage. if the patient develops an unexpected postoperative swelling with increasing pain this diagnosis needs to be taken into consideration.	the use of computer navigation has the potential to improve implant position in total knee arthroplasty (tka), but pin fixation of reference arrays introduces an additional potential source of complications. we report a case of vascular injury related to the insertion of a femoral pin during navigated tka.
in this issue of critical care, yildiz and colleagues reported the first randomized, controlled trial on the efficacy and safety of physiologic doses of steroids in severe sepsis. during the past 5 years, five phase ii trials and a phase iii placebo - controlled trial on cortisol replacement, i.e. prolonged treatment with physiologic doses of steroids, have been completed in patients with vasopressor - dependent septic shock (table 1). two of them have already been published in peer - reviewed journals, three have been published in abstract form and will be published shortly in peer reviewed journals, and the results of a phase ii trial that has just been completed will be available very soon (oppert and colleagues, personal communication). these trials have consistently shown beneficial effects of cortisol replacement on the amount of vasopressors, on the duration of shock, on the duration and intensity of organ dysfunction, and on the intensity of the systemic inflammatory response. the survival benefit observed with cortisol replacement in several phase ii trials was recently confirmed by the phase iii trial. in all these trials, cortisol replacement was never associated with even a trend toward serious side effects. a confirmatory phase iii, multinational, placebo - controlled trial (the corticus study) is under way, and results should be available within the next 3 years. in the meantime, given the consistency of the results across available trials, cortisol replacement should be considered as a standard of care for patients with vasopressor - dependent septic shock. yildiz and colleagues found that, in patients with severe sepsis, irrespective of the need for vasopressors, treatment for 10 days with prednisolone given intravenously twice daily (5 mg at 6 a.m. and 2.5 mg at 6 p.m.) was associated with a 20% absolute reduction in mortality within 28 days. these findings are very challenging, because they suggest that cortisol replacement might be introduced in severe sepsis as well as in vasopressor - dependent septic shock, and that the mechanisms underlying the favorable effects of the treatment might not be limited to a reduction of the need for vasopressors. obviously, a phase iii trial must be set up to confirm the potential survival benefit of cortisol replacement in patients with severe sepsis who are not vasopressor - dependent. recently completed randomized, controlled trials of cortisol replacement in septic shock the study by yildiz and colleagues addressed another important issue, i.e. the need for an adrenocorticotropic hormone (acth) test to identify patients with severe sepsis or septic shock who will benefit from cortisol replacement. in this small trial, the effects of steroids were not significantly altered by the results of a short acth test. however, there were only 14 nonresponders (5 in the steroid group and 9 in the placebo group) to the test, i.e. a cortisol increment after a 250-g intravenous bolus of acth of less than 9 g / dl, as previously defined. subsequently, in this subset of patients with occult adrenal insufficiency, the 15.6% absolute reduction in 28-day mortality in favor of the steroid group was not statistically significant. among the six completed trials of cortisol replacement in septic shock, only two reported separate data according to the results of a short corticotropin test, and only one trial was adequately powered to assess the survival benefit of cortisol replacement in patients with occult adrenal insufficiency. in fact, in this trial, cortisol replacement dramatically improved rates of survival for 28 days in the intensive care unit or elsewhere in the hospital in the nonresponders to the acth test but not in those having an increase in cortisol levels of more than 9 g / dl after acth. however, this trial was not adequately powered to allow definite conclusions regarding patients deemed to have normal cortisol response to acth and we therefore need to wait for the results of the corticus study. in the meantime, cortisol replacement should be considered only in vasopressor - dependent septic shock with occult adrenal insufficiency. as the results of the acth test might not be available everywhere at all times, it is recommended that cortisol replacement be started immediately after the acth test is performed, and that in the light of the results of the test, treatment could be continued for up to 7 days in nonresponders and stopped in patients with normal cortisol response to acth.	based on several recently completed randomized controlled trials, cortisol replacement is likely to become a standard of care for vasopressor dependent septic shock. further studies are needed in order to accomplish whether this treatment should be limited to patients with a blunted cortisol response to corticotrophin. similarly, in patients with severe sepsis who do not need vasopressors, the benefit / risk ratio of cortisol replacement remains to be assessed.
gemination is an uncommon anomaly caused by the incomplete attempt of a single tooth bud to form two teeth.1 geminated teeth are found more frequently in primary dentition than permanent dentition.24 the prevalence in the latter ranges from 0.07% to 2.1%.57 maxillary central incisors were found to be the most commonly affected by gemination.6,7 gemination causes aesthetic problems, bad positioning, and impaction of adjacent teeth because of the greater volume of the geminated tooth crown.8 talon cusps are also uncommon dental anomalies manifesting as an accessory cusp - like structure projecting from the cingulum area or the cemento - enamel junction of a maxillary or mandibular anterior tooth in either primary or permanent dentition.9,10 the prevalence of talon cusps in permanent dentition differs among populations, ranging between 0.6% 7.7%.1116 the clinical problems associated with talon cusps include food stagnation ; caries periapical lesions ; tongue irritation ; breast feeding problems ; compromised aesthetics ; occlusal interference, which may lead to accidental cusp fracture ; displacement of the affected tooth ; dental sensitivity, temporomandibular joint pain ; and periodontal problems because of excessive occlusal force.10,11,17 even though talon cusp may occur in isolation, it may also be associated with other variations in crown anatomy, such as peg - shaped crown, supernumerary teeth, and dens invaginatus.10,1822 a talon cusp on a geminated tooth is a very rare finding. five cases of unilateral geminated teeth with talon cusps20,2326 have been reported, and no cases of bilateral geminated teeth with talon cusps have been reported in the literature. this article aims to describe an unusual case of bilateral geminated teeth with talon cusps and the multidisciplinary treatment administered in this case. he had no history of any severe illness or orofacial trauma, and his physical development appeared normal for his age. clinical examination revealed that the crowns of his maxillary central incisors were very large (figure 1). since he had a normal number of teeth, the shape anomaly of the crowns was attributed to bilateral gemination. the mesiodistal diameters for the right maxillary incisor and left maxillary central incisor were 12.1 mm and 12.7 mm, respectively. the mesiodistal widths of the crowns were significantly greater in the incisal third than the cole region, which created a fan - like shape. although the buccolingual groove reached the incisal edge for the left incisor, it finished at around the middle third of the crown for the right incisor. an incisal notch was located in the mesial portion of the incisal edge for the left incisor, but the right incisor had 2 incisal notches on the mesial and distal portions of the incisal edge. both central incisors exhibited pronounced, well - demarcated accessory cusps on the palatal surfaces (figure 2). the talon cusp was 5.6 mm long, 4.3 mm wide and 4.3 mm thick for the right incisor. for the left incisor, it was 5.9 mm long, 4.7 mm wide and 4.6 mm thick. the anomalous cusp of the right incisor occupied the distal half of the palatal surface. in the left incisor, it was located centrally. both anomalous cusps extended from the gingival margin to the incisal edges of the crowns and had a y - shaped outline. there were vertical grooves on the mesial and distal aspects of the talon cusps extending from the base of the cusp to the tip. panoramic and periapical radiographs (figure 3) revealed a v - shaped radiopaque structure superimposed on the image of the affected large crowns. pulp extensions could be traced to the middle of the anomalous cusps of both teeth. on the periapical radiographs, the pulp chambers and root canals were large in both teeth, but there was only 1 of each. the patient had skeletal and dental class i malocclusion. during clinical examination, a space requirement of 3 mm after clinical and radiographic examinations, management was directed toward eliminating the tongue irritation caused by the talon cusps and improving the aesthetic appearance of the anterior teeth by minimal restorative and orthodontic treatment. to eliminate the source of tongue irritation, the talon cusps in both incisors were gradually reduced using a water - cooled diamond bur on a high - speed hand piece on 2 consecutive sittings held 68 weeks apart. the purpose of this period is to allow for the deposition of reparative dentin for pulpal protection and to avoid pulpal exposure. after both grinding procedures, the exposed surface was treated with fluoride gel as a desensitizing agent (topex neutral ph, sultan healthcare inc. the distinct enamel grooves running buccolingually on both central incisors were restored with a composite resin, and the aesthetic appearance of anterior teeth was improved (3 m filtek supreme xt, 3 m espe, usa) (figure 4). the vertical grooves on the mesial and distal aspects of the talon cusps on the palatal surfaces were obliterated with a flowable composite resin (3 m filtek supreme xt, 3 m espe, usa). after this minimal restorative treatment, fixed orthodontic treatment was initiated for repositioning of the left maxillary lateral incisors. after the treatment is completed, the aesthetic appearance will be checked again, and if necessary, it will be rearranged. talon cusp and gemination are relatively rare dental anomalies,1,9,10 and the bilateral concomitancy of gemination and talon cusp is even more unusual. two cases of bilateral gemination with talon cusps in the maxillary central incisors have been reported in the literature, but only the right incisors had talon cusps.26 in the current case, both geminated teeth had talon cusps, and the mesiodistal widths of the teeth were significantly different between the cole region and the incisal thirds of the crowns ; the mesiodistal width of the incisal third was significantly greater than that of the cole region. this finding was also different from that in other reported cases in the literature.20,21,2326 because of this appearance, the aesthetic problems were more striking in the present case. the talon cusps in this case were also more pronounced than those in other reported cases. they significantly irritated the patient s tongue but did not interfere with the occlusion because of the tet - a - tet occlusion of the anterior teeth. in table 1, the details of previous cases of geminated teeth with talon cusps and our case is presented. however, large prominent cusps, as in our case, may cause problems for the patient and diagnostic and treatment planning difficulties for the dentist.20 the treatment of talon cusps involves careful clinical judgment and depends on whether the cusp contains or is devoid of a pulp horn. some reports involving radiographic examination indicated that talon cusps contain pulp horns to varying extents. pulp extensions could be radiographically traced to the middle of the anomalous cusps in the present case. however, tracing pulpal configuration inside the talon cusp by using radiography is inherently difficult because the cusp is superimposed over the affected tooth crown. therefore, on the basis of the application used by al - omari,20 management was directed toward removing the source of tongue irritation. gemination is a developmental aberration that occurs during morphodifferentiation of the tooth bud, which attempts to divide. fusion is another cause of double teeth but it manifests as a missing tooth. in our patients, both his central incisors were very large and fan shaped and lateral incisors were palatinally displaced. after the size and shape of the geminated incisors were reduced and corrected by minimal restorative treatment, fixed orthodontic treatment was initiated to reposition the lateral incisors. generally, geminated incisors have a single large pulp chamber and root canal, as in the present case. tomazinho reported a geminated tooth with a single large pulp chamber and mesial and distal root canals that were joined at the apical third. during the root - canal treatment of geminated teeth, the structure of the pulp tissue should be carefully examined by radiographic examination. in summary, long term management protocol should be necessary to eliminate the complaints of patients with geminated teeth with talon cusp.	talon cusps and gemination are rare dental anomalies that can cause significant aesthetic and clinical problems. bilateral talon cusps on geminated teeth have not been reported so far. the case of gemination with talon cusps on both maxillary central incisors was presented in this report. the main complaints of the patient were tongue irritation and aesthetic problems. the talon cusps were gradually reduced at 2 consecutive sittings and the exposed surface was treated with a fluoride gel. the aesthetical appearance was improved using a composite resin. fixed orthodontic treatment was initiated for repositioning the left maxillary lateral incisor. a long term, multidisciplinary approach is necessary for the treatment of gemination with talon cusps.
infection is probably the most dangerous and feared complication after total hip arthroplasty (tha). since timely treatment is mandatory to increase the chance of success, careful patient monitoring and prompt irrigation and debridement of possibly infected wounds are essential. absorbable sutures are widely used for wound closure after tha, and vicryl plus (ethicon, johnson & johnson) combines the features of a well known absorbable suture (vicryl) with a broad - spectrum antibacterial agent (triclosan). a few cases of adverse reactions to vicryl / vicryl plus have reported to date in contrast with the worldwide circulation of these products in most fields of surgery ; however, interestingly, three cases were described as mimicking infection after tha. the present paper aims to present another two cases, whose clinical history, histopathological and laboratory findings are so distinctive (and consistent with previous reports) as to define a novel, exceptional tha complication, the suture - related pseudoinfection (srpi). a 63-year - old woman with displaced femoral neck fracture of the left hip underwent cementless ceramic - on - ceramic tha through straight lateral approach. the patient had no relevant risk factors for infection (immunocompetent, non - diabetic with normal body mass index and no history of recent infections) except light smoking (less than 10 cigarettes per day), and surgery was completed within 80 min. antibiotic prophylaxis was obtained with a short intravenous course of cefazolin (2 g before operation, followed by 1 g 61422 h later). the trochanteric digastrics tendon split and the fascial incision were sutured with vycril plus # 2, while subcutaneous tissue was sutured with vycril plus # 2 and # 0 in the deep layer and vycril plus # 2/0 in the superficial layer. two deep suction drains were maintained for 48 h and removed at first dressing change. the post - operative course was uneventful : body temperature normalized (below 37 c) 2 days after surgery, the wound was dry with no signs of inflammation or hematoma, c - reactive protein (crp) levels halved every 2 days, and the hip was mobile and pain - free. the patient was therefore discharged home 8 days after surgery. on the 14th postoperative day skin staples were removed and on the fifth week the patient was seen in the outpatient clinic ; x - rays and clinical examination were extremely satisfactory, and she was allowed to abandon her crutches and to resume ordinary life activities. in the ninth week from index surgery the patient, previously pain - free, started to complain of tenderness, warmth and redness of the skin around the scar. she was examined immediately after symptom onset and a minimal seropurulent discharge was noticed from a small sinus, which was carefully dilated with a sterile swab, allowing the exudate to drain and microbiological samples to be collected (with negative results). blood tests detected mildly elevated crp (1.4 mg / dl) and erythrocyte sedimentation rate (esr) (60 mm / h), but no elevation of white blood cell (wbc) count. ultrasonographic (us) examination of the hip demonstrated an abscess in the deep layer of the hypodermis, with several sinus tracts towards the surface. the presence of local signs (warmth, redness, swelling, tenderness and fluid discharge), us signs (abscess) and laboratory signs (elevated crp) of surgical site infection convinced us to schedule immediate irrigation and debridement (i d) within 1 week from complication onset. the debridement was performed through the pre - existing scar, with excision of multiple sinus tracts. a massive abscess, with purulent grey - yellowish content, was retrieved in the deep subcutaneous tissue, extending along the whole incision. after culture and histological sampling, the cavity was debrided and irrigated with diluted iodopovidone and saline solution. the fascia, apparently intact, was then incised and the pertrochanteric space was inspected. since no signs of infection were retrieved below the fascia, surgical gowns, gloves and instruments were replaced before splitting the digastrics tendon and opening the periprosthetic capsule ; within the joint just a few milliliters of clear fluid were found. thorough irrigation was performed after microbiological sampling. since the infection seemed not to have spread below the fascia, and given the risk of ceramic rupture associated with head and liner exchange, no attempt was made to remove them. the wound was closed in a standard fashion, but employing as few sutures as possible so as not to leave an excessive amount of foreign material in a potentially infected surgical site, and two suction drains (whose tips were sent to the microbiology laboratory for further cultures) were placed. during the procedure, immediately after culture sampling, an empirical course of antibiotics was started (teicoplanin 800 mg and levofloxacin 1 g i.v.) and was confirmed postoperatively (teicoplanin 600 mg q.d. and levofloxacin 500 mg b.i.d.). on the first postoperative day the patient was already pain - free, her body temperature normalized and the wound healed regularly. crp stayed within the range throughout the hospitalization, after normalizing with sinus drainage 3 days before surgery. no cultures were positive, but given the strong suspicion of infection and the absence of adverse reactions to antibiotics, the patient was discharged home 7 days after i d with an oral 4-week therapy (cotrimoxazole 800 mg/160 mg b.i.d. and levofloxacin 500 mg q.d.). the histological examination of the collected material demonstrated a giant - cell foreign - body reaction, where some amorphous birefringent material was clearly visible (fig. gc giant cell, fb foreign body (haematoxylin and eosin, original magnification 200) foreign - body reaction in the superficial hypodermis. gc giant cell, fb foreign body (haematoxylin and eosin, original magnification 200) even though the patient was asymptomatic, she was followed up monthly with physical examinations and blood tests (fig. 2), and 8 weeks after i d another mild crp elevation (1.6 mg / dl) was noticed without reasonable causes, except minimal scar inflammation and extrusion of suture material. the wound was treated with iodopovidone solution and daily dressing change and healed in a week after complete extrusion of the foreign material. the two grey vertical lines represent the procedures (tha and i d), while the grey horizontal line represents the highest value of the normal crp range (1 mg / dl) c - reactive protein kinetics of patient # 1. the two grey vertical lines represent the procedures (tha and i d), while the grey horizontal line represents the highest value of the normal crp range (1 mg / dl) a 64-year - old woman affected by bilateral hip osteoarthritis underwent cementless ceramic - on - ceramic right hip tha through straight lateral approach. she had no relevant risk factors for infection, surgery was uncomplicated and lasted about 70 min. the same antibiotic prophylaxis, surgical technique and suture materials were employed as in case # 1. the post - operative course was similarly uneventful : body temperature never exceeded 37 c, the wound was dry with no signs of inflammation or hematoma, crp fell within the normal range in 12 days, and the hip was mobile and pain - free. the patient was therefore discharged to the rehabilitation facility as soon as an inpatient rehab bed was available, 8 days after surgery. on the 15th postoperative day skin staples were removed, she returned home and on the fifth week the patient was seen in the outpatient clinic with excellent functional recovery and x - rays. she was allowed to abandon her crutches and to resume ordinary life activities. in the eighth week after tha, almost as in case # 1, the patient, previously pain - free, started complaining of tenderness, warmth and redness of the scar, with mild elevation of body temperature (37.5 c). she was seen 3 days after symptom onset and no drainage was noticed from the scar, but it was extremely painful on palpation. blood tests detected mildly elevated crp (1.5 mg / dl) and esr (50 mm / h), but no wbc count elevation. ultrasonographic examination of the hip demonstrated a bulky pertrochanteric abscess, with several sinus tracts perforating the fascia towards the surface. the presence of local signs (warmth, redness, swelling and tenderness), us signs (abscess) and laboratory signs (elevated crp) of surgical site infection persuaded us to schedule prompt reoperation for i d. the debridement was performed through the pre - existing scar and a massive abscess, with purulent grey - yellowish material, was retrieved in the deep hypodermis. several fistulae perforated the fascia and allowed the exudates to spread in the pertrochanteric space. after culture and histological sampling, the cavity was debrided and irrigated with diluted iodopovidone and saline solution. the fascia was then incised, trans - fascial fistulae excised and the pertrochanteric space debrided and irrigated similarly. since the abductor mechanism seemed to be intact and the preoperative us examination did not show joint space effusion, surgical gowns, gloves and instruments were replaced before splitting the digastrics tendon and opening the joint capsule ; the same healthy periprosthetic environment was found as in case # 1. the procedure was completed as previously described, with microbiological sampling, careful joint irrigation but without head / liner exchange, and administering the same intravenous empirical antibiotic therapy. on the first postoperative day no cultures (either intraoperative or postoperative on drainage tube tips) were positive, but given the strong suspicion of infection and the absence of adverse reactions to antibiotics, the patient was discharged home 13 days after i d with an oral 4-week therapy (amoxicillin 1 g t.i.d. and levofloxacin 500 mg q.d.). histological examination of the material collected showed the same pattern of foreign - body reaction : a mixed inflammatory cell infiltrate, with multinucleated giant cells and amorphous birefringent material (fig. 3).fig. 3foreign - body reaction in the superficial (a) and deep (b) hypodermis. gc giant cell, fb foreign body, vs vascular space (haematoxylin and eosin, original magnification 400) foreign - body reaction in the superficial (a) and deep (b) hypodermis. gc giant cell, fb foreign body, vs vascular space (haematoxylin and eosin, original magnification 400) during the postoperative clinical and laboratory follow - up (fig. 4), the patient demonstrated an elevated crp (1.3 mg / dl) 5 weeks after reoperation, associated with suture material extrusion. frequent wound care allowed complete recovery and renormalization of crp within 2 weeks, without any further recurrence.fig. the two grey vertical lines represent the procedures (tha and i d), while the grey horizontal line represents the highest value of the normal crp range (1 mg / dl) c - reactive protein kinetics of patient # 2. the two grey vertical lines represent the procedures (tha and i d), while the grey horizontal line represents the highest value of the normal crp range (1 mg / dl) fourteen months after right hip tha, the patient, satisfied with the previous joint replacement despite the complication, requested left hip tha as originally planned. in order to minimize the risk of foreign - body reaction, a different suture material with no colouring or antibacterial agents was selected (undyed polysorb), and the closure was performed using as few and as thin sutures as possible. from the sixth to the ninth postoperative week the patient complained about suture material extrusion through the scar and mild local tenderness, but no blood test abnormalities, ultrasonographically detectable abscess or significant functional impairment occurred. two years after the first joint replacement and 10 months after the second one, the patient is extremely satisfied with her bilateral tha. a 63-year - old woman with displaced femoral neck fracture of the left hip underwent cementless ceramic - on - ceramic tha through straight lateral approach. the patient had no relevant risk factors for infection (immunocompetent, non - diabetic with normal body mass index and no history of recent infections) except light smoking (less than 10 cigarettes per day), and surgery was completed within 80 min. antibiotic prophylaxis was obtained with a short intravenous course of cefazolin (2 g before operation, followed by 1 g 61422 h later). the trochanteric digastrics tendon split and the fascial incision were sutured with vycril plus # 2, while subcutaneous tissue was sutured with vycril plus # 2 and # 0 in the deep layer and vycril plus # 2/0 in the superficial layer. two deep suction drains were maintained for 48 h and removed at first dressing change. the post - operative course was uneventful : body temperature normalized (below 37 c) 2 days after surgery, the wound was dry with no signs of inflammation or hematoma, c - reactive protein (crp) levels halved every 2 days, and the hip was mobile and pain - free. the patient was therefore discharged home 8 days after surgery. on the 14th postoperative day skin staples were removed and on the fifth week the patient was seen in the outpatient clinic ; x - rays and clinical examination were extremely satisfactory, and she was allowed to abandon her crutches and to resume ordinary life activities. in the ninth week from index surgery the patient, previously pain - free, started to complain of tenderness, warmth and redness of the skin around the scar. she was examined immediately after symptom onset and a minimal seropurulent discharge was noticed from a small sinus, which was carefully dilated with a sterile swab, allowing the exudate to drain and microbiological samples to be collected (with negative results). blood tests detected mildly elevated crp (1.4 mg / dl) and erythrocyte sedimentation rate (esr) (60 mm / h), but no elevation of white blood cell (wbc) count. ultrasonographic (us) examination of the hip demonstrated an abscess in the deep layer of the hypodermis, with several sinus tracts towards the surface. the presence of local signs (warmth, redness, swelling, tenderness and fluid discharge), us signs (abscess) and laboratory signs (elevated crp) of surgical site infection convinced us to schedule immediate irrigation and debridement (i d) within 1 week from complication onset. the debridement was performed through the pre - existing scar, with excision of multiple sinus tracts. a massive abscess, with purulent grey - yellowish content, was retrieved in the deep subcutaneous tissue, extending along the whole incision. after culture and histological sampling, the cavity was debrided and irrigated with diluted iodopovidone and saline solution. the fascia, apparently intact, was then incised and the pertrochanteric space was inspected. since no signs of infection were retrieved below the fascia, surgical gowns, gloves and instruments were replaced before splitting the digastrics tendon and opening the periprosthetic capsule ; within the joint just a few milliliters of clear fluid were found. thorough irrigation was performed after microbiological sampling. since the infection seemed not to have spread below the fascia, and given the risk of ceramic rupture associated with head and liner exchange, no attempt was made to remove them. the wound was closed in a standard fashion, but employing as few sutures as possible so as not to leave an excessive amount of foreign material in a potentially infected surgical site, and two suction drains (whose tips were sent to the microbiology laboratory for further cultures) were placed. during the procedure, immediately after culture sampling, an empirical course of antibiotics was started (teicoplanin 800 mg and levofloxacin 1 g i.v.) and was confirmed postoperatively (teicoplanin 600 mg q.d. and levofloxacin 500 mg b.i.d.). on the first postoperative day the patient was already pain - free, her body temperature normalized and the wound healed regularly. crp stayed within the range throughout the hospitalization, after normalizing with sinus drainage 3 days before surgery. no cultures were positive, but given the strong suspicion of infection and the absence of adverse reactions to antibiotics, the patient was discharged home 7 days after i d with an oral 4-week therapy (cotrimoxazole 800 mg/160 mg b.i.d. and levofloxacin 500 mg q.d.). the histological examination of the collected material demonstrated a giant - cell foreign - body reaction, where some amorphous birefringent material was clearly visible (fig. gc giant cell, fb foreign body (haematoxylin and eosin, original magnification 200) foreign - body reaction in the superficial hypodermis. gc giant cell, fb foreign body (haematoxylin and eosin, original magnification 200) even though the patient was asymptomatic, she was followed up monthly with physical examinations and blood tests (fig. 2), and 8 weeks after i d another mild crp elevation (1.6 mg / dl) was noticed without reasonable causes, except minimal scar inflammation and extrusion of suture material. the wound was treated with iodopovidone solution and daily dressing change and healed in a week after complete extrusion of the foreign material. the two grey vertical lines represent the procedures (tha and i d), while the grey horizontal line represents the highest value of the normal crp range (1 mg / dl) c - reactive protein kinetics of patient # 1. the two grey vertical lines represent the procedures (tha and i d), while the grey horizontal line represents the highest value of the normal crp range (1 mg / dl) a 64-year - old woman affected by bilateral hip osteoarthritis underwent cementless ceramic - on - ceramic right hip tha through straight lateral approach. she had no relevant risk factors for infection, surgery was uncomplicated and lasted about 70 min. the same antibiotic prophylaxis, surgical technique and suture materials were employed as in case # 1. the post - operative course was similarly uneventful : body temperature never exceeded 37 c, the wound was dry with no signs of inflammation or hematoma, crp fell within the normal range in 12 days, and the hip was mobile and pain - free. the patient was therefore discharged to the rehabilitation facility as soon as an inpatient rehab bed was available, 8 days after surgery. on the 15th postoperative day skin staples were removed, she returned home and on the fifth week the patient was seen in the outpatient clinic with excellent functional recovery and x - rays. she was allowed to abandon her crutches and to resume ordinary life activities. in the eighth week after tha, almost as in case # 1, the patient, previously pain - free, started complaining of tenderness, warmth and redness of the scar, with mild elevation of body temperature (37.5 c). she was seen 3 days after symptom onset and no drainage was noticed from the scar, but it was extremely painful on palpation. blood tests detected mildly elevated crp (1.5 mg / dl) and esr (50 mm / h), but no wbc count elevation. ultrasonographic examination of the hip demonstrated a bulky pertrochanteric abscess, with several sinus tracts perforating the fascia towards the surface. the presence of local signs (warmth, redness, swelling and tenderness), us signs (abscess) and laboratory signs (elevated crp) of surgical site infection persuaded us to schedule prompt reoperation for i d. the debridement was performed through the pre - existing scar and a massive abscess, with purulent grey - yellowish material, was retrieved in the deep hypodermis. several fistulae perforated the fascia and allowed the exudates to spread in the pertrochanteric space. after culture and histological sampling, the cavity was debrided and irrigated with diluted iodopovidone and saline solution. the fascia was then incised, trans - fascial fistulae excised and the pertrochanteric space debrided and irrigated similarly. since the abductor mechanism seemed to be intact and the preoperative us examination did not show joint space effusion, surgical gowns, gloves and instruments were replaced before splitting the digastrics tendon and opening the joint capsule ; the same healthy periprosthetic environment was found as in case # 1. the procedure was completed as previously described, with microbiological sampling, careful joint irrigation but without head / liner exchange, and administering the same intravenous empirical antibiotic therapy. on the first postoperative day no cultures (either intraoperative or postoperative on drainage tube tips) were positive, but given the strong suspicion of infection and the absence of adverse reactions to antibiotics, the patient was discharged home 13 days after i d with an oral 4-week therapy (amoxicillin 1 g t.i.d. and levofloxacin 500 mg q.d.). histological examination of the material collected showed the same pattern of foreign - body reaction : a mixed inflammatory cell infiltrate, with multinucleated giant cells and amorphous birefringent material (fig. 3).fig. 3foreign - body reaction in the superficial (a) and deep (b) hypodermis. gc giant cell, fb foreign body, vs vascular space (haematoxylin and eosin, original magnification 400) foreign - body reaction in the superficial (a) and deep (b) hypodermis. gc giant cell, fb foreign body, vs vascular space (haematoxylin and eosin, original magnification 400) during the postoperative clinical and laboratory follow - up (fig. 4), the patient demonstrated an elevated crp (1.3 mg / dl) 5 weeks after reoperation, associated with suture material extrusion. frequent wound care allowed complete recovery and renormalization of crp within 2 weeks, without any further recurrence.fig. the two grey vertical lines represent the procedures (tha and i d), while the grey horizontal line represents the highest value of the normal crp range (1 mg / dl) c - reactive protein kinetics of patient # 2. the two grey vertical lines represent the procedures (tha and i d), while the grey horizontal line represents the highest value of the normal crp range (1 mg / dl) fourteen months after right hip tha, the patient, satisfied with the previous joint replacement despite the complication, requested left hip tha as originally planned. in order to minimize the risk of foreign - body reaction, a different suture material with no colouring or antibacterial agents was selected (undyed polysorb), and the closure was performed using as few and as thin sutures as possible. from the sixth to the ninth postoperative week the patient complained about suture material extrusion through the scar and mild local tenderness, but no blood test abnormalities, ultrasonographically detectable abscess or significant functional impairment occurred. two years after the first joint replacement and 10 months after the second one, the patient is extremely satisfied with her bilateral tha. the two cases presented demonstrate that an adverse reaction to an absorbable suture after total hip replacement might determine a clinical condition that can not be reliably differentiated from a surgical site infection. both cases were standard, uncomplicated procedures performed on low - risk patients, had an uneventful early postoperative course with no complaints up to the 8th9th postoperative week. they then developed local, systemic, us and laboratory signs of surgical site infection. although no positive cultures were available, i d could not have been questioned or delayed, given the high probability of infection and the negative prognostic impact of the elapsed time [1, 4, 5 ]. because of this latter concern, joint aspiration was not attempted and both hips were quickly reoperated. the patients had a mild recurrence 8 and 5 weeks, respectively, after i d, likely because the same suture material was used as in the primary surgery, but in a smaller amount. however, knowledge of the histological diagnosis, awareness of having reused the suture material that elicited the first foreign - body reaction, and the similar presentation and timing suggested that we provide simple wound care, without any surgical or antibiotic treatment, and the relapses self - healed without any consequences. to the best of our knowledge, only three other cases of adverse reaction to suture material mimicking a periprosthetic joint infection have been reported to date, by sayegh and coworkers (table 1). those three patients received the same resorbable suture as in our series, but without antibacterial agent (vicryl instead of vicryl plus). interestingly, the timing is almost identical : 8 and 7 weeks after index sugery in our series (with recurrences 8 and 5 weeks after i d, respectively) ; 6, 8 and 9 weeks after index surgery in sayegh.s series (with no mention of possible relapses). on the other hand, the eosinophilia described by sayegh. was not confirmed in our two patients, who showed a normal total wbc count, with minor elevation of neutrophil percentage but normal neutrophil count. eosinophils were within the normal range for percentage and for count. while the three previously described patients had an extensive involvement of all the layers from the hypodermis to the intracapsular space, our two patients had a relatively superficial involvement, with no penetration of the glutei muscle cuff. we believe that this might depend on capsular repair, which we never performed after a straight lateral approach, but might have been performed by sayegh and coworkers, especially if a posterolateral approach was used. however, this explanation is conjectural, since surgical approach and capsular repair are not mentioned by the above authors.table 1synoptic table summarizing the main clinical information from the three cases reported by sayegh. (i, ii and iii) and the two cases presented here (iv and v)iiiiiiiv (# 1)v (# 2)suture materialvicryl vicryl vicryl vicryl plus vicryl plus presentation time (weeks after surgery)89687local inflammation+++++draining sinus+++body temperature (c)37.93739<3737.5crpelevatedelevatedelevatedelevatedelevatedwbcnormal with eosinophilianormal with eosinophilianormal with eosinophilianormalnormalabscess locationextensive (from subcutaneous to intracapsular)extensive (from subcutaneous to intracapsular)extensive (from subcutaneous to intracapsular)superficial (prefascial)superficial and intermediate (pre- and subfascial, with no extension through the glutei muscles)recurrencenot mentionednot mentionednot mentionedyes (8 weeks later)yes (5 weeks later) synoptic table summarizing the main clinical information from the three cases reported by sayegh. (i, ii and iii) and the two cases presented here (iv and v) the two cases presented are the first suture - related pseudoinfections whose recurrence after absorbable suture material re - implantation is documented. similar timing but different extents between first episode and recurrence confirm the hypothetical aetiopathogenesis, since the same material was used but in different amounts. all the reported five patients had the wound closed with coated vicryl, a synthetic suture material made of polyglactin 910, which is a copolymer obtained from 90 % glycolide and 10 % l - lactide. its resorption is completed by hydrolysis within 5670 days from implantation (which corresponds perfectly to the latency of the psuedoinfection). it is used worldwide in most surgical fields, and recently became available associated with an antibacterial agent, triclosan (vicryl plus). few adverse reactions have been reported to date : holzheimer described inflammation and occasional sinus discharge in 12 patients after subcutaneous suture with vicryl or vicryl plus and skin closure with dermabond glue in patients operated for hernia, varicose veins and soft tissue tumors. the complication occurred 38 weeks after the index procedure, and only in two patients was an infection demonstrated. local inflammation after wound healing is likely under - reported, since suture extrusion is a common and benign complication of surgical wounds, often overlooked by patients and general practitioners. drake and coworkers clearly demonstrated that this phenomenon depends both on the material (vicryl is more prone to extrusion than polysorb) and on the volume (the more knots, the higher the risk). on the other hand, some cases of foreign - body reactions to suture material might have been classified as surgical site infection with false - negative cultures, since histological samples are not routinely collected by all surgeons. it is well known that preoperative culture sensitivity is only fair (0.70 from joint aspiration in infected tha according to qu., and possibly lower from sinus discharge swabs), and even intraoperative culture sensitivity is suboptimal (0.94 according to spangehl.). dealing with a supposed periprosthetic joint infection with no positive cultures is thus not an exceptional experience for orthopaedic surgeons. however, in the presented cases several elements make occult infection extremely unlikely : multiple cultures (preoperative swabs, three intraoperative samples and postoperative cultures on drain tips) were negative without any preoperative antibiotic administration, the histological examination found a mixed inflammatory infiltrate with lymphomonocytes prevailing over neutrophils, and the relapses self - healed after complete suture absorption or extrusion. remarkably, in our patient # 2, who received a subsequent contralateral tha sutured with undyed polysorb, made of lactomer (another glycolide / lactide copolymer) coated with a mixture of a caprolactone / glycolide copolymer and calcium stearoyl lactylate, the absorption phase was not uneventful, although the reaction was milder than after the first surgery. the role of the suture material therefore seems to be important, but likely less important than the patient s aptitude to foreign - body reaction. in conclusion, the five cases described to date allow us to define a somewhat novel complication of total hip replacement, the suture - related pseudoinfection (srpi). srpi is characterized by local and systemic signs of inflammation occurring 69 weeks after tha, when sutures are absorbed. a sterile abscess is usually located in the subcutaneous tissue, with possible superficial seropurulent drainage and deep extension through the fascia. the phenomenon can not be reliably differentiated from a postoperative infection at the time of its presentation, and only the negative result of all the microbiological samples, the benign course and the histological examination allow the differential diagnosis, which is always ex post. thus, even though this complication might possibly self - heal after complete absorption of the foreign material, we strongly advice against nonsurgical management, which would surely worsen the prognosis of a true, more common postoperative infection. the awareness of this exceptional phenomenon leads to some clinical considerations. first, the principle that only early periprosthetic joint infections are eligible for simple irrigation and debridement should not be overemphasized. if strict exclusion criteria were applied [4, 912 ], some of the reported five patients might have been candidates for two - stage revision arthroplasty, since more than 6 weeks had elapsed from implantation and no microbiological diagnosis was available. the acute onset and the short interval from onset to treatment, rather than from implantation to onset, should be considered a relevant positive factor in favour of a prosthesis - sparing surgery. second, histological specimens should always be collected when potential periprosthetic joint infections are debrided. third, the smallest possible volume of suture material should be left in every wound, especially in the subcutaneous tissue, where little tensile strength is required and foreign - body reactions seem to be more devastating due to extensive fat necrosis. in our routine surgical practice, deep subcutaneous suture after tha is now obtained with # 0 suture only (instead of using two or three # 2 stitches), and the number of knots has been reduced from four to three. fourth, if a srpi is suspected, closing the wound after i d with a suture material with low propensity to induce foreign - body reaction might lower the chance and the severity of possible recurrences.	absorbable sutures are widely used for wound closure after total hip replacement. here we present two cases of suture - related foreign - body reaction that perfectly mimicked a periprosthetic joint infection, with sterile abscess formation and physical and laboratory signs of inflammation acutely presenting 78 weeks after surgery, at the time of suture absorption. both recurred with analogous timing after irrigation and debridement, likely due to re - using the same suture material. multiple negative microbiological samples and positive histological samples showing a foreign - body reaction are the fundamental steps towards the diagnosis of a suture - related pseudoinfection (srpi). only three other cases have been reported to date, but the recurrence, together with the self - healing course after relapse, represents a completely novel feature and possibly the strongest demonstration of the supposed aetiopathogenesis. the knowledge of this possible complication leads to some clinical implications : all potential periprosthetic joint infections should routinely undergo not only microbiological but also histological sampling ; caution should be used when recommending prosthesis exchange for potential infections occurring in the time range of suture absorption ; lastly, if srpi is suspected, a suture with low propensity to induce foreign - body reactions should be chosen after irrigation and debridement and the volume of absorbable material left in the wound should be as small as possible.
	this study assesses whether deprived populations living close to industry experience greater mortality from lung cancer than populations with comparable socioeconomic characteristics living farther away. mortality data, census data, a postal survey of living circumstances, historic and contemporary data on air quality and a historic land - use survey were used. analysis was based on two conurbations in england, teesside and sunderland. housing estates in teesside were selected based on socioeconomic criteria and distinguished by proximity to steel and chemical industries ; they were grouped into three zones : near (a), intermediate (b), and farther (c), with a single zone in sunderland. we included 14,962 deaths in 27 estates. standardized mortality ratios (smr) for lung cancer [international classification of diseases # 9 (icd-9) 162 ] and cancers other than lung (icd-9 140 - 239, excluding 162), and sex ratios were calculated. mortality from lung cancer was well above national levels in all zones. for men, a weak gradient corresponding with proximity to industry at younger ages reversed at older ages. in women 0 - 64 years of age, stronger gradients in lung cancer mortality corresponded with proximity to industry across zones a, b, and c (smr = 393, 251, 242, respectively). overall rates in teesside were higher than sunderland rates for women aged 0 - 64 years (smr = 287 vs. 185) and 65 - 74 years (smr = 190 vs. 157). the association between raised lung cancer mortality and proximity to industry in women under 75 years of age could not be explained by smoking, occupation, socioeconomic factors, or artifact. explanations for differences between men and women may include gender - specific occupational experiences and smoking patterns. our judgment is that the observed gradient in women points to a role for industrial air pollution.imagesfigure 1figure 2
neurofibromatosis type 1 (nf1) is a common autosomal dominant genetic disorder with an incidence of approximately 1 in 3,000 - 3,500 individuals worldwide (1). nf1 is clinically characterized by the presence of well established phenotypic features, including caf - au - lait (cal) spots, neurofibromas, freckling of the axillary or inguinal region, lisch nodules, optic nerve gliomas, and bone dysplasias (1). nearly all nf1 patients have benign dermal neurofibromas, and approximately 30% of nf1 patients have benign plexiform neurofibromas which can undergo malignant transformation to malignant peripheral nerve sheet tumors (mpnsts) (2). malignant transformation into mpnsts was observed in 2 - 13% of nf1 patients with plexiform neurofibromas (3) and represents a major cause of mortality in nf1 patients (1). haploinsufficiency for neurofibromin has been suggested as the molecular basis of the disease (1, 2). nf1 is caused by mutations in 1 of the 2 alleles of the nf1 gene, located at chromosome 17q11.2, encoding neurofibromin, a gtpase activating protein (gap). approximately 5 - 20% of all nf1 patients have been reported to carry a heterozygous large ~1.5 mb deletion at chromosome 17q11, where the entirety of the nf1 gene and several neighboring genes exist, mediated by homologous recombination between the nf1 repetitive sequences (4). it has been reported that a bi - allelic inactivation of nf1, with one allele constitutionally inactivated and the other somatically mutated, is required for neurofibroma and mpnst formation (5), indicating that the tumor progression of nf1 is most likely triggered by the complete loss of the nf1 gene in somatic cells. somatic loss of heterozygosity (loh) at the nf1 locus has been described for neurofibromas and mpnsts in previous studies (5). in a previous study, we reported the case of a 24-yr old male nf1 patient with benign plexiform neurfiboromas and mpnsts (6). a whole gene expression comparison study was carried out using tissue samples obtained by surgical resection and skin biopsy from the patient. because frequent genomic imbalances in chromosomes 17, 19, and 22q in the neurofibromas and mpnsts have been reported in the patients with nf1 (7), we also tested for genomic alterations and/or chromosomal aberrations in the same patient in this study. comparison study among normal, benign and malignant tissues and cells was carried out on the chromosomal level. here, we report a korean patient with nf1 who had a mosaic y chromosome loss involved in malignant progression. a 24-yr old male patient was diagnosed to have nf1 based on standard diagnostic criteria at the genetic clinic in ajou university hospital. the patient, having a nf1 nonsense mutation (y2264x) in the nf1 gene, prefsented the clinical features of nf1 with caf - au - lait spots, plexiform neurofibromas, cutaneous neurofibromas, subcutaneous neurofibromas, scoliosis, and neurofibrosarcomas (mpnsts) (6). tumor specimens containing benign and malignant tumors and histopathologically normal tissues were obtained by surgical resection and skin biopsy, respectively. three types of tissues, normal skin fibroblasts, benign plexiform neurofibromas, and mpnsts were prepared and histopathologically evaluated by routine light microscopy after staining with hematoxylin and eosin (h&e) as previously described (6). to determine whether genomic alterations, including microdeletions and gene copy number changes, existed in this male patient, we performed a comparative genomic hybridization (cgh) array with high resolution cgh array slides containing 1440 clones, including 356 cancer related genes from bac libraries at a resolution of 2.3 mb. three types of tissues were used ; normal skin fibroblasts, benign plexiform neurofibromas, and malignant neurofibrosarcomas (mpnst), all bearing an identical germ line mutation of the y2264x (c.6792c > g) nonsense mutation on the nf1 gene (6). dna was extracted from the tissue samples and used for a cgh array, performed as previously described (8). korea) were analyzed using the chromofluor image analysis system (arrayscanner, array analysis ; macrogen inc. the slides were scanned into two 16-bit tiff image files using genepix4200a two - color fluorescent scanner (mds inc., green (reference) to red (test) (g / r) ratios were automatically determined for each sample, and the normalized g / r ratio was taken to represent the relative average number of copies of the sequence for those spots that were selected as controls. spots with g / r ratios more than the mean plus 2.5 standard deviations (1.25) were considered as amplifications or gains of the indicated copy number ; less than the mean minus 2.5 deviations (-0.75) were considered as losses of the copy number. control hybridization of non - nf1 male dna was performed in four independent experiments and resulted in a mean log2 fluorescence ratio of 0.00.125 s.d., reflecting the equal copy number in test and reference dnas (data not shown). hybridization of non - nf1 male dna (reference) vs. dna from normal tissue of the nf1 patient and further hybridizations of dna from normal tissue and from benign or malignant tissues from the nf1 patient were performed and their results shown in fig. 1. multiple tests were performed to further narrow down the significant clones discussed in this paper. no genetic alteration, including dna copy number change across whole chromosomes, was detected in the hybridizations of reference dna vs. dna from either normal tissue (fig. however, the loss of the whole y chromosome was detected in the hybridization of the dna from normal tissue vs. the dna from mpnst tissue (fig. 1c). the detailed cgh array profile of the y chromosome for npnst tissue showed y chromosome - specific genomic loss across the whole region of the y chromosome (fig therefore, we focused our study on the y chromosome aberrations in the mpnst tissue. to confirm the cgh array findings, first, primary tissue culture was performed by primary explant technique from the pathologically normal, benign, and mpnst tissue fragments. the dissected tissues were finely chopped, rinsed with pbs, and the pieces were seeded onto the surface of a culture t24 flask in a small volume (1 ml) of dulbecco 's modified eagle 's complete medium (dmem) supplemented with a high concentration (40%) of heat - treated fetal bovine serum (fbs), 2 mm glutamine, non - essential amino acids, 2.5 mm sodium pyruvate, 100 u / ml penicillin and 100 mg / ml streptomycin. after an overnight incubation at 37, the medium volume was made up to 5 ml and then changed weekly until a substantial outgrowth of cells was observed. metaphase cells were harvested and g - banding analyses were carried out using the cultured cells of 5 passages. cytogenetic analyses were performed on gtg - banded metaphase spreads prepared from three types of fibroblast cells from the nf1 patient. chromosome analyses were done in 50 metaphases for each sample with a resolution of 450 bands. 2a), but abnormal karyotype with a mosaic loss of the y chromosome was detected in the malignant tissue cultured cells (fig. this type of y chromosome loss was detected in approximately 56% of the counted cells (28/50). these g - banding study results in primary tissue cultured cells reproduced the cgh array findings in the same tissues. the karyotype for the malignant cells from mpnst tissue revealed 45,x, -y/46, xy. nf1 is notable for the malignant transformation of normal and/or benign tumor tissues to malignant peripheral nerve sheet tumors (mpnsts) (3). three different pathological phenotypes of tissues, normal, benign and malignant, may exist within one individual despite of an identical germ line mutation in the nf1 gene, supporting the two - hit hypothesis that an additional nf1 loss is an independent, somatic event (9). studies on the somatic loss of heterozygosity (loh) in nf1 showed that about 20% of dermal neurofibromas, 40% of plexiform neurofibromas, and 60% of mpnsts have a loh either at the nf1 locus or at 17q (5, 10). the molecular mechanisms potentially required for the full transformation of benign neurofibromas into mpnsts are poorly understood. loss of neurofibromin function by bi - allelic inactivation of nf1 may be necessary for benign neurofibroma formation, but is not sufficient for the transformation of neurofibromas to mpnsts, suggesting that other genetic alterations or epigenetic events must occur in benign tumors for the malignant transformations in nf1 patients. at the gene level, alterations like mutations and/or gene expression changes in other genes including cdkn2a / p14/p15/p16, cdkn1b / p27, rb, tp53, pten, egfr, frap1 (mtor), tsc2, tgf-, hgf-, tnxb, and tnc, have been identified in mpnsts (6, 11). in the chromosomal level, several cgh studies of nf1-associated and sporadic mpnsts reported the existence of gains and/or losses of genetic materials in chromosomes, 4q, 7, 8q, 15q, 17p, 17q, 19, 22q, and x (7, 12, 13). although no previous studies have reported common patterns of chromosomal aberrations in nf1, the most frequent genomic imbalances in nf-1 associated mpnsts were detected in chromosome 17q (7). in our previous study, we reported the results of a gene expression comparison study of a 24-yr old patient with nf1 (6). a whole gene expression comparison study was carried out in normal, benign and malignant tissues and a total of 20 genes were identified showing clear differences in expression patterns among those tissues. recent studies regarding chromosomal aberrations in nf1 led to this study in the chromosomal level of the same patient. here, we performed molecular cytogenetic analysis using samples of the same normal, benign and malignant tissues from the patient and also performed cytogenetic analysis using the primary cultured cells from those tissues. initially, a comparison study was carried out between tissue types using a cgh array. high - resolution cgh arrays are a powerful tool for the detection of genomic alterations, including gene copy number changes and chromosome deletions and duplications (8). recent studies have identified a gain of a 550 kb segment at 7q, loss of 2.5 mb at 17q11.2, and duplications in the nf1 locus at 17q11 through cgh array analysis (14). using a cgh array, we identified the loss of the y chromosome in the malignant tissue of a patient with nf1. karyotype results showed a mosaic loss in the y chromosome of the malignant cells, but not in the normal and benign cells, suggesting that the somatic loss of the y chromosome in this patient may be associated with the malignant transformation of benign neurofibromas to mpnsts. in this study, y chromosome loss was first detected through cgh array in mpnst tissue and confirmed by cytogenetic analysis in cultured cells from mpnst tissue. this ruled out the possibility that the y chromosome loss occurred during cell culture by chance. multiple studies have reported that loss of the y chromosome is a normal age - related phenomenon (15). the likelihood of y chromosome loss increased significantly in normal males after the age of 70. in our case study, the normal age - related y chromosome loss is less relevant as the nf1 patient is in his mid - twenties. in addition, y chromosome loss is frequently observed in some types of tumors such as prostate cancer, pancreatic cancer, squamous cell carcinoma of the head and neck, acute leukemia, hepatocellular carcinoma, and kaposi 's sarcoma (16, 17). a study regarding the significance of y chromosome loss in hematologic diseases reported that the institutional incidence of y chromosome loss was ~10% of hematologic disease groups and the y loss is frequently seen as mosaicism with a normal (46,xy) clone (18). our case had a y chromosome loss with mosaicism in 56% of the counted cells. several cancer related genes have been found to be located on the y chromosome at yp, tspy (y - encoded testis - specific gene), yq, xkry (xk - related protein on y chromosome), pry (ptpbl - related protein on y), rrm (rna recognition motif), yrrm2 (y chromosome rna recognition motif 2), and cdy1 (chromodomain on y chromosome) (19). although male predominance has been reported in the nf1 patients with tibial pseudarthrosis (20), it is not clear whether these genes are associated with malignant transformation of benign neurofibromas to mpnsts in this case. further studies are necessary to elucidate the relationship between y chromosome - specific cancer related genes and tumor progression of nf1. to elucidate the mechanisms for the malignant transformation of nf1, we previously performed a comparison study at the gene level in histopathologically different tissues of a korean patient with nf1 (6), and in the present study we carried out comparison study on the genomic and chromosomal levels in the same patient. as a result, we have found the mosaic loss of the y chromosome in mpnst tissues and cells of the patient. considering y chromosome loss has been associated with some types of tumors (16, 17), this result strongly suggests that the somatic loss of the y chromosome may have caused the transformation of benign tumors to mpnsts in this patient. although we are reporting on one case, our data may provide insight into improving the understanding the underlying mechanisms of somatic tumor progression of nf1 on the chromosomal level.	neurofibromatosis type 1 (nf1) is one of the most commonly inherited autosomal dominant disorders. in order to determine whether genomic alterations and/or chromosomal aberrations involved in the malignant progression of nf1 were present in a korean patient with nf1, molecular and cytogenetic analyses were performed on the pathologically normal, benign, and malignant tissues and primary cells cultured from those tissues of the patient. the comparative genomic hybridization (cgh) array revealed a y chromosome loss in the malignant peripheral nerve sheet tumor (mpnst) tissue. g - banding analysis of 50 metaphase cells showed normal chromosomal patterns in the histopathologically normal and benign cultured cells, but a mosaic y chromosome loss in the malignant cells. the final karyotype for the malignant cells from mpnst tissue was 45,x,- y[28]/46,xy[22 ]. the data suggest that the somatic y chromosome loss may be involved in the transformation of benign tumors to mpnsts.
a 32-year - old male came to us with complaints of cystic lesions in both lids [figs. 1, 2a and b ]. he was diagnosed to have lipoid proteinosis elsewhere and was completely screened for systemic involvement. a buccal mucosal biopsy taken elsewhere showed deposition of pas - positive hyaline material [fig. 3 ]. there were verrucous lesions in both upper and lower lids with cauliflower shaped lesion in the lower puncta of both eyes.. external photograph of the eye external photograph closer view (a) upper lid (b) lower lid histopathology picture depicting pas positive hyaline material uws is an autosomal recessive disorder, first described by urbach and wiethe in 1929. the incidence of hyalinosis cutis et mucosae seems to be fairly high in south africa. it is a multi - system disease caused due to mutations in the gene encoding extracellular matrix protein 1 on chromosome 1q21. skin lesions generally appear as nodules on the face, lips (at earlier stages), and later become hyperkeratotic. schirmer 's test in both eyes was normal suggesting no involvement of lacrimal gland in our case. various ocular manifestations such as dry eyes, open angle glaucoma, drusen in the macula, retinitis pigmentosa, uveitis and subluxation of the lens has been reported along with lipoid proteinosis. however, our patient had no abnormality in his eyes. the most common radiological hallmark is the presence of bean or comma shaped intracranial calcifications in the temporal lobes in the amygdala, which is more evident in the patients who have lipoid proteinosis for a long duration. patients with neurological manifestations present with a migraine, seizures, mental retardation, anxiety, depression, and panic attacks. though rare, systemic manifestations of lipoid proteinosis include life - threatening situations like acute respiratory distress or seizures. awareness among ophthalmologists about this rare entity is crucial for appropriate management of these patients.	urbach wiethe syndrome or lipoid proteinosis is a rare autosomal recessive disorder characterized histologically by infiltration of periodic acid schiff - positive hyaline material in the skin, upper aerodigestive tract, eyelids, and internal organs. classical clinical features include scarring of the skin, beaded eyelid papules (moniliform blepharosis) and laryngeal infiltration leading to hoarseness of voice. lipoid proteinosis can lead to life - threatening conditions such as acute respiratory distress and seizures. awareness among ophthalmologists about this rare entity is crucial for appropriate management of these patients.
mayaro fever is a dengue - like acute viral disease that is usually self - limiting. its agent is an alphavirus that belongs to the togaviridae family within the semliki forest virus antigenic complex. the first isolation of mayaro virus was made in august and september of 1954 in five febrile patients from mayaro county, trinidad island. casals and whitman characterized it as an arbovirus closely related to the semliki forest virus. the clinical manifestations of mayaro virus disease have been recorded during outbreak studies and documented sporadic cases. after an incubation period of 7 to 12 days, the patient frequently presents with an abrupt fever accompanied by headache, arthralgias, myalgias, retro - orbital pain, vomiting, diarrhea, and maculopapular rash ; some patients may develop severe and prolonged arthralgias.[36 ] shorter incubation periods have also been observed, other symptoms reported less frequently include nausea, cough, sore throat, abdominal pain, nasal congestion and bleeding gums. in 20% of the cases, swelling of small joints, especially in the wrists, fingers, ankles, and toes, has been reported. usually the fever is between 39c and 40.2c. presence of mayaro virus antibodies in human populations has been reported in bolivia, brazil, colombia, panama, peru, surinam, trinidad and tobago, venezuela, french guiana and mexico, suggesting the appearance and dissemination of this virus to other countries of the america continent.[36911 ] airborne virus infection of a laboratory worker has been also documented. a mayaro virus outbreak was reported in belterra, para, brazil in 1978, with an attack rate of 20%. under apparently endemic and enzootic conditions, annual incidence rates between 1.6% to 7% were reported among okinawan colonists in bolivia in 1955 and among dutch military troops detached in surinam. monkeys are suspected to be the principal reservoir for mayaro virus, maintaining the enzoonosis in the rainforest, with periodic epizootics and epidemics. evidence of mayaro infection has been found in cebidae, callithricidae, saguinus, and alouatta monkeys.[1719 ] a recent serologic survey in french guiana found a wide variety of non - flying mammals as reservoir for the virus, nevertheless their significance to the transmission of the virus is unknown. in addition to this finding, it has been reported that mayaro virus could also infect birds. epidemics begin with the onset of the rainy season and end near the onset of the dry season, correlating with the rise and fall in the mosquito population in the rainforest. mayaro virus has been isolated from several genera of mosquitoes, including culex, haemagogus, mansonia, aedes, psorophora, and sabethes. many authors consider the possibility of urbanization of the disease since experimental studies have shown that the virus could infect aedes aegypti, as population and land use increases.[72123 ] the morbidity caused by the disease, specially the temporary incapacitating arthralgias, could cause an important social, economic and public health impact. in late july through early august of 1997, an outbreak of hemorrhagic fever was reported in one of the amazonian rainforest garrisons of the ecuadorian armed forces. during the outbreak investigation, yellow fever and mayaro virus have been frequently associated, and we sought to investigate the potential presence and the risk factors of mayaro virus infection in ecuador. the jungle garrison under study consisted of one main post, three detachments, and five outposts, all located in southeastern ecuador in the amazonian rainforest near the peruvian border. the geographic area, classified as humid tropical forest is situated 100 meters above sea level. the province has approximately 57,000 inhabitants, with an average population density of 1.92 inhabitants per square kilometer. a cross - sectional seroepidemiological survey was conducted among the study population. after providing written informed consent, study subjects participated in a questionnaire interview concerning demographic variables, medical history, and potential risk factors. in a few cases, because of severity of the patients conditions, recent medical history data were obtained at the military hospital no. 1 of quito (hg-1) rather than from patient interviews. blood samples were processed immediately after collection, and sera were stored frozen at -20c until transported on dry ice to the u.s. naval medical research institute detachment (namrid) in lima, peru for viral isolation and serologic testing. all procedures followed international guidelines for research in human subjects and were supervised by the ecuadorian national council against hemorrhagic fevers, complemented by health officers representing the ecuadorian armed forces and the ministry of public health. confluent monolayers of llcmk2 or vero cells were infected with prototype den-1, oropouche (oro) peru 1992, yellow fever 17d, or venezuelan equine encephalitis (vee) subtype i - ab virus, vr-69 (american type culture collection [atcc ], rockville, md, u.s.a.) and mayaro virus (may) tr467 strains. the resulting supernatant viral antigens were used to test sera for igm antibody by a capture enzyme - linked immunosorbent assay (elisa) and for preparing lysate viral antigens for performing igg antibody elisa. a capture elisa using goat anti - human igm (tago, camarillo, ca, u.s.a.) bound to 96-well limbro microtiter plates was used to test for igm antibodies. an indirect elisa employing viral infected or uninfected cell lysate bound to 96-well microtiter plates was used to test serum for igg antibody. sera were tested initially at 1:100 dilutions, and reactive samples were further tested at 1:200 through 1:12,800 dilutions to determine the antibody endpoint titer. mayaro virus specific igm and igg antibody positive and negative controls (run at 1:100 dilutions) were included in each test to validate the results. a horseradish peroxidase (hrp, kirkegards and perry, gaithersburg, md, u.s.a.) conjugated anti - mouse igg and an enzyme substrate 2,2-azino di (3-ethyl - benzthiazoline) sulfonate (abts) was used to detect igm antibody. hrp - conjugated goat anti - human igg and abts were used to detect igg antibody. the absorbance values for the mock antigens were subtracted from those of the viral antigen to yield correlated absorbance values. serum dilutions with corrected absorbance values greater than the reference cut - off value, estimated as the mean absorbance of the 10 antibody - negative serum samples plus 3 standard deviations, were considered to indicate the sample was antibody positive. all antibody titers were expressed as the reciprocal of the highest dilution yielding a positive result. the laboratory procedures reported herein were conducted according to the principles set forth in u. s. federal guidelines (guide for the care use of laboratory animals, institute of laboratory animal resources, national research council, dhhs, publication no. logistic regression analysis was used to evaluate the association between risk factors for arboviral infections and seroprevalence of alpahviruses antibodies. odds ratio (or) and 95% confidence intervals (ci) were calculated for each risk or protective factor and adjusted for the other factors in the model. the goodness of fit of the model was assessed using hosmer and lemeshow 's test. in a second step, the jungle garrison under study consisted of one main post, three detachments, and five outposts, all located in southeastern ecuador in the amazonian rainforest near the peruvian border. the geographic area, classified as humid tropical forest is situated 100 meters above sea level. the province has approximately 57,000 inhabitants, with an average population density of 1.92 inhabitants per square kilometer. a cross - sectional seroepidemiological survey was conducted among the study population. after providing written informed consent, study subjects participated in a questionnaire interview concerning demographic variables, medical history, and potential risk factors. in a few cases, because of severity of the patients conditions, recent medical history data were obtained at the military hospital no. 1 of quito (hg-1) rather than from patient interviews. blood samples were processed immediately after collection, and sera were stored frozen at -20c until transported on dry ice to the u.s. naval medical research institute detachment (namrid) in lima, peru for viral isolation and serologic testing. all procedures followed international guidelines for research in human subjects and were supervised by the ecuadorian national council against hemorrhagic fevers, complemented by health officers representing the ecuadorian armed forces and the ministry of public health. confluent monolayers of llcmk2 or vero cells were infected with prototype den-1, oropouche (oro) peru 1992, yellow fever 17d, or venezuelan equine encephalitis (vee) subtype i - ab virus, vr-69 (american type culture collection [atcc ], rockville, md, u.s.a.) and mayaro virus (may) tr467 strains. the resulting supernatant viral antigens were used to test sera for igm antibody by a capture enzyme - linked immunosorbent assay (elisa) and for preparing lysate viral antigens for performing igg antibody elisa. a capture elisa using goat anti - human igm (tago, camarillo, ca, u.s.a.) bound to 96-well limbro microtiter plates was used to test for igm antibodies. an indirect elisa employing viral infected or uninfected cell lysate bound to 96-well microtiter plates was used to test serum for igg antibody. sera were tested initially at 1:100 dilutions, and reactive samples were further tested at 1:200 through 1:12,800 dilutions to determine the antibody endpoint titer. mayaro virus specific igm and igg antibody positive and negative controls (run at 1:100 dilutions) were included in each test to validate the results. a horseradish peroxidase (hrp, kirkegards and perry, gaithersburg, md, u.s.a.) conjugated anti - mouse igg and an enzyme substrate 2,2-azino di (3-ethyl - benzthiazoline) sulfonate (abts) was used to detect igm antibody. hrp - conjugated goat anti - human igg and abts were used to detect igg antibody. the absorbance values for the mock antigens were subtracted from those of the viral antigen to yield correlated absorbance values. serum dilutions with corrected absorbance values greater than the reference cut - off value, estimated as the mean absorbance of the 10 antibody - negative serum samples plus 3 standard deviations, were considered to indicate the sample was antibody positive. all antibody titers were expressed as the reciprocal of the highest dilution yielding a positive result. the laboratory procedures reported herein were conducted according to the principles set forth in u. s. federal guidelines (guide for the care use of laboratory animals, institute of laboratory animal resources, national research council, dhhs, publication no. logistic regression analysis was used to evaluate the association between risk factors for arboviral infections and seroprevalence of alpahviruses antibodies. odds ratio (or) and 95% confidence intervals (ci) were calculated for each risk or protective factor and adjusted for the other factors in the model. the goodness of fit of the model was assessed using hosmer and lemeshow 's test. in a second step, alphavirus igm antibodies were detected in three members of the military garrison who were ill very recently or were ill during the outbreak study. there were 338 study subjects, accounting for 97% of the active personnel of the garrison. of these, 174 were from the coastal area of the country ; 73 from the andean zone, and 91 were native to the amazonian rainforest, most from the shuar and huaorani indigenous rainforest ethnic groups. two variables were significantly associated with higher alphavirus seroprevalence : age of 30 years or older (or = 7.9 ; ci = 2.229.1) and history of hunting (or = 6.2 ; ci = 1.232.4). clearing of the forest (or = 1.5 ; ci = 0.54.3) and going into the rain forest (or = 1.8 ; ci = 0.47.4) showed weak, but not statistically significant, associations with alphavirus seroprevalence. use of bed nets did not show a protective effect in reducing alphavirus seroprevalence (or = 1.1 ; ci = 0.25.9) ; use of repellents had a weak, but nonsignificant, protective effect (or = 0.7 ; ci = 0.22.2 ; [table 1 ]). the seroprevalence increased to 35.7% in the 21 to 30 year age group, increased sharply to 92.3% among persons 30 to 40 years of age, and was 100% for those over 40 years of age [table 2 ]. correlates of mayaro virus seroprevalence (igg) among military personnel, july august 1997 mayaro igg antibody prevalence by age strata among personnel native to the amazonian rainforest while the technique used, elisa, is not enough to determine the specific alphavirus circulating in the area, the clinical and epidemiological data suggest the potential presence of mayaro virus. the possibility of other heterologous alphavirus antibodies cross - reacting with mayaro virus when elisa or hi test are used is high, especially with venezuelan equine encephalitis virus (veev) and chikungunya. however, chikungunya infections have never been reported in the amazon basin and the clinical manifestations of veev are characterized by central nervous system manifestations but not by arthralgias, as found in our study. moreover, only 3% of healthy persons from this enzootic region had veev - neutralizing antibodies suggesting that humans are exposed but do not develop apparent infection with veev due to poor infectivity and/or avirulence of south american strains. we report an alphavirus seroprevalence of 46% among this rainforest population. in the hypothetical case that veev may have been circulating in this area, the possible 3% seroprevalence is negligible compared to the 46% found in this study. therefore, the clinical and epidemiological aspects indicate that the possible alphavirus circulating in the area is mayaro virus, representing this paper, the first report to document the potential transmission of mayaro virus in ecuador. evidence of transmission of mayaro virus has been reported in trinidad and tobago, brazil, bolivia, surinam, guiana, colombia, venezuela, and peru under similar circumstances ; mayaro virus isolates or antibodies were detected during the investigation of yellow fever outbreaks. we observed an overall seroprevalence of 48 of 338 (14%) in garrison personnel, largely restricted to amazonian natives (42/91, 46%). serological surveys of other populations in northern south america have found antibodies against mayaro virus in rates that range from 1% to 60%.[11133032 ] le duc. carried out a study in belterra, brazil in 1977 and 1978. following an attack, rate of 20% among susceptible hosts with an estimated baseline seroprevalence of 10%, the overall mayaro virus seroprevalence after the outbreak was about 30%. azevedo. reported a 34% seroprevalence after another outbreak in a settlement located in santa barbara municipality, northern brazil. average seroprevalence rates of 12% in amazonas state, 4% in para state, 5% in mato grosso state, 9% in goias state, and 5% in paraiba state were described in a national serum survey of brazilian military recruits. our average seroprevalence is similar to that described in brazilian recruits from the amazonas state. when our analysis was restricted to the amazonian natives, seroprevalence increased dramatically to 46%. high seroprevalence was observed by black. in a seroepidemiological survey carried out among indigenous tribes living in the lower amazon basin in brazil : 47% of the tiriyo tribe, 46% of the xikrin tribe, 49% of the mekranoti tribe, 20% of the kuben kk tribe, and 37% of the gorotire tribe talarmin. also found a significant higher seroprevalence in ethnic groups living in rain forest areas of french guiana. the seroprevalence of noir - marrons and amerindians observed during the serological survey was 23.7% and 19.4%, respectively. because the personnel from the andean and coastal region were mobilized to the amazonian rainforest, the 2% seroprevalence rate among them may have reflected the cumulative incidence rate under endemic and enzootic conditions and after an average of one year of residence in the garrison and its detachments. this rate is similar to the 1.6 to 5.3% annual infection rate reported in the dutch military troops on patrol in surinam. subjects with a history of hunting were six times more likely to be anti - body positive than were non hunters (or = 6.2 ; ci = 1.2032.4). during the initial 1957 report of mayaro fever in trinidad, causey, and maroja stated : this brief series suggests that exposure to the virus occurred at a time and place when the men were segregated from women and children, namely, during the day and at work. similarly, during the construction of the transamazon highway, the hunting activity of the colonists was the suspected cause that resulted in high rates of arboviral infections, including mayaro disease. this observation, hunting as a risk factor for mayaro virus infection, is also suggested by other authors when trying to explain the higher seroprevalence observed with increasing age. game constitutes the main source of protein among shuar and huaroni ethnic groups, contributing an estimated of 20% of the diet. meat sources include mammals, such as peccary, agouti, and howler, squirrel, capuchin, and black monkeys. the hunter, usually with male companions, waits until the monkeys are calling among themselves before stepping stealthily to the base of the monkeys tree and blowing the darts. hunting monkeys in the most remote parts of the rainforest usually takes several days. because one man can only hunt a fraction of a monkey troop the hunting team consists of young men supervised by the old master of ceremony, the wea, who inhales tobacco and guides the hunters during the hunting ritual session called kusupan. hunting, therefore, selectively places shuar and huaorani native males in close contact with hemagogus mosquitoes, which breed in tree holes and feed on blood from monkeys. in south america, the monkeys, in turn, serve as reservoirs of mayaro virus in the transmission cycle. during the belterra outbreak, hoch. collected blood samples from 585 mammals representing 47 species. antibodies against mayaro virus were detected in the single cebidae monkey studied and in 32 of the 119 (27%) callithricidae. in 1994 and 1995 in guiana, talarmin. tested sera from 106 howler monkeys (alouatta seniculos) finding 66.6% positive for mayaro virus antibodies. the gender of the monkey was not correlated with seroprevalence, but seroprevalence increased with increased age and weight of the monkeys. sera were also collected from 44 marmoset monkeys (saguinus midas) that showed a lower seroprevalence of 18.2%. in 1982, a study carried out by seymour. in panama, found howler monkeys (alouatta villosa) and agoutis (dasyprocta punctata) to have antibodies against mayaro virus. a recent serological survey for mayaro virus conducted in french guiana on 28 non - flying mammalian rainforest species found a wide variety of animals as reservoirs for mayaro virus. human subjects aged 30 years or more were eight times more likely to be seropositive than younger subjects (or = 7.9 ; ci = 2.229.1). when the analysis was restricted to native personnel [table 2 ] seroprevalence increased sharply to over 90% at age 30 years or more. in the study carried out in french guiana, talarmin. observed that seroprevalence increased significantly with age : < 10 years, 0% ; 1019 years, 5.5% ; 2029 years, 5.9% ; 3039 years, 8% ; 4049 years, 13% ; and 50 years, 20%. this steady rise in the increase of mayaro virus antibody prevalence by age can be interpreted as evidence of transmission under endemic and enzootic conditions. on the other hand, in our study group considering that age closely reflects years of residence among native rainforest population, it is plausible that the sharply higher prevalence in the 30 years age group is indicative that a major epidemic or epizootic event occurred sometime in the past two decades (when the younger birth cohort of native men were not yet hunting), followed by the maintenance of endemic levels linked to an enzoonosis. consequently, our results can be interpreted as evidence that hunter cohorts may be exposed sporadically to alphavirus, most likely mayaro virus, epizootic in the deep amazonian rainforest. the epidemic and epizootic behavior of mayaro virus transmission was demonstrated by the belterra, para, brazil study carried out in 1978. this is congruent with the diurnal behavior of h. janthinomys, the most likely vector in the amazon basin, whose activity peaks at approximately 1300 hours, decreases around 1600 hours, and ceases by 1800 hours. those who go to the jungle and clear the forest showed an increased risk ; however, the point estimates showed a wide confidence interval that included the null value. is mainly a tree - hole breeder, although it occasionally can be found in bamboo stumps. the presence of a high seroprevalence of alphavirus, most likely mayaro virus, antibodies was found during the investigation of a yellow fever outbreak. concomitant identification of yellow fever and mayaro virus has been reported among alouatta, cebidae, and callithricidae monkeys. although mayaro virus has not been reported in ecuador, a syndrome often referred to as jungle flu has been described by civilian and military physicians in the ecuadorian rainforest. this clinical syndrome was described in this study as flu - like symptoms with fever, arthralgia, myalgia, and headache. as mentioned before, these clinical symptoms are compatible with a potential infection with mayaro virus. this study constitutes the first systematic evaluation of risk factors associated with the transmission of mayaro virus, and its findings suggest a simple model of transmission in rainforest. while this data suggest further evidence that mayaro viral infection is common among rural / forest dwelling humans throughout south america, there is the possibility of other heterologous alphavirus antibodies cross - reacting with mayaro virus when elisa or hi test are used, especially venezuelan equine encephalitis virus (veev) and una virus. although the status of una virus infection in the ecuadorian amazon has not been investigated, there are reports of the presence of its subtype una virus in argentina, brazil and paraguay. a recent study of acute undifferentiated febrile illnesses in selected clinics from ecuador, peru, bolivia, and paraguay, reported the presence of mayaro virus in bolivia and peru. did not find mayaro virus infections in this area of ecuador because the virus is commonly found in rainforest areas. a limitation of our study is that neutralization tests were not performed to provide more conclusive results related to viral specificity of infection. indigenous people who grew up in the amazonian rainforest showed increased seroprevalence rates of alphavirus virus infection in relation to populations from the coastal and andean zones of the country. this increased seroprevalence among amazonian birth cohorts along with the clinical and epidemiological data demonstrates the potential presence of mayaro virus epidemics epizootics going on periodically in the deep amazonian rainforest with the maintenance of endemicity linked to a constant enzoonosis. our findings suggest the potential transmission of mayaro virus in ecuador, especially among the native population of the amazonian basin, most of whom are descendants of the ethnic shuar and huaorani people. hunting places these ethnic groups in close contact with arthropod vectors and primate reservoirs, which are the key elements that participate in this jungle model of transmission taking place deep in the rainforest. the high seroprevalence of alphavirus antibodies observed among natives of the amazonian rainforest identifies a possible mayaro focus of jungle transmission in this tropical area of ecuador. experimental infections of aedes mosquitoes suggest the possibility of the appearance of mayaro virus urban model of transmission, as has been observed in asia with the chikungunya virus, an alphavirus closely related to mayaro virus. it is necessary to develop and implement epidemiological sentinel centers for the surveillance of vector - borne diseases in central and south america.	objectives : the objectives of this report were to document the potential presence of mayaro virus infection in ecuador and to examine potential risk factors for mayaro virus infection among the personnel of a military garrison in the amazonian rainforest.materials and methods : the study population consisted of the personnel of a garrison located in the ecuadorian amazonian rainforest. the cross - sectional study employed interviews and seroepidemiological methods. humoral immune response to mayaro virus infection was assessed by evaluating igm- and igg - specific antibodies using elisa.results:of 338 subjects studied, 174 were from the coastal zone of ecuador, 73 from andean zone, and 91 were native to the amazonian rainforest. seroprevalence of mayaro virus infection was more than 20 times higher among amazonian natives (46%) than among subjects born in other areas (2%).conclusions : age and hunting in the rainforest were significant predictors of mayaro virus infection overall and among amazonian natives. the results provide the first demonstration of the potential presence of mayaro virus infection in ecuador and a systematic evaluation of risk factors for the transmission of this alphavirus. the large difference in prevalence rates between amazonian natives and other groups and between older and younger natives suggest that mayaro virus is endemic and enzootic in the rainforest, with sporadic outbreaks that determine differences in risk between birth cohorts of natives. deep forest hunting may selectively expose native men, descendants of the shuar and huaronai ethnic groups, to the arthropod vectors of mayaro virus in areas close to primate reservoirs.
the capacity of drugs to inhibit the bile salt export pump (bsep) has been correlated with clinical drug induced liver injury (dili). furthermore, known inhibitors of bsep and other bile acid (ba) transporters have been implicated in the case studies of dili. glibenclamide has been associated with lobular liver injury in the clinic, bosentan has been associated with many cases of hepatotoxicity and carries a black - box warning for hepatotoxicity, and troglitazone was withdrawn from the market due to idiosyncratic dili. currently marketed bsep inhibitors, such as lapatinib, have been given black - box warnings due to issues with liver toxicity. interestingly, bsep inhibitors often have additional proposed mechanisms for hepatotoxicity, and this can often confound our understanding of how these drugs cause dili. understanding the effects of bsep inhibitors on ba metabolism and processing will prove crucial in understanding the importance of bsep inhibition in clinical dili. while much is understood qualitatively about the basics of ba homeostasis, there are still many aspects of ba transport about which little quantitative information exists. for example, regulation of transporter activity by the farnesoid - x receptor (fxr) and other nuclear receptors generally responsible for ba synthesis has been demonstrated, and chenodeoxycholic acid (cdca) and its amide conjugates have been shown to decrease ba synthesis and trigger fxr. however, to our knowledge, fxr response and transporter activity have not been linked quantitatively to ba concentrations within hepatocytes. secondary bas, such as lithocholic acid (lca) and deoxycholic acid (dca), are synthesized in the gut by intestinal bacteria, but to our knowledge, the rates of synthesis and the population variability of this synthesis have not been quantified in any species. transporter kinetic and inhibition studies have used (or focused on) taurocholic acid, a metabolically stable model ba, but similar studies rarely have been performed on other bas. furthermore, while certain ba species, such as lca and cdca, are more cytotoxic than other bas, the effect that intrahepatic concentrations of these bas have on hepatocytes remains to be elucidated. while bsep transporter expression variability in humans has been quantified, and underlying diseases have been shown to affect transporter expression, the significance of this variability has not been explored fully. the process of constructing a mathematical model of ba - induced dili can be helpful in determining which data gaps should be filled first for maximum impact. while any mechanistic model of ba - induced dili will be lacking in quantitative accuracy due to the significant data gaps, mechanistic modeling can be used to qualitatively describe elements of the system that would be more or less likely to contribute to ba - mediated dili. in this study, we use dilisym (www.dilisym.com), a mechanistic mathematical model of dili, to explore the nature of ba homeostasis and its disruption by ba transporter inhibitors. dilisym has been used previously to assess the efficacy of different n - acetylcysteine treatment regimens in acetaminophen - overdosed patients and to understand the species differences in methapyrilene toxicity using in vitro metabolism data. for this study, we have constructed a module of ba homeostasis within dilisym for rats and humans ; information on the data used to construct this module is available in the supplementary materials online. we have also collected novel in vivo data from the rats treated with the bsep inhibitor glibenclamide and used these data to ensure the reasonability of the dilisym model. we also compared the human representation in dilisym to serum ba data in humans after acetaminophen overdose. this model was used to explore the changes in intrahepatic ba concentrations that are predicted to occur in humans when a ba transporter inhibitor is administered. finally, a sample population was used to determine which system parameters have the most influence on the magnitude of the intrahepatic ba changes that occur after dosing with a ba transporter inhibitor and would thus be the system components that would be most useful to be illuminated by future experiments. the bsep and na - taurocholate - cotransporting polypeptide inhibitor glibenclamide, when administered orally to rats, causes an increase in total plasma bas ; this increase in ba concentrations is associated with high systemic exposure to glibenclamide, but is not observed at lower exposure levels. figure 1 shows the results from the single - dose studies. glibenclamide is notoriously poorly absorbed ; as such, the systemic exposure for each individual rat is more important than the dose administered. at concentrations below a cmax of 10,000 ng / ml, there was little correspondence between glibenclamide concentrations and serum ba fold change, suggesting that the variability in ba processing among rats exceeds the effects of transporter inhibition at these exposure levels. rats with glibenclamide cmax > 10,000 ng / ml generally displayed a higher concentration of bas, albeit over a wide range. as shown in figure 1, the simulated population (simpops) covers the range of ba increases observed in the experimental rat data at each maximum simulated concentration tested, validating our model. figure 2 summarizes the results of the multiple - dose (300, 750, and 1,500 mg / kg) studies where individual ba species were measured. serum data from day 1 are plotted in figure 2 ; each data point represents an individual rat. serum cdca and lca concentrations increased very soon after glibenclamide dosing with a return to the baseline predosing value by the end of 24 h ; serum cdca amide conjugates did not appear to change after glibenclamide dosing. on day 7, plasma concentrations of glibenclamide did not vary widely in animals treated with the three different dose levels (data not shown) ; as a result, a single simulation was conducted on a rat simpops at a simulated drug exposure level similar to that observed in the rats in vivo. the results of this simulation were compared to the experimental data for lca, cdca, and cdca amide conjugates in figure 2. the simulated population showed similar dynamics to those observed in vivo ; the simulated rats exhibited a mild increase in bas between 1 and 2 h after dosing and returned to baseline values by 24 h. for unconjugated cdca, the simulated rat population covered the range of observed responses ; for lca, the simulated responses covered the bulk of the experimental data but missed the highest ba concentrations, while for cdca amide, our simulated population covered a much wider range than the experimental data, likely due to a wider range of initial cdca amide concentrations in the rat simpops. figure 2 demonstrates that dilisym provides a good approximation of the range of ba increases that were observed after administration of a transporter inhibitor. as data detailing the effect of ba transporter inhibitors on ba concentrations in humans were scarce, the model was validated in humans by comparing the response of the system after acetaminophen dosing to serum ba data from the clinic. acetaminophen is not a bsep inhibitor, so in this case, ba elevations are due to hepatocyte necrosis. our baseline human model had a similar response to that demonstrated by james., that is, little to no ba elevations in serum when injury was minimal, small but significant increases when there was moderate injury, and large elevations when the injury was severe. the small human simpops also exhibited a similar range of ba concentration changes to the patients reported in the james study. with the model structure validated using the rat and human experimental data, we proceeded to simulate a bsep inhibitor in our baseline human model. the difference in liver ba area under the curves (aucs) over the course of simulated drug administration in the presence and absence of the theoretical inhibitor is given in table 1. in all zones of the liver, increases were observed in the auc of bulk bas, cdca amide conjugates, and lca sulfate conjugates. meanwhile, the auc of unconjugated cdca and unconjugated lca actually decreased, while the auc of amide - conjugated lca remained about the same. the changes in ba concentrations with inhibitor as a function of the zonality of the liver were also examined using dilisym (table 1). in the periportal region, where most bas are concentrated, however, in the centrilobular region, all ba species except for unconjugated lca increased significantly. for cdca amide and lca sulfate conjugates, the increases in auc were far greater than those predicted in the periportal region. however, the absolute centrilobular auc remained lower than the absolute periportal auc for all ba species. the large model human population was used to understand the sensitivity of the model parameters to ba accumulation. the most important variables for the accumulation of each ba species in simulated human liver are shown in table 2. since the baseline human model simulations suggested that cdca amide and lca sulfate were the most likely ba species to accumulate in the liver, we assessed the correlation between changes in system parameters and increases in cdca amide and lca sulfate concentrations. the sensitivity analysis suggested that bsep expression, as represented by cdca amide canalicular transport vmax, was the most important variable for cdca amide accumulation, while the magnitude of lca synthesis in the gut was the most important variable for lca sulfate accumulation. amide accumulation when cdca amide canalicular efflux vmax changes compared to when the canalicular transport regulation scaling factor changes (which roughly corresponds to the magnitude of the response of ba transporter expression to fxr activation), as seen in figure 4, is particularly instructive. when cdca amide canalicular efflux vmax was varied, the baseline cdca amide concentration of the individual changed ; however, the percentage increase in cdca amide concentration after administration of the inhibitor was approximately constant across the variable range. in contrast, when the canalicular regulation scaling factor was varied, the baseline concentration of cdca amide remained the same (although meal fluctuations were more pronounced with less regulation), while the percentage increase in cdca amide concentration was much higher when canalicular transport regulation was lower. the novel in vivo data included herein demonstrate the importance of considering population variability and individual characteristics in any model of ba homeostasis and its disruption. the variability between rats shrouded the detection of changes in ba due to low concentrations of glibenclamide (cmax : 50010,000 ng / ml) and the resultant transporter inhibition. the lack of an apparent exposure / response effect in the individual ba data is due to the population variability. even with higher doses of glibenclamide, when an exposure / response relationship was observed, we found that there was a wide range of responses, as measured by a fold increase in ba concentrations, among the rats with glibenclamide cmax higher than 10,000 ng / ml. few rats reached the higher drug - exposure levels ; further experiments, perhaps using a more readily absorbed formulation of glibenclamide, could help illuminate this effect. the variability in the results also makes model validation difficult, as our ability to reproduce the experimental conditions (including individual rats ' initial plasma and liver ba concentrations) within the context of a simulation is challenging ; while our model is reasonably validated, further experimentation in this area will continue to improve our representation. our results suggest that due to the population variability inherent in the ba system, a baseline model is of limited utility for predicting the response of rats (or patients) to ba transporter inhibitors. a baseline model is useful for gleaning interesting information about the basic behavior of the system, but quantitative predictions of ba increases and decreases should not be based on the behavior of a baseline ba model. constructing an appropriate population for the human model is, therefore, of the utmost importance for the prediction of ba - mediated dili. to that end, we used the ba model to identify the most important parameters that are likely to vary among individuals. these parameters should be included in the creation of a reasonable population for the prediction of ba toxicity. the model suggests that the end - product ba conjugates are the ba species that are most likely to accumulate in the liver. this is likely due to the fact that the conjugation of bas is fairly rapid in the liver, and these pathways do not easily saturate. previous research has placed the km for ba amidation in the 1 mmol / l range, which is several orders of magnitude higher than typical in vivo unconjugated ba concentrations. as a result of the predicted accumulation of ba conjugates in the liver, ba amide and sulfate conjugates are potential liver toxicophores ; the toxicity of these molecules should be explored and quantified with future experimentation. centrilobular cells, which generally have a lower ba concentration than their periportal counterparts, have a much higher predicted relative accumulation of all ba species. in fact, the auc of unconjugated bas was predicted to increase in the centrilobular zone, even though the same bas ' auc decreased in the periportal zone. despite the differential ba changes in the two zones, the absolute auc of bas in the centrilobular zone was predicted to remain lower than the periportal zone. however, if centrilobular cells are more sensitive to ba toxicity than periportal cells, an increase in ba concentrations could lead to zonal centrilobular toxicity. indeed, some case reports of liver injury due to glibenclamide demonstrate centrilobular injury. the investigation of the differential effects of bas on centrilobular and periportal liver cell toxicity would be another interesting and worthwhile experiment. simulations using a model population provided further insight into the most valuable experiments that could be performed to improve our understanding of ba - mediated dili. among the many system unknowns varied within the model population, the most important variables included lca synthesis in the gut and the regulatory response to ba accumulation. therefore, quantifying lca synthesis in the gut in addition to changes in bsep expression and activity with increasing hepatocyte ba concentrations would be important and impactful experiments. the importance of bsep expression levels to ba accumulation in hepatocytes, for example, could be quantified using existing animal or in vitro models. the modeling also revealed the importance of transporter expression levels on the behavior of the system ; however, it is important to note a key difference between the behavior of the system when these expression levels are varied and its behavior when the regulatory response is varied. when transporter expression levels especially canalicular transporter levels are decreased, the baseline ba concentration in the liver increases ; the percentage increase in bas after dosing the inhibitor remains somewhat constant. varying the magnitude of the regulatory response (fxr activation), by contrast, does not have a large effect on baseline ba concentrations in the liver ; however, the percentage increase in bas after inhibitor dosing is highly variable. both transporter expression levels and the magnitude of the regulatory response are expected to vary within a population ; however, only the variability in transporter expression levels may be apparent in untreated individuals. this result suggests both the promise and the limitations of prescreening individuals for certain risk factors before prescribing known bsep inhibitors. it includes (i) the synthesis and metabolism of bas in hepatocytes, (ii) the basolateral and canalicular active transport of bas, (iii) the release of bas from the gallbladder in humans, (iv) the synthesis of secondary bas and deconjugation of bas in the gut, (v) the recirculation of bas from the gut and subsequent active uptake by the liver, and (vi) the regulatory effects of bas on transporter expression and ba synthesis. the model contains representations of lca and cdca and its conjugates, the ba species most frequently linked to toxicity in in vitro experiments, and a bulk ba representation that contains the other bas. a more detailed description of the ba homeostasis model and its parameterization is presented in the supplementary materials online. to represent ba dynamics in humans, the model was optimized to the known profile of bas in serum published by trottier., as well as to overall concentrations of bas in the liver measured by setchell and garca - caaveras. there were 47 system variables that were either unknown or expected to vary within the human population that were fit to the ba profile ; a list of the variables used in the optimization is provided in the supplementary materials online. the optimization of the model based on the published ba profile was performed in a manner similar to the simpops method outlined in previous publications, wherein a genetic algorithm was used to generate values of variable parameters that lead to model outcomes (in this case, ba profiles) that are within the range of experimental data. using this optimization method allowed the selection of a population of 2,400 individuals with reasonable baseline ba concentrations for the large human sample population. a smaller, 10-parameter, 331-individual simpops was also constructed for the purpose of model validation. while the large population was given artificially wide parameter ranges for the purpose of the sensitivity analysis, the small human sample population was constructed with more constrained parameter ranges for the purpose of approximating a plausible population of humans. for example, the transporter vmax ranges included four orders of magnitude in the large population, but were constrained to ranges suggested by transporter expression profiles from meier. in the small population. a population of 191 rats using a more limited 11 variable set (supplementary table s4 online) was generated. this population was intended to represent rats with both plausible serum ba concentrations and plausible values for the parameters that were varied. the baseline rat model was optimized to the ba profile from the control rats in the present experiment, and the simpops was constructed around this baseline. details on the simulations performed for the model validation and for the model exploration can be found in the supplementary materials online. multivariate analysis on the population sample was performed using jmp 9 from sas (cary, nc). multiple - dose glibenclamide study in rats for the ba - profiling experiments, 16 male 8- to 9-week - old cd-1 rats from charles river laboratories (raleigh, nc) weighing between 200 and 300 g were randomized into four groups of four animals each. these groups were administered daily doses of either the vehicle control (0.5% hydroxypropylmethylcellulose /0.1% tween 80 in water) or glibenclamide (sigma - aldrich, st louis, mo) in vehicle via oral gavage for 7 days at three dose levels (300, 750, and 1,500 mg / kg / day). rats underwent a viability check twice per day, and detailed clinical observations were taken at least twice over the course of the study. blood was drawn for serum ba profiles at 1, 3, 6, and 24 h after dosing on day 1 and day 7, and glibenclamide concentrations were measured for toxicokinetic analysis using the same blood samples from day 7. clinical and anatomic pathology data were collected from the animals, and these results are reported in the supplementary materials online. the serum ba concentrations from day 1 were used for comparison to the simulation results. ba profiling in serum was performed using liquid chromatography tandem mass spectrometry analysis at glaxosmithkline (ware, uk). bas in liver tissue 24 h after the final dose also were profiled ; results from this analysis, as well as the liquid chromatography tandem mass spectrometry analytical method, are presented in the supplemental materials online. this study was conducted in accordance with the glaxosmithkline policy on the care, welfare and treatment of laboratory animals and was reviewed by the institutional animal care and use committee. for this experiment, doses of glibenclamide were administered every 24 h for 7 days. systemic exposure data were compared to simulation results for day 7 ; day 1 ba data were compared to simulated ba concentrations on day 1. short - term glibenclamide studies in rats for the short - term studies, male han wistar rats (substrain alpkhsdbrlhan : wist ; astrazeneca, macclesfield, uk) of 1012-week age (300400 g) were used. details on the treatment of the rats used in this study are available in the supplemental materials online. two experiments were performed in which total plasma ba concentrations and glibenclamide plasma concentrations were determined. glibenclamide (sigma - aldrich) was formulated as a solution or suspension in hydroxypropyl--cyclodextrin (acros organics, distributed by fisher scientific, loughborough, uk) in aqueous 0.2 mol / l na2co3/nahco3 buffer (ph 10). in the first experiment (29 animals), four groups of five animals received a single dose via oral gavage of 50, 250, and 500 mg / kg glibenclamide or 10% (w / v) hydroxypropyl--cyclodextrin vehicle alone, and blood samples were taken at 1, 6, and 24 h after dosing ; an additional three animals per glibenclamide - treated group received a single dose of 50, 250, and 500 mg / kg glibenclamide, and blood samples were taken at 1, 3, 6, 12, and 24 h after dosing. in the second experiment (20 animals), two groups of five animals each received two oral doses of 250 and 500 mg / kg glibenclamide in 20% (w / v) hydroxypropyl--cyclodextrin vehicle at 0 and 4 h, and blood samples were taken predose and at 0.5, 1, 2, and 4 h after dosing ; blood samples from an additional five animals per glibenclamide - treated group were taken predose and 1 h after dosing to increase the dataset for this time point.	bile salt export pump (bsep) inhibition has been proposed to be an important mechanism for drug - induced liver injury (dili). modeling can prioritize knowledge gaps concerning bile acid (ba) homeostasis and thus help guide experimentation. a submodel of ba homeostasis in rats and humans was constructed within dilisym, a mechanistic model of dili. in vivo experiments in rats with glibenclamide were conducted, and data from these experiments were used to validate the model. the behavior of dilisym was analyzed in the presence of a simulated theoretical bsep inhibitor. bsep inhibition in humans is predicted to increase liver concentrations of conjugated chenodeoxycholic acid (cdca) and sulfate - conjugated lithocholic acid (lca) while the concentration of other liver bas remains constant or decreases. on the basis of a sensitivity analysis, the most important unknowns are the level of bsep expression, the amount of intestinal synthesis of lca, and the magnitude of farnesoid - x nuclear receptor (fxr)-mediated regulation.
straight back syndrome has been reported to be a pseudo - heart disease that can mimic congenital abnormalities, especially atrial septal defect (asd) (1). however, three - dimensional anatomical recognition of this rare disease entity appears to be insufficient. in this case report, we demonstrate the detailed anatomical background of straight back syndrome with a series of images obtained from low - dose dual - source computed tomography (dsct). a 23-year - old asymptomatic woman was referred to our hospital for a detailed examination of a systolic ejection murmur with fixed splitting of the second heart sound auscultated at the third left sternal border. electrocardiography showed right axis deviation and an incomplete right bundle branch block. according to these findings, the patient was suspected of having left - to - right shunt disease, including asd. contrary to expectations, transthoracic echocardiography did not indicate asd, but instead only showed the presence of trivial mitral valve regurgitation due to anterior mitral valve prolapse. because the four pulmonary veins could not be adequately visualized, she underwent low - dose electrocardiogram - gated contrast - enhanced cardiac computed tomography (ct) using commercially available third - generation dsct (somatom force, siemens healthcare, forchheim, germany) for further differential diagnosis, including partial anomalous pulmonary venous return, unroofed coronary sinus, subvalvular pulmonary stenosis, and double - chambered right ventricle. a low - dose protocol (acquisition mode, high - pitch dual spiral scan ; tube voltage, 70 kvp ; rotation time, 250 ms ; effective radiation dose, around 1 msv) was performed with a contrast agent volume of only 20 ml. the dsct findings ruled out the possibility of any congenital heart diseases, whereas the axial images clearly showed a markedly shortened anteroposterior diameter of the chest (fig. 1), which led us to a diagnosis of straight back syndrome. a vertically oriented pancake appearance (a compressed heart that appears to be enlarged in frontal images) of the heart (1) located in the so - called valentine position (the heart positioned on its apex) (2) (fig. 2b), and compression of the entire right ventricular outflow tract (rvot) (figure 3, 4) were clearly demonstrated on the reconstructed images. an accelerated flow in the compressed rvot was confirmed with subsequently re - examined transthoracic echocardiography. compression of the rvot and the accelerated flow were compatible findings as the cause of her systolic ejection murmur with fixed splitting of the second heart sound. axial image showing thoracic cage compression observed as a shortening of the anteroposterior diameter of the chest. a vertically oriented pancake appearance of the heart (a) and a straight vertebral column (b) are shown. ao : ascending aorta, icv : inferior caval vein, la : left atrium, laa : left atrial appendage, lv : left ventricle, lvot : left ventricular outflow tract, pa : pulmonary artery, raa : right atrial appendage, rv : right ventricle, rvot : right ventricular outflow tract, scv : superior caval vein, sv : sinus of valsalva compression of the right ventricular outflow tract : virtual dissection images. compression of the entire right ventricular outflow tract (rvot) between the aortic root and sternum are shown in the multiplanar reconstruction image (a) and volume - rendered image viewed from the cranial (b) and right (c) directions. the sectional plane of panel a is on the same level as that of panel b. the anteroposterior diameter (red arrowheads) of the rvot is 11.6 mm in systole. as : atrial septum, cs : coronary sinus, dao : descending aorta, l : left coronary aortic sinus, la : left atrium, laa : left atrial appendage, lad : left anterior descending artery, lcx : left circumflex artery, lipv : left inferior pulmonary vein, lmt : left main trunk, mb : moderator band, mva : mitral valvular attachment, n : non - adjacent aortic sinus, r : right coronary aortic sinus, ra : right atrium, rca : right coronary artery, ripv : right inferior pulmonary vein, spt : septoparietal trabecula, tva : tricuspid valvular attachment compression of the right ventricular outflow tract : dye - cast images. the relationship between the sternum and right ventricular outflow tract is shown in the frontal image (a). viewed from the left posterior oblique 120, the three - dimensional aspect of the entirely compressed right ventricular outflow tract (yellow dotted circle) between the sternum and aortic root is observed (b). the ascending aorta, aortic root, and left ventricle are removed from panel b (c). lv : left ventricle, ra : right atrium, raa : right atrial appendage, rv : right ventricle straight back syndrome has been reported to be a pseudo - heart disease that can mimic congenital abnormalities, especially asd (1,3). it typically occurs in young, thin persons with a reduced anteroposterior diameter of the chest because of a straight thoracic vertebral column caused by the absence of normal thoracic kyphosis. exaggerated splitting of the second heart sound and an incomplete right bundle branch block are common associated findings with asd (1,3). although the systolic ejection murmur, often heard at the left sternal border, originates due to rvot compression, this murmur lacks the typical rivero - carvallo sign. rather, this murmur decreases on deep inspiration and increases on deep expiration (3), because deep inspiration enlarges the thoracic cage and releases compression of the rvot. reported that the average transverse - to - anteroposterior thoracic diameter ratio of patients with straight back syndrome is 3.80, which is compatible with the present case (figure 1, 5), whereas that of the normal group is 2.17 (4). the difference in the anteroposterior diameter of the rvot measured using dsct and echocardiography could be explained by the differences in the respiratory phase of image data acquisition ; the dsct scan was obtained on deep inspiration in systole, whereas the echocardiographic image was obtained on deep expiration and measured in systole. figure 5, 6 show a comparison of the present case with a control case of a 30-year - old woman. comparison of axial images of the present case with those of the control case. axial images at the level of the ninth thoracic vertebra showing a more flattened chest in the present case (a) than that in the control case (b). comparison of volume - rendered images of the present case with those of the control case. volume - rendered thoracic images revealing a straight thoracic vertebra due to the absence of normal thoracic kyphosis (a), narrowed thoracic cages (a, b), a compressed heart (b), and a vertical median recess (red arrows) at the back between the scapulae (c). within the pericardial space, the posterior surface of the heart therefore, compared with the posterior part, the anterior to apical part of the heart is relatively easy to rotate. a considerable proportion of patients with pectus excavatum present with right atrial and ventricular compression due to narrowing of the anteroposterior diameter of the chest (6). however, compression of the rvot with a systolic ejection murmur and accentuated splitting of the second heart sound appears to be less common than straight back syndrome. the frequently observed leftward cardiac displacement in pectus excavatum (7) although it remains a speculation, in pectus excavatum, the negatively bulged anterior chest wall may allow the heart to be displaced, often toward the left side (7). on the other hand, the relatively flat anterior chest wall in straight back syndrome may completely prevent the displacement of the heart, as observed in the present case. regardless, in both anatomical situations, whether the rvot can escape from considerable compression is relevant. to the best of our knowledge, this is the first three - dimensional image of straight back syndrome reconstructed using low - dose dsct. as demonstrated, low - dose dsct with minimal contrast volume could comprehensively visualize the detailed anatomical background of this rare disease entity. the reconstructed images help identify the morphology of the heart and thorax in straight back syndrome and reinforce the importance of upper body inspection (including the superior dorsal region), careful auscultation, and lateral chest radiography in young patients who present with clinical findings suggesting asd.	a 23-year - old asymptomatic woman was referred to our hospital for further examination of a systolic ejection murmur with fixed splitting of the second heart sound auscultated at the third left sternal border. initial echocardiography could not detect the cause. subsequently performed low - dose computed tomography, however, ruled out the possibility of any congenital heart diseases, but revealed a markedly shortened anteroposterior diameter of the chest, which led us to a diagnosis of straight back syndrome. a vertically oriented pancake appearance of the heart, straight vertebral column, and compression of the right ventricular outflow tract were clearly demonstrated on the reconstructed images.
primary duodenal tumors are rare, accounting for less than 1% among all gastrointestinal tumors [1, 2 ]. brunner 's gland adenoma, also known as brunner 's hamartoma is a rare benign small bowel neoplasm with an estimated incidence of less than 0.01%. generally, it is an incidental finding discovered in an upper gastrointestinal endoscopy (egd) and presenting as a single pedunculated polyp, with an average size of 2 cm. occasionally, they may be larger than 5 cm, and located in the first section of the duodenum. most duodenal tumors of brunner 's glands are demonstrated as hyperplastic or hamartomatous mucosal changes and their malignant transformation has been reported to be extremely rare [6, 7 ]. in a recent study, dysplastic changes were seen in 2.1% and invasive carcinoma in 0.3% of all brunner 's gland hyperplasia. most patients are asymptomatic, although they can present with common gastrointestinal symptoms like bleeding, nausea, vomiting, or chronic abdominal pain. we present an illustrative case of a female patient with a duodenal polypoid mass of more than 6 cm who was admitted to our department with upper gastrointestinal bleeding. a 47-year - old woman arrived at our emergency room with melena and anemia accompanied by epigastric pain. physical examination on admission revealed normal vital signs ; she was afebrile with a soft and nontender abdomen. however, melena was detected in the rectal examination and the laboratory data showed a hemoglobin concentration of 8.2 g / dl (normal range : 12.016.0), and mean corpuscular volume of 88 fl (normal range : 8096). the emergency egd revealed a large pedunculated polyp (3 6 cm) in the first section of the duodenum with stigmata of recent hemorrhage which almost occluded the duodenal lumen completely (fig. the patient was transferred to our intensive care unit and was administered pantoprazole intravenously at 10 mg / h after an 80-mg loading dose. contrast - enhanced computed tomography scan showed a heterogeneously enhancing intraluminal mass arising from the proximal duodenum. repeated upper endoscopy, performed 1 day later, revealed a not actively bleeding polyp located in the bulb of the duodenum. because of the enormous size of the polyp, with a benign appearance, we decided to perform endoscopic resection. according to the high risk of bleeding an endoloop this procedure was repeated 3 times until the bulk seemed to be removed (fig. the endoscopic view was quiet poor because the base was placed directly behind the pylorus. to avoid perforation, the intervention was stopped at the moment, and endoscopic ultrasound (eus) was performed the next day. the brunner 's gland hyperproliferation was extended within the submucosa with a distance of 12 mm to the muscularis (fig. 4), though the endoscopic examination showed a strong vascularity of the submucosal lesions. evaluating the findings of endoscopy, eus and computed tomography scan we discussed either endoscopic mucosal resection (emr), endoscopic submucosal dissection (esd), or surgical management. after discussions of all approaches with the patient, including the risk of endoscopic perforation or bleeding, the patient consented to an elective duodenotomy. following the preoperative checkup, the pylorus was identified and a longitudinal incision was made on the pylorus ring for duodenal mucosa exploration. during the exploration, the mass was removed from the base and sent for histopathological examination. histologically, there was no evidence of malignancy, and once again, it was confirmed as a brunner 's gland adenoma measuring 16 15 6 mm with a residual peduncle of 4 mm. the tumor was composed of lobules of brunner 's glands with a few dilated glands. usually, polyps arise from the mucosal layer although some submucosal pathologies may cause mucosal protrusion into the lumen and resemble mucosal polyps. brunner glands are branched acinotubular glands with submucosal location found exclusively between the pyloric ring and the papilla of vater. they secrete an alkaline fluid composed of viscous mucin to protect the duodenal epithelium from acid chyme of the stomach. brunner 's gland adenoma is a rare tumor - like lesion, mostly present in middle age without sex predominance. curveilhier described the first case of benign duodenal brunner 's gland adenoma in 1835. in 1688, brunner gave a precise anatomic description of the duodenal submucosal glands and coined the term pancreas secundarium. in 1846, middeldorpf corrected these glands name as brunner 's glands. presently, fewer than 200 cases have been described with synonyms of brunner gland adenoma, brunner gland hamartoma, or brunneroma. brunner gland adenoma is generally a single pedunculated polyp, with an average size of 2 cm, rarely larger than 5 cm, and located in the first section of the duodenum. nonetheless, primary duodenal tumors are rare, accounting for less than 1% among the total gastrointestinal tumors even though they rarely have a malignant transformation [5, 6 ]. in a recent study, dysplastic changes were seen in 2.1% and invasive carcinoma in 0.3% of all brunner 's gland hyperplasia. the precise pathogenesis is poorly understood but the excessive local irritation from acidic gastric chyme, vagal stimuli, or unidentified antral hormones seems to have relevance. helicobacter pylori infection is accused of contributing to the pathogenesis of brunner 's gland hamartoma. in a study, 5 of 7 cases had concurrent h. pylori infection. nevertheless, the definite relationship has not yet been proven because of the high prevalence of h. pylori and the rarity of this lesion in the general population. some authors have further divided these lesions as follows : for lesions of less than 1 cm, the term hyperplasia is used while the term adenoma has been used for lesions of more than 1 cm and the term hamartoma if it also contains mesenchymal elements. the main differential diagnoses are gastrointestinal stromal tumor, lymphoma, carcinoid, peutz - jeghers polyps, prolapsed pyloric mucosa, or aberrant pancreatic tissue. after histopathological examination, treatment is recommended for tumors larger than 2.0 cm, even if they are asymptomatic. although endoscopic techniques of removal are more helpful, this procedure can be limited by difficult anatomical sites, so that various strategies, such as endoscopic, surgical, or a combination of both, are used, depending on the situation [3, 13 ]. presently, there is no relevant data of recurrence in such a lesion as well as any guidance in the follow - up. initially, we performed a partial endoscopic resection using endoloop and snare alternatively to prevent severe bleeding. however, on request of the patient, an elective surgical duodenotomy with submucosal resection of the remaining small duodenal tumor was performed. to better define the patient 's characteristics and treatment options of these lesions, a systematic review of the available literature in pubmed was performed (table 1). nowadays, an endoscopic removal of such lesions has commonly increased, and became a safe treatment modality utilizing advanced endoscopic equipment, particularly for benign submucosal tumors. various endoscopic procedures, including snare resection, esd, and the endoloop technique have been introduced for safe resection of benign tumors. duodenal lesions susceptible to endoscopic resection include premalignant lesions like adenomas, benign lesions (brunner hyperplasia or lipoma), and submucosal lesions with malignant potential like neuroendocrine tumors (net) or gastrointestinal stromal tumors (gist) (table 2) [14, 15 ]. furthermore, submucosal dissection in coagulation mode is used to control the depth of the cut and reduce the risk of bleeding. due to high complication rates (bleeding, perforation), esd could be a safe modality of treatment and less invasive in our case. informed consent has also been obtained from the involved patient, and there is no identifying patient information in the manuscript. the authors certify that they have no affiliations with or involvement in any organization or entity with any financial interest (such as honoraria ; educational grants ; participation in speakers bureaus ; membership, employment, consultancies, stock ownership, or other equity interest ; and expert testimony or patient - licensing arrangements), or non - financial interest (such as personal or professional relationships, affiliations, knowledge or beliefs) in the subject matter or materials discussed in the manuscript.	brunner 's gland adenoma is an extremely rare benign small bowel neoplasm, often discovered incidentally during upper gastrointestinal endoscopy or radiological diagnostics. in few cases, it tends to cause gastrointestinal hemorrhage or intestinal obstruction. we report here our experience with a 47-year - old woman with a brunner 's gland adenoma of more than 6 cm in size, located in the first part of the duodenum and causing gastrointestinal bleeding. initially, we performed a partial endoscopic resection using endoloop and snare alternatively to prevent severe bleeding. a rest endoscopic polypectomy with the submucosal dissection technique was planned. however, on request of the patient, an elective surgical duodenotomy with submucosal resection of the remaining small duodenal tumor was performed. to better define the patient 's characteristics and treatment options of such lesions, we performed a systematic review of the available literature in pubmed. recently, an endoscopic removal is being increasingly practiced and is considered as a safe treatment modality of such lesions.
total knee arthroplasty (tka) malalignment is related to an unsatisfactory outcome, including patella maltracking, anterior knee pain, flexion instability and early loosening. furthermore, inadequate positioning particularly of the femoral component is a common indication for revision [2, 8 ]. using the conventional and bony reference point methods, rotation of the femoral component can be determined intraoperatively by the use of the transepicondylar line, the posterior condylar line and/or the whiteside line [5, 23 ]. with the need for more accurate alignment as an important outcome determinant in tka, prosthesis positioning has been facilitated in recent years by computer assisted orthopaedic surgery (caos). the (intraoperative) value of caos on coronal plane alignment of knee prostheses has been discussed in literature. some showed improved alignment using caos [12, 21, 22, 26 ], while others showed little difference in alignment [3, 31 ] and no significantly better results during follow - up. the reason for the differences are both surgical and related to the intraoperative navigation using predetermined anatomical landmarks ; furthermore, the caos software program may be relevant. in caos, the planned rotational position of the components can be determined using the transepicondylar, the posterior condylar and the whiteside line. although the caos systems have been developed in an attempt to align implants more accurately and more consistently, it is unknown if navigation systems improve the accuracy of femoral rotational alignment as compared to the traditional techniques using mechanical guiding devices [10, 11, 28 ]. whether the intraoperative positions of the knee prosthesis components, as shown on the caos screen, reflect the goal of this study was to determine the validity of the intraoperative caos position of knee prostheses compared to the postoperative rotational position of the knee prosthesis using a postoperative ct scan evaluation method [7, 15 ]. twenty imageless navigated total knee arthroplasties were performed at the department of orthopaedic surgery at the leiden university medical centre. in a former study by van strien., the caos system was evaluated using postoperative radiographs and ct scans as well as rsa. five patients had secondary osteoarthritis due to rheumatoid arthritis and one secondary to haemophilia. in 11 patients the left knee was operated upon, in nine the right knee. in all patients a nexgen lps flex prosthesis (zimmer inc., the vector vision ct free computer navigation system, software version 1.6 (brainlab, feldkirchen, germany) was used in all operations. before identification of the bone and rotational centres of the leg and knee, the surgeon chooses in the software which reference axis will be used for determining the correct rotational position of the femoral component. these reference axes in the brainlab system are the epicondylar line, the posterior condylar line or the whitesides line. during surgery, anatomical landmarks are used to build a virtual image of the tibia and femur in the brainlab system. after attaching reference markers to the tibia and femur the intraoperative femoral anatomical registration points are : the most prominent points of the medial and lateral epicondyles, the anterior sulcus (whitesides line), the femoral mechanical axis, a cloud of points of the anterior distal femur and a cloud of points of the posterior condyles. after localisation of the landmarks is completed, the software calculates the ideal position of the femoral and tibial component based on the anatomical data input of axes and surfaces (i.e. femur and tibia). with respect to the rotation reference axes, the system uses one of the preoperative selected axes (in this study the epicondylar axis) ; it does not take into account all three axes. however, the caos software displays the displacement of the component with respect to all three axes on the screen (fig. 1). 1screenshot of the caos system with intraoperative data showing the deviation of the planned femoral component position compared to the rotational axis screenshot of the caos system with intraoperative data showing the deviation of the planned femoral component position compared to the rotational axis the definite femoral component was positioned as proposed by the navigation system, being the optimal caos femoral position. in these 20 cases the anterior cut was verified with a plane - verifying marker tree after the bone cut so that there was no change in rotation caused by the saw blade. this plane was then stored in the brainlab system (fig. 2). thus the postoperative measured bone cut along the femoral component is the same as made intraoperatively. 2screenshot of the caos system showing intraoperative information on the actual femoral cut screenshot of the caos system showing intraoperative information on the actual femoral cut the postoperative multi - slice ct scan was made between six weeks and three months after the operation, according to a standard protocol. based on availability, either a 16-slice (nine patients) or 64-slice (11 patients) machine was used (aquilion, toshiba, otawara, japan). ct protocols were developed based on recommendations by the brainlab company. for 16-slice ct, scanning parameters were beam collimation 16 x 1 mm and pitch 0.938 ; images were reconstructed using a medium - smooth kernel with 1-mm slice thickness and 1-mm reconstruction index. for 64-slice ct, scanning parameters were beam collimation 64 0.5 mm and pitch 0.828 ; images were reconstructed using a standard kernel with 1-mm slice thickness and 1-mm reconstruction index. postoperative ct images were interactively viewed on a workstation (vitrea2, vital images, minnetonka, mn, usa) using an extended window scale (16-bit deep, up to a window width and level of 65,500). thin - slice (1 - 2 mm) images of the distal femur were used to measure the postoperative rotational axes. the senior author (rn) performed all the operations and was not involved in the postoperative measurements of component position. we used the condylar twist angle (cta) to measure the rotational position of the femoral component. this epicondylar line was drawn between the most prominent point of the medial epicondyle and the most prominent point of the lateral condyle of the distal femur. the most prominent point of the medial epicondyle which is required for the cta is easier to identify than the medial sulcus which is required for the posterior condylar angle. the posterior condylar line was drawn along the posterior femoral cut (i.e. the inner border of the metal posterior condyles of the femoral component). at the ct scan viewer (sectra workstation) two points were identified at the medial and lateral epicondyles for angle measurement (cta). these points were marked at the ct workstation and were thus visible at the different ct slices (fig., the angle between the medial and lateral epicondyle could be measured accurately without reconstructing a thick slice to visualise both most prominent epicondylar points at the same time. fig. 3postoperative computed tomography (ct) example showing the measured condylar twist angle (cta) postoperative computed tomography (ct) example showing the measured condylar twist angle (cta) the cta was independently measured by two observers, at two separate time intervals two weeks apart. these measurements were compared to the intraoperative registered rotation of the femoral component ; the latter is stored in a therapy report by the caos system. this report is an overview of all registered femoral and tibial points, which are needed to register the specific morphology of both tibia and femur as well as the centre of the hip joint and the ankle joint. furthermore, this report saves, during the several steps of the coas procedure, final steps after bone cuts have been made (i.e. tibial cut, femoral bone cuts). the epicondylar axis which was obtained from the caos system was compared to the ct measurements of the femoral component using an intraclass correlation coefficient. limits of agreement were obtained for the different comparison according to bland and altman, a graphical tool to measure agreement between two methods. the interpretation of the icc is similar to that of the cohen s kappa, such that icc = 0.400.59 is moderate interobserver reliability, 0.600.79 substantial and 0.80 outstanding. for statistical analysis, the rotational alignment of the femoral component which was saved in the registry report of the caos system was 3.5 (range 2.49.6). in none of the knee prostheses was a cement layer of more than 1 mm detected at the lateral radiograph on the anterior, posterior and/or distal cut. the mean cta measured on the postoperative ct scan was 4.0 (range 1.77.2) for observer 1 and 4.4 (range 1.29.9, sd 1.5) for observer 2. the measured cta on the ct scan showed an intraclass correlation of 0.81 (p 1 in the frontal plane of the femur in 20%. however, the rotational position was not evaluated and the influence of the thickness of the cement layer on femoral component position is therefore still unknown. thus, the positioning of the components in total knee arthroplasty, which mainly involves cementation and impaction of the final components, can introduce an error in alignment, regardless of how accurately the resection planes are made. in conclusion, the intraoperative caos measured rotation of the femoral component differs from the postoperative ct measured position and is therefore not reliable as an absolute value. caos can probably help to achieve the optimal position of the femoral component but continuous improvement in methods to accurately identify the rotational position and establish the ideal rotation of the components in total knee arthroplasty is still needed.	rotation of the femoral component in total knee arthroplasty (tka) is of high importance in respect of the balancing of the knee and the patellofemoral joint. though it is shown that computer assisted surgery (caos) improves the anteroposterior (ap) alignment in tka, it is still unknown whether navigation helps in finding the accurate rotation or even improving rotation. therefore the aim of our study was to evaluate the postoperative femoral component rotation on computed tomography (ct) with the intraoperative data of the navigation system. in 20 navigated tkas the difference between the intraoperative stored rotation data of the femoral component and the postoperative rotation on ct was measured using the condylar twist angle (cta). this is the angle between the epicondylar axis and the posterior condylar axis. statistical analysis consisted of the intraclass correlation coefficient (icc) and bland - altman plot. the mean intraoperative rotation cta based on caos was 3.5 (range 2.48.6). the postoperative ct scan showed a mean cta of 4.0 (1.77.2). the icc between the two observers was 0.81, and within observers this was 0.84 and 0.82, respectively. however, the icc of the caos cta versus the postoperative ct cta was only 0.38. though caos is being used for optimising the position of a tka, this study shows that the (virtual) individual rotational position of the femoral component using a caos system is significantly different from the position on a postoperative ct scan.
the hypoxic pulmonary vasoconstriction (hpv) is physiologically and clinically important phenomenon to prevent systemic hypoxemia by diverting pulmonary blood flow from unventilated area to normoxic regions of lung. the oxygen (o2) sensing mechanisms of pulmonary arteries have been long dispute. although the o2-dependent regulations of ion channels, especially the hypoxic inhibition of k channel, are strong candidate mechanisms, it is still unclear whether ion channels by themselves are the o2 sensing molecule (1 - 3). twik - related acid - sensing k channel (task) is a member of two - pore domain k channel family, and has been suggested as a candidate of o2-sensing k channels in various types of tissues such as carotid body and pulmonary arterial smooth muscle (4). the hypoxic inhibition of task might explain, at least partly, the depolarization of pulmonary arterial smooth muscle and contractile responses under hypoxia (5). recently, we found that the hypoxic inhibition of task-1 channel is mediated by nadph oxidase type 4 (nox-4), which is mediated by the heme moiety and heme - binding domains of nox4 (6). in that study, it was found that the hypoxic inhibition of task-1 was prevented by a pretreatment with carbon monoxide (co), which implicated that a high - affinity binding of co with hemoprotein (nox-4) might have mimicked the o2-binding state in spite of the hypoxic conditions. co has long been considered a toxic byproduct of incomplete combustion of coals and fuels. the toxic effect of co is due to its strong affinity for hemoglobin and resultant impairment of o2 delivery by erythrocytes. in contrast to this conventional idea, an endogenous production of co from heme metabolism by heme oxygenase (ho) has become well recognized. the endogenously produced co is believed to play physiological roles such as anti - inflammatory and anti - apoptotic signals (7). in this regard, an exogenous application of co at sub - lethal concentration has been suggested as a therapeutic maneuver to improve tissue implantation and to prevent vascular remodeling such as atheroscleoris (8). a recent animal study demonstrated that sublethal treatment with co effectively prevents the medial proliferation (vascular remodeling) and pulmonary hypertension under chronic hypoxia (9). such physiological and pharmacological effects of co are thought to be mediated by multiple mechanisms such as soluble guanylate cyclase (sgc)-dependent production of cgmp and regulation of mapk - pathways (10). in addition, co has been also suggested as a positive regulator of large - conductance ca - activated k channel (bkca) via heme moieties that are associated with bkca (11). the activation of bkca by co could induce hyperpolarization and relaxation of arteries (12). regarding to the regulation of putatively o2-sensing k channels by co, it was tempting to investigate the physiological and pharmacological roles of co in hpv and pulmonary arteries. the effects of co on pulmonary blood flow and hpv have been previously investigated using perfused / ventilated lungs (v / p lungs) (13 - 16). in these studies, however, the exogenous application of co showed diverse results ; from essentially no effect to substantial inhibition of hpv depending on the tested ranges of co concentrations (200 ppm to 12% of ventilated gas). in our pilot study using isolated pulmonary artery (pa), we found that co treatment effectively abolish the contractile response of pa to hypoxia. from these backgrounds, we attempted to further investigate the effects of co on the hpv of pa and v / p lungs. our present study revealed intriguing difference between the hpv responses of pa (hpvpa) and lung (hpvlung) in terms of their modulation by exogenous co. the animal studies were performed after receiving approval of the institutional animal care and use committee (iacuc) in seoul national university (iacuc approval no. male sprague - dawley rats (250??00 g) were fully anaesthetized with pentobarbital sodium (40 mg / kg). a tracheotomy was performed, and the animals were ventilated with gas mixture of 21% o2 and 5% co2 with balance made up by n2 with a harvard respirator (small animal ventilator 683, harvard apparatus, holliston, ma, usa). stable ventilation (85 breaths / min) with regular tidal volume (10 ml / kg) after a median sternotomy, lungs were exposed, and a suture was placed around the ascending aorta and the main pulmonary artery. after injection of heparin (200 u / kg) into the right ventricle, a cannula was inserted into the pulmonary artery via the right ventriculotomy, and the suture was tightened. another cannula was into the left atrium via the left ventriculotomy and tied off the left ventricle, and then the blood was allowed to flow from the lung into the reservoir (37). the anesthetized rats were sacrificed during the above procedure by diverting blood flow to extra - corporal circulation. lungs were perfused at a constant flow of 15 ml / min using a peristaltic pump (servo amplifier 2990, harvard apparatus). the perfusate consisted of 20 ml of whole blood and 30 ml of physiological salt solution (pss) resulting 10 - 15% hematocrit in 50 ml of the recycling perfusate. the mean pap was measured using membrane pressure transducers connected to a side port of the inflow cannula, and the data acquisition and storage was done with powerlab/4st and chart5 (adinstruments). after a stabilization period, angiotensin ii (1 g) was injected into the circuit near the lung and then restabilization of pulmonary arterial pressure, the lungs were exposed to cycles of normoxia (5 min) and hypoxia (5 min) through ventilation with gas containing 21% or 3% o2 and 5% co2 with balance made up by n2. lungs were rapidly removed from the fully anesthetized rats (see above), and the second- and third - order branches of pas (i.d. 300 - 400 m) were carefully dissected and cut into segments (2 mm in length). segment of artery was mounted on two 40-m wires in a mulvany - type myograph (myo - interface model 410a, dmt, denmark). after a stabilization period in pss continuously gassed with 74% n2, 21% o2 and 5% co2 at 37, a basal tone (~0.5 g) was applied. before the experiments, we evaluated viability of arteries using 80 mm kcl - pss (equimolar substitution with nacl). the bath solution was directly bubbled with hypoxic gas to lower the dissolved o2. before the application of hypoxic gas, a low concentration of thromboxane a2 analogue (10 nm u46619) the u46619-induced pretone was equivalent with 5 to 10% of 80k contraction, and this partial contraction was necessary to evoke hpv in the isolated pas in our experimental condition. we also measured the partial pressure of o2 (po2) nearby the pa using a micro - oxygen electrode (mi-730, microelectrodes inc., bedford, nh, usa), and confirmed that the po2 was dropped to 3 - 4% by bubbling with the hypoxic gas (> 5 min). the pss used in ventilated / perfused lung experiment consisted of the following composition (in mm) : nacl 131, kh2po4 1.2, nahco3 22.6, cacl2 3.2, mgso4 1.2, glucose 11 and albumin 30.0 g / l. the pss used in myograph experiment with pa consisted of the following composition (in mm) : nacl 118, kcl 4, nah2po4 0.44, nahco3 24, cacl2 1.8, mgso4 1 and glucose 5.6. isotonic high k solutions (80 mm) were prepared by replacing nacl with an equimolar amount of kcl in pss solution. bovine serum albumin (bsa) 1h - oxadiazolo-[4,3-a]quinoxalin-1-one (odq) was purchased from tocris (ellisville, mo, usa). zinc protoporphyrin ix (znpp) was obtained from sigma (st. louis, mo, usa). znpp was dissolved in 0.1 n naoh, titrated to ph 7.4 with 0.1 m hcl and diluted with phosphate buffered solution (pbs). the data is presented as the original recordings and bar graphs of the meansem (for n tested animals and arteries). where necessary, one - way analysis of variance (anova) and bonferoni multiple range tests were used for the statistical analysis. the animal studies were performed after receiving approval of the institutional animal care and use committee (iacuc) in seoul national university (iacuc approval no. male sprague - dawley rats (250??00 g) were fully anaesthetized with pentobarbital sodium (40 mg / kg). a tracheotomy was performed, and the animals were ventilated with gas mixture of 21% o2 and 5% co2 with balance made up by n2 with a harvard respirator (small animal ventilator 683, harvard apparatus, holliston, ma, usa). stable ventilation (85 breaths / min) with regular tidal volume (10 ml / kg) after a median sternotomy, lungs were exposed, and a suture was placed around the ascending aorta and the main pulmonary artery. after injection of heparin (200 u / kg) into the right ventricle, a cannula was inserted into the pulmonary artery via the right ventriculotomy, and the suture was tightened. another cannula was into the left atrium via the left ventriculotomy and tied off the left ventricle, and then the blood was allowed to flow from the lung into the reservoir (37). the anesthetized rats were sacrificed during the above procedure by diverting blood flow to extra - corporal circulation. lungs were perfused at a constant flow of 15 ml / min using a peristaltic pump (servo amplifier 2990, harvard apparatus). the perfusate consisted of 20 ml of whole blood and 30 ml of physiological salt solution (pss) resulting 10 - 15% hematocrit in 50 ml of the recycling perfusate. the mean pap was measured using membrane pressure transducers connected to a side port of the inflow cannula, and the data acquisition and storage was done with powerlab/4st and chart5 (adinstruments). after a stabilization period, angiotensin ii (1 g) was injected into the circuit near the lung and then restabilization of pulmonary arterial pressure, the lungs were exposed to cycles of normoxia (5 min) and hypoxia (5 min) through ventilation with gas containing 21% or 3% o2 and 5% co2 with balance made up by n2. lungs were rapidly removed from the fully anesthetized rats (see above), and the second- and third - order branches of pas (i.d. 300 - 400 m) were carefully dissected and cut into segments (2 mm in length). segment of artery was mounted on two 40-m wires in a mulvany - type myograph (myo - interface model 410a, dmt, denmark). after a stabilization period in pss continuously gassed with 74% n2, 21% o2 and 5% co2 at 37, a basal tone (~0.5 g) was applied. before the experiments, we evaluated viability of arteries using 80 mm kcl - pss (equimolar substitution with nacl). the bath solution was directly bubbled with hypoxic gas to lower the dissolved o2. before the application of hypoxic gas, a low concentration of thromboxane a2 analogue (10 nm u46619) the u46619-induced pretone was equivalent with 5 to 10% of 80k contraction, and this partial contraction was necessary to evoke hpv in the isolated pas in our experimental condition. we also measured the partial pressure of o2 (po2) nearby the pa using a micro - oxygen electrode (mi-730, microelectrodes inc., bedford, nh, usa), and confirmed that the po2 was dropped to 3 - 4% by bubbling with the hypoxic gas (> 5 min). the pss used in ventilated / perfused lung experiment consisted of the following composition (in mm) : nacl 131, kh2po4 1.2, nahco3 22.6, cacl2 3.2, mgso4 1.2, glucose 11 and albumin 30.0 g / l. the pss used in myograph experiment with pa consisted of the following composition (in mm) : nacl 118, kcl 4, nah2po4 0.44, nahco3 24, cacl2 1.8, mgso4 1 and glucose 5.6. isotonic high k solutions (80 mm) were prepared by replacing nacl with an equimolar amount of kcl in pss solution. bovine serum albumin (bsa) 1h - oxadiazolo-[4,3-a]quinoxalin-1-one (odq) was purchased from tocris (ellisville, mo, usa). zinc protoporphyrin ix (znpp) was obtained from sigma (st. louis, mo, usa). znpp was dissolved in 0.1 n naoh, titrated to ph 7.4 with 0.1 m hcl and diluted with phosphate buffered solution (pbs). the data is presented as the original recordings and bar graphs of the meansem (for n tested animals and arteries). where necessary, one - way analysis of variance (anova) and bonferoni multiple range tests were used for the statistical analysis. the isometric tension of pa was measured under continuous aeration (21% o2/5% co2). for normalization, high k (80 mm)-induced contraction (80k contraction) was confirmed in each vessel. after returning to control solution, 10 nm u46619 (thromboxane a2 stable analogue) was applied to induce a ' pretone ' that was equivalent with 5 to 10% of 80k contraction. in the pretone state, a robust hpv was consistently observed by bubbling with hypoxic gas (po2, 3%, 916.1% of 80k contraction, n=7, fig. application of 3% co in normoxic condition did not affect the pretone induced by u46619, while completely blocked the hpvpa (fig. the suppressed hpvpa was completely reversed to 1057.9% of 80k contraction by co washout (n=8, fig. therefore, we tested whether the application of 2 mm tea, a potent blocker of bkca, recover the hpv under the inhibition by co. however, the tone of pa was only slightly increased by tea, and the hpvpa was recovered only after the removal of co (fig. next, we tested whether the guanylate cyclase is involved in the inhibition of hpvpa by co. the application of odq (30 m), an inhibitor of soluble guanylate cyclase, effectively recovered the hpvpa (fig. 2b, n=3). the above results suggested that an activation of sgc by co and cgmp - dependent signaling effectively inhibited the hpvpa. then we tested the effects of co on the hpvlung. in the v / p lungs of rats, an increase of pap in response to hypoxic (po2, 3%, 5 min) ventilation (paphypox) was measured to monitor the hpv. the repetitive hypoxic ventilation with 5 min of recovery time in normoxic ventilation showed similar amplitudes of paphypox. after confirming the consistent paphypox, co (0.3, 1, and 3%) the amplitude of paphypox was decreased by co in a dose - dependent manner (fig. however, the inhibition of hpvlung was incomplete even at 3% co. the partial inhibitory effects of co on the hpvlung and basal pap were reversed by ventilating with co - free gases. in addition, the removal of co revealed a kind of rebound increase of basal pap and hpvlung (fig. the partial inhibition of hpvlung by co was not affected by blocking bkca using 2 mm tea (fig. however, different from the response of hpvpa, the partial inhibition of hpvlung was also unaffected by odq (fig. interestingly, in the presence of 10 m odq, an application of 10 m l - name still induced a marked increase in basal pap and paphypox. furthermore, an additive co application decreased the amplitude of paphypox to a similar extent as in control (fig. the ineffectiveness might indicate that odq could not inhibit sgc by unknown reasons when applied to the blood - containing perfusate. otherwise, co inhibits hpvlung in sgc - independent manner (see discussion). finally, we tested whether hpvlung is regulated by endogenously produced co via ho - dependent pathway. a pretreatment of 30 m znpp, an inhibitor of ho, appeared to induce a slight increase in hpvlung (fig. in this study, an exogenous application of 3% co completely inhibits the hpvpa whereas the same level of co had only a partial inhibitory effect on hpvlung in the rats. the test of odq on these differential responses revealed more perplexing results ; the hpvpa was completely recovered from the co - induced inhibition whereas the partially inhibited hpvlung was unaffected by odq treatment. a previous study by other researchers also showed partial inhibition of hpvlung by co, which is unaffected by the pretreatment with nos inhibitor (16). our present results in v / p lung model (insignificant effects of l - name and odq) are consistent with this report in terms of cgmp - independent inhibition of hpv by co. however, as mentioned above, the recovery of hpvpa by odq was inconsistent with these findings, for which we do not have a satisfactory explanation yet. also, the ineffectiveness of ho inhibitor on the hpvpa and on the basal tone of pas indicates that the putative role of endogenous co by ho is less likely in the o2 sensing mechanisms of pa. if odq had actually inhibited sgc in the v / p lungs, it was expected that the application of odq alone would mimic the effects of l - name because the vasorelaxation by endogenous no is mainly mediated by cgmp. however, in contrast to the prominent increase of basal pap and hpvlung by l - name, the odq pretreatment alone did not change these parameters (fig. 4). moreover, in the odq - pretreated v / p lungs, the additive application of l - name showed increased basal pap and hpvlung responses. from these results, it was suggested that odq applied to the blood containing perfusate might somehow lose its inhibitory action on sgc in v / p lungs. while the concentration of odq (30 m) used in this study was much higher than the reported ic50 on sgc (40??00 nm) (17), we could not exclude such possibility. interestingly, an earlier study of odq showed that the potent inhibition of sgc by odq is not directly associated with the prevention of the no donor - induced relaxation in bovine pas in that the anti - relaxing effect requires much higher concentrations (1 - 10 m) of odq (17). in this respect, the inhibition of hpvpa by co and its recovery by odq might be also cgmp - independent events. such speculation is actually consistent with the conclusion of previous studies in v / p lungs (16). lastly, the more prominent pap increase by l - name than by odq might suggest multiple vasodilatory mechanisms of no ; sgc - independent relaxing effects of no (18, 19). as mentioned in introduction, the present study was initially triggered by our previous experimental finding ; prevention of hypoxic task-1 inhibition by co (6). in this study, the heme - binding domain of nox4 has been proposed as the o2 sensing module that is also affected by co. since a deletion of nadph - binding domain did not affect the nox4-mediated task-1 regulation by o2, it was suggested that a non - enzymatic actions of nox4 was suggested as the mechanism for hypoxic inhibition of task-1 (6). while not shown in our present study, the application of anandamide, an inhibitor of task-1 (4), did not induce a significant contraction of pas (data not shown). therefore, the hypoxic inhibition of task-1 might not play a major role of hpv in rats. also, the complete recovery of hpvpa by odq did not support the role of nox4-like o2 sensor molecules in hpv. in general, the consistent contractile response of isolated pa to hypoxia has been used as an experimental model to investigate the cellular mechanisms of hpv. the differential sensitivities of hpvlung and hpvpa to 3% co indicated that the underlying mechanisms of hpv are more complex in v / p lungs than isolated pas. the vasoactive substances and neurotransmitters released from lung parenchyma and blood cells might have additive or synergistic effects on the hypoxic responses, and thereby showed persistent hpvlung under co treatment. while the natures of facilitating factor are still incompletely known, our previous study showed that the blood cells are critical for maintaining the hpvlung (20). the high affinity binding of co with hemoglobin might also affect the reactivity of pa in v / p lungs. however, since the inhibition of hpv by co was readily reversible by co - free ventilation or bubbling, the involvement of hemoglobin is a less - likely explanation. another concern was that the co concentration in the v / p lung might not reached an equilibrium due to the high affinity of hemoglobin to co. however, a previous in vivo study of rats showed that the plasma co concentration readily reaches steady - state equilibrium within 5 min when ventilated with 1% co (21). in our present study, the decrease of hpvlung by prolonged co ventilation was not different from the acute response to co (see fig. 3 and 4). as a whole, however, the results of studies on hpv mechanism require cautious interpretation in terms of experimental modes and conditions. in summary, our study reveals intriguing differences in the sensitivity of hpv to exogenous co ; total vs partial inhibition in pa and v / p lungs, respectively. the resistance of hpvlung to co implies redundant o2-sensing mechanisms in vivo. the inconsistent effects of odq on hpvpa and hpvlung suggest that odq may lose its sgc inhibitory action when applied to the blood - containing perfusate. the requirements of relatively high concentration of co to induce a partial inhibition of hpvlung indicate that the therapeutic application of co (< 300 ppm) in some previous reports (7 - 10) is not relevant with the mechanisms in hpv. further investigation is required to understand the effects of an endogenous / exogenous co on the chronic hypoxia - induced changes in cells and tissues (22).	hypoxic pulmonary vasoconstriction (hpv), a unique response of pulmonary circulation, is critical to prevent hypoxemia under local hypoventilation. hypoxic inhibition of k+ channel is known as an important o2-sensing mechanism in hpv. carbon monoxide (co) is suggested as a positive regulator of ca2 + -activated k+ channel (bkca), a stimulator of guanylate cyclase, and an o2-mimetic agent in heme moiety - dependent o2 sensing mechanisms. here we compared the effects of co on the hpv (po2, 3%) in isolated pulmonary artery (hpvpa) and in blood - perfused / ventilated lungs (hpvlung) of rats. a pretreatment with co (3%) abolished the hpvpa in a reversible manner. the inhibition of hpvpa was completely reversed by 1h-[1,2,4]oxadiazolo-[4,3-a]quinoxalin-1-one (odq), a guanylate cyclase inhibitor. in contrast, the hpvlung was only partly decreased by co. moreover, the partial inhibition of hpvlung by co was affected neither by the pretreatment with odq nor by no synthase inhibitor (l - name). the co - induced inhibitions of hpvpa and hpvlung were commonly unaffected by tetraethylammonium (tea, 2 mm), a blocker of bkca. as a whole, co inhibits hpvpa via activating guanylate cyclase. the inconsistent effects of odq on hpvpa and hpvlung suggest that odq may lose its sgc inhibitory action when applied to the blood - containing perfusate.
traumatic brain injury (tbi) caused by a direct mechanical insult to the brain induces cerebral contusion and motor and cognitive dysfunction [14 ]. recent studies have indicated that populations of damaged or destroyed neurons can be replenished by proliferation of neural stem cells (nscs) [5, 6 ] or newly forming neurons. doublecortin (dcx), a microtubule - associated protein, is specifically expressed in all migrating neuronal precursors of the developing brain [7, 8 ]. dcx expression is retained mainly within areas of the subventricular zone (svz) of the lateral ventricles and the subgranular zone (sgz) at the dentate gyrus / hilus interface of hippocampus [8, 9 ] in the adult brain. following an insult to the brain, the increased number of divided cells in the svz and sgz is newly formed immature neurons and expresses dcx [1, 7, 10 ]. because of its association with neurogenic processes, dcx expression levels in the adult brain reflect neurogenesis. inhibiting tumor necrosis factor - alpha (tnf-) with etanercept is effective for attenuating tbi - induced cerebral contusion, motor and cognitive dysfunction, astrocytic and microglial activation, and activated inflammation [11, 12 ]. however, it is not known whether systemically administered etanercept penetrates injured brain tissue and attenuates the tbi - induced brain dysfunction by stimulating dcx - associated neurogenesis. therefore, we examine the relationship between dcx - associated neurogenesis and the tbi - induced formation of cerebral contusions around a damaged brain area. changes in 5-bromodeoxyuridine-(brdu-) dcx double expression are analyzed using immunohistochemistry to investigate the relationship between dcx - associated neurogenesis and the formation of cerebral contusions and cognitive dysfunction in rats treated with and without etanercept. quantitative enzyme immunoassays are used to analyze etanercept levels in the brain after its systemic administration to ascertain whether it had passed through the blood - brain barrier (bbb) during tbi. male sprague - dawley rats (weight, 254 10 g) were purchased from the national animal laboratory center of the national science council (taipei, taiwan). four rats were housed together at an ambient temperature of 22 1c with a 12 h light - dark cycle. all protocols were approved by the animal ethics committee of the chi mei medical center. we did as much as possible to minimize the rats ' discomfort during surgery and in the recovery period. anesthetized with sodium pentobarbital (25 mg / kg) (sigma - aldrich, st. louis, mo, usa) and intramuscularly (i.m.) with a mixture containing ketamine (4.4 mg / kg) (nang kuang pharmaceutical, tainan, taiwan), atropine (0.02633 mg / kg) (sintong chemical, taoyuan, taiwan), and xylazine (6.77 mg / kg) (bayer, leverkusen, germany). each rat was placed in a stereotaxic frame, and its scalp was sagittally incised. the rats were then subjected to a lateral fluid percussion injury. after the scalp had been incised, a 4.8 mm circular craniotomy was done midway between lambda and bregma, 3.0 mm to the right of the central suture. a modified luer - lock connector (trauma cannula) with an inner diameter of 2.6 mm was secured in the craniotomy with cyanoacrylate adhesive and dental acrylic. a moderate percussion (2.2 atm) was produced by rapidly injecting a small volume of saline into the closed cranial cavity with a fluid percussion device (vcu biochemical engineering, richmond, va, usa). the rat was removed from the device, the acrylic was removed, and the incision was sutured. each injured and sham - injured animal for the percussion model was closely evaluated immediately after percussion for behavioral recovery. the rats were randomly allocated into one of three groups : (i) tbi + vehicle (tbi + v) : the rats were subjected to tbi and injected with normal saline (1 ml / kg ; i.p.) (n = 8) ; (ii) tbi + etanercept (tbi + e) : the rats were subjected to tbi and injected with etanercept (0.1 mg / kg ; i.p.) once every 12 h for 3 consecutive days (n = 8) ; and (iii) sham - tbi : the rats were subjected to the same surgical procedures as described in section 2.2 but not to percussion - induced tbi (n = 8). in experiment 1, etanercept (enbrel ; wyeth pharmaceuticals, new lane, havant, hampshire, uk) or saline was injected immediately after tbi once every 12 h for 3 consecutive days, and the effect on the maximal angle of an inclined plane that the rats could cling to, as well as neurological severity score (nss), was assessed 7 days after tbi. in experiment 2, etanercept or saline was randomly administered immediately after tbi once every 12 h for 3 consecutive days, and the effect on the rats ' cerebral contusion zone was assessed 7 days after tbi. in experiment 3, etanercept or saline was randomly administered immediately after tbi once every 12 h for 3 consecutive days, and the effect on double - immunofluorescence staining for doublecortin (dcx) and neuronal nuclei (neun) in the rats ' damaged brain areas was assessed 7 days after tbi. in experiment 4, etanercept or saline was injected immediately after tbi once every 12 h for 3 consecutive days, and the effect on the enzyme immunoassay for the quantitative determination of etanercept in the rats ' damaged brain tissue was assessed 7 days after tbi. acute neurological injury was assessed in all rats the day prior to and 7 days after surgery using an nss. thus, the higher the score is, the more severe the injury is, with a maximum of 14 points. the inclined plane was used to measure limb strength. the rat was placed, facing right and then left, perpendicular to the slope of a 20 20 cm ruffed surface of an inclined plane starting at an angle of 55. the angle was increased or decreased in 5 increments to determine the maximal angle at which a rat could hold to the plane. the data for each day were the mean of the left- and right - side maximal angles. all behavioral tests were examined and independently scored by two observers who were unaware of what treatment the rats had been given. these scores were averaged to arrive at one score for each rat for the behavioral session. cerebral hemispheres were quickly dissected free and kept on ice in physiological salt solution containing 5 mm glucose. segments of cerebral cortex (75 mg, i.e., approximately the weight of each cerebral hemisphere) were weighted, cut into small pieces, dispersed by aspiration into a pipette, and suspended in 1 ml of physiological salt solution in a test tube. tnf- concentrations were measured using commercial enzyme - linked immunosorbent assay (elisa) kits (biosource international inc. the minimum detectable concentrations of tnf- were 1.1 pg / ml. there was no cross - reactivity reported with other cytokines. four days after tbi, all the rats were deeply anesthetized (sodium pentobarbital, 100 mg / kg ; i.p.) and then intracardially perfused with saline. their brain tissue was then removed, immersed in cold saline for 5 min, and sliced into 2.0 mm sections with a tissue slicer. the brain slices were incubated in 2% ttc dissolved in phosphate buffer saline (pbs) for 30 min at 37c and then transferred to 5% formaldehyde solution for fixation. the volume of contusion, as revealed by negative ttc stains indicating dehydrogenase - deficient tissue, was measured in each slice and summed using computerized planimetry (image - pro plus 5.0 ; media cybernetics, bethesda, md, usa). the volume of contusion was calculated as 2 mm (thickness of the slice) (sum of the contusion area in all brain slices (mm)). to evaluate the proliferation of cells, the rats were injected once daily for 3 consecutive days after tbi with 5-bromodeoxyuridine (brdu) (50 the rats were killed and then perfused intracardially with 300 ml of 0.1 m pbs (ph 7.4 - 7.5), followed by 300 ml 4% paraformaldehyde (pfa) in pbs (ph 7.4 - 7.5) 7 days after tbi. their brains were removed and stored in pfa for 3 days and then were sliced into serial coronal sections (50 m thick) and the maximum size of the lesion using a microslicer (dousaka em, kyoto, japan). the section was used for dcx immunostaining, followed by counterstaining with double - immunofluorescence staining for dcx and brdu. serial 50 m sections corresponding to coronal coordinates 0.8 mm to 5.3 mm posterior to the bregma were incubated in 2 mol / l hcl for 30 min, rinsed in 0.1 mol / l boric acid (ph8.5) for 3 min at room temperature, and then incubated with primary antibodies in phosphate - buffered saline (pbs) containing 0.5% normal bovine serum at 4c overnight ; secondary antibodies were incubated for 1 h at room temperature. the antibodies therein were, sequentially, rabbit anti - dcx antibody (cell signaling technology, 1 : 200), rat anti - brdu antibody (abcam, 1 : 200), goat anti - rabbit igg - h&l antibody (abcam, 1 : 400), and goat anti - rat igg antibody (abcam, 1 : 400). the sections were overslipped with the mounting medium (fluorescent mounting medium ; dako). the labeled cells were calculated in 5 coronal sections from each rat and expressed as the mean number of cells per section. for negative control sections, an enzyme immunoassay (etanercept (enbrel) elisa q - eta ; matriks biotek laboratories, ankara, turkey), a solid phase enzyme - linked immunosorbent assay (elisa) based on the sandwich principle, was used for the quantitative determination of etanercept in brain tissue samples. standards and samples were incubated in a microtiter plate coated with the monoclonal antibody specific for etanercept. after the incubation, a biotin - labeled tracer monoclonal antibody against etanercept was added and bound to etanercept captured by the first monoclonal antibody on the surface of the wells. after a second incubation, the wells were washed and then streptavidin - horse radish peroxidase (hrp) was added and bound to the biotin - conjugated probe. after a third incubation, the wells were washed and the bound enzymatic activity was detected by adding chromogen substrate. the color developed is proportional to the amount of etanercept in the sample or standard. bromodeoxyuridine (brdu), a thymidine analogy that is incorporated into the dna of dividing cells during s - phase, was used for mitotic labeling (roche diagnostics, indianapolis, usa ; 50 mg / kg). the fpi animals were killed 7 days after fpi for brdu labeling. the brdu immunostaining procedure with specific antibody against brdu (1 : 400 ; roche diagnostics) and quantification of brdu - immunoreactive cells statistical analysis was done using one - way analysis of variance (anova) with fisher 's post hoc test. analyses for behavioral variables used student 's unpaired t - test to compare variables between groups. bonferroni 's analysis was then performed when appropriate, to determine posthoc significance at individual time point. data was analyzed using statiatica software, and, in all cases, statistical significance was set at p < 0.05. seven days after the rats had been subjected to tbi, behavioral tests revealed that the nss scores of both the (tbi + v) group and the (tbi + e) group were significantly (p < 0.05) higher than those of the untreated sham - tbi group (figure 1). however, compared with those of the (tbi + v) group, the nss scores values of the (tbi + e) group were significantly (p < 0.05) lower. in contrast, motor function tests showed that the maximal angles of the (tbi + v) group were significantly lower than those of the sham - tbi group (figure 1). compared with those of the (tbi + v) group, the maximal degrees were significantly (p < 0.05) higher in the (tbi + e) group. seven days after the rats had been subjected to tbi, ttc staining and elisa kits showed that the (tbi + v) group had significantly (p < 0.01) larger areas of brain contusion and larger contents (pg / ml) of brain tnf- than did the sham - tbi group (figure 2). both the cerebral contusion and the increased brain tnf- contents (pg / ml) were significantly (p < 0.01) smaller in the (tbi + e) group than in the (tbi + v) group (figure 2). seven days after the rats had been subjected to tbi, double - immunofluorescence staining showed that the cell numbers of colocalizations of both dcx and brdu around the contused frontal cortex core (figure 3), contused cortex penumbral (figure 4), and contused hippocampal area (figure 5) were significantly (p < 0.01) higher than those of the sham - tbi group. additionally, the numbers of colocalizations of both dcx and brdu around the contused cortical core, cortical penumbra, and hippocampus in the (tbi + e) group were significantly (p < 0.05) higher than those of the (tbi + v) group (figures 35). seven days after the rats had been subjected to tbi, a quantitative enzyme immunoassay showed the levels of etanercept in the contused frontal cortex (core), hippocampus, and frontal cortex (penumbra) could be detected in the (tbi + e) group but not in the (tbi + v) group or the sham - tbi group (figure 6). it has previously reported that proliferation increases three- to sixfold beginning as early as 2 days after injury, peaks during the first week after injury, and returns to baseline levels of proliferation in the dentate gyrus by 35 days [2, 10, 18, 19 ]. in addition, it was found that in the first week after tbi, reduced numbers of dcx - positive cells were seen in the hippocampus ; a return to control levels occurred at 14 days. based on these observations, the estimation day was chosen to be 7 days after injury especially in this study, instead of 4 days after tbi as previously shown in our literature. here, we have shown that peripheral administration of etanercept is able to penetrate into the damaged frontal cortex and hippocampus to decrease novo local tnf- expression, to increase numbers of the cells with the colocalization of both dcx and brdu specific markers, and to improve neurological and motor dysfunction in rats during the first week after injury. etanercept is both hydrophilic and of high molecular weight, and so it is prevented from crossing the intact bbb in normal condition. however, we do observe that the levels of etanercept in the damaged frontal cortex and hippocampus are scientifically increased 7 days after systemic administration of etanercept. in fact, the central effects of etanercept are supported by several previous reports. for example, perispinal administration of etanercept induced rapid cognitive improvement in a patient with late - 's disease ; systemic administration of etanercept inhibited interleukin-1-mediated the depression of open - field activity and reduced glucose consumption ; direct injection of a selective tumor necrosis factor- antagonist - soluble tumor necrosis factor- receptor fusion protein 15 min before and 1 h after tbi improved performance in a series of standard tasks after injury ; and systemic administration of etanercept attenuated spinal cord injury in rats. as shown in figure 6, the levels of etanercept given 7 days before sacrifice are so similar or identical in all structures (core, penumbra, and hippocampus). this indicates that this drug (etanercept) may accumulate in both the contused and the healthy brain tissues. established studies [5, 6 ] suggest that the mammalian nervous system has the potential to replenish populations of damaged neurons by the proliferation of neural stem cells (nscs). the presence of nscs has been confirmed in two portions in the adult rodent brain : one is the svz of the lateral cerebral ventricles and the other is the sgz at the dentate gyrus / hilus interface [27, 28 ]. indeed, as shown in the present study, a direct mechanical insult to the brain 7 days after tbi induced neurogenesis, which was evidenced by an increase in dcx - brdu double - positive cells in the damaged areas of the hippocampus, the periventricular areas, and the cortex. according to itoh., dcx - positive cells were present near and among the glial scars after tbi, and these cells changed from immature to mature neurons. it is believed that promoting the maturation and differentiation of newly formed immature neurons near glial scars after tbi attenuates after tbi glial - scar - induced brain dysfunction. indeed, we showed that the number of the newly formed brdu - dcx double - positive cells in injured brain areas (including both the core of the infarct and the hippocampus) was significantly higher in rats that had undergone tbi. the great similarity between the number of dcx - brdu positive cells at the core of the infarct and the hippocampus suggests that newly formed cells have already migrated to the core of infarction from the hippocampus. for example, chiaretti. reported that early dcx concentrations in the cerebrospinal fluid (csf) were correlated significantly with the severity of heat injury in children. in contrast, our data were not supported by those of rola., who found that, during the first week after tbi, there were fewer dcx - positive cells at all the time points except 48 h after injury, when there was a transient increase in mice that had underwent tbi. some evidence indicates that tnf- plays a neuroprotective role following tbi [30, 31 ], whereas other evidence shows that tnf- plays an important role in the pathophysiology of tbi [3234 ]. our present data demonstrate that tnf- overexpression is associated with the pathological effects as well as neurological motor deficits during injury. on the other hand, at recovery process, tnf- contributes to neuroanatomical plasticity as well as an improvement of locomotor activity following tbi. putting these observations together, we can derive that etanercept may improve outcomes of tbi in rats by reducing overproduction of brain tnf- at least during the early stage (e.g., 7 days). although our present results tend to support the central effects of etanercept administered systemically, etanercept may work by blocking peripheral tnf-, which, we now know, is produced by the liver as part of the peripheral response to acute central nervous system inflammation or tbi. our data further indicate that peripheral administration of etanercept can be used to induce neurogenesis in nonneurogenic regions by stimulating local nscs or recruiting nscs from neurogenic areas to other areas of the brain during tbi. it has been documented that uncontrolled inflammation is associated with activation of microglia as well as detrimental to neurogenesis partially through production of tnf- [37, 38 ]. this is confirmed by the present results showing about 10-fold increase in tnf- at day 7 after tbi (figure 2). the negative effect on neurogenesis by activated microglia is because of the overproduction of tnf- and other mediators. our present results show that suppression of production of brain tnf- with etanercept significantly stimulates neurogenesis but significantly attenuates the neurological and motor deficits as well as the brain contusion during tbi in rats. the current study demonstrates that tbi, in addition to inducing cerebral contusion and neurological motor deficits, induces the overproduction of tnf- as well as the increased numbers of the colocalizations of brdu and dcx specific markers in the contused bran tissues. levels of etanercept can be detected in brain following systemic delivery of etanercept to tbi animals. in addition, cerebral contusion, neurological motor deficits, and increased brain contents of tnf- can be attenuated, whereas the increased numbers of colocalizations of brdu and dcx specific markers in the contused brain tissue can be enhanced by etanercept therapy during tbi. thus, it appears that etanercept attenuates tbi in rats by reducing tnf- contents and by enhancing newly formed neurogenesis in the contused brain tissues.	it remains unclear whether etanercept penetrates directly into the contused brain and improves the outcomes of tbi by attenuating brain contents of tnf- and/or stimulating newly formed neurogenesis. rats that sustained tbi are immediately treated with etanercept. acute neurological and motor injury is assessed in all rats the day prior to and 7 days after surgery. the numbers of the colocalizations of 5-bromodeoxyuridine and doublecortin specific markers in the contused brain injury that occurred during tbi were counted by immunofluorescence staining. enzyme immunoassay for quantitative determination of tnf- or etanercept in brain tissues is also performed. seven days after systemic administration of etanercept, levels of etanercept can be detected in the contused brain tissues. in addition, neurological and motor deficits, cerebral contusion, and increased brain tnf- contents caused by tbi can be attenuated by etanercept therapy. furthermore, the increased numbers of the colocalizations of 5-bromodeoxyuridine and doublecortin specific markers in the contused brain tissues caused by tbi can be potentiated by etanercept therapy. these findings indicate that systemically administered etanercept may penetrate directly into the contused brain tissues and may improve outcomes of tbi by reducing brain contents of tnf- and by stimulating newly formed neurogenesis.
there are few evidences about type 2 diabetes mellitus (t2 dm) in frail elderly subjects and, specifically, in older patients living in long - term care residences [13 ]. these patients have usually reduced life expectancy, poor general health, and at least some degree of functional dependence and/or cognitive impairment. they represent those frail and vulnerable patients affected by t2 dm for whom recent international guidelines specifically recommended less stringent glycemic targets and prioritized well - being and quality of life [46 ]. duration of diabetes and advancing age independently predict morbidity and mortality rates in elderly subjects. recent observations, demonstrating that cardiovascular complications and hypoglycemia are common among older diabetic patients, support the reorientation of care of older patients with t2 dm away from intensive glycemic control as the core focus of management. target goal for glycated hemoglobin (hba1c) in older adults generally should be 7.5% to 8%. although hba1c between 7% and 7.5% may be appropriate if it can be safely achieved in healthy older adults with few comorbidities and good functional status, higher hba1c targets (8%-9%) are appropriate for older adults with multiple comorbidities, poor health, and limited life expectancy [46 ]. moreover there is potential harm in lowering hba1c to less than 6.5% in older adults with type 2 dm. despite these recommendations for older vulnerable diabetic patients, there is little evidence on prevalence, clinical correlates, and treatment of t2 dm in elderly patients living in long - term care facilities. in the present study we aimed to comprehensively evaluate prevalence, clinical correlates, and use of glucose - lowering drugs among nursing home older patients with diabetes in this prospective observational study, patients living in 83 long - term care facilities in piedmont, northern italy, were evaluated during the period of march august 2013 ; all patients aged > 65 and affected by diabetes were enrolled, without exclusion criteria. signed informed consent from patients or carer was obtained for all participants and the study was conducted according to the recommendations guiding physicians in biomedical research involving human subjects. for all the patients the following information was recorded : identification, age, gender, and date of admission. relevant conditions (as dementia, immobilization, and pressure sores) were also recorded. a thorough medical chart review was performed in order to ascertain, as far as possible, type and age of onset of diabetes, current hypoglycemic therapy, previous hypoglycemic episodes, and last available blood chemistries including serum glucose and glycated hemoglobin (hba1c) levels and pre- and postprandial glucose levels. body mass index (bmi, according to the formula weight (kg)/height (m)) was calculated and categorized in 4 classes (underweight : bmi 8.5%) and either functional dependence or presence and severity of cognitive impairment, as well as mean hba1c values, did not significantly differ in patients with or without functional dependence and cognitive impairment. significantly lower hba1c levels were observed in demented patients than in nondemented subjects (6.92 1.28% versus 7.23 1.67%, p = 0.013). preprandial glycemic values (available for 95.2% of patients) below 126 mg / dl were documented in 51.6% of patients ; 26% of patients had values between 126 and 180 mg / dl and 17.7% had values above 180 mg / dl. postprandial glycemic values under 180 mg / dl were observed in 37.2% of patients, 18.1% of patients had values between 181 and 250 mg / dl, and 8.1% of patients had values above 250 mg / dl. for 36.6% of patients documented hypoglycemic episodes were reported in medical charts for 57 (6.6%) patients. at the moment of data collection, 30 of these patients (52.6%) were treated with insulin, 22 (38.5%) received oral hypoglycemic agents (9 received metformin and glibenclamide, 2 received metformin and other sulphonylureas, 5 received metformin, 5 received sulphonylureas, and 1 received metformin and repaglinide), and 3 (5.2%) were treated with insulin and oral hypoglycemic agents (2 with acarbose and 1 with glibenclamide) ; 2 of these patients (3.5%) were not receiving drugs at the moment of data collection. among patients with reported previous hypoglycemic episodes 11 (19.3%) were bedridden and 19 (33.3%) were affected by severe cognitive impairment. at the moment of data collection, previous hypoglycemic episodes were not associated with age, functional dependence, or cognitive impairment, although a trend to a greater prevalence of hypoglycemia among demented patients was observed. mean hba1c levels were not significantly lower in patients with previous reported hypoglycemia than in other diabetic patients (6.83 1.18 versus 7.143 1.37, p = 0.08). single therapy with metformin was significantly more prevalent among patients without reported hypoglycemic episodes (p = 0.033). we did not observe significant association between use of sulphonylureas and hypoglycemic episodes, but therapy with metformin and glibenclamide was significantly more prevalent among patients with reported previous hypoglycemic episodes (p = 0.004). patients receiving insulin therapy were significantly more prevalent among those with previous reported hypoglycemia (p = 0.009). we aimed to investigate prevalence, clinical correlates, and use of glucose - lowering drugs among older patients with t2 dm living in long - term facilities in piedmont, northern italy. our study demonstrated that t2 dm is a common clinical problem among these patients, affecting roughly less than one - fifth of residents, with a greater prevalence of the disease in women than in men. less than one - fifth of them were functionally independent and roughly two - thirds of them had some degree of cognitive impairment, with concomitant functional dependence and cognitive impairment in more than 95% of patients. two - thirds of patients had 24 severe comorbidities, mainly hypertension, dementia, cardio- and cerebrovascular disease, and bone fractures. finally, we documented a high prevalence of low hba1c values and a remarkable incidence of documented hypoglycemic episodes among these cognitively and functionally impaired older residents. the prevalence of t2 dm observed in our sample was in accordance with that observed in a french study, which reported a prevalence of t2 dm of 17.1% among 6275 older long - term facility residents aged 86 years. because mean duration of t2 dm in the patients enrolled in our study was around 12 years, it is reasonable to suppose that diabetes onset in most of the patients occurred probably at an older age. despite current recommendations on hypoglycemic treatment and hba1c targets for older, frail, and vulnerable patients [46 ] we found that more than half of long - term facility older residents had hba1c values below 7%, and 75% of them had levels below 8.5%. these findings demonstrate an undesired and potentially harmful aggressive hypoglycemic therapeutic approach in these frail and vulnerable patients. there are very few evidences about overall health benefit of hypoglycemic therapy among these frail patients, who are more vulnerable to and at higher risk of incident hypoglycemic episodes. therefore, recent international guidelines support the reorientation of care of older patients with t2 dm away from intensive glycemic control as the core focus of management, and hba1c targets around 8%-9% are deemed appropriate for older adults with multiple comorbidities, poor health, and limited life expectancy [46 ]. moreover, hba1c levels were significantly lower among demented patients, who are more prone to the negative consequences of hypoglycemia. there is a burden of evidence linking hypoglycemia and cognitive decline : cognitively impaired and demented patients are more prone and vulnerable to hypoglycemia, which itself represents a major risk factor for further cognitive decline [1318 ]. unawareness of hypoglycemia and subtle or atypical clinical presentation make extremely difficult an early diagnosis of hypoglycemia in demented, frail patients, leading to the potential for major harm in these patients. hypoglycemic episodes were reported in medical charts in 6.6% of patients, probably underestimating the true prevalence of this feared complication. among patients with reported hypoglycemic events, roughly one - fifth of them were bedridden and one - third had severe cognitive impairment. at the moment of data collection hba1c values below 7.5% were yet more frequent in patients with previous hypoglycemic episodes than in patients without prior hypoglycemic episodes (75.4% versus 45.1%, p = 0.03). combination therapy with metformin and glibenclamide and insulin therapy were both significantly more frequent among patients with previous hypoglycemic episodes, whereas single therapy with metformin was more prevalent among t2 dm patients without previous hypoglycemic episodes. these findings are in keeping with and reinforce current beers recommendations about potentially inappropriate medication use in the elderly : metformin is considered the safest oral glucose - lowering approach in diabetic patients without specific contraindications, whereas rapid - acting insulins are considered the drugs with the highest potential for harmful hypoglycemic events. however, because of the cross - sectional retrospective medical charts study, these findings should be carefully considered because we were able to document current glucose - lowering drug therapy at the moment of collection of data but we could not ascertain from medical charts which therapies were administered at the moment of hypoglycemic crisis. some limitations of the present study should be considered. the main limitation is inherent to the retrospective design of the study, based on data extracted from long - term facilities medical charts not scrupulously filled in. moreover, retrospective observation makes it extremely difficult to define causality between adverse events and current hypoglycemic therapy, which however was not among the main goals of this study. on the other hand to the best of our knowledge this is one of the first attempts to comprehensively evaluate global health status, including functional and cognitive conditions, among older patients with t2 dm in long - term facilities. the high number of patients enrolled from a variegated sample of regional long - term facilities and the close similarity of our findings with results from the french study suggest that our results may reasonably and wisely be generalized to older southern europe patients living in long - term facilities. in conclusion, our results documented that roughly three - fourths of older and frail diabetic patients living in long - term residences have hba1c values lower than optimal, suggesting a potential for hypoglycemic harm especially among patients with severe cognitive impairment. despite the current recommendations that strongly advise using soft hba1c targets and wise and safe glucose - lowering medical therapies in these vulnerable patients, our findings seem to suggest an inappropriate and aggressive glucose - lowering therapeutic approach in most of these frail and vulnerable elderly residents.	prevalence, clinical correlates, and use of glucose - lowering drugs were comprehensively evaluated among 863 nursing home older patients with diabetes (mean age 82.9 2.1 years) : functional dependence and cognitive impairment were present in 84.1% and 68% of patients, respectively, and 66.3% of patients had 24 comorbidities. hba1c values < 7.0% were documented in 54.9% of diabetic ; significantly lower hba1c levels were observed in demented patients than in nondemented subjects. documented hypoglycemic episodes were reported for 57 patients (6.6%), without significant association with age, functional dependence, cognitive impairment, or hba1c levels. about one - fifth of older long - term facilities residents have diabetes, with concomitant poor health conditions and high prevalence of cognitive impairment and functional dependence. roughly three - fourths of these older and frail diabetic patients have hba1c values lower than optimal, suggesting a potential for hypoglycemic harm especially among patients with severe cognitive impairment.
a stroke is a disorder that results from a dysfunction in the brain anatomically due to problems in the cerebrovascular blood supply and vessel hemorrhage. depending on the location and seriousness of the damaged in the brain, stroke patients can have sensory - motor dysfunction, proprioception deficits and hypertonus1. the sensory - motor dysfunction in stroke patients includes not only muscle weakness and abnormal muscle tone but also proprioception deficits. proprioceptiors such as the mechanoreceptor and free nerve ending, are found in the skin, facia, muscles, tendons, joint capsules, and ligaments. when active or passive movement occurs, receptors transmit the mobility information to the central nervous system2. the proprioception provides the angles and angular speed of every joint involved in body position or postural perception and movements. it plays the largest part in maintaining dynamic joint stability, induces normal movements, and protects joints from external damages3. if proprioception is degraded by a stroke, it could also undermine muscle strength, normal muscle tone, posture control, protective reflex ability, and joint motor ability. clinically, the proprioception level has emerged as an important assessment item used for stroke patient assessment clinically together with treatment procedures4. in the months following an upper motor neuron (umn) lesion in stroke patients, muscle tone increases as a result of changes within the muscle, producing excessive resistance to muscle stretch, which is usually called spasticity. when a umn lesion interrupts descending motor commands, the lower motor neuron (lmn) is affected and becomes temporarily inactive. this condition is called cerebral shock, depending on the location of the lesion. during nervous system shock, stretch reflexes can not be elicited, and the muscles are hypotonic ; that is, the muscles have abnormally low tone because facilitation of lmns has been lost due to interruption of descending motor commands by a umn5. the most important goal is restoration of somatic sensory function, as this can have a positive effect on abnormal muscle conditions. the purpose of this study was to compare the proprioception levels of knee joints between the affected and non - affected sides in stroke patients and analyze the correlation of proprioception with muscle strength and spasticity level. the hypotheses were as follows : the knee joint proprioception in stroke patients will be different in their affected side compared with the non - affected side, and the loss of proprioception will be correlated with muscle strength and spasticity level. this study examined 31 patients with stroke selected from among the candidates who were receiving physical therapy services at s hospital in daejeon, south korea, and consented to participate in this study. the criteria for selection of the study subjects were as follows : 1) patients who agreed to participate in this study experiment, 2) patients who could understand and follow a therapist s instructions (those with an mmse - k score of at least 24), 3) patients without any orthopedic or neurosurgical history in their ankle joint, hip joint, and lumbar spine, and 4) patients with no problems in range of motion in the knee joint. the research protocol was approved by the research ethics committee for human research of daejeon university, south korea. in this study, to evaluate the joint position sense on both affected and non - affected knee joints of stroke patients, the passive angle reproduction test was utilized, and to evaluate the kinesthesia in both affected and non - affected knee joints of stroke patients, the active angle reproduction test was employed. the direction of movement during assessment and assessment method were determined by randomly drawing ball marked with flexion and extension (movement direction), passive angle reproduction test, and active angle production test (assessment method), respectively. participants lay in the side - lying position, flexed slightly their hip joint comfortably, and flexed 70 degrees (for extension test) and extended 10 degree (for flexion test) their knee joint. the knee joints were moved by a tester to a target angle without any help. the flexion angles were set in advance at 50 and 60 degrees6, 7. to exclude learning effects during the test, 60 degrees was used in the active angle reproduction test if 50 degrees was used in the passive angle reproduction test. the extension test was performed based on 90 degrees of flexion in the knee joints and started from 70 degrees of flexion. the subjects were instructed to allow a tester to move them passively to a target angle. in the active angle reproduction test, the subjects were instructed to move actively to the target angle. if 20 degrees was used in the passive angle reproduction test, 30 degrees was used in the active angle reproduction test. to block any visual information from patients, their eyes were covered with a shade during the tests. a tester caused passive movement by holding the patients ankle and upper part of their knee joint. the holding time for each target angle was 10 seconds so that the subjects could remember the position. after returning to a starting position passively or actively, the subjects took a 5-second rest. during the passive angle reproduction test stop when they thought their knee joint flexion or extension reached the target angle. during the active angle reproduction test, the subjects moved to the target angles on their own. the tester marked the results on the measuring board with a sticker and measured the angle with a goniometer. the measured angles were recorded as negative if they were smaller than the target angle and positive if they were larger than the target angle. measurements were performed for 3 rounds in total, and the average values were recorded. the affected - side knee muscle strength of the stroke patients was measured by manual muscle test. the subjects lay in a side - lying position for the flexion and extension muscle strength test. before the test, the subjects were examined for any pain and were given a sufficient explanation about the measurement procedures. the modified ashworth scale (mas) was employed in this study to evaluate the spasticity level of the affected - side knee joint. the mas expresses the degree of spasticity of patients with a damaged central nervous system. the patients sat comfortably on the treatment stand, and the rater evaluated and recorded the spasticity in the flexion and extension directions. the larger the number indicating spasticity grade, the more spasticity a patient would have. the measurement data were statistically processed with pasw statistics for window version 18.0. for the general characteristics of the subjects, spearman correlation analysis was employed to analyze the correlation of knee joint proprioception with muscle strength and spasticity in the stroke patients. the independent t - test was adopted to compare the difference in knee joint proprioception between the affected and non - affected sides. this study performed a knee joint proprioception test for 31 stroke patients and analyzed the correlation of the proprioception level with muscle strength and spasticity. table 1table 1.general characteristics of the subjects (n=31)variables (unit)subjectsmeansdgender (male / female)22/9age (years)51.111.4height (cm)164.27.3weight (kg)66.912.1onset (years)>0.651<onset35<321side of lesion (left / right)16/15 shows subjects characteristics such as gender, age, height, weight, onset and side of lesion. comparison of the difference in proprioception levels in the knee joints on the affected and non - affected side in the stroke patients revealed the error angles for joint position sense in the flexion - direction 14.25 degrees on the affected side and 5.33 degrees on the non - affected side, representing a significant difference (p<0.01). for the extension direction, the error angles were 12.25 degrees on the affected side and 5.15 degrees non - affected side, representing a significant difference (p<0.01). in both the flexion and extension directions, the affected sides were found to have a larger error angles in joint position sense than the non - affected sides (table 2table 2.comparison of proprioception between the affected and non - affected kneetest typedirectionaffected (n=31)non - affected (n=31)mean differenceparflexion14.2511.945.334.76 8.912.30extension12.259.905.154.99 7.101.99aarflexion5.372.363.563.461.810.94extension4.652.623.453.791.201.04par : passive angle reproduction test (joint position sense) ; aar : active angle reproduction test (kinesthesia)mean (error angle)sd. : passive angle reproduction test (joint position sense) ; aar : active angle reproduction test (kinesthesia) mean (error angle)sd. p<0.01 the correlation of proprioception levels with muscle strength and spasticity in the stroke patients was analyzed. muscle strength was found to have a negative correlation with the flexors and extensors with respect to joint position sense and the flexors with respect to kinesthesia. spasticity showed a negative correlation with joint position sense (p<0.05) (table 3table 3.correlation for coefficients the correlation of proprioception with muscle strength and spasticity in the affected kneeparaarflexionextensionflexionextensionmmtflexor0.8360.8210.5210.218extensor0.8470.8430.4110.411mas0.7220.7080.5990.600par : passive angle reproduction test (joint position sense) ; aar : active angle reproduction test (kinesthesia) ; mmt : manual muscle test ; mas : modified ashworth scale. par : passive angle reproduction test (joint position sense) ; aar : active angle reproduction test (kinesthesia) ; mmt : manual muscle test ; mas : modified ashworth scale. this study examined 31 stroke patients who had been hospitalized or received outpatient treatment by conducting active and passive angle reproduction tests and analyzed the correlation of proprioception with muscle strength and spasticity. proprioception is a sensory system that plays a key role in maintaining human body stability through motor control by integrating information from peripheral receptors in the central nervous system10. stroke patients collect information from peripheral receptors normally, but their central nervous system processes information abnormally, causing errors in original information11, 12. previous studies reported that activation of contractive tissues comprising muscles, rather than non - contractive tissues such as ligaments and joint capsules, was more effective in treating a proprioception deficit13, 14. in addition, active movement rather than passive movement was said to increase proprioception perception ability15, 16. the results of this study showed a significant difference between the affected and non - affected sides in the passive angle reproduction test but not in the active angle reproduction test. this means that the errors were smaller in the active reproduction test, in which muscle receptors are activated, than in the passive reproduction test, in which muscle receptors are not activated much. stroke patients have damage in the central nervous system that could cause limb muscle weakness or hypertonus17. kim and ahn18 reported that for stroke patients, muscle strength was a significant factor determining movement and that therapy to improve muscle strength improving was more effective than therapy to reduce hypertonus. they also argued that to restore the sensory - motor system, muscle strength should be reinforced and spasticity should be reduced. in this study, examination of the correlation of proprioception with muscle strength and spasticity revealed a negative correlation with muscle strength in the passive angle reproduction test and a positive correlation with spasticity. this is because weaker muscle and higher spasticity generate larger errors, and this is consistent with previous studies. this study is limited with respect to the ability to generalize its findings to adult stroke patients in general, as it only examined patients of a single general hospital who met the specific criteria for the study. another limitation is the small number of subjects, as there were only 31 subjects in this study. follow - up studies are needed to further study the effects of muscle strength exercise, gait, and balance exercises on proprioception of stroke patients. in summary, 31 stroke patients were examined through a proprioception test on the affected and non - affected sides of the knee joint. then their muscle strength and spasticity were analyzed for correlations. in comparison of proprioception between the affected and non - affected knee joints, the affected side was found to have a significantly larger error than the non - affected side. in the analysis of the correlation of proprioception with muscle strength and spasticity, the spasticity levels and joint position sense showed a positive correlation, and muscle strength showed a negative correlation. in conclusion, this study reported that knee joint proprioception deficits are associated with muscle strength and the spasticity level in stroke patients.	[purpose ] the purpose of this study was to investigate the relationship of knee proprioception with muscle strength and spasticity in stroke patients. [subjects and methods ] the subjects were 31 stroke patients. the subjects received an explanation of the procedures and methods and provided informed consent before the experiment. a measurement board was used to determine the the proprioception deficit of the knee as a proprioception test. the proprioception test consisted of a passive and active angle reproduction test. a manual muscle test and modified ashworth scale were used to evaluate knee muscle strength and spasticity level. the data were analyzed using an independent t - test and spearman correlation. [results ] the results of this study revealed a significant difference between the affected side and non - affected side in the passive angle reproduction test and a significant difference in the correlation of the proprioception level with muscle strength and spasticity level. [conclusion ] this study indicates that the knee proprioception level is associated with spasticity and muscle strength in stroke patients.
bacterial meningitis is frequently accompanied by intracranial and systemic complications, such as septic shock, adult respiratory distress syndrome, or disseminated intravascular coagulation in children. however, spinal cord involvement is an extremely rare complication of bacterial meningitis in adults5). recurrent bacterial meningitis is defined as repeated episodes of acute infection followed by periods during which signs and symptoms are absent and cerebrospinal fluid (csf) is normal, and is usually a complication of a cranial anatomical defect or the result of impaired humoral immunity, notably, a complement system defects or agammaglobulinemia2). recurrent bacterial meningitis can present a diverse range of symptoms in children, but no previous report has been issued of recurrent meningitis accompanied by a spinal intramedullary abscess in an adult2). in this article, we report a rare and interesting case of recurrent bacterial meningitis in an adult presenting as a spinal intramedullary abscess. a 63-year - old man was admitted to the emergency department complaining about severe suboccipital headache, fever, and neck pain lasting for 5 days. on physical examination, he was alert and fully oriented, but febrile (38.3) and had apparent nuchal stiffness with positive kernig and brudzinski signs. his pupils were midsize and reactive to the light, and bilateral papilledema was not detected in the fundoscopic examination. a laboratory examination revealed a white blood cell count of 13,100/mm and an erythrocyte sedimentation rate (esr) of 78 mm / hour. for the diagnosis of bacterial meningitis, lumbar puncture (lp) was performed after emergent brain computed tomography (ct) scan, which ruled out any space - occupying lesion within brain parenchyma. csf contained 792 cells/l (94% polymorphonuclear cells), protein level was 6.3g / dl, and his csf glucose level was less than 15% of the serum glucose level. from the csf gram - positive cocci were found, and staphylococcus aureus (s. aureus) was isolated. hence, ceftriaxone (hanmi pharmaceuticals, korea) and vancomycin (cj pharmaceuticals, korea), which had been initiated empirically before confirmation of staphylococcus, were continued for 14 days. an obvious clinical improvement occurred after lp and antibiotic therapy, and he was discharged after a second lp that revealed infection was resolved by culture (42 white blood cells and normal glucose and protein in csf). however, 6 days after discharge, he was readmitted due to the reappearance of fever and severe headache. he was also complaing about decreased sensation on the lower extremities, but his motor power remained intact. laboratory data showed leukocytosis (12300/mm with 89% neutrophils) and elevated esr at 60 mm / hour. g / l, and a glucose level of 29 mg/100 ml, but the second csf culture was negative for s. aureus. magnetic resonance imaging (mri) of the thoracolumbar spine revealed a homogeneously enhanced solid lesion in gadolinium enhanced t1 weighted images (fig. 1). a 6-week course of high - dose, broad - spectrum antibiotics (ceftriaxone, vancomycin) was administered again and a series of magnetic resonance images were taken every 3 week. no surgical removal was performed, due to rapid improvement of his clinical symptoms and radiological findings. this rarity is attributed to the absence of sinuses in the spinal cord, the width of filtering epidural space, which filters, and the centripetal pattern of blood flow as compared with the centrifugal pattern of blood flow in the brain4,7). most of these lesions are either secondary to hematogenous spread from a cardiopulmonary source or originate in mediastinal, peritoneal, or retroperitoneal spaces6). acute bacterial meningitis is a potentially life - threatening infection of the cranial and spinal leptomeninges, and although recurrent episodes of meningitis are rarely seen in children, if they occur, an extensive investigation has to be made to identify the etiologic factors. congenital or acquired anatomical defects are the most common entities that accompanied by recurrent meningitis in children. however, in this case, which developed in an adult, we could not identify the primary source of responsible for the spinal cord abscess, and no congenital defects, such as, a dermoid sinus, were evident. the csf cultures in our patient were negative at discharge and readmission, which might have been a result of antibiotic therapy. however, given his laboratory csf findings, a negative csf culture did not rule out recurrent meningitis. the clinical presentations of acute spinal cord abscess are depend on the location of an abscess and are consistent with fever, back pain, an increased wbc and esr, and partial or total transverse myelitic features1). mri visualizes the extent and the location of an abscess better than ct or myelography. in addition, mri also can be used to determine the extent of disease, to distinguish solid lesions, and it may suggest the nature of the lesion3). after the diagnosis has been made, prompt decompressive laminectomy, myelotomy, and surgical drainage along with appropriate antibiotics, which are the mainstay of the treatment. due to the eloquent location of the lesion in our patient and the lack of symptoms at diagnosis, 6 weeks of broad - spectrum antibiotic therapy was considered with close clinical and imaging follow up (mri was performed 3 weekly to monitor the size of the lesion). first, a spinal intramedllary abscess combined with a recurrent bacterial meningitis is uncommon in adults. although it is not clear whether the spinal intramedullary abscess was the source of the meningeal infection in this case, it seems that this is the first case to suggest such a relationship between these two entities in an adult. we report a rare case of recurrent bacterial meningitis who recovered from the disease by antibiotic therapy to treat a spinal intramedullary abscess in an adult. although rare, the relationship between spinal intramedullary abscess and recurrent meningeal infection should be borne in mind.	bacterial meningitis is rarely complicated by an intradural spinal abscess, and recurrent meningitis is an uncommon presentation of a spinal intramedullary abscess. here, we report a 63-year - old patient with recurrent meningitis as the first manifestation of an underlying spinal intramedullary abscess. to the best of our knowledge, no previous report has been issued on recurrent meningitis accompanied by a spinal intramedullary abscess in an adult. in this article, the pathophysiological mechanism of this uncommon entity is discussed and the relevant literature reviewed.
99% of the 1,000 different mitochondrial proteins are produced on cytosolic ribosomes and are imported into the organelle (sickmann. dolezal., 2006 ; van der laan., 2006a). the classic pathway of protein import into mitochondria involves n - terminal presequences on the precursor proteins (fig. 1). the presequences target the proteins to receptors of the translocase of outer mitochondrial membrane (tom) complex. after translocation through the tom channel, the preproteins are directed to the tim23 (presequence translocase of inner mitochondrial membrane) complex. the presequence translocase - associated motor (pam) completes preprotein translocation into the matrix. here, the mitochondrial processing peptidase removes the presequences, and the proteins are folded to their mature forms. presequence - carrying proteins are transported by the tim23 complex and the motor pam into the matrix, where mitochondrial processing peptidase (mpp) cleaves off the presequences. small proteins of the intermembrane space (ims) are imported via the mitochondrial intermembrane space assembly machinery (mia). -barrel precursors of the outer membrane (om) are transferred by the tim9tim10 chaperone complex from tom to sam. precursors of inner membrane (i m) carriers use tim9tim10 for transfer to the tim22 complex that drives insertion into the inner membrane. however, many mitochondrial precursor proteins are not synthesized with cleavable presequences but possess internal targeting signals. although the tom complex functions as the central import site for most precursors, the subsequent transport of proteins to the four mitochondrial compartments is mediated by different machineries. (1) the precursors of outer membrane -barrel proteins are transferred by the tim9tim10 chaperone complex to the sorting and assembly machinery (sam) complex of the outer membrane (wiedemann. (2) multispanning proteins of the inner membrane like the metabolite carriers also use the tim9tim10 chaperone complex to traverse the intermembrane space and are inserted into the inner membrane by the tim22 (carrier translocase of inner mitochondrial membrane) complex (curran., 2002 ; vial., 2002 ; rehling., 2003). (3) many proteins of the intermembrane space contain cysteine motifs and are imported and oxidized by the mitochondrial intermembrane space assembly system (chacinska., 2004 ; nao., 2004 ; allen., 2005 ; mesecke., the protein translocases in the four mitochondrial compartments do not function as independent complexes but cooperate in a dynamic manner. this includes transient contacts between translocases located in different compartments and the involvement of protein complexes that have previously been thought not to be related to protein biogenesis, such as the respiratory chain and mitochondrial morphology components. cleavable preproteins are guided into mitochondria by a chain of sequential binding sites for presequences, including the receptor domains of tom20 and tom22, the channel formed by tom40, and the intermembrane space tail of tom22 (fig. tom40 is not simply a passive channel but recognizes the presequences and participates in the selection of precursors for the subsequent sorting pathways (gabriel., 2003). it has been a long - standing question of how preproteins are transferred from the tom complex to the tim23 complex of the inner membrane. preproteins with cleavable presequences are targeted to the tom complex (stage 1). upon translocation through the tom40 channel, tim50 interacts with the preprotein, and the presequence binds to the intermembrane space (ims) tail of tom22. subsequently, tim21 binds to tom22 and promotes release of the presequence (stage 2). pathway a : preproteins with a hydrophobic sorting (stop transfer) signal are laterally released into the inner membrane (i m) by a tim21-containing motor - free tim23 complex ; interaction of the tim23 complex with the bc1 complex and cytochrome c oxidase (cox) of the respiratory chain stimulates the membrane potential driven sorting step. pathway b : preproteins that only carry a matrix - targeting signal are transported into the matrix by a tim23 complex that associates with the motor pam. the identification of tim50 and tim21 as new subunits of the tim23 complex revealed a dynamic mechanism of tom tim cooperation (geissler., 2002 ; yamamoto., 2002 ; chacinska., 2005). in the absence of preproteins, tim50 keeps the inner membrane channel formed by tim23 in a closed state (meinecke., 2006). as soon as preproteins emerge from the tom40 channel, tim50 binds to them and stimulates interaction of the presequence with the intermembrane space tail of tom22. thus, remarkably, a tim protein helps a preprotein in transit to make contact with the trans - side of the tom machinery. subsequently, tim21 binds to tom22, representing a direct but transient interaction between tom and tim during protein import (fig. thereby, tim21 induces a release of the presequence from tom22 and promotes transfer of the preprotein to the next stage, insertion into the inner membrane (chacinska., 2005 ; albrecht., 2006). presequence binding to tim23 completes the chain of binding sites for preproteins on the way from tom to tim (truscott., 2001). transport of presequences through the tim23 complex is driven by the inner membrane potential, which performs a dual role. it activates the channel protein tim23 and drives translocation of the positively charged presequences by an electrophoretic mechanism (truscott., 2001). now, a decision has to be made about the further pathway of the preprotein : either lateral sorting into the inner membrane or complete transport into the matrix. recent studies showed that two different modular forms of the presequence translocase exist (chacinska. the core of both forms consists of tim50, tim23, and tim17, whereas the presence of additional subunits or partners depends on the import route of the preprotein in transit (chacinska., 2005). the sorting form of the tim23 complex, which is responsible for lateral release of proteins into the inner membrane, contains tim21 but not the import motor pam (fig. 2, stage 3a), whereas the matrix transport form of tim23 lacks tim21 but is associated with the multicomponent pam machinery (fig. this sorting signal stops translocation across the inner membrane, and the protein is released into the lipid phase by the motor - free tim23 complex (fig. surprisingly, tim21 was found to recruit a supercomplex of the mitochondrial respiratory chain consisting of the bc1 complex and cytochrome c oxidase (fig. 2, stage 3a ; van der laan., 2006b). what could be the function of a direct association between tim23 and the respiratory chain ? lateral sorting into the inner membrane can be driven by the electrochemical potential as the only external energy source without a requirement for the atp - dependent motor pam. indeed, upon lowering of the overall electrochemical potential of the inner membrane, tim23 complexes that are in the direct vicinity of the respiratory chain are still competent in preprotein insertion, whereas other transport processes across the inner membrane are diminished (van der laan., 2006b).. the proton motive force may be higher in close proximity to a proton - pumping complex, or protons may be directly translocated to the tim23 complex and facilitate preprotein transport. however, the majority of presequence - carrying preproteins are completely translocated into the matrix. to perform this task, the tim23 complex associates with pam, which consists of several modules (fig., 2007). mitochondrial heat - shock protein 70 (hsp70 [mthsp70 ]) is the central component of pam. four membrane - bound cochaperones, tim44, pam18, pam17, and pam16, interact with the tim23 complex and coordinate the function of mthsp70 directly at the tim channel. tim44 provides a binding site for mthsp70, whereas the j protein pam18 (tim14) stimulates the atpase activity of mthsp70. pam16 (tim16) regulates the activity of pam18, and pam17 is required to organize the pam18pam16 module (d'silva., 2005 ; van der laan., 2005 finally, mitochondrial grpe (mge1) promotes release of the nucleotides from mthsp70, completing the motor reaction cycle. thus, pam is a multistep motor that involves a coordinated action of membrane - bound and soluble proteins to promote the unfolding of preproteins and drive them into the matrix (van der laan., 2005 ; wilcox., three partner complexes interact with tim23 in an alternating manner : the tom complex in early transfer from outer membrane to inner membrane, the respiratory chain for promoting sorting into the inner membrane, and pam for translocation into the matrix. tim21 alternates between binding to tom and the respiratory chain (van der laan., 2006b), whereas tim17 is involved in the switch between inner membrane sorting and pam binding (chacinska., 2005). complex with its partner complexes involves more than one interaction site in each case. for the tom, 2005), whereas for the coupling to respiratory chain and pam, further interacting partners have to be defined in future studies. as the tim23respiratory chain interaction is impaired but not blocked by the deletion of tim21 (van der laan., 2006b), the existence of at least one more interaction site is apparent. most mitochondrial membrane proteins with several transmembrane segments (multispanning proteins) are synthesized without cleavable presequences. two major classes are the -barrel proteins of the outer membrane and the metabolite carriers of the inner membrane (fig. 3). to prevent aggregation of the hydrophobic precursors, chaperones operate at several stages of the biogenesis pathway. for transfer from cytosolic ribosomes to the tom receptors, chaperones of the hsp90 and hsp70 classes bind to the precursors (fig. 3, stage 1 ; young., 2003 ; humphries., 2005). the receptor tom70 possesses a specific binding site for the chaperones, and, thus, the precursor chaperone complex docks onto tom70 and delivers the substrate. tom70 oligomerizes in the presence of substrate such that several tom70 molecules bind to one precursor polypeptide and prevent aggregation during transfer to the tom40 channel (wiedemann., 2001 ; esaki., the import pathways of two classes of multispanning membrane proteins are shown : -barrel proteins of the outer membrane (om ; pathway a) and carrier proteins of the inner membrane (i m ; pathway b). the precursors are delivered to the tom complex with the help of cytosolic chaperones (stage 1). the tim9tim10 complex binds to precursors emerging on the intermembrane space (ims) side of tom40 (stage 2). -barrel precursors are transferred to the sam complex (stage 3a) that cooperates with the mdm complex for membrane insertion and protein assembly (stage 4a). tim22 inserts the precursors into the inner membrane in a membrane potential ()driven process. therefore, the intermembrane space contains a soluble translocase, the tim9tim10 complex, which binds to the precursors of carrier proteins as soon as part of the polypeptide chain has traversed the tom40 channel (wiedemann., 2001). tim9tim10 forms a hexameric tim chaperone complex that protects the hydrophobic segments of precursors from aggregation (curran., 2002 ; vial., 2002 ; webb., the carrier precursors do not cross the outer membrane as linear polypeptide chain like cleavable preproteins but are translocated through tom40 in a loop formation (fig. precursor release from tom requires an active tim chaperone complex, indicating a close cooperation of both translocases (wiedemann., 2001 ; zara., 2001 ; truscott., the intermembrane space contains a second tim chaperone complex, the tim8tim13 complex, which is homologous to the tim9tim10 complex and interacts with a subset of hydrophobic precursor proteins (hoppins and nargang, 2004 ; davis., 2007). the tim9tim10 chaperone delivers the carrier precursors to the tim22 complex. tim12, a small tim protein peripherally bound to the tim22 complex, associates with tim9 and tim10 in a ternary complex, and so these small tim proteins become membrane bound (fig. the tim22 complex contains three integral membrane proteins : tim54, tim22, and tim18. tim22 is the channel - forming protein and mediates protein insertion into the inner membrane in a membrane potential driven manner (rehling., 2003). it is not known which of the three integral subunits binds the small tim proteins. we speculate that tim54, with its large domain in the intermembrane space, functions as a docking site for small tim proteins at the carrier translocase. the tim chaperone complexes cooperate with a third membrane translocase, the sam complex of the outer membrane (wiedemann., 2003). upon translocation via the tom40 channel, the precursors of -barrel proteins bind to tim9tim10 or tim8tim13 and are transferred to sam (fig. 3, stage 3a ; hoppins and nargang, 2004 ; wiedemann., 2004). precursor insertion into the outer membrane is initiated by sam50 (omp85/tob55), the central component of the sam complex (kozjak. it is not yet known whether sam50 provides a direct interaction site for the tim chaperones. in summary, the soluble tim chaperone complexes, tim9tim10 and tim8tim13, provide a shuttle system between tom and the membrane insertases tim22 and sam and, thus, ensure that precursors are kept in a translocation - competent conformation. the outer membrane sam complex contains three core components : the channel - forming protein sam50, sam37, and sam35 (wiedemann., 2003 ; gentle., 2004 the lateral opening of a -barrel protein is energetically unfavorable, as many hydrogen bonds would have to be broken. we envisage that the -barrel precursors, which are delivered by the tim chaperones, may insert between several sam50 molecules and, thus, have access to the lipid phase (fig. sam50 is homologous to omp85/yaet of gram - negative bacteria, implying a conserved mechanism of -barrel insertion in mitochondria and bacteria (voulhoux., 2003, 2006 ; bredemeier., 2007). however, the partner proteins of sam50 and omp85/yaet are not homologous to each other. in addition, as the lipid composition of bacterial and mitochondrial outer membranes differs considerably, it is likely that the mitochondrial assembly machinery was originally derived from the bacterial one but underwent substantial changes during evolution. further characterization of the sam pathway revealed an unexpected connection to the machinery that maintains mitochondrial morphology. a fourth subunit found in a fraction of sam complexes turned out to be the morphology protein mdm10 (meisinger. mdm10 is required to assemble -barrel precursors, in particular the precursor of tom40, into functional complexes. mdm10 not only associates with the sam complex but also with two further morphology proteins, mdm12 and mmm1, to form a different complex (boldogh., 2003 ; meisinger., 2007) remarkably, this mitochondrial distribution and morphology (mdm) complex is also required for the -barrel assembly pathway of the mitochondrial outer membrane at a stage after the sam core components (fig. the mdm complex possibly mediates the cooperation of both mitochondrial membranes because mdm proteins are enriched in punctate structures near contact sites of outer and inner membranes (aiken hobbs., 2001 ; boldogh., 2003, kondo - okamoto., 2003, jensen, 2005). it should be emphasized that the majority of proteins that were reported to function in the maintenance of mitochondrial morphology are not involved in the assembly of -barrel proteins (meisinger., 2007). only a subset of morphology proteins associating with the sam complex or the mdm complex perform a primary function in protein assembly. as their function involves the biogenesis of the tom complex (i.e., assembly of the main entry gate of mitochondria), a defect of these morphology proteins leads to a defect of the tom complex and, consequently, to a defect in the import of genuine morphology components. we are just beginning to understand how the interplay between tom, sam, and mdm complexes is organized. tom7, a small subunit of the tom complex, plays a second role outside the mature tom complex. tom7 regulates the association of mdm10 with the sam complex in an antagonistic manner. upon deletion of tom7, the amount of mdm10 at the sam complex is increased, and the assembly of tom40 is accelerated (meisinger., 2006). it is a subunit of the mature tom complex and acts as a negative regulator of the assembly pathway of tom40. we suggest that the biogenesis of outer membrane -barrel proteins involves a dynamic cooperation of tom, tim chaperones, sam, and mdm to ensure an efficient and regulated transfer of precursor proteins. we suggest a new level of organization of the mitochondrial protein import machinery. although the initial characterization of protein transport led to the identification of numerous components and their presence in stable translocase complexes, we have reviewed here that the translocases are highly dynamic machineries. depending on the sorting signals present in precursor proteins, the translocases undergo modular rearrangements and transiently interact with each other. importantly, this involves a dynamic interaction between transport complexes located in different mitochondrial compartments, such as the tom tim23 connection, the tim23pam interaction, and the cooperation of tim chaperones of the intermembrane space with translocases of both outer and inner membranes. the cooperation not only involves the known translocases but also complexes that have not been related to protein import so far, such as the respiratory chain and the mdm complex. the dynamic nature of the protein import machinery is also reflected in increasing evidence that transport components perform two or more functions or interact with alternating partners. we outlined the examples of tom22, tim50, tim21, and tim17 in the tim23 reaction cycle, the cooperation of tim9tim10 with three different translocases, and the dual role of tom7 as tom subunit and regulator of mdm10. seeing this growing list, we speculate that import components that play more than one function are much more common than anticipated. the rapid increase in knowledge of the cooperation of preprotein translocases suggests that future studies will reveal more dynamic interactions between translocases, be it for preprotein transfer or for regulatory purposes. for example, the three stages defined for the tim23 reaction cycle likely represent only snapshots that are accessible to our current experimental tools. it is conceivable that the switch between inner membrane sorting and motor binding occurs in several intermediate steps (e.g., for preproteins, which possess a sorting signal but also contain folded domains that require the unfolding power of pam). we speculate that tom, sam, and mdm may be organized in transient, larger assemblies. moreover, the inner membrane contains machineries for the export of mitochondrially encoded proteins from the matrix (frazier., 2006 ; it will be interesting to see whether these export machineries cooperate with the tim import machineries. a cooperation of machineries and components located in different compartments of mitochondria is not only important for protein biogenesis but also for tethering mitochondria to the cytoskeleton, for fusion and fission of the mitochondrial membranes, and for apoptotic processes (jensen, 2005 ; meeusen and nunnari, 2005 ; okamoto and shaw, 2005 ; perfettini., 2005). thus, a characterization of the mechanisms, which coordinate and regulate the activities of both mitochondrial membranes and the two aqueous compartments, will be a major challenge toward a molecular understanding of this highly dynamic cell organelle.	most mitochondrial proteins are synthesized in the cytosol and imported into one of the four mitochondrial compartments : outer membrane, intermembrane space, inner membrane, and matrix. each compartment contains protein complexes that interact with precursor proteins and promote their transport. these translocase complexes do not act as independent units but cooperate with each other and further membrane complexes in a dynamic manner. we propose that a regulated coupling of translocases is important for the coordination of preprotein translocation and efficient sorting to intramitochondrial compartments.
the simultaneous or sequential development of autoimmune hemolytic anemia (aiha) and immune thrombocytopenia (itp) and/or immune neutropenia in the absence of any underlying cause was described as the evans syndrome (es) by evans., in 1951. since its first description, es was considered as an idiopathic condition, and mainly as a diagnosis of exclusion. however, few case reports showed a common association of es with other diseases, such as, systemic lupus erythematous, lymphoproliferative disorders, and immunodeficiency, which warranted the classification of es into primary and secondary. only three case reports of the association of evans syndrome with hashimoto 's thyroiditis were found in the literature review, and to the best of our knowledge, this is the fourth case, with a complete evaluation. a 34-year - old female, who is a known case of hashimoto 's thyroiditis, on synthetic thyroid hormone intake (50 g / day) since five years, presented with high - grade intermittent fever associated with chills and rigors, headache, and breathlessness. there was no significant family history of thyroid disease and she was on no other medication except for the thyroxine intake. on examination, her blood pressure was 110/90 mm of hg, body temperature was 101f, and pulse rate was 120 per minute. she had minimal, firm thyromegaly, tenderness in the right hypochondrium, and mild splenomegaly, on an ultrasound scan of the abdomen. there were neither enlarged peripheral lymph nodes nor any enlargement of them on the abdominal ultrasound scan. further investigations were negative for malaria, hepatitis b surface (hbs) antigen, hepatitis c virus (hcv) antibody, dengue, hiv, syphilis, and leptospirosis. she had low hemoglobin, hematocrit, red blood cells (rbc), and platelet count along with high mean corpuscular volume (mcv). peripheral blood smear examination showed a marked anisocytosis comprising of macrocytes, polychromatic cells, and microspherocytes. a high percentage of nucleated rbc and thrombocytopenia were also seen [figure 1 ]. peripheral blood smear shows features of hemolysis manifested as spherocytes, macrocytosis, nucleated rbc, and polychromatic cells along with thrombocytopenia (400) bone marrow aspiration was done to rule out any underlying lymphoproliferative conditions and the slides showed only hypercellular marrow with erythroid hyperplasia and increased megakaryopoiesis [figure 2 ]. the overall impression on hematological examination was hemolytic anemia with thrombocytopenia and reactive marrow hyperplasia. to summarize, the patient had a positive direct antiglobulin test, evidence of hemolysis in the form of reticulocytosis, elevated indirect bilurubin, and serum lactate dehydrogenase (ldh). the constellation of the clinical and laboratory data suggested that the patient was a case of hashimoto 's thyroiditis complicated by evans syndrome. her present hemoglobin is 13.2 grams% and total serum bilirubin is 0.8 mg / dl. autoimmune diseases comprise of a heterogeneous group of disorders and are sometimes defined as a clinical syndrome caused by alterations in the immune system such as activation of t cells or b cells or both, resulting in a spectrum of diseases that can target specific organs or affect the body systemically. autoimmune thyroid diseases, thus comprise of a series of interrelated conditions including hyperthyroid graves disease, hashimoto 's thyroiditis, atrophic autoimmune hypothyroidism, postpartum thyroiditis, and thyroid - associated ophthalmopathy. the initiation of autoimmune events in hashimoto 's thyroiditis may be caused by a molecular mimicry mechanism, abnormal antigen - specific induction of t cells due to abnormal human leukocyte antigen (hla)-related genes, mutation of t cells to form abnormal clones, or an immune defect causing reduced induction of t - suppressor cells by specific antigens. the detection of anti - thyroid peroxidase (tpo) is one of the reliable diagnostic tests for hashimoto 's thyroiditis (ht) and our patient showed a high antibody level. the diagnostic features of autoimmune hemolytic anemia include a combination of clinical and laboratory signs of rbc hemolysis, together with the detection of autoantibodies, as represented mostly by a positive direct antiglobulin test ; which has been demonstrated in our case. the formation of autoantibodies in autoimmune hemolytic anemia (aiha) may be due to the break down in t - cell regulation of b cells, with the emergence of a hostile clone of immunocytes, or to a change in the structure of the antigen on the patient 's red cells, which is then recognized as non - self by its immune system. a rise in serum bilirubin greater than 5 mg / dl seldom occurs in uncomplicated hemolysis unless hepatobiliary disease is also present, however, increased bilirubin with normal alkaline phosphatase suggests constitutional hyperbilirubinemias or hemolytic crisis. an elevated aspartate transferase (sgpt) alone can be of nonspecific etiology, such as, anemia. patients with isolated unconjugated hyperbilirubinemia (gilbert 's syndrome) may develop more pronounced hyperbilirubinemia in intercurrent illness, such as, febrile illness. we attribute the high bilirubin and altered serum glutamic pyruvate transaminase (sgpt) noted in our patient to hemolytic crisis and anemia. we could not evaluate the hepatic conjugating enzyme uridine diphosphate glucuronyl transferase in our case, to exclude gilbert 's disease. the clinical presentation of febrile illness, hyperbilirubinemia, and hemolytic crisis, with relatively normal liver function tests, as a scenario in our case, has provocated us to exclude a previously unrecognized gilbert 's syndrome in the follow - up. there is a diversity of autoimmune mechanisms in idiopathic thrombocytopenic purpura (itp), such as, antiplatelet antibodies and b - cell, and t - cell tolerance. platelet antibodies are only detected in approximately 60% of the patients and failure to detect may be due to limited test specificity or undetected antigens. the immune tolerance defects in itp can arise during early development (central tolerance defects), due to differentiation blocks with skewed peripheral b - cell subsets or peripheral tolerance defects arising in the setting of immune stimulation. a negative antiplatelet antibody in our case may be due to the above - mentioned reasons and in cases of concomitant active aiha, the presence of mild splenomegaly is not an exclusion criterion for itp. approximately 2% of the patients with itp have coexisting immune hemolytic anemia (evans syndrome). however, in clinical practice true cases of es may show a variety of underlying diseases, and thus, es should be classified as primary or secondary. the increased relative risk of acquiring a second autoimmune disease may be due to a genetic susceptibility that affects both diseases, the alteration of the body 's homeostasis by one disease that creates a susceptibility to another or some as - yet undefined shared mechanism. the present case is a rare clustering of three autoimmune diseases ; hashimoto 's thyroiditis, autoimmune hemolytic anemia, and immune thrombocytopenia, and can be attributed to any of the above - mentioned causes. polyglandular autoimmune syndromes (pgas) are rare immune endocrinopathies characterized by the coexistence of at least two endocrine gland insufficiencies, and associations with nonendocrine immune diseases may occur. the serum electrolytes and glucose levels of the patient had been normal, thus ruling out adrenal insufficiency in our case. organ - specific autoantibody screening facilitates the identification of those that are at risk of developing pgas. in view of financial constraints we have not been able to screen for all the organ - specific autoantibodies, but the patient is kept under regular follow - up. detection of such cases needs close collaboration and good communication between the laboratory physician and the clinician. patients with clustered autoimmunological diseases necessitate evaluation over time, and detection of various organ - specific antibodies as well as hla - gene polymorphisms, will broaden the entities under autoimmune polyendocrine syndromes.	evans syndrome is a rare combination of autoimmune hemolytic anemia and immune thrombocytopenia. their association with autoimmune thyroid diseases has been reported by few authors ; however, a sequential development of the evans syndrome in cases of hashimoto 's thyroiditis is extremely rare. the clustering of these autoimmune diseases might share a common pathogenic pathway. we present the fourth such case in world literature, of a 34-year - old female diagnosed with hashimoto 's thyroiditis in 2006, who has been taking synthetic thyroid hormone since then. her condition is now clinically complicated with the development of the evans syndrome.
biomarkers are tools that should aid the physician in diagnosis, in risk stratification with prediction of outcome, and, at best, in clinical decision - making. because the usual renal biomarkers (for example, serum creatinine and/or urine output) may fail to detect acute kidney injury (aki) at early onset, there is a current effort to search for and validate new diagnostic biomarkers. neutrophil gelatinase - associated lipocalin (ngal) is one of the most promising candidates because its level of expression in renal tissue increases dramatically after ischemia - reperfusion injury but not in the case of pure pre - renal failure. those data suggest the ability of ngal to detect renal structural damage. although first studies have highlighted that ngal monitoring would perform better than standard biomarkers in detecting or quantifying aki, other reports have yielded conflicting results and raised concerns regarding the accuracy of ngal for this purpose. in this context, the study published by di somma and colleagues in critical care provides important additional insights. the study included patients admitted to hospital from the emergency room, to assess the diagnosis and prognosis value of plasmatic ngal using a point - of - care method. the authors attempted a multidimensional approach including the ngal level combined with the initial clinical assessment of risk of presumed aki by the caring physician. in a net reclassification improvement analysis, this improvement occurred mainly by moving patients from the aki to the no - aki subgroups. ngal was confirmed to have a high predictive negative value in this population with low prevalence of aki. at first glance, these results suggest that ngal has an additional diagnostic value to clinical suspicion, which is a crucial requirement for a new biomarker to improve the predictive accuracy of the standard of care. looking deeper, this study highlights concerns regarding the clinical validation of biomarkers of renal injury. interestingly, the authors excluded acute renal dysfunctions from aki, a classification that referred to a subset of disease characterized by transient decline of the glomerular filtration rate with presumed no or minor structural damage (similarly to pre - renal aki). this study adds evidence to the recent study from nejat and colleagues that these classifications based on clinical presumption may be erroneous, with increased serum levels of both biomarkers of renal function and injury in these subsets of patients. using classifications based on markers of glomerular function (acute kidney injury network / risk injury failure loss endstage / kidney disease : improving global outcomes) to validate biomarkers of renal injury introduces the risk of diverting such biomarkers from their true goal and significance, namely to detect organ damage. using classifications based on a clinical assumption of pure pre - renal mechanism of renal failure although an association exists between organ injury and the inherent loss of function, the relationship is obviously complex and may vary with respect to the causative process. intriguingly, urine ngal has been associated with long - term cardiovascular mortality in a cohort of older community - dwelling adults with no past history of clinical cardiovascular disease with a median level of 192 ng / ml, higher than the threshold proposed for detection of aki in the study by di somma and colleagues (that is, 150 ng / ml), reflecting a high noise / signal ratio for the diagnosis of renal failure (which semantically better defines altered glomerular function). the expectation that a single biomarker (with a much hunted critical threshold) could at the same time capture these mechanisms of disease and could accurately predict the loss of function and/or stage of kidney injury is therefore obviously flawed. by analogy, who would expect ngal carries risk information beyond markers of renal function and clinical assessment. in the present study ngal did not perform better than the estimated glomerular filtration rate or clinical judgment, which share common criteria with the clinical endpoint (namely serum creatinine and estimated glomerular filtration rate) - further suggesting that these biomarkers provide different information, including a prognostic value. is it time for intensivists to operate the paradigm shift at the bedside in the way we assess aki by using ngal to monitor renal damage ? further exploration of the association between biomarkers of renal function, biomarkers of renal injury and prognosis appears a crucial next step before doing so. the results of an ongoing large multicenter study assessing the association between ngal and 1-year outcome in icu patients will provide important insights into this issue (frog - icu trial, clinicaltrials.gov:nct01367093). exploration of the links between hits, damage and driving forces of renal failure through the sources of different biomarkers, identification of the ngal pathways (that is, systemic inflammation, chronic renal injury, acute renal injury, and so forth) and increased specificity of biomarkers toward renal injury is then required (figure 1). most importantly, intensivists and emergency physicians should explore whether risk stratification using ngal will translate in clinical decision - making. serum / urine neutrophil - gelatinase associated lipocalin increase might outweigh renal function biomarkers for prediction of adverse outcome. several lines of evidence suggest that a rise of serum or urine level of neutrophil - gelatinase associated lipocalin (ngal) might outweigh biomarkers of renal function for prediction of adverse outcome (that is, mortality). dashed lines enclose potential effectors linking biomarkers of renal function (for example, serum creatinine) and renal injury (for example, ngal) to poor outcome. these factors can affect the serum level of these biomarkers (+) but can also influence outcome (-). further research should explore the significance of these associations and will unveil the specificity of the biomarkers toward renal injury. in conclusion, current definitions of aki are based on renal function biomarkers that carry different information than biomarkers of injury. injury does not always translate into renal failure, however, and the converse holds true. future research should aim at clarifying what we are really looking at with biomarkers of kidney injury, including ngal, and what are the clinical implications. pending these advancements, we certainly have to accept that injury is not function and that in most conditions trying to predict renal failure with biomarkers of injury will remain an elusive task.	neutrophil gelatinase - associated lipocalin (ngal) is one of the most promising candidate biomarkers of renal injury, with expression in renal tissue increasing dramatically after ischemia - reperfusion injury but not in the case of pure pre - renal failure. in a recent issue of critical care, di somma and colleagues reported that ngal could improve the classification of acute kidney injury compared with clinical assessment and showed that ngal was associated with poor prognosis. ngal may therefore carry different information than biomarkers of renal function. this study finally provides additional evidence for the highly complex relationship between renal function and renal injury.
cylindroma is a benign skin adnexal neoplasm that presents in the head and neck region. the tumor may be single or multiple, and is commonly located on the scalp. histopathology is diagnostic with characteristic ' jigsaw puzzle ' architecture and features of ductular differentiation. a 58-year - old man presented to the outpatient department with the complaints of a painful swelling over the right side of the face and scalp that gradually increased in size since two years. on examination, the facial swelling appeared bosellated and fungating, with surface ulceration [figure 1 ]. a trucut biopsy was done from the face as well as the scalp nodule [figure 2 ]. histopathological examination from both the swellings were identical and revealed lobules of epithelial cells separated by thin acellular eosinophilic septae, which imparted a mosaic or jigsaw the lobules comprised of a peripheral layer of dark staining basaloid cells and pale staining cells in the center. the periodic acid schiff (pas) stain highlighted the acellular basement membrane like material surrounding the lobules as well as entrapped masses of hyaline material within the lobules [figure 4 ], thereby supporting a diagnosis of eccrine cylindroma. there was no significant family history to support a diagnosis of brooke spiegler syndrome or familial cylindromatosis. bosellated and ulcerated swelling on the face low - power view (h and e 10) showing islands of epithelial cells giving a jigsaw puzzle appearance pas stain highlighting the eosinophilic ribbons surrounding the islands and hyaline globules (h and e 40) the cell of origin is from the pluripotent stem cells in the folliculo - sebaceous - apocrine unit. the tumor continues to incite the curiosity of dermatologists and dermatopathologists, due to its syndromic association as well as due to its unique histopathological appearance. spiegler syndrome is an autosomal dominant cutaneous tumor syndrome, which presents with multiple skin adnexal neoplasms including cylindromas, trichoepitheliomas, and rarely spiradenomas. multiple scalp lesions can cover the entire scalp like a turban, earning it the name of turban tumor. histopathology is diagnostic with islands of cells separated by hyaline basement membrane material that is pas positive. pas - positive hyaline material in globules is also seen within the lobules. in conclusion, this in conjunction with a carefully elicited family history is mandatory to suggest or refute a syndromic association such as brooke spiegler syndrome.	cylindroma is a benign skin adnexal tumor of eccrine differentiation. clinically, they are disfiguring lesions that can mimic a malignancy. cylindromas can be single or multiple and commonly involve the scalp (turban tumor) and face. multiple cylindromas can have a syndromic association as seen in brooke spiegler syndrome and familial cylindromatosis. we present a case of non familial cylindroma of the face that clinically mimicked a basal cell carcinoma. the histopathology was confirmatory. herein we also highlight the utility of a simple and inexpensive histochemical stain periodic acid schiff in supporting the diagnosis.
embryonic stem cells have the ability to ultimately differentiate into all types of cells in our bodies, whereas tissue stem cells (also known as adult stem cells) serve as immediate sources of cell supply to their resident tissues. stem cell research has offered the promise of effective cell - based therapies in treating many debilitating diseases such as diabetes, neurodegenerative diseases, and cancer. the therapeutic potential of stem cells has inspired the imagination, intense interest, and targeted investment of scientists, clinicians, and the general public toward this fascinating area of biology. at present, human embryonic stem cell research is politically charged, with biologists engaging in ethical debates. meanwhile, much of the research effort has been channeled to harnessing stem cells into desired cell types for clinical applications. excitement notwithstanding, there is still a long way to go in understanding the fundamental mechanisms of stem cells before new therapies will be effectively established. however, this aspect of stem cell research has not garnered as much attention. as evident from the three papers in this series of reviews, stem cell biology is, by and large, an integral part of cell biology and presents a vast new terrain of basic cell biology for exploration. the hallmark of a stem cell is its ability to self - renew while generating many daughter cells that are committed to differentiation. intimately related to this ability are a host of fundamental questions that await investigation : how can we definitively identify a stem cell ? what defines a stem cell in molecular terms ? what signaling events control stem cell proliferation and differentiation ? how does a stem cell behave in its biological context ? what happens to a differentiated cell when it is reprogrammed into a stem cell or vice versa ? solutions to these wide - ranging and perplexing questions of cell biology are all related to understanding the single defining feature of stem cells their self - renewing ability. the self - renewing ability of stem cells is tightly related to their ability to undergo self - renewing asymmetric divisions. the concept of self - renewing asymmetry should be applicable, either strictly during each mitosis or loosely among several mitoses, to all types of tissue stem cells and perhaps even to embryonic stem cells to account for their self - renewal. a stereotypical asymmetric division gives rise to both a daughter stem cell and a daughter cell that has acquired a more differentiated fate. this unique asymmetry allows a stem cell to self - replicate while producing numerous differentiated progeny. it is distinct from another form of asymmetric division that produces two daughter cells that are different from each other as well as from the mother, as often seen for progenitor cells. for those stem cells that undergo apparently symmetric divisions, the self - renewing asymmetry still exists among several divisions because, even stochastically, 50% of the daughter cells need to acquire a more differentiated fate after the divisions. therefore, how the self - renewing asymmetry is achieved is a central question in stem cell biology. the three reviews in this issue effectively summarize the latest progress in our understanding of mechanisms that underlie self - renewing asymmetric division of three of the best - characterized tissue stem cell systems drosophila melanogaster neuroblasts, drosophila germline stem cells, and mammalian skin stem cells. discoveries from these three model systems complement one another, each revealing a unique aspect of the asymmetric mechanism. together, they present a comprehensive landscape of molecular mechanisms underlying the self - renewing asymmetric division of stem cells. it is a pleasure to comment on these exciting discoveries from a more general perspective. self - renewing asymmetric division of a stem cell is controlled by both extrinsic signaling and intrinsic mechanisms. much progress has been made in understanding intercellular mechanisms, especially the identification of niches for various types of tissue stem cells and elucidation of the role of the niche in regulating asymmetric stem cell division. perhaps the best - illustrated role of the niche in regulating stem cell division comes from the study of germline stem cells in the drosophila ovary and testis (see yamashita and fuller on p. 261 of this issue ; for more detailed information, also see lin, 2002). in female flies, somatic niche signaling requires the tgf pathway and another signaling pathway defined by the yb and piwi proteins, which are required in niche cells for germline stem cell maintenance. the tgf and yb piwi pathways converge in germline stem cells to repress the expression of bag of marbles (bam), a gene that is necessary and sufficient for promoting stem cell differentiation (chen and mckearin, 2005 ; szakmary., 2005). the niche induces the attachment of one pole of the stem cell spindle to the niche cells (deng and lin, 1997). such attachment is mediated by a spectrin - rich structure called the spectrosome and a cytoplasmic dynein - mediated mechanism (deng and lin, 1997 ; mcgrail and hays, 1997). similarly, the drosophila male germline stem cell system contains somatic niche cells (hub cells) that secrete the unpaired ligand for the jak stat (janus kinase signal transducer and activator of transcription) signaling pathway to maintain germline stem cells, as reviewed by yamashita and fuller (2008). as a stem cell divides, one pole of its mitotic spindle is anchored to the niche cells, ensuring the asymmetric division that allows only one of the two daughter cells to maintain contact with the niche cells and, as such, retains the stem cell fate. this attachment requires adherens complexes that contain cadherin, -catenin, and adenomatous polyposis coli 2 (apc2) protein, which is similar to the anchorage of mitotic spindle in drosophila embryonic epithelial cells (for review see lin, 2003). although the role of niche in the asymmetric division of mammalian stem cells has not been as clearly illustrated, fuchs and colleagues have shown that embryonic basal epidermal cells use their polarity to divide asymmetrically with respect to the underlying basal lamina, generating a committed suprabasal cell and a proliferative basal cell (lechler and fuchs, 2005 ; see fuchs on p. 273 of this issue). because skin stem cells are a subpopulation of mitotically active basal epidermal cells, it is conceivable that these stem cells divide in an asymmetric fashion to self - renew and to produce differentiated keratinocytes. moreover, integrins and cadherins in the basal lamina are essential for the proper localization of apical complexes containing atypical pkc (apkc), the par3lgn inscuteable protein, and numa (nuclear mitotic apparatus protein)dynactin. this asymmetric localization may be functionally important because similar complexes in drosophila neuroblasts are essential for asymmetric division, as reviewed in this issue (see chia. on p. 267 of this issue). the requirement of integrins and cadherins suggests that the extracellular matrix, such as basal lamina, can also serve as a stem cell niche or part of a niche. such an acellular niche also contains signaling molecules such as laminin 5, which is a stable ligand for integrin in hemidesmosomes and focal adhesions. in addition, the basal lamina may serve as mechanical support to the stem cell system. moreover, its resident proteoglycans and other proteins may function as molecular sinks for growth factors that either promote or restrict the proliferation of epidermal cells, thus serving as a signaling source for these molecules. in addition to basal epidermal cells, mouse neuroepithelial stem cells and hematopoietic precursor cells undergo both asymmetric and symmetric divisions. in the mammalian central nervous system, embryonic neuroepithelial cells first undergo symmetric division to expand their population and then switch to asymmetric divisions for neurogenesis. this switch involves a change in cleavage plane orientation from perpendicular to parallel to the plane of the apical lamina, leading to an asymmetric distribution to the daughter cells of the apical plasma membrane, which constitutes only a minute fraction (12%) of the entire neuroepithelial cell plasma membrane (kosodo., 2004). somewhat similarly, mouse hematopoietic progenitor cells are capable of both symmetric and asymmetric divisions in cultures supported by stromal cells (wu., 2007). a prodifferentiation stromal cell line increased the frequency of asymmetric division, whereas a pro - proliferation stromal cell line promoted symmetric division. these observations indicate that niche signaling can also control the asymmetry of stem cell division at a populational level. although niche induction accounts for asymmetric division in some types of stem cells, it may not play a role in all types of stem cells. for drosophila neuroblasts, the initial cue for symmetry seems to depend solely on the cell itself, as reviewed by chia. the neuroblasts are derived from embryonic epithelial cells and inherit their polarity, with one end being apical and the other being basal. this allows molecules that determine cell fate to be segregated along the apical - basal axis. the mitotic spindle is also oriented along this axis such that the plane of division is perpendicular to the axis. this means that one daughter cell inherits the apical molecules and remains a neuroblast ; the other inherits the basal components and becomes a ganglion mother cell. studies on drosophila neuroblasts in the past 15 years have identified a group of proteins localized to the apical cortex that determine the asymmetry of stem cell division. par3, apkc, and par6, which regulates the tumor suppressor lethal (2) giant larva (lgl). such regulation is likely via phosphorylation, which, in turn, affects the activity of lgl in the localization of basal complexes. conversely, lgl inhibits the basal localization of apkc, thereby restricting apkc to the apical cortex (lee., 2006). the second apical complex contains heterotrimeric g protein signaling mechanism components : gi, partner of inscuteable (pins), and locomotion defect (loco). these two complexes work in parallel to control the asymmetric localization of cell fate regulators, the apicobasal orientation of the mitotic spindle, and the asymmetric structure of the spindle itself. the coordination of all of these aspects of asymmetry is essential for the asymmetric fates of the two daughter cells, as reviewed by chia. (2008), and will be discussed in further detail in the following sections. interestingly, key components of the par3 complex have also been found in the apical cortex of mammalian skin stem cells, as reviewed by fuchs (2008). the mouse numb homologue is localized asymmetrically during hematopoietic precursor cell division, similar to the asymmetric behavior of numb in drosophila neuroblasts (wu., 2007). these observations raise the possibility that the asymmetric mechanism discovered in the drosophila neuroblast is conserved during evolution. a fundamental aspect of the asymmetric division mechanism is the asymmetric property of centrosomes during stem cell division. the mother and daughter centrosomes are known to differ in size, molecular composition, the ability to organize microtubules, and even the ability to localize mrnas or possibly other cell fate determinants, as systematically discussed by yamashita and fuller (2008) and by chia. drosophila male germline stem cells and neuroblasts, the large mother centrosome organizes a more extensive population of astral microtubules and is selectively retained in the daughter stem cell after stem cell division. this feature has also been found in mammalian cultured cells. additionally, the two centrosomes may differentially associate with cell fate determinants, which would be an effective mechanism for the asymmetric segregation of cell fate determinants. finally, anchoring of the mother centrosome to the niche is also important for the oriented asymmetric division. the multifaceted difference between the mother and daughter centrosomes may be a consequence of the structural difference of their resident old and young centrioles, as discussed by yamashita and fuller (2008). the exploration of asymmetric features in centrosomal biogenesis and function represents a new area of stem cell research with general implications in cell and cancer biology. an intriguing feature of asymmetry as revealed by the study of drosophila neuroblast division is the asymmetric geometry of the mitotic spindle. particularly, the distance between the apical pole and equator of the spindle is greater than that between the basal pole and the equator. this results in an apically located larger daughter neuroblast and a basally located smaller differentiated cell (i.e., the ganglion mother cell). the spindle asymmetry is controlled by both apical complex i (bazooka par3 and apkc par6) and apical complex ii (gi pins loco), with either complex alone being sufficient to maintain the geometric asymmetry of the spindle (cai., 2003). in addition, the apical localization of these complexes leads to displacement of the spindle toward the basal cortex, which also contributes to the size difference between the two daughter cells. given that the components of these complexes are evolutionally conserved, this mechanism may be involved in the asymmetric division of other types of stem cells that generates two daughter cells of unequal size. a particularly exciting development in basic stem cell research in the past few years is the discovery of novel functions of cell cycle regulators in controlling the asymmetry of stem cell division, as timely reviewed by chia. for example, the cdc2/cdk1 level controls whether a neural or muscle progenitor undergoes symmetric or asymmetric division. in neuroblasts, high levels of cdk1 during mitosis are required for the asymmetric localization of apical and basal protein complexes. in addition, aurora and polo kinases act as tumor suppressors in neuroblasts by preventing excess self - renewal, implicating the function of asymmetric division in restricting overproliferation. the mutations of these two kinase genes affect the asymmetric localization of apkc, numb, partner of numb, and notch, causing symmetric division to generate two daughter neuroblasts. in addition, anaphase - promoting complex / cyclosome is also required for the localization of miranda and its cargo proteins (prospero, brain tumor, and staufen). more surprisingly, even cyclin e, a g1 cyclin, is involved in asymmetric neuroblast division. multiple lines of evidence suggest that the asymmetric function of these cell cycle regulators is not via their conventional function in cell cycle control but rather by directly impinging on the asymmetric localization and segregation machineries in neuroblasts. mutants of some of these cell cycle genes exhibit tumor phenotypes, which is similar to the phenotype of genes required for apicobasal polarity in drosophila epithelia and neuroblasts. these observations highlight the importance of asymmetry in preventing overproliferation (chia., 2008). just as it is important to understand the asymmetric mechanism of stem cells, it is imperative to comprehend the biological impact of asymmetric stem cell division on the development and maintenance of tissues. in this regard, mammalian epidermal stem cells provide an unparalleled opportunity. as described in the review by fuchs (2008), stem cells for the epidermis and its appendages (hair follicles and sebaceous glands) have been relatively well identified. in the epidermis, different types of differentiating keratinocytes are organized in an orderly fashion along the baso - apical axis. this reflects a gradient of differentiation from basally located stem cells to the most differentiated cells, the stratum corneum on the apical surface. this organization pattern is readily accessible for investigating how the asymmetric division of epidermal stem cells with a defined orientation serves the need to replenish this tissue. moreover, epidermal stem cells together with hair follicle and sebaceous gland stem cells contribute to the skin. the three types of stem cells behave similarly in their corresponding lineage, yet they can transiently contribute to another lineage during the injury repair process. this provides excellent opportunities for studying the coordinated control of different stem cell lineages within a tissue to ensure its development and homeostasis. for example, wnt signaling plays a key role in promoting hair follicle versus epidermal development. after formation of the hair follicle primordial (placodes), shh further promotes the growth and maturation of hair buds by turning on specific transcription factors. current progress in studying the self - renewing mechanisms of stem cells demonstrates how basic stem cell questions are characteristically cell biological questions and how these questions can be effectively approached by cell biological approaches. current findings also reveal that stem cells use evolutionally conserved molecular pathways and machineries for their asymmetric division and self - renewal. thus, the unique properties of stem cells are more a result of the unique combination of cell - general mechanisms than the existence and effect of stem cell specific molecules. the three reviews in this issue each in its own unique way cover this exciting progress as well as present challenging questions that await exploration. these challenges and progress invite cell biologists to the fascinating world of basic stem cell research.	stem cells present a vast, new terrain of cell biology. a central question in stem cell research is how stem cells achieve asymmetric divisions to replicate themselves while producing differentiated daughter cells. this hallmark of stem cells is manifested either strictly during each mitosis or loosely among several divisions. current research has revealed the crucial roles of niche signaling, intrinsic cell polarity, subcellular localization mechanism, asymmetric centrosomes and spindles, as well as cell cycle regulators in establishing self - renewing asymmetry during stem cell division. much of this progress has benefited from studies in model stem cell systems such as drosophila melanogaster neuroblasts and germline stem cells and mammalian skin stem cells. further investigations of these questions in diverse types of stem cells will significantly advance our knowledge of cell biology and allow us to effectively harness stem cells for therapeutic applications.
cardiovascular disease (cvd) is the main cause of death and it imposes a burden across the world.1) developed countries have already reduced the cvd mortality rate considerably through the identification and selection of high - risk groups, and the application of direct interventions, such as education and the prescription of medications.2) however, cvd has been gradually increasing in countries undergoing rapid economic development.2) in korea, where the ischemic heart disease (ihd) mortality rate is the highest among the cvd mortality rates, the ihd mortality rate has increased sharply from 11.6 persons per 100000 people in 1994 to 28.9 persons per 100000 people in 2012.3) this increase in the ihd mortality rate illustrates the need for an ihd prevention project to actively manage cvd risk factors in korea. capitalizing on the improved diagnosis and cardiac surgery, 5250 cases of cardiac surgery are performed annually in korea and a low mortality rate of less than two percent after these surgeries has been recorded.4) as a result, more than 85% of domestic congenital heart disease (chd) patients, including cyanotic and complex chd patients, reach adult age,5) and it is estimated that there are already about 150000 to 200000 adults with congenital heart disease (achd) patients nationwide.6) however, prevention and management strategies for ihd are still required in these achd patients. cardiovascular (cv) risk factors include age, hypercholesterolemia, diabetes, hypertension, smoking, drinking, exercise, and metabolic syndrome (ms), and these risk factors are closely related to genetic and environmental predispositions.7) in particular, the identification and management of risk factors attract intense attention because the risk factors for developing ihd after middle age can be mostly prevented or managed by behavioral modifications, such as changes to the lifestyle or dietary habits.7) furthermore, the identification of risk factors for the specific disease enables tailored care of disease features,8) and may promote more effective prevention or management of conditions such as atherosclerosis and ihd. therefore, this research attempted, for the first time in korea, to provide evidence to support the development of interventions to reduce the cv risk factors by identifying their levels in achd patients and comparing them with those in a control group. this study was conducted in 135 achd patients and 135 adults with a structurally normal heart who were randomly selected from those who visited the center for health promotion at the hospital during the same period. the achd patient group consisted of 135 patients, aged 18 years and above, who visited the outpatient clinic for achd at the samsung medical center between october 1, 2010 and april 30, 2011. this group was further divided into two achd groups, cyanotic and surgically corrected achd groups. the cyanotic achd group comprised 45 cyanotic achd patients who had cyanosis, regardless of whether or not they underwent cardiac surgery. cyanosis was defined in patients with a peripheral oxygen saturation of 126 mg / dl. patients were defined as having hypercholesterolemia if they met one of the following criteria : diagnosis of hypercholesterolemia or a history of taking medication for hypercholesterolemia, tc>200 mg / dl, or ldl - c > 130 mg / dl. the following bmi categories9) were recognized : normal (126 mg / dl. patients were defined as having hypercholesterolemia if they met one of the following criteria : diagnosis of hypercholesterolemia or a history of taking medication for hypercholesterolemia, tc>200 mg / dl, or ldl - c > 130 mg / dl. the following bmi categories9) were recognized : normal (< 22.9 kg / m), overweight (23.0 - 24.9 kg / m), and obese (25.0 kg / m). with respect to smoking, the subjects were categorized into those who had never smoked, past smokers, and current smokers.10) alcohol use behavior was categorized according to the alcohol use disorders identification test (audit) score. audit is a simple tool, developed by the world health organization,11) to identify alcohol use behaviors in a primary care setting. the main items on this instrument are recent alcohol use, alcohol dependence symptoms, and alcohol - related problems. the test consists of 10 questions adding up to a total score ranging from 0 to 40 ; that is, each question has a set of possible responses, and each response has a score ranging from 0 to 4. scores in the range of 0 - 7 represent low - risk drinking, 8 - 15 represents a medium - level alcohol problem, and scores of 16 represent a high - level alcohol problem.11) this study categorized alcohol use into normal use (0 - 7), hazardous use (8 - 15), and problematic use (16 - 40). exercise was assessed on a yes / no basis, where " exercise " meant moderate activity for more than 30 minutes five days per week, intense activity for more than 20 minutes three days per week,12) or walking for more than 30 minutes a day for more than five days per week. based on the guidance provided by the national cholesterol education program - adult treatment panel iii13)14)15)16) and the western pacific region 's asia pacific guideline,9) we defined ms when three or more of the following criteria were satisfied : 1) presence of hypertension, as determined by sbp 130 mmhg or dbp 85 mmhg, or undergoing active antihypertensive drug therapy ; 2) fbs 100 mg / dl or active use of oral hypoglycemic agents or insulin ; 3) tg levels 150 mg / dl ; 4) hdl - c < 40 mg / dl in males, < 50 mg / dl in females ; and 5) bmi 25 kg / m.17)18) demographic data and cv risk factors were summarized descriptively with continuous variables expressed as mean (sd), and categorical data were presented as percentage frequency. the general characteristics of subjects and cv risk factors in the surgically corrected achd, cyanotic achd, and control groups were analyzed by one - way analysis of variance or kruskal -wallis test with the bonferroni method for performing multiple comparisons of continuous variables. multiple logistic regression analysis was employed to determine the association between cv risk factors in the cyanotic achd, surgically corrected achd, and control groups after adjustment for age, gender, smoking, drinking, and exercise. all analyses were performed using statistical software (sas 9.3 ; sas institute inc., the mean (sd) age of patients in the surgically corrected achd group was 48.4 (10.9) years, while the mean age of patients in the cyanotic achd group was 43.1 (9.0) years, and that of patients in the control group was 47.1 (10.3) years (p=0.042). the proportion of males was 36.7% in the surgically corrected achd group, 57.8% in the cyanotic achd group, and 43.7% in the control group(p=0.002). the proportion of subjects who had never smoked was highest in the cyanotic achd group at 77.8%, and the highest proportion of current smokers was 22.3%, in the control group (p=0.018). the proportion of subjects with alcohol use categorized as hazardous was highest in the surgically corrected achd group at 43.3%, and the highest percentage of problematic alcohol use was 16.3% in the control group (p=0.027). the highest proportion of subjects who exercised was found in the control group (47.4%)(p<0.001). the cholesterol measurements showed the highest level of tc, tg, and ldl - c in the surgically corrected achd group ; fbs level was highest in the cyanotic achd group (p<0.001). the corrected achd group had a higher proportion of subjects with ht, dm, and hypercholesterolemia than the cyanotic and control group (all p<0.001). in addition, more number of subjects in the surgically corrected achd group were obese than those in the cyanotic achd and control groups (p<0.001). ms had the highest distribution in the surgically corrected achd group. among the components of ms, subjects in the surgically corrected achd group had higher bp (p<0.001), higher fbs (p<0.001), higher tg (p=0.019), lower hdl - c (p<0.001), and were more obese (p<0.001) than those in the other two groups. there was a tendency for an increased risk of ms in the achd groups with age, male gender, alcohol consumption, and a lack of exercise. after adjustment for age, gender, smoking, alcohol use, and exercise, the ors for ms were 0.46 { 95% confidence interval (ci) 0.35 - 0.57 } and 1.48 (95% ci 1.14 - 1.92) in the cyanotic achd and surgically corrected achd groups, respectively, with an increase in the surgically corrected achd group (table 3). additionally, after adjustment for risk factors in the surgically corrected achd group, age [or 2.43, 95% ci 1.33 - 4.42) ], male gender [or 2.51, 95% ci 1.93 - 4.76), smoking [or 1.63, 95% ci 1.05 - 2.52 in the current smoking group ], alcohol consumption [or 1.08, 95% ci 1.06 - 1.09) in the hazardous use group ; or 1.96, 95% ci 1.21 - 2.85) in the problematic use group ] and no exercise [or 2.31, 95% ci 1.40 - 4.55) ] were significantly associated with an increased risk of ms (table 4). this research was undertaken to provide support for the development of interventions to lower cv risk factor levels by identifying these levels in achd patients and comparing them with those in a control group. this is the first time that such a research has been undertaken in korea. according to the results of this study, the surgically corrected achd group had higher levels of risk factors as compared with the control group, but the cyanotic achd group had lower levels of risk factors than the control group. atherosclerotic cvd is the main cause of mortality in the adult population, and the atherosclerotic process, together with various risk factors, is closely related to lipid concentrations.19) of these risk factors, being overweight and obese have positive correlations with high lipid levels and total cholesterol, and have negative correlations with hdl - c.20)21)22) in addition to obesity, a lack of physical activity is also associated with the accumulation of fat and metabolic changes. vasconcelos.23) reported that, compared with inactive or sedentary peers, active adults had lower total cholesterol and tg levels. moreover, varady.24) stated that through lifestyle changes, including diet and exercise, most adults could significantly decrease their lipid levels and atherosclerotic risk. however, because there was a belief that physical activity or exercise may have a negative influence on their cardiac condition, achd patients had a tendency to avoid physical activity or exercise.25) this finding is in partial agreement with the results of our study. patients in the surgically corrected achd group, who exercised less than those in the control group, were more obese and had higher lipid levels. in addition, subjects in the surgically corrected achd group had increased risk of hypertension, diabetes, hyperlipidemia, and ms than those in the control group. therefore, active management of obesity and lipid levels through diet and customized exercise prescriptions, taking into account the patient 's cardiac condition, may reduce the prevalence of hypertension, diabetes, and hyperlipidemia. unlike the patients in the surgically corrected achd group, those in the cyanotic achd group in the present study had a significantly lower risk of high lipid levels, including ldl - c, hyperlipidemia, diabetes, hypertension, and metabolic disorder compared to those in the other two groups. this result is in agreement with the finding of the study by martnez - quintana.20) which suggested that patients with cyanosis had significantly lower levels of tc and ldl - c compared with patients without cyanosis. hypocholesterolemia can be explained by the genetic determinants of cyanosis, hypoxemia, erythrocytosis and, related factors. in addition, the lower prevalence of coronary atherosclerosis in the cyanotic achd group might be explained by hypocholesterolemia, along with the upregulation of nitric oxide, hyperbilirubinemia, and a lower platelet count.26) there are still some controversies about glucose levels. hait.27) reported that glucose levels could be high in patients with a left - to - right shunt lesion such as asd, vsd, and atrioventricular septal defect as well as even in cyanotic patients including those with eisenmenger syndrome due to excessive clearance of insulin by the lungs. however, lundell.28) suggested that cyanotic patients can also have lower glucose levels when fasting because of chronic increases in circulating catecholamines and poor nutrition. in our study, cyanotic patients including patients with eisenmenger syndrome showed significantly higher glucose levels than those in the other two groups. these cyanotic patients could have unstable glucose levels ; hence, they require continuous monitoring and nutritional management. this study showed that the risk of ms in patients of the surgically corrected achd group was 1.48 times higher than that in patients of the control group, and that the risk factors included age, gender, lack of exercise, alcohol consumption, and smoking. these factors were the already known risk factors for an increase in ms and they were controllable factors.7) therefore, during follow - up in the achd outpatient clinic, identifying the patient 's risk factors, and developing as well as applying tailored intervention which allows self - management of the risk factors may contribute to the prevention of ms in achd patients. in a manner similar to that in which hypertension can persist after total correction of coarctation of the aorta, adverse sequelae of a cv event can persist after chd treatment. for these reasons, patients with chd need proactive evaluation of cv risk factors and more frequent follow - ups.29) our study has a number of limitations. first, there were significant differences in the age and gender between the participant groups. to minimize the effect of age and gender, second, the surgically corrected achd group included patients who underwent total correction, irrespective of whether the original chd morphological classification diagnosis was acyanotic or cyanotic chd. according to fyfe.26) there was a significant difference between postsurgical patients with cyanotic achd and those with acyanotic achd ; lipid levels increased in only 11% of the cyanotic patients who had hypocholesterolemia before surgery. the present study did not consider the pre- and postsurgical characteristics of the cyanotic patients in the analyses. thus, it is advisable to differentiate between acyanotic and cyanotic surgically corrected achd patients in follow - up studies. third, steinberger.19) stated that the atherosclerotic process begins in childhood and progresses slowly into adulthood, and that lipid levels in childhood are linked to lipid levels and obesity in adulthood.21) however, the present study measured the lipid levels and obesity at only one time point during adulthood. therefore, it is advisable to conduct a longitudinal study of risk factors including lipid levels and obesity from childhood to adulthood. on comparing the cv risk factors between the surgically corrected achd, cyanotic achd, and control groups, the patients in the surgically corrected achd group demonstrated lower exercise levels, higher lipid levels, and increased obesity compared with the controls and they showed higher risk of hypertension, diabetes, and hyperlipidemia. on the other hand, the patients in the cyanotic achd group showed lower risk of all lipid levels, hypertension, diabetes, hyperlipidemia, and metabolic disorder than the controls. therefore, for patients with surgically corrected achd, there is a need to develop intervention programs and guidelines for managing risk factors, including obesity and lipid levels. on comparing the cv risk factors between the surgically corrected achd, cyanotic achd, and control groups, the patients in the surgically corrected achd group demonstrated lower exercise levels, higher lipid levels, and increased obesity compared with the controls and they showed higher risk of hypertension, diabetes, and hyperlipidemia. on the other hand, the patients in the cyanotic achd group showed lower risk of all lipid levels, hypertension, diabetes, hyperlipidemia, and metabolic disorder than the controls. therefore, for patients with surgically corrected achd, there is a need to develop intervention programs and guidelines for managing risk factors, including obesity and lipid levels.	background and objectivesthe objective of this study was to analyze cardiovascular risk factors in adults with congenital heart disease (achd).subjects and methodsthe subjects for this study comprised 135 patients, aged 18 years and above, who visited the achd clinic at the samsung medical center and 135 adults with a structurally normal heart who were randomly selected from the center for health promotion during the same period. for the analysis, the achd group was further divided into an achd group that underwent correction by cardiac surgery and a cyanotic group.resultsthe mean (standard diviation) age (years) of patients in the surgically corrected group was 48.4 (10.9) years, while that of patients in the cyanotic group was 43.1 (9.0) years and that of patients in the control group was 47.1 (10.3) years (p=0.042). the adjusted odds ratios (ors) for past smoking, hypertension, diabetes mellitus, hypercholesterolemia, obesity, and metabolic syndrome were significantly higher in the surgically corrected patients than in the controls. however, the ors for all variables excluding past smoking were significantly lower in the cyanotic group compared with the control group. after adjustment for age, gender, smoking, alcohol use, and exercise, the ors for metabolic syndrome were 0.46 (0.35 - 0.57, p<0.001) and 1.48 (1.14 - 1.92, p=0.003) in the cyanotic and surgically corrected groups, respectively.conclusioncardiovascular risk factors need to be considered in surgically corrected achd patients as well as in adults with a structurally normal heart. a further study with a long - term follow - up is needed for developing guidelines for prevention.

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.