article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
the major causes of death in patients with congestive heart failure are sudden death and death from progressive pump failure. mortality remains unacceptably high despite recent pharmacological advancements in treatment, with sudden, ' unexpected ' death occurring in up to 40 - 70% of patients. although the total mortality among patients with mild heart failure is low, the relative proportion of patients dying suddenly is significant (50 - 70%). the relative proportion of sudden death in patients with more advanced heart failure amounts to less than 30% of all causes of death. the risk is still substantial, however, given the annual mortality of 40 - 60% in advanced heart failure (figure 1). the major cause of death in patients with severe congestive heart failure (class iii and iv) is from progressive myocardial dysfunction and hemodynamic deterioration. the absolute incidence of sudden death, however, remains comparable with that of functional class ii patients, at approximately 30%. sudden death tends to occur early in the course of heart failure, and probably results from ventricular tachycardia or ventricular fibrillation. although severe bradycardia or electromechanical dissociation may be more prevalent in patients with advanced heart failure, high risk for developing life - threatening sustained ventricular arrhythmias persists. an effective strategy for reducing that risk would prevent sudden death and would save many lives throughout the various stages of heart failure. recommendations for prevention of sudden death in patients with left ventricular dysfunction have evolved largely from the results of clinical trials. patient populations have, however, been highly diverse among these different studies, and formulating a consensus on a management strategy has therefore been difficult. although several clinical variables have been associated with an increased cardiac mortality in patients with heart failure, major limitations remain in identifying the individual at highest risk of sudden death. risk stratification for sudden death using non - invasive methods or programmed stimulation is inadequate and, at best, limited to patients with coronary artery disease and non - sustained ventricular arrhythmia. importantly, preliminary analysis of outcomes in this subset of patients who participated in the multicenter unsustained tachycardia trial (mustt) and the multicenter automatic defibrillator implantation trial (madit) suggests persistent high risk, even in those patients without inducible ventricular tachycardia. moreover, ventricular programmed stimulation has proven to be of no value in patients with non - ischemic cardiomyopathy. prevention of sudden death in patients with left ventricular dysfunction should thus be based on a logical strategy that optimizes effective pharmacologic and non - pharmacologic therapies. the efficacy of angiotension - converting enzyme (ace) inhibitors in decreasing overall mortality has been well established in populations with various degrees of myocardial systolic impairment. however, the impact of ace inhibitors on sudden death rate is probably minimal. most trials using anti - arrhythmic drugs have resulted in worsening outcomes in the drug treatment arms, especially in patients with left ventricular dysfunction. the possible exception to this rule is amiodarone, which does not appear to have an adverse effect on either survival or heart failure. in the congestive heart failure - survival trial of antiarrhythmic therapy (chf - stat) the argentinean gesica trial did show a reduction of total mortality with amiodarone compared with placebo. other studies such as emiat and camiat focused on patients with ischemic heart disease and prior myocardial infarction. the conflicting outcomes of the studies evaluating amiodarone suggest that the protective beta - blocking effects of the drug may be offset by its pro - arrhythmia properties. the only drug class that convincingly reduces total mortality as well as the risk of sudden death relative reductions of cardiac death and sudden death in some trials ranged from 30 to 50%, and may involve mechanisms related to anti - ischemic, anti - fibrillatory effects of beta - blockade, neuro - endocrine deactivation or ventricular remodeling. previous studies involving high - risk patients, however, had consistently showed low rates of beta - blocker use (< 50%). the utility of beta - blockers may be limited by bradyarrhythmias or worsening heart failure in patient populations with heart failure. non - pharmacological therapy has proven more effective in improving survival and reducing sudden death risk. the utility of the implantable defibrillators in ' secondary prevention ' has been well established in patients resuscitated from cardiac arrest or syncopal ventricular tachycardia. importantly, the effectiveness of icds in primary prevention has also been established in the subgroup of patients with coronary artery disease and non - sustained ventricular tachycardia. madit was the first study to evaluate the prophylactic use of icds in patients with prior myocardial infarction, low ejection fraction, and inducible but non - suppressible ventricular arrhythmias. the use of icds is associated with a significant survival benefit compared with ' conventional ' anti - arrhythmic drug therapy (mostly amiodarone). madit has been criticized for its small sample size and the low rate of beta - blocker use in patients on ' conventional ' therapy (5%) compared with the icd arm (27%). however, this difference alone can not mitigate the magnitude of mortality reduction (54%) observed in the defibrillator group. the randomized, controlled mustt evaluated the utility of electrophysiologically guided therapy to reduce the risk of sudden death. the study included a larger patient population, but similar to that of the madit, and had a higher rate of beta - blockers and ace inhibitor use among patients. mustt demonstrated that, in this relatively asymptomatic population, inducible sustained arrhythmia is associated with a substantial risk of dying suddenly, and therapy guided by electrophysiologic testing resulted in a significant reduction of sudden death. this survival benefit was, however, solely due to the use of defibrillators. among patients who received defibrillators, there was no difference in sudden death rate based on beta - blocker use. it is also noteworthy that the 2-year mortality rate in patients who received defibrillators was similar in both madit and mustt, even though the rate of beta - blocker use in mustt was twice that in madit. these data confirm that the benefit of icd therapy is independent of the beneficial effects of beta - blockers. other ongoing trials, such as the defibrillators in non - ischemic cardiomyopathy treatment evaluation trial (definite), will address the utility of prophylactic icd therapy in the subset of patients with dilated cardiomyopathy and non - ischemic heart failure. the counterpart of definite for patients with coronary artery disease is the madit ii trial, in which patients are randomized to either icd or no anti - arrhythmic drug therapy. the sudden cardiac death in heart failure trial (scd - heft) is the first heart failure trial focusing on prophylactic intervention for sudden death. it is unique because its entry criteria are based only on the presence of heart failure and low ejection fraction. although we have been concerned that this study may not be powered sufficiently to identify a small, but nevertheless, important improvement in survival, we are optimistic, given the effectiveness of the icd, that a positive outcome favoring icd therapy will be forthcoming. most of these ongoing trials included an empiric icd arm and incorporated maximal heart failure therapy with ace inhibitors and beta - blockers. at the conclusion of these trials, we should have a better understanding of which group of the high - risk patients will benefit most from icd therapy. with the current transvenous lead systems, defibrillator implantation can be now achieved with a brief (< 24 h) hospital stay, and is associated with less than 1% mortality and minimal morbidity risk. defibrillators can additionally provide sophisticated monitoring and diagnostic functions that allow one to more accurately assess arrhythmia recurrence and determine the mode of death. furthermore, current generation devices are capable of providing a full range of physiologic pacing, which can facilitate the optimum utilization of beta - blocker therapy, potentially resulting in even greater synergistic benefits on improving survival. icd therapy has also been shown to be cost - effective in long - term management of patients with life - threatening ventricular arrhythmias. to summarize, patients with heart failure will undoubtedly benefit from implantable defibrillators for prevention of sudden death (figure 2). since the highest risk of arrhythmia death occurs among patients with less severe functional impairment (new york heart association class ii - iii), defibrillator implantation should be considered early in the course of illness. empiric icd therapy, targeting the population with mild to moderate heart failure, will maximize the impact of such therapy on improving long - term survival. our efforts should no longer be directed at trying to determine whether icds are effective in preventing sudden death and improving survival in patients with heart failure. we are confident that icds are effective, and believe the outcomes of definite, madit ii, and scd - heft trials will support this hypothesis. first, we should be working with device manufacturers to reduce icd costs and improve device longevity to maximize cost - effectiveness of icd therapy. we should also optimize and standardize practice guidelines and troubleshooting strategies to guarantee safety and effectiveness of icd therapy. finally, with the advent of bi - ventricular and other newer modalities of pacing for hemodynamic support, survival benefits we can then focus on identifying the appropriate patient who will experience the greatest improvement in heart failure symptoms and hemodynamic survival, because sudden death will have been eradicated in this protected population. | sudden death is a major cause of mortality in patients with ventricular dysfunction. the highest risk occurs among patients with less severe functional impairment. current methods of risk stratification are inadequate, and a rational therapy for prevention of sudden death is not available. the implantable cardioverter - defibrillator (icd) has proven to be more effective than drugs in reducing sudden - death risk in some subsets of patients. empiric icd therapy, targeting the general population with mild to moderate heart failure, will maximize the impact of such a strategy to prevent sudden death and improve long - term survival. |
fungal strains - the f. oxysporum 07 sd strain was kindly provided by elisa espsito (center for environmental sciences, university of mogi das cruzes, mogi das cruzes, state of so paulo, brazil). the fungus was cultivated and maintained on potato dextrose agar (pda) (becton & dickinson and company, usa) at 28c in petri dishes. the following strains of candida spp and cryptococcu s spp were used to evaluate the antifungal activity of the snps : candida albicans atcc 10231, c. albicans atcc 24433, candida krusei atcc 6258, candida glabrata atcc 2001, candida parapsilosis atcc 22019, candida tropicalis atcc 13803, cryptococcus neofor- mans atcc 28957 and cryptococcus gattii atcc 56990. the yeasts were maintained on sabouraud dextrose agar (sda) (becton & dickinson) at 4c and subcultured at least twice on the same medium at 35c for 48 h prior to use in experiments to ensure optimal growth. snp production - f. oxysporum previously grown on pda at 28c was inoculated in medium containing 2% malt extract and 0.5% yeast extract and incubated at 28c for 7 days with agitation. subsequently, the biomass was centrifuged, washed three times with sterile water and weighed. approximately 10 g of f. oxysporum biomass was added to a glass erlenmeyer flask containing 100 ml distilled water and incubated for 72 h at 28c with agitation. then, the components of the fungal aqueous extract were obtained by filtration through a 0.45 m pore size nylon membrane filter and a silver nitrate (agno 3) solution was added to produce different concentrations of silver ions (0.5 mm, 1.0 mm, 1.5 mm and 2.0 mm). the solutions were kept up to 60 days at room temperature in the dark. periodically, aliquots of the reaction solutions were removed and the absorption was measured from 200 - 600 nm with a spectrophotometer (spectramax m2e, molecular devices, sunnyvale, ca, usa). the aliquots were also characterised using microscopy methods as follows. snp characterisation - transmission electron microscopy (tem) - a drop of snp colloidal solution obtained from a 1.0 mm agno 3 solution collected at various times (5, 10, 15, 30 and 60 days) was directly dispensed on a copper grid (300 mesh) coated with polyvinyl resin (formvar, ted pella, inc) and dried in a vacuum desiccator. images of the snps were obtained with a jeol 1200 electron microscope (jeol, tokyo, japan) equipped with a ccd camera (megaview iii model, soft image system, germany) and processed with item software (soft image system). routines were performed following the guidelines established by national institute of standards and technology (nist) for size characterisation by microscopy - based techniques (jillavenkatesa. the snps size was measured using the software imagej [national institutes of health (nih), usa ] (rsb.info.nih.gov/ij/) from several images obtained by tem. for elemental analysis, briefly, x - rays were collected using a lithium - drifet silicon detector with a norvar window in a 0 - 10 kev energy range with a resolution of 10 ev / channel. scanning electron microscopy (sem) - a drop of snp colloidal solution obtained from a 1.0 mm agno 3 solution at various days of incubation (5, 10, 15, 30 and 60 days) was directly adhered to coverslips coated with formvar and subsequently recovered by a carbon strip. the nanoparticles were analysed by a backscattered electron detector with a quanta 250 scanning electron microscope (fei company, tokyo, japan) operating at high vacuum mode. atomic force microscopy - a 10 l aliquot of snp colloidal solution obtained from a 1.0 mm agno 3 solution at various times (5, 10, 15, 30 and 60 days) was spread onto freshly cleaved 1 cm mica slides and dried with a low pressure jet of nitrogen gas. next, the snps on the slide were examined by an mfp-3d - bio system (asylum research, santa barbara, ca, usa) operating in intermittent contact mode using a cantilever olympus ac240ts. snp size analyses were quantified and diameter size measured with the package particle analysis function in imagej (nih) using several snps images according to standards established by nist (jillavenkatesa. antifungal activity assay - the in vitro antifungal activity of the snps was evaluated using the disk difusion method (clsi 2004) with some modifications. this assay was used to test snps formed with different concentrations of agno 3 solutions and at different time points after the start of the reaction. briefly, mller - hinton agar (becton, dickinson and company) petri plates (4 mm of depth) were prepared and, subsequently, 100 l of fungal inoculum [1 - 5 x 10 colony - forming unit (cfu)/ml ] was uniformly spread onto the plates. then, a 5 l aliquot of snp colloidal solution was impregnated on whatman no. 1 sterile filter paper discs (5 mm in diameter). the discs were applied to the plates, which were then incubated at 35c for 24 - 48 h. finally, the inhibition halo was measured. in addition, the antifungal activity of the snp colloidal solution obtained from a 30-day reaction with 1.0 mm agno 3 solution was evaluated by the broth microdilution method (clsi 2008). briefly, the snps were serially diluted two - fold in rpmi-1640 medium without sodium bicarbonate (sigma chemical co, mo, usa) buffered with 0.165 m mops (sigma chemical co) in 96-well microtitre trays to obtain concentrations of 0.1 to 54 g / ml. a fungal suspension of 1 - 5 x 10 cfu / ml was prepared and 100 l was dispensed into each well to obtain final concentrations of 0.5 - 2.5 x 10 cfu / ml. the microtitre trays were incubated at 35c for 48 h (candida spp) or 72 h (cryptococcus spp) in a humidified chamber. the minimum inhibitory concentration (mic) was the lowest concentration of snps that resulted in visual inhibition of fungal growth. the determination of the minimum fungicidal concentration (mfc) was performed after 48 h of treatment with the inhibitory concentrations used in the broth microdilution assay. an aliquot of all treatments were transferred onto sda plates without the presence of drugs. the plates were incubated at 35c for 48 h and the mfc was determined. morphological alterations - c. neoformans atcc 28957 yeasts were selected for the following experiments due to higher antifungal susceptibility presenting the lowest snps mic and mfc values. yeasts were treated with a sub - inhibitory concentration (0.21 g / ml) of snps, for 72 h at 35c, were washed in pbs, ph 7.2 and fixed in 2.5% glutaraldehyde and 4% paraformaldehyde in 0.1 m cacodylate buffer. then, the yeasts were post - fixed in 1% osmium tetroxide in cacodylate buffer containing 1.25% potassium ferrocyanide and 5 mm cacl 2 for 2 h and serially dehydrated in ethanol. subsequently, the yeasts were embedded in spurr s epoxy resin and ultra - thin sections were obtained using a reichert - jung ultracut (leica microsystems, wetzlar, germany). finally, the sections were stained with 5% uranyl acetate and 0.5% lead citrate and visualised on a jeol 1200 electron microscope. one - way anova (dunnett s test) was utilised to compare the snp production from different silver concentrations and student s t test was used to analyse the snp size. snp production - the production of snps was initially evaluated visually for up to 60 days during the reaction of silver ions and aqueous extracts from f. oxysporum. darkening of the medium colour occurred during the 60 days of the reaction for different silver ion concentrations compared to aqueous extract from f. oxysporum without agno 3 solution and sterile distilled water. the darkening of the colloidal solution occurred in a time - dependent manner for the first five days of the reaction ; after five days, the colour remained constant until 60 days (data not shown). these colour changes are related to the reduction of silver ions that occurs during the production of snps. at all this reaction times, the colour of the colloidal solutions became darker in a dose - dependent manner until the concentration of 1.5 mm agno 3. snps exhibited the highest absorbance between 340 - 560 nm, with an absorption peak at 440 nm, for all agno 3 concentrations used and reaction times tested (fig. 2 shows that snp production proceed the fastest rate from zero - three days ; production continued to increase up to 30 days and decrease between 30 - 60 days. furthermore, snp production increased dose - dependently way to the silver ion concentration added to the reaction (fig. 2). significantly fewer snps were produced from the 0.5 mm solution, as evaluated by absorbance at 440 nm, than from ion silver concentrations above 1 mm (p 1.0 mm did not result in increased snp production. with respect to the kinetics of snp production, we found that increasing amounts of snps were produced for the first 30 days, followed by a decrease in production after 60 days. this finding indicates that the snps likely began to degrade after a prolonged incubation time. these changes in snp production rates correlated with the appearance of needle - shaped snps, in addition to the previously observed spherical forms, on day 60 of the reactions. snps sizes could range from 1 - 100 nm and are characterised by a large surface area to volume ratio (rai. the snps produced in this work were predominantly monodispersed and spherical, with diameters ranging from 1.9 - 64.9 nm. our data revealed that the optimal snp production occurred when a 1.0 mm agno 3 solution was used during three - five days into the reaction. in this case homogenous snps with approximate diameters of 10 nm were detected. the reducing agent, reaction medium and snp stabilisation are three key factors in the synthesis of metallic nanoparticles (liu. (2005), reductases in the aqueous extracts of f. oxysporum are responsible for the reduction of ag cations and subsequent snp production. in addition, the snp size, spherical form stability and dispersion may be mediated by an interaction between the snps and proteins present in the fungal extract (durn. furthermore, snps formed in solutions of complex organic molecules seem to be stabilised by a protective coating. (2011) reported that humic acid facilitate the generation of snps by reducing silver ions, which suggests that nanoparticles can exist in a natural environment. humic acid appears to stabilise the nanoparticles by coating them and preventing their aggregation into a larger mass of silver (akaighe. the fungal extract used in this work could also be considered a natural environment. this could explain the difference in the diameters of the agglomerates observed by afm and tem. tem can not resolve the large agglomerates of snps as well as afm (300 57 nm). furthermore, the tem and sem backscattered images only reveal the silver atomic nuclei. previous studies have shown that snps exhibit antimicrobial activity against different bacterial species, such as shigella dysenteriae type i, staphylococcus aureus, citrobacter sp., escherichia coli, pseudomonas aeruginosa and bacillus subtilis (musarrat. 2010) and some fungal species, such as trichophyton mentagrophytes and candida spp (keuk - jun., we employed two different methods to determine the susceptibility of candida spp and cryptococcus spp. the disc diffusion method resulted in the formation of zones of growth inhibition ranging from 8 - 15 mm and with the broth microdilution assay we observed mics of 0.42 - 1.68 g / ml. (2011), who tested the effect of snps on bacteria and fungi using the same methods. 2008) observed that the mics of snps against c. albicans were lower (2 - 4 g / ml) than against candida non- albicans (1 - 25 g / ml). recently, (2013) observed snps antifungal activity against several fungi as candida spp, aspergillus spp, fusarium spp, c. neoformans and sporothrix schenckii presenting mic values of 0.12 - 1 g / ml. in our work, we observed similar mic values for all candida spp and cryptococcus spp tested. however, the mfc values suggest that snps are fungistatic to c. parapsilosis and c. krusei and fungicidal to c. albicans, c. tropicalis, c. glabrata and cryptococcus spp. recently, monteiro. (2011) reported an inhibitory effect of snps on c. albicans and c. glabrata biofilm formation due to reduced cell viability. our ultrastructural studies revealed that the yeast cell alterations induced by snps treatment largely occur in the cytoplasmic membrane and fungal cw. c. neoformans exposed to snps exhibit cytoplasmic leakage and apparent snp retention in the polysaccharide capsule. to our knowledge, this is the first report that demonstrates the action of snps on c. neoformans cell envelope. previous work has already demonstrated the ultrastructural effect on c. albicans yeast treated with snps (kim. snps also presented inhibitory activity against c. albicans (mic = 2 g / ml) and the action may exert the disrupting of the structure of the c. albicans cw and cytoplasm membrane and inhibit the normal budding process due to the destruction of the membrane integrity when yeasts were treated with snps concentration above mic value (170 g / ml) (kim. 2009). our work treated c. albicans yeasts with mic/2 concentration of snps, however none ultrastructural alterations was observed by tem technique. interestingly, the mic/2 value of snps was able to lead a change of cell envelop ultrastructure of c. neoformans. several other studies have demonstrated that the cell envelope constitutes the major target of snp antimicrobial activity. (2010) also demonstrated that the snps can self - assemble and interact with c. albicans and s. aureus cells, leading to the disintegration of cws and cytoplasmic membranes and cytoplasm leakage. the effect of snps on s. aureus growth, morphology and cw integrity was investigated (mirzajani. 2011), revealing bacterial growth inhibition, cw damage with peptidoglycan variations and release of muramic acid and accumulation of snps in the bacterial membrane at snp concentrations greater than 8 g / ml. membrane disruption by snps is likely due to the production of reactive oxygen species (ros), including free radicals that cause membrane lipid peroxidation. this membrane disruption allows the passage of snps into the cytoplasm, which causes subsequent damage of dna and other phosphorus - containing compounds and impairs the respiratory chain and cell division (rai. the treatment induced in c. albicans yeasts an accumulation of ros, reduction in the mitochondrial membrane potential, phosphatidylserine externalisation, dna and nuclear fragmentation and the activation of metacaspases. in mammalian cells, cytotoxicity is related to a loss of cell viability, dna fragmentation and subsequent apoptosis. furthermore, the endoplasmic reticulum may play an important role in the response to oxidative stress - induced damage and is quite sensitive to oxidative damage (zhang. interestingly, biogenic snps seems to be generally less cyto / genotoxic in vivo compared with chemically synthesised nanoparticles. furthermore, human cells were found to have a greater resistance to the toxic effects of snps in comparison with other organisms (lima. the antimicrobial effects of snps depend on their size and the rate of silver ion release. smaller - sized particles exhibit greater activity due to their higher surface area to volume ratio (morones. the ionic form of silver has been known for centuries to cure infectious diseases caused by various bacterial species, e.g., e. coli, s. aureus, klebsiella sp. and snps have an advantage over ionic silver because they exhibit reduced toxicity and greater antimicrobial potential (ingle. the superior antimicrobial properties of snps compared to silver salts are due to the large surface area of the particles, which provides better contact with the microorganisms. in addition, the snps release silver ions directly into the bacteria, which enhance bactericidal activity (rai. although in vitro and in vivo studies have indicated that snps are toxic to mammalian cells and that increased exposure of humans to snps entails potential risk, some studies have described broad applications of snps in the technological and medical fields (ahmad. the production of snps using aqueous extracts of the fungus f. oxysporum is a potential candidate for low - cost and environmentally friendly production of stable and uniformly sized snps with anticandidal and anticryptococcal activities. in this regard, the results obtained in this work open several avenues of further study, such as purification and biochemical characterisation of reductases produced by f. oxysporum or development of an alternative snp formulation that reduces the toxicity of silver. in addition, the utilisation of silver metal in nanoparticulate form may be a new strategy for the treatment of fungal infection. | the microbial synthesis of nanoparticles is a green chemistry approach that combines nanotechnology and microbial biotechnology. the aim of this study was to obtain silver nanoparticles (snps) using aqueous extract from the filamentous fungus fusarium oxysporum as an alternative to chemical procedures and to evaluate its antifungal activity. snps production increased in a concentration - dependent way up to 1 mm silver nitrate until 30 days of reaction. monodispersed and spherical snps were predominantly produced. after 60 days, it was possible to observe degenerated snps with in additional needle morphology. the snps showed a high antifungal activity against candida and cryptococcus, with minimum inhibitory concentration values 1.68 g / ml for both genera. morphological alterations of cryptococcus neoformans treated with snps were observed such as disruption of the cell wall and cytoplasmic membrane and lost of the cytoplasm content. this work revealed that snps can be easily produced by f. oxysporum aqueous extracts and may be a feasible, low - cost, environmentally friendly method for generating stable and uniformly sized snps. finally, we have demonstrated that these snps are active against pathogenic fungi, such as candida and cryptococcus. |
thyroid cancer is one of the most common head and neck cancers with increasing incidences all over the world. the five - year survival rate across all the stages is 97%, but they are different among the stages. the five - year survival is only 59% in a late stage compared to nearly 100% for an earlier, localized stage. early detection is one of the keys to reduce the mortality. at present, fine - needle aspiration cytology (fnac) is the most commonly used diagnostic tool for diagnosing thyroid diseases, especially for small nodules (< 1.5 cm) and nonpalpable thyroid nodules. although fnac is a primary method for detecting malignant nodules, 10%25% of thyroid nodules are categorized as indeterminate nodules. studies have shown that serum thyroglobulin (tg) determination serves as the proper monitoring strategy for differentiated thyroid cancer (dtc) after surgery [5, 6 ]. however, some studies demonstrated undetectable preoperative tg in patients with dtc and low postoperative nonstimulated tg in patients with i - avid metastases. hence, it is necessary to screen sensitive presurgical biomarkers for predicting thyroid cancer. vascular adhesion protein-1 (vap-1), a 170-kda homodimeric glycoprotein, is an endothelial adhesion molecule involved in leukocyte rolling, adhesion, and transmigration into sites of inflammation. another function of vap-1 is as an enzyme, semicarbazide - sensitive amine oxidase, which catalyzes oxidative deamination of primary amines into aldehydes, hydrogen peroxide, and ammonia [10, 11 ]. serum vap-1 is released or shed from many tissues such as endothelium, adipocyte, and smooth muscle cells [12, 13 ]. vap-1 is upregulated at sites of inflammation, and it mediates lymphocyte binding to inflamed endothelium [14, 15 ]. increased serum vap-1 levels in chronic liver disease and multiple sclerosis compared to healthy individuals have been reported previously [16, 17 ]. in addition, low serum vap-1 is associated with disease relapse and worse prognosis in colon cancer and gastric cancer [1821 ]. however, the diagnostic and prognostic values of serum vap-1 for tc, particularly before surgery, have not yet been studied. in this study, we determined the serum levels of vap-1 in the thyroid cancer and benign thyroid adenoma patients. in this study, 179 participants were recruited from may 2013 to july 2015 in the second hospital of hebei medical university, including 53 healthy controls (volunteer), 69 patients with benign thyroid nodules, and 57 patients with thyroid cancer. the 53 healthy participants have no diseases reported, who had come to receive their annual health checkup. patients with the following conditions were excluded : (a) autoimmune disease ; (b) coexistence of other cancers in addition to thyroid cancer ; (c) pregnancy ; (d) positive thyroglobulin antibody, because the serum thyroglobulin concentration is often subject to interference of thyroglobulin antibodies, leading to false - negative occurrence. physical exam, biopsy, and imaging tests (ultrasound, ct scan, mri, chest x - ray, and nuclear medicine scans) were performed in each patient before surgery. in the surgical cohort, 69 patients were diagnosed with benign thyroid nodules (42 cases of multinodular goiter and 27 cases of thyroid adenoma) as the thyroid was normal in tissue biopsy and thyroid ultrasonography tests. 57 patients were diagnosed with thyroid cancer as positive cytological results for samples obtained by preoperative fine - needle aspiration from enlarged cervical neck lymph nodes. the pathologic classification of 57 patients with thyroid cancer was based on the original surgical pathology report, including 46 cases of papillary histotype (ptc) and 11 cases of follicular thyroid carcinoma (ftc). the tnm classification system of the american joint committee on cancer (ajcc) was used for staging. all the participants with thyroid cancer received total thyroidectomy and neck lymph node resection if metastasis was suspected. the study was approved by the ethics committee of the second hospital of hebei medical university and informed written consent was obtained from all study participants. peripheral venous blood samples were collected from all participants in fasting state and were gently subjected to centrifugation at 1500 g for 15 min. all of the samples were taken in accordance with the regulations and approval of the institutional review board of the second hospital of hebei medical university. thyroglobulin (tg) was assessed by a chemiluminescent reaction on a fully automated immulite 2000 analyzer (siemens healthcare diagnostics, los angeles, usa). free thyroxine (ft4) and thyroid stimulating hormone (tsh) assays were performed on a fully automated advia centaur analyzer (siemens healthcare diagnostics, new york, usa). briefly, the assay utilized a biotin - conjugated monoclonal anti - human vap-1 antibody (biotie therapies corp.) as a capturer on a streptavidin - coated microtiter plate. detection of bound serum vap-1 was performed using a different europium - conjugated anti - human vap-1 antibody (biotie therapies). the time - resolved fluorescence was measured using a fluorometer (victor2 multilabel counter, perkinelmer) at 615 nm. serum vap-1 concentration was quantified on the basis of a reference sample of highly purified human serum vap-1 (biovian ltd.). the intra- and interassay coefficients of variation were < 5% and < 10%, respectively. serum vap-1 concentrations were used to draw receiver operating characteristic (roc) curve, and the specificity, sensitivity, and area under the roc curve (auc) and cut - off value were determined. a total of 126 patients with thyroid nodules and 53 healthy controls were enrolled in this study. the patients were further divided into subgroup 1 (69 cases with benign thyroid nodules) and subgroup 2 (57 cases with thyroid cancer). among the thyroid cancer patients, 41 (71.9%) had tumor stage i / ii and 16 (28.1%) had tumor stage iii / iv. the age and gender distribution for healthy controls, benign thyroid adenoma, and thyroid cancer patients were not statistically different. serum tg levels were found to be significantly higher in the thyroid cancer patients than in the normal control subjects. no significant difference was found in other biochemical results, including ft4 and ths between patient and control group. in addition, no significant difference was observed in diabetes and hepatic diseases between patients with benign thyroid nodule and with thyroid cancer. to determine the changes of vap-1 in patients with thyroid cancer, the serum levels of vap-1 were measured in healthy controls, patients with benign thyroid nodules, and patients with thyroid cancer. scatter graphs of vap-1 were plotted to demonstrate the intergroup differences (figure 1). the serum vap-1 levels were significantly lower in thyroid cancer patients than in healthy controls, as well as that in the benign thyroid nodule patients. these data suggest that vap-1 is involved in the pathogenesis of thyroid cancer. since preoperative increasing serum levels of tg correlate with higher risk of thyroid cancer [24, 25 ], we analyzed the correlation between the serum vap-1 concentrations and tg levels in thyroid cancer patients. as shown in figure 2, nonparametric spearman 's correlation test showed that a negative correlation was observed between the serum vap-1 concentration and levels of tg (r = 0.81 ; p < 0.001). we further analyzed the relationship of serum vap-1 concentrations with age and tumor stage using spearman 's correlation test. no significant correlation was found between vap-1 concentrations and age (p = 0.62) and tumor stage (p = 0.12), respectively. to evaluate the predictive value of vap-1 for thyroid cancer as shown in figure 3, the area under the roc curve was 0.78 (95% confidence interval, 0.700.87 ; p < 0.001). the decision on optimal cut - off value for serum vap-1 was based on maximizing the sum of sensitivity and specificity. the cut - off value of vap-1 was 456.1 ng / ml with a 77.4% specificity and 66.7% sensitivity for thyroid cancer diagnosis. it has been over 40 years since biological markers were first introduced as a way to detect and manage thyroid cancer. from the beginning, the goal was to find markers that can identify benign thyroid nodules and malignant thyroid tumors and to predict the behavior of these thyroid cancers. however, thyroid nodules remain a challenge from both a diagnostic and a management perspective. an accurate presurgical biomarker that can quantify the likelihood of malignancy within a thyroid nodule is needed. in this study, we found that serum vap-1 levels were significantly lower in thyroid cancer group than in healthy control and benign thyroid nodule groups. serum vap-1 level negatively associated with serum thyroglobulin concentration in thyroid cancer patients and has a good capability in the diagnosis of thyroid cancer. these findings suggest that serum vap-1 could be a potential useful adjunct in the diagnosis of thyroid cancer. vap-1 is one of the endothelial adhesion molecules which supports shear - dependent lymphocyte binding to high - endothelial venules in lymph nodes [14, 28 ]. a number of studies have suggested a strong correlation between serum vap-1 levels and cancer prognosis [18, 19, 21 ]. one recent study showed that the serum vap-1 level was significantly lower in the colorectal cancer group compared with the control group. tissue vap-1 protein and mrna levels were also significantly lower in colorectal cancer compared with normal colon tissue. these findings suggest that vap-1 is downregulated in human colorectal cancer and it may be part of a mechanism used by the tumor to prevent the recruitment of antitumor immune cells. in addition, li. reported that serum vap-1 predicts mortality independently and improves risk stratification in colorectal cancer subjects. in contrast, strong vap-1 expression has been detected on liver cancers where it has been proposed that vap-1 supports the recruitment of lymphocytes. increased vap-1 immunoreactivity has been demonstrated in microvessels in human conjunctival tumors and in human breast cancer, tumor vap-1 mrna expression is associated with oestrogen receptor expression and improved prognosis [32, 33 ]. interestingly, yasuda. demonstrated that serum vap-1 levels are significantly higher in gastric cancer patients compared to healthy controls. furthermore, an inverse correlation between serum vap-1 level and tumor size, serosal invasion, lymph node metastasis, peritoneal dissemination, and tnm classification was found, and patients with low vap-1 levels had a significantly poorer prognosis compared to those with high vap-1 levels. there is limited data about the clinical importance of serum vap-1 levels in thyroid cancer. to the best of our knowledge, decreased serum vap-1 concentration was found in patients with thyroid cancer group compared to healthy control and benign thyroid nodule groups. ideally, a serum biomarker is one that is highly sensitive and specific, can establish diagnostic certainty, and can be easily measured. this definition has remained fairly consistent over several decades, despite the introduction of complex bioinformatics systems that are being used as analytical tools to identify new biomarkers. in recent years, several immunohistochemical markers, such as cytokeratin-19, galectin-3, hbme-1, fibronectin-1, and intracellular sodium / iodide symporter, or their combinations have been used to differentiate benign thyroid diseases from thyroid cancer [3537 ]. another study has indicated that diffusion - weighted mr imaging as a promising noninvasive method to diagnose diseases has high diagnostic ability to differentiate benign from malignant in thyroid lesions [38, 39 ]. however, diffusion - weighted mr imaging technology is very complex and easily affected by instrument parameters. in the present study, a negative correlation between the serum vap-1 and thyroglobulin levels was observed. previous studies have indicated that preoperative serum thyroglobulin levels could be a predictor of differentiated thyroid cancer [24, 25, 40 ]. al - bader. also reported that thyroglobulin levels can aid in preoperative assessment of a thyroid nodule. however, gupta. showed that high serum thyroglobulin with negative i whole body scan did not warrant an aggressive differentiated thyroid cancer disease. these patients in their 5 years ' or till recurrence follow - up showed downward trends of serum thyroglobulin, no higher risk or recurrence, and no shorter progression - free survival. moreover, the role of vap-1 in tumor progression is likely to depend on both the host and tumor type. another important finding of our study is that the optimum cut - off value of vap-1 was 456.6 ng / ml with a 77.4% specificity and 66.7% sensitivity for thyroid cancer diagnosis, suggesting that serum vap-1 had relatively high sensitivity and specificity in predicting thyroid cancer. a number of recent studies have showed that serum biomarkers play important role in the diagnosis of thyroid cancer. for instance, zheng. reported that higher serum thyroid stimulating hormone concentration is associated with an increased risk of thyroid cancer. showed that myostatin serum levels may have a potential ability for early diagnosis of cachexia in medullary thyroid cancer patients, especially in females. cho. demonstrated that one - third of the patients with medullary thyroid cancer with hypercalcitoninemia experienced structural recurrence, and postoperative basal serum calcitonin might be a simple tumor marker to predict structural recurrence. in addition, it has been reported that low wnt inhibitor dickkopf-1 serum levels are associated with poor prognosis in papillary thyroid cancer patients and dickkopf-1 could potentially be used as a biomarker leading to earlier diagnosis of papillary thyroid cancer. interestingly, one recent study showed that the combined application of us - guided fine - needle aspiration cytology and thyroglobulin measurement on fine - needle aspiration / serum thyroglobulin contributes to improving the accuracy of diagnosing cervical lymph node metastases in patients with thyroid cancer. our study showed that serum vap-1 could be a potential useful adjunct in the diagnosis of thyroid cancer. therefore, the combined application of ultrasonographic features, reports of aspiration cytology or biopsy, and vap-1 measurement could be a potential way to improve the accuracy of diagnosing thyroid cancer. first, we recruited a relatively small number of cases and conducted a retrospective study. second, we did not perform follow - up analyses on prognostic values of vap-1 which predict new metastases or recurrence. third, the patients with positive thyroglobulin antibody were excluded and this study included only chinese subjects ; therefore, our results may not fully apply to the general patient. thus, large prospective longitudinal studies, ideally involving many ethnic groups, are needed to improve our understanding of the long - term health risks associated with thyroid cancer. in conclusion, decreased preoperative serum vap-1 levels were found in patients with thyroid cancer.. however, these data are exploratory and preliminary. future larger prospective cohort studies, which include postoperative levels of vap-1 and longer follow - up periods, will better define the clinical utility and prognostic use of this marker. | vascular adhesion protein-1 (vap-1) is a glycoprotein that mediates tissue - selective lymphocyte adhesion. the prognostic value of vap-1 has been determined in gastric cancer. the aim of this study was to evaluate the changes and the predictive value of serum vap-1 in patients with thyroid cancer. a total of 126 patients with thyroid nodules and 53 healthy controls participated in this study. the patients were further divided into subgroup 1 (69 cases with benign thyroid nodules) and subgroup 2 (57 cases with thyroid cancer). serum vap-1 was measured by time - resolved immunofluorometric assay. diagnostic value of presurgical vap-1 for thyroid cancer was conducted by receiver operating characteristic (roc) curves. serum levels of vap-1 were significantly lower in thyroid cancer group than in healthy control and benign thyroid nodule groups. vap-1 concentrations negatively correlated with serum thyroglobulin (tg) levels in thyroid cancer patients (r = 0.81 ; p < 0.001). the optimum cut - off value of vap-1 was 456.6 ng / ml with a 77.4% specificity and 66.7% sensitivity for thyroid cancer diagnosis. serum vap-1 decreased in thyroid cancer patients and vap-1 could be a potential useful adjunct biomarker in the diagnosis of thyroid cancer. |
the world health organization (who) states lung cancer to be the most common cause of cancer - related deaths worldwide (1.3 million / year). the most important and common cause of lung cancer is the long - term exposure to tobacco smoke. nevertheless, the global burden of 15% of men and 53% of women with lung cancer, which is not attributable to tobacco smoking, amounts up to 25% of all lung cancer cases worldwide. that would position lung cancer in never smokers among the top ten of the causes of cancer - related deaths worldwide. suggested risk factors for the disease in never smokers include environmental tobacco smoke, radon gas, cooking oil vapours, indoor coal and wood burning, asbestos, genetic factors, and viral agents. syrjnen in 1979 first suggested the possibility of human papilloma virus (hpv) involvement in bronchial squamous cell carcinoma. several studies after that, put together, further suggest strongly a role for hpv as an aetiological agent of lung cancer. starting from the preliminary step of hpv gaining access to the lung tissue, discrete molecular and genetic changes have to occur for tumor initiation and progression. however, studies on hpv and lung cancer are very limited, of which epidemiological reports outnumber molecular mechanisms. there are several questions to be answered to get a complete picture of any possible mechanism for hpv - induced lung cancer. this paper tries to summarize work carried out in this field and dwells into possible mechanisms of molecular pathogenesis of hpv - induced lung cancer. human papilloma viruses, belonging to the papillomaviridae family, are dna viruses and are strictly host specific and exquisitely tissue tropic, having a preference to infect cutaneous or internal mucosal surfaces. nearly 200 subtypes of hpv have been identified which are categorized as high risk (hr) and low risk (lr) based on their oncogenic potential. hpv infects the keratinocytes found in the basal layer of the skin (stratum germinativum). several investigations have convincingly proved the presence of human papilloma virus in the lesions of upper aerodigestive tract (uadt). we have previously described the distribution of hpv types in oral cancer as well as in the larynx. the process of hpv - induced cell transformation is a combined manifestation of several discrete cellular, genetic, and molecular alterations accumulated in the mucosal tissue, termed condemned mucosa syndrome, which later progresses onto invasive cancer. the viral proteins e6 and e7 contribute predominantly to the process of carcinogenesis and further tumor progression. these oncoproteins interact with critical cell cycle regulators to hamper their activity ensuing deregulation of the cell cycle machinery leading to uncontrolled cell proliferation. the virally encoded e6 binds to a cellular ubiquitin / protein ligase, e6-ap, and to p53 resulting in ubiquitination of p53 leading to its proteolytic degradation. on the other hand, the e7 oncoprotein binds to the prb dissociating the transcription factor e2f from the prb / e2f complex, resulting in the transcriptional activation of several genes which facilitate cell proliferation. rogli. in 1975 and rubel and reynolds in 1979 provided first evidence for involvement of hpv in benign bronchial lesions, through the observations of koilocytosis in sputum samples characteristic of hpv infections [8, 9 ]. syrjnen described that the epithelial changes seen in bronchial carcinoma closely resembled hpv - induced genital lesions. klein., in 2008, have beautifully concised worldwide epidemiological data available in the hpv incidence in lung cancer. the distribution pattern ranges from a prevalence of 15% in the american continent and 17% in europe to a mean incidence of 35.7% in asia. in majority of the studies, the high - risk subtypes of hpv detected in the lung cancer tissues were 16, 18, 31, and 33, and the most prevalent low - risk subtypes were hpv 6 and 11. the alarmingly high percentages of incidences reported in greece (69%), taiwan (78.5%), and japan (79%) suggest hpv to be the second most important possible etiological agent of lung cancer after cigarette smoking and advocate the need for further research in this issue. the human respiratory tract has a divergent histology of the mucous lining with columnar epithelium throughout the respiratory tract and stratified columnar epithelium covering the mucosa of the pharynx and larynx. the resulting squamocolumnar junctions (scjs) can be compared to a similar junction in the cervix and could favour establishment of hpv infections. lung cancer can be histologically categorised, based on the biology, therapy, and prognosis as small - cell lung carcinoma (sclc) and non - small - cell lung carcinoma (nsclc). nsclcs are further classified into squamous cell carcinoma (scc), adenocarcinoma (adc), and large - cell lung carcinoma (lclc). lung cancer in never smokers when considered as a different disease is more frequent in the nsclcs than in sclcs. hpv can not bind to the live tissue, instead infects the epithelial tissue through the exposed basal keratinocytes following microabrasions of skin as would occur after a sexual intercourse. however, how a well - protected organ like lung deeply positioned in the thoracic cavity, where probability of acquiring abrasions and thereby getting exposed to hpv, is not clear. multiple sex partners, oral - genital sex, and oral - anal sex could be some of the factors favouring transmission of hpv to the oral cavity and oropharyngeal cancers. prevalence of oncogenic mucosal hpv is higher in younger age oral cavity or oropharynx cancer cases whose sexual practices are typically associated with sexual transmission of the virus. the study results from two different cancer registries in the united states, connecticut, and the surveillance, epidemiology, and end results (seer) program tumor registries report evidence of shared etiological factors of various second primary cancers following anal and cervical cancer. there were 275 cases of lung or bronchial cancer following cervical cancer recorded in these registries as compared with 91.8 expected cases, a relative risk of 3.0 (95% confidence interval 2.73.4). studies conducted by hennig. found that 49% of bronchopulmonary carcinomas were detected to be hpv dna positive in the women who had a clinical history of cin iii lesions. hpv 16 and 18 e6 mrna detected in the peripheral blood of cervical cancer patients suggests a possibility that hpv infection in the lung tissue may originate in the cervix and later infect lung via a hematogenous spread (figure 1). it has also been suggested that the presence of circulating hpv 16/18 dna may act as a risk marker for lung cancer. peripheral blood mononuclear cells (pbmcs) can function as hpv carriers and might spread the virus through blood. in all the samples tested positive, the hpv genome was found to be in the episomal form, although in a low copy number. all these reports put together designate oncogenic hpv dna as a possible risk factor in developing second primary cancers after hpv - related primary neoplasias. whether or not persistent hpv infection or hpv - induced cervical cancer is a prerequisite for the development of hpv - associated lung cancer needs further investigation. the entry of hpv into the cells in vitro is initiated by binding to a cell surface receptor in contrast to the in vivo situation where the basement membrane is a primary site of virus binding. widely distributed and evolutionary conserved cell surface receptors, heparin sulphate, and stabilizing proteoglycans (hspgs) are presumed to be epithelial cell receptors for hpv. the existence of hspgs on the cell surface, as well as extracellular matrix of lung fibroblasts, can make them suitable receptors for viral entry into lung tissue (figure 1). as ubiquitous members of extracellular membrane (ecm) microenvironment and hence the cancer stem cell niche, hspgs are major factors responsible for the microenvironment changes, involved in the tumor initiation, progression, and malignant conversion. hspg functions as an attachment factor in hpv infection, and the resulting interaction promotes essential conformational changes in viral capsid, but hspgs are obviously not the cell surface receptors that arbitrate virion internalization and the subsequent events in infection. the cell adhesion receptors 6 integrins have close association with hspgs as matrix components, and act as secondary receptors for hpv after its interaction with hspg. the drug surviving side population cells from human lung tumor tissue express the 6 integrin otherwise termed as very late antigen-6 (vla-6). the presence of cd49f receptors (another term for 6 integrins) in the adult mouse lung stem cells have also been demonstrated all suggestive of the possible involvement of lung cancer stem cells in the hpv entry leading to infection and cancer. the integrins, heterodimeric glycoproteins comprising of and subunits, are expressed in a variety of cell types, primarily involved in cell - matrix and cell - cell interactions, act as virus receptors, and aid in initial binding and/or internalization of viruses into the host tissue. of the various and subunits known, 6, 4, and 1 play a major role in the hpv binding and internalization. the preferential expression of 6 subunit with the 4 subunit forming the 64 complex expressed exclusively in the stratified squamous epithelium, the primary sites of hpv infection, makes 64-integrin the key receptor for hpv binding and possibly accounts for the predominance of hpv in squamous cell carcinoma than in other histologic subtypes of lung cancer. although the presence of oncogenic hpv in the lung tumor tissue has been reported in several studies, the causal association of the hpv and lung cancer needs to be authenticated with evidence. an argument supporting the causative role of hpv in the tumorigenesis of lung tissue is that hpv dna is indeed integrated into the host genome, which is the initial key step in the tumor initiation. furthermore, the viral oncoproteins e6 and e7 are in fact found to be expressed in the lung tumors, down regulating tumor suppressor genes such as p53. taiwanese nonsmokers had significantly high prevalence of hpv16/18, suggesting hpv infection as a possible etiological agent of lung cancer in nonsmokers. moreover, the nonsmoking females are more prone to hpv positivity than their male counterparts. also, compared to the male smokers, the female nonsmokers are at a higher risk of having hpv in their lung tumor tissue. though a few studies reported hpv absence in nonsmokers with lung cancer, this can be attributed to the technical variations in the experimental conditions such as specificity of the primers and probes used, disparity in the study subjects, and above all the overall prevalence of hpv in the study population. the process of hpv - mediated carcinogenesis is the consequence of an integrated process of defective apoptosis, neovascularisation, and cellular immortality. once the pathogen gains entry into its tissue of interest, it takes up the cellular machinery, replicates its genome, evades cell apoptosis, and initiates tumor formation. a few possible molecular events manifested upon hpv infection in addition to the already reported ones in the hpv - induced lung tumor tissue are summarised here. the fragile site fra3b, adjacent to the fragile histidine triad (fhit) is a site of integration of hpv genome. the fhit gene located in chromosome 3p14.2 undergoes frequent allele loss of heterogeneity (loh) or homozygous deletions in several cancers including lung cancer. upon integration of hpv to this site a study conducted among hpv infected, nonsmoking, female lung cancer patients from taiwan suggested that tumorigenesis may be in part due to the increase in frequency of the fhit loh, reducing the expression of fhit. the status of hpv in the tissue may determine expression level of the proapoptotic protein bcl-2, the levels of which being significantly higher in integrated hpv positive patients than those that were negative or with episomal forms (figure 1). one of the most important molecular changes documented in lung cancer progression is activation of dominant oncogenes such as ras family genes. of various genes in the ras family, k - ras gene is found to have point mutations in codon 12, in most of the lung carcinomas. also, in 50% of hpv positive lung tumors, k - ras mutation was seen to coexist, constitutively activating the ras / raf / mek pathway (figure 2). this suggests that hpv infection is not sufficient by itself for malignant transformation but requires cooperation of the activated ras gene. the e6 protein has a well - recognised signature in pathogenesis of hpv - induced cervical and oral cancer. e6 is the major viral protein which can activate two independent pathways to prevent apoptosis - p53-dependent and p53-independent pathway. e6 protein binds to the e6-ap, a host cell ubiquitin ligase, and p53 tumor suppressor protein simultaneously and induces accelerated proteosomal degradation of p53 (figure 2). kinoshita. in 1995 reported expression of e6 mrna in the hpv 18 dna - positive lung tumor tissues. in this study, they also put forward the possibility of cellular targets of hpv other than p53. hpv e6 proteins are indeed expressed in lung tumor tissues, which are negatively associated with the p53 expression. the corresponding downregulation of mdm2 and p21 (waf1/sdi1/cip1), which are the downstream targets of p53, leads to the conclusion that hpv e6 protein can inactivate the expression of p53 in lung tumor tissues (figure 2). the human dead - box rna helicase (ddx3), which plays a role in regulation of gene expression via rna metabolism, transcription, splicing, mrna export, and translation, has been associated with development of viral associated cancers. ddx3 transcription is predominantly regulated by p53, and p21 transcription is being synergistically suppressed by the alteration of the p53-ddx3 pathway via e6, in lung tumors. reduction of p21 make lung cancer patients vulnerable to tumor reversion and thereby bring about poor relapse - free survival. the viral oncoprotein e6 can also promote carcinogenesis by upregulating expression of inhibitors of antiapoptosis proteins (iaps). hpv e6 upregulates the expression of ciap2 via epidermal growth factor receptor (egfr)/phosphatidyl inositol 3-kinase (pi3k)/akt cascade. creb, which is a regulatory targeting molecule of akt, and is phosphorylated via the egfr / pi3k / akt pathway, which plays a crucial role in the upregulation of ciap2 by e6 protein (figure 2). this upregulation has been shown to confer resistance to cisplatin in hpv 16/18 infected lung cancer. the bcl-2 homologous antagonist / killer (bak) protein is a proapoptotic member of the bcl-2 gene family which is involved in apoptosis. in the p53-independent pathway e6 from high - risk hpv subtypes (16,18) and low - risk type (11) can bind to bak, in vitro, and can stimulate its degradation, in vivo. bak can associate with e6-associated protein in the absence of e6 in contrast to p53, and the subsequent inhibits the bak - induced apoptosis through this e6-ap - dependent process. though the status of bak expression in hpv - induced lung cancer is yet to be studied, we strongly suspect this mechanism to be active in promoting the tumorigenesis of lung tissue. the coexpression of e7 along with the e6 is indispensable for the increased oncogenic activity of the hpv. the e7 protein of the high - risk hpv has a strong affinity to bind to prb, abrogating the prb signalling pathway. kinoshita. in 1995 reported the coexpression of e7 mrna along with e6 mrna in the hpv 18 dna - positive lung tumor tissue. the cell cycle regulatory gene cdkn2a regulated by prb is found to be altered in the hpv associated tumors. of the two proteins encoded by cdkn2a, p16 and p14, the former prevents the cells from s - phase entry by inhibiting cdk4/6-mediated phosphorylation of rb and the p14 is a p53 stabilizer. p16 hpv e7 inactivates the prb, releasing the histone deacetylases (hdac) from the e2f - rb - hdac complex to enhance p16 hypermethylation through chromatin remodelling by hdac (figure 3). enzymes named dna methyl transferases (dnmts) mainly of three types (dnmt1, dnmt3a, and dnmt3b) by their complex interplay establish the cytosine methylation pattern. the p16 promoter hypermethylation was analysed using methylation - specific pcr (msp), the results of which showed p16 hypermethylation in 59.7% of smoking males, 36.6% of nonsmoking males, and 60.3% of nonsmoking females lung tumors among taiwanese population. p16 hypermethylation frequency in nonsmoking female lung tumors with hpv infection was as high as 70% compared to those without hpv infection, which was as low as 30%. a statistically significant correlation was observed only in the nonsmoking female lung cancer cases (p = 0.017), but not in male smoking or nonsmoking lung tumors. furthermore, reports from the same research group demonstrated involvement of hpv infection in increased expression of the dnmt3b (dna methyl transferase), to cause p16 promoter hypermethylation among the nonsmoking female lung tumor (figure 3). once the hpv genome is integrated into the host genome, the e5 gene is frequently deleted, and hence the e5 gene expression is terminated during the progression of disease from the low grade to malignant stage [40, 41 ]. so if at all e5 protein has an effect on the process of carcinogenesis, it has to act as an early - stage protein, that is, before the hpv genome integration. the key activity of hpv e5 seems to be the upregulation of egf receptors in a ligand - dependent manner. the e5 protein controls mitogenic signalling pathways by forming complex with egfr [42, 43 ]. hpv e5 exerts its action by upregulation of the egf receptor in a ligand - dependent manner. the mechanism by which the hpv e5 does this appears to be due to (i) a decrease in the rate of receptor degradation mediated by binding of e5 to the 16 kda subunit of the endosomal proton pump atpase and (ii) a net increase in the receptor phosphorylation without decreased downregulation [44, 45 ]. e5 protein can also activate map kinases via pkc (protein kinase c) and ras - mediated receptor tyrosine kinase (rtk) pathway. the e5 protein can activate the nuclear oncogenes, c - jun and jun - b, through the activation protein-1 (ap-1) binding site. the activity of tumor - suppressor gene p21 (waf1/sdi1/cip1) is being repressed through the activation of c - jun by the hpv e5 protein, which promotes cell proliferation. suppression of p21 gene by hpv e5 activates the cdk4-cyclin d complexes, which in turn phosphorylates prb and inactivates prb checkpoint control leading to uncontrolled cell replication (figure 4). the fact that the egfrs are often upregulated in the lung tumor tissues highlights the possibility of the e5 protein playing a role in the early stages of the transformation process. on the contrary, crusius. reported that the hpv 16 e5 protein modulates the stress - dependent activation of erk1/2 and p38 map kinase activation in human keratinocytes by an egf - independent mechanism. no studies are reported yet, indicating the presence of hpv e5 protein in the lung tumor tissues. studies towards this aspect would probably suggest new vaccine candidates or therapeutic targets against hpv - induced lung cancer. estrogen contributes to a large extent to the onset of hpv infection and tumor progression. though the presence of estrogen receptors (ers) in human lung tissue has been controversial for many years, it has been proved beyond doubt that some forms of both er and er are indeed present in normal lung cells as well as in lung tumors, which are undeniably functional, as evidenced by the estrogen - induced cell proliferation in the lung in vitro as well as in vivo ; activation of transcription from estrogen response elements (ere) in lung cancer cells by estrogen and estrogen - stimulated secretion of a growth factor thought to be involved in lung tumorigenesis, collectively demonstrating that ers play a biological role in the lungs. aromatase, the enzyme involved in catalysing the biosynthesis of estrogen, is induced in cervical carcinomas favouring the increased expression of viral oncogenes e6 and e7. this is expressed in lung tissue also which catalyses the local production of estrogen from androgen and is suggested to be a predictive biomarker for the prognosis of nsclcs. this enhanced local site production of estrogen triggers the nongenomic mechanism of estrogen action, which rapidly activates egfr. the well - established crosstalk between er and egfr in head and neck cancers arbitrates this action which is further validated by the colocalised membrane er and egfr in the lung tumors. combined targeting of er and egfr in nsclc has been proved to enhance antiproliferative effects in the treatment of lung cancer. we strongly argue that this er - egfr crosstalk could occur in the lung tissue which can consequently favour hpv persistence and malignant transformation of the lung tissue (figure 5). furthermore, when this probable crosstalk fits in position, the increased vulnerability of female never smokers to develop hpv - induced lung cancer as well as the histologic affinity of hpv to nsclc is better explained. hypoxia - inducible factors (hifs) are heterodimeric transcription factors that respond to changes in available oxygen in the cellular environment, specifically, to decreases in oxygen, or hypoxia by promoting the transcription of several hypoxia inducible genes. hifs are frequently upregulated in solid tumors and are found to be expressed in three isoforms hif-1, hif-2, and hif-3 each with an and a subunit. estrogen can regulate the hif-1 expression through pi3k - akt pathway (figure 5). the oncogenic protein e7 of hpv props up hif-1-dependent transcription by blocking the interaction of hdacs with hif-1 in a manner dependent on the hdac binding domain of e7. hif-1 induces expression of the genes essential for adapting to hypoxia including those for erythropoietin, glucose transporters, glycolytic enzymes, and vascular endothelial growth factor (vegf), eliciting successful homeostatic regulation under hypoxic conditions. in cervical cancer, vegf upregulates egfr and downregulates igf - bp3, thus amplifying the cell proliferative activity of egfr (figure 5). this action of vegf seems to be mediated, directly through egfr or indirectly through hpv - e6 in the hpv - positive cancers. we strongly suspect this mechanism to be active in hpv - infected lung tissue which favours angiogenesis and metastasis. would the vaccines such as gardasil, cervarix, and so forth, directed towards the cervical cancer ensure protection against hpv - induced lung cancer too ? this would be a focal question of interest that needs to be addressed to combat the disease prophylactically. given that the hpv subtypes infecting and most of the molecular events occurring in the cervical cancer may be extended to hpv - induced lung cancer, these vaccines can presumed to be effective against lung cancer too. lung cancer in nonsmokers is molecularly different disease from that seen in the smoker population. mutation frequency as well as profile of the genes encoding egfr, p53 and k - ras is conspicuously dissimilar in smoking and nonsmoking groups. also, the hpv infection paves way to altering the signalling pathways leading to cancer. the fact that egfr has a crucial role in lung carcinogenesis makes it an admirable target for therapy. monoclonal antibodies targeted against egf receptors, small molecule tk inhibitors, and antisense oligonucleotides can reduce the activity of egfr thereby inactivating the mitogenic signalling pathways like ras / raf / mek and pi3k / akt / mtor pathway. one such anti - egfr monoclonal antibody being used is cetuximab, in combination with chemotherapeutic agents such as carboplatin and paclitaxel, when provided concurrently or sequentially gave positive results in clinical trials [5860 ]. other than these, matuzumab which is a human monoclonal antibody, along with chemotherapy and certain other multikinase inhibitors, can be used in the treatment of advanced non - small - cell lung cancer. tyrosine kinase inhibitors such as gefitinib interrupt the downstream signalling activated during the binding of ligands or mutational activation of egfr. combined targeting of estrogen receptor and egfr, using fulvestrant and gefitinib has proved to have enhanced antiproliferative effects in the in vivo studies. mek, a mitogenic signalling pathway protein activated as a result of k - ras mutations in hpv infection is another, suitable target for therapy. inhibitors of mammalian target of rapamycin (mtor), a protein kinase which regulates cell growth by regulating different cell processes : rapamycin and temsirolimus, gave partial response in patients with nsclc. from the reported studies and suspected crosstalks, we robustly argue egfr to be a core molecular hub in pathogenesis of hpv - induced lung cancer. it can be presumed that combination therapy targeting egfr and other molecules having crosstalk with egfr may be effective in treatment of the disease rather than a single target therapy. it is still not apparent whether hpv is a causal factor of lung cancer or whether it is just an opportunistic pathogen in the lung cancer tissue and the exact molecular mechanisms behind it. almost all of the signalling pathways having a role in lung cancer are found to be altered or blocked by human papilloma viral proteins initiating tumorigenesis. further evidence is mandatory to substantiate beyond doubt the causative role of hpv in the lung tissue tumorigenesis. moreover, the cofactors supplementing the hpv in the transformation processes are yet to be classified. studies directed towards these targets would give a clearer image of the disease which will eventually pave the way to designing new prophylactic or therapeutic strategies in combating the disease. | human papilloma virus (hpv), known to be an etiological agent for genital cancers, has been suggested also to be a possible contributory agent for lung cancer. alternatively, lung cancer, formerly considered to be solely a smoker 's disease, may now be more appropriately categorised into never smoker 's and smoker 's lung cancer. through this paper we attempt to bring forth the current knowledge regarding mechanisms of hpv gaining access into the lung tissue, various strategies involved in hpv - associated tumorigenesis in lung tissue. |
infective endocarditis (ie) is an infection of the cardiac valves or mural endocardium caused by bacteria and fungi producing a wide variety of systemic signs and symptoms through several mechanisms, including both sterile and infected emboli and various immunological phenomena. the modified dukes ' diagnostic criteria have been in use for case definition as definite or possible ie. despite recent advances in the field of cardiology and infectious disease medicine, culture - negative ie is also recognized as an important clinical entity. since in the indian scenario very few studies [4, 5 ] have been undertaken on the changing epidemiological aspects of ie in the last decade and with the emergence of new advancements in the diagnostic modalities, we aim to investigate the clinical, microbiological, and echocardiographic profile of patients of ie reporting to a north indian tertiary care hospital. the study was a cross - sectional, observational study including 44 patients provisionally diagnosed as infective endocarditis according to definition proposed by modified dukes ' criteria over a period of 24 months from october 2011 to september 2013 presenting in the medical emergency or outpatient visit of department of medicine, pgimer, dr. any patient presenting with signs or symptoms compatible with the diagnosis of ie as laid down in the guidelines for the diagnosis and antibiotic treatment of endocarditis in adults, a report of the working party of the british society for antimicrobial chemotherapy, 2012, associated with at risk cardiac valve lesions, was considered for clinical evaluation and thus investigated. any patient having documented treatment history of receiving antibiotics, oral or parenteral, within 710 days ' duration for their febrile illness, was excluded from the study. pregnant women and patients less than 12 years of age and those not willing to give consent for the study were also excluded. detailed clinical history with past history of previous episodes of endocarditis, rheumatic heart disease (rhd), and previous treatment history was especially sought. meticulous thorough physical examination was conducted with special emphasis on cardiac examination, any stigmata of ie, and its complication whatsoever. investigations included a complete hemogram, routine serum chemistry profile (table 2), a 12-lead electrocardiogram, chest x - ray pa view, urinalysis, screening for hiv, and serological tests for rheumatoid factor (rf), ana, c - reactive protein (crp), and aso. special investigation included microbiological analysis consisting of at least three sets of blood cultures, each drawn at least one hour apart from three different venipuncture sites, for aerobic media (bact / alert) and fungal subcultures in sabouraud 's dextrose agar. bact / alert pf culture bottles were used with the bact / alert microbial detection system in qualitative procedures for enhanced recovery and detection of aerobic and facultative anaerobic microorganisms (bacteria and yeast) from blood. all patients underwent a comprehensive transthoracic 2d - echocardiographic (tte) analysis including two - dimensional, doppler, and m - mode imaging on philips hd11xe analyser with standardised view, by a single echocardiographer to minimise interobserver bias. the entire study was performed with special consideration to the anatomy and pathology of heart valves and intracardiac shunts, site, and number of vegetations, if any, size of the largest vegetation, nature of the valve vegetation along with special reference to left ventricular ejection fraction, any regional wall motion abnormalities, and abscesses or perforation sited at the involved valves and/or subvalvular apparatus, if any. in case of ambiguity or vegetations not properly visualized, it was further confirmed and corroborated with a transesophageal echocardiography (tee) on philips aw 21110a. in this study, a total of 44 patients in the age range of 14 to 61 years with the diagnosis of definite ie as per modified dukes ' criteria were analysed. however, the exact incidence of ie could not be calculated as population at risk was not defined. the mean age of patients was 31 years and male patients were more commonly encountered with a male : female sex ratio of about 3.4 : 1. the mean duration of hospitalization was 24 days. majority of the patients were discharged after being conservatively treated for the episode of ie. four patients (9%) are warranted for surgical intervention due to ie complicating the existing valvular heart disease. analysis of major risk factors of the study patients revealed 64% having rhd, 23% having congenital heart disease (chd), and 9% being intravenous drug user (idu). however, all the cases were of native valve endocarditis. out of the 4 patients with history of being idu diagnosed with ie, all of them had tricuspid valve lesions and 2 patients had normal heart valves. two patients were found to have nosocomial ie (4.5%) : one due to placement of intravenous catheter for a prolonged period and the other due to a septic sequel of arthrotomy. eight patients among all (18%) had a previous history of episode of ie too. the study revealed 91% of the patients had fever as their chief complaints, majority of them being high grade with prolonged pyrexia (> 2 weeks ' duration). all of the patients complained of some degree of dyspnea and they were divided according to nyha grading : 50% presented with nyha grade iv dyspnea, 41% with grade iii, and the rest with grade ii. new onset palpitation at rest was complained by 77% patients and 45% reported a significant weight loss. general physical examination revealed 82% with pallor, 59% with clubbing, mostly grade ii / iii, 50% with pedal edema, and 14% with icterus. on clinical examination, 60% of the patients had tachycardia and 10 (23%) were in atrial fibrillation that was of new onset. examination of eyes and integuments revealed the following : subconjunctival hemorrhage in 6/44 (14% patients);optic disc hemorrhage in 9/44 (23% patients) and roth spot in 2/44 (4.5% patients) by fundoscopic examination;osler 's nodes in 2/44 (4.5% patients);janeway lesion in 9/44 (23% patients). subconjunctival hemorrhage in 6/44 (14% patients) ; optic disc hemorrhage in 9/44 (23% patients) and roth spot in 2/44 (4.5% patients) by fundoscopic examination ; osler 's nodes in 2/44 (4.5% patients) ; janeway lesion in 9/44 (23% patients). regarding clinical outcomes, 50% of the patients presented with overt congestive cardiac failure with evidence of pulmonary edema. eight patients (36%) had arf with corresponding biochemical evidence of uremia (table 3). thromboembolic phenomena as a result of embolisation of vegetations of ie were encountered in twelve patients (27%) : four of them had cerebral infarcts due to acute embolus resulting in hemiparesis, and remaining 8 patients had pulmonary embolism leading to infarcts and/or segmental collapse of lung parenchyma. incidentally, all the 12 patients had large vegetations (size more than 10 mm in its longest axis) ; the former patients have left sided endocarditis, and the latter had vegetation on the right sided chambers, either being an idu or having fungal etiology for ie. fifty - two percent of the patients were blood culture positive for an etiological agent (figure 1). gram - positive organisms were mainly the offending pathogen amounting to 70% of the cases. out of these staphylococcus aureus, coagulase negative staphylococcus (cons), streptococcus spp. the rest 17% were of fungal etiology : mostly candida spp. with one of very unusual isolations of alternaria, an uncommon pathogenic mould. drug sensitivity reports obtained from bacterial cultures revealed that 2 out of 3 s. aureus spp. and all cons spp. all the patients had elevated levels of c - reactive protein (crp) on diagnosis of ie, with 50% of them having quantitative estimation of > 32 mg / l and the rest had levels > 24 mg / l (normal reference range however, after treatment with antibiotic therapy repeat crp showed undetectable levels. due to immunologic interplay in sera in patients of ie, rheumatoid factor (rf) was tested and detected in 36% of the patients, without any evidence of active synovitis or periarticular swelling / effusion in individual patients. serum for hiv i&ii elisa test were non - reactive for all the patients ; but a false positive test was reported for hbsag in only one patient, as he had no detectable anti - hbcag antibody or hbv dna titres. vegetations in the cardiac structures or associated lesions, in each and every patient of ie, were either detected by transthoracic or confirmed by transesophageal echocardiography (figure 2). vegetations were localized on either damaged heart valves due to previous rheumatic activity or congenital cardiac lesions, and some were in normal structured cardiac valves with compromised function. among the patients with rhd (64%), most of them were found to be multivalvular and regurgitant lesions (table 4). mitral regurgitation (mr) was the most frequent valvular defect identified with incidence of 89% of all rhds, followed by aortic regurgitation (ar), 68%, and tricuspid regurgitation (tr), 57%. stenotic lesions that were also encountered were mitral stenosis (ms), 28%, and aortic stenosis (as), 7%. mitral valve prolapse (mvp) was seen in 14% of the patients. among patients of ie with chd comprising 23% of the study population, ventricular septal defect (vsd) was the predominant lesion (80%), associated with functional tricuspid regurgitation (figure 3). we also had 2 patients of bicuspid aortic valve (bav) disease (20%) associated with as and ar. left ventricular ejection fraction (lvef) being a reliable indicator of normal contractility of the heart was measured in each patient but only 14% of them recorded a decline of lvef to less than 50% within the study population. statistical analysis using chi - square test and fischer 's exact t - test analysis were calculated and significance was obtained when p value 15 days) (p = 0.001) and also manifested significant pallor (p = 0.005) and concomitant hematuria (p = 0.006), proteinuria (p = 0.004), and large vegetation size (p = 0.014). patients presenting with acute renal failure as a complication of ie too had more hematuria (p = 0.012) and proteinuria (p = 0.001) and were with culture positive endocarditis with persistent bacteremia (p = 0.036). embolic phenomena due to dislodgement of vegetation microthrombi were more associated with those patients who presented with evidence of prolonged pyrexia (p = 0.043), proteinuria (p = 0.027), positive reaction for rf (p = 0.04), large vegetation on echocardiography (p = 0.007), and risk factors for ie other than rhd (p = 0.013). analysis of echocardiographic findings revealed that the size of vegetation was directly proportionate to the duration of fever (p = 0.03) and positive reaction for rf (p = 0.02). patients with rheumatic heart disease had relatively smaller vegetations than other risk factors (p = 0.05). similarly, patients with right sided endocarditis had a relatively prolonged history of fever (p = 0.01) and most of them were associated with pallor (p = 0.037) relative to left sided endocarditis. patients with right sided vegetations were frequently associated with congenital heart disease or normal valve with h / o being idu (p = 0.001) and those with left sided vegetation in majority presented with atrial fibrillation (p = 0.009). multivariate regression analysis on the clinical variables, however, showed that patients presenting with heart failure had significant hematuria (p < 0.05), and those with acute renal failure had significant proteinuria (p = 0.03), rheumatoid factor positive (p = 0.021), and iron deficiency (p = 0.018) ; large vegetations on echocardiography had longer duration of fever (p = 0.025), and right sided lesions had significant hematuria (p = 0.036), proteinuria (p = 0.019), and larger vegetation size (p = 0.02) (table 6). ie remains to be an uncommon disease with sporadic incidence, yet a serious entity in modern medicine, as its diagnosis requires a high degree of suspicion and treatment involves a holistic approach. although there has been a notion that the incidence of ie has increased in recent years, contemporary population - based data have been lacking to support this opinion. only a few studies involving profile of patients with ie were reported in the last decade in the region of northern india [5, 9, 10 ]. in the present study, the mean age of patients was 31 years and male patients were more commonly encountered with a male : female sex ratio of about 3.4 : 1. this is comparable to other indian studies done by kothari., 2005, garg., 2005, subramanian., 2010, and math., 2011, where the mean age was computed as 34 years, 27 years, 29 years, and 23.5 years, respectively however, this is by far a contradistinction to the studies published in the west and the developed nations where the incidence of ie is higher among the age group of 5th to 6th decade of life. this is attributed to the fact that in indian scenario, rhd is still the most prevalent risk factor for ie which makes the younger population vulnerable to infection of the diseased heart valves. moreover, the incidence of untreated or undiagnosed chd idu in the young is also a major factor. as in recent studies from abroad, done by weinberger., implicating mitral valve prolapse [12, 13 ] as an important underlying cardiac valve lesion, our study only had 4 patients (9%) associated with ie. we encountered only native valve endocarditis in our study population, which may be due to the fact that either postoperative prosthetic valve patients followed a strict follow - up with adequate medical care or patients with predisposing cardiac conditions were previously unaware of or lack surgical prosthetic management in this region. four patients with history of being idu (9%) were diagnosed with ie (figure 4), the incidence of which is as previously studied by miro.. regarding the physical examination, pallor was the commonest sign (82%) ; however anemia was evident in only 68% patients. patients with iron deficiency state, determined by serum iron concentration and transferrin saturation, were almost comparable with those having anemia. however, microcytosis constituted half of the population with anemia indicating severe iron deficiency state only, due to previous poor nutritional state probably. incidentally, multivariate regression analysis has shown significant association of iron deficiency in patients with history of prolonged duration of fever. thus, the relation of anemia of chronic inflammation with iron deficiency state in ie patients invites further study. icterus was present in 8 patients, mainly due to sepsis (4 patients), congestive heart failure (2 patients), or both (2 patients). the other clinical signs obtained were similar to the frequency distribution of population studied by identical series [5, 10 ]. while comparing the culture positivity of cases of ie, it is found that definitive microbial etiology is underreported in indian studies compared to the western literature, as culture positivity was reported as 23%, 41%, and 67% by subramanian., math., and garg., respectively ; however, the european heart survey reported that 86% of their patients were with culture positive endocarditis. blood culture negative endocarditis (bcne) cases are now less prevalent nowadays, since a myriad of fastidious organisms are identified with the help of serological and molecular diagnostic advancements like the brucella, bartonella, coxiella, tropheryma, legionella, mycoplasma, and so forth. few case reports and a recent prospective study on large number of bcne cases highlight the zoonotic link of ie with the causative organism [17, 18 ]. incidentally, in our study we had 48% bcne cases, relying on standard culture techniques ; but majority of the patients with bcne (12 of 21) epidemiologically were either housewives or farmers by occupation highlighting their agrarian background in indian setup. a mixed bag of opinion is available regarding the etiological agents for ie, while reviewing previously established studies globally, on temporal trends of the disease. referring to the indian studies, garg. 2005 documented higher prevalence of streptococcus (23%) for the most frequent etiological agent. 2011 reported an equal incidence of staphylococcus and streptococcus etiology with gram - positive organisms predominating. 2010 reiterated the importance of streptococcus viridians reporting an incidence of 55% among all culture positive growths. in studies from abroad, a 10-year multicentric study in us by bor., 19992008, reported incidence of staphylococcus and streptococcus in cultures to be 28% and 24%, respectively. (40%) than streptococcal family (29%) in 2010. a 5-year prospective study in olmsted county, 2010, reported an equal prevalence of either organisms, 12% each, with a significant increase in frequency of coagulase negative staphylococcus epidemiology, 8%. similar results of equal incidence of the two gram - positive cocci were reported by fedeli. in 2011 in a record linkage analysis data of 1863 patients of ie. in an international collaborative prospective cohort study in over 25 countries, murdoch. showed the emerging significance of staphylococcus as the predominant organism for ie, except in south america where streptococcus etiology due to higher prevalence of rhd was found and significant proportion of cases due to fastidious organisms reported from european countries. castillo., too, reported a significant increase in causal epidemiology for staphylococcus etiology in 2011. in contradistinction a maintained higher incidence of streptococcus bacteremia in ie was established by gotsman. in this study, although rhd proved to be a major cardiac substrate at risk, staphylococcal cultures were the majority etiology, reiterating the paradigm shift of causative pathogen involving ie. drug sensitivity reports obtained from bacterial cultures revealed a uniform susceptibility of almost all organisms to vancomycin, which is still considered a potent bactericidal agent in cases of enterobacteriaceae family and methicillin resistant staphylococcus aureus (mrsa) bacteremia. in the present study, rhd has been found to be the predominant cardiac condition among the risk factors for ie (64%) followed by chd in adults which is almost one - third of the incidence (23%). among similar indian series elaborating on the predisposing factors for ie, choudhury. reported an incidence of 42% rhd and 33% chd in his study, garg. this nonuniformity most probably depicts the heterogeneity of the risk factors and presenting population of ie pertaining to their region of study. incidentally, the prevalence of rhd in india, as documented by various population - based studies in the recent decade, is 5.89.7/1000 population [28, 29 ], which arguably is one of the highest in the world. concurrently, the presence of uncorrected chd in children less than 15 years in india has been speculated in few studies as 4.2/1000 population, but no systematic data on prevalence among adults was available. left sided endocarditis predominated in our study (66%) due to higher prevalence of rhd as a major risk factor and mitral and aortic valves being more vulnerable to deforming effect of rheumatic activity. vegetations found in the right sided chambers of the heart (33%) were most commonly associated with chd, that is, vsd involving the right ventricular aspect of septal defect forming the low pressure zone and the associated septal cusp of tricuspid leaflet ; and the rest one - third were cases of being idu where vegetations were seen implanted on tricuspid leaflets of anatomical normal tricuspid valve resulting in functional regurgitation. however, the various valve apparatus and perivalvular complications that were evidenced in routine echocardiography, like valve leaflet prolapse or perforation, chordal rupture, or annular abscess, were all associated with left sided chamber endocarditis. seventy - six percent of all vegetations were primarily detected by transthoracic echocardiography (tte). most of the vegetations diagnosed on tte were large sized and importantly all right sided endocarditis were detectable with the help of tte. the rest were diagnosed on transesophageal echocardiography (tee) ; remarkably all of them were left sided endocarditis : located on either anterior or posterior mitral leaflet or tip or right coronary cusp of aortic valve, that is, the structures which are located more posteriorly in relation to precordium (figure 2). this confers with the better degree of sensitivity (76100%) and specificity (94%) of tee over tte (65% and 76%, resp.) for identifying vegetations and perivalvular complication in both adults and children [31, 32 ]. according to the recommendations, tte is considered the first - line diagnostic modality in suspected ie ; however tee should always be sought in cases of highly suspicious ie where tte is normal. vegetation size was also accurately recorded in each and every patient and a size of more than or equal to 10 mm in its longest axis was considered large vegetation. size of vegetation did bear a significant prognosis in all patients of ie as previously studied by gotsman., 2007, influencing the clinical outcome of the patients and as a measure of response to treatment and need for surgical intervention. incidentally in our study, patients with large sized vegetation had longer duration of fever at presentation, increased incidence of heart failure, and embolic phenomena and were directly proportionate to rf positivity. similarly patients with congenital cardiac lesions or idu patients with normal valves had larger vegetations than their rhd counterparts. surgical opinion was sought in all the cases of ie studied but only 4 patients (all with rhd with preexisting valvular deformity with clinical deterioration) could be operated on. though surgical indication was present in other patients, it was not feasible due to either lack of consent for operative procedure or economic constraints of the patients ' part. there was no mortality in those managed surgically and who had a better outcome as also reported by gupta. patients with cardiogenic shock were advised to continue inotropic support in order to stabilise preoperatively, but two of them succumbed within a couple of days ' admission. during statistical computation using multivariate regression analysis, this invites consideration which was possibility of cardiorenal syndrome as there was also significant proteinuria associated, but systemic renal embolism can be ruled out in cases of vegetations involving right sided chambers. patients developing acute renal failure were frequently found to be rf positive and iron deficient, the significance of which is undetermined and needs further deliberation. in contrast, large sized vegetation had expectedly significant longer history of fever at presentation but was localised commonly on the right side, which differs from previous reports [35, 36 ]. the following were the limitations of this study.all patients diagnosed as ie were included in the study, irrespective of the status of primary or referral case.pediatric age group < 12 years was excluded thus affecting the predisposing patients at risk due to chd lesions.not a single case of endocarditis of prosthetic valve was obtained in the study.latest and sophisticated serological investigations for identification of fastidious organisms could not be included. all patients diagnosed as ie were included in the study, irrespective of the status of primary or referral case. pediatric age group < 12 years was excluded thus affecting the predisposing patients at risk due to chd lesions. infective endocarditis remains a constant source of menace in medical practice, with associated morbidity and mortality. rhd continues to be the commonest risk factor for ie due to increased predisposition of deformed malfunctioning heart valves in rhd. younger age group is predominantly seen to be predisposed with mean age group in thirties. fever, dyspnea, and palpitation are the commonest symptom, and pallor, clubbing, presence of regurgitant murmur, and evidence of heart failure were the frequent signs encountered. vegetations are considered the cardinal lesion in echocardiography associated with its complications with tee faring slightly better than tte in detection of lesions. rheumatic mitral regurgitation was the commonest valvular lesion, with anterior mitral leaflet being the commonly occurring site of localizing of vegetation. size of the vegetations appears to be an independent factor for risk of embolic phenomena in patients suffering from ie. blood cultures grown are positive in only half of the cases, with staphylococcus aureus and coagulase negative staphylococcus being obtained in a majority of them. vancomycin still emerges as a dependent antibiotic susceptible to the varied bacterial flora grown on blood culture and sensitivity testing. rheumatoid factor proves to be an important surrogate marker for underlying immunological phenomena due to persistent bacteremia. | infective endocarditis, a great masquerader, is a clinical entity which may present with a myriad of manifestations. its changing epidemiological profile has been studied in the previous decades in both the developed and the developing nations. in this study, we strived to uphold the evolving clinical profile and its outcome from a government tertiary care hospital in northern india. it was a descriptive, cross - sectional, observational study conducted over two years ' period involving 44 patients diagnosed with definite infective endocarditis, according to modified dukes ' criteria. demographic, clinical, microbiological, and echocardiographic data were analysed. mean age of patients was 31 years. rheumatic heart disease with regurgitant lesions was the commonest risk factor. dyspnea and fever were the predominant symptom, and pallor and heart failure the commonest sign. cultures were positive in 52% with staphylococcus, the major isolate. transesophageal echocardiography fared better than transthoracic one to define the vegetations. mortality is reported in 4.5%. prolonged duration of fever, pallor, hematuria, proteinuria, rheumatoid factor positivity, and large vegetations proved to be poor prognostic variables. culture positive endocarditis, with persistent bacteremia, had higher incidence of acute renal failure. right sided endocarditis was frequent in congenital lesions or iv drug user, whereas left sided endocarditis mostly presented with atrial fibrillation. |
nod - rag1 il2r (nrg) (14), nod - rag1 prf1 ins2 (10), and nod - scid il2r (nsg) (15) mice have previously been described. to generate nrg - akita mice, nod.cg-rag1 additional crosses fixed the wild - type prf1 allele and the il2r mutation to homozygosity while maintaining the ins2 mutation in the heterozygous state. mice were housed in a specific pathogen - free facility in microisolator cages (15). all animal use was in accordance with the guidelines of the iacucs of the university of massachusetts and the jackson laboratory. anti - human foxp3 (ebioscience, san diego, ca), anti - human cd123 and bdca2 (miltenyi biotec, bergisch gladbach, germany), anti - human cd11c (biolegend, san diego, ca), and anti - human cd235a (coulter immunotech, miami, fl) were obtained as indicated. bone marrow, spleen, and thymus cell suspensions and heparinized blood were incubated with anti - mouse fcr11b to block fc binding (14,19). cells were prepared for flow cytometry, and at least 50,000 events were acquired on bd biosciences lsrii or facscalibur instruments (bd biosciences) (14,15,20). data analysis was performed with flowjo (tree star, ashland, or) software. handpicked balb / c islets (21) were also dissociated into single - cell suspensions (22). dissociated islet cell suspensions were treated with cytofix / cytoperm (bd biosciences) for intracellular staining using a biotinylated anti - insulin antibody and developed with streptavidin - allophycocyanin (sa - apc). dissociated preparations contained a mean sd of 62 19% (n = 10) insulin - positive cells. islets or dissociated cells were transplanted intrapancreatically or subrenally into stz diabetic nsg mice (150 mg / kg) or unmanipulated diabetic nrg - akita recipients. human islets were obtained from juvenile diabetes research foundation islet isolation centers or the national institutes of health integrated islet distribution program. human islets (ieqs) (4,000) were transplanted subrenally into diabetic nsg or nrg - akita mice. loss of graft function was determined by two consecutive blood glucose values > 250 mg / dl. nrg mice or progeny of nrg nrg - akita matings (50% heterozygous for ins2) 13 days old were irradiated with 400 cgy and engrafted with umbilical cord blood. hscs were provided by the university of massachusetts memorial umbilical cord blood donation program under insitutional review board approval (14,20). pancreata and islet transplants were stained with hemotoxlin - eosin (h - e) and for insulin, glucagon, and human cd45 (16). unilateral nephrectomy of the graft - bearing kidney was performed on selected cohorts to confirm recurrent hyperglycemia. in some cases, most data are presented as means sd, and flow cytometry data are presented as means sem. parametric data were compared by one - way anova with bonferroni posttests to compare individual pairwise groupings. nonparametric data were compared by a kruskal - wallis with dunns posttest to compare individual pairwise groupings. all statistical analyses were performed using graphpad prism software (version 4.0c ; graphpad, san diego, ca). anti - human foxp3 (ebioscience, san diego, ca), anti - human cd123 and bdca2 (miltenyi biotec, bergisch gladbach, germany), anti - human cd11c (biolegend, san diego, ca), and anti - human cd235a (coulter immunotech, miami, fl) were obtained as indicated. bone marrow, spleen, and thymus cell suspensions and heparinized blood were incubated with anti - mouse fcr11b to block fc binding (14,19). cells were prepared for flow cytometry, and at least 50,000 events were acquired on bd biosciences lsrii or facscalibur instruments (bd biosciences) (14,15,20). data analysis was performed with flowjo (tree star, ashland, or) software. handpicked balb / c islets (21) were also dissociated into single - cell suspensions (22). dissociated islet cell suspensions were treated with cytofix / cytoperm (bd biosciences) for intracellular staining using a biotinylated anti - insulin antibody and developed with streptavidin - allophycocyanin (sa - apc). dissociated preparations contained a mean sd of 62 19% (n = 10) insulin - positive cells. islets or dissociated cells were transplanted intrapancreatically or subrenally into stz diabetic nsg mice (150 mg / kg) or unmanipulated diabetic nrg - akita recipients. human islets were obtained from juvenile diabetes research foundation islet isolation centers or the national institutes of health integrated islet distribution program. human islets (ieqs) (4,000) were transplanted subrenally into diabetic nsg or nrg - akita mice. loss of graft function was determined by two consecutive blood glucose values > 250 mg / dl. nrg mice or progeny of nrg nrg - akita matings (50% heterozygous for ins2) 13 days old were irradiated with 400 cgy and engrafted with umbilical cord blood. hscs were provided by the university of massachusetts memorial umbilical cord blood donation program under insitutional review board approval (14,20). pancreata and islet transplants were stained with hemotoxlin - eosin (h - e) and for insulin, glucagon, and human cd45 (16). unilateral nephrectomy of the graft - bearing kidney was performed on selected cohorts to confirm recurrent hyperglycemia. in some cases, most data are presented as means sd, and flow cytometry data are presented as means sem. parametric data were compared by one - way anova with bonferroni posttests to compare individual pairwise groupings. nonparametric data were compared by a kruskal - wallis with dunns posttest to compare individual pairwise groupings. significant differences were assumed for p values 200 days with blood glucose monitored at the days of age indicated as described in research design and methods. pancreata from male (b) and female (d) nrg - akita and nod - rag1 il2r littermate control mice at the indicated ages were stained with h - e and immunohistochemically for insulin and glucagon. young and older control nrg (+ /+) mice and young nrg - akita (+ /akita) mice displayed normal architecture and histochemical structure with insulin - positive cells throughout the islets and a peripheral rim of glucagon - positive cells. older nrg - akita mice displayed collapsed islet structure with fewer insulin - positive -cells and numerous glucagon positive cells scattered throughout the islets. blood glucose levels of the mice at the time of recovery of the pancreas are shown at the bottom of each panel. (a high - quality digital representation of this figure is available in the online issue.) normal islet architecture and insulin and glucagon staining were observed in the pancreata of nrg mice at all ages (fig. the pancreata of nrg - akita mice were only slightly disorganized and strong insulin staining was observed. by 32 weeks of age in hyperglycemic nrg - akita mice, subrenal transplantation of 20 mouse islets / g body wt into hyperglycemic nrg - akita mice restored normoglycemia (fig. islet graft recipients remained normoglycemic to the end of observation periods or, in selected cases, reverted to hyperglycemia following removal of the graft - bearing kidney (data not shown). diabetic nrg - akita mice were transplanted in the renal subcapsular space with 4,000 ieq human islets or with 20 islets / g body wt mouse islets as described in research design and methods. blood glucose levels were determined, and the kidney bearing the islet transplant and the host pancreas were recovered at the end of the experiment for histological and immunohistological analyses. a : h - e, insulin, and glucagon staining of transplanted mouse (left panel) and human (right panel) islets and host pancreas of the nrg - akita transplant recipient at the times indicated after islet transplantation. in the renal subcapsular space, there was robust engraftment of mouse and human islets. small vertical bars indicate censored data, i.e., mice that were found dead or were removed from the study for other analyses. (a high - quality digital representation of this figure is available in the online issue.) transplantation of 4,000 ieq human islets into the subrenal capsular space routinely restored euglycemia in nrg - akita mice (fig. these islets remained functional throughout the observation periods in some cases over 300 days. graft survival was confirmed by histology or by removal of the graft - bearing kidney and reversion to hyperglycemia (data not shown). intrapancreatic transplantation of 20 islets / g body wt into stz diabetic nsg mice failed to restore normoglycemia, whereas 40 islets / g body wt restored normoglycemia in two of seven recipients (supplemental fig. using dissociated islet cells, more than 5 10 insulin - positive -cells was required for restoration of normoglycemia following subrenal transplantation in diabetic nsg mice (supplemental fig. 1). in diabetic nrg - akita mice, intrapancreatic transplantation of 40 mouse islets / g body wt restored normoglycemia in three of four nrg - akita mice, whereas 20 islets / g body wt restored normoglycemia in only one of three nrg - akita recipients (supplemental fig. this is in contrast to restoration of normoglycemia in diabetic nrg - akita recipients following subrenal transplantation of 20 mouse islets / g body wt (fig. intrapancreatic transplantation of dissociated mouse islet cells containing 14 10 insulin - positive -cells restored euglycemia in only one of five diabetic nrg - akita recipients (supplemental fig. only two of six hyperglycemic nrg - akita mice became euglycemic after subrenal transplantation with 14 10 dissociated mouse islet cells (supplemental fig. these data document 1) that dissociated mouse islets can restore normoglycemia in diabetic nsg and nrg - akita mice and 2) that fewer insulin - positive cells are required for restoration of normoglycemia following subrenal compared with intrapancreatic transplantation. we have shown that nrg mice engraft with human hsc at levels similar to those observed in nsg mice (14), but the effect of chronic hyperglycemia on the development of a human immune system is unknown. twelve weeks later, hyperglycemia was confirmed in nrg - akita mice (data not shown). similar percentages of splenic human cd45 cells and all human cell subsets were observed in hyperglycemic nrg - akita acompared with euglycemic nrg mice (table 1). comparable levels of human cd45 and human cell subsets were also observed in the bone marrow, blood, and thymus of hyperglycemic nrg - akita and euglycemic nrg mice (supplemental tables 24). these data document that the human immune systems that develop in hyperglycemic nrg - akita mice appear phenotypically comparable with those developing in normoglycemic nrg mice. human hsc engraftment in the spleen of nrg and nrg - akita mice newborn nrg and nrg - akita mice were irradiated with 400 cgy and injected with t cell depleted umbilical cord blood (ucb) containing 3 10 human cd34 hscs by intracardiac injection as described in research design and methods. the percent of various human cell populations in the spleen was determined by flow cytometry 12 weeks later. eight of nine human islet recipients of 4,000 ieq restored normoglycemia (200 days with blood glucose monitored at the days of age indicated as described in research design and methods. pancreata from male (b) and female (d) nrg - akita and nod - rag1 il2r littermate control mice at the indicated ages were stained with h - e and immunohistochemically for insulin and glucagon. young and older control nrg (+ /+) mice and young nrg - akita (+ /akita) mice displayed normal architecture and histochemical structure with insulin - positive cells throughout the islets and a peripheral rim of glucagon - positive cells. older nrg - akita mice displayed collapsed islet structure with fewer insulin - positive -cells and numerous glucagon positive cells scattered throughout the islets. blood glucose levels of the mice at the time of recovery of the pancreas are shown at the bottom of each panel. (a high - quality digital representation of this figure is available in the online issue.) normal islet architecture and insulin and glucagon staining were observed in the pancreata of nrg mice at all ages (fig. the pancreata of nrg - akita mice were only slightly disorganized and strong insulin staining was observed. by 32 weeks of age in hyperglycemic nrg - akita mice, subrenal transplantation of 20 mouse islets / g body wt into hyperglycemic nrg - akita mice restored normoglycemia (fig. 2). islet graft recipients remained normoglycemic to the end of observation periods or, in selected cases, reverted to hyperglycemia following removal of the graft - bearing kidney (data not shown). diabetic nrg - akita mice were transplanted in the renal subcapsular space with 4,000 ieq human islets or with 20 islets / g body wt mouse islets as described in research design and methods. blood glucose levels were determined, and the kidney bearing the islet transplant and the host pancreas were recovered at the end of the experiment for histological and immunohistological analyses. a : h - e, insulin, and glucagon staining of transplanted mouse (left panel) and human (right panel) islets and host pancreas of the nrg - akita transplant recipient at the times indicated after islet transplantation. in the renal subcapsular space, there was robust engraftment of mouse and human islets. small vertical bars indicate censored data, i.e., mice that were found dead or were removed from the study for other analyses. (a high - quality digital representation of this figure is available in the online issue.) transplantation of 4,000 ieq human islets into the subrenal capsular space routinely restored euglycemia in nrg - akita mice (fig. 2). these islets remained functional throughout the observation periods in some cases over 300 days. graft survival was confirmed by histology or by removal of the graft - bearing kidney and reversion to hyperglycemia (data not shown). intrapancreatic transplantation of 20 islets / g body wt into stz diabetic nsg mice failed to restore normoglycemia, whereas 40 islets / g body wt restored normoglycemia in two of seven recipients (supplemental fig. 1). using dissociated islet cells, more than 5 10 insulin - positive -cells was required for restoration of normoglycemia following subrenal transplantation in diabetic nsg mice (supplemental fig. 1). in diabetic nrg - akita mice, intrapancreatic transplantation of 40 mouse islets / g body wt restored normoglycemia in three of four nrg - akita mice, whereas 20 islets / g body wt restored normoglycemia in only one of three nrg - akita recipients (supplemental fig. this is in contrast to restoration of normoglycemia in diabetic nrg - akita recipients following subrenal transplantation of 20 mouse islets / g body wt (fig. intrapancreatic transplantation of dissociated mouse islet cells containing 14 10 insulin - positive -cells restored euglycemia in only one of five diabetic nrg - akita recipients (supplemental fig. only two of six hyperglycemic nrg - akita mice became euglycemic after subrenal transplantation with 14 10 dissociated mouse islet cells (supplemental fig. these data document 1) that dissociated mouse islets can restore normoglycemia in diabetic nsg and nrg - akita mice and 2) that fewer insulin - positive cells are required for restoration of normoglycemia following subrenal compared with intrapancreatic transplantation. we have shown that nrg mice engraft with human hsc at levels similar to those observed in nsg mice (14), but the effect of chronic hyperglycemia on the development of a human immune system is unknown. twelve weeks later, hyperglycemia was confirmed in nrg - akita mice (data not shown). similar percentages of splenic human cd45 cells and all human cell subsets were observed in hyperglycemic nrg - akita acompared with euglycemic nrg mice (table 1). comparable levels of human cd45 and human cell subsets were also observed in the bone marrow, blood, and thymus of hyperglycemic nrg - akita and euglycemic nrg mice (supplemental tables 24). these data document that the human immune systems that develop in hyperglycemic nrg - akita mice appear phenotypically comparable with those developing in normoglycemic nrg mice. human hsc engraftment in the spleen of nrg and nrg - akita mice newborn nrg and nrg - akita mice were irradiated with 400 cgy and injected with t cell depleted umbilical cord blood (ucb) containing 3 10 human cd34 hscs by intracardiac injection as described in research design and methods. the percent of various human cell populations in the spleen was determined by flow cytometry 12 weeks later. eight of nine human islet recipients of 4,000 ieq restored normoglycemia (< 250 mg / dl) (fig. 3) in non hsc - engrafted diabetic nrg - akita mice. in contrast, eight of 13 human were rejected in hsc - engrafted nrg - akita mice (fig. insulin staining in the absence of mononuclear cell infiltration was detected in human in non hsc - engrafted nrg - akita mice (fig. 3). in the eight hsc - engrafted nrg - akita human islet recipients that reverted to hyperglycemia, human cd45 cell infiltration into the graft site and loss of -cells were observed. in the five hsc - engrafted nrg - akita mice that did not revert to hyperglycemia, insulin - positive cells and human cd45 cell islet infiltration transplantation of human into diabetic nrg - akita mice engrafted with human hsc. diabetic nrg - akita and hsc - engrafted nrg - akita mice were transplanted subrenally with 4,000 human ieq as described in research design and methods. a : frequency of diabetes in recipients. b : representative histology and immunochemical staining patterns are shown. note the abundance of insulin - positive cells and the absence of human cd45-positive cells in non hsc engrafted nrg - akita mice (left panel). note the presence of fewer insulin - positive cells and islet graft infiltration by human cd45 cells in hsc - engrafted nrg - akita mice that were normoglycemic at the end of the experiment (middle panel). note the scarcity of insulin - positive cells and moderate numbers of human cd45 cells in hsc - engrafted nrg akita mice that were hyperglycemic at the end of the experiment and had rejected their human (right panel). (a high - quality digital representation of this figure is available in the online issue.) we have previously described the development of spontaneously diabetic nod - rag1 prf1 ins2 mice (10), but nod - rag1 prf1 mice engraft poorly with human immune systems (23). to address this limitation, we generated nrg - akita mice that spontaneously develop hyperglycemia. euglycemia can be restored following transplantation with mouse or human islets or with dissociated mouse islet cells. even in the presence of a state of chronic hyperglycemia, a human immune system develops following engraftment with human hscs that is capable of rejecting human in some of the transplanted mice. unmanipulated nrg - akita mice maintain a phenotype consistent with a severely immunodeficient mouse bearing il2r and ins2 mutated genes. both male and female mice develop hyperglycemia between 3 and 5 weeks of age, and islets progressively lose insulin - positive cells with age. however, small numbers of insulin - positive cells remain throughout life, perhaps explaining why administration of exogenous insulin is not required for long - term survival. we confirmed that transplantation of mouse or human islets restores euglycemia in diabetic nrg - akita and nsg mice. higher numbers of islets were required following intrapancreatic implantation than were needed following subrenal transplantation to restore euglycemia. our data also suggest that single - cell suspensions of insulin - producing cells may be less functional than comparable numbers contained within an islet structure. we confirmed that a human immune system develops in diabetic nrg - akita mice engrafted with human hscs, and this immune system is phenotypically comparable with that generated in euglycemic nrg mice. however, only 60% of human immune system engrafted nrg - akita mice rejected human. in separate studies, hsc - engrafted nsg mice readily reject human skin allografts (m.a.b., unpublished observations), but it is known that skin allografts prompt a more robust alloimmune response than do (24,25). alternatively, the human immune system may be impaired as a result of the hyperglycemic environment or we may not have allowed sufficient time for graft rejection. in summary, we have developed a new model of spontaneous hyperglycemia based on immunodeficient nod mice bearing mutations in the il2r gene and the ins2 gene. nrg - akita mice can be engrafted with a human immune system, providing a recipient environment similar to that which will be encountered when transplanting allogeneic -cells in the clinic. these mice provide a novel model system suitable for validation of the function of stem cell derived human -cells in the absence or presence of an alloreactive human immune system. | objectiveto create an immunodeficient mouse model that spontaneously develops hyperglycemia to serve as a diabetic host for human islets and stem cell derived -cells in the absence or presence of a functional human immune system.research design and methodswe backcrossed the ins2akita mutation onto the nod - rag1null il2rnull strain and determined 1) the spontaneous development of hyperglycemia, 2) the ability of human islets, mouse islets, and dissociated mouse islet cells to restore euglycemia, 3) the generation of a human immune system following engraftment of human hematopoietic stem cells, and 4) the ability of the humanized mice to reject human.resultswe confirmed the defects in innate and adaptive immunity and the spontaneous development of hyperglycemia conferred by the il2rnull, rag1null, and ins2akita genes in nod - rag1null il2rnull ins2akita (nrg - akita) mice. mouse and human islets restored nrg - akita mice to normoglycemia. insulin - positive cells in dissociated mouse islets, required to restore euglycemia in chemically diabetic nod - scid il2rnull and spontaneously diabetic nrg - akita mice, were quantified following transplantation via the intrapancreatic and subrenal routes. engraftment of human hematopoietic stem cells in newborn nrg - akita and nrg mice resulted in equivalent human immune system development in a normoglycemic or chronically hyperglycemic environment, with > 50% of engrafted nrg - akita mice capable of rejecting human.conclusionsnrg-akita mice provide a model system for validation of the function of human islets and human adult stem cell, embryonic stem cell, or induced pluripotent stem cell derived -cells in the absence or presence of an alloreactive human immune system. |
the term antiphospholipid antibody syndrome (aps) was first coined to denote the clinical association between antiphospholipid antibodies and a syndrome of hypercoagulability.1,2 aps is an autoimmune disease characterized by the presence of thromboembolic complications and/or pregnancy morbidity in the presence of persistently increased titers of antiphospholipid antibodies.3 the most commonly detected subgroups of antiphospholipid antibodies are lupus anticoagulant, anticardiolipin, and anti - beta-2-glycoprotein 1 antibodies. classification of the antibodies into these groups is based on the biochemical method of detection. the biological function of these antibodies, although not well elucidated, is thought to act as a natural anticoagulant.4 despite their name, lupus anticoagulant antibodies are associated with thromboembolic events rather than clinical bleeding. phospholipid surfaces inhibit procoagulant pathways and therefore prolong clotting ; in vivo, meanwhile, the microenvironment of cell membranes promotes greater inhibition of anticoagulant pathways and thus also thrombosis.5 although the pathogenesis of aps is poorly understood, many mechanisms have been postulated, including the binding of antiphospholipid antibodies to endothelial cells, which stimulates an upregulation of adhesion molecules, increasing leucocyte adhesion6 and creating a prothrombotic state.7 clinically, aps can be very diverse and can occur in a variety of disease states, rendering diagnosis and treatment challenging, especially in resource - limited settings. the authors therefore present the case of a 43-year - old man with multiple thrombotic events and the presence of antiphospholipid antibodies, which, to the best of the authors knowledge, is the first time this has been reported in cameroonians. a 43-year - old man presented with a history of fatigue, abdominal pain and discomfort, constipation, nausea, and vomiting of insidious onset over a 1-month period. a diagnosis of subacute intestinal obstruction was made and the patient was conservatively managed with regression of all other symptoms except abdominal pains, for which he was referred to the authors for further reassessment. the patient s family history was unremarkable, but his personal history showed that 6 years earlier he had undergone an intestinal resection with end - to - end anastomosis of his small intestine, indicated for infarction and gangrene of two - thirds of his small intestine (figure 1). at that time, intestinal gangrene and infarction were thought to be secondary to mesenteric venous thrombosis, because onset was sudden and there was hemorrhagic infarction of the involved intestinal segment. postoperative recovery was uneventful and the patient was lost to follow - up until the onset of the recent symptoms for which he was referred. it is worth noting that the patient had never smoked and had drunk alcohol sparingly. on clinical examination a complete blood count revealed leukocytosis at 12,300/l, predominantly with neutrophils ; a hemoglobin level of 12 g / dl ; and a normal platelet count. the patient s prothrombin time (pt) was 62%, with a prolonged kaolin - cephalin clotting time (kct) of 41.5 seconds (control, 36 seconds) ; his blood sugar, blood urea nitrogen, and creatinine levels were all within normal limits. an abdominal computed tomography scan showed moderate dilatation of the inferior vena cava (ivc) with an intraluminal hypodensity consistent with venous thrombosis. the liver appeared hypodense compared with the spleen (figure 2), with dilated intrahepatic veins that did not appear opacified, even in enhanced images (figure 3), and there was homogenous splenomegaly. these findings were compatible with budd - chiari syndrome (bcs) secondary to ivc thrombosis. the patient was placed on a 10-day course of low - molecular - weight heparin, this in spite of the prolonged pt and kct. further anticoagulation was deemed risky because of the patient s irregularity in respect to follow - up appointments. he was therefore placed on low - dose aspirin and, as there was no local experience with transjugular intrahepatic portosystemic shunting, he was referred to a vascular surgeon in a hospital in yaound, about 150 miles from douala, for decompressive ivc surgery. because the cost of the surgery was prohibitive for the patient, he was lost to follow - up for a second time. the patient reappeared 2 months later with persistent abdominal pains, this time associated with distention of 2 weeks duration. on examination, the patient had lost a considerable amount of weight and had pale conjunctivae but no jaundice ; there was prominent thoracoabdominal collateral circulation, ascites, and splenomegaly that extended 10 cm below the left costal margin. investigations performed revealed a decrease in the patient s hemoglobin level to 9.6 g / dl, leucocytes at 7300/l, normal platelets at 241,000/l, an erythrocyte sedimentation rate of 20 mm in the first hour, a pt of 41.1%, an international normalized ratio of 1.69, a kct of 38.5 seconds (control, 30.2 seconds), normal total proteins of 71 g / l but decreased albumin at 28.4 g / l, and almost doubly raised transaminases (serum glutamic oxaloacetic transaminase [aspartate aminotransferase ] of 56 the results of hepatitis b surface antigen, anti hepatitis c virus, and human immunodeficiency virus serology were negative. the blood urea nitrogen and creatinine levels were within normal limits and the alpha - fetoprotein level was normal. grade 34 esophageal varices with red signs, portal hypertensive gastropathy, and congestive duodenitis were found on gastroscopy. the patient was placed on oral propranolol to prevent variceal bleeding and spironolactone to deplete his fluid overload. a comparative computed tomography scan showed persistent supra- and infrahepatic ivc thrombosis, splenomegaly, and this time massive ascites (figure 4). these findings of portal hypertension complicating hepatic venous thrombosis in a patient with prolonged kct and a past history of mesenteric venous thrombosis were suggestive of hypercoagulability. in addition, high titers of anticardiolipin antibodies at 52 units (normal range being, 12 units) (a test for immunoglobulin m anticardiolipin antibodies was negative) were consistent with aps. tests for proteins s and c were normal and a test for lupus anticoagulant antibodies was negative. six months later, the patient was admitted to hospital for hepatic encephalopathy ; this was managed favorably and he was discharged. four years on, the patient developed pain and swelling of the left supraclavicular region, with visible subcutaneous collateral veins in the shoulder area and upper anterior chest wall. doppler ultrasound studies of the patient s neck veins revealed findings consistent with thrombosis of the left axillary and subclavian veins. one year following this, the patient presented with sepsis and a gangrenous scrotum. this documented case of thrombosis of the mesenteric vein, inferior vena cava, and axillary and subclavian veins in the presence of antiphospholipid antibodies fulfills the sydney criteria for aps diagnosis, which stipulates cases require the presence of at least one of the clinical criteria (vascular thrombosis and/or pregnancy morbidity) and at least one of the laboratory criteria (detection of lupus anticoagulant, anticardiolipin, or anti - beta-2-glycoprotein 1 antibodies).3 although the complications associated with vascular thrombosis in the present patient were serious, they seemed to appear one at a time ; this is in clear contrast to catastrophic aps, where there are multiple simultaneous vascular occlusions and multiorgan involvement.1 the initial mesenteric vascular ischemia was due to acute venous thrombosis. chandra reported in 2002 a case of subacute intestinal obstruction resulting from ischemic stricture in the proximal small intestine. in hindsight, this is similar to how the patient in the present case presented prior to the overt portal hypertension. at the time, chandra case was the first reported case of aps presenting with noncirrhotic portal fibrosis and mesenteric venous thrombosis.8 in the presence of an underlying hypercoagulable state, portal hypertension, which results in stagnation of blood in the splanchnic venous bed, predisposes an individual to the development of venous thrombi. the second major vascular occlusion in the present patient was bcs due to ivc thrombosis. bcs is an uncommon condition induced by thrombotic or nonthrombotic obstruction of hepatic venous outflow. this may occur at any point between hepatic venules and the junction of the ivc and the right atrium of the heart.9,10 bcs is an infrequent complication in aps patients and sometimes can be its first manifestation.11,12 in a prospective study of 22 patients with nontumorous bcs, aps was the second most common cause after myeloproliferative disorders.13 furthermore, thrombosis of the axillary and subclavian veins generally termed as upper - extremity deep vein thrombosis occurs infrequently, thereby constituting less than 11% of all deep venous thromboses.14 its risk factors include indwelling venous catheters, malignancy, and coagulation defects. although it occurred several years after the diagnosis of aps, a hypercoagulable state and the absence of anticoagulant treatment were identified as the main risk factors in the present patient. finally, the treatment of aps falls under four main areas : (1) thromboprophylaxis with low - dose aspirin,15 (2) prevention of further thrombosis of large vessels, (3) treatment of acute thrombotic event by anticoagulation, and (4) management of pregnancy in association with antiphospholipid antibodies. management of the present patient involved nutrition (given his remarkable weight loss), the prevention of hepatic encephalopathy through management of chronic liver disease, and the prevention of variceal bleeding. treatment with prolonged anticoagulation using vitamin k antagonists was not undertaken in the present case for fear of severe complications in a setting of hepatic insufficiency and because the patient was predictably noncompliant. steroids were hesitantly prescribed because evidence shows that steroids and immunosuppressive agents have disappointing results with regard to thrombosis.16 in conclusion, clinicians need to have a high index of suspicion of aps in patients who present with a thrombotic episode. clinicians should investigate for the presence of antiphospholipid antibodies, as early diagnosis may influence the course of the disease. furthermore, resources for the detection of antiphospholipid antibodies should be made readily available in resource - limited settings so as to test patients with a history of thrombosis or pregnancy complications. finally, management of aps that involves prevention of thrombosis together with close monitoring of the patient on an anticoagulant could be quite challenging, especially in a setting like the one in this study, where anticoagulants are mostly prescribed by specialist physicians and payment for work - up and medications is exclusively made by the patient. therefore, patient education on the importance of drug compliance, periodic monitoring, and prevention of thrombosis is indispensable, especially as mortality could be associated with the effects of vascular thrombosis and/or the effects of bleeding due to anticoagulants. | antiphospholipid antibody syndrome is defined by the presence of thromboembolic complications and/or pregnancy morbidity in the presence of persistently increased titers of antiphospholipid antibodies. its clinical presentation can be diverse and any organ can be involved, with a current impact in most surgical and medical specialties. the authors present the case of a 43-year - old man who, over a 13-year period of follow - up, presented with thrombosis of the mesenteric vein, inferior vena cava, and axillary and subclavian veins in a setting where diagnostic and therapeutic options are limited and costly. through this case report, the authors aim to describe the evolution of this complex pathology, which to date has not been described in the authors milieu probably because of its challenging diagnosis and the limited treatment options available. the authors conclude that clinicians need to have a high index of suspicion of aps in patients who present with a thrombotic episode clinicians should investigate for the presence of antiphospholipid antibodies, as early diagnosis may influence the course of the disease. furthermore, resources for the detection of antiphospholipid antibodies should be made readily available in resource - limited settings. finally, patient education on the importance of drug compliance, periodic monitoring, and prevention of thrombosis is indispensable, especially as mortality could be associated with the effects of vascular thrombosis and/or the effects of bleeding due to anticoagulants. |
tremor in multiple sclerosis (ms) is a low - frequency action tremor with the clinical picture often being a combination of postural and intention tremor. intention tremor, clinically defined as an increase in tremor amplitude during visually guided movements towards a target at the termination of the movement, is related to lesions in the cerebellum and/or connected pathways in the brain stem and is often synonymously used with cerebellar tremor [1, 2 ]. cerebellar tremor is suspected to be related to unstable central motor pathways and a malfunction of feedforward loops within the central nervous system, especially the cerebellum [35 ]. a feedforward system predicts the consequences of a movement, even prior to movement onset. as such, fine - tuning of movements can occur prior and during movement execution, and time delays inherently associated with sensory feedback can be overcome. in contrast, the motor performance is more dependent on feedback information when a malfunction in the feedforward system is present. this may explain the susceptibility of cerebellar tremor to peripheral factors such as mechanical loading. tremor amplitude and frequency were shown to be modulated by mechanical loads, which indicates the involvement of stretch - elicited peripheral feedback mechanisms in the manifestation of cerebellar tremor [6, 7 ]. in support of this view, load - compensating tasks, evoking sudden stretch, induced an increase of tremor in cerebellar patients. the tremor increase was suggested to be caused by delayed and enlarged long - latency stretch reflexes which have been observed before in patients with cerebellar tremor [5, 8, 9 ]. a reduction of cerebellar tremor during handwriting has been found after the application of an ischaemic block to the arm. intention tremor amplitude decreased during visually - guided movements after peripheral cooling, likely caused by a reduction of the muscle spindle afferent inflow. in contrast, overall tremor amplitude increased during memory guided movements when muscle spindles were artificially activated by means of tendon vibration. similarly, an increase of tremor and in coordination had been reported during high - frequency tendon vibration in patients with cerebellar dysfunction. the effects of both cooling and tendon vibration on tremor amplitude are likely related to the changed activity of the muscle spindles influencing the reflex arc and may indirectly suggest a contribution of abnormal peripheral reflexes to the generation of tremor in ms. the present study investigated the contribution of reflex activity to intention tremor amplitude in patients with ms, by measuring tendon reflexes (t - reflexes) which are considered as phasic stretch reflexes. specifically, latency, peak amplitude, and peak - to - peak amplitude of biceps brachii, triceps brachii, and brachioradialis tendon reflexes were studied in ms patients with intention tremor, ms patients without tremor, and healthy control subjects. these 3 groups were compared in order to differentiate general ms - related deficits such as decreased nerve conduction velocity from specific reflex abnormalities due to the lesions causing tremor. it was hypothesised that ms patients with intention tremor would show delayed and enlarged t - reflexes compared to ms patients without intention tremor and healthy control subjects. 17 ms patients with intention tremor (9 men and 8 women ; mean age 48.1 years with range 3365 ; 15 right handed, 2 left handed) and 17 ms patients without intention tremor (6 men and 11 women ; mean age 49.1 years with range 3272 ; all right handed) were selected from patients with clinically definite ms by neurologists of the belgian national ms centre in melsbroek. in both groups, arms showing clinically detectable spasticity, muscle paresis (score below 4 + on the medical research council), and sensory loss were excluded. overall disability was rated using the expanded disability status scale (edss), obtained from the medical files of the patient. in addition, a healthy control group of 18 persons (6 men and 12 women ; mean age 37.2 years with range 2256 ; 15 right handed, 3 left handed) without known neurological deficits was selected. the study was conducted according to the ethical standards laid down in the 1964 declaration of helsinki and was approved by the local ethics committee. before participation, informed consent was obtained from all participants. fahn 's tremor rating scale was used for the clinical assessment of rest, postural, and intention tremor, the latter rated during the finger - nose test (04). in addition, spirography and the nine - hole peg test (smith & nephew, hull, uk) were performed to estimate tremor - related disability. overall strength of the arm was estimated by measuring handgrip using a hand - held dynamometer (jamar, ja preston co, jackson, mich, usa). height, upper arm length (distance between acromion and olecranon), and forearm length (distance between processus styloideus radii and epicondylus humeralis lateralis) were measured. tendon reflex responses of biceps brachii, triceps brachii, and brachioradialis muscles were bilaterally elicited using an electromechanical triggered reflex hammer connected to an electromyography (emg) measurement device (synergy, oxford instruments, surrey, uk). the reflex hammer, whose weight and handling were similar to those of typical clinical reflex hammers, consists of a rubber hammer with a ring contact. a firm contact between the rubber hammer and the tendon triggered a microswitch in the ring, providing a precise time baseline of the tapping. parameters characterising the t - reflexes were onset latency, peak amplitude, and peak - to - peak amplitude and were all calculated on the basis of the surface emg signal of the tapped muscle. the latency was measured as the time between hammer contact and the onset of the first deflection from the baseline, the peak amplitude as the amplitude between baseline and first positive peak, and the peak - to - peak amplitude as the amplitude between the positive and negative peaks. t - reflex responses of the biceps brachii of a healthy control are illustrated in figure 1. in addition to the objective registration, an overall clinical rating (04) was given to the t - reflexes by the examiner. during the reflex assessment, subjects were comfortably seated with the forearm in midposition and supported in 90 elbow flexion (see illustration in figure 2). the bipolar electrode was placed on the belly of the muscle, specifically at half the distance between tuberculum major and elbow fold for biceps brachii, between acromion and olecranon for triceps brachii, and 3 cm distant from the elbow fold for brachioradialis. before tapping, reflexes were tapped 5 times on the index finger of the examiner, with an interval of approximately 5 seconds between consecutive taps. tapping force was kept as constant as possible between consecutive taps, as well as between different subjects. the physician who tapped the t - reflexes persons without or with insufficient number of detectable reflexes were excluded from data analyses (1 in ms - tremor, 2 in ms - no - tremor, and 2 in the healthy control group). 25 arms in 16 persons were measured in the ms - tremor group after exclusion of 3 arms because of muscle paresis and another 4 arms that did not show tremor. in the ms - no - tremor group, 24 arms of 15 persons were evaluated after exclusion of 5 arms because of muscle paresis and 1 because of difficulties in performing the clinical tasks due to a finger amputation. in the healthy control group, t - reflexes of 31 arms of 16 persons to investigate possible differences between the clinical characteristics of the ms - tremor and ms - no - tremor group, the unpaired t - test was used for examination of disease duration and the chi - square test () for examination of type of ms, handedness, and male - to - female ratio. the mann - whitney u tests were performed to investigate if intention tremor (finger - nose test), overall disability (edss), and the clinical rating of the t - reflexes differed between groups. factorial anovas were conducted for age, height, upper arm length, forearm length, handgrip, nine - hole peg test, and the 3 t - reflex parameters (mean latency, peak amplitude, peak - to - peak amplitude), the latter for each muscle (biceps, triceps, and brachioradialis). the ms - tremor and ms - no - tremor groups did not differ significantly regarding disease duration, (t = 0.06 ; p = 0.96), type of ms (= 0.16 ; p = 0.92), handedness (= 2.13 ; p = 0.14), male - to - female ratio (= 1.22 ; p = 0.26), and edss (z = 1.61 ; p = 0.1). the healthy control group was on average younger than both ms groups (f(2,35) = 6.58 ; p < 0.01) while no differences between the ms - tremor group and the ms - no - tremor group were found. as intention tremor was the discriminating symptom between the 3 groups, it is not surprising that the ms - tremor group was rated significantly higher on the finger - nose test compared with the ms - no - tremor group and the healthy control group (z = 5.95 ; p < 0.0001 and z = 6.39 ; p < 0.0001, resp.). the finger - nose test score was not significantly different between the ms - no - tremor group and the control group (z = 0.26 ; p = 0.79). in line with the finger - nose test findings, the nine - hole peg test time score was greater in the ms - tremor (86s 49 ; f(2,77) = 43.2 ; p < 0.0001) than in both the ms - no - tremor (32s 11) and the healthy control group (17.9s 2). handgrip and all length outcome variables (height, upper arm, forearm) were not different among the three groups. table 2 provides an overview of the reflex parameters of the biceps brachii, triceps brachii, and brachioradialis for all 3 groups. the mean latency of the brachioradialis reflex was significantly greater in the ms - tremor compared to both the ms - no - tremor and healthy control groups (f(2,75) = 5.8 ; p < 0.01). similarly, the mean latency of the biceps reflex was the greatest in the ms - tremor group and greater in the ms - no - tremor group compared to the healthy control group (f(2,75) = 17.2 ; p < 0.0001). the mean latency of the triceps reflex was significantly greater in the ms tremor group compared to the healthy control group (f(2,72) = 3.27 ; p < 0.05), but no significant differences were found between the ms - no - tremor group and either ms - tremor or control groups. neither the mean peak amplitude nor the mean peak - to - peak amplitude of the biceps brachii, triceps brachii, and brachioradialis reflexes differed significantly between groups. in line with the objective findings on reflex amplitude, the clinical ratings given to the t - reflexes did not significantly differ from each other among the groups (biceps : z = 0.3, p = 0.75 ; triceps : z = 0.02, p = 0.98 ; brachioradialis : z = 0.2, p = 0.82). repeated measures anova revealed an increased latency for the brachioradialis (f(4,296) = 4.7, p < 0.001) and triceps reflex (f(4,264) = 2.6, p < 0.05) in the fifth (last) t - reflex compared to the first and/or second elicited t - reflex. however, no interaction effects of group by reflex number were found indicating that the changes were the same in all groups. for the biceps reflex, no significant difference in latency between the successive elicitations was found. in contrast to the latency findings, peak and peak - to - peak amplitudes of all three t - reflexes remained unchanged during 5 successive elicitations. the present study investigated upper limb tendon reflexes in ms patients with tremor in comparison with ms patients without tremor and healthy control subjects. brachioradialis and biceps and triceps tendon reflexes were delayed in the ms patients with tremor compared to healthy control subjects. the amplitude of the upper limb tendon reflexes was not different among the groups. this study was generated following previous work suggesting that ms intention tremor was modulated by sensory information. overall, intention tremor amplitude decreased after sustained peripheral cooling of the forearm, while it increased when muscle spindles were artificially stimulated by means of tendon vibration of the wrist extensors. given that h - reflexes are more complex to elicit in the upper limb, it was chosen to measure tendon reflexes, which can be easily evaluated in the clinical setting. the relevance of the tendon reflex in the present study is its sensitivity for supraspinal inhibiting and facilitating influences. it was hypothesised that t - reflexes may be delayed and enlarged in ms patients with tremor because of decreased supraspinal control due to lesions in the cerebellar system. all t - reflexes were evaluated while subjects were comfortably seated with the arm in 90 flexion of the elbow. this position was chosen because it is regarded as the normalised position for the elbow joint during reflex evaluation. in support of this view, the amplitude of the biceps t - reflex was found to be maximal in 90 flexion compared to other elbow positions. as temperature is known to have an effect on t - reflexes, skin temperature in each subject was carefully checked to be above 31c. all three upper limb reflexes were significantly delayed in the ms - tremor group compared to healthy control group. the delay could be caused by decreased supraspinal control due to lesions in the cerebellar system, or by general slowed nerve conduction velocity due to the disease of multiple sclerosis. to distinguish between both, an additional ms group without arm tremor was evaluated, however, showing similar general clinical characteristics of gender, age, disease progression, and overall disability as the ms - tremor group. the onset latency of the biceps brachii reflex was also greater in the ms - no - tremor compared to the control group ; however, that of the triceps and brachioradialis muscle was not. in addition, the ms - tremor group showed significant greater reflex onset latencies for the brachioradialis and biceps muscles than the ms - no - tremor group, strongly suggesting that delayed tendon reflexes in ms patients with tremor can not simply be attributed to decreased nerve conduction velocity due to the disease of ms. before further interpretation of the results, other factors potentially influencing the t - reflex parameters must be discussed. it is well known that the latency of t - reflexes in the lower limb is prolonged with increasing age [22, 23 ]. thus, the greater latency in both ms groups (of the same age) compared to the healthy control group (of younger age) for the biceps brachii could be due to the significant age difference. however, latency of triceps brachii and brachioradials did not differ between the ms - no - tremor group and healthy control group despite different age. in support of this, other studies examining tendon reflexes in the upper limb did not find significant correlations between age and onset latency for the biceps [2024 ] and triceps brachii. another factor to be considered is the length as the latency of the biceps tendon reflex was shown to correlate with upper arm length and both biceps and triceps reflex latencies correlated with height. however, no differences between height, upper arm length, or forearm length were observed between the three groups in our study. one may also argue that the repetitive tapping with a short interval may have induced a postactivation depression in the t - reflex parameters [14, 25 ], with mean values perhaps concealing differences between the groups. latencies of triceps brachii and brachioradialis reflexes were indeed increased during the last tendon reflex compared to the first one. however, this observation was made in all groups suggesting that it unlikely can account for any differences or similarities between the groups. the latency of biceps brachii did not change after repetitive tapping, suggesting that the mean values of latency were valid to compare between groups. further support for the validity of the latency data is provided by comparison with other studies, showing very similar latency values for biceps and triceps reflexes recorded in healthy controls [20, 26 ]. it is noteworthy that onset latency of the triceps reflex showed less significant differences between groups compared to the brachioradialis and biceps reflexes. this could be related to a greater intersubject variability, perhaps due to a less suitable testing position or the clinical observation that this reflex is more difficult to elicit. in contrast to the latency data, no differences in reflex amplitude in the clinical ratings of neither biceps brachii, triceps brachii, or brachioradialis reflexes were found between subjects with or without upper limb tremor. the reflex amplitude did not decrease after repetitive tapping, similar to observations in patients with head injury when the interstimulus interval was between 1 and 10 seconds. one may question the validity of the tendon reflex parameters given that the investigating physician may have changed the force of tap execution in different groups, and as such have influenced the amplitude of the t - response. first, a period of practice had preceded the actual measurements to train the physician to strike the tendon each time with similar force. secondly, the physician was unfamiliar with the selected ms patients as he was working only very recently at the rehabilitation centre and was blinded to group allocation. unfortunately, it can not be excluded that tremulous movements were observed in the ms patients with tremor during the test session, for example, while taking off their watch or lifting their arm, and obviously healthy control subjects were recognized as they walked in not showing any symptoms. in this regard, the absence of major differences in reflex amplitude between all groups may actually confirm that the physician intended to strike the tendon each time with similar force. in contrast to latency values, many studies report a considerable intersubject and intrasubject variation in t - reflex amplitudes. also the type of hammer used in the study and the placement of the index finger may have an effect on latency magnitude. moreover, relatively, literature is available on tendon reflexes in upper limb muscles compared to achilles and patellar t - reflexes making direct comparison of absolute values difficult to perform. a limitation of the study methodology is acknowledged with a manual procedure to test tendon reflexes similar to clinical practice is more variable in force application on the tendon compared to measurement in a laboratory with standardized hammer impact. still, group differences were found, showing delayed, but not enlarged in ms patients with tremor compared to ms patients without tremor and healthy control subjects. it is hypothesised that peripheral delayed reflexes may contribute to intention tremor, however, which is an action tremor not occurring during rest conditions. the tendon reflex is primarily a mono- or oligosynaptic response and is tested when the muscle is in a relaxed state, whereas stretch of an actively contracting muscle produces a more complex response with the tendon reflex often being followed by a long - latency stretch reflex. the long - latency response is reported to be increased in patients with cerebellar deficits [9, 27 ]. it is not thought that muscle spindle discharge frequency is changed in persons with cerebellar deficits as the range of muscle spindle sensitivity to fusimotor drive in cats was not changed when inactivating cerebellar output nuclei. however, intention tremor is hypothesised to relate to malfunction of feedforward control due to cerebellar damage, and related excessive reliance on feedback may contribute to oscillations by means of uncontrolled alternating stretch reflexes of antagonist muscle pairs. future research should investigate peripheral reflex activity during voluntary action, for example, by means of stretch of an actively contracting muscle. the investigation of tendon reflexes could also be applied on other types of neurological impairments such as ataxic hemiparesis, which is an uncommon syndrome caused by lacunar cerebral infarction. reflex latencies may be different depending on whether the lacunar infarction affected the cerebellar pathways versus cerebrothalamic pathways. | intention tremor is related to lesions in the cerebellum or connected pathways. intention tremor amplitude decreased after peripheral arm cooling in patients with multiple sclerosis (ms), likely caused by a reduction of muscle spindle afferent inflow, while amplitude increased when muscle spindles were artificially stimulated by tendon vibration. this study investigated the contribution of peripheral reflexes to the generation of ms intention tremor. tendon reflexes of biceps, triceps, and brachioradialis, muscles were measured, using an electromechanical triggered reflex hammer. ms patients with (n = 17) and without (n = 17) upper limb intention and 18 healthy controls were tested. latency of brachioradialis, biceps, and triceps tendon reflexes was greater in ms patients with tremor than in healthy controls and ms patients without tremor (except for the triceps reflex). peak and peak - to - peak amplitude were not different between groups. it is concluded that tendon reflexes were delayed but not enlarged in ms patients with tremor. |
leishmaniasis is a parasitosis caused by different species of the leishmania genus that affects about 12 million people around the world, with 90% of the cases reported in afghanistan, pakistan, iran, iraq, syria, saudi arabia, india, bangladesh, nepal, sudan, algeria, ethiopia, brazil, bolivia, colombia, ecuador, peru, and venezuela. approximately 21 species have been described to cause three different clinical manifestations : (1) cutaneous (cl), where the lesions are confined to the site of the inoculation by the sandfly ; (2) mucocutaneous (mcl), which affects the mucosal tissues ; (3) visceral (vl), where the parasites have a tropism for phagocytes mainly localized in the spleen and the liver. visceral leishmaniasis is fatal if not treated, while some forms of cutaneous manifestations can cure spontaneously. according to who, around 70,000 deaths per year occur throughout the world. in brazil, leishmania amazonensis is one of the species responsible for the cutaneous disease ; however, in some individuals the immune system fails to mount an appropriate response against the parasite, leading to clinical manifestations of diffuse cutaneous leishmaniasis. pentavalent antimonials such as meglumine antimoniate (glucantime) and sodium stibogluconate (pentostan) have been employed as first - line treatment for many decades. in the case of resistance to pentavalent antimonials, second - line treatments using amphotericin b or pentamidine have been successfully used. for visceral leishmaniasis, miltefosine (impavido) has been recently employed by oral route in india as a first - line treatment. however, the drug is teratogenic and has a narrow chemotherapeutic window. more recently, combination treatments are emerging as first - line treatments for visceral leishmaniasis. toxic side effects and increasing resistance limit most of the current specific treatments for leishmaniasis, indicating that there is an urgent need to develop new drugs that are efficacious, safe, and more accessible for the patient populations. amiodarone (amio) is the antiarrhythmic class iii drug most frequently used to treat arrhythmias in general as well as in patients with chronic chagas ' disease and cardiac compromise. the antiarrhythmic action in mammals has been well characterized and results from ca and kchannel inactivation, but it has recently been shown that the drug also has selective activity against parasitic protozoa such as trypanosoma cruzi and leishmania mexicana [810 ] as well as a broad - spectrum antifungal action [11, 12 ]. the mechanisms of action of amio reported in these different microorganisms involve the inhibition of sterol biosynthesis, disruption of mitochondrial membrane potential (m), and ca homeostasis, as well as production of reactive oxygen species [8, 9, 1113 ]. apparently, these alterations in the mitochondrial metabolism trigger a sequence of cellular events leading to apoptosis - like cell death. however, the action of amio on the mitochondrion of target cells is controversial, as some groups have implicated inhibition of mitochondrial respiration, mainly by the direct action of amio against complex i, ii, and f0f1-atp synthase or by a rapid release of ca from the mitochondrial compartment due to a collapse of mitochondrial membrane potential (m) (see [8, 9 ]), while others suggest that amio is able to protect mitochondrial function [1417 ]. in this study, we investigated the antiproliferative, ultrastructural, and physiological effects of amiodarone on promastigote and intracellular amastigote forms of leishmania amazonensis. the results indicated that amio acts mainly by altering the mitochondrial ultrastructure and physiology but other deleterious effects were also observed, including lipid accumulation, loss of the plasma membrane integrity, and presence of autophagic - like structures, suggesting different types of cell death involved in the mechanism of action of amio. mhom / br/75/josefa strain of leishmania amazonensis isolated from a patient with diffuse cutaneous leishmaniasis by c. a. cuba - cuba (universidade de brasilia, brazil) was used in the present study. it has been maintained by hamster footpad inoculation and, in the case of promastigotes, axenically cultured in warren 's medium (brain heart infusion plus hemin and folic acid) supplemented with 10% fetal bovine serum at 25c. infective promastigotes of the josefa strain were used to obtain intracellular amastigotes in macrophage cultures. amiodarone (amio), { (2-butyl-3-benzofuranyl)-[4-[2-(diethylamino)ethoxi]-3,5-diiodophenyl]methanone hydrochloride }, was purchased from sigma, dissolved in dimethyl sulfoxide as a 100 mm stock, and stored at 20c. growth experiments with promastigotes were initiated with 2.0 10 parasites / ml, and amio was added at different concentrations from concentrated stock solutions in dmso after 24 h of growth. cell densities were evaluated daily in a neubauer chamber during 72 h of growth. to evaluate the effects of the amio on the l. amazonensis intracellular amastigotes, peritoneal macrophages from cf1 mice were harvested by washing them with rpmi medium (gibco) and plated in 24-well tissue culture chamber slides, allowing them to adhere to the slides for 24 h at 37c in 5% co2. adherent macrophages were infected with metacyclic promastigotes at a macrophage - to - parasite ratio of 1 : 10 at 35c for 2 h. after this time, noningested parasites were removed by washing and infected cultures were incubated for 24 h in rpmi (containing 10% of fetal bovine serum) without amio. different concentrations of amio were added after 24 h of interaction, when the number of amastigotes per macrophage was in the range of two to four, and fresh medium with amio was added daily for 2 days. the cultures were fixed with 4% freshly prepared formaldehyde in phosphate buffer saline (pbs, ph 7.2) and stained with giemsa for 15 min. association indexes (mean number of parasites internalized per cell, multiplied by the percentage of infected macrophages, and divided by the total number of macrophages) were determined and used as a parameter to calculate the intensity of infection in each condition used in this study. the 50% inhibitory concentrations (ic50s) were calculated with the sigmaplot (version 10) program. the results are expressed as the means of three independent experiments. to evaluate the cytotoxicity effects of amio against the host cell cultures, macrophages were incubated with different concentrations of amio for 48 h, and exclusion tests with 0.1% trypan blue were carried out for 5 min. the percentages of dead and alive cells were determined after counting of 400 macrophages in randomly selected fields by light microscopy. m of the control and amio - treated (6,10, and 15 m) promastigotes was investigated using the jc-1 fluorochrome, which is a lipophilic cationic mitochondrial vital dye that becomes concentrated in the mitochondria in response to m. the dye exists as a monomer at low concentrations, where the emission is 530 nm (green fluorescence), but at higher concentrations it forms j - aggregates after accumulation in the mitochondrion, where the emission is 590 nm (red fluorescence). thus, the fluorescence of jc-1 is considered an indicator of an energized mitochondrial state, and it has been used to measure the m in leishmania [1921 ]. control and amio - treated promastigotes after 48 h of treatment were harvested, washed in pbs, ph 7.2, added to a reaction medium containing 125 mm sucrose, 65 mm kcl, 10 mm hepes / k ph 7.2, 2 mm pi, 1 mm mgcl2, and 500 m egta, and counted in a neubauer chamber. to evaluate the m for each experimental condition, 2.0 10 parasites were incubated in 10 g / ml jc-1 during 30 min, with readings made every 1 min using a molecular devices microplate reader (a spectrofluorometer spectramax m2/m2). cells were incubated in the presence of oligomycin (10 m), a f0f1-atp synthase inhibitor, or fccp (1 m), a mitochondrial protonophore, during the 30 min of experiment as positive controls of the depolarization of the mitochondrial membrane. fccp at the concentration of 2 m was added at the end of all experiments to abolish m. the relative m value was obtained calculating the ratio between the reading at 590 nm and the reading at 530 nm (590 : 530 ratio). control and amio - treated promastigotes were also observed under a zeiss axioplan epifluorescence microscope using different optical filter sets : (1) for j - aggregate alone, we used 546 nm band - pass filter for excitation, with a 580 nm beam splitter, and a 590 nm long - pass for emission ; (2) for monomer and j - aggregate, together, we used a 450490 nm for excitation, with a 510 nm beam splitter, and a 520 nm long pass for emission. each experiment was repeated at least three times in triplicate, and the figures shown are representative of these experiments. intracellular ros level was measured in intact control and amio - treated promastigotes as described previously. briefly, cells (3.0 10) were washed, resuspended in 500 l of pbs ph 7.2, and then incubated with the cell - permeable probe green h2dcfda at a concentration of 10 g / ml for 1h at 25c. after incubation, cells were analyzed at a molecular devices microplate reader (a spectrofluorometer spectramax m2/m2, molecular devices) using a pair of 507 nm and 530 nm as emission and excitation wavelengths, respectively. control and amio - treated (6,10, and 15 m) promastigotes were harvested, washed in pbs, ph 7.2, and counted in a neubauer chamber. after that, cells (5.0 10) were incubated with 1 m sytox blue and 10 g / ml nile red for 20 minutes. the final volume in each well was 200 l of cell suspension in pbs. the reading was done in a molecular devices microplate reader (a spectrofluorometer spectramax m2/m2) according to the following wavelengths for excitation and emission, respectively : 444 and 560 nm for sytox blue, and 485 and 538 nm for the nile red. after the readings, control and amio - treated cells were observed under a zeiss axioplan epifluorescence microscope equipped with optical filters to sytox blue (the same of dapi) and nile red (450490 nm for excitation, and 528 nm for emission). each experiment was repeated at least three times in triplicate, and the figures shown are representative of these experiments. control and amio - treated promastigotes were fixed for 3 h at 4c in 2.5% glutaraldehyde (sigma chemical co.) in 0.1 m cacodylate buffer (ph 7.2). after fixation, cells were postfixed for 30 min in a solution containing 1% oso4 and 1.25% potassium ferrocyanide in 0.1 m cacodylate buffer, washed in the same buffer, dehydrated in acetone, and embedded in epon. ultrathin sections were stained with uranyl acetate and lead citrate and observed in a zeiss 900 electron microscope. l. amazonensis promastigotes were exposed to different concentrations of amio, and their proliferation was followed during 4 days. figure 1(a) shows a concentration - dependent inhibition of the growth induced by the treatment. the 50% inhibitory concentration (ic50) was 4.21 m after 48 h of treatment. inhibition of around 100% was obtained with a concentration of 15 m amio, which also induced a delayed lytic effect. we also investigated the effects of amio on intracellular amastigotes, the clinically relevant form of the parasite. macrophages were infected with metacyclic promastigotes and treated with different concentrations of the drug. the ic50 obtained was 0.46 m after 48 h of treatment, with a total elimination of amastigotes when macrophages were treated with 6 m for 48h (figure 1(b)). detailed inspection of treated cultures using light microscopy confirmed the potent antiproliferative effect against intracellular amastigotes, as no intact parasites were seen after treatment with concentrations 6 m of amio for 48 h (figure 2). comparing our results with those published for l. mexicana, another species of the same leishmania subgenus but that is not relevant for the epidemiology of leishmaniasis in brazil, the ic50 values found in this study were higher for both stages (4.21 m for promastigotes and 0.46 m for intracellular amastigotes compared with 900 nm and 8 nm, respectively, for l. mexicana), indicating a lower susceptibility of our l. amazonensis strain to the drug. these results are consistent with the known fact that patients infected with l. amazonensis are less responsive to the available anti - leishmania treatments. it is interesting to point out that the clinically relevant intracellular amastigote form of the parasite had a ten - fold higher susceptibility to amiodarone than the extracellular promastigotes, a result similar to those obtained for t. cruzi and l. mexicana. using the cytotoxicity trypan blue test, viable cells were evaluated in macrophage cultures exposed to amio at concentrations varying between 2 and 50 m for 48 h (figure 1(c)). the cytotoxicity concentration to reduce 50% (cc50) of viable macrophages was 12.9 m (figure 1), giving a mean selectivity index of 28. light microscopy showed that macrophages treated with 6 and 8 m amio did not present any significant alteration (figure 2). in several mammalian cell lines, amio has been described to be very toxic [17, 22, 23 ]. however, the selectivity of amio for trypanosomatid parasites over mammalian cells and organisms has been confirmed in experimental models of chagas ' disease and leishmaniasis [810 ] and more recently in clinical studies [24, 25 ]. in order to evaluate the effect of amio on the plasma membrane integrity and the presence of lipid - storage bodies in l. amazonensis promastigotes, we performed a quantitative analysis after simultaneous incubation of the cells with sytox blue and nile red. the results indicated that at the higher concentration used (15 m amio), the plasma membrane permeability was significantly altered (data not shown). this effect was not observed at lower concentrations (6 and 10 m amio). on the other hand, incubation with nile red revealed a concentration - dependent effect on neutral lipids ' accumulation, which was quantified by fluorimeter (data not shown). the visualization of amio - treated promastigotes under fluorescence microscopy revealed the presence of many lipid bodies positive to nile red and randomly distributed throughout the cytoplasm (figures 3(a)3(h)). the fluorescence images indicate a concentration - dependent increase in the number of lipid bodies (figures 3(d), 3(f), and 3(h)), while differential interference contrast microscopy (dic) revealed an important alteration in the shape of promastigotes treated with 15 m amio, which appeared rounded and swollen with a clear evidence of loss of the cytoplasmatic content (figure 3(g)), confirming the alteration on the plasma membrane integrity indicated by sytox blue staining. these results are consistent with the reported effect of amio on the de novo sterol biosynthesis in t. cruzi and l. mexicana. we also evaluated the effect of amio on the fine structure of l. amazonensis promastigote. figure 4(a) shows a longitudinal section of a control promastigote presenting different organelles such as mitochondrion, nucleus, kinetoplast, and flagellum with normal ultrastructure. parasites incubated in the presence of amio displayed significant morphological changes, which varied from discrete alterations to a total destruction of the parasite, depending on the drug concentration and length of incubation. the changes began to appear with 5 m amio after 48 h of incubation, when it was possible to observe the presence of some vacuoles similar to autophagosomes (figure 4(b), stars). with just 24 h of treatment, but using higher concentrations (15 and 20 m), several alterations could be observed such as presence of lipid - storage bodies (arrowheads), large myelin - like figures (arrow) with presence of endoplasmic reticulum profiles (big arrow), and autophagic structures containing cellular debris (figures 4(c)4(f)). these structures could be related to a degradation of damaged organelle induced by the drug treatment. in addition, alterations in the mitochondrion, in the kinetoplast, and in the chromatin condensation can be observed in figures 4(c)4(d). we also observed the presence of several small vesicles inside the flagellar pocket (figure 4(e)) and many cells swollen and completely destroyed after treatment with 15 and 20 m amio for 24 h (figure 4(f)). all these alterations are characteristic of the three main types of cell death : apoptosis, necrosis, and autophagy (reviewed in). some of the lipid bodies appeared near the plasma membrane and the autophagic - like structures, which could be related, respectively, to alterations of the biophysical properties of the plasma membrane and degradation of abnormal lipids that accumulated as a consequence of the treatment. thus, alterations of lipid composition resulting from treatment with amio could interfere with plasma membrane integrity, leading to cell death by necrosis. we investigated the effect of amio on the mitochondrial function and ultrastructure using three criteria : mitochondrial transmembrane electric potential (m) using jc-1 fluorochrome, production of reactive oxygen species (ros) using a green h2dcfda probe, and transmission electron microscopy. jc-1 is a cell - permeant cationic lipophilic fluorochrome that accumulates in the functional mitochondrion forming red - fluorescent j - aggregates. on the other hand, thus, the decrease in the red / green fluorescence intensity ratio indicates a collapse in the mitochondrial transmembrane potential. there are some advantages of using the jc-1 : (1) it is not necessary to permeabilize the cells ; (2) it is easy to quantify in a fluorimeter as well as to observe the process under a fluorescence microscopy. promastigotes were treated with 0, 6, 10, and 15 m amio for 48 h prior to the analysis of the mitochondrial features. incubation with jc-1 for 30 min indicated that cells treated with 6 and 15 m amio had a very significant reduction of m (figure 5(a), traces b and c) when compared with the control (untreated) parasites (figure 5(a), trace a). the results indicated a marked reduction in the mitochondrial polarization with 6 m amio (figure 5(a), trace b), and an almost total depolarization of the mitochondrial membrane potential with 15 m amio (figure 5(a), trace c). after 30 min of jc-1 uptake, 2 m fccp was added to fully collapse the m : it can be seen that in control parasites the release of jc-1 was more prominent than in treated promastigotes. to compare these findings with other situations that can induce depolarization of the mitochondrion, control and treated parasites were incubated with two classical inhibitors of the mitochondrial function : olygomicin, which is an inhibitor of the f0f1-atp synthase, and fccp, a classical protonophore uncoupler that dissipates the mitochondrial electrochemical h+ gradient (figure 5(b)). it can be seen that the reduction of m found in cells grown in the presence of 6 and 15 m amio (figure 5(a)) is similar to those obtained in control cells incubated with olygomicin or fccp (figure 5(b)). in addition, when these inhibitors were added in amio - treated promastigotes, the decrease of the m was more evident. we also investigated the effect of amio on the production of reactive oxygen species (ros), as it is known that inhibition of oxidative phosphorylation induces an increase in the production of ros. the results shown in figure 5(c) indicate that cells grown in the presence of amio at the same concentrations used to evaluate the m, showed very significant and concentration - dependent increase in the production of ros. alterations of the mitochondrion were also investigated using fluorescence and transmission electron microscopy, confirming the results obtained at the fluorimeter. visualization of control and amio - treated promastigotes incubated with jc-1 under fluorescence microscopy revealed that cells grown with 15 m amio for 48 h showed reduced accumulation of the fluorochrome, restricted to the kinetoplast region of the single giant mitochondrion (figures 6(e) and 6(f)), indicating a loss of only m in most parts of the organelle. in contrast, in control promastigotes, jc-1 accumulated in the whole extension of the ramified mitochondrion (figures 6(b) and 6(c)). images (b) and (e) show the fluorescence for monomers and j - aggregates, together, while the images (c) and (f) show the fluorescence for j - aggregates alone. finally, ultrastructural alterations on the mitochondrion were also investigated : in figure 7 the occurrence of dramatic modifications in different aspects of the organelle can be seen. it is evident that long - term incubation with amio induced mitochondrial swelling at all the concentrations tested (figures 7(a), 7(c), 7(d) and 7(e)), which is followed by alterations in the mitochondrial membranes (figures 7(d) and 7(e), arrowheads), appearance of circular cristae (figure 7(a) and 7(c)), and loss of the mitochondrial matrix content (figures 7(a) and 7(d)). in addition, we also observed an important interaction between the mitochondrion and structures similar to autophagic vacuoles (figure 7(c)). in this same figure, ultrastructural alterations on the mitochondrion also predominate in t. cruzi and leishmania cells treated with sterol biosynthesis inhibitors, including quinuclidine derivatives, azoles and azasterols, indicating that this organelle is an important target for compounds that interfere with sterol and lipid composition [2735 ]. the dose - dependent reduction of m induced by amiodarone was correlated with the increase in the production of reactive oxygen species and mitochondrial ultrastructural alterations detected with transmission electron microscopy. two possible explanations for these combined alterations are : (1) calcium release from the mitochondrion, which would result from a direct action of amio on the organelle and lead to apoptotic cell death ; and, (2) sterol biosynthesis inhibition, as observed in fungi and trypanosomatids [8, 9 ], leading to an important alteration in the lipid composition of the mitochondrial membranes that should modify their biophysical properties [28, 38, 39 ], and loss of mitochondrial function. in conclusion, the results of this work support the potential usefulness of amio as a chemotherapeutic agent against leishmania amazonensis. such activity is mainly mediated by profound and selective effects on the ultrastructure and physiology of the parasite mitochondrion, which culminate in cell death by necrosis, apoptosis, or autophagy. more studies are necessary to better characterize the different types of cell death associated with the mechanisms of action of amio and the activity of the drug in murine models of cutaneous leishmaniasis by l. amazonensis. | amiodarone (amio), the most frequently antiarrhythmic drug used for the symptomatic treatment of chronic chagas ' disease patients with cardiac compromise, has recently been shown to have also specific activity against fungi, trypanosoma cruzi and leishmania. in this work, we characterized the effects of amio on proliferation, mitochondrial physiology, and ultrastructure of leishmania amazonensis promastigotes and intracellular amastigotes. the ic50 values were 4.21 and 0.46 m against promastigotes and intracellular amastigotes, respectively, indicating high selectivity for the clinically relevant stage. we also found that treatment with amio leads to a collapse of the mitochondrial membrane potential (m) and to an increase in the production of reactive oxygen species, in a dose - dependent manner. fluorescence microscopy of cells labeled with jc-1, a marker for mitochondrial energization, and transmission electron microscopy confirmed severe alterations of the mitochondrion, including intense swelling and modification of its membranes. other ultrastructural alterations included (1) presence of numerous lipid - storage bodies, (2) presence of large autophagosomes containing part of the cytoplasm and membrane profiles, sometimes in close association with the mitochondrion and endoplasmic reticulum, and (3) alterations in the chromatin condensation and plasma membrane integrity. taken together, our results indicate that amio is a potent inhibitor of l. amazonensis growth, acting through irreversible alterations in the mitochondrial structure and function, which lead to cell death by necrosis, apoptosis and/or autophagy. |
hypertension is the most important modifiable risk factor for coronary heart disease, stroke, congestive heart failure, end - stage renal disease and peripheral vascular disease. it accounts for a major part of morbidity and mortality due to cardiovascular diseases (cvd). as per world health organization (who), cvd will be the largest cause of death and disability in india by 2020 and nearly half of this mortality will be in young and middle - aged individuals. currently, indians experience cvd deaths at least a decade earlier than their counterparts in countries with well - established market economies. out of so many risk factors for essential hypertension, chronic psychological stress and negative affective states contribute significantly to the pathogenesis and progression of hypertension. however, it is an accepted fact that psychosocial factors operate through mental processes, consciously or unconsciously, to produce hypertension. virtually all studies on blood pressure (bp) and catecholamine levels revealed significantly higher noradrenaline levels in hypertensives than normotensives. this supports the contention that over activity of sympathetic nervous system has an important part to play in the pathogenesis of hypertension. scientists have tried to study the pathophysiological mechanisms induced by stress in experimental models and laboratory induced stress in volunteers. these studies have demonstrated increased heart rate (hr) and bp and thus an increase in oxygen demand. these peaks are associated with work stress and psychobehavioral responses to stress such as anger, anxiety, tension and nervousness. numerous approaches are available for stress management that can decrease these patient 's suffering and enhance their quality of life. relaxation methodologies in the form of yoga (asanas, pranayama, transcendental meditation and progressive muscular relaxation) has become more popular recently, though these techniques have been practiced in the past. yoga is an ancient system of relaxation, exercise and healing with origins in india. pranayama, the formal practice of controlling the breath, lies at the heart of yoga. ayama means stretch or extend and describes the action of pranayama. if hypertensive patients could adopt a simple relaxation technique that would reduce stress and its physiological effects, they may be able to control their bp better, decrease the requirements for antihypertensive drugs and respond better during such physiologically stressful events. studies have shown a decrease in bp with pranayama. however, in hypertensive patients, myocardial oxygen demand (mvo2) can be a better marker of predicting cvd. the studies have shown different effects of relaxation therapies on bp in different populations. hence, this study was designed to evaluate the effect of pranayama on rpp in mild hypertensive patients. the present study was carried out on both males and females of age group 20 - 50 years having mild hypertension. patient diagnosed with mild hypertension (stage i) according to criteria developed by european society of hypertension were enrolled. patients with secondary hypertension or with previous experience of yoga or history of major cardiac / renal / pulmonary disease or history of any surgery in the recent past or history of major medical illness in the past such as tuberculosis, diabetes mellitus, bronchial asthma were excluded. group a (n = 25) was a control group and received antihypertensive drugs for 6 weeks. group b (n = 25) was study group which received pranayama along with antihypertensive drugs for 6 weeks. the study was approved by institute ethics committee and written informed consent was obtained from all patients. the philosophy of yoga is sometimes pictured as a tree with eight branches : pranayama (breathing exercises), asana (physical postures), yama (moral behavior), niyama (healthy habits), dharana (concentration), prathyahara (sense withdrawal), dhyana (contemplation) and samadhi (higher concoiusness). pranayama is a method of relaxation, which involves minimal training, can be learnt quickly and more importantly can be applied immediately to everyday situations. the techniques of the following pranayama were taught to the patients of group b and practiced regularly for 6 weeks. pranayamas taught were : nadi - shodhana pranayama : patient was instructed to use right thumb for right nostril and right third finger for left nostril. he was told to close the right nostril and inhale deeply through left nostril to the count of 4. then he was told to block both nostrils and hold the breath for 2 counts. this was followed by blocking of the left nostril and exhalation through the right nostril to the count of 4. the time duration was at least 2 min at first, progressively increasing the duration up to 10 minchandar bhedi pranayama : the patient was asked to close the right nostril, inhale through the left nostril. then he was told to close the left nostril and exhale through the right nostril without any pause. time duration was at least for 2 min at first, progressively increasing the duration up to 10 minbhramari pranayama : the patient was asked to close eyes with four fingers over each eye and thumbs blocking the ears. then he was told to inhale deeply through both nostrils and with the mouth closed exhale through both the nostrils producing a continuous humming sound until the exhalation has exhausted. this was repeated for 10 cyclesomkar chanting : the patient was asked to inhale deeply with both nostrils followed by a loud chanting of sound of omkar from the mouth during exhalation in the ratio of a : o ; ma as 1:4;2. nadi - shodhana pranayama : patient was instructed to use right thumb for right nostril and right third finger for left nostril. he was told to close the right nostril and inhale deeply through left nostril to the count of 4. then he was told to block both nostrils and hold the breath for 2 counts. this was followed by blocking of the left nostril and exhalation through the right nostril to the count of 4. the time duration was at least 2 min at first, progressively increasing the duration up to 10 min chandar bhedi pranayama : the patient was asked to close the right nostril, inhale through the left nostril. then he was told to close the left nostril and exhale through the right nostril without any pause. time duration was at least for 2 min at first, progressively increasing the duration up to 10 min bhramari pranayama : the patient was asked to close eyes with four fingers over each eye and thumbs blocking the ears. then he was told to inhale deeply through both nostrils and with the mouth closed exhale through both the nostrils producing a continuous humming sound until the exhalation has exhausted. this was repeated for 10 cycles omkar chanting : the patient was asked to inhale deeply with both nostrils followed by a loud chanting of sound of omkar from the mouth during exhalation in the ratio of a : o ; ma as 1:4;2. the following parameters were recorded at baseline and after 6 weeks of interventions in both control and study group. hr : subject was made to lie down while continuous electrocardiographic (ecg) on cardiofax machine (limb lead - ii) was recorded. the r - r interval was measured on ecg with a ruler, hr was calculated as : bp recording was done by standard sphygmomanometer. hr : subject was made to lie down while continuous electrocardiographic (ecg) on cardiofax machine (limb lead - ii) was recorded. the r - r interval was measured on ecg with a ruler, hr was calculated as : bp recording was done by standard sphygmomanometer. rpp was calculated as : sbp : systolic bp in mmhg hr : heart rate in beats per minutes the value thus obtained was expressed as mmhg beats per min. this hemodynamic parameter has been shown to follow a circadian pattern similar to that observed with cardiovascular events. data were analyzed using unpaired t - test for comparison of rpp between control and study group. the paired t - test was used for comparison among the same group between pre - treatment and post - treatment values. the philosophy of yoga is sometimes pictured as a tree with eight branches : pranayama (breathing exercises), asana (physical postures), yama (moral behavior), niyama (healthy habits), dharana (concentration), prathyahara (sense withdrawal), dhyana (contemplation) and samadhi (higher concoiusness). pranayama is a method of relaxation, which involves minimal training, can be learnt quickly and more importantly can be applied immediately to everyday situations. the techniques of the following pranayama were taught to the patients of group b and practiced regularly for 6 weeks. pranayamas taught were : nadi - shodhana pranayama : patient was instructed to use right thumb for right nostril and right third finger for left nostril. he was told to close the right nostril and inhale deeply through left nostril to the count of 4. then he was told to block both nostrils and hold the breath for 2 counts. this was followed by blocking of the left nostril and exhalation through the right nostril to the count of 4. the time duration was at least 2 min at first, progressively increasing the duration up to 10 minchandar bhedi pranayama : the patient was asked to close the right nostril, inhale through the left nostril. then he was told to close the left nostril and exhale through the right nostril without any pause. time duration was at least for 2 min at first, progressively increasing the duration up to 10 minbhramari pranayama : the patient was asked to close eyes with four fingers over each eye and thumbs blocking the ears. then he was told to inhale deeply through both nostrils and with the mouth closed exhale through both the nostrils producing a continuous humming sound until the exhalation has exhausted. this was repeated for 10 cyclesomkar chanting : the patient was asked to inhale deeply with both nostrils followed by a loud chanting of sound of omkar from the mouth during exhalation in the ratio of a : o ; ma as 1:4;2. nadi - shodhana pranayama : patient was instructed to use right thumb for right nostril and right third finger for left nostril. he was told to close the right nostril and inhale deeply through left nostril to the count of 4. then he was told to block both nostrils and hold the breath for 2 counts. this was followed by blocking of the left nostril and exhalation through the right nostril to the count of 4. the time duration was at least 2 min at first, progressively increasing the duration up to 10 min chandar bhedi pranayama : the patient was asked to close the right nostril, inhale through the left nostril. then he was told to close the left nostril and exhale through the right nostril without any pause. time duration was at least for 2 min at first, progressively increasing the duration up to 10 min bhramari pranayama : the patient was asked to close eyes with four fingers over each eye and thumbs blocking the ears. then he was told to inhale deeply through both nostrils and with the mouth closed exhale through both the nostrils producing a continuous humming sound until the exhalation has exhausted. this was repeated for 10 cycles omkar chanting : the patient was asked to inhale deeply with both nostrils followed by a loud chanting of sound of omkar from the mouth during exhalation in the ratio of a : o ; ma as 1:4;2. the following parameters were recorded at baseline and after 6 weeks of interventions in both control and study group. hr : subject was made to lie down while continuous electrocardiographic (ecg) on cardiofax machine (limb lead - ii) was recorded. the r - r interval was measured on ecg with a ruler, hr was calculated as : bp recording was done by standard sphygmomanometer. hr : subject was made to lie down while continuous electrocardiographic (ecg) on cardiofax machine (limb lead - ii) was recorded. the r - r interval was measured on ecg with a ruler, hr was calculated as : bp recording was done by standard sphygmomanometer. rpp was calculated as : sbp : systolic bp in mmhg hr : heart rate in beats per minutes the value thus obtained was expressed as mmhg beats per min. this hemodynamic parameter has been shown to follow a circadian pattern similar to that observed with cardiovascular events. data were analyzed using unpaired t - test for comparison of rpp between control and study group. the paired t - test was used for comparison among the same group between pre - treatment and post - treatment values. males were more in both groups (60% in group a and 64% in group b). most of the patients were in the age group of 35 - 50 years [figure 1 ]. there were only 8% patients in group a in the age group of 30 - 35 years and none in group b. as can be seen in table 2 and figure 2, hr decreased significantly in both groups. although there was a decrease in bp in both groups when compared to baseline, the decrease was not statistically significant in group a. the decrease was statistically significant in group b when compared to baseline (p < 0.001). the decrease was significantly more in group b as compared to group a (p < 0.001). demographic characteristics of subjects in both groups age wise distribution of subjects in both groups cardiovascular parameters in both groups (meanse) comparison of changes in rate pressure product at baseline and 6 weeks post - intervention. rpp : rate pressure product rpp which is a product of bp and hr decreased significantly in both groups (p < 0.001). the decrease was significantly more in group b where pranayama was added to antihypertensive therapy. among the various approaches to reduce the level of anxiety, pranayama is one that combines the physical elements of a healthy life - style with prescriptions for abiding mental piece. further, the growth of psychoneuroimmunology has strengthened the scientific foundations of mind - body technique. as tools for influencing the mind positively have assumed extensive application in a wide variety of illness, it is important to examine their efficacy. in the present study, we measured effect of pranayama on rpp in mild hypertensives. rpp is a reliable index of myocardial oxygen consumption and cardiac work and it correlates well with the oxygen consumption of normal subjects as well as patients with angina pectoris. in the present study, demographic were comparable in both groups and cardiac parameters measured (bp, hr, rpp) were also similar in both groups at baseline. this is expected as hypertension affects male gender more in the age groups we compared. most of the patients were in the age group of 35 - 50 years and this is in accordance with changing trends where hypertension is affecting more younger people especially due to life - style pressures and high demanding professions. bp decreased in both groups when compared to baseline levels, however the decrease was significant in the group b where pranayama was added to regular antihypertensive therapy. the decrease was more in group b as compared to group a given only antihypertensive drugs. one of the earlier study reported that treatment by anti - hypertensive drugs produce the greatest lowering of bp. treatment by weight reduction, yoga and muscle relaxation each produced smaller, but appreciable, changes in bp and salt reductions were inferior to those of other regimens and were not significantly different to the effect of placebo treatment. similarly hr decreased significantly in both groups, however this decrease was comparable in both groups indicating that antihypertensive drugs alone and along with pranayama decreased hr to a similar extent. the isolated changes in bp and hr sometimes may not convey the overall effect of pranayama on the disease process. hence, rpp which is a product of systolic bp and hr and is a better index of mvo2 and is very useful parameter. rpp is especially important in patient care as this is an indirect indicator of myocardial oxygen consumption and load on the heart, thereby signifying a lowering of strain on the heart. the rpp also provides a simple measure of overall hr variability (hrv) in hypertensive patients and is a surrogate marker in situations where hrv analysis is not available. hence, the reduction in rpp in our study implies better autonomic regulation of the heart in hypertensive patients. a previous study from our laboratories reported that pranayama training of 3 months duration modulates ventricular performance by increasing parasympathetic activity and simultaneously decreasing sympathetic activity. this may explain significant decreases in hr and bp observed in the present study with pronounced effects on the heart. in the present study, rpp decreased significantly in both the groups indicating that antihypertensive drugs alone as well as along with pranayama decreased rpp. this is in accordance with the earlier study showing that antihypertensive drugs were effective in controlling the variables of hypertension. the decrease in rpp in both groups, indicates the fact that antihypertensive drugs alone as well as along with pranayama decrease mvo2, which decreases the load on heart and hence cardiovascular morbidity and mortality. the decrease in rpp was more in group which practiced pranayama for 6 weeks along with antiyhypertensive drugs. these finding indicate that pranayama adds on to antihypertensive action of drugs and more decrease in rpp than antihypertensive drugs alone. the significant reduction in rpp indicates a decrease in myocardial oxygen consumption and load on heart. this can be explained on the basis of decrease in sympathetic drive to the heart. a practitioner of pranayama not only tries to breath, but at the same time, also tries to keep his / her attention on the act of breathing, leading to concentration. these acts of concentration remove his attention from worldly worries and de - stress him / her. our findings are in consistent with an earlier study which reported that yogic training produces a significant decrease in bp associated with improvement of baroreflex sensitivity and attenuation of sympathetic and rennin - angiotensin activity. this was also in accordance with the results of earlier studies where they observed a significant reduction in resting hr after 2 weeks of yogasanas and pranayama training. systolic bp, diastolic bp and mean pressure showed a significant reduction at 3 weeks of the training period. whereas in another study, pranayama training produced a decrease in basal hr but systolic, diastolic bp did not change in either pranayama group or control group though there was a significant reduction in rpp in pranayama group. hence, the results of the present study conclude that pranayama leads to better control of bp in mild hypertensive patients. the further studies are needed to explore the effects of these techniques in various stages of hypertension. | context : the modern living life - style is known to produce various physical and psychological stresses resulting in increased blood pressure (bp) and heart rate (hr). this can lead to increased myocardial oxygen demand (mvo2). mvo2 correlated best with rate pressure product (rpp). rpp is a product of hr and systolic bp.objective:the present study was conducted to evaluate the effect of relaxation in the form of pranayama on rpp in mild hypertensives.materials and methods : mild hypertensive patients were divided into two groups. group a received antihypertensive drugs for 6 weeks and group b received antihypertensive drugs along with pranayama training for 6 weeks.results:bp decreased significantly in group b (148 8.09 - 127 12.10 mm of hg) where pranayama was added. the decrease was significant as compared to group a. hr decreased significantly in both the groups as compared to baseline, however the decrease was similar in both groups. rpp decreased significantly in both groups as compared to baseline, however the decrease was significantly more (p < 0.01) when pranayama was added to antihypertensive drugs (96.73 20.53) when compared to antihypertensive drugs alone (114.66 26.30).conclusion : the pranayama produces relaxed state and in this state parasympathetic activity overrides sympathetic activity. hence, addition of pranayama can be a useful addition to antihypertensive drugs for better control of hypertension in mild hypertensives. |
open inguinal surgery can lead to high levels of intra- and post - operative pain. currently available perioperative pain management options include oral or intravenous analgesics, surgical wound infiltration, and single - shot caudal blocks. however, these treatments may yield suboptimal pain control or may be limited by the significant risk of side effects. of the commonly used oral analgesics, acetaminophen has only mild analgesic properties and has a prolonged time to onset1, 2. opioid medications are associated with somnolence, nausea, vomiting, and respiratory depression. the potential risks of caudal blocks include subcutaneous infiltration, blood vessel puncture, and dural penetration3, 4. recently, ilioinguinal / iliohypogastric (ii / ih) nerve or transversus abdominis plane (tap) blocks have attracted interest as viable alternatives3 to provide effective perioperative analgesia for open inguinal surgery. importantly, it may provide a similar duration of analgesia as a caudal block. it uses a lower dose of local anesthetic agent (0.3 ml / kg of 0.25% bupivacaine) than that used in a caudal block (1 ml / kg)4. there are two main techniques for ii / ih or tap blocks : the landmark - based method or the use of ultrasound guidance. it is difficult to identify the correct fascial plane, which may lead to the need for multiple attempts1. a failure rate of 2845% has been reported, even in experienced hands5, 6. weintraud.6 reported a mere 14% accuracy rate when local anesthetic was deposited using a landmark - based approach and subsequently imaged under ultrasound to document the location of the fluid collection. no optimal injection site along the course of the ii / ih nerve has been identified to improve the accuracy rate largely because of the fact that none of the sites studied have anatomical features that would make the clicking prominent enough to be reproducible7. in addition, landmark - based techniques are associated with a substantial risk of colonic or small bowel punctures, pelvic hematoma8, and femoral nerve palsy9. ultrasound guidance in regional anesthesia has gained popularity in recent years10, 11 and has become popular in soft tissue evaluation12,13,14 and guided injection15. it has emerged as an excellent modality to visualize the tap, ii / ih nerves, vessels, and needle, which may be beneficial in reducing the risk of intraneural, intravascular, or intraperitoneal injections. in addition, a lower dose of local anesthetic is possible because the needle placement can be confirmed. this negates the use of additional volume to offset for inaccurate needle placement6, 16. the disadvantages of an ultrasound - guided procedure include the required special equipment, training, and increased cost. the cost - benefit justification requires assessment of efficacy with ultrasound guidance in comparison with the landmark - based approach. multiple randomized controlled trials have been conducted, but often with a small sample size, heterogeneous designs, and conflicting outcomes. therefore, we conducted this systematic review and meta - analysis to summarize the current evidence, as well as to evaluate the clinical efficacy of ultrasound - guided ii / ih or tap block for perioperative analgesia in pediatric and adult patients undergoing inguinal surgery. it defined objectives, search strategy, inclusion / exclusion criteria, data extraction, outcomes of interest, and analytical approaches. the reporting of this systematic review complies with the preferred reporting items for systematic reviews and meta - analyses (prisma) statement17, 18. comprehensive searches were performed on pubmed, ovid medline, ovid embase, ovid cochrane central, web of science, and scopus from the inception of the database through march 8, 2015. each concept used a combination of controlled vocabulary (mesh and emtree) combined with text words for each database that uses subject heading (pubmed, medline, embase, central). the subject headings included inguinal canal, hernia, inguinal, inguinal hernia and the text words inguinal, ilioinguinal, or iliohypogastric. similarly, the concept of pain and ultrasound guidance included nerve block, pain, and postoperative and the text words for ultrasound included echogram, ultrasound, and ultrasono. each search was imported into endnote (thomson reuters research soft), which is a bibliographic database manager. we included randomized controlled trials (rcts), which compared the clinical efficacy of ii / ih nerve or tap block using ultrasound guidance vs. landmark - based technique for perioperative analgesia in patients following open inguinal surgery. articles focusing on the therapeutic effect of ultrasound - guided ii / ih nerve block for chronic inguinal pain were excluded. articles focusing on the comparison of ultrasound - guided ii / ih nerve or tap block and wound infiltration were also excluded. two reviewers (y.w. and m.t.), working independently and in duplicate, reviewed titles and abstracts, followed by full texts in order to exclude irrelevant studies. all conflicts were discussed and resolved with a third author (w.q.). the same two reviewers extracted study details from the full text studies using a standardized pilot - tested form. the following data were extracted : the author, year of publication, study location, sample size, patient characteristics (gender, age), general anesthesia, regional anesthesia, timing of regional anesthesia, the surgery performed, and outcome measures, including the number of patients receiving additional analgesia during surgery and the pain scores of patients during day - stay. we used the cochrane risk of bias tool to assess the methodological quality of the included rcts in terms of sequence generation, allocation concealment, blinding, incomplete outcome data, selective outcome reporting, and other sources of bias19. for the continuous outcomes (pain scores), we combined the standardized mean difference (smd) from the included studies using the der simonian and laird random - effect models20. we also calculated the odds ratio (or) for dichotomized outcomes and the pooled or using the der simonian and laird random - effect models. although we planned to assess publication bias by visually inspecting funnel plots and by conducting the egger regression asymmetry test, we were unable to conduct these tests because of the limited number of included studies22. all statistical analyses were conducted using stata version 12.1 (stata corp lp, college station, tx, usa). we identified 139 articles, which included four rcts7, 23, 24, 25 conducted between 2005 and 2014 that were eligible for this review (fig. 1.flowchart of enrolled studies on ultrasound - guided ii / ih nerve or tap block for peri - operative analgesia in pediatric patients undergoing inguinal surgery). the characteristics of the enrolled studies are described in table 1table 1.the characteristics of the enrolled studiesfirst authorpublish yearcountrysample sizepatients ageregional anesthesiatiming of anesthesiasurgerystudy designstudy conclusionconventional nerve block groupultrasound - guided ii / ih nerve or tap blockwillschke.72005austria1001 month 8 yearslandmark ii / ih nerve block : 0.25% levobupivacaine 0.3 ml / kgus - guided ii / ih nerve block : 0.25% levobupivacaine 0.19ml / kgbefore surgeryinguinal hernia repair, orchidopexy or hydrocele repairrctultrasound - guided ii / ih nerve blocks can be achieved with significantly smaller volumes of local anaestheticsaveline.252011france2733183 yearsii / ih block by the loss - of - resistance technique : 0.5% levobupivacaine (1.5 mg / kg)ultrasound - guided tap block : 0.5% levobupivacaine (1.5 mg / kg)before surgeryunilateral open inguinal hernia repairrctultrasound - guided tap block provided better pain control than blind ii / ih block after inguinal hernianan.242012china10048 yearslandmark ii / ih nerve block : 0.8% lidocaine and 0.25% levobupivacaine 0.3 ml / kgus - guided ii / ih nerve block : 0.8% lidocaine and 0.25% levobupivacaine 0.2 ml / kgbefore surgeryunilateral inguinal hernia repair, hydrocelectomy, or orchidopexyrctus - guided ii / ih nerve block can lower the quantity of local anesthetic and alleviate the medicinal toxicitydemirci.232014portugal401880 yearslandmark- ii / ih nerve block : 20 ml of 0.5% levobupivacaineih / ii nerve block with the us guided : 20 ml of 0.5% levobupivacainebefore surgeryinguinal hernia repairrctus guided ii / ih nerve block in adult are more effective than landmark technique. all patients underwent open surgeries, including inguinal hernia repair, orchidopexy, hydrocelectomy, and hydrocele repair. all patients received general anesthesia that was maintained by halothane or sevoflurane in nitrous oxide and oxygen. all patients were randomized into one of two technique groups : ultrasound - guided group and landmark - based group. the procedures of the control group were performed using a landmark - based technique. all ii / ih nerve or tap blocks in both groups were performed before surgery. flowchart of enrolled studies on ultrasound - guided ii / ih nerve or tap block for peri - operative analgesia in pediatric patients undergoing inguinal surgery all of the studies reported a low risk of bias in terms of incomplete outcome data and selective outcome reporting. however, patients and care providers were not blinded to half of the included studies and the remaining studies did not report the blinding at all. we were also unable to evaluate publication bias because of the small number of studies included in the analyses. in summary, the risk of bias within the studies was medium as a result of potential publication bias and unknown quality. four studies were included in the meta - analysis3, 7, 23, 24 of which blocked the ii / ih nerve and 125 blocked the tap using either an ultrasound - guided or landmark - based technique. a total of 513 patients were randomized into either one of the two technique groups for ii / ih nerve or tap block : ultrasound - guided group (n = 245) or landmark - based group (n = 259). of the 313 adult patients, 154 were in the ultrasound - guided group and 159 were in the landmark - based group. patients who received an ultrasound - guided ilioinguinal / iliohypogastric nerve block were significantly less likely to have intraoperative additional analgesia with an or = 0.21 (95% ci : 0.09 to 0.49 ; p < - stay units, the pain score of the ultrasound - guided ii / ih or tap block group was significantly lower than that of the control group with smd = 0.96 (95% ci : 1.68 to 0.24 ; p < the use of rescue drugs was also significantly lower in the ultrasound - guided group (or = 0.16 ; 95% ci : 0.06, 0.40 ; p < 0.001, i = 10.2%). we found no significant difference in the number of satisfied patients (p = 0.84) (table 2table 2.comparison between ultrasound - guided and landmark - based ii / ih or tap blocksoutcomesmeasurees95% ciineed intraoperative additional analgesiaor0.210.09, 0.490.0%painscores duringday - staysmd0.961.68, 0.2488.3%need rescue drugor0.160.06, 0.4010.2%patientsatisfactionor1.080.49, 2.38n / a p<0.05). this meta - analysis shows that ultrasound - guided ii / ih nerve or tap block is associated with reduced use of intraoperative additional analgesia, reduced pain in day - stay units, and reduced use of rescue drugs. this improved efficacy is most likely associated with improved proximity of needle placement and local anesthetic agent deposit to ii / ih nerves. landmark - based ii / ih nerve block has a low success rate largely because of the highly variable course of the ii / ih nerves as shown by cadaver studies26. in addition, only two muscle layers could be identified in some patients in the common injection sites where the external oblique abdominal muscle is only an aponeurosis. thus, the click feeling may not be a reliable way to target the fascial plane between the internal oblique abdominal muscle and the transversus abdominis muscle. in contrast, ultrasound - guided ii / ih nerve block could target the ii / ih nerve with more accuracy because of the high - resolution imaging of the soft tissue. the abdominal wall layers in addition to the ii / ih nerves themselves can often be detected on real - time ultrasound. the real - time visualization of the injectant flow assists with the final adjustment of the needle position for optimal distribution of the local anesthetic solution to the nerves lying under the fascia of the transversus abdominis muscle. the significant decrease in intra - operative analgesia is of great value for patients undergoing open inguinal surgery. fentanyl and morphine are commonly used for additional intraoperative and post - anesthesia care unit (pacu) pain control. they are associated with common side effects including nausea, vomiting, and respiratory depression23. the lowest effective amount of local anesthetics for a peripheral block is particularly important in pediatric patients because of an increased risk of toxicity secondary to a higher level of the unbound fraction of the local anesthetic in a younger age. with ultrasound guidance, successful peripheral nerve blocks have been reported with a lower dose of local anesthetics, compared with non - guided techniques27. during the last two decades, ultrasonography has also been widely used to evaluate the soft tissues of the musculoskeletal system 28,29,30. ultrasound guidance in regional anesthesia has been recognized as a cost - effective modality and is recommended as the preferred nerve block technique in larger anesthetic departments. access to equipment and training has dramatically improved over the past few decades as a result of regional anesthesia fellowship programs, as well as workshops offered by various academic societies and groups. while the application of ultrasound guidance in perioperative pain control is expanding, this study provides evidence in support of using ultrasound - guided ii / ih nerve or tap blocks in managing perioperative open inguinal surgery pain. although we conducted a comprehensive search of five databases, only four studies were included in this review. in addition, we were unable to test potential publication bias as a result of the small number of studies. overall, using the grades of recommendation assessment development and evaluation (grade) framework, the overall quality of the evidence is moderate because of the likelihood of publication bias. in summary, the findings of this meta - analysis suggest that ultrasound - guided ii / ih nerve or tap blocks are associated with improved perioperative analgesia in patients following inguinal surgery compared with landmark - based techniques. while large medical centers may have already adopted the use of ultrasound for guidance in nerve blocks, it should be noted that more anesthesia practices may benefit from ultrasound - guided ii / ih nerve or tap block techniques in the management of perioperative pain associated with open inguinal surgeries. | [purpose ] ultrasound - guided ilioinguinal / iliohypogastric (ii / ih) nerve and transversus abdominis plane (tap) blocks have been increasingly utilized in patients for perioperative analgesia. we conducted this meta - analysis to evaluate the clinical efficacy of ultrasound - guided ii / ih nerve or tap blocks for perioperative analgesia in patients undergoing open inguinal surgery. [subjects and methods ] a systematic search was conducted of 7 databases from the inception to march 5, 2015. randomized controlled trials (rcts) comparing the clinical efficacy of ultrasound - guided vs. landmark - based techniques to perform ii / ih nerve and tap blocks in patients with open inguinal surgery were included. we constructed random effects models to pool the standardized mean difference (smd) for continuous outcomes and the odds ratio (or) for dichotomized outcomes. [results ] ultrasound - guided ii / ih nerve or tap blocks were associated with a reduced use of intraoperative additional analgesia and a significant reduction of pain scores during day - stay. the use of rescue drugs was also significantly lower in the ultrasound - guided group. [conclusion ] the use of ultrasound - guidance to perform an ii / ih nerve or a tap block was associated with improved perioperative analgesia in patients following open inguinal surgery compared to landmark - based methods. |
it is shown to be more common in people of hispanic origin and among asians.1 treatment of melasma is unsatisfactory most of the times, even by tolerating various side effects such as contact dermatitis, irritation, and scarring.13 according to the most recent cochrane review, evidence shows insufficiency to provide robust guidance for practice, and more randomized clinical trials are needed in the field of melasma treatment.4 the range of treatments investigated for melasma covers all systemic, procedural, and topical modalities. topical treatments have their own advantage over systemic therapies being among the most common interventions investigated and used for treating melasma.4 hormonal role is shown to exist in pathogenesis of the melasma.58 therefore, flutamide as an anti - androgenic agent may theoretically be considered to have an effect in treating melasma. a safe way to assess such an effect would be to use its topical form. the aim of this study was to investigate efficacy of 1% flutamide cream versus 4% hydroquinone cream on melasma. a parallel randomized clinical trial design was conducted to compare the effect of topical hydroquinone, as the standard treatment of melasma, with topical flutamide as the new test treatment. the study participants comprised 74 women with melasma referred to a private dermatology clinic in ardabil from 2010 to 2013. melasma was diagnosed by an experienced dermatologist and wood s light examination was done to assess the depth. the following criteria were set for excluding the subjects from the study : pregnancybreastfeedinguse of oral contraceptives, spironolactone, or phenytoinbeing treated with tretinoin through the last 3 weeksbeing treated with hydroquinone through the last 6 monthshydroquinone hypersensitivity reactionsdrug or alcohol addictionhepatic disease. use of oral contraceptives, spironolactone, or phenytoin being treated with tretinoin through the last 3 weeks being treated with hydroquinone through the last 6 months hydroquinone hypersensitivity reactions drug or alcohol addiction both the patients and outcome assessors were blinded to the treatment type. to ensure the blinding, both the hydroquinone and flutamide cream tubes were produced in the same size and appearance. randomly permuted blocks were generated using ralloc module in stata 11 statistical software package and patients were allocated to receive either 1% flutamide topical cream or 4% hydroquinone topical cream.9 after baseline assessments, patients in both the groups were treated for 4 months. the active treatment group received 4% hydroquinone cream (sobhan daru drug industries, rasht, iran) at nights after cleaning the face. through the day, after cleaning the face, a sunscreen with sun protection factor (spf) 30 (ardene, pars haiat industries, tehran, iran) was used three times, 1 g each time at 9, 12, and 15 oclock. this treatment was continued for 4 months and melasma status was assessed at the end of each month. the patients in test trial group received 1% flutamide cream (produced by tabriz faculty of pharmacy, iran) at nights after cleaning the face. pigmentation reduction as the primary outcome of the study was assessed through various methods analyzed and reported as follows : melasma area and severity index (masi) : this method is a relevant method of assessing improvement of melasma after treatment.10mexameter melanin assay : mexameter was used to assess pigmentation in five facial locations : cheeks (left and right), forehead, upper lip, and nasal area. at the baseline, these points were marked on a facial mapping sheet in patient records in order to repeat the measurements on the same points through the follow - up assessments. the mexameter scores recorded for each location was then averaged to form a total score. mexameter examination was done in a semidark room and after cleaning the face with water and soap.patient satisfaction : the patient satisfaction was assessed through five likert - type scale questions : 1 improvement of melasma patches ; 2 satisfaction with drug and potential side effects ; 3 skin succulence improvement ; 4 skin darkness improvement ; and 5 overall satisfaction with treatment. melasma area and severity index (masi) : this method is a relevant method of assessing improvement of melasma after treatment.10 mexameter melanin assay : mexameter was used to assess pigmentation in five facial locations : cheeks (left and right), forehead, upper lip, and nasal area. at the baseline, these points were marked on a facial mapping sheet in patient records in order to repeat the measurements on the same points through the follow - up assessments. the mexameter scores recorded for each location was then averaged to form a total score. mexameter examination was done in a semidark room and after cleaning the face with water and soap. patient satisfaction : the patient satisfaction was assessed through five likert - type scale questions : 1 improvement of melasma patches ; 2 satisfaction with drug and potential side effects ; 3 skin succulence improvement ; 4 skin darkness improvement ; and 5 overall satisfaction with treatment. per - protocol analysis was run and data were analyzed using stata version 11 statistical software package (statacorp lp, college station, tx, usa). to study the trend of masi and mexameter outcome scales, measured repeatedly over time, mixed - effects models were selected to analyze the longitudinal data. nonparametric tests of comparing numeric scales were applied to compare the effect of topical flutamide and hydroquinone on patient satisfaction. a p - value < 0.05 was considered to be statistically significant. the study protocol was approved by regional committee of ethics in ardabil university of medical sciences. the study was registered in iranian registry of clinical trials clinical registration center approved by the world health organization under the number irct138905114310n4. mean age of the participants was 33.8 years with a standard deviation (sd) of 6.7 years (range : 2052 years). mean (sd) of age was 33.2 (6) years in flutamide group versus 34.4 (7.4) years in hydroquinone group. the percentage of child birth history was 92.7% for flutamide group compared with 88.5% in hydroquinone group. mean length of time suffering from melasma was 96.3 months (sd 69.5) and this time did not differ significantly between the trial groups. the subjects reported an average 1.1 hours per day of exposure to sunlight (sd 1). the mean exposure time for the past 24 hours prior to participation in the study was 1.4 hours (sd 1.3). mean standardized total patient satisfaction score was 28.8 (sd 17.2) in flutamide group patients versus 18 (sd 15.5) in control group (p<0.01). when compared with the control group, median satisfaction rank was significantly higher in flutamide group patients in all the four satisfaction items : 1 improvement of melasma patches (p<0.01) ; 2 satisfaction with drug and side effects (p<0.01) ; 3 skin succulence improvement (p<0.05) ; and 4 skin darkness improvement (p<0.01). total dissatisfaction was observed in 35% of hydroquinone group patients versus 22% in flutamide group, nevertheless, the observed difference in this measure was not statistically significant (intervention risk ratio [rr ] : 0.63, 95% confidence interval [ci ] : 0.31.3). regardless of the treatment group, the skin darkness assessed upon masi scales was reduced over the treatment course (p<0.001). similarly, the total percentage of the face area involving melasma did not also change significantly over the time period of investigation. the trend of change in skin darkness compared for flutamide and hydroquinone is shown in figure 1a. the trend of variations in skin homogeneity measurements compared for flutamide and hydroquinone is shown in figure 1b. the masi score had a decreasing trend over the treatment course for both the groups (figure 2). descriptive results of melanin measurement compared for flutamide and hydroquinone are given in table 2. using mixed effects, longitudinal modeling showed better treatment efficacy based on masi scale for flutamide group compared to the hydroquinone group (p<0.05). however, longitudinal analysis of mexameter scores did not reveal any significant difference in melanin measurements between flutamide and hydroquinone. the results of present study confirmed that both the hydroquinone and flutamide creams were effective in treating the melasma. however, flutamide appeared to have higher efficacy than hydroquinone with respect to the patient satisfaction score as well as the masi scale score. several randomized clinical trials have been conducted in recent years, to compare hydroquinone with other alternatives. most studies revealed that hydroquinone cream had higher efficacy compared to new treatments (table 3). nonrandomized clinical trials have also been conducted, the results of which should be interpreted cautiously. in a mexican 12-week study, the patients who received 1% dioic acid cream were compared with those receiving 2% hydroquinone cream according to masi score. no significant difference between treatments were observed and the side effects were similar ; however, pruritus was more common in hydroquinone group.11 another nonrandomized study had compared the clinical efficacy and safety of the association of belides, emblica, and licorice 7%, with hydroquinone 2% in the treatment of melasma. similarly with the mexican study, this study also did not reveal the superiority of the new alternative even to the 2% hydroquinone treatment.12 contrary to most melasma studies, these two studies used 2% hydroquinone twice daily. use of recommended 4% hydroquinone might have changed the results of testing the hypothesis of different efficacy. some studies have investigated the efficacy of hydroquinone with other agents mostly reporting higher efficacy of combined treatments ; however, the cost - effectiveness of these treatment needs to be investigated in more detail.1315 in the present study, topical flutamide was shown to be relatively safe when compared with hydroquinone. although the present study seems to be the first study published on the efficacy of topical flutamide in treating melasma, flutamide in its topical or oral forms has been used earlier for treatment of acne, hirsutism, and hair loss with promising results in human and animal studies.1618 the preliminary results of an ongoing case control study by the authors are also in line with the role of androgenic disorders in melasma. considering some ambiguity in etiologic mechanisms of melasma, it is also very hard to understand the exact mechanism of action observed for the effect of flutamide on melasma. the initiative behind this trial was the available clinical experience of improved melasma coexisting with acne when the patients were treated with flutamide. there is theoretical evidence of potential association between melasma and other androgenic - related conditions such as acne, polycystic ovarian disease, and hirsutism. the mechanism behind the effect may lie in modifications on alpha - melanocyte - stimulating hormone or cyclic adenosine monophosphate - elevating agents affecting the melanin synthesis ; however, both future animal and clinical studies are recommended to investigate the mechanism in detail.19,20 a case report has also been published on possible effects of topical flutamide in pigmentation problems.21 the use of topical drugs are much more attractive for dermatologists because there is the potential for relatively mild systemic adverse effects during topical use of drugs. topical flutamide would be more safe compared to its oral form taking into account potentials for severe side effects when oral flutamide has been used.22 as the present study is possibly the first clinical experience on efficacy of topical flutamide on melasma, it would be quite unreasonable to recommend the product for clinical use before future studies replicate the results on its efficacy and safety. all three types of outcomes used in present study to assess the treatment efficacy have been shown to be relevant outcomes for such purpose.1 while patient satisfaction is a subjective assessment, masi is a semiquantitative objective scale and mexameter assessment is a full quantitative and objective measure. masi has been the most common endpoint for evaluation of the treatment effect in randomized clinical trials on melasma. soft subjective endpoints such as patient satisfaction, although criticized in earlier decades to be used in clinical trials, have gained more attention in recent years. moreover, the more the patients are satisfied with the treatment, the more likely they are to comply with medical treatment ensuring to have a better outcome.23,24 it seems that as beauty turns to be a major demand in the field of dermatology, and especially with respect to pigmentation disorders, it would be quite critical to include patient satisfaction among the evaluation outcomes of melasma improvement preferably along with the objective measures such as masi. the present study investigated patient satisfaction as a subjective soft endpoint, masi as a semiquantitative objective measure as well as full - quantitative objective measure of skin melanin by mexameter the length of study was decided to be 120 days ; however, future longer studies may yield more information to build the evidence. moreover, as it was the first time flutamide was being used for melasma treatment, a study with much larger sample size was not planned, but considering the preliminary promising results of the present study, larger clinical trials could now be planned in order to better depict the potential applicability of topical flutamide. topical flutamide appeared as effective as topical hydroquinone in treating melasma with higher patient satisfaction. as the present study is possibly the first clinical experience on efficacy of topical flutamide on melasma, it would be quite unreasonable to recommend the product for clinical use before future studies replicate its results on efficacy and safety. | backgroundtreatment of melasma is unsatisfactory most of the times. hormonal role is shown to exist in pathogenesis of the melasma, and sex - hormone related drugs may have an effect on melasma.aimto investigate efficacy of 1% flutamide cream versus 4% hydroquinone cream on melasma.methodsin a parallel randomized clinical trial, 74 women with melasma were allocated to receive a sunscreen along with 4% hydroquinone cream or 1% flutamide cream. melasma area and severity index (masi), mexameter melanin assay, and patient satisfaction were investigated.resultsmean age of the participants was 33.8 years. mean length of time suffering from melasma was 96.3 months. the subjects reported in average 1.1 hours per day of exposure to sunlight. mean standardized total patient satisfaction score was 28.8 (standard deviation [sd ] 17.2) in flutamide group patients versus 18 (sd 15.5) in control group (p<0.01). regardless of treatment group, the skin darkness assessed upon masi scales was reduced over the treatment course (p<0.001). using mixed effects, longitudinal modeling showed better treatment efficacy based on masi scale for flutamide group compared to the hydroquinone group (p<0.05). however, longitudinal analysis of mexameter scores did not reveal any significant difference in melanin measurements between flutamide and hydroquinone.conclusiontopical flutamide appeared as effective as topical hydroquinone in treating melasma using mexameter assessment but with a better masi improvement trend and higher patient satisfaction in flutamide treatment versus topical hydroquinone. as the present study is possibly the first clinical experience on efficacy of topical flutamide on melasma, it would be quite unreasonable to recommend clinical use of it before future studies replicate the results on its efficacy and safety. |
the cancer stem cell hypothesis assumes that cancers originate from mutated tissue stem cells (scs) that have dysregulated self - renewal properties, and thus selectively drive tumor growth. current chemotherapeutic agents and radiation therapy target the rapidly dividing cells that form the bulk of the tumor but do not target the relatively quiescent cancer stem cell (csc), thus possibly accounting for treatment failures. furthermore, both scs and cscs appear to have multidrug resistance, antiapoptotic machinery, and enhanced dna repair allowing them to evade conventional treatments [14 ]. thus, to target tumors effectively and with minimal toxicity, drugs need to be identified that specifically target the relatively rare csc population while sparing normal tissue stem cells. the properties that cscs are postulated to exhibit are : (1)tumorigenic capacity or self - renewal, (2)the potential for multilineage differentiation (such that they can recapitulate the multiple tumor cell types found in the parent tumor), (3)serial passage, and (4)expression of a unique repertoire of surface markers that allow for their reliable identification and purification. specifically, the csc hypothesis posits that within a given tumor, only a distinct phenotypic subset of cells has tumorigenic capacity, that is, injection of this cell fraction into nude mice is able to fully recapitulate the parent tumor. currently, serial passage in xenotransplantation models is the gold standard assay for defining the csc fraction. normal tissue scs tightly regulate the balance between self - renewal and differentiation, and quiescence and proliferation (reviewed in [7, 8 ]). sc number, in the context of the stem cell niche, is precisely maintained via the ratio of symmetric and asymmetric cell divisions. dysregulation of self - renewal pathways appears to result in csc overpopulation [9, 10 ]. this may be due to an increase in symmetric divisions of the csc and may represent a potential drug target [11, 12 ]. as has been well characterized in the hematopoietic system, the cells within solid organs appear to demonstrate a hierarchy in which stem cells give rise to committed progenitor cells which give rise to rapidly proliferating cells which give rise to terminally differentiated cells. as scs mature from a self - renewable stem cell to a terminally differentiated cell, they progressively lose their ability for self - renewal and pluripotency but gain mitotic activity. by analogy to normal tissue scs, cscs must able to give rise to all of the different cell types that comprise a given tumor, lending credence to the idea that tumors can be viewed as aberrantly functioning complex organs. tumor heterogeneity is likely a consequence of ongoing accumulation of mutations over time that result in variable degrees of cellular differentiation. mutations in fundamental self - renewal pathways, such as the hh pathway, likely cause normal stem cells to become independent of regulatory signals that are generated by their microenvironment. these pathways play a critical role in development and are usurped by transformed cells for tumor initiation, progression, and metastasis. the hedgehog proteins are secreted signaling proteins that were initially identified in drosophila as segment polarity genes. in multiple tissue types, the hh pathway plays a key role in organogenesis, patterning, and stem cell maintenance. depending upon context, hh can function both as a morphogen and a mitogen. as a morphogen,, it drives the proliferation of precursor cells and mediates the interaction between the epithelial and mesenchymal compartments. in multiple tissue types the components of the hh signal transduction machinery have been elucidated, and while there are some important differences across species, the pathway remains relatively well conserved between drosophila and higher organisms. three secreted hh ligands have been identified in humans, sonic hedgehog (shh), indian hedgehog (ihh), and desert hedgehog (dhh) and are known to signal in an autocrine and paracrine manner. in the absence of hh ligand, patch (ptch), the hedgehog receptor binds and inhibits smoothened (smo) and binding of the hh ligand to ptch releases smo and allows for further propagation of the signal, leading to target gene transcription through three gli transcription factors, gli1, gli2, and gli3. gli proteins regulate target gene expression by direct association with a consensus sequence located within the promoter of the target genes. thus, ptch is a negative regulator and smo a positive regulator of the pathway. intriguingly, in mammals, it appears that protein components of the primary cilium are required for the coordination of hedgehog signaling [15, 16 ]. loss of function mutations in the hh receptor, ptch, were initially noted in patients with gorlin syndrome or basal cell nevus syndrome [17, 18 ]. gorlin patients have a variety of developmental defects and have an increased incidence of benign and malignant tumors including basal cell carcinomas (bcc), medulloblastomas, ovarian fibromas, rhabdomyosarcomas, and meningiomas. a large majority of sporadic medulloblastomas and basal cell carcinomas also exhibit hyperactive hh signaling (in a ligand - independent fashion) due to mutations in hh pathway components including, ptch, smo, and occasionally suppressor of fused (sufu), a negative regulator of the hh pathway. in clinical trials, smo inhibitors have now been demonstrated to have potent antitumor activity in patients with bcc and one patient with medulloblastoma, thus confirming an oncogene addiction model in which deregulated hh signaling results in increased cell proliferation and tumor formation [20, 21 ]. there is now a growing body of evidence that the hh pathway is activated in a variety of other solid tumors including colorectal, pancreatic, breast, and small cell lung cancer and hepatocellular carcinoma [2228 ]. unlike bcc and medulloblastoma, hh activation in these tumor types both in vitro and in vivo, hh pathway activation appears to impact tumor progression via effects on cell proliferation, cell survival, angiogenesis, invasion, and genetic instability. given that this data has been reviewed recently and comprehensively [14, 19, 29 ], we will focus on the role of hh signaling in cancer stem cell expansion and maintenance with a focus on pancreatic cancer and hepatocellular carcinoma (hcc). increased hh pathway activity was first documented in early pancreatic cancer by thayer. where the degree of shh expression in the ductal epithelium was noted to positively correlate with degree of atypia. while shh expression appeared to be confined to the epithelium, increased ptch expression was seen in the abnormal epithelium and the surrounding mesenchymal cells suggesting both an autocrine and paracrine mechanism of signaling. furthermore, treatment of pancreatic cancer cells lines with the smo inhibitor, cyclopamine, resulted in decreased cell proliferation and increased apoptosis further supporting autocrine signaling. in vivo, cyclopamine treatment of pancreatic tumor xenografts resulted in decreased tumor mass suggesting an important role for hh signaling in cell survival and proliferation. a series of experiments that have been performed to further define an epithelial versus stromal role for hh signaling have led to contradictory results. demonstrated that in both colon and pancreatic adenocarcinomas, epithelial tumor cells secrete high levels of hh ligand in comparison to normal tissue controls. hh pathway activation is noted in the neighboring stromal cells but not in the epithelial cells consistent with a paracrine signaling mechanism. in addition, expression of an oncogenic allele of smo in the pancreatic epithelium did not result in hh pathway activation and had no impact on the development of pancreatic neoplasia, while smo activation in the mesenchyme led to hh pathway activation. taken together, these data suggest that only the stromal compartment is competent to activate hh signaling. while this data is consistent with hh signaling in cscs, which do not express markers of epithelial differentiation, these results conflict with considerable evidence for ligand - dependent hh - signaling in epithelial cells of multiple other tumor types. these discrepancies may be explained in part by differing mouse models, human tumor xenografts versus transgenic models of spontaneous carcinomas. clearly, further study is required to define the precise mode of hh signaling, as it will have important ramifications for drug development. in order to determine whether increased hh activity is a property of all pancreatic tumor cells or is selective for the csc, li. demonstrated, using quantitative real time - pcr, that shh transcripts were 4-fold upregulated in the bulk pancreatic xenograft cells and 43-fold upregulated in the cd44+cd24+esa+ pancreatic csc as compared with normal pancreatic epithelial cells. active hh signaling has now also been identified in the cscs from glioblastoma and breast tumors and modulation of hh pathway activity in these cell types results in decreased tumorigenic potential and depletion of the csc compartment [3436 ]. in development, both the pancreas and the liver are specified by domains of the gut endoderm. embryonic outgrowths of the dorsal and ventral regions of the foregut endoderm give rise to the endocrine and exocrine pancreas. the liver, however, derives solely from the ventral foregut endoderm [37, 38 ]. using embryo tissue explant assays, it has been shown that the default fate of the ventral endoderm is to activate the pancreatic organogenesis program. in the developing embryo, the ventral foregut becomes closely apposed to the cardiac mesoderm, and this proximity is required for liver specification. fgf signaling from the cardiac mesoderm induces the local production of sonic hedgehog, and bmp signaling from the underlying septum transversum mesenchyme cells coordinately directs the development of the liver bud and inhibits pancreas development. conversely, treatment with the bmp inhibitor, noggin, enhances pancreatic gene expression and suppresses hepatic gene expression in ventral foregut explants [39, 40 ]. these multiple signaling pathways direct endoderm patterning via induction of specific transcription factors. the forkhead box a proteins (foxa) are transcription factors expressed in endoderm derived tissues and are required for hepatic, pancreatic, and pulmonary specification. transcriptional activation of foxa2 is directly regulated by the hedgehog target genes, gli proteins, providing support for its central role in hepatic organogenesis. the liver bud then gives rise to cells destined to become bipotential liver progenitor cells, or hepatoblasts, which give rise to two distinct lineages, hepatocytes and cholangiocytes. a comparison of pluripotent, murine embryonic stem (es) cells, endodermally lineage - restricted es cells, and mature hepatocytes suggests that hedgehog activity is progressively silenced as progenitors differentiate into mature liver parenchymal cells. treatment of hepatic progenitors isolated from human livers (epcam+ cell fraction) with cyclopamine results in increased cellular necrosis and apoptosis, demonstrating that hh activity is required for optimal viability of the progenitor cells. while minimal hh ligand production is seen in healthy, human hepatocytes, the small resident progenitor population within the normal adult liver, residing along the canals of hering, continues to demonstrate expression of hh ligands, and hh - responsive target genes [44, 45 ]. hh signaling is reactivated in the liver after acute or chronic liver injury when major reconstruction of the adult liver is required. moreover, the degree of hepatic production of hh ligands and accumulation of hh responsive cells is typically proportionate with the severity of liver damage and fibrosis. immunohistochemical analysis of diseased human livers, such as those from patient with chronic viral hepatitis, alcoholic liver disease, and nonalcoholic fatty liver disease [44, 48 ], confirms that hh signaling and the number of hh responsive cells is increased in the presence of injury. the hh - responsive cells are noted in the expanded progenitor and stromal cell compartments, suggesting that these cells actively contribute to regenerative processes in adult livers. this was confirmed by treating healthy, adult mice with cyclopamine after 70% partial hepatectomy, which provides a tremendous regenerative pressure. in comparison to vehicle control, inhibition of hh signaling after partial hepatectomy prevented normal liver regeneration by blocking progenitor expansion and fibrogenic liver repair. notably, cyclopamine - treated animals were unable to reconstitute their liver mass, and there was significant mortality in the group 48-hours postpartial hepatectomy in comparison to vehicle treated controls. furthermore, in rodent models of liver injury, once the offending agent is removed, hh ligand levels decline and hh - responsive cells gradually regress as normal liver architecture is restored [50, 51 ]. taken together, these data suggest that in the setting of acute injury, transient activation of the hh pathway is necessary for effective regeneration of the adult liver (figure 1). however, chronic or persistent injury results in prolonged increases in hh signaling, thus perpetuating the expansion of myofibroblasts and liver progenitor cells which contribute to fibrotic repair or cirrhosis. this data has significant implications for the development of hcc as cirrhosis is the most important determinant of risk for the development of hcc. expression of shh is noted in approximately 60% of hccs and expression of the hh target genes, gli1 and ptch, was noted in 50% of tumors suggesting that the hh pathway is activated in hcc. in three hcc cell lines, hep3b, huh7, and plc / prf/5, with detectable expression of hh target genes, treatment with hh neutralizing antibodies or no effects on cell viability were noted in the two hcc cell lines that lacked hh signaling, demonstrating that the results were specific to the hh pathway [27, 28 ]. in multiple tissue types, wnt pathway activity is also crucial to the maintenance of the stem cell compartment and a complex interaction of wnt, notch, hedgehog, and bmp signaling regulates the balance between stem cell renewal and cellular differentiation [52, 53 ]. while the role of wnt signaling in liver scs remains poorly understood, prior work in a mouse model of chronic liver injury has demonstrated that wnt ligand induction is localized to postnatal hepatic progenitors both in vitro and in vivo. abnormal regulation of the wnt signaling pathway has been extensively described as a key early carcinogenic event in hcc development. multiple groups have demonstrated that hccs harbor activating mutations of -catenin, a transcription factor in wnt signaling, or inactivating mutations of axin1 and axin2, negative regulators of this pathway [5560 ]. furthermore, treatment with anti - wnt-1 antibodies dose dependently inhibits the viability and proliferation of wnt-1 overexpressing hcc cell lines, huh7 and hep40, but not normal hepatocytes. intratumoral injection of anti - wnt-1 antibody also suppresses tumor growth in a huh7 xenograft model via induction of tumor cell apoptosis. further studies will be required to clarify the role of wnt signaling in liver cscs. taken together, these data suggest that stem cell renewal pathways such as hh and wnt are upregulated in the setting of chronic liver injury and result in the expansion of liver progenitor populations. ongoing production of ligand confers a survival advantage to these immature cells, some of which may eventually become tumor - initiating cells for primary liver cancers [62, 63 ]. this model of cancer in which neoplasia is the result of overexuberant tissue repair is supported by the strong association between chronic tissue injury and cancer incidence. this association is particularly robust in hepatobiliary cancers, where exposure to a variety of toxins [65, 66 ], chronic infections [46, 67, 68 ], and inflammatory conditions [69, 70 ] significantly increases cancer risk. in the setting of ongoing injury, expansion of the progenitor pool persists allowing for the accumulation of genetic or epigenetic events that constitutively activate the stem / progenitor cell compartment, thus resulting in tumor initiation (figure 2). investigators have now identified multiple markers that have been used to successfully enrich the csc fraction from hccs [52, 71, 72 ]. genetic alterations in self renewal and pluripotency pathways, including wnt/-catenin, notch, hh, myc, and tgf-, have been documented in these cells. furthermore, epigenetic changes including alterations in dna methylation patterns and the aberrant expression of both oncogenic [77, 78 ] and tumor suppressive micrornas have been shown to contribute to hepatocarcinogenesis. these results beg the question : would targeting the tissue sc be an effective chemoprevention strategy ? ontologically, a stem cell - like cell is an ideal target for transformation due to their capacity for self - renewal and long life. pathways such as hedgehog, notch, and wnt have well established roles in organogenesis and normal stem cell renewal (reviewed in [13, 80, 81 ]). growing evidence suggests that these pathways are dysregulated in transformation and thus contribute to tumor initiation, tumor maintenance, and metastasis of multiple tumor types [22, 23, 8286 ]. furthermore, as a consequence of self - renewal, stem cells persist for long periods of time, likely allowing them to accumulate the numerous mutations necessary for transformation. but the ultimate origins of cscs remain controversial at this time. whether cscs arise from existing tissue stem cells, restricted progenitor cells, or from mutations in terminally differentiated cells, resulting in dedifferentiation likely depends on context (reviewed in [8, 88 ]). nonetheless, each of these scenarios is consistent with the idea that distinct population of cells with stem cell properties is essential for the development and perpetuation of various human cancers. utilizing a xenograft model of primary pancreatic adenocarcinoma, li. purified a subpopulation of cd44+cd24+esa+ pancreatic cancer cells (approximately 0.2%0.8% of the total cell number) that demonstrated the requisite csc properties of self - renewal, tumorigenic capacity, and production of phenotypically diverse progeny. combinatorial approaches demonstrated that the cells expressing all three markers had the highest tumorigenic potential, and the percentage of cells expressing all three markers remained constant with serial passage. these three markers have been previously used to mark cscs in other tumor types and are known to act as cell adhesion molecules with multiple signaling functions (reviewed in). however, the role of cscs may not be confined to tumor initiation and growth, but may also play a role in metastases. previous studies had demonstrated that in colon cancer and brain tumors, cd133 + marks the csc population [9, 10, 89 ]. hermann. demonstrated that the tumorigenic potential of pancreatic cancer is restricted to cd133 + cells, as they recapitulate the original tumor when injected into athymic mice. in addition, they identified a subpopulation of cd133+cxcr4 + pancreatic cancer cells from human pancreatic cancer tissue samples that localized almost exclusively to the invasive front of the tumor. postulating that these cells played a role in metastatic potential, cd133+cxcr4 + cells and cd133+cxcr4 cells were orthotopically injected into athymic mice. while both groups of animals evidenced localized tumor development, only mice in the cxcr4 + group demonstrated liver metastases, suggesting an important role for cd133 + cxcr4 + pancreatic cscs in metastasis formation. this study suggests two forms of cancer stem cells, a localized form and a migratory form. notably, inhibition of cxcr4 (via both drug and neutralizing antibody) in this tumor model prevented metastatic disease., it remains unclear whether there is more than one population of cscs in pancreatic cancer or the differing results are due to methodological issues. interestingly, there does appear to be some degree of overlap between cd44+cd24+esa+ and cd133 + pancreatic cancer cells. while none of above markers appear to selectively characterize a pure population of cscs, the studies taken together do provide consistent evidence for an enriched csc population (reviewed in). however, whether cscs are the only cells with tumorigenic potential remains controversial [92, 93 ]. consistent with the data presented above, cscs appear to undergo adaptive changes over time as programs are activated that foster invasion and migration. epithelial - mesenchymal transition (emt) and the reverse process mesenchymal - epithelial transition (met) play central roles in organogenesis, and in the context of tumorigenesis, appear to confer csc properties and drive tumor metastasis (reviewed in [88, 94 ]). conventionally, epithelial cells are defined as tightly adherent cells with apical - basal polarity that are organized in adherent sheets via adherens junctions, tight junctions and desmosomes. typically, epithelial cells are surface barrier cells with secretory functions and remain separated from adjacent tissues by a basal lamina. in contrast, mesenchymal or stromal cells are loosely organized, nonpolarized, migratory cells embedded within extracellular matrix and form the connective tissue or stroma of a given organ. the conversion of epithelial cells to mesenchymal cells involves profound morphological changes including dissolution of cell adhesions, loss of apicobasal polarity and acquisition of migratory and invasive phenotypes. this process appears to be coopted by transformed cells during tumor progression, and interestingly, results in expression of stem - cell markers. mani. reported that induction of emt, via ectopic expression of the transcription factors twist or snail in immortalized human mammary epithelial cells, leads to acquisition of mesenchymal traits, expression of stem cell markers, and an increased ability to form mammospheres, a property associated with epithelial stem cells. prior to emt, these cells express the cd44/cd24 phenotype on the cell surface, corresponding to the phenotype of the majority of cells found in breast carcinomas. following induction of emt, the cells undergo conversion to the cd44/cd24 configuration, a profile that is associated with human breast cscs and normal mammary epithelial stem cells. injection of the transformed human mammary epithelial cells that have undergone emt into immunodeficient hosts results in significantly increased tumor formation in comparison to cells lacking either twist or snail expression. further extended these findings by noting that activation of the ras signaling pathway appears to be a crucial event in facilitating the emergence of cd24 cells. furthermore, microarray analysis of poorly differentiated human tumors associated with an aggressive clinical course were noted to have preferential overexpression of genes normally expressed by es cells, thus confirming stemness as a predictor of poor clinical outcome. taken together, these findings convincingly demonstrate a link between emt and the acquisition of stem cell properties. there is a considerable body of in vitro and in vivo evidence that emt is centrally involved in the process of metastasis (reviewed in [88, 94 ]). emt has been noted to occur at the invasive front of multiple different cancer types including colon carcinoma, breast carcinoma, and papillary thyroid cancers [99103 ]. the invasive front of the tumor represents the host - tumor interface and emt at this border reflects the balance of growth pressures by the tumor body and the tumor periphery. microarray signatures of emt have been shown to correlate with aggressive histopathological subtypes of human tumors and inducers of emt such as snail1, snail2, foxc, and zeb1 have been shown to correlate with increased rates of disease relapse and poor overall survival [101, 104108 ]. in order to integrate the concepts of cscs and emt, brabletz. propose the existence of two cancer stem cell populations, a stationary cancer stem cell and a migratory cancer stem cell, in order to model all aspects of tumor progression. this model has now been preliminarily validated in pancreatic cancer with the identification of two distinct populations of cscs. in order to carefully dissect the contribution of epithelial and mesenchymal states to liver csc growth and metastasis, ding. established an emt model of liver cancer. a single cd133 +, cd45 liver csc purified from pten / alb - cre mice was expanded and then sequentially transplanted. this population of cscs have been previously shown to initiate hcc - like and cholangiocarcinoma - like tumors in vivo. with serial rounds of transplantation, two cell populations became apparent ; one with epithelial morphology and a second with mesenchymal morphology. clones of these two cell populations were subisolated and pten loss was confirmed, demonstrating that tumor cells were derived from the original pten/ host. subcutaneous implantation of these cells into nude mice revealed that the mesenchymal subpopulation of cells generated significantly larger tumors than those seen with the epithelial subpopulation or the mixed cell population. histologically, epithelial cells generated hepatoma like tumors, while the mesenchymal cells formed fibroblastoma - like tumors. the mixed cells formed tumors with both mesenchymal and epithelial cell morphology. furthermore, in vitro mesenchymal cells were more migratory and invasive than their epithelial counterparts and this was confirmed in vivo by demonstrating their increased metastatic capacity. normal tissue stem cells and cscs exhibit properties of chemoresistance and radiation - resistance due to their relative quiescence, expression of atp - binding cassette (abc) transporters, activated dna repair systems, and resistance to apoptosis. a growing body of work now supports the idea that chemoradiotherapy spares or even enriches the csc population within the original tumor, allowing these cells to repopulate the recurrent tumor, despite the fact that the bulk of the tumor has disappeared. in vitro, the cd133 + pancreatic cancer stem cells exhibit significant drug resistance to the chemotherapy agent gemcitabine in comparison to autologous cd133 cells. in vivo, treatment of pancreatic xenografts with gemcitabine also resulted in a significant decrease in tumor volume, but an enrichment of the cd133 + cell fraction, suggesting that cscs play a role in treatment resistance. similarly ionizing radiation therapy of human glioma xenografts resulted in an enrichment of the cd133 + glioma csc subpopulation by fourfold in comparison to untreated controls. decreased rates of apoptosis, preferential activation of dna damage checkpoint responses, more efficient repair of dna damage, and activation of the stem cell renewal pathway, notch, are some of the mechanisms that underlie the increased survival of cd133 + glioma cells. pharmacological inhibition of the chk1 and chk2 checkpoint kinases as well as the notch pathway (by gamma - secretase inhibitors) has been shown to overcome the radioresistance of cd133 + glioma cells, suggesting possible therapeutic targets [112, 113 ]. these observations raise the question of whether the csc represents a new and viable therapeutic target. some of the most promising therapeutic strategies inhibit sc renewal pathways, such as the hh pathway, often in combination with conventional cytotoxic agents. the role of hedgehog signaling in pancreatic cancer metastases was investigated by feldmann. using a spontaneously metastasizing xenograft model of pancreatic cancer. these studies demonstrated that while cyclopamine treatment did not significantly inhibit primary tumor growth, rates of distant metastasis to the lung and liver were significantly inhibited by cyclopamine treatment and completely abolished by the combination of gemcitabine and cyclopamine. no histologic distinctions in the tumor tissue were detected between cyclopamine and vehicle - treated animals, but cyclopamine treatment did result in a 3-fold reduction of aldh - expressing pancreatic cancer cells in vitro. aldh has been implicated as another putative marker of pancreatic cscs, and this initial study suggests that inhibition of the hedgehog pathway results in depletion of the pancreatic csc compartment and is a putative mechanism for metastasis. further extended these findings by demonstrating that dual inhibition of the hedgehog pathway and the mtor pathway in combination with gemcitabine is required to completely eliminates both cd133 + and cd24+cd44+epcam+ pancreatic csc populations in vitro. in contrast, inhibition of the hh pathway alone in combination with gemcitabine abolished the cd133+cxcr4 + migratory csc population. similarly, in a mouse model of orthotopic pancreatic cancer, treatment with cyclopamine, rapamycin (mtor inhibitor) and gemcitabine was required to fully inhibit growth at the primary site and resulted in a significant overall survival benefit. however, treatment with cyclopamine and gemcitabine resulted in complete inhibition of metastatic activity. thus, they conclude that dual pathway inhibition is required for complete abrogation of tumorigenic potential. recently, olive. utilized a mouse model of gemcitabine - refractory, pancreatic ductal adenocarcinoma to demonstrate that treatment with the smoothened inhibitor, ipi-926, alone or in combination with gemcitabine, results in depletion of the desmoplastic stroma and an increase in intratumoral vascular density. in these animals, concentrations of gemcitabine metabolites were augmented by 60% following a ten day pretreatment with ipi-926/gemcitabine. furthermore, treatment with ipi-926 and gemcitabine (as opposed to either agent alone) resulted in a transient reduction in tumor size at the primary site and significantly inhibited liver metastases, resulting in an overall survival benefit. their interpretation of these results is that inhibition of the hh pathway results in increased tumor angiogenesis and stromal collapse, both contributing to enhanced gemcitabine delivery to the pancreatic ductal cells. however, an alternate explanation for these findings is that hh inhibition depletes the cancer stem cell compartment. hence, maintenance of normal organ structure and function necessitates appropriate mobilization and differentiation of cells within the stem cell niche of each tissue. demands on this process increase during adult tissue injury and may unmask defective regulation of pathways, such as hh and other morphogens that modulate progenitor cell fate. dysregulation of the hh pathway has been demonstrated in many types of cancer, including pancreatic and liver cancers. in such tumors, defective hh signaling has been linked to outgrowth of hh - responsive cancer stem - initiating cells and stromal elements, suggesting that the hh pathway might be a therapeutic target. | because cell turnover occurs in all adult organs, stem / progenitor cells within the stem - cell niche of each tissue must be appropriately mobilized and differentiated to maintain normal organ structure and function. tissue injury increases the demands on this process, and thus may unmask defective regulation of pathways, such as hedgehog (hh), that modulate progenitor cell fate. hh pathway dysregulation has been demonstrated in many types of cancer, including pancreatic and liver cancers, in which defective hh signaling has been linked to outgrowth of hh - responsive cancer stem - initiating cells and stromal elements. hence, the hh pathway might be a therapeutic target in such tumors. |
branch retinal vein occlusion (brvo) is the second most frequent retinal vascular disease after diabetic retinopathy. the disease is a common cause of visual loss in middle aged and elderly people. the predominant pathogenetic mechanism for brvo is thought to be compression of the retinal vein by a thickened retinal artery that occurs at a site of arteriovenous crossing. this mechanical narrowing of the venous lumen results in widespread flame - shaped haemorrhages, axonal congestion, dilated tortuous veins, ischaemia, and oedema upstream of the occlusion [2, 4 ]. in retinal tissue brvo induces complex biological processes that are driven by a multitude of interacting proteins. for example, the vegf - vegf2 signalling pathway has been shown to have an essential role in brvo. large - scale protein changes following brvo can effectively be studied using proteomic technologies to bring new insights into pathological processes and signaling pathway alterations that occur in the disease [68 ]. however, no method for analyzing large - scale protein changes following brvo has been established. from human eyes with brvo, retinal tissue samples are generally only obtainable at postmortem [9, 10 ] which makes experimental models of large animals better suited for studying retinal protein changes using proteomics. the porcine retina is fully vascularised which is an advantage if hypoperfusion and ischemia develop. therefore, porcine eyes may render a sufficient amount of retinal tissue for proteomic studies. in addition, the size of porcine eyes makes them suitable for validation with fluorescein angiography and fundus photography. existing experimental models of brvo with photothrombosis the animal receives an intravenous injection of rose bengal dye followed by application of argon green laser burns directly on the branch vein which creates an intravascular thrombus [14, 15 ]. the peak absorption of rose bengal is close to the wavelength of argon laser which makes it possible to use less laser energy. therefore, experimental brvo is best induced without the use of rose bengal if the retinal tissue is intended for proteomic experiments. in this paper we introduce a novel method that allows for large - scale protein identification of more than 2000 proteins in porcine retinal tissue exposed to experimental brvo by combining a dye - free experimental model with label - free liquid chromatography mass spectrometry based proteomics. the study was approved by the danish animal experiments inspectorate (permission number 2013 - 15 - 2934 - 00775). a danish landrace pig, approximately 30 kg, was anesthetized with an intramuscular injection of zoletil (ketamine 6.25 mg / ml, tiletamine 6.25 mg / ml, zolazepam 6.25 mg / ml, butorphanol 1.25 mg / ml, and xylain 6.25/ml). the eyes were anesthetized with oxybuprocaine hydro 0.4% (bausch & lomb) and tetracaine 1% (bausch & lomb) followed by dilatation with tropicamide 0.5% (mydriacyl ; bausch & lomb) and phenylephrine 10% (metaoxidrin ; bausch & lomb). to prevent the corneal surface from becoming dry and compromise the view of the retina systane ultra eye drops (polyethylene glycol 400, propylene glycol ; alcon, copenhagen, denmark) were applied every 5 minutes. brvo was induced using a standard argon laser (532 nm) that was given by indirect ophthalmoscopy. the following laser application was given directly on the vein until stagnation of the venous blood flow occurred. after 37 laser applications with a power of 400 mw and a duration of 550 ms the venous blood stagnated in the vein (figure 1). peripheral flame - shaped hemorrhages appeared within 30 minutes after the occlusion had been induced. in the inferior retina of the left eye that served as a control, a validating fluorescein angiography was conducted nine days after induction of the brvo to confirm successful occlusion. by day 15 the pig was examined with ophthalmoscopic examination and fundus photography followed by enucleation of the eyes that were stored at 80c until preparation for proteomic analysis. a circumferential incision was made around the iris 2 mm posteriorly to the limbus to remove the cornea and the iris. the lens and the vitreous body were carefully lifted and the retina was peeled from the eye cup and placed in an eppendorf tube with five 2.3 mm chromium balls. the eppendorf tube was placed on a vortex mixer for approximately 30 seconds to homogenize the sample. a volume of 500 l cold pbs was added to the eppendorf tube followed by another 30 seconds of homogenization on the vortex mixer. a volume of 50 l of the homogenate was placed in a bead beading tube containing 500 l 5% sodium deoxycholate (nadoc), ph 8.5, and homogenized by bead beading with a precellys 24 homogenizer (bertin technologies, rockville, md, usa) at 6,000 rpm for 20 sec per round. the retinal sample was placed in a ym-10 spin filter (millipore) and buffer exchange to digestion buffer (1% nadoc in 0.1 m teab ; ph 7.8) was performed. this was followed by reduction at 37c using 12 mm tcep for 30 minutes and alkylation with 40 mm iodoacetamide for 30 minutes followed by two times buffer exchange by centrifugation at 14.400 g into 0.5% nadoc in 0.1 m teab ; ph 7.8. for digestion two ug trypsin (modified, promega) was added for incubation overnight. the filtrate was recovered and sodium deoxycholate was precipitated by adding 5% formic acid followed by recovery of the soluble peptides. an internal standard of 20 fm / ul bsa digest (waters massprep) was added and the retinal sample was analyzed by nano - uplc ms. a sample volume of 5 l was transferred onto a dionex rslc nano - uplc system connected to a quadrupole orbitrap (q exactive plus) mass spectrometer that was equipped with a nanospray flex ion source (thermo scientific, bremen, germany). the sample was loaded onto a trapping column (acclaim pepmap100 c18, 5 m column from thermo scientific) at a flow rate of 8 l per min. peptide separation was conducted at a nanoflow of 300 nl per min on the analytical column (50 cm acclaim pepmap rslc). formic acid 0.1% (buffer a) and 99.9% acetonitrile with formic acid 0.1% (buffer b) were used as buffers. operating in data - dependent acquisition mode a full ms scan in the mass range of 350 to 1400 m / z was obtained at a resolution of 70,000 with an agc target of 10 and maximum fill time set to 100 ms. the contaminant ion at 391.28429 m / z was used for instrument lock mass correction. up to 12 ms / ms acquisitions on abundant peptide precursor ions were triggered per cycle. the ms / ms scans were acquired with a dynamic mass range at a resolution of 17,500 and with an agc target of 5 10 and max fill time of 50 ms. a quadrupole isolation window of 2.0 m / z was used for isolation of the precursor ions that were fragmented in the hcd trap with a normalised collision energy set to 30. apex triggering was set to 3 s10 s and dynamic exclusion was set to 30 s. the sample was analyzed in three technical replicates. data obtained by mass spectrometry were searched against a pig isoform database optimized from uniprot using maxquant (version 1.5.0.22). a two - tailed, heteroscedastic t - test was used to calculate p values. technical replicates were averaged by mean and proteins identified by less than two unique peptides were removed from the dataset. perseus was used to search for proteins that were identified from peptides that were found to be part of a protein derived from the reversed part of the decoy database. proteins with no assigned gene name in the identification were searched for on http://www.uniprot.com/ and gene names corresponding to the identified proteins were added. gene names corresponding to the identified proteins were entered in genecodis3 to conduct gene ontology cellular component analysis. homo sapiens was selected as organism to ensure that all gene names were recognized by genegodis3. fluorescein angiography nine days after experimental brvo showed delayed venous filling of the occluded vein (figure 2). drainage of venous blood by adjacent veins (figure 3) was observed in the angiography after approximately 1214 seconds and peripheral haemorrhages (figure 4) appeared after 3040 seconds. the vein remained occluded for the entire duration of the angiography that lasted close to 12 minutes. peripheral haemorrhages had been absorbed and no retinal edema was observed. after filtering by the criteria described above the proteomic analysis provided identification of 2686 proteins in the retina that was exposed to brvo. gene ontology analysis showed that a large variety of proteins were identified in the retinal sample (table 1). used a rose bengal concentration of 10 mg / kg that was injected intravenously in minipigs of 10 to 12 kg. brvo was induced by applying argon green laser (wavelength 514 nm) on a branch vein close to the optic nerve head using an energy intensity of 250 mw, a pulse duration of 0.2 seconds, and a spot diameter of 500 m. in our experiment without rose bengal the retinal vein remained unaffected when exposed to laser applications at 250 mw suggesting that the use of rose bengal reduces the amount of energy that is needed for brvo to occur. in a study on porcine eyes by mcallister. an intravenous injection of 10 mg / kg of rose bengal was injected via an ear vein and brvo was induced with an argon green laser (wavelength 514 nm) applied via a slit - lamp using the central position of a 3-mirror contact lens. with a spot size of 125 m, power of 150 mw, and duration of 1 second repeated laser burns (approximately 4 - 5) were applied directly to the inferior branch retinal vein until stagnation of the retinal blood flow was observed. though a duration of 1 second per laser application is a long exposure time, our experiment may indicate that a larger amount of laser applications is necessary to induce brvo without rose bengal dye. few laser applications may be an advantage in studies in which creation of the venous thrombus with minimal damage to the retinal vein is important. alternatively, brvo can be induced in a porcine retina by establishing three sclerotomies in the porcine eye as in a three - port pars plana vitrectomy. by slowly lowering the diathermy probe toward the point of diathermia brvo however, this model requires access to surgical facilities and may affect the proteome of the vitreoretinal interface as the diathermy probe is in direct contact with the vitreous body and the retina. when exposed to visible light and oxygen, rose bengal produces singlet oxygen and reactive oxidative species, which can induce a number of protein modifications and interactions that may potentially affect the outcome of the proteomic study conducted. singlet oxygen (o2) is known to oxidize the free amino acids trp, tyr, his, cys, and met resulting in alterations to protein structure and function [2224 ]. these o2-mediated changes include oxidation of side chains, dimerization, aggregation, unfolding, conformational changes, and alterations in cellular handling and turnover. in a study by rahmanto. the thioredoxin reductase and glutathione peroxidase as purified proteins and as cell lysates were exposed to rose bengal and visible light which resulted in photolysis induced reductions in the activity of the enzymes.. demonstrated that irradiation of retinal pigment epithelium (rpe) cells with visible light in the presence of rose bengal dye induces rpe cell lysis in vitro. rose bengal has been shown to bind to albumin which makes the dye likely to be distributed to several retinal layers when the blood - retinal barrier is disrupted due to brvo. furthermore, rose bengal has been shown to induce secondary and tertiary structure alternations of bovine -crystallin in the presence of visible light. laser photocoagulation was found to induce a downregulation of wnt-5 beta and calretinin in dark agouti rats with streptozotocin - induced diabetes mellitus. to measure the proteome change caused by brvo and avoid the measurement of protein changes caused by laser treatment it is essential to create an adequate control with an area of laser burns that is as identical as possible to the eye with brvo. the laser exposure in the eye with brvo should be sufficient for the brvo to be induced, but unnecessary laser should be avoided. in this paper we describe a novel optimized method for proteomic analysis of retinal tissue exposed to experimental brvo by combining a dye - free photocoagulation based porcine model with liquid chromatography tandem mass spectrometry. the following proteomic analysis of the retinal tissue resulted in identification of 2686 proteins of various cellular compartments. for proteomic analysis of retinal tissue brvo is best conducted without the use of rose bengal to avoid the multiple protein modifications that are induced when the dye is irradiated. however, induction of brvo without rose bengal dye may require a larger number of laser applications and a higher level of laser energy. therefore, creation of an adequate control with an area of laser burns that is similar to the eye with brvo is essential to avoid measuring laser - induced proteome changes. | branch retinal vein occlusion induces complex biological processes in the retina that are generated by a multitude of interacting proteins. these proteins and their posttranslational modifications can effectively be studied using modern proteomic techniques. however, no method for studying large - scale protein changes following branch retinal vein occlusion has been available until now. obtainment of retinal tissue exposed to branch retinal vein occlusion is only available through experimental animal models. traditional models of experimental branch retinal vein occlusion require the use of rose bengal dye combined with argon laser photocoagulation. the use of rose bengal dye is problematic in proteomic studies as the dye can induce multiple protein modifications when irradiated. this paper presents a novel technique for proteomic analysis of porcine retinal tissue with branch retinal vein occlusion combining a dye - free experimental model with label - free liquid chromatography mass spectrometry based proteomics. |
atopic dermatitis is a common chronic relapsing inflammatory skin disease, which affects patients of all life decades. therapy of atopic dermatitis is mainly based on topical therapies like moisturizers, corticosteroids, or calcineurin inhibitors and avoidance of trigger factors. though a beneficial effect of solar exposure has been appreciated for decades, phototherapy of atopic dermatitis has been largely empirical. since the early twenties it was known that sea climate can improve atopic dermatitis and soon it was additionally recognized that atopic dermatitis improved during the summer season. in 1948, the helpful effects of uv radiation were studied for the first time by exposing patients to radiation emitted from carbon arc lamps. from the 1970s on, fluorescent lamps were applied and in spite of more or less precisely defined emission spectra, some of these types of lamps are still in use. in the last years therapies like uva1 and narrowband uvb (311 nm) gained importance not at least as a result of wide experience in other inflammatory dermatoses like psoriasis. in general, phototherapy is indicated in chronic stages of atopic dermatitis, except uva1 which is also effective in acute flares. however, phototherapy has to be a part of a comprehensive treatment plan, which has to consider some limitations. furthermore, patients have to be compliant to follow a therapy plan for 35 times a week up to 612 weeks. some areas like hairy skin and skin folds are difficult to treat, which limits the efficiency. the advances in photoimmunology and molecular biology give explanation to the mode of action of different phototherapeutic regimes. nevertheless, the majority of concepts in phototherapy of atopic dermatitis are still empirical today. the lack of randomized controlled trials, which compare the different phototherapeutic regimens, still limits recommendations for the most appropriate phototherapeutic regimen. searches on phototherapy and atopic dermatitis were performed using pubmed and cross - references of these publications. oldest phototherapeutic regimen, has a long tradition in treating atopic dermatitis and started with the exposure of patients to carbon arc lamps. uvb fluorescent and mercury arc lamps made uvb regimens the therapy of choice for quite a long time and its efficacy was documented in several studies [35 ]. in one of the first studies, atopic patients (n = 17) were irradiated with broadband uvb (0.51.0 minimal erythema dose, med) compared with visible light (each regimen applied to one - half of the body over 8 weeks). this led in the majority of patients to a complete healing of the lesions compared to visible - light - exposed areas. the same group examined also the therapeutic dose response to uvb (0.8 med versus 0.4 med applied to one - half of the body) for eight weeks (n = 24). however, although both uvb doses were found to be effective, no significant differences were found between the doses applied. this supports the fact that lower doses are equally effective compared with near erythemogenic doses. in another study in 107 atopic patients, uvb was applied once daily for 419 days. a beneficial effect was observed in 93% of the cases as well as a significant corticosteroid - sparing effect. however, the used irradiation device (psorilux 9050) emitted also to a certain extend in the uva range when looking at the reported emission spectra. in psoriasis, which is still the most frequent indication for uvb therapy, the comparison of the therapeutic spectra showed the highest efficacy in the range of around 313 nm [7, 8 ]. subsequently, a narrowband (311313 nm) uvb fluorescent lamp (philips tl01) was introduced. narrowband uvb is much less erythemogenic due to the exclusion of short wave lengthuvb irradiation. data comparing the carcinogenic risks of narrowband uvb and broadband uvb are limited in humans. in 2004, the skin cancer risk in 195 psoriasis patients treated with broadband or narrowband uvb phototherapy was surveyed retrospectively and did not provide evidence for a significant increased skin cancer risk during an observation period of ten years. however, prospective longitudinal studies with prolonged follow - up periods are required. in a large cohort (n = 1908) a median number of 23 treatments did not result in an increased incidence of squamous cell carcinoma or melanoma (median followup 4 (0.0413) years), though the risk of basal cell carcinoma was increased twofold. however, to determine the definite risk, definitely longer followup is essential as well. based on the human carcinogenesis action spectrum, the carcinogenic risk of narrowband uvb lamps is estimated 50% higher for equal erythemal doses than selected broadband lamps. an epidemiologic evidence is still pending, while in mice, narrowband uvb irradiation produced more malignant skin tumors. nevertheless, narrowband uvb is more effective in treating psoriasis and fewer treatments are needed to achieve remission, which might overall weigh up the higher carcinogenic risk by less exposure. in psoriasis, narrowband uvb is superior and has almost entirely replaced broadband uvb, which led to other indications including atopic dermatitis [1520 ]. several studies clearly demonstrate the effectiveness of narrowband uvb for treatment of atopic dermatitis and furthermore show that long - term benefit can be achieved by phototherapy. due to worsening of itch and sweating especially during uva / uva-1 therapy, patients have been treated with air - conditioned narrowband uvb phototherapy three times weekly for 12 weeks (n = 21), which resulted in a 68% reduction in atopic dermatitis severity scores and a concomitant 88% reduction in topical corticosteoird use. even after six months 15 patients in this open study had long - term benefit. the activity of atopic dermatitis was markedly reduced after three weeks of irradiation with a cumulative dose of 9 j / cm narrowband uvb. the response was good to excellent in 80% (n = 40, mean age 11 years) whereas the most frequent adverse effects were erythema and xerosis [15, 20 ]. jury. reported that 68% of children achieved minimal residual diseases after treatment (n = 25). however, it was not commented on the eczema severity, length of remission, or whether topical treatment was continued during treatment with narrowband uvb. a six - year retrospective study (19992005) of narrowband uvb phototherapy for children with atopic dermatitis (n = 50) achieved in 40% of these patients severe eczema clearance or minimal residual activity ; these patients were permitted to use topical steroids, so it is difficult to assess the effect of narrowband uvb alone. recent studies confirmed narrowband uvb to be an effective and well - tolerated treatment modality in children [23, 24 ]. in conclusion, uvb 311 nm can be successfully used for the phototherapy for children with atopic dermatitis. nevertheless, based on the potential long - term adverse events it should not be regarded as first - line treatment. since different forms of phototherapy including 8-methoxypsoralen bath - puva [psoralen plus uva (puva) ] are empirically efficient in atopic patients, it is important to compare them systematically. narrowband uvb was compared to puva (each applied on the half of the body) in patients with severe atopic dermatitis (n = 12, three times weekly for six weeks). after cessation of phototherapy, a decrease in the mean baseline scorad score by 64% (puva) and 66% (narrowband uvb) was observed. hence, both regimens appear to be equally effective in atopic dermatitis. no acute severe adverse effects were reported. in a more recent randomized controlled trial narrowband uvb (n = 26), broadband uva (n = 24), and visible light (n = 23) phototherapy has been applied twice weekly for 12 weeks. narrowband uvb was demonstrated to be very effective in moderate - to - severe adult atopic dermatitis and remission lasted three months. however, this study did not demonstrate a significant corticosteroid - sparing effect by either irradiation regimens as has been reported before. a therapy of oral short - term cyclosporin a for 4 weeks, followed by a washout phase of 46 weeks and consecutive narrowband uvb phototherapy (3 times / week, up to 2 months) has been reported to be effective in the treatment of severe atopic dermatitis. however, long - term effects of this protocol has to be viewed very critically especially regarding its carcinogenic potential. a small trial by legat. compared narrowband uvb to medium - dose uva1 via half - side comparison in nine patients with chronic atopic dermatitis and confirmed the effect of narrowband uvb. a 40% reduction of clinical severity score (costa score) under treatment with narrowband uvb and a better reduction of pruritus was documented while treatment with uva1 did not achieve any statistically significant disease reduction. however, more recent trials demonstrated narrowband uvb and medium - dose uva1 to be equally effective in the treatment of moderate - to - severe atopic dermatitis [28, 29 ]. combination phototherapy of uva and uvb irradiations has quite a long history in atopic eczema [4, 30, 31 ]. it can be applied by using special tubes whose emission spectrum includes both ranges (e.g., metec helarium) or by combining uva and uvb tubes simultaneously or in a subsequent manner. uva / b therapy was preferentially used since uva / b could be demonstrated to be superior to conventional broadband uvb in atopic dermatitis. altogether in 48% of patients a complete remission was achieved with uva / b phototherapy (n = 23) compared to only 27% in patients with uvb (n = 33) with an average of 5 irradiations per week over 4 weeks. a combination of uva and uvb on one side of the body and uvb on the other was applied 3 times / week for a total of eight weeks. in this clinical evaluation, uva / b treatment was reported to be superior for all scores including the pruritus score. however, regarding the extent of the disease, no statistically significant differences were notable. a disadvantage of the combined irradiation is that it is impossible to dose uva and uvb separately. in devices which are equipped with uva and uvb tubes uva / b therapy was popular, because of its superiority to broadband uvb. since the introduction of narrowband uvb and uva1, uvab therapy has lost some of its importance but is still in use. in children, a combination of uvb and uva for atopic dermatitis resulted in 68.3% of the patients in a > 70% reduction of the scorad index. in adult patients with atopic dermatitis, an ongoing topical therapy with corticosteroids resulted in significant clinical improvement. topical corticosteroids reduced the total uvb dose required and the duration of treatment without any overall difference on remission or side effects compared with uva / uvb monotherapy. in contrast to uva / b, pure uva therapy plays a rather minor therapeutic role. conventional uva fluorescent tubes have only a limited output and thus require relatively long exposure times to achieve biologically effective doses. uva-1 devices, which cover the long wave length range from 340 to 400 nm, emit rather high doses in a reasonable amount of time [3439 ]. the rationale for developing uva-1 lamps was the assumption to reduce the adverse effects by omitting the uva-2 part (320340 nm), which is closer to the uvb range. initially, these high power uva-1 lamps were used to perform photoprovocations, consecutively, these lamps were also used for therapeutic purposes, because high doses of uva-1 could be applied without inducing, sunburn reaction. it has been reported to be beneficial for patients with acute and recalcitrant atopic eczema [36, 37, 40, 41 ]. uva-1 penetrates deeper into the skin than uvb and uva-2, thus, higher doses can reach the dermis, and the superficial blood vessel plexus and cause biological effects [42, 43 ]. in the first pilot study of uva-1 irradiation in atopic dermatitis, a single dose of 130 j / cm was given for 15 consecutive days. this treatment regimen was compared to uva / b irradiation (starting doses 30 mj / cm uvb and 7 j / cm uva, resp.). uva-1 was significantly more effective compared to uva / b therapy, as well in clinical scores and in the downregulation of eosinophilic cationic protein levels. it was quite surprising and unexpected that all patients responded to uva-1 therapy after only six exposures. several years later, a multicenter follow - up study with more patients revealed that uva-1 high - dose therapy was superior in comparison with topical corticosteroids and uva / b therapy. however, the initially reported quick response of the previous study could not be reproduced. uva-1 high dose therapy is a valuable therapeutic option especially in acute severe atopic dermatitis but is by far not the standard treatment as it was promoted after the initial pilot study. unfortunately, high power uva-1 devices develop heat when applying these high doses and many atopic patients do not tolerate this. this led to the development of uva-1 lamps, which filtered the infrared part, so - called uva-1 cold light. a medium - dose uva-1 cold light (50 j / cm / day for 15 days) induced a significant reduction of the scorad score and cytokine receptor levels in atopic eczema. however, after a three - month follow up a recurrence of symptoms could be noted. these regimens gave rise to quite controversial opinions about extremely high doses, as medium - dose uva-1 regimen was shown to be also of therapeutic benefit [34, 39 ]. as a consequence, a comparison of high - dose versus medium - dose uva-1 irradiation was initiated. in a half - side comparison by tzaneva. high - dose uva-1 irradiation (130 j / cm / day for 15 days) led to a 35%, medium - dose uva-1 (65 j / cm / day for 15 days) to a 28% decrease in the scorad score. in another study, patients were randomized to receive either low - dose (20 j / cm), medium - dose (65 j / cm), or high - dose (130 j / cm) uva-1. it was found that the medium - dose and high - dose treatment regimens were superior as compared to the low - dose uva-1 treated group of patients. however, there were no significant differences between the high - dose and the medium - dose groups and the tolerability was higher in the medium - dose group, which supports the concept that medium - dose uva-1 is comparatively as effective as exposure to high - doses of uva-1 for the treatment of patients with severe generalized atopic dermatitis. a medium dose of uva-1 cold light (45 j / cm five times weekly for 4 weeks) showed prolonged therapeutically effects concerning disease activity and quality of life. however, until now, no state - of - the - art regimen could be designed relating to the optimal dose and the duration and frequency of the treatment. as long as controlled studies with large numbers of patients are lacking, preference should be given to medium - dose regimes. partial body uva-1 phototherapy is an option for localized and defined areas, which is proven to be successful in the treatment of dyshidrotic eczema of the palms and soles. in atopic dermatitis, medium - dose uva-1 phototherapy induced in 10 out of 12 patients healing of the lesions (15 irradiation cycles) and no relapse occurred up to 3 months. therefore, local uva-1 treatment appears to be an alternative option for the treatment of chronic dermatitis, however, comparative studies against other phototherapies including photochemotherapy are rarely reported. one of the major mechanisms of uva-1 is t lymphocyte apoptosis, as demonstrated by in vitro studies. cd4 + t cells are found in atopic lesions and these t cells undergo apoptosis upon uva-1 exposure as demonstrated in situ. the appearance of apoptotic t cells was followed by their depletion from cutaneous lesions, a reduction in the in situ expression of ifn - gamma by t cells and clearing of the atopic inflammation. furthermore, uva-1 is also able to modulate the balance between the antiapoptotic proteins as potent regulators of t - cell apoptosis [4851 ]. taken together, (8-methoxypsoralen, 8-mop) can be applied orally (systemic puva) or topically (bath- or cream - puva). systemic puva has proven to be effective in severe atopic eczema, but relatively large numbers of exposures had to be given [5359 ]. in several patients who did not continue topical application of corticosteroids, a rebound phenomenon occurred after termination of puva. puva has been used in dermatology for over 30 years and long - term safety data are available mostly for psoriatic patients. in psoriasis, long - term after 25 years, more than 50% of the patients with more than 400 treatments developed at least one squamous cell carcinoma. almost one - third of the patients exposed to more than 200 treatments developed at least one basal cell carcinoma [6062 ] and it is also known that the risk of malignant melanoma particularly in long - term therapy is higher as well (> 250 treatments) [6365 ]. in atopic dermatitis, long - term safety data have not been investigated so far. however, the potential risk must be weighed against the potency of other therapies. in spite of long - term follow - ups, which are essential in these patients, the performance of long - term puva for atopic patients systemic puva can occasionally cause side effects like nausea and vomiting, although this problem is much less common with 5-methoxypsoralen, which is no longer available. unfortunately, it is not approved in most countries and has been taken off the market recently. other disadvantages of oral psoralens are the relatively long photosensitivity (elimination not before 8 hours after ingestion) and the necessity of eye protection. these problems can be avoided, when applying psoralens topically [55, 66 ]. for bath - puva, patients are bathing in warm water (2030 minutes) that contains approximately 0.5 to 1.0 mg psoralens per liter. alternatively, psoralen cream, usually a water - in - oil ointment containing 0.0006% 8-methoxypsoralen, is applied to a defined area of lesional skin one hour before irradiation, which has been shown to be very effective in chronic hand and foot dermatitis. therefore, cream puva is a good option for atopic patients with dyshidrotic eczema, in 70% complete remission has been reported. cream puva is superior to bath puva in clearing the lesions ; the moisturizing of the skin may contribute to the beneficial effect.. the mechanisms of puva are less well understood compared to uva or uvb treatment. puva is most effective in psoriasis, as uva - induced dna - psoralen photoadducts are presumed to inhibit cell proliferation. this was observed at psoralen concentrations and uva doses, which do not affect cell viability. the cell death of lymphocytes may be responsible for anti - inflammatory effects and for therapeutic effects on lymphoproliferative diseases, like cutaneous t - cell lymphoma. therefore, puva aims to induce remissions of skin diseases by repeated, controlled phototoxic reactions. a recent publication states that puva reduces epidermal hyperinnervation observed in atopic dermatitis, and therefore may target the development of pruritus. puva will be only recommended for severe atopic patients, in most cases preference will be given to other phototherapeutic regimens. peripheral blood mononuclear cells are acquired from patients, exposed to uva and psoralens (8-methoxypsoralen) in an extracorporeal irradiation device and are reinfused. extracorporeal photopheresis was initially developed for the treatment of cutaneous t - cell lymphoma, in particular szary syndrome. however, photophoresis proved to be also effective in (auto)immune - mediated diseases [7275 ]. due to its immunosuppressive / modulatory capacity, photophoresis was applied experimentally in selected patients with atopic dermatitis and in small studies and turned out to be effective in this indication when performed in four - week intervals. however, ecp had to be combined with topical corticosteroids to control disease activity. two - week intervals led to a significant improvement of the lesions, a decrease in the overall skin score as well as serum ecp concentrations could be noted. high levels of total ige turned out to be a predictor of negative outcome in ecp. beyond, a significant therapeutic effect on the quality - of - life improvement in patients who are refractory to conventional forms of therapy. recently, long - term photopheresis (> 1 year) has been demonstrated to be effective in six patients with severe recalcitrant atopic dermatitis. in summary, these findings suggest that extracorporeal phototherapy is effective in the treatment of atopic dermatitis in selected patients with severe disease, which are refractory to conventional therapies. nevertheless, ecp is expensive and time - consuming and controlled randomized studies with sufficient numbers of patients are still not available, so that this therapy is only an option for selected patients. the induction of skin tumors after long - term puva (> 200 treatments) is undoubted, whereas the role of uvb phototherapy in human skin carcinogenesis is less clear. in a murine study, the tumor outgrowth was enhanced by broadband uvb but not by narrowband uvb or uva-1. in mutant mice, the long term skin cancer risk of narrowband uvb is thought to be less than that of puva. in spite of great clinical importance, no data are available concerning the long - term risk of developing skin cancer in children undergoing narrowband uvb. furthermore, the underlying mechanisms of uvb - induced biological actions are still not entirely clear. there is recent evidence that uvb can also reach the upper parts of the dermis, however, a for long time it was supposed that uvb can only act in the epidermis due to its lower penetration compared with uva. uvb induces apoptosis via nuclear dna damage and direct activation of death receptors and in psoriatic lesions it was shown that the therapeutic effect of narrowband uvb is associated with the induction of apoptosis of t lymphocytes. uvb has an immunosuppressing effect by inhibiting antigen presentation and inducing the release of immunosuppressive cytokines. it preferentially inhibits th1 immune responses and is even able to skew immune reactions towards a th2 type. on first sight, this would not support a beneficial effect of uvb in atopic dermatitis, since atopy in general is regarded as a th2 driven disease. in chronic atopic dermatitis there is, however, a shift towards a th1 reaction which also explains why it resembles much more a delayed - type hypersensitivity response. at this stage, this may explain why chronic atopic lesions have a better response to uvb than acute lesions. atopic skin has an altered bacterial skin flora and expresses different levels of antimicrobial peptides compared with healthy or psoriatic skin. narrowband uvb has a significant influence on the expression of antimicrobial peptides, bacterial colonization of the skin surface, and bacterial superantigens. narrowband uvb therapy is able to reduce skin surface bacteria, superantigen production and alter mrna levels of antimicrobial peptides, which have been shown to trigger atopic dermatitis disease activity [87, 88 ]. in conclusion, in view of its efficacy, benefit - risk profile, and costs, narrowband uvb should be considered as the first - line phototherapeutic option for moderately severe atopic dermatitis. however, more clinical trials are needed to investigate central issues such as carcinogenicity and effectiveness in skin diseases other than psoriasis. taken together, narrowband uvb is a very useful additive therapy for atopic patients, which significantly reduces disease activity, extent of disease, and pruritus. phototherapy is still one of the major therapeutic options in atopic dermatitis and this will certainly also apply in the future. new developments, like uv - free phototherapy or excimer laser treatment might broaden the indication for phototherapy [9092 ]. nevertheless, even for conventional regimes, much more clinical research is needed to confirm potential indications and determining when and how it should be used. while the development of phototherapeutic regimens was mostly empirical in the past, recent developments are based on the increase of our knowledge on the pathogenesis of atopic dermatitis as well as in the molecular mechanisms mediating the biological effects of uv radiation [48, 93, 94 ]. despite that, compared for example to psoriasis, atopic dermatitis does less reliably respond to phototherapy in general. there are still a reasonable number of patients who do not respond or even get worse under phototherapy. this may be due to the fact that atopic dermatitis is a highly complex disease in which numerous factors determine the clinical outcome and the therapeutic response. it is important, to identify criteria and parameters, which will determine whether the patients will respond to phototherapy and in particular to which type of treatment. | phototherapy has still great importance in the treatment of atopic dermatitis, though costs, compliance, and long - term risks narrow its relevance. in spite of its long history, up to now, the therapeutic regimes are mostly empirical. narrowband uvb und uva1 are the most frequently applied regimens in atopic dermatitis with proven efficacy. however, even for these modalities randomized prospective and controlled studies are still pending. advances in photoimmunology and molecular biology had demonstrated that phototherapy targets inflammatory cells, alters cytokine production, and has a significant antimicrobial effect within atopic skin. this paper summarizes the current literature on the different regimes of phototherapy and also discusses therapeutic modalities like photochemotherapy and extracorporeal photopheresis. these more complex regimes should be restricted to severe cases of atopic dermatitis, which are refractory to topical treatment. |
a 26-year - old man presented to our outpatient clinic with complaints of lower abdominal discomfort and a palpable mass in the right lower quadrant. the abdomen examination revealed a 6 cm palpable mass without tenderness in the right lower quadrant. routine urine analysis revealed pyuria of 10 - 19 white blood cell (wbc)/high - power field (hpf) and microscopic hematuria of 5 - 9 red blood cell (rbc)/hpf. abdominal ultrasonography revealed irregular wall thickening of the bladder dome with extension to the abdominal wall. an abdominal computed tomography (ct) scan revealed an abdominal wall mass that extended from the bladder dome and irregular perivesical infiltration, suggesting urachal remnant - associated disease (fig. additional fluorine-18 fluorodeoxyglucose (fdg) positron - emission tomography (pet)/ct was performed to rule out a urachal tumor. the pet / ct showed hypermetabolic bladder wall thickening with mesenteric and omental infiltration, extending along the urachus (fig. partial cystectomy with resection of the abdominal wall mass was performed because malignancy could not be ruled out completely. the mass contained necrotic lesions with yellowish foci in the deep resection margin and the final pathology was consistent with actinomyces israelii with sulfur granules (fig. 3). the patient underwent treatment with oral fluoroquinolone for 3 months and recovered without complications. actinomyces israelii invades and penetrates the intestinal mucosa and bowel wall, producing localized or extended peritoneal and retroperitoneal abscess formation. actinomyces israelii is a commensal organism within the oral cavity, alimentary tract, and vagina and spreads by direct extension. definite diagnosis can be made by demonstration of actinomyces israelii in a needle or surgical biopsy specimen. hypermetabolic changes at the bladder dome and urachus on pet / ct made the diagnosis very elusive in this case. because there is not much difference in the pet / ct findings between malignancy and actinomycosis, utilization of pet / ct to rule out malignancy does not seem to be necessary, unless the case is strongly suggestive of malignancy. we performed a partial cystectomy to clarify this elusive disease entity and confirmed actinomyces israelii colonies in the specimen. intravenous administration of penicillin should be given, followed by oral penicillin or amoxicillin. if the patient has penicillin allergy or resistance, ceftriaxone, doxycycline, clindamycin, or fluoroquinolone is recommended. | a 26-year - old man presented with lower abdominal discomfort and a palpable mass in the right lower quadrant. an abdominal computed tomography (ct) scan revealed an abdominal wall mass that extended from the dome of the bladder. fluorine-18 fluorodeoxyglucose (fdg) positron - emission tomography / ct (pet / ct) showed hypermetabolic wall thickening around the bladder dome area that extended to the abdominal wall and hypermetabolic mesenteric infiltration. differential diagnosis included a urachal tumor with invasion into adjacent organs and chronic inflammatory disease. partial cystectomy with abdominal wall mass excision was performed, and the final pathologic report was consistent with urachal actinomycosis. |
the british society of echocardiography (bse) education committee has previously published a minimum dataset for a standard adult transthoracic echocardiogram (1). this guideline specifically states that the minimum dataset is usually sufficient only when the echocardiographic study is entirely normal. the aim of the bse education committee is to publish a series of appendices to cover specific pathologies supporting this minimum dataset.the intended benefits of such supplementary recommendations are to : support cardiologists and echocardiographers to develop local protocols and quality control programs for adult transthoracic study.promote quality by defining a set of descriptive terms and measurements, in conjunction with a systematic approach to performing and reporting a study in specific disease states.facilitate the accurate comparison of serial echocardiograms performed in patients at the same or different sites. this guideline gives recommendations for the image and analysis dataset required in patients either being assessed for, or with a known diagnosis of hypertrophic cardiomyopathy (hcm). the views and measurements are supplementary to those outlined in the minimum dataset and are given assuming that a full study will be performed in all patients.when the condition or acoustic windows of the patient prevent the acquisition of one or more components of the supplementary dataset, or when measurements result in misleading information (e.g. off - axis measurements), this should be stated.this document is a guideline for echocardiography in hcm and will be updated in accordance with changes directed by publications or changes in practice (table 1).table 1additional views and measurements to be obtained in patients with known or suspected hypertrophic cardiomyopathy view (modality) measurement explanatory note image plax (2d / mm)ivsdivsd measure > 3 cm is a key marker of increased risk (2) demonstrate if ash is presentmeasure rv wall thickness if on axis plax (2d / mm)la sizemeasure la size (anterior posterior diameter). la diameter is one of the criteria used to estimate risk of sudden cardiac death (3) plax (mm and cfm)mv leaflet tips and av leaflet tipsdemonstrate if sam is present on m - mode and for colour flow turbulence within the lvotdemonstrate if early closure of the av psax mv (2d)frozen 2d image : obtain wall thickness measurements from level of the basal lv. measure at four points, using clock face references (12, 3, 6, 9 o'clock)to assess for asymmetric and symmetric segmental lv hypertrophysegmental hypertrophy > 1.5 cm (2) with normal or small lv internal cavity dimensions is strongly suggestive of hcm (in absence of other pathologies such as hypertension) psax pm (2d)2d frozen image at the mid - lv level. measure at four points, using clock face references (12, 3, 6, 9 o'clock)avoid off - axis measurements, papillary muscle and trabeculations psax apex (2d)apical - level measure at two points (12 and 6 o'clock)apical hypertrophy may be present if apical / basal lateral ratio is > 1.5. consideration should be given to use of lv opacification contrast modified psax (2d and pw / cw)rv wall thickness and rvot forward flow velocitiesmodify both the rv inflow and outflow to assess for rvh and rvot obstruction. rvh present if > 0.5 cm modified a4c (2d)rv wall thicknessif clear images can be obtained, measure rv wall thickness. rvh present if > 0.5 cm a4c and a2c (2d)la volumeindex la volume to bsa (4) a4c (cfm)aetiology and severity of mitral regurgitationif sam is present, mr may be eccentric and is usually mid / late systolic a4c (pw tdi)systolic (s '), early (e ') and atrial (a ') relaxation velocities at anterolateral lv annulusreduction in s ' or e ' velocities below normal range for age and sex (5) assess for elevated lvedp by measuring e / e '. abnormal if > 10 (4) a4c (pw tdi)systolic (s '), early (e ') and atrial (a ') relaxation velocities at inferoseptal lv annulusreduction in sa or ea velocities below normal range for age and sex (5) assess for elevated lvedp by measuring e / e '. abnormal if > 10 (4) a5c and a3c (cfm) locate turbulent flow both within the lv cavity and the lvot a5c and a3c (pw / cw)quantify lvot / lv intracavity dynamic flow gradientsample pw doppler throughout the lv cavity, paying particular attention to areas with turbulent flow. a valsalva manoeuvre should be performed in the sitting and semi - supine position (and then on standing if no gradient is produced) to assess dynamic lvot gradients. in addition, exercise stress echocardiography should be considered in patients with lvot gradients 3 cm is a key marker of increased risk (2) demonstrate if ash is presentmeasure rv wall thickness if on axis plax (2d / mm)la sizemeasure la size (anterior posterior diameter). la diameter is one of the criteria used to estimate risk of sudden cardiac death (3) plax (mm and cfm)mv leaflet tips and av leaflet tipsdemonstrate if sam is present on m - mode and for colour flow turbulence within the lvotdemonstrate if early closure of the av psax mv (2d)frozen 2d image : obtain wall thickness measurements from level of the basal lv. measure at four points, using clock face references (12, 3, 6, 9 o'clock)to assess for asymmetric and symmetric segmental lv hypertrophysegmental hypertrophy > 1.5 cm (2) with normal or small lv internal cavity dimensions is strongly suggestive of hcm (in absence of other pathologies such as hypertension) psax pm (2d)2d frozen image at the mid - lv level. measure at four points, using clock face references (12, 3, 6, 9 o'clock)avoid off - axis measurements, papillary muscle and trabeculations psax apex (2d)apical - level measure at two points (12 and 6 o'clock)apical hypertrophy may be present if apical / basal lateral ratio is > 1.5. consideration should be given to use of lv opacification contrast modified psax (2d and pw / cw)rv wall thickness and rvot forward flow velocitiesmodify both the rv inflow and outflow to assess for rvh and rvot obstruction. rvh present if > 0.5 cm modified a4c (2d)rv wall thicknessif clear images can be obtained, measure rv wall thickness. otherwise measurement from plax and subcostal views is preferred. rvh present if > 0.5 cm a4c and a2c (2d)la volumeindex la volume to bsa (4) a4c (cfm)aetiology and severity of mitral regurgitationif sam is present, mr may be eccentric and is usually mid / late systolic a4c (pw tdi)systolic (s '), early (e ') and atrial (a ') relaxation velocities at anterolateral lv annulusreduction in s ' or e ' velocities below normal range for age and sex (5) assess for elevated lvedp by measuring e / e '. abnormal if > 10 (4) a4c (pw tdi)systolic (s '), early (e ') and atrial (a ') relaxation velocities at inferoseptal lv annulusreduction in sa or ea velocities below normal range for age and sex (5) assess for elevated lvedp by measuring e / e '. abnormal if > 10 (4) a5c and a3c (cfm) locate turbulent flow both within the lv cavity and the lvot a5c and a3c (pw / cw)quantify lvot / lv intracavity dynamic flow gradientsample pw doppler throughout the lv cavity, paying particular attention to areas with turbulent flow. a valsalva manoeuvre should be performed in the sitting and semi - supine position (and then on standing if no gradient is produced) to assess dynamic lvot gradients. in addition, exercise stress echocardiography should be considered in patients with lvot gradients < 50 mmhg at rest (with or without valsalva) (3) a2c (pw tdi)systolic (s '), early (e ') and atrial (a ') relaxation velocities at inferior lv annulusreduction in s ' or e ' velocities below normal range for age and sex (5) a2c (pw tdi)systolic (s '), early (e ') and atrial (a ') relaxation velocities at anterior lv annulusreduction in s ' or e ' velocities below normal range for age and sex (5) additional views and measurements to be obtained in patients with known or suspected hypertrophic cardiomyopathy abbreviations views a2capical two chamber a4capical four chamber a5capical five chamber a3capical three chamber or apical long axis plaxparasternal long axis psaxparasternal short axis scsubcostal ssnsuprasternal modality cfmcolour flow doppler cwcontinuous - wave doppler pwpulse wave doppler tditissue doppler imaging measurement and explanatory text a'lateral and/or septal late annular relaxation velocity aoaorta ashasymmetrical septal hypertrophy avaortic valve bsabody surface area dtdeceleration time e'lateral and/or septal early annular relaxation velocity hcmhypertrophic cardiomyopathy hprfhigh pulse repetition frequency ivcinferior vena cava ivsdinterventricular septal width in diastole laleft atrium llpvleft lower pulmonary vein lpaleft pulmonary artery lupvleft upper pulmonary vein lvleft ventricle lvedpleft ventricular end - diastolic pressure lvidd / sleft ventricular internal dimension in diastole and systole lvotleft ventricular outflow tract lvpwdleft ventricular posterior wall width in diastole mapsemitral annular plane systolic excursion mrmitral regurgitation mvmitral valve papulmonary artery pappulmonary artery pressure phtpressure half - time prpulmonary regurgitation pspulmonary stenosis pvpulmonary valve raright atrium rlpvright lower pulmonary vein rupvright upper pulmonary vein rvright ventricle rvhright ventricular hypertrophy rviddright ventricular cavity diameter in diastole rwmaregional wall motion abnormality rvotright ventricular outflow tract rvotdright ventricular outflow tract dimension s'lateral and/or septal systolic annular velocity samsystolic anterior motion stjsinotubular junction svolstroke volume tapsetricuspid annular plane systolic excursion trtricuspid regurgitation tvtricuspid valve vmaxmaximum velocity vsdventricular septal defect vtivelocity time integral the authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of this guideline. this guideline did not receive any specific grant from any funding agency in the public, commercial or not - for - profit sector. | hypertrophic cardiomyopathy (hcm) is a relatively common inherited cardiac condition with a prevalence of approximately one in 500. it results in otherwise unexplained hypertrophy of the myocardium and predisposes the patient to a variety of disease - related complications including sudden cardiac death. echocardiography is of vital importance in the diagnosis, assessment and follow - up of patients with known or suspected hcm. the british society of echocardiography (bse) has previously published a minimum dataset for transthoracic echocardiography, providing the core parameters necessary when performing a standard echocardiographic study. however, for patients with known or suspected hcm, additional views and measurements are necessary. these additional views allow more subtle abnormalities to be detected or may provide important information in order to identify patients with an adverse prognosis. the aim of this guideline is to outline the additional images and measurements that should be obtained when performing a study on a patient with known or suspected hcm. |
presentation can vary significantly based on the extent of tumor invasion and associated paraneoplastic syndromes. we present a case of svc syndrome from a type b1, masaoka stage iva invasive thymoma that was invading multiple mediastinal structures including the superior vena cava, right atrium, pericardium and right upper lung lobe. a 74-year - old female presented with facial and upper extremity swelling over the last month. social history was notable for 40-pack - year smoking history, but she quit smoking 12 years ago. physical examination revealed mild facial swelling, non - pitting edema of the upper extremities and distention of superficial veins of the anterior chest wall and jugular veins. an echocardiogram showed moderate right atrial dilation with a mobile mass in the atrial cavity prolapsing through the tricuspid valve, bowing of atrial septum from right to left consistent with increased right atrial pressure, moderate tricuspid regurgitation and normal left ventricular ejection fraction with no regional wall motion abnormalities. cardiovascular magnetic resonance imaging revealed a 9.9 4.3 cm heterogeneous mass admixed with thrombus in the anterior mediastinum compressing the svc and endovenously extending into the right atrium (figs 13). a computed tomography (ct)-guided biopsy revealed a tan - colored mass with cd5 lymphocyte predominance, inconspicuous epithelial cells positive for p63 expression and cytokeratin ae1/ae3 that was morphologically consistent with thymoma type b1. figure 1:cmr sagittal view : large anterior mediastinal mass with extension into the right atrium. figure 2:cmr coronal view : anterior mediastinal mass invading superior vena cava and extending into the right atrium. figure 3:cmr axial four - chamber view : mass in the right atrial cavity protruding through the tricuspid valve into the right ventricle. cmr coronal view : anterior mediastinal mass invading superior vena cava and extending into the right atrium. cmr axial four - chamber view : mass in the right atrial cavity protruding through the tricuspid valve into the right ventricle. a large tan - colored mediastinal mass was found infiltrating the right upper lobe of the lung, pericardium, right phrenic nerve, brachiocephalic vein, right innominate vein, svc and the right atrium. the mediastinal mass was resected followed by wedge resection of the right upper lobe that was densely adherent to. cardiopulmonary bypass was then initiated, maintaining a flow of 2.4 l / min and a mean arterial pressure of 70 mmhg. snares were placed over the svc, inferior vena cava and innominate vein after cannulation. once the snare was tightened, the right atrium was then opened followed by removal of a 6.5 6.0 4.8 cm tan - colored mass with thrombus that was penetrating into the svc. there was tumor infiltration of the svc which required excision and reconstruction with a gortex patch. the mass was classified as a stage iva invasive thymoma using the masaoka classification due to pleural and pericardial invasion. there were no postoperative complications and the swelling of the face and upper extremity improved. patient is being followed in the outpatient radiation oncology clinic and is recurrence free at 3 years. invasive thymoma commonly invades surrounding thoracic structures such as the heart, lungs and vessels causing compressive symptoms. most thymomas with cardiac involvement are limited to the pericardium and very few cases of transcaval extension with intracardiac involvement have been reported [1, 2 ]. initial diagnostic evaluation of thymomas involves investigation of paraneoplastic syndromes of which myasthenia gravis is the most common [46 ]. imaging test involves a ct scan or an mri to evaluate the mass and its surrounding structure for potential resection. our case is a type b1 thymoma characterized by cd5 lymphocyte predominance, inconspicuous epithelial cells positive for p63 expression and cytokeratin ae1/ae3 using the world health organization histologic classification. the masaoka classification was stage iva as there were pleural and pericardial invasion with no evidence of lymph node involvement or distant hematogenous spread. both histologic characteristics and tumor staging are independent prognostic factors [5, 9 ]. the invasiveness of a type b1 thymoma is 73.3% and the potential to invade greater vessels is 6.6%. a retrospective study by rena. showed a 10-year disease - free survival of 85% with a 5-year relapse rate between 2 and 10% for type b1 thymoma after complete resection followed by either radiation therapy, chemotherapy or a combination of both. there were no stage iva thymomas that reached a 10-year follow - up, but disease - free survival after 5 years was 61%. however, a larger study by strbel. showed a 10-year survival probability of 47% for stage iv tumors. this case highlights svc syndrome from an invasive type b1, masaoka stage iva thymoma causing extrinsic compression with transcaval infiltration to the right atrium. successful resection under cardiopulmonary bypass can be performed and further treatment with radiation therapy reduces the risk of recurrence. this manuscript has not been submitted for publication ; it has not been accepted for publication and has not been published in any other journal. | invasive thymoma with transcaval extension to the right atrium is a rare cause of superior vena cava syndrome. we present a case on a 74-year - old female presenting with dyspnea on exertion, and facial and upper extremity swelling. physical examination revealed mild facial swelling, non - pitting edema involving the upper extremities and distention of superficial veins of the anterior chest wall and jugular veins. an echocardiogram showed moderate right atrial dilation with a mobile mass in the atrial cavity prolapsing through the tricuspid valve. cardiac magnetic resonance imaging revealed a 9.9 4.3 cm heterogeneous mass in the anterior mediastinum compressing the superior vena cava and endovenously extending into the right atrium. tissue biopsy of the mediastinal mass revealed a type b1 thymoma, further staged as a masaoka iva invasive thymoma that underwent successful en bloc resection followed by removal of intracaval and right atrial mass. |
jared leadbetter takes us for a nature walk through the diversity of life resident in the termite hindgut - a microenvironment containing 250 different species found nowhere else on earth. jared reveals that the symbiosis exhibited by this system is multi - layered and involves not only a relationship between the termite and its gut inhabitants, but also involves a complex web of symbiosis among the gut microbes themselves. |
|
keratoconus (kc) and fuchs ' dystrophy (fuchs) are the leading indications for penetrating keratoplasty (pkp). the cornea surgeon 's main attention in corneal transplantation has shifted from preserving a clear graft to achieving a good refractive outcome. the nonmechanical excimer laser trephination (exc) has been first introduced in 1989 at the university eye hospital of erlangen (germany) [13 ]. it has been frequently reported that this technique yielded a better refractive outcome in comparison to manual trephination, particularly lower postoperative keratometric astigmatism, higher regularity of topography, and improved visual acuity [4, 5 ]. it ensures an outstanding perpendicular incision profile. such cut edges in combination with orientation teeth (figure 1) potentially reduce vertical tilt and horizontal torsion of the graft in the recipient bed, thus improving the visual performance after transplantation. however, despite the promising results, the exc pkp did not get widely spread, because corneal surgeons did not have an excimer laser in their operating theater. instead, newer technologies were introduced, particularly femtosecond laser - assisted keratoplasty (flak), which got spread more widely since 2006 [68 ]. historically, the femtosecond laser has been mainly used in refractive surgery, for example, for flap preparation in lasik, intracorneal ring segment implantation in keratoconus patients, or antiastigmatic incisions following pkp [911 ]. the most common trephination profiles are the mushroom and the top hat profile as well as the more complex these shaped wound configurations offer the advantages of better donor - recipient fit and increased donor - host junction surface area contact, both resulting in faster wound healing and earlier suture removal, thus potentially promoting rapid visual recovery. in addition, in vivo confocal microscopy (ivcm) after flak showed earlier regrowth of corneal nerves in both the peripheral and central stroma compared to conventional pkp. to the best of our knowledge, this is the first study to compare two nonmechanical (excimer and femtosecond laser) laser - assisted pkp in keratoconus and fuchs dystrophy. the purpose of this work is to demonstrate the intraoperative results regarding the centration of the graft, necessity of completion of graft and donor incisions with scissors, anterior stepping, gaping, necessity of additional interrupted sutures, positive pressure during the surgery (vis a tergo), and the proper alignment of the orientation markers in host and graft. in this prospective randomized clinical single - center study, 68 patients (age 18 to 87 years) with keratoconus or fuchs dystrophy (phakic or pseudophakic eyes that underwent a primary central pkp) were randomly distributed to 4 groups : 35 eyes with keratoconus and 33 eyes with fuchs dystrophy were treated either with excimer laser ([exc ] groups i and ii) and with femtosecond laser - assisted ([flak ] groups iii and iv) penetrating keratoplasty. exclusion criteria were repeated pkp and simultaneous cataract surgery because during the triple procedure, the iris - lens diaphragm is not stable and, therefore, might influence the main outcome measures of this study. all surgical procedures were carried out by one surgeon (bs) and under general anesthesia. in the study, a 193 nm excimer laser (mel 70, carl zeiss meditec, jena, germany) with a 35 hz repetition rate and spot size of 1.2 mm, in combination with conventional donor / recipient masks, and the 60 khz intralase fs laser [amo (abbott medical optics), abbott park, il, usa ] have been used. exc and flak were performed in patients with keratoconus and with fuchs ' endothelial dystrophy (if they presented advanced stages of the disease including scarring, thus they were not suitable for lamellar techniques such as dsaek or dmek). main intraoperative outcome measures included ultrasound pachymetry al-3000 (tomey, nagoya, japan) at the center and in 4 midperipheral points at 0, 90, 180, and 270 of the donor, complications of laser trephination, trephination time, anterior gaping, graft override, need for additional interrupted sutures to achieve proper donor - host alignment, and alignment of orientation markers and positive vitreous pressure (vis a tergo) depicted in three grades (0 = no intraoperative pressure, 1 = iris prolapse till the level of the corneal incision, and 2 = iris prolapse beyond the level of corneal incision). graft decentration was measured at the end of the operation by measuring the distance between limbus and graft with calipers at the 12- and 6-o'clock position. decentration was considered if the difference between the two distances was more than 0.5 mm. a measurement prior to incision was not possible because of the suction ring for the femtolaser which prevents view on the limbus area. trephination was performed using the 193 nm excimer laser along metal masks with eight orientation teeth / notches. mean patient age in keratoconus was 37.4 14.2 and in fuchs 69.8 8.9 years. for donor trephination from the epithelial side using the 193 nm excimer laser mel 70, a circular metal aperture mask (diameter : 8.1 mm ; central opening : 3.0 mm for centration ; thickness : 0.5 mm ; weight : 0.173 g ; eight orientation teeth : 0.15 0.3 mm, figure 1) was positioned on a corneoscleral button (16 mm diameter) fixed in an artificial anterior chamber under microscopic control (figure 2). after perforation, the remaining stromal lamellae and descemet 's membrane were cut with curved corneal microscissors. a corresponding circular metal mask was used (diameter : 12.5 mm ; central opening : 8.0 mm ; thickness : 0.5 mm ; weight : 0.29 g ; eight orientation notches : 0.15 0.3 mm, figures 1 and 2). the mask holds without additional stabilization because of the horizontal orientation of the patient 's head. the laser beam is guided automatically along the edge of the mask without ablating the central cornea. after focal corneal perforation, the remaining deep stromal lamellae and descemet 's membrane were cut with curved corneal microscissors. mean patient age in keratoconus group was 40.2 14.0 years and in the fuchs group it was 69.2 12.0 years. in all cases, we used energy of 0.1 j less than the maximum energy in the posterior side cut, 0.5 j less than the maximum energy in the anterior side cut, and 0.4 j less than the maximum energy in the ring lamellar cut (2.3 to 2.9 j). the 8 alignment incisions in both the donor and recipient were created as follows : energy of 1.5 j, length of 1000 m, width of 50 m, spot separation of 6 m, line separation of 6 m, and layer separation of 5 m. the radial offsets were + 2 in all recipients (meaning that all the alignment incisions were outside the trephination) and 2 in all donors (meaning that all the alignment incisions were inside the trephination). on the anterior side cuts, the spot separation and the layer separation were 3 m ; in the ring lamellar cut (spiral pattern), the tangential spot separation was 5 m and the radial spot separation was 4 m ; on the posterior side cut, the spot separation was 3 m and the layer separation was 2 m. the depth of the lamellar cut of the donor and recipient was 2/3 of the mean corneal thickness of the graft and recipient 's eye, respectively. all diameters (anterior side cut, lamellar cut, and posterior side cut) were performed, 0.1 mm larger than the resulting diameter, thus overlapping each other. the donor cornea was placed into an artificial anterior chamber type barron (katena, denville, usa) to achieve trephination from the epithelial side. each laser procedure requires a disposable glass interface, which applanates the cornea completely during the laser procedure. for laser trephination of the recipient 's cornea, the glass cone interface was placed within the suction ring so that the cornea was completely applanated. we performed a complete penetrating laser trephination after which the corneal button was removed with forceps and a spatula under microscopic control. if necessary, a microscissor was used to complete the incision. the top hat profile was used in fuchs dystrophy, whereas the mushroom profile was used in keratoconus patients (figure 3). in all patients, after temporary fixation of the donor button in the recipient bed with 8 interrupted sutures, a permanent wound closure was achieved by a 16-bite double - running diagonal cross - stitch suture (100 nylon) according to hoffmann (figure 4). the eight cardinal sutures were placed at the site of orientation teeth with the excimer laser and at the site of the alignment incisions with the femtosecond laser as well as possible (figure 5). in cases of wound gaping or graft override, additional interrupted sutures were used to ensure proper donor - host alignment at the end of surgery. generally, the laser action time for trephination was much shorter for femtosecond compared to excimer laser trephination (figure 6). incisions had to be completed with scissors in almost all eyes of groups i / ii but only 2 cases in groups iii / iv. decentration happened in none of the eyes in groups i / ii, but in 3/1 eyes in groups iii / iv. no additional interrupted sutures were necessary for groups i / ii, but in 4/1 cases in groups iii / iv. orientation markers were aligned in all cases of the excimer groups ; in contrast, orientation markers were not totally aligned in 7/1 cases in groups iii / iv. after removal of 8 cardinal sutures, graft override appeared in none of groups i / ii / iv but in one case of group iii. moreover, gaping occurred in 0/1 eyes of groups i / ii but in 2/1 cases in groups iii / iv. intraoperative positive pressure from vitreous has occurred in all groups as follows : 3/9 eyes in groups i / ii and 8/11 in groups iii / iv (figure 8). in particular, positive vitreous pressure grade 2 appeared in 8 patients of the keratoconus flak group, but only in 1 patient of the fuchs excimer laser group. studies comparing an established corneal transplantation procedure with the new femtosecond laser technology that was introduced to clinical practice in 2006 were already carried out [18, 19 ]. in a recent publication, birnbaum. have compared the results of 123 flak with conventional pkp in a randomized clinical study. it has been revealed that despite the potential advantages of the femtosecond procedure it did not provide superior refractive results as compared to mechanical trephination. they found a topographic astigmatism after suture removal of about 6 diopters in the flak group. a major advantage of femtosecond laser is the possibility to create different 3d profiles (with the most widely spread ones being the top hat, mushroom, and zig - zag profile [13, 18 ]). its stability is derived from the overlap, which is created by the side cut especially in the top hat configuration [20, 21 ]. nevertheless, we found in our study that it was difficult to get it watertight without steps and gaps in comparison to the excimer laser keratoplasty. to avoid complications recorded in earlier studies using the mushroom profile (e.g., infiltrates, steps, and ointment deposits), we successfully used an anterior part of the mushroom as thick as two - thirds of the mean of midperipheral donor and recipient thickness. the fact that flak created more gaps after the removal of the cardinal sutures resulted in the necessity to use more single interrupted sutures for correct donor - host adaptation. this was not due to a learning curve of the surgeon because a different cut profile was used in the flak group. although, the mushroom profile has a relatively large diameter at the corneal surface, the wound apposition was less accurate. we have to admit that a suture depth of 90% can only be intended and depends strongly on the experience of the surgeon. we further have to admit that there are no ideal geometrical settings for the mushroom profile. but a more likely explanation is that in keratoconus eyes the applanation done to the cone - shaped bulging cornea results in flattening. we believe that this extreme flattening effect leads to an alteration in the theoretically planned right angles of the anterior, posterior, and lamellar side cuts. therefore, we got instead of right angles oblique angles and instead of a round trephination an oval- or pear - shaped trephination, which led to difficulty in fitting the properly cut donor button into the somehow distorted recipient bed. in particular, in keratoconus, orientation lines of donor and recipient tended not to match exactly (figure 5). in such flak cases, an interrupted suturing technique might be more appropriate than a double - running suture. it was obvious that the excimer laser needs more time to penetrate the cornea than the femtosecond laser. this is because the excimer laser digs from the surface a trench into the cornea while its energy is gradually absorbed. on the other hand, the femtosecond laser creates cavitation bubbles at different depths of the cornea and thus an incision can be obtained faster. we intended a complete perforation of the cornea during flak. if the femtosecond laser theatre is separated from the surgery room, it might be preferable to leave a stromal gap between 50 and 80 m and to complete perforation in the surgery room. flak achieved an overwhelming number of cases with complete perforation of the cornea in comparison to the excimer pkp. the double continuous running suture technique remains to be the suture of choice in flak. in our study, the suturing was done down deep to the pre - descemet 's layer and not just at the level of the side cut of the profiled graft. in an ordinary pkp or exc pkp, the suture is placed in the pre - descemet 's region of the donor cornea. in germany, the double - running cross - stitch suture according to hoffmann is preferred over interrupted sutures, because it results in earlier visual rehabilitation and higher regularity of topography as long as the sutures are in place and a lower risk of suture loosening and need of suture replacement. in case of corneal thinning, such as that in keratoconus, the suture may run through the anterior chamber at the recipient site. one of the disadvantages of flak is that it generates a higher intraocular pressure than the exc pkp. therefore, an increase in the volume of choroidal blood vessels produces disproportionate changes of intraocular volume and thus intraocular pressure. moreover, it leads to major changes in the osmolarity of the vitreous. when the cornea is removed, the mechanical barrier to vitreous expansion is lost. in this situation, the iris - lens diaphragm is pushed forward (the so - called positive vitreous pressure or vis a tergo). in severe cases, it is impossible to maintain the anterior chamber and the cardinal sutures are difficult to place. even the iris can be sutured to the corneal button thus leading to further difficulties. moreover, a sudden increase in the intraocular pressure to values which are higher than the perfusion of the retinal vessels was recorded. however, this effect is only for a short time, due to the fast perforation of the cornea. up to now, no central artery occlusion due to flak has been reported. by leaving a stromal gap and finishing the perforation in the surgery room this leads to reduction of pressure on the eye, thus enabling intraocular pressure reaching equilibrium and reducing positive vitreous pressure. moreover, there are now also faster femtosecond laser platforms available which may help to further minimize this risk. decentration of corneal grafts in keratoconus patients with flak was more frequent than that in patients that were treated with excimer laser. because of the flat applanation with the flak, it was more likely to obtain a decentered oval - shaped recipient incision. in contrast, in the excimer laser pkp, we have been using masks with orientation teeth which allow us to suture the first eight cardinal sutures with small risk of horizontal torsion because, according to the key - keyhole - principle, the orientation teeth in the donor fit exactly into the orientation notches of the recipient. such a precise orientation is absent in the flak, since only radial markings are present. it became obvious that in the femtosecond laser trephined kc eyes these radial incision lines did not fit completely comparing donor and recipient. therefore, the hypothesis that a better graft alignment can be achieved with flak can not be confirmed with the geometrical settings in our study. intraoperative decentration, misalignment of the donor in the recipient bed, and need for additional interrupted sutures, as well as positive pressure from the vitreous, were more frequent when flak was performed. future comparative studies with a faster excimer laser platform and a concave femtosecond laser patient interface or even a liquid interface are needed to be carried out. the next step of our group is the presentation of best - spectacle corrected visual acuity, postoperative astigmatism, and regularity of topography after removal of all sutures in all eyes. | purpose. to assess the intraoperative results comparing two non - mechanical laser assisted penetrating keratoplasty approaches in keratoconus and fuchs dystrophy. patients and methods. 68 patients (age 18 to 87 years) with keratoconus or fuchs dystrophy were randomly distributed to 4 groups. 35 eyes with keratoconus and 33 eyes with fuchs dystrophy were treated with either excimer laser ([exc ] groups i and ii) or femtosecond laser - assisted ([flak ] groups iii and iv) penetrating keratoplasty. main intraoperative outcome measures included intraoperative decentration, need for additional interrupted sutures, alignment of orientation markers, and intraocular positive pressure (vis a tergo). results. intraoperative recipient decentration occurred in 4 eyes of groups iii / iv but in none of groups i / ii. additional interrupted sutures were not necessary in groups i / ii but in 5 eyes of groups iii / iv. orientation markers were all aligned in groups i / ii but were partly misaligned in 8 eyes of groups iii / iv. intraocular positive pressure grade was recognized in 12 eyes of groups i / ii and in 19 eyes of groups iii / iv. in particular, in group iii, severe vis a tergo occurred in 8 eyes. conclusions. intraoperative decentration, misalignment of the donor in the recipient bed, and need for additional interrupted sutures as well as high percentage of severe intraocular positive pressure were predominantly present in the femtosecond laser in keratoconus eyes. |
primary sjgren 's syndrome (pss) is a t cell - mediated autoimmune disorder characterized by lymphocytic infiltrates, destruction of the salivary glands, and systemic production of autoantibodies against ribonucleoprotein particles (ss - a / ro and ss - b / la).13 finding the subtypes m1, m3 and m4 submandibular gland machrs - specific auto antibodies in a majority of patiens with pss is an important advance towards understanding the pathogenesis of pss.46 however, m3 machr is the major subtype expressed in the membrane of rat submandibular gland and also, m3 machr pss igg was more active than m1 and m4 machrs pss igg.7 it is assumed that autoreactive t cells and m3 machr - specific antibodies may recognize auto antigens, triggering autoimmunity in the salivary glands, and leading to clinical symptoms of mouth and eye dryness (sicca syndrome).8 these data indicate an important role for t and b cell interactions in the pathogenesis of salivary gland autoimmunity. profound secretary dysfunction may be associated with the capacity of these auto antibodies to impair the acetylcholine action on machrs on aqueous salivary secretion.6 however, the mechanism underlying the machr - specific autoantibody - mediated alteration of the secretion of salivary mucins via binding to the m3 machr remains to be defined. the acinar cells of the submandibular gland receive both adrenergic and cholinergic innervations that regulate secretory responses such as the release of water, electrolytes and proteins. it is accepted that the release of high molecular weight mucin is provoked by the stimulation of the adrenergic receptors in rat submandibular glands910 and electrical stimulation of chorda tympani and can be induced by injection of bethanechol in vivo into a dog submandibular gland.11 the ability of muscarinic cholinergic stimulation to elicit mucin release is dependent on the increase of intracellular calcium ion in the cells of rat submandibular gland ; this highlights the need of calcium function in receptor - mediated mucin release.12 the increase in intracellular calcium in antral mucous cells results in the stimulation of cyclooxygenase-1 (cox-1) activity, which in turn leads to the prostaglandin e2 (pge2) synthesis and its subsequent release from cells. the secreted pge2 may then enhance the calcium - regulated mucin exocytosed by antral mucosal cells.13 the major goal of the present study was to demonstrate that the serum igg from pss patients interacts with m3 machr in rat submandibular gland and regulates the release and production of mucin, and to determine if this effect is associated with the activation of phospholipase c (plc) and cyclooxygenase-2 (cox-2). female patients within the range of 3555 yrs of age, free from receiving treatment for 6 months, and with 7 - 15 yr from the time of the diagnosis of their illness, were selected from the metropolitan area of buenos aires (argentina). the patients in the present study were 18 women with primary sjgren 's syndrome (pss) who presented with dry mouth, and 16 healthy women (mean age 45 10 yr) without any systemic diseases (control group). the diagnosis of ss was based on four or more of the criteria published elsewhere.14 biopsy results, degree of xerostomia and keratoconjunctivitis sicca, and the results of serological tests on the different groups were the same as previously reported.15 all participants agreed to participate in the study, according to an approved protocol satisfying the ethics committee requirement of buenos aires university at the school of dentistry. serum igg fraction from patients with pss and from normal individuals (as control) were isolated using protein g affinity chromatography as described elsewhere16 briefly, serum were loaded onto the protein g affinity columns (sigma, st louis, mo, usa). the columns were then equilibrated with 1 m tris hcl, ph 8.0, and the columns were then washed with 10 volumes of the same buffer. the igg fraction was eluted with 100 mm glycine - hcl, ph 3.0, and immediately was neutralized with the corresponding buffer. the igg fraction from patients with pss was independently subjected to affinity chromatography using the m3 machr synthesized peptide (25-mer peptide ; k - r - t - v - p - d - n - q - c - fi - q - f - l - s - n - p - a - v - t - f - g - t - a - i) covalently linked to an affigel 15 (bio - rad, richmond, ca, usa). the igg fraction was loaded onto the affinity column equilibrated with phosphate - buffered saline (pbs) and the non6 anti - peptide fraction was first eluted using the same buffer. specific anti - peptide autoantibodies were then eluted using 3 m kscn/1 m nacl, followed by immediate extensive dialysis against pbs. the igg concentrations of both nonanti- peptide immunoglobulins (igs) and specific anti - muscarinic receptor peptide igs (pss igg) were determined using radial immunodiffusion assays. immunological reactivity against the muscarinic receptor peptide was evaluated using an enzyme - linked immunosorbent assay (elisa).16 after removing free connective tissue and fat from submandibular glands, they were cut into small slices that were incubated in 500 l of krebs ringer bicarbonate medium (krb), ph 7.4, with 5% co2 in o2 for 30 min at 37 c. when inhibitors were used, they were included from the beginning of the incubation time and stimuli were added during the last 15 min. mucin production and release into the medium were determined using the alcian blue methodology as described by hall.17 and modified by sarosiek.18 mucin release and production were expressed as micrograms per milligrams of total protein (g / mg protein). rat submandibular gland slices (10 mg) were incubated for 60 min in 500 l of krb, gassed with 5% co2 in o2 at 37c. anti - m3 peptide pss igg or pilocarpine were added 30 minutes before the end of the incubation period and blockers were added 30 minutes before the addition of different concentrations of anti - m3 peptide pss igg or 1 10 m pilocarpine. all applied procedures were according to the protocol from the pge2 biotrak enzyme immuno assay system (elisa ; amersham biosciences, piscataway, nj, usa). the pge2 results were expressed as picograms per milligram of total protein (pg / mg protein). rat submandibular gland slices were incubated for 120 min in 500 l of krb gassed with 5% co2 in o2 with 1 ci [myo - h ] inositol ([h]mi) (sp. act. litium chloride (lici) (10 mm) was added for inositol monophosphate accumulation. pilocarpine and pss igg were added 30 minutes before the end of the incubation period and the blockers were added 30 minutes before the addition of the agonist. water - soluble insp were extracted after 120 min and the results were expressed as area units per milligram of tissue wet weight (area / mg wet weight). male wistar rats weighing within the range of 250 - 300 g from the pharmacologic bioterium (school of dentistry, university of buenos aires) were used throughout the study. the animals were kept in standard environmental conditions were fed with a commercial pellet diet and water. for surgical removal of submandibular glands, the experimental protocol followed the guide to the care and use of experimental animals (dhew publication, nih 80 - 23). pilocarpine (machr agonist), pirenzepine (m1 machr antagonist), 4-damp (m3 machr antagonist), u-73122 (plc inhibitor), and calphostin (pkc inhibitor) were obtained from sigma chemical co. ; fr-12204 (cox-1 inhibitor), dup 697 (cox-2 inhibitor), sc 19220 (ep2 receptor antagonist) and ah 6809 (ep1/ep2 receptor antagonist) were from tocris cookson (ellisville, mo, usa). the drugs were diluted in the bath to achieve the final concentrations as stated in the text. analysis of variance (anova) and a post - hoc test (dunnett 's method or student - newman - keuls test) were employed when a pair wise multiple comparison procedure was necessary. female patients within the range of 3555 yrs of age, free from receiving treatment for 6 months, and with 7 - 15 yr from the time of the diagnosis of their illness, were selected from the metropolitan area of buenos aires (argentina). the patients in the present study were 18 women with primary sjgren 's syndrome (pss) who presented with dry mouth, and 16 healthy women (mean age 45 10 yr) without any systemic diseases (control group). the diagnosis of ss was based on four or more of the criteria published elsewhere.14 biopsy results, degree of xerostomia and keratoconjunctivitis sicca, and the results of serological tests on the different groups were the same as previously reported.15 all participants agreed to participate in the study, according to an approved protocol satisfying the ethics committee requirement of buenos aires university at the school of dentistry. serum igg fraction from patients with pss and from normal individuals (as control) were isolated using protein g affinity chromatography as described elsewhere16 briefly, serum were loaded onto the protein g affinity columns (sigma, st louis, mo, usa). the columns were then equilibrated with 1 m tris hcl, ph 8.0, and the columns were then washed with 10 volumes of the same buffer. the igg fraction was eluted with 100 mm glycine - hcl, ph 3.0, and immediately was neutralized with the corresponding buffer. the igg fraction from patients with pss was independently subjected to affinity chromatography using the m3 machr synthesized peptide (25-mer peptide ; k - r - t - v - p - d - n - q - c - fi - q - f - l - s - n - p - a - v - t - f - g - t - a - i) covalently linked to an affigel 15 (bio - rad, richmond, ca, usa). the igg fraction was loaded onto the affinity column equilibrated with phosphate - buffered saline (pbs) and the non6 anti - peptide fraction was first eluted using the same buffer. specific anti - peptide autoantibodies were then eluted using 3 m kscn/1 m nacl, followed by immediate extensive dialysis against pbs. the igg concentrations of both nonanti- peptide immunoglobulins (igs) and specific anti - muscarinic receptor peptide igs (pss igg) were determined using radial immunodiffusion assays. immunological reactivity against the muscarinic receptor peptide was evaluated using an enzyme - linked immunosorbent assay (elisa).16 after removing free connective tissue and fat from submandibular glands, they were cut into small slices that were incubated in 500 l of krebs ringer bicarbonate medium (krb), ph 7.4, with 5% co2 in o2 for 30 min at 37 c. when inhibitors were used, they were included from the beginning of the incubation time and stimuli were added during the last 15 min. mucin production and release into the medium were determined using the alcian blue methodology as described by hall.17 and modified by sarosiek.18 mucin release and production were expressed as micrograms per milligrams of total protein (g / mg protein). rat submandibular gland slices (10 mg) were incubated for 60 min in 500 l of krb, gassed with 5% co2 in o2 at 37c. anti - m3 peptide pss igg or pilocarpine were added 30 minutes before the end of the incubation period and blockers were added 30 minutes before the addition of different concentrations of anti - m3 peptide pss igg or 1 10 m pilocarpine. all applied procedures were according to the protocol from the pge2 biotrak enzyme immuno assay system (elisa ; amersham biosciences, piscataway, nj, usa). the pge2 results were expressed as picograms per milligram of total protein (pg / mg protein). rat submandibular gland slices were incubated for 120 min in 500 l of krb gassed with 5% co2 in o2 with 1 ci [myo - h ] inositol ([h]mi) (sp. act. litium chloride (lici) (10 mm) was added for inositol monophosphate accumulation. pilocarpine and pss igg were added 30 minutes before the end of the incubation period and the blockers were added 30 minutes before the addition of the agonist. water - soluble insp were extracted after 120 min and the results were expressed as area units per milligram of tissue wet weight (area / mg wet weight). male wistar rats weighing within the range of 250 - 300 g from the pharmacologic bioterium (school of dentistry, university of buenos aires) were used throughout the study. the animals were kept in standard environmental conditions were fed with a commercial pellet diet and water. for surgical removal of submandibular glands, the experimental protocol followed the guide to the care and use of experimental animals (dhew publication, nih 80 - 23). pilocarpine (machr agonist), pirenzepine (m1 machr antagonist), 4-damp (m3 machr antagonist), u-73122 (plc inhibitor), and calphostin (pkc inhibitor) were obtained from sigma chemical co. ; fr-12204 (cox-1 inhibitor), dup 697 (cox-2 inhibitor), sc 19220 (ep2 receptor antagonist) and ah 6809 (ep1/ep2 receptor antagonist) were from tocris cookson (ellisville, mo, usa). the drugs were diluted in the bath to achieve the final concentrations as stated in the text. analysis of variance (anova) and a post - hoc test (dunnett 's method or student - newman - keuls test) were employed when a pair wise multiple comparison procedure was necessary. female patients within the range of 3555 yrs of age, free from receiving treatment for 6 months, and with 7 - 15 yr from the time of the diagnosis of their illness, were selected from the metropolitan area of buenos aires (argentina). the patients in the present study were 18 women with primary sjgren 's syndrome (pss) who presented with dry mouth, and 16 healthy women (mean age 45 10 yr) without any systemic diseases (control group). the diagnosis of ss was based on four or more of the criteria published elsewhere.14 biopsy results, degree of xerostomia and keratoconjunctivitis sicca, and the results of serological tests on the different groups were the same as previously reported.15 all participants agreed to participate in the study, according to an approved protocol satisfying the ethics committee requirement of buenos aires university at the school of dentistry. serum igg fraction from patients with pss and from normal individuals (as control) were isolated using protein g affinity chromatography as described elsewhere16 briefly, serum were loaded onto the protein g affinity columns (sigma, st louis, mo, usa). the columns were then equilibrated with 1 m tris hcl, ph 8.0, and the columns were then washed with 10 volumes of the same buffer. the igg fraction was eluted with 100 mm glycine - hcl, ph 3.0, and immediately was neutralized with the corresponding buffer. the igg fraction from patients with pss was independently subjected to affinity chromatography using the m3 machr synthesized peptide (25-mer peptide ; k - r - t - v - p - d - n - q - c - fi - q - f - l - s - n - p - a - v - t - f - g - t - a - i) covalently linked to an affigel 15 (bio - rad, richmond, ca, usa). the igg fraction was loaded onto the affinity column equilibrated with phosphate - buffered saline (pbs) and the non6 anti - peptide fraction was first eluted using the same buffer. specific anti - peptide autoantibodies were then eluted using 3 m kscn/1 m nacl, followed by immediate extensive dialysis against pbs. the igg concentrations of both nonanti- peptide immunoglobulins (igs) and specific anti - muscarinic receptor peptide igs (pss igg) were determined using radial immunodiffusion assays. immunological reactivity against the muscarinic receptor peptide after removing free connective tissue and fat from submandibular glands, they were cut into small slices that were incubated in 500 l of krebs ringer bicarbonate medium (krb), ph 7.4, with 5% co2 in o2 for 30 min at 37 c. when inhibitors were used, they were included from the beginning of the incubation time and stimuli were added during the last 15 min. mucin production and release into the medium were determined using the alcian blue methodology as described by hall.17 and modified by sarosiek.18 mucin release and production were expressed as micrograms per milligrams of total protein (g / mg protein). rat submandibular gland slices (10 mg) were incubated for 60 min in 500 l of krb, gassed with 5% co2 in o2 at 37c. anti - m3 peptide pss igg or pilocarpine were added 30 minutes before the end of the incubation period and blockers were added 30 minutes before the addition of different concentrations of anti - m3 peptide pss igg or 1 10 m pilocarpine. all applied procedures were according to the protocol from the pge2 biotrak enzyme immuno assay system (elisa ; amersham biosciences, piscataway, nj, usa). the pge2 results were expressed as picograms per milligram of total protein (pg / mg protein). rat submandibular gland slices were incubated for 120 min in 500 l of krb gassed with 5% co2 in o2 with 1 ci [myo - h ] inositol ([h]mi) (sp. act. litium chloride (lici) (10 mm) was added for inositol monophosphate accumulation. pilocarpine and pss igg were added 30 minutes before the end of the incubation period and the blockers were added 30 minutes before the addition of the agonist. water - soluble insp were extracted after 120 min and the results were expressed as area units per milligram of tissue wet weight (area / mg wet weight). male wistar rats weighing within the range of 250 - 300 g from the pharmacologic bioterium (school of dentistry, university of buenos aires) were used throughout the study. the animals were kept in standard environmental conditions were fed with a commercial pellet diet and water. for surgical removal of submandibular glands, the experimental protocol followed the guide to the care and use of experimental animals (dhew publication, nih 80 - 23). pilocarpine (machr agonist), pirenzepine (m1 machr antagonist), 4-damp (m3 machr antagonist), u-73122 (plc inhibitor), and calphostin (pkc inhibitor) were obtained from sigma chemical co. ; fr-12204 (cox-1 inhibitor), dup 697 (cox-2 inhibitor), sc 19220 (ep2 receptor antagonist) and ah 6809 (ep1/ep2 receptor antagonist) were from tocris cookson (ellisville, mo, usa). the drugs were diluted in the bath to achieve the final concentrations as stated in the text. analysis of variance (anova) and a post - hoc test (dunnett 's method or student - newman - keuls test) were employed when a pair wise multiple comparison procedure was necessary. at concentrations ranging from 1 10 - 9 m to 1 10 - 6 m, pss - associated igg induced a concentration - dependent inhibitory effect on the release and production of mucin by the rat submandibular gland (figure 1a, b). normal igg did not modify either the release or production of mucin (figure 1a, b). in contrast, pilocarpine increased mucin release (figure 1a) without modifying its production (figure 1b). dose - response - curves of pss igg (), normal igg () and pilocarpine () on mucin release (a) and mucin production (b). rat salivary glands were incubated with each concentration of the reactant for 30 min and the concentration of mucin was assayed as described in the material and methods. values represent the mean standard error of the mean (sem) of 18 patients with pss and 16 normal subjects. the m3 machr antagonist 4-damp, but not the m1 machr antagonist, pirenzepine, neutralized the effect of pss igg (1 10 - 7 m) on both mucin release and production (figure 2a). while the stimulatory effect of pilocarpine (1 10 - 7 m) on mucine release was abrogated by pirenzepine effect of 1 10 m pss igg (a) and 1 10 m pilocarpine (b) on mucin release (black column) and mucin production (white column) by the rat submandibular gland. the salivary glands were incubated for 30 min in the absence (basal) or presence of pss igg (alone) or with 1 10 m 4-damp or 1 10 m pirenzepine. values are expressed as the mean sem of 18 pss patients in each group. p < 0.001 vs. pss igg alone or pilocarpine alone. to investigate the possibility that plc and cox-2 activities were involved in the inhibitory effect of pss igg on mucin release and production, the effect of selective inhibitors of plc (u-73122, 5 10 - 6 m) and of cox-2 (dup 697, 5 10 - 6 m) was determined. u-73122 and dup 697 prevented the pss igg -mediated inhibition of mucin release and production. moreover, sc 19220 (1 10 - 8 m), an ep1 receptor antagonist, also blocked the pss igg effects (figure 3a, b). upper panel : dose - response curve of pss igg alone () or in the presence of 5 10 m dup 697 (), 5 10 m u-73122 (), and 1 10 m sc 19220 () on mucin release (a) and mucin production (b). p < 0.001 vs. pss igg + dup 697, u-73122 or sc 19220. lower panel : (c) total insp accumulation and (d) pge2 production in rat submandibular glands in the absence (basal) or presence of 1 10 m pss igg (alone), 1 10 m pss igg + u-73122 or sc 19220 or 4-damp. c : p < 0.001 vs. pss igg + u-73122 or sc 19220 or 4-damp. d : p < 0.001 vs. pss igg + u-73122 or dup 697 or sc 19220 or 4-damp. to discern the participation of different second messengers in the signal transduction pathways triggered after pss igg binds and activates m3 machr, the production of pge2 and insp were measured. this clearly demonstrated that pss igg (1 10 - 7 m) stimulated the accumulation of insp and generated pge2 (figure 3c, d). the inhibition of plc by u-73122 and the ep1 receptor antagonist sc 19220, abrogated the stimulatory action of pss igg on insp accumulation (figure 3c). moreover, the inhibition of plc (u-73122) and cox-2 (dup 697) diminished the stimulatory activity of pss igg on pge2 generation. the production of both insp and pge2 was blocked by the m3 machr antagonist 4-damp (figure 3c, d). there is a significant negative correlation between pss igg - stimulated production of pge2 and insp with pss igg - mediated inhibition of mucin production (figure 4a, b). these results demonstrated that the activation of the m3 machr by pss igg inhibited mucin production by stimulating insp accumulation and pge2 production. negative correlation between the inhibition of mucin production and the stimulation of the production of pge2 (a) or accumulation of insp (b) by the igg from patients with primary sjgren 's syndrome. table 1 shows comparatively, the pss igg inhibitory action with pilocarpine stimulatory activity on mucin release. the pss igg - inhibition of mucin release could be prevented by cox-2 (dup 697) and ep1 receptor antagonist (sc 19220) or by inhibiting the activities of plc (u-73122) and pkc (calphostin). in contrast, the pilocarpine stimulatory activity was abrogated by cox-1 (fr 1220479) and ep1/ep2 receptor antagonists (ah 6809). plc (u-73122) and pkc (calphostin) inhibitors had no effect on our system. autoantibody acting at the level of the post - synaptic m3 machr of rat submandibular gland have been implicated in the autonomic parasympathetic dysfunction in pss. mucin secretion from rat submandibular gland is dependent on the parasympathetic stimulation.1920 sjgren 's syndrome is an autoimmune disease which is characterized by the hallmark clinical feature of salivary insufficiency associated with focal, periductal and perivenular lymphocytic infiltrates21 ; pss patients express autoantibodies against m3 machr that, at least in part, are responsible for altering the parasympathetic control of saliva secretion.2223 the effectiveness of pilocarpine in stimulating mucin release may suggest that the muscarinic cholinergic system participates in the regulation of mucin release from the rat submandibular gland24 and the mucin secretory response to the cholinergic agonist was dependent on the m1 machr subtype and a calcium -dependent mechanism.25 in contrast to the stimulatory effects of pilocarpine, in this study we demonstrated that patients with pss produce functional igg autoantibodies that interact with glandular m3 machr, inhibiting mucin release and production. the antibody - mediated inhibitory effect correlates with the incremental accumulation of insp and increase in pge2 production. this effect highlighted the possibility that autoantibodies play an important role in the pathogenesis of dry mouth in pss patients. furthermore, we even demonstrated the inhibition of mucin or the stimulation of insp and pge2 by pss igg, could be abolished by the inhibition of m3 machr, plc, or cox-2 activities, indicating that pss igg functions through m3 machr - mediated signalling in the submandibular gland membranes. under normal conditions, the constitutive isoform of cox-1 is in virtually all organs and its products help to maintain normal physiological functions such as cytoprotection. this is true for the authentic agonist, pilocarpine, which acts on m1 machr to increase mucin release and provoke an increase in pge2 production via the activation of cox-1. in contrast, in an inflammatory setting, the inducible isoform of the enzyme (cox-2) is produced, resulting in the generation of a large amount of pro - inflammatory pge2.26 this pro- inflammatory agent mediates acute and chronic inflammation, immunological alterations and cytotoxic tissue damage.26 in the present study, we demonstrated that the pro - inflammatory mediator, cox-2, and its product, pge2, are induced by pss - specific autoantibodies. therefore, the inflammatory process described in the glands of pss patients might be attributed partly to antibody fixation on membranes that, through interaction with m3 machr, triggers pge2 production via cox-2 activation. an important feature of the differences seen in the effect of pss igg and pilocarpine is the ability to decrease or increase mucin release, respectively. this difference could be related to the machr and pge2 receptor subtypes they interact with. in pilocarpine - stimulated mucin release, the m1 machr and ep2 receptor subtypes are involved ; in pss igg - decreased mucin release, the m3 machr and ep1 receptor subtypes are involved. moreover, the activation of m1 machr and ep2 receptors increases camp and calcium mobilization,27 while the activation of m3 machr and ep1 receptors decreases camp and increases pkc activity.27 in addition, mucin secretion is stimulated by a number of agents that elevate camp concentration28 and the inhibition of mucin secretion is related to a decrease in camp and pkc activation.24 sjgren 's syndrome patients present a marked decrease in output per minute of mucin 5b.29 mucin 5b is assumed to coat and protect oral tissue.3032 the decreased concentration of mucin 5b in the saliva of pss patients could lead to a reduced protection of oral tissue and increased susceptibility to mucosal damage.29 based on our results, we postulated that the agonist - promoted activation of glandular m3 machr initiated by pss igg binding and persistent activation results in the production of pge2 and accumulation of insp, leading to inhibition of mucin release and production. this inhibition was mediated by igg autoantibodies in pss patients and could lead to a reduction in the protection of oral tissues and increased susceptibility to mucosal damage. moreover, it may also promote the presence of plaque at the level of gingival margin on the tooth leading to caries and periodontal problems, which are frequently seen in ss patients. | background : patients with primary sjgren 's syndrome (pss) produce functional igg against cholinoreceptor of exocrine glands modifying their activity. the aim of the present work was to demonstrate pss igg antibodies (pss igg) interacting with m3 muscarinic acetylcholine receptors (machr) of rats submandibular glands that alter mucin release and production via phospholipase c (plc) and cyclooxigenase-2 (cox-2) pathways.methods:mucin release and production of prostaglandin e2 (pge2), and total inositol phosphates (insp) were measured in rat submandibular gland in the presence of pss igg auto antibodies.results:the auto antibodies interacting with m3 machr decreased mucin release and production through stimulation of plc and cox-2. this stimulation leads to an incremental increase in insp production and in pge2 generation, inducing signalling through the prostaglandin membrane receptors subtype 2 (ep2). moreover, the decrease in mucin production had negative correlation with pge2 generation and insp accumulation.conclusion:igg in patients with pss could play an important role in the pathoetiology of dry mouth, decreasing the salivary mucin through the production of proinflammatory substances and leading to the reduction in the protection of the oral tissues. |
the wealth of data deposited by structural gnenomics initiatives indicates that 20% of protein crystal structures contain stably bound small molecules. these endogenous ligands include substrates, cofactors, products, bound metal ions,(1) and even components of the crystallant. for example, of 3500 structures deposited by the protein structure initiative (as of january 2009), approximately 342 contain natural ligands and 280 contain cofactors (http://smb.slac.stanford.edu/jcsg/ligand_search/). not infrequently, electron density deriving from an unknown ligand is present in deposited structures. moreover, there are numerous reports of natural molecules that mediate powerful biological effects by stabilizing proteinprotein interactions. evolution produced conserved protein motifs that optimally bind small molecules representing preferred or privileged chemical architectures. kuntz.(4) showed empirically that for ligands that bind strongly to proteins, each non - hydrogen atom contributes about 1.5 kcal / mol to the free energy of ligand binding to about 15 non - hydrogen atoms (180 mw), the maximum size of most enzyme substrates or metabolites. furthermore, the dominant interactions were van der waals interactions that will depend upon shape complementarity and hydrophobic effects. thus, the coevolution of protein structures with chemical architectures represented in the metabolome will select for optimization of van der waals interactions based on shape complementarity. this suggests that the natural molecules of life represented by the metabolome(5) can be a preferred starting point for fragment based drug discovery (fbdda).aabbreviations : lta4h, leukotriene a4 hydrolase ; lcms, liquid chromatography mass spectrometry ; fol, fragments of life ; fbdd, fragment based drug discovery ; tpsa, total polar surface area ; nmr, nuclear magnetic resonance ; pdb i d, protein data bank identification number ; clogp, calculated log of octanol / water partition coefficient ; ltb4, leukotriene b4 ; fol - nat, members of the fragments of life library that are natural molecules of life ; fol - natd, members of the fragments of life library that are synthetic derivatives or isosteres of natural molecules of life ; fol - biaryl, members of the fragments of life library that are synthetic biaryl molecules, many of whose energy minimized structures mimic -, -, and -turns ; hwb, human whole blood ; rt, room temperature. abbreviations : lta4h, leukotriene a4 hydrolase ; lcms, liquid chromatography mass spectrometry ; fol, fragments of life ; fbdd, fragment based drug discovery ; tpsa, total polar surface area ; nmr, nuclear magnetic resonance ; pdb i d, protein data bank identification number ; clogp, calculated log of octanol / water partition coefficient ; ltb4, leukotriene b4 ; fol - nat, members of the fragments of life library that are natural molecules of life ; fol - natd, members of the fragments of life library that are synthetic derivatives or isosteres of natural molecules of life ; fol - biaryl, members of the fragments of life library that are synthetic biaryl molecules, many of whose energy minimized structures mimic -, -, and -turns ; hwb, human whole blood ; rt, room temperature. we therefore constructed a screening set for fbdd that we have called fragments of life fragment - based drug discovery has gained acceptance within the pharmaceutical industry (as reviewed by congreve.(9)), as it provides an alternative to expensive and sometimes inefficient high - throughput screening (hts) methods for chemical hit identification.(10) the general concept of fbdd involves screening of low molecular weight rule of three compounds (mw 1 mm). therefore, the two shallow surface pockets mapped out by compounds 10 and 7 are unlikely to be useful targets for inhibition of lta4h. however, our findings suggest that the application of fol methodology may yield additional insight into the topology of surface domains or allosteric sites. it could be further used to develop modulators of proteinprotein interactions.(76) the two most common approaches in fbdd are fragment evolution and fragment linking.(9) the fragment evolution technique involves chemical optimization of the initial fragment hit to produce higher affinity ligands.(77) fragment linking is focused on assembling adjacent independently bound fragments into a single molecule to produce high affinity ligands. in order to expedite the transition from fragment hits to leadlike molecules, we explored the possibility of identifying dual simultaneous fol hits in lta4h. fragment plus fragment approach was inspired by a growing number of cases where two small molecules bind within protein targets and contact each other. for example, this can be seen in the interaction of the plant hormone auxin (indole-3-acetic acid)(82) and an inositol hexakisphosphate cofactor in the crystal structure of the tir1-ask1 complex.(2) in one fragment plus fragment approach, we soaked lta4h crystals with fol pools that were spiked with 1 mm bestatin (ic50 = 178 nm in peptidase assay). subsequent screening of fol yielded three different indole fragments (compounds 1113) bound in the substrate binding cleft (figure 2km). notably, these fragments interacted with lta4h only in the presence of bestatin. a representative example, this core is exhibited in the 5-hydroxyindole-3-acetic acid structure, which is a serotonin metabolite(83) (figure 1). it was bound near residues trp311 and tyr378, with the hydroxyl oriented closest to the bestatin, 3.5 away (figure 2k). two halogenated analogues of 11, namely, 12 and 13 lined up with the target in a similar orientation. both chlorine and fluorine atoms of 12 and 13, respectively, were 5.7 away from the nearest atom of the phenyl ring of bestatin. the shift in the binding mode of these indoles likely results from their decreased polar surface area compared to 11. all obtained x - ray structures revealed well - defined electron density maps for bestatin with a binding mode essentially identical to that previously observed.(26) in another approach, we sought to determine if the presence of bestatin could alter the binding mode of another fragment hit whose binding pose would be expected to be overlapping or incompatible with bestatin. our rationale for this approach was to determine if the binding mode(s) of any fragments could be adjusted by induced - fit mechanisms resulting from the bestatin interaction with zn. with this approach, we found that bestatin could induce dihydroresveratrol (3) to adopt a different pose compared to the fragment 3 alone within the lta4h substrate binding cavity (figure 3a). specifically, a brief lta4h crystal soak of 3 (25 mm) followed by a 4 h soak with a mixture of 3 (25 mm) and bestatin (1 mm) resulted in a structure where 3 was displaced by 2.5 from its original binding site. with bestatin chelating the zn in its typical binding mode, molecule 3 was forced to bind at the bottom of the lta4h substrate binding cleft. it displaced two of the three structurally conserved water molecules with its phenolic hydroxyl groups (figure 3b) and was within a distance of 3.3 to bestatin. the torsional angle about the c7c8 bond featured by the molecule in a lta4h3bestatin structure was approximately 169. resveratrol (compound 2) could not be visualized in a similar crystal cosoak with bestatin. we attributed this outcome to the lack of flexibility in 2 that is critical to the binding at the bottom of the binding cleft in the presence of bestatin. the discovery of a binding mode unattainable without a second fragment was an interesting outcome from the fragment plus fragment approach. in this case, bestatin altered the topology of lta4h binding cavity and pushed dihydroresveratrol deeper into the cavity. as a result, the molecule adopted a novel binding mode requiring the side chain movement of phe362. the new observed binding mode is intriguing, particularly in the displacement of structurally conserved waters. it is conceivable that fragment elaboration principles could be employed to produce potent inhibitor(s) that incorporates design concepts of both bestatin and the novel dihydroresveratrol interaction. acetate is one of the smallest of fragments, with just four non - hydrogen atoms and a molecular weight of 56. in lta4h, acetate ions in the crystallization solution were often visualized binding to yb ions that are located at a key crystal lattice interface. similarly, we have observed acetate binding to the catalytic zn in the high resolution crystal structures of lta4h with fol compound 9 (figure 2i). we sought to extend the fragment plus fragment strategy by employing acetate bound at the catalytic zinc in combination with other fragments. notably, when 200 mm acetate was included as an additive in an lta4h crystal soak with compound 4, the final solved structure revealed both acetate and compound 4 binding simultaneously as anticipated from their previously observed individual binding modes. it is interesting to note that the acetatezn binding events together with the binding modes of compounds 4, 5, and 9 were essentially superimposable (see supporting information figure 6). on the basis of this observation, we postulated that a proper linking of carboxylic acid functionality to a hydrophobic biaryl would yield a potent inhibitor. of particular interest were templates that could provide for the proper dihedral angle and distances in positioning both biaryl and acetate pharmacophores within the active site of lta4h. physicochemical properties, good ligand efficiency, and chemical feasibility were additional criteria we considered. in the course of chemical studies, (r)-prolinol was selected as a tether between a hydrophobic biaryl and a metal - binding carboxylate, yielding dg-051 (19), a drug molecule that has completed phase iia clinical studies.(43) thus, the dg-051 molecule (figure 2s) displays two key pharmacophore features suggested by our fragment - based studies, namely, a carboxylic acid moiety binding to the active site zinc and a hydrophobic anchor at the bottom of the substrate binding cavity. the abundance of fragment screening data summarized above prompted us to improve the potency of several fol hits through a limited medicinal chemistry effort. the rationale was to conceptually prove that the identified weak binders could be rapidly evolved into a potent lta4h inhibitors following structural guidance obtained thus far. on the basis of the synthetic feasibility, we selected three fragments (4, 6, and 11) as templates for this chemical elaboration (see schemes 13). in selecting proper pharmacophores for our chemistry effort, we considered both the trajectory for fragment linkage as suggested by the structural studies as well as druglike character of the designed molecules. midsized cyclic amines were of particular interest, as they offered well - defined spatial orientation for the pharmacophores. furthermore, these moieties were expected to mediate additional interaction within the active site and to enhance solubility and permeability of a fragment derivative across biological barriers. a brief synthetic effort followed by crystallographic for example, considering the lta4h binding mode of 4, we reasoned that amendment of 20 with the optimized (r)-prolinol linker of dg-051 would yield a more potent molecule, 14 (scheme 1). further, on the basis of the structural data for 7, wherein its aminothiazole was found to displace structurally conserved water molecules deep within the lta4h active site cavity, we amended 23 to introduce both thiophene and (r)-prolinol groups to afford 18 (scheme 1). synthesis of the prolinol derived analogue 14 was accomplished by the nucleophilic displacement of tosyl group in 24 with the phenolate derived from 4-benzylaminophenol 20 (scheme 1). the friedelcrafts acylation of anisole with 4-iodobenzoyl chloride followed by reaction of the methyl ether 22 with boron tribromide in ch2cl2 provided the phenol 23. the sodium phenolate of 23, generated in situ with nah in dmf, was subsequently reacted with the tosylate 24 to provide the boc protected 4-iodobenzophenone derivative 26. stille coupling of 26 with thiophene-3-boronic acid followed by deprotection of the n - boc under acidic conditions provided the compound 18 (scheme 1). reagents and conditions : (a) alcl3, 10 c, nitrobenzene, 90% ; (b), bbr3, ch2cl2, 78 c 0 c, 85% ; (c) nah / dmf, 0 c rt 90 c ; (d) 1 m hcl / et2o, 8097% ; (e) thiophene-3-boronic acid (2 equiv), pd(oac)2 (25 mol %), k2co3/etoh / dme, 90 c, 60%. subsequent structural studies of 14 revealed that the pyrrolidine moiety was bound at the bend in the lta4h substrate binding cavity (figure 2n). its binding mode resembled the pyrrolidine group orientation in the dg-051-lta4h complex (figure 4). it was also similar to the positioning of the phenyl ring of bestatin bound to lta4h. this allowed the lone electron pair of the nitrogen to form a potential 3 hydrogen bond with o1 of gln134. this simple structure - guided modification immediately furnished a 4000-fold improvement in affinity of 14 against the enzyme with ic50 values of 207 and 157 nm in the peptidase and hydrolase assays, respectively. superimposing the structure of 14 with the coordinates of the fragment plus fragment structure of 4 with acetate showed that there was a 1.9 gap between the methyl carbon of acetate and the nearest carbon atom of the pyrrolidine (figure 4), suggesting that a single carbon atom linkage between the two components would yield a molecule with lta4h binding similar to that of dg-051 (figure 2s). structural studies of 18 (figure 2r) confirmed that, similar to 7, the thiophene moiety displaced two water molecules from the bottom of the substrate binding cavity (figure 5). the biaryl core of 18 was shifted compared to the parent molecule 6, moving carbonyl oxygens 5.2 apart. this motion likely decreased the unfavorable interaction with the backbone carbonyl of trp311, resulting in a potent inhibitor with ic50 values of 80 nm in the peptidase assay and 189 nm in the hydrolase assay. refined crystal structures of lta4h in complex with molecules in the compound 4 elaboration series are shown. compound 4 and acetate from the fragment plus fragment structure are displayed as yellow stick structures, while compound 14 is magenta and compound 19 (dg-051) is green. the side chain conformations of lta4h bound to each of these compounds are essentially superimposable (gray side chains) with the exception of gln134, which demonstrates some flexibility in its conformation as represented by dg-051 (green), compound 4 and acetate (yellow), and compound 14 (magenta). (a) superposition of compounds 6 (yellow), 17 (green), and 18 (cyan). invariant portions of the lta4h structure are colored gray, and compound - specific polar contacts, side chain conformations, and bound water molecules are color - coded by compound. (b) superpostion of 18 (cyan) with the thiazole - containing fragment 7 (rose) and the pyrrolidine containing compound 14 (magenta). both 7 and 18 displace the central structurally conserved water molecule, and both 14 and 18 have pyrrolidine moieties that occupy nearly the same space in the lta4h structures. to further explore elaboration of fragment 6, we displaced the fluorine atom in 6 with n - pyrrolidin-2-ethanol to furnish the biaryl ketone 27 (scheme 2). this intermediate was reduced with sodium borohydride to afford the targeted biaryl carbinol derivative 17 (scheme 2). reagents and conditions used are as follows : (a) 1-(2-hydroxyethyl)pyrrolidine, k - obu, dmso, 90 c, 16 h, 54% ; (b) nabh4, meoh, 40 c, 4 h. the lta4h cocrystal structure of 17 revealed a potential hydrogen bond between the oh group in the molecule and the carbonyl of trp311 (figure 2q). molecule 17 featured an ic50 of 202 m (peptidase assay) and 170 m (hydrolase assay), which was a 25- to 30-fold improvement over the initial hit 6 but was an order of magnitude less potent than molecule 18, the more fully elaborated derivative of fragment 6. this comparison suggests that the improved potency of compound 18 likely results from a combination of water molecule displacement deep within the lta4h active site pocket by the thiophene, plus the effects of hydrogen bonding between gln134 and the pyrrolidine of 18. encouraged by these data, we routinely used pyrrolidine - containing moieties in our optimization effort. for example, the 5-hydroxyindole fragment identified earlier as hit 11 was modified with 1-(2-methoxyethyl)pyrrolidine in the presence of k2co3 in acetone (scheme 3) to afford compound 15 (ic50 of about 321 and 234 m in the peptidase and hydrolase assays, respectively). structural data suggested that the pyrrolidine moiety of 15 occupied the same space as observed for 14, with the ring being in proximity to the side chain of gln134 (figure 2o). considering both activity data and synthetic feasibility, we attempted to replace the pyrrolidine ring of 15 with a piperidine carboxylic acid moiety to furnish 16 (scheme 3). for the preparation of compound 16, subsequent displacement of the primary chloro group of 28 with piperidine-4-carboxylic acid ethyl ester in refluxing 2-butanone furnished the ester derivative 29. this compound was further hydrolyzed with naoh in etoh to afford the targeted molecule 16. structural elucidation of 16 bound to lta4h revealed that its carboxylic acid moiety was bound to the active site zn (figure 2p). however, its potency of ic50 of about 1491 and 966 m in the peptidase and hydrolase assays, respectively, was 4-fold less than that of 15. positioning of indole group (figure 6) was driven by the orientation of pyrrolidine (for 15) and piperidine-4-carboxylic acid (for 16) pharmacophores in the active site of lta4h. elaboration of 5-hydroxyindole 11, showing superposition of the indole - containing fragment structures : 5-hydroxyindole 11 (dark green), 5-chlororindole 12 (magenta), 5-fluoroindole 13 (cyan), and derivative compounds 15 (yellow) and 16 (pink). reagents and conditions : (a) 1-(2-chloroethyl)pyrrolidine, k2co3, acetone, 19% ; (b) 1-bromo-2-chloroethane, k2co3, 2-butanone, reflux 60 h, 17% ; (c) piperidine-4-carboxylic acid ethyl ester, hcl (2 equiv), ki (0.3 equiv), k2co3, dmf, rt 90 c, 57% ; (d) aq naoh, etoh, rt. in this work we have combined the concepts of metabolomics with fragment based drug discovery to assemble a 1300-member fragments of life (fol) small molecule library for screening by x - ray crystallography. this set includes highly soluble metabolites, natural products, their derivatives, and biaryl molecules mimicking architectural motifs found in proteins. small molecules of life have coevolved with their respective macromolecular targets, and therefore, such interactions are likely to be highly ligand efficient. in addition, signaling pathways are known to display allosteric feedback mechanisms involving small molecules (for a recent review, see goodey and benkovic(84)). consequently, application of molecules of life in the fbdd approach may lead to the identification of novel allosteric binding sites in protein targets. in addition, many molecules of life are likely to feature druglike properties, since these compounds display properties necessary for intracellular activity (e.g., reasonable target affinity, reversible binding, controlled on / off rates, solubility, permeability, etc.). the fol library has been designed without target bias. in the initial validation, we screened approximately 200 molecules (15%) of the entire selection (1329 compounds) against lta4h using x - ray crystallography. most of the identified fragments (12 out of 13) were bound to the active site pocket, while fragment 10 bound within a shallow surface pocket. it is noteworthy that the two fragments found binding to the surface of lta4h were biaryl structures with either a thiophene or thiazole moiety plus at least one amino or hydroxyl group. interaction,(76) suggesting the possibility that these themes may be exploited to develop specialized fragment libraries to screen for modulators of proteinprotein interactions. importantly, fol hits varied both structurally and in their source within the library. specifically, biological molecules fol - nat (e.g., resveratrol, dihydroresveratrol, 5-hydroxindole), their derivatives fol - natd (e.g., 5-hydroxyindole, nicotinamide, and isonicotinic acid derivatives), and fol - biaryls which mimic a protein structure (e.g., fragment 10) were found to bind to lta4h in a diverse array of binding modes. the structures of lta4h with bound resveratrol (compound 2) and its metabolite dihydroresveratrol3 were of particular interest because of the potential therapeutic implications. as lta4h is involved in both increased risk of myocardial infarction(29) and inflammation,(30) one may consider attributing the apparent cardioprotective properties of resveratrol and other sirtuin activators to lta4h modulation. our finding suggests that the fol approach may facilitate rational identification of small molecule agents that simultaneously modulate several therapeutically relevant pathways.(8) the binding of dihydroresveratrol 3 also illustrates the potential utility of fragment plus fragment mode of screening. for example, when 3 bound to lta4h together with bestatin, several structural water molecules were displaced within the lta4h active site pocket and phe362 was found to adopt an alternative side chain rotamer conformation. this finding shows that when fragment cocktails are repooled with other fragments, new induced - fit fragment binding modes can be observed. using structural guidance from fol screening, we showed that fragment hits could be expeditiously modified to generate potent lta4h inhibitors in a short synthetic sequence. the diverse chemical nature of the initial hits suggests that this strategy is applicable to the identification of novel and structurally distinct chemotypes. in a representative example, structural information from diverse active fragments was combined to evolve a fragment hit 6 of very poor activity (ic50 = 5.3 mm) in the peptidase assay into a potent lta4h inhibitor 18 (ic50 = 80 nm) in two synthetic steps. fragment hit 4 was derivatized in a single step to afford 14, a novel and potent inhibitor of lta4h (ic50 = 150 nm in the hydrolase assay) with comparable potency (ic50 = 131 nm) for inhibition of ltb4 production in human whole blood. compound 14 featured high ligand efficiency of 0.44 kcal/(molheavy atom) vs 0.36 kcal/(molheavy atom) for the clinical candidate dg-051 19. thus, a combination of properly selected fragments with structural insight into their mode of binding allowed for maintenance of ligand efficiency and druglike potential of the optimized hits. the fol library was of value in expanding the known chemical space of lta4h inhibitors. for example, the binding modes of our compounds 4 and 5 were all superimposed and mimicked the benzoxyphenyl components of lta4h inhibitors reported by kirkland. (see supporting information figure 4).(40) furthermore, our ligand docking studies suggest that the predicted binding modes of the lta4h inhibitors reported by grice. and namely, the indole core of fragments 12 and 13 overlaps well with the benzoxazole or benzothiazole templates described by these authors (see supporting information figure 7). the fluorophenyl ring of 6, the phenol substituent of 2 and 3, the phenyl ring of 4, and 5 all superimpose to emulate the binding mode of the phenoxy pharmacophore featured in the inhibitors reported by grice. and kirkland. (see supporting information figure 8). given the importance of lta4h activity in myocardial infarction and inflammatory respiratory disease,(88) we previously reported the development of dg-051 (19, figure 2s). this molecule is a potent inhibitor of ltb4 production in human whole blood (ic50 = 37 nm). it has recently completed phase iia clinical trials.(43) the agent comprises three functional components : a butanoic acid, a pyrrolidine linker, and a lipophilic biphenyl ether moiety. as suggested by our structural studies, reversible binding of the butanoic acid moiety of dg-051 to zn in the active site of lta4h was mimicked by the acetate ion in our fragment plus fragment approach (figure 4). the pyrrolidine linker that provides flexibility for dg-051 to navigate the bend in the substrate binding cavity was largely typified by the prolinol derivatives 14 and 18 as well as the pyrrolidine derivatives 15 and 17. the biphenyl ether functionality of our clinical candidate binds within the most hydrophobic part of the cleft lined with aromatic amino acid residues including tyr267, trp311, and phe314. its chlorine substituent resides within 3.2 from one of the three structurally conserved water molecules (in the proximity of lys364 and leu365) at the bottom of the l - shaped active site cavity.(43) these binding features of dg-051 were represented by fragments 29. in summary, we introduced a concept of fragments of life (fol) library for structure - based drug discovery. in proof - of - concept studies we further demonstrated that the identified fragments could be optimized in a short reaction sequence to yield molecules with high ligand efficiency and potent biological activity. the fragments and their derivatives feature binding efficiency for lta4h and surface efficiency indices that match those of marketed drugs(16) (see supporting information figure 9). further studies are required to determine the versatility of the fol library screening against diverse target classes. it is likely that further chemical amendments to this selection will be needed to enhance hit rates. in addition, the versatility of the fol set is being tested in different readout platforms including nmr and surface plasmon resonance. recombinant human lta4h (residues 1611) was expressed in e. coli bl21-ai / prare. an amount of 7.5 g of cell paste was lysed by nitrogen cavitation at 2200 psi for 1 h in a lysis buffer consisting of 50 mm tris - hcl, ph 8.0, 1 mm pmsf, 0.2 mg / ml lysozyme, and 1.5 u / ml benzonase. the lysate was clarified by centrifugation at 42 000 rpm for 45 min at 4 c. lysate was then applied to 2 5 mm histrap hp columns (ge healthcare) equilibrated with 20 mm tris - hcl, ph 8.0, and 200 mm nacl. the column was washed with six column volumes of 30 mm imidazole and eluted with a linear gradient of 30300 mm imidazole in 20 mm tris - hcl, ph 8.0, containing 200 mm nacl. the pooled peak fractions were > 95% pure by sdspage at a concentration of 2.7 mg / ml and used directly for crystallization without further concentration or dialysis. lta4h was crystallized by sitting drop vapor diffusion against a crystallant containing 100 mm imidazole, ph 6.5, 12.67% w / v peg-8000, 100 mm sodium acetate, and 5 mm ybcl3. seed stocks were prepared by suspending several crystals in 20 l of crystallant and crushing them by vortexing in a seed bead tube (hampton research). crushed crystals were diluted 1:100 into fresh crystallant and vortexed again to form the final seed stock. 96-well crystallization plate (emerald biosystems) by combining 0.7 l of lta4h (2.7 mg / ml) with 0.7 l of crystallant and 0.2 l of seed stock over a reservoir volume of 100 l. twenty - five pools of eight compounds from the fol library were screened against lta4h by x - ray crystallography. pool stocks consisted of cocktails of eight fragments, each at 6.25 mm in methanol. individual fol compounds are stored in barcode labeled sealed septum vials as 50 mm stocks in pure methanol and stored at 20 c. approximately 30% of the fragment stocks have been analyzed over a period of 12 months by mass spectrometry to demonstrate general stability of the compounds in methanol (data not shown). fragment cocktails in methanol were spotted onto the drop chambers of crystallization plates and the solvent was allowed to evaporate, leaving a precise amount of fragment compounds as a dry powder with no solvent residue that could potentially interfere with crystallization or crystal stability. a volume of crystallization mother liquor equal to the initial volume of fragment cocktail was added to the dry powder, allowing for dissolution of the fragments. this technique is versatile, as it is suitable for both cocrystallization and soaking experiments, and adjusting ratios of methanol solution to crystallant solution allows for adjustment of the final fragment concentration in the drop. although diversity pooling was conducted to aid in identification of fragments from pool density alone, factors such as low resolution, low occupancy, or competitive binding can lead to uncertainty. therefore, in cases where crystals exposed to fragment cocktails produce difference electron density indicative of fragment binding, follow - up experiments with individual fragments were performed. during this deconvolution step, the resulting crystal structures provide unambiguous confirmation of fragment hits, and all structures presented were generated from single molecule crystal soaking experiments. l - arginine - p - nitroanilide (arg - pna) substrate was obtained from sigma. stock solution of arg - pna (500 mm) was prepared and serially diluted in dmso. final peptidase assays were performed in 96-well clear, flat bottom plates (corning). each assay plate contained eight positive (no inhibitor) and eight negative (no enzyme) controls. lta4h (45 l) and test compounds (5 l) were preincubated for 10 min followed by addition of substrate (50 l) ; final reactions contained 100 mm tris - hcl (ph 8.0), 100 mm nacl, 5% dmso, 0.5 mm arg - pna, and 20 nm lta4h. control experiments showed that 5% dmso had no effect by itself on enzyme activity (data not shown). reaction rates were monitored in a spectramax 190 plate reader (molecular devices) at room temperature (rt) by measuring the increase in absorbance at 410 nm due to cleavage of the amide bond of the substrate and formation of p - nitroaniline. reactions were measured for 30 min, and initial rates were determined from the linear portions of the progression curves using softmax pro software (molecular devices). doseresponse curves ware calculated by fitting data to a sigmoidal four - parameter logistic equation using prism (graphpad). lta4 substrate was prepared from the methyl ester of lta4 (biomol or cayman chemicals) by treatment under nitrogen with 100 mol equiv of naoh in an acetone / h2o (4:1) solution at rt for 40 min. stock solutions of lta4 were kept frozen at 80 c for a maximum of 1 week prior to use. recombinant human lta4h (10 nm final concentration) was incubated with various concentrations of test compound for 10 min at rt in assay buffer (0.1 m tris - hcl, 0.1 m nacl, 5 mg / ml fatty acid free bsa, 10% dmso, ph 8.0). immediately before the assay, lta4 was diluted in assay buffer (without dmso) and added to the reaction mixture to a final concentration of 1 m to initiate the enzyme reaction. samples were incubated for 10 min at rt followed by addition of 2 volumes of chilled quenching buffer (ch3cn with 1% ch3cooh and 73 nm ltb4-d4 (biomol). the samples were then stored at 4 c for 12 h to complete protein precipitation and centrifuged for 15 min at 1800 g. ltb4 formed was measured in the supernatant by lcms / ms using ltb4-d4 as an internal standard and an external ltb4 standard (biomol) for a calibration curve. briefly, the analyte was separated from ltb4 isomers formed by spontaneous hydrolysis of lta4 using isocratic elution on an hplc system (waters) and analyzed on a tandem quadrupole mass spectrometer (waters micromass quattro premier). mrm transitions followed on two channels were 335.2 195.3 (ltb4) and 339.2 197.3 (ltb4-d4). on the basis of the measured amounts of ltb4 formed at each inhibitor concentration, a doseresponse curve was fitted to the data using a sigmoidal four - parameter function (prism, graphpad) and an ic50 value was calculated. ligand efficiency values were calculated for hydrolase and peptidase assays independently using le (kcal/(molha)) = rt ln(ic50)/ha = 0.59179(ln ic50)/ha, where ha is the number of heavy atoms (non - hydrogen). human blood (45 ml) was collected in heparin - containing vacutainer tubes (greiner - bio one) with informed consent., 200 l of blood was dispensed into a prewarmed 96-well plate and 188 l of rpmi-1640 medium (invitrogen) containing 20 g / ml indomethacin (sigma) was added. an amount of 4 l of a series of compound dilutions (final dmso concentration of 1%) was added in triplicate, followed by a 15 min incubation at 37 c with gentle shaking. blood samples were stimulated by adding 8 l of ionomycin (from streptomyces conglobatus, calbiochem) to a final concentration of 36 m. after another incubation at 37 c for 30 min, samples were centrifuged at 4 c for 5 min at 1800 g. ltb4 concentrations in supernatants were determined using a commercially available enzyme - linked immunosorbent assay (r&d systems) according to the manufacturer s instructions. on the basis of the measured amounts of ltb4 formed at each inhibitor concentration, a doseresponse curve was fitted to the data using a sigmoidal three - parameter function (xlfit, idbs), and an ic50 value was calculated. each assay plate contained eight positive controls (no compound) and eight negative controls (no ionomycin). approximately 400 candidate fragments representing natural molecules of life with (i) molecular weights less than 350, (ii) fewer than six hydrogen bond donors, and (iii) fewer than seven hydrogen bond acceptors were manually selected from known metabolic pathways. molecules were selected from eukaryotic, archaebacterial, and eubacterial metabolic pathways and from presumed primordial pathways. there was no bias toward any particular metabolic pathway ; however, molecules of conserved intermediary metabolism were prioritized.(91) approximately 300 of the resulting fragments were commercially available, reasonably priced, and acquired. these fragments were tested for solubility (50 mm in methanol) to yield a final core set of 218 natural molecules (fol - nat). the chemical diversity of the first 218 fol - nat fragments was determined using a 210 210 principal component analysis (pca) using cerius (accelrys). in this analysis 1d, 2d, and 3d descriptors (conformational, cat shape, electronic, quantum chemical, information content, spatial, structural, thermodynamical, topological, and geometrical) were calculated and the 3d distribution of the fragments was visualized in a 3d plot (see supporting information figure 2). this analysis showed that the fragments were diverse but did not densely cover the desired chemical space. therefore, in addition to the manual selection, we explored the available chemicals directory (acd / lab, version 7, mdl) and the maybridge fragment library (www.maybridge.com) as a source of additional fragments. we intended to diversify the original set by selecting heteroatom - containing derivatives of natural molecules (fol - natd) with fragment - like properties. toward this goal, a selection of 238 996 compounds were analyzed using modified rule of three(11) parameters to afford 49 877 fragments with (i) molecular weights between 110 and 250 da, (ii) calculated log of octanol / water partition coefficient (clogp) of less than or equal to 3.0 (calculated with software available from daylight chemical information systems, inc.), (iii) hydrogen bond donors less than or equal to 3, and (iv) hydrogen bond acceptors less than or equal to 6 (calculated with sybyl, version 6.8, tripos). virtual selection of the 49 877 molecules was further subjected to a panel of smarts filters(92) in order to eliminate molecules endowed with problematic functionalities. a partial list of these smarts filters included reactive functional groups, lipophilic chains of seven or more carbon atoms, crown ethers, disulfides, excessive (> 3) acidic groups, thiols, epoxides, aziridines, hydrazones, thioureas, thiocyanates, benzylic quaternary nitrogens, thioesters cyanamide, four membered lactones, di- and triphosphates, metals, phosphines, phosphonic acids, sulfonic acids, sulfonyl halides, boronic acids, isotopes, salts, metals, more than 3 halogens, more than two nitro groups, and lanthanides. each fragment from the resultant filtering was converted from 2d to 3d projection using concord (tripos) and used to identify fragments with 3 rotatable bonds and calculated psa values of 60. the resulting 5606 fragments were again analyzed using the previously described principal component analysis (pca), and 1016 unique fragments were selected with preference for molecules that could be visually identified to have at least 8 atoms with chemical arrangements that matched that of a known natural molecule of life. from this set, these fragments were tested for solubility (> 50 mm in methanol), and the resulting 666 fragments (fol - natd) were added to the fol library. pca analysis showed that the fol - natd fragments occupy distinctly different chemical space (see supporting information figure 2) and that together the fol - nat and fol - natd fragments combine to form a diverse and relatively dense set of fragments. finally, we were also intrigued by the possibility of mimicking a protein 3d architecture using biaryl small molecule fragments. in order to identify protein mimetic fragments (fol - biaryl), we first identified 566 molecules containing 55, 65, and 66 biaryls connected via a -bond to allow for a controlled torsional freedom from the chemblock library (www.chemblock.com). the energy minimized conformations (tripos force field, sybyl 6.8) of a selection of these biaryl fragments were overlaid with the,, turns of a known protein structure (1rtp.pdb) and shown to have good steric and electronic mimicry of protein structure. the resulting fragments were tested for solubility (> 50 mm in methanol), resulting in 445 fragment molecules (fol - biaryl). results from the pca analysis and physical properties of the fragments [mw, clogp, total polar surface area, number of hydrogen bond donor / acceptors, rotatable bonds, and rings ] of the complete 1329 member fol library are provided in supporting information (see supporting information figure 1). when fragments are pooled into structurally diverse cocktails of 410 compounds per mix, the throughput of x - ray screening of fragment libraries can be significantly increased. the pooling of fragments was carried out using the same 210 210 descriptor space principle component analysis (cerius, accelrys) in order to select eight diverse fragments per pool. the nature of the fragment (fol - nat, fol - natd, fol - biaryl) was not considered in the pooling strategy. monte carlo optimization using diversity metric function maxmin distance (accelrys) with the optimum distance range of 1.972.57 was used to randomly extract eight diverse fragments. after extraction of eight fragments from the library, the process was repeated until the entire library was computationally pooled into structurally diverse pools each containing eight fragments. individual fragments, each > 95% pure as determined by nmr spectroscopy, were prepared as 50 mm stocks in methanol. physical pools of eight fragments each were prepared by mixing fragment stocks such that the final concentration of each was 6 mm. the fragment pools were found to be visibly stable, with no observed precipitation, suggesting that fragment pairs or combinations do not have a propensity to aggregate. the ligand docking into lta4h was carried out with the surflex interface implemented in sybyl 7.2 (tripos inc., st. the surflex - dock engine uses an empirical scoring function and a patented search engine to dock ligands into a protein s binding site.(96) the pdb i d 3chi file was converted to a mole2 file, and hydrogens were added. the surflex - dock protomol, a computational representation of the intended binding site, was generated using the probes ch4, nh, and c = o. lta4h inhibitors were drawn in isis draw and converted to 3d structures with concord of sybyl 7.2 (tripos inc. all of the inhibitors were properly typed with hydrogens, and a 3d structure data file was created for docking. all the fragments were scored,(97) and the highest scoring fragment was kept as the head fragment. the tail fragments were selected on the basis of the similar principle, and gradual attachment was carried out to build the docked ligand. thirty poses for each of the ligand were generated and visualized in the active site based on their surflex scores. all reagents and anhydrous solvents were obtained from commercial sources and used without further purification unless otherwise noted. nmr spectra were recorded at 400 or 500 mhz (varian instruments) in the solvent indicated, and tms was used as an internal reference. acdlabs nmr software was used to process fids to generate spectral parameters ((ppm)/hz). mass spectra were obtained using either apci or electrospray ionization (pe - sciex single - quad or agilent mixed - mode units). (knoxville, tn) or midwest microlab, llc (indianapolis, in). column chromatography was carried out in the solvents indicated with silica gel (mp ecochrom, 32 - 63d, 60). compounds were eluted using a gradient of 90/10 to 10/90 a / b over 40 min at a flow rate of 1.0 ml / min, where solvent a was 0.05% tfa in 100% h2o and solvent b was 0.05% tfa in 100% acetonitrile. for hplc data (final products), peak area percent and retention time (tr in min) are provided. the following compounds were obtained from commercial sources : compound 4 from matrix, compounds 5, 7, 8, 9, and 10 from maybridge, compound 6 from vwr, and compounds 11, 12, and 13 from aldrich. to a solution of 25 (148 mg, 0.387 mmol) in methanol (3 ml) was added hcl (1 m in diethyl ether, 6 ml). the mixture was stirred at rt for 3 h. the solvent was removed in vacuo to provide the title compound 14 as a hydrochloride salt (128 mg, 93%). h nmr (400 mhz, dmso - d6) 1.601.73 (m, 1h), 1.872.12 (m, 3h), 3.173.21 (m, 2h), 3.843.87 (m, 2h), 4.194.23 (dd, 1h j1 = 3.6 hz, j2 = 10.8 hz), 4.114.16 (m, 1h), 4.44 (s, 2h), 7.0 (d, 2h j = 8.8 hz), 7.297.38 (m, 5h), 7.487.49 (m, 2h) 9.1 (s, 1h), 9.8 (s, 1h). (c18h22n2o2hcl) c, h, n. to a solution of 5-hydroxyindole 11 (446 mg, 3.35 mmol) in anhydrous acetone (20 ml) was added potassium carbonate (1.36 g, 9.8 mmol) and 1-(2-chloroethyl)pyrrolidine hydrochloride (1.28 g, 7.5 mmol). the reaction was heated to reflux for 16 h. after the mixture was cooled to rt, a solution of tetrabutylammonium bromide (200 mg, 0.6 mmol) in dmf (10 ml) was added and the mixture was heated to 55 c for 16 h. the solvent was removed in vacuo, and the resulting residue was partitioned between etoac (25 ml) and water (50 ml). the organic layer was separated, dried with anhydrous mgso4, and concentrated in vacuo to an oil. the oil was purified by silica gel flash chromatography (100 g of sio2, 05% meoh / ch2cl2, gradient) to provide the title compound 15 (145 mg, 19%). h nmr (400 mhz, dmso - d6) 1.68 (dt, j = 6.57, 3.15 hz, 4 h), 2.53 (br s, 4 h), 2.78 (t, j = 6.04 hz, 2 h), 4.03 (t, j = 6.04 hz, 2 h), 6.31 (br s, 1 h), 6.71 (dd, j = 8.72, 2.42 hz, 1 h), 7.03 (d, j = 2.15 hz, 1 h), 7.237.29 (m, 2 h), 10.88 (br s, 1 h). lcms (apci) : mass calcd for c14h18n2o, 230.3 ; m / z found 231 (m + 1), 99%. hplc : 98.9%, tr = 10.32 min. to a solution of 29 (145 mg, 0.46 mmol) in 5% etoh / h2o (0.1 ml) was added 50% aqueous naoh (0.07 ml, 1.15 mmol). the reaction mixture was concentrated to /2 volume and neutralized (ph 7) with 1 m hcl. the remaining aqueous layer was concentrated in vacuo to give a crude residue, which was purified by preparatory thin layer chromatography (c-18, 1:2 ch3cn / h2o) to provide the title compound 16 (16.7 mg, 13%). lcms (apci) : mass calcd for c16h20n2o3, 288.3 ; m / z found 289 (m + 1), 99%. h nmr (400 mhz, meoh - d4) 2.07 (br s, 4 h), 2.39 (br s, 1 h), 2.99 (br s, 2 h), 3.40 (t, j = 4.70 hz, 2 h), 3.48 (d, 2 h), 4.30 (t, j = 5.03 hz, 2 h), 6.37 (d, j = 2.95 hz, 1 h), 6.83 (dd, j = 8.72, 2.28 hz, 1 h), 7.14 (d, j = 2.28 hz, 1 h), 7.20 (d, j = 2.95 hz, 1 h), 7.29 (d, j = 8.72 hz, 1 h). hplc : 95.9%, tr = 10.25 min. to a solution of 27 (500 mg, 1.7 mmol) in meoh (4 ml) was added sodium borohydride (280 mg, 7.4 mmol) portionwise over 5 min. the mixture was stirred at rt for 16 h and then warmed to 40 c for 4 h. the mixture was concentrated in vacuo, and the resulting residue was partitioned between 50 ml of saturated nh4cl (aq) and etoac (25 ml). the organic layer was washed with water (25 ml) and brine (25 ml), then dried over na2so4, and concentrated in vacuo. the crude material was purified by preparatory thin layer chromatography (sio2, 10% 7 n nh3 in meoh / ch2cl2 (1:20), isocratic) to provide the title compound 17 (18 mg, 4%). lcms (apci) : mass calcd for c18h22n2o2, 298.3 ; m / z found 299 (m + 1), 99%. h nmr (400 mhz, dmso - d6) 1.67 (t, j = 3.09 hz, 4 h), 2.76 (t, j = 5.84 hz, 2 h), 4.02 (t, j = 5.90 hz, 2 h), 5.65 (d, j = 3.76 hz, 1 h), 6.00 (d, j = 4.03 hz, 1 h), 6.87 (d, j = 8.59 hz, 2 h), 7.26 (d, j = 8.59 hz, 2 h), 7.34 (d, j = 5.77 hz, 2 h), 8.47 (d, j = 5.77 hz, 2 h). resistant vial, a suspension of 26 (250 mg, 0.5 mmol), thiophene-3-boronic acid (130 mg, 1 mmol), palladium(ii) acetate (20 mg, 0.1 mmol), and triphenylphosphine (60 mg, 0.25 mmol) in dme (10 ml) was stirred, and a mixture of k2co3 (500 mg, 3 mmol) in etoh (1 ml) and water (1 ml) was added at rt. the tube was sealed, and the mixture was allowed to stir at rt for 30 min, and then it was heated to 90 c for 16 h. the mixture was cooled to rt and poured into icewater (200 ml). the organic layers were washed with water (100 ml) and brine (100 ml), then dried over anhydrous na2so4. purification (75 g of sio2, 020% etoac / hexanes, gradient) provided the desired product, boc - protected intermediate (130 mg, 60%), which was used as such for the next step. to this material (50 mg, 0.1 mmol) dissolved in dioxane (2 ml) was added hcl (4 m in dioxane, 2 ml) at 0 c. the mixture was allowed to warm to rt and was stirred for 16 h. the solvent was reduced to 1 ml, and et2o (15 ml) was added to form a precipitate. the resulting solid was filtered and dried in vacuo to provide the title compound 18 as a hydrochloride salt (30 mg, 80%). h nmr (400 mhz, dmso - d6) 1.912.31 (m, 4h), 3.263.40 (m, 2h), 4.054.10 (m, 1h), 4.204.25 (m, 1h), 4.46 (dd, 1h, j1 = 10.8 hz, j2 = 3.6 hz), 7.16 (d, j = 9.2 hz, 2h), 7.537.57 (m, 2h), 7.787.87 (m, 7h). lcms (apci) : mass calcd for c22h21no2s, 363.5 ; m / z found 364.7 (m + 1), 98%. nitrobenzene (45 ml) was cooled in an ice bath and treated portionwise with alcl3 (13.5 g, 101 mmol, 1.15 equiv) and followed by addition of 4-iodobenzoic acid chloride 21 (25 g, 94 mmol, 1.07 equiv) in nitrobenzene (25 ml) while maintaining a maximum of 10 c. the reaction mixture was stirred at 0 c for 10 min, whereupon anisole (9.5 g, 88 mmol, 1 equiv) was added dropwise in such a manner that the temperature didnt exceed 10 c. the precipitate was collected by filtration and washed with water (3 25 ml). residue was dissolved in ch2cl2 (1 l), washed sequentially with aqueous nahco3 (2 150 ml), dried over anhydrous mgso4, and concentrated in vacuo to provide the title product 22 (26.7 g, 90%). h nmr (400 mhz, cdcl3) 3.89 (s, 3h), 6.96 (d, j = 8.4 hz, 2h), 7.48 (d, j = 8.0 hz, 2h), 7.79 (d, j = 8.4 hz, 2h), 7.84 (d, j = 8.0 hz, 2h). ms (apci) : mass calcd for c14h11io2, 338.2 ; m / z found 339.3 (m + 1). to a solution of 22 (1.7 g, 14 mmol) in ch2cl2 (20 ml) was added 1 m bbr3 in ch2cl2 (15 ml, 15 mmol) at 78 c. the resulting mixture was allowed to warm to rt and was stirred for 6 h. the mixture was poured onto 50 ml of icewater and extracted with ch2cl2 (2 100 ml). the combined organic layers were washed with water (50 ml) and brine (50 ml) and dried over anhydrous na2so4. the solvent was removed in vacuo to obtain the crude product which was purified by recrystallization from acetoneetoachexane (1:2:1) to provide the desired product 23 as a white solid (1.4 g, 85%). h nmr (400 mhz, cdcl3) 6.76 (d, j = 8.5 hz, 2 h), 6.92 (d, j = 8.1 hz, 2 h), 7.03 (d, j = 8.3 hz, 2 h), 7.60 (d, j = 8.2 hz, 2 h). to a stirred solution of (r)-2-hydroxymethylpyrrolidine-1-carboxylic acid tert - butyl ester (12.0 g, 60 mmol) in pyridine (100 ml) at 5 c is added p - toluenesulfonyl chloride (11.6 g, 60 mmol). the mixture is allowed to warm to rt and is stirred for 16 h. the solvent is removed in vacuo, and the resulting residue was partitioned between etoac (500 ml) and water (250 ml). the organic layer was washed with brine (2 125 ml) and dried over anhydrous na2so4. the solvent was removed in vacuo to obtain the product 24, which was used for the next step without further purification (18.9 g, 90%). h nmr (400 mhz, cdcl3) 1.39 (d, j = 15.3 hz, 9 h), 1.65 (br s, 2 h), 1.751.85 (m, 1 h), 1.871.98 (m, 2 h), 2.40 (d, j = 8.9 hz, 1 h), 2.45 (s, 3 h), 3.30 (m, j = 6.2 hz, 1 h), 3.814.02 (m, 1 h), 4.064.12 (m, 1 h), 7.35 (d, j = 4.2 hz, 2 h), 7.78 (d, j = 8.2 hz, 2 h). to a solution of 4-benzylaminophenol (200 mg, 1 mmol) in dmf (3 ml) at 05 c was added nah (60% in mineral oil, 48 mg, 1.2 mmol) at 05 c. a solution of 24 (356 mg, 1 mmol) in dmf (2 ml) was added to the above mixture at 05 c. the reaction mixture was warmed to rt and then heated to 90 c for 15 h. the resulting mixture was concentrated in vacuo and partitioned between 25 ml of saturated nahco3 (aq) and 25 ml of etoac. the organic layer was separated, dried over anhydrous mgso4, and concentrated in vacuo to obtain 400 mg of crude product, which was purified by flash chromatography (50 g of sio2, 12% etoac / hexanes, isocratic) to provide the desired product 25 (169 mg, 44%). h nmr (400 mhz, cdcl3) 1.47 (s, 9 h), 1.782.10 (m, 4 h), 3.263.47 (m, 2 h), 3.643.76 (m, 1 h), 3.763.90 (m, 1 h), 3.994.18 (m, 2 h), 4.29 (s, 2 h), 6.60 (d, j = 8.7 hz, 2 h), 6.80 (d, j = 8.1 hz, 2 h), 7.297.41 (m, 5 h). to a suspension of nah (60% in mineral oil, 60 mg, 1.5 mmol) in dmf (10 ml) at 0 c was added 23 (324 mg, 1 mmol). the mixture was again cooled to 0 c, and 24 (400 mg, 1.1 mmol) in 1 ml dmf was added. the resulting mixture was allowed to warm to rt, stirred for 30 min, and heated to 95 c for 16 h. the reaction was cooled to rt and poured into icewater (100 ml), and the mixture was stirred for 30 min. the resulting solid was filtered and dried in vacuo to provide the desired product 26 (280 mg, 60%). h nmr (400 mhz, cdcl3) 0.810.92 (m, 2 h), 1.27 (s, 2 h), 1.49 (br s, 8 h), 1.56 (s, 7 h), 2.012.09 (m, 1 h), 6.967.05 (m, 2 h), 7.48 (d, j = 8.2 hz, 2 h), 7.78 (d, j = 8.7 hz, 1 h), 7.85 (d, j = 8.1 hz, 1 h). a solution of (4-fluorophenyl)pyridin-4-yl - methanone 6 (1.5 g, 7.5 mmol) in anhydrous dmso (45 ml) was cooled to 0 c, and potassium tert - butoxide (1.0 g, 8.9 mmol) and 1-(2-hydroxyethyl)pyrrolidine (0.95 ml, 8.1 mmol) were added. the resulting mixture was warmed to rt and then heated to 90 c for 16 h. the reaction mixture was poured into icewater (100 ml) and extracted with 3 25 ml of etoac. the organic layer was washed with water (50 ml) and brine (50 ml), then dried over anhydrous mgso4 and concentrated in vacuo. the crude mixture was purified by flash chromatography (150 g of sio2, 07.5% 7 n nh3 in 1:20 meoh / ch2cl2 mixture, gradient) to provide the title compound 27 (1.2 g, 54%). h nmr (400 mhz, meoh - d4) 1.86 (dt, j = 6.54, 3.24 hz, 4 h), 2.73 (br s, 4 h), 3.00 (t, j = 5.50 hz, 2 h), 4.26 (t, j = 5.50 hz, 2 h), 7.11 (d, j = 8.86 hz, 2 h), 7.64 (d, j = 5.90 hz, 2 h), 7.84 (d, j = 8.86 hz, 2 h), 8.74 (d, j = 6.04 hz, 2 h). lcms (esi) : mass calcd for c18h20n2o2, 296.4 ; m / z found 297.7 (m + 1). to a solution of 5-hydroxyindole 11 (2.7 g, 20 mmol) in 2-butanone (50 ml) was added potassium carbonate (5.5 g, 40 mmol) and 1-bromo-2-chloroethane (2.0 ml, 24 mmol). the suspension was stirred under argon and heated to reflux for 60 h. the reaction mixture was filtered, and the filtrate was concentrated in vacuo. the resulting residue was purified by flash chromatography (200 g of sio2, ch2cl2/hexanes, 1:2) to provide 28 (650 mg, 17%). h nmr (400 mhz, cdcl3) 3.84 (t, j = 6.0 hz, 2 h), 4.29 (t, j = 6.0 hz, 2 h), 6.50 (br s, 1 h), 6.91 (dd, j = 8.8, 2.3 hz, 1 h), 7.15 (d, j = 2.1 hz, 1 h), 7.21 (t, j = 2.7 hz, 1 h), 7.31 (d, j = 8.9 hz, 1 h). to a stirred mixture of 28 (150 mg, 0.75 mmol), potassium carbonate (207 mg, 1.5 mmol), and potassium iodide (46 mg, 0.28 mmol) in dmf (6 ml) was added piperidine-4-carboxylic acid ethyl ester (0.23 ml, 1.5 mmol). the reaction mixture was heated to 90 c for 16 h. after cooling to rt, the mixture was diluted with water (6 ml) and stirred for 2 h. the supernatant liquid was decanted from the resulting residue, which was purified by flash chromatography (25 g of sio2, 03% meoh / ch2cl2, gradient) to provide 29 (145 mg, 57%). h nmr (400 mhz, cdcl3) 1.26 (t, j = 7.2 hz, 3 h), 1.751.88 (m, 2 h), 1.891.97 (m, 2 h), 2.152.25 (m, 2 h), 2.252.36 (m, 1 h), 2.83 (t, j = 6.0 hz, 2 h), 3.01 (d, j = 11.7 hz, 2 h), 4.104.20 (m, 4 h), 6.48 (br s, 1 h), 6.88 (dd, j = 8.8, 2.3 hz, 1 h), 7.12 (d, j = 2.0 hz, 1 h), 7.19 (t, j = 2.7 hz, 1 h), 7.30 (d, j = 1.0 hz, 1 h), 8.07 (br. | we describe a novel fragment library termed fragments of life (fol) for structure - based drug discovery. the fol library includes natural small molecules of life, derivatives thereof, and biaryl protein architecture mimetics. the choice of fragments facilitates the interrogation of protein active sites, allosteric binding sites, and proteinprotein interaction surfaces for fragment binding. we screened the fol library against leukotriene a4 hydrolase (lta4h) by x - ray crystallography. a diverse set of fragments including derivatives of resveratrol, nicotinamide, and indole were identified as efficient ligands for lta4h. these fragments were elaborated in a small number of synthetic cycles into potent inhibitors of lta4h representing multiple novel chemotypes for modulating leukotriene biosynthesis. analysis of the fragment - bound structures also showed that the fragments comprehensively recapitulated key chemical features and binding modes of several reported lta4h inhibitors. |
this qualitative study collected the data via focus group discussions with participation of service users (students) and service providers (key informants / managers) as an interactive qualitative technique for eliciting new ideas.12 all iranian universities of medical sciences were divided into three clusters (based on educational level). cluster one (type1universities) included tehran, shahid beheshti and iran universities of medical sciences. cluster 2 (type 2 universities) consisted of baghiyatallah, welfare and rehabilitation and qazvin universities of medical sciences. finally, cluster 3 (type 3 universities) included uremia, bushehr and shahre kord universities of medical sciences. service providers with five years of experience in counseling centers and also sophomores or students of higher semesters in all medical fields were studied. four sessions of focus group discussion (fgd) with managers (two sessions with managers in cluster 1 and one session with each of the other two clusters) were implemented in the research and technology office. twelve sessions of fgd with students (four sessions in each cluster) were conducted. the fgd sessions were held in the corresponding universities. in addition, medical science students were chosen through random sampling. since the participants would be more comfortable sharing ideas in a same - gender group,13 each cluster consisted of two male and two female focus groups of 5 - 8 participants. to obtain homogenous groups and enhance group dynamics,14 in each fgd session, the moderator was the main researcher and the observer and notetakers were trained persons who had related experience. two guide questionnaires, one for the students and one for the managers, were used to collect data. each guide questionnaire consisted of ten main questions that covered the study objectives. for students, the fgd session started with an oral presentation of the scenario of a student who had decided to marry and he / she needed advice. the discussion started with a question related to the case : what does he / she do for taking advice ?. all guide questionnaires included four main subjects, namely students need for counseling services, successes and limits of student counseling centers, priorities of services offered at student counseling centers, and suggestions for service promotion. meaning units. the coding scheme was derived theoretically according to the framework of the study. on the other hand, the themes and subthemes were identified from transcripts, providing a basis for generating new codes or modifying the codes developed by induction. credibility, dependability, conformability, and transferability are used to describe various aspects of trustworthiness in qualitative methods.1516 to enhance credibility, we selected participants with different positions (students and key persons / managers). to address conformability, we shared summarized interview findings with the participants at the end of the group discussion (respondent validation). transferability was considered by attempting to clearly detail methods of data collection, analysis, added quotes, and meaning units. to assess dependability, peer checking was performed by an experienced colleague to re - analyze some of the data. consistency checks between colleagues were also performed throughout the coding process.17 the participants were informed about the confidentiality of data. they were also informed that participation was voluntary and that they could withdraw at any time during the study. the nature and purpose of the study were explained to each participant before written consents were taken. in addition, the process of conducting fgd sessions was approved by the cultural and student affair offices at each university. using content analysis, 243 codes were extracted according to the framework of the study. the identified themes and subthemes founded the basis of new codes inductively. for better understanding, the final results of analyses are presented as four main domains, namely students need for counseling centers, successes and limitations of student counseling centers, priorities of student counseling services, and suggestions for promoting student counseling services. all participants in key informants fgd sessions agreed on the necessity of student counseling services, especially for students at risk. one of the participants said : where active centers were known and confidant for the students, their frequent references justified these centers requirement. (counselor, cluster 2). moreover, most key informant participants mentioned that cooperation of private sector with student counseling centers provides accessibility to various specialists and motivates the students to use these services. most participants in the student groups emphasized the need for counseling centers, especially as confidant references for sharing experiences and receiving help in problem solving. although some others, did not feel such a need and believed that they were mature enough to solve their own problems. in some cases lack of efficacy and unsuccessful previous experiences led to such a belief as one student (female, cluster 1) said : counseling is only a motto and could not give you anything more.. participants in key informant groups believed that although sccs have been relatively successful in achieving their short time goals, they faced serious difficulties in realizing long time goals. counseling centers perform acceptable activities considering their available resources, but there are some problems we can not do anything about. for instance, we can not help the students with their frustration about future employment and many other serious problems. in addition, the majority of participants in these groups agreed that cultural problems, such as considering counseling as a taboo, make students unwilling to refer to counseling centers. the society considers counseling a cultural taboo, thus the output of centers decreases noticeably. weakness in advocacy, poor information, lack of confidence in some centers, structural and organizational problems, and also inefficient use of available potentials were some other weak points discussed by the members of these groups. key informant participants mentioned that predicted tasks for student counseling services do not match the existing structure of offices. a counselor from cluster 2 stated that ignoring many important motivator factors for the counselors such as enough financial support and employment improvement, definitely affects their offered services. on the other hand, the students believed that improvements must be done in order for sccs to be successful. table 1 presents the limitations students face in counseling centers. as it is seen, they considered stereotype counseling, repeated advices, lack of confidence, poor information, and cultural weakness were the main barriers for successful practice of student counseling centers. the majority of key informant participants indicated the most common problems leading the students to the counseling centers as academic problems, depression and anxiety, frustration and malaise, psychological damage caused by risky behaviors, marriage, interpersonal relationships, financial problems, concerns about the future, employment, and cultural conflicts. as a counselor in cluster 2 said the students never talk about their real problem at first. which could be due to lack of confidence, cultural barriers, shame, and fear of official outcomes of the problems. in the students groups however, the participants introduced mental health, motivation and targeted, financial problems, employment, marriage, and interpersonal relationships as the most common problems they would refer to an scc for. the comments provided by the participants are summarized in table 2. suggested strategies for promoting student counseling services. the key informants pointed out peer education and peer counseling services must be strengthened in universities since they are available and effective channels with many advantages such as prevention of mental problems and possibility of early intervention. however, they also expressed that some criteria such as popularity, trustworthiness, and academic success must be exactly detected in selection of volunteer peers. peers can be effective, but the training is essential in three fields including identification, screening and referring. in addition, the domain of their intervention should be determined. another counseling center staff member declared that an scc would be able to offer better service if it selects appropriate personnel.. a counselor in cluster 2 also mentioned that for successful planning some essential factors such as defined indicators, evaluation process, and participatory planning must be considered. moreover, financial and human resources and other facilities should be provided based on participatory need assessments.. students believed that as peer groups have a common understanding of the situations, they could be more effective. everyone who trusts his friend certainly accepts his guidance more than others. stated a female student in cluster 4. they also emphasized the necessity of the presence of an accurate peer trainer and consultants selection process. the main ideas the student groups presented were as follows : participation of more professional counselors and promotion of interested relationship lead to increasing the efficacy of services. they should recognize potential client students, try to attract them and their confidence, and finally detect and solve their problems. if someone 's problem is solved effectively, it will be the best propaganda for the center. all participants in key informants fgd sessions agreed on the necessity of student counseling services, especially for students at risk. one of the participants said : where active centers were known and confidant for the students, their frequent references justified these centers requirement. (counselor, cluster 2). moreover, most key informant participants mentioned that cooperation of private sector with student counseling centers provides accessibility to various specialists and motivates the students to use these services. most participants in the student groups emphasized the need for counseling centers, especially as confidant references for sharing experiences and receiving help in problem solving. although some others, did not feel such a need and believed that they were mature enough to solve their own problems. in some cases lack of efficacy and unsuccessful previous experiences led to such a belief as one student (female, cluster 1) said : counseling is only a motto and could not give you anything more.. participants in key informant groups believed that although sccs have been relatively successful in achieving their short time goals, they faced serious difficulties in realizing long time goals. counseling centers perform acceptable activities considering their available resources, but there are some problems we can not do anything about. for instance, we can not help the students with their frustration about future employment and many other serious problems., the majority of participants in these groups agreed that cultural problems, such as considering counseling as a taboo, make students unwilling to refer to counseling centers. the society considers counseling a cultural taboo, thus the output of centers decreases noticeably. weakness in advocacy, poor information, lack of confidence in some centers, structural and organizational problems, and also inefficient use of available potentials were some other weak points discussed by the members of these groups. key informant participants mentioned that predicted tasks for student counseling services do not match the existing structure of offices. a counselor from cluster 2 stated that ignoring many important motivator factors for the counselors such as enough financial support and employment improvement, definitely affects their offered services.. on the other hand, the students believed that improvements must be done in order for sccs to be successful. table 1 presents the limitations students face in counseling centers. as it is seen, they considered stereotype counseling, repeated advices, lack of confidence, poor information, and cultural weakness were the main barriers for successful practice of student counseling centers. the majority of key informant participants indicated the most common problems leading the students to the counseling centers as academic problems, depression and anxiety, frustration and malaise, psychological damage caused by risky behaviors, marriage, interpersonal relationships, financial problems, concerns about the future, employment, and cultural conflicts. as a counselor in cluster 2 said the students never talk about their real problem at first. which could be due to lack of confidence, cultural barriers, shame, and fear of official outcomes of the problems. in the students groups however, the participants introduced mental health, motivation and targeted, financial problems, employment, marriage, and interpersonal relationships as the most common problems they would refer to an scc for. the comments provided by the participants are summarized in table 2. suggested strategies for promoting student counseling services. the key informants pointed out peer education and peer counseling services must be strengthened in universities since they are available and effective channels with many advantages such as prevention of mental problems and possibility of early intervention. however, they also expressed that some criteria such as popularity, trustworthiness, and academic success must be exactly detected in selection of volunteer peers. peers can be effective, but the training is essential in three fields including identification, screening and referring. in addition, the domain of their intervention should be determined. another counseling center staff member declared that an scc would be able to offer better service if it selects appropriate personnel.. a counselor in cluster 2 also mentioned that for successful planning some essential factors such as defined indicators, evaluation process, and participatory planning must be considered. moreover, financial and human resources and other facilities should be provided based on participatory need assessments.. students believed that as peer groups have a common understanding of the situations, they could be more effective. everyone who trusts his friend certainly accepts his guidance more than others. stated a female student in cluster 4. they also emphasized the necessity of the presence of an accurate peer trainer and consultants selection process. the main ideas the student groups presented were as follows : participation of more professional counselors and promotion of interested relationship lead to increasing the efficacy of services. they should recognize potential client students, try to attract them and their confidence, and finally detect and solve their problems. if someone 's problem is solved effectively, it will be the best propaganda for the center. all participants in key informants fgd sessions agreed on the necessity of student counseling services, especially for students at risk. one of the participants said : where active centers were known and confidant for the students, their frequent references justified these centers requirement. (counselor, cluster 2). moreover, most key informant participants mentioned that cooperation of private sector with student counseling centers provides accessibility to various specialists and motivates the students to use these services. most participants in the student groups emphasized the need for counseling centers, especially as confidant references for sharing experiences and receiving help in problem solving. although some others, did not feel such a need and believed that they were mature enough to solve their own problems. in some cases lack of efficacy and unsuccessful previous experiences led to such a belief as one student (female, cluster 1) said : counseling is only a motto and could not give you anything more.. participants in key informant groups believed that although sccs have been relatively successful in achieving their short time goals, they faced serious difficulties in realizing long time goals. counseling centers perform acceptable activities considering their available resources, but there are some problems we can not do anything about. for instance, we can not help the students with their frustration about future employment and many other serious problems. in addition, the majority of participants in these groups agreed that cultural problems, such as considering counseling as a taboo, make students unwilling to refer to counseling centers. the society considers counseling a cultural taboo, thus the output of centers decreases noticeably. weakness in advocacy, poor information, lack of confidence in some centers, structural and organizational problems, and also inefficient use of available potentials were some other weak points discussed by the members of these groups. key informant participants mentioned that predicted tasks for student counseling services do not match the existing structure of offices. the situation of universities is not considered realistically but only idealistically. declared a counseling center staff member in cluster 3. a counselor from cluster 2 stated that ignoring many important motivator factors for the counselors such as enough financial support and employment improvement, definitely affects their offered services.. on the other hand, the students believed that improvements must be done in order for sccs to be successful. table 1 presents the limitations students face in counseling centers. as it is seen, they considered stereotype counseling, repeated advices, lack of confidence, poor information, and cultural weakness were the main barriers for successful practice of student counseling centers. the majority of key informant participants indicated the most common problems leading the students to the counseling centers as academic problems, depression and anxiety, frustration and malaise, psychological damage caused by risky behaviors, marriage, interpersonal relationships, financial problems, concerns about the future, employment, and cultural conflicts. as a counselor in cluster 2 said the students never talk about their real problem at first. which could be due to lack of confidence, cultural barriers, shame, and fear of official outcomes of the problems. in the students groups however, the participants introduced mental health, motivation and targeted, financial problems, employment, marriage, and interpersonal relationships as the most common problems they would refer to an scc for. the comments provided by the participants are summarized in table 2. suggested strategies for promoting student counseling services. the key informants pointed out peer education and peer counseling services must be strengthened in universities since they are available and effective channels with many advantages such as prevention of mental problems and possibility of early intervention. however, they also expressed that some criteria such as popularity, trustworthiness, and academic success must be exactly detected in selection of volunteer peers. peers can be effective, but the training is essential in three fields including identification, screening and referring. another counseling center staff member declared that an scc would be able to offer better service if it selects appropriate personnel.. a counselor in cluster 2 also mentioned that for successful planning some essential factors such as defined indicators, evaluation process, and participatory planning must be considered. moreover, financial and human resources and other facilities should be provided based on participatory need assessments.. students believed that as peer groups have a common understanding of the situations, they could be more effective. everyone who trusts his friend certainly accepts his guidance more than others. stated a female student in cluster 4. they also emphasized the necessity of the presence of an accurate peer trainer and consultants selection process. the main ideas the student groups presented were as follows : participation of more professional counselors and promotion of interested relationship lead to increasing the efficacy of services. they should recognize potential client students, try to attract them and their confidence, and finally detect and solve their problems. if someone 's problem is solved effectively, it will be the best propaganda for the center. (female student, cluster 3). sccs, as a part of universities student administration, ultimately aim to promote different aspects of students health such as physical, psychological and social health. the most essential tasks in such services include providing appropriate conditions for students personality development, educational improvement, capacity building and growing compatibility with familial, social, occupational and intellectual situations.18 in the present study, we specifically focused on the participation university students and key informants. it is noteworthy that both the key informants and students emphasized the absolute and urgent need for sccs among students. such results were also found in other similar studies.19 strengths and weaknesses of student counseling services was another subject discussed in this study. most participants from all groups believed that capacity building and improvement of counseling centers are the most important points for service promotion. they mentioned ignoring existing potential and lack of participatory planning as the main management problems. a challenge emphasized by most participants in all student groups was lack of mutual confidence between clients and counselors. this problem has been emphasized in many other studies which proposed that safe and confident conditions as the first health requirement.20 in another study, young participants also cited cultural problems including negative attitude towards counseling and cultural taboo as the most noticeable problems.21 our findings were in agreement with a similar research indicating the necessity of basing each health operational planning on a comprehensive need assessment.22 in the present study, student participants introduced need assessment as the first and most reliable method to set priorities in counseling services. mental health was a priority mentioned by both key informants and students. based on professional experiences of key informants a significant percentage of students refer to sccs because of depression, anxiety and despair which was also confirmed in other studies.1012 meilman., and lucas and berkel showed that thinking of suicide, fear, anxiety, and depression were the most common major problems in students referred to the emergency consultation centers.2324 another study indicated that students mental health needed more attention, better planning, more power investment, and more expert participations.25 similar to previous related studies,8 we found interpersonal communication skills as another priority mentioned by all student and key informant groups. main ideas students proposed for improving student counseling services were strategy planning, resource mobilization, needs assessment and priority setting, and participatory decision making. another study highlighted the importance of interrelationships between various service providing sectors, stakeholders participation, considering cultural beliefs, and trying different methods for promoting health training.25 peer group education and counseling were the noticeable suggestions expressed by another researcher.826 due to the vision and design of the present study, it only represents the basic and fundamental views of the challenges sccs face. it also offers suggestions for better health which should be followed by complimentary detailed researches. in conclusion, the results of this study indicate that the undeniable need for sccs should be provided through wide and comprehensive advocacy. moreover, participatory planning based on systematic needs assessment and priority setting should be considered as the foundation of students health promotion. we finally suggest some key points that lead to sccs promotion according to the findings of the present study : reviewing the objectives, tasks and instructions of sccs by the department of cultural and student affairs at the ministry of health and medical education with the participation of key stakeholders.strategic planning for sccs in each university according to their situation analyses.internal and external monitoring and evaluation of the sccs.needs assessment and priority setting of the sccs.participatory interaction with other stakeholders. reviewing the objectives, tasks and instructions of sccs by the department of cultural and student affairs at the ministry of health and medical education with the participation of key stakeholders. strategic planning for sccs in each university according to their situation analyses. internal and external monitoring and evaluation of the sccs. needs assessment and priority setting of the sccs. n.p, f.rt, hm and sh.dj carried out the design, coordinated the study, participated in most experiments, and prepared the manuscript. mbe provided assistance in the design of the study, coordinated and carried out all experiments, and participated in manuscript preparation. | background : student counseling centers are responsible for physical, mental and social health of university students. therefore, this study was conducted to assess the key stakeholders opinions on different aspects of the activities performed in these centers.methods:this qualitative study used focus group discussion. key stakeholders including university students and key informants from nine randomly selected medical universities participated in the study. after data saturation, thematic analysis was conducted. themes were drawn out through constant comparative method.results:based on 243 extracted codes and through comparative analysis, four categories were determined, namely students need for students counseling centers, successes and limitations of student counseling centers, student counseling services priorities, and suggestions for service promotion.conclusions:according to stakeholders opinions, youth participation in needs assessment and priority setting processes in real - based situations leads to better performance of counseling services. empowering the counselors is another point required for better outcomes. in addition, strategic planning and monitoring, along with evaluation of programs, could promote the provided services. |
written informed consent was obtained from the patient for publication of this report and accompanying images. written informed consent was obtained from the patient for publication of this case report and accompanying images. a copy of the written consent is available for review by the editor - in - chief of this journal on request. all authors contributed to data analysis and writing those sections of the manuscript that pertained to their particular area of specialty expertise in this case of polytrauma management. | highlightssexual problems are related to three components : physiology, sociocultural background, and neurological location of injury.studying the neural basis of sexual response and preference is crucial for exposing pathways involved in sexual disorders.literature case reports have shown that sexual disinhibition is associated with basal frontal lobe dysfunction. |
sickle cell disease (scd) is a genetic hemoglobinopathy, in which hemoglobin, is slightly abnormal. cerebral damage is a serious complication in scd patients, with cerebral infarction (overt stroke) secondary to occlusive vasculopathy developing in 5.5 - 17% of patients with scd. conversely the incidence of silent cerebral infarcts (scis) lies between 3 - 38% in patients with beta - thalassemia and between 5 - 31% in patients with hbsc being far more common in this patient population. the pathophysiology of cerebrovascular disease in sickle cell anemia is probably related to two processes : i) intimal hyperplasia and ii) thrombosis. stroke is attributed to both microvascular and macrovascular lesions. according to the microvascular scenario the small vessels are more likely to be involved in cases of peripheral vaso - occlusive events. in such cases the arteriole and postcapillary venule are the major sites of sicklecell adhesion and subsequent occlusion. the deep white matter, which is perfused by arterioles with sparse anastomoses, is more susceptible to inadequate perfusion and infarction. the deoxygenated, less flexible sickled red blood cells, adhere to the endothelium of capillaries and venules, leading to intravascular stasis and microvascular occlusion. in the macrovascular scenario, scd patients develop chronic anemia resulting in hyperdynamic blood circulation and increased velocity of the blood flow, which has severe consequences on the vessels. repeated red blood cell (rbc) adhesion, followed by forcible removal under high - shear forces causes endothelial injury, leading to intimal hyperplasia and endoluminal narrowing. subsequently rbc adherence to damaged vessel walls results in secondary thrombosis, occlusion of the vessel and distal branch emboli. the effects of these lesions depend on the vessel involved, as well as the rapidity of the process. approximately 75% of strokes in scd patients are the result of occlusion of large arteries. however, as stated earlier, the most common form of cns damage in scd patients is silent cerebral infarct (sci). the definition of sci comprises both an abnormal mri with absence of physical findings of overt stroke. surprisingly scd patients will have an incidence of sci up to 27% by age 6 and 37% by age 14. recent evidence suggests that adult scd patients are prone to develop new and ongoing scis. the latter may on the one hand be the cause for poor intellectual performance in these patients and on the other hand either become progressive sci or overt stroke disease. the first study addressing the issue of sci was undertaken with ct and patients were referred to be suffering a covert stroke. subsequently and after the cooperative study of sickle cell disease (csscd) the term sci or silent stroke is preferred. the aim of the study is to find out if there is any correlation between the extent of silent cerebral infartcs (scis) depicted on mri with the disease severity in scd adult patients. the study group consisted of 24 consecutive patients (11 men, 13 women) with known scd and a mean age of 38.4 (range 20 - 59) years. the study was approved by the local ethical committee and informed consent was obtained prior to each examination from all patients. all patients included in the study had no evidence of focal neurologic deficit from physical examination. patients with any clinical evidence of neurologic deficit were excluded from the study, as well as patients with contraindications to mr imaging, such as the presence of cardiac pacemakers or metallic implants. the disease was classified according to the number of vaso - occlusive episodes which needed hospitalization per year, the number of transfused rbc units per year, the degree of hemolysis, and the incidence of acute chest syndrome (acs), pulmonary hypertension (ph) and acute splenic sequestration (ass). a patient with more than 6 hospitalizations per year and/or for more than 30 days in total, or transfusion - dependency with more than 2 units rbc per month, or with a continuously high degree of intravascular hemolysis, or finally with a history of acs, ph, ass, was considered as severely ill (grade 2). the disease of a patient with none of the above criteria was characterized as mild (grade 0), whereas the presence of 3 - 5 hospitalizations per year for less than 30 days or sporadic transfusions as moderately severe (grade 1). treatment with hydroxyurea was applied to patients with severe and moderately severe form of the disease, and it clearly changed disease severity, dramatically. however, for the needs of this study, the definition of disease severity was based on the patient s history since birth, and it did not take into consideration the last period on hydroxyurea therapy. from these patients (50%) 66.67%(16/24) of the patients were on treatment with hydroxyurea, due to history of more frequent or pronounced vaso - occlusive episodes. all patients were submitted to brain mri on a 1 tesla, gyroscan intera, philips mr scanner with a dedicated head coil. mri protocol consisted of tse t2-weighted (tr 5300 ms, te 120 ms) and flair (tr 6000 ms, te 110 ms, ti 2000 ms) images in the axial and coronal planes. the examinations were reviewed by two radiologists, which were blinded to the clinical results, for evidence of scis (i.e. lacunar infarcts and leukoencephalopathy). lacunar infarcts were defined as focal (less than 1 cm) high intensity lesions on the t2-weighted or flair images. leukoencephalopathy was defined as multiple high intensity lesions over 1 cm on the t2-weighted or flair images. score 1 was attributed to small unifocal lesions 3 cm. irrespective of their sci score, patients were also evaluated for evidence of brain atrophy, with binary criteria either existing or non - existing. atrophy was defined as lesser volume of brain tissue than the one expected in a healthy person of similar age. the study group consisted of 24 consecutive patients (11 men, 13 women) with known scd and a mean age of 38.4 (range 20 - 59) years. the study was approved by the local ethical committee and informed consent was obtained prior to each examination from all patients. all patients included in the study had no evidence of focal neurologic deficit from physical examination. patients with any clinical evidence of neurologic deficit were excluded from the study, as well as patients with contraindications to mr imaging, such as the presence of cardiac pacemakers or metallic implants. the disease was classified according to the number of vaso - occlusive episodes which needed hospitalization per year, the number of transfused rbc units per year, the degree of hemolysis, and the incidence of acute chest syndrome (acs), pulmonary hypertension (ph) and acute splenic sequestration (ass). a patient with more than 6 hospitalizations per year and/or for more than 30 days in total, or transfusion - dependency with more than 2 units rbc per month, or with a continuously high degree of intravascular hemolysis, or finally with a history of acs, ph, ass, was considered as severely ill (grade 2). the disease of a patient with none of the above criteria was characterized as mild (grade 0), whereas the presence of 3 - 5 hospitalizations per year for less than 30 days or sporadic transfusions as moderately severe (grade 1). treatment with hydroxyurea was applied to patients with severe and moderately severe form of the disease, and it clearly changed disease severity, dramatically. however, for the needs of this study, the definition of disease severity was based on the patient s history since birth, and it did not take into consideration the last period on hydroxyurea therapy. from these patients (50%) 66.67%(16/24) of the patients were on treatment with hydroxyurea, due to history of more frequent or pronounced vaso - occlusive episodes. all patients were submitted to brain mri on a 1 tesla, gyroscan intera, philips mr scanner with a dedicated head coil. mri protocol consisted of tse t2-weighted (tr 5300 ms, te 120 ms) and flair (tr 6000 ms, te 110 ms, ti 2000 ms) images in the axial and coronal planes. the examinations were reviewed by two radiologists, which were blinded to the clinical results, for evidence of scis (i.e. lacunar infarcts and leukoencephalopathy). lacunar infarcts were defined as focal (less than 1 cm) high intensity lesions on the t2-weighted or flair images. leukoencephalopathy was defined as multiple high intensity lesions over 1 cm on the t2-weighted or flair images. score 1 was attributed to small unifocal lesions 3 cm. irrespective of their sci score, patients were also evaluated for evidence of brain atrophy, with binary criteria either existing or non - existing. atrophy was defined as lesser volume of brain tissue than the one expected in a healthy person of similar age. based on clinical criteria 33.33% (8/24) of the patients had mild, 37.50% (9/24) moderate and 29.17% (7/24) severe clinical disease. more specifically 8.33% (2/24) of them were classified as score 1 and 58.33% (14/24) were classified as score 2 (figure 1a - c). the rest 33.3% (8/24) of the patients had no evidence of cerebral lesions on mri and were classified as score 0. from these 8 patients with no abnormalities on the mri, 25% (2/8) had mild, 37.50% (3/8) had moderate and the remaining 37.50% (3/8) had severe clinical disease. from the 2 patients with score 1 on mri, 50% (1/2) had moderate clinical disease and 50% (1/2) had severe clinical disease. from the 14 patients with score 2 on the mri, 42.86% (6/14) of them had mild, 35.71% (5/14) moderate and 21.43% (3/14) had severe clinical disease. atrophy was found in 54.16% (13/24) of the patients (figure 2a, b). clinical severity and mri score were investigated both through the spearman s correlation coefficient (rho=-0.227, p=0.286) and with tests for independence (p=0.72, chisquare test). considering the 38.4 years as the mean age, the patients were subcategorized in two groups : the younger group whose age was under 38.4 years and the older group aged over 38.4. in the younger age group 35.71% (5/14) did not show any abnormalities on the mri and were classified as score 0, no patients were classified as score 1 and 64.29% (9/14) of them were score 2. alternatively from the older age group 30% (3/10) did not exhibit any abnormalities and were classified as score 0, 20.00% (2/10) patients were classified as score 1, whereas 50% (5/10) were classified as score 2, on mri. the observed difference in mri scores between the two age groups was not statistically significant (p=0.216, chi - square test). moreover the mri score was not correlated either with patient gender (p=0.950) or with hydroxyurea treatment (p=0.230). sickle cell disease (scd) is characterized by hemolytic anemia, an increased susceptibility to infections, growth retardation, painful crises, acute chest syndrome and vaso - occlusion. the latter occurs in almost all vascular beds, resulting in ischemia, including the central nervous system, with high morbidity and mortality. outcome is difficult to predict and few effective treatments are available. stroke is a serious complication in patients with sickle cell disease occurring in 5 - 17%, most often between 9 to 15 years of age. there are two main theories for brain infarcts in these patients including both a microvascular scenario and a macrovascular scenario. recent research indicates that scd is also associated with silent cerebral infarcts (scis). the latter is defined as the presence of abnormalities on neuroimaging studies, in the absence of overt clinical symptoms. scis are thought to rather represent small vessel disease but direct evidence is still lacking. furthermore scis seem to affect more the borderline zones and this may suggest hemodynamic reasons implicated in its pathogenesis. mri has proved to be highly sensitive in the identification of scis. due to its sensitivity to detect increased amounts of water within brain tissue at sites of acute and chronic infarctions, especially with fluid - attenuated inversion recovery (flair) images, mri has revolutionized the ability to see not only acute symptomatic infarctions, but also scis, especially those within the deep white matter of the centrum semiovale. in our study in contrast in the csscd cohort the prevalence of scis at baseline was 21.2%, while in the sit trial the presence of scis reached a total of 30.8%. both of these studies however have included children and teenagers. the overall percentage of reported sci incidence in the literature is between 3 - 38% in patients with beta - thalassemia and between 5 - 31% in patients with hbsc. scis are known to be more common in homozygous ss patients but they are also known to happen to heterozygous patients like sickle beta - thalassemia and hbsc disease. while one would probably expect a lower overall incidence of scis in our heterozygous scd patients this was surprisingly not the case as the incidence was far greater than that reported in the literature for heterozygous scd adult patients. more specifically a study by kugler. found that 50% of the homozygous sdc adult patients (mean age 20 years) had scis and of these lesions 16% were at least 1.5 cm. reported an sci incidence of 13% in his study with adult (19 - 55 years) homozygous scd patients., comprising adult patients with a mean age of 26.99.3 years with both homozygous ss and heterozygous s thal was 20%. studied adult patients younger than 50 years with thalassemia intermedia and homozygous sickle - cell thalassemia. they found scis in 37.5% in patients with thalassemia intermedia and 52% in patients with homozygous sickle cell - thalassemia disease. differences in results between studies may reflect study population differences and differences concerning the study protocol and definitions. there seems to be different ways to define scis and there is no wider consensus. for example in the silent cerebral infarct trial (sit trial) it included lesions that were at least 3 mm in their greatest dimension and visible in at least two planes on the t2-weighted images. evaluating adult patients the definition of sci included lesions of at least 5 mm, hyperintense on the t2-weighted image but had to be hypointense on the t1-weighted image. according to zhu. discrepancies in the literature are mainly due to : i) differences in mr parameters, like slice thickness, ii) different criteria for sci definition and iii) different criteria for defining dilated virchow - robin spaces (dvrs). while a high percentage 58.33% (14/24) of our patients had a high mri score of 2, only a small percentage 29.17% (7/24) of these patients had severe disease according to clinical criteria. found that brain damage was more severe in patients with sickle cell - thalassemia disease who had more vaso - occlusive episodes per year. this was not the case in our study, where the extent of scis was not well - correlated with clinical severity. however according to other previous studies, various imaging techniques reveal a more extensive and diffuse pattern of vascular involvement than the one expected from the patient s clinical presentation. this may imply the silent, insidious nature and complex pathophysiology of microvascular disease in scd patients. in the study of vichinski. lacunae (lesions 5 mm) were seen in 13% and white matter lesions in 15% and in our study lacunar lesions (5 - 9 mm) were seen in 8.33% and larger lesions (> 10 mm) in 58.33%. although the study design is different it seems that while moderate mri disease scores are rather similar in both studies, severe mri disease scores are much higher in our study. in our study younger and older patient groups did not show statistically significant differences in the extent of scis. more specifically a high percentage 64.26 % (9/14) from the patients of the younger age group (38.4 years) age group patients exhibited scis in a total percentage of 70% (7/10), whereas 20% (2/10) were score 1 and 50% (5/10) were scored 2 on mri. in contrast, manrfe. reported that in thalassemia intermedia patients, the frequency of brain damage increased with age. previous estimates have shown that the incidence of sci with mri in the general population is between 5.8% and 17.7%. more specifically the incidence of these hyperintensities has been 15.6% and 10.7% in two large studies. the framingham offspring study found an incidence or 10.7%, using 1 tesla mri and 4 mm section thickness in a patient population with a mean age of 629 years. on the other hand the incidence was 15.6% in the helsinki aging brain study, using patients between 55 and 85 years and a 0.2-t mri and 10 mm section thickness. in our case this may, however be counteracted by the fact that the younger patient s group 113 mmhg and male gender. in our study hydroxyurea and hematopoietic stem cell transplantation are considered for primary and secondary prevention of sci but there is still no high level evidence to support this. in our study there were no statistically significant differences in the extent of scis between patients receiving or not receiving hydroxyurea. some other study limitations in comparison to other studies are : the rather small number of patients studied and the use of 1 t mri scanner instead of the 1.5 t used in other studies. according to the field strength and study parameters (slice thickness of 5 mm) the smallest lesions that could be picked - up, would be around 5 mm. we did not use lesion subcategorization for lesions 5 mm and < 10 mm were given score 1. this may have made it more difficult to compare our results with those of larger studies. the clinical criteria for disease severity were rather qualitative, but all patients were on follow - up for many years, as the thalassemia and hemoglobinopathies unit of our hospital is a reference center for scd patients. concerning the incidence of brain atrophy it should be noted that the definition is rather subjective and this may also create bias when comparing with previous studies. this is reflected in previous studies with the reported incidence being between 23 - 51% finally it should be noted that although it is known that sci may occur in infants just 1 year of age and continue during childhood, reaching maximum incidence rate in children around 6 years of age, little is known about the natural history of scis in the adult, which is not thoroughly understood. our study may further contribute to the understanding of the disease in the adult as it is one of a few focusing on heterozygous sickle - cell/-thal adult patients. in contrast to larger cohorts that focus on homozygous scd patients of school - age or teenager patients. in conclusion, the extent of silent cerebral infarcts on mr imaging in compound heterozygous (hbs/-thal) adult patients is not correlated with the severity of clinical disease. moreover the extent of scis on mr imaging in these patients is not age - related and may be quite severe even in the younger ones. | the aim of this paper is to correlate the extent of silent cerebral infarcts (scis) on magnetic resonance imaging (mri) with the clinical severity of sickle cell disease (scd) in adult patients. twenty - four consecutive adult asymptomatic scd patients (11 male and 13 female) with a mean age of 38.4 years (range 20 - 59) were submitted to brain mri on a 1 tesla gyroscan intera, philips mr scanner with a dedicated head coil. the protocol consisted of tse t2-weighted and flair images on the axial and coronal planes. mri readings were undertaken by two radiologists and consensus readings. patients were compound heterozygotes (hbs/-thal). the extent of scis was classified from 0 - 2 with 0 designating no lesions. clinical severity was graded as 0 - 2 by the hematologist, according to the frequency and severity of vaso - occlusive crises. there was no statistically significant correlation between the severity of clinical disease and the extent of scis on mr imaging. the extent of sci lesions did not differ statistically between younger and older patients. patients receiving hydroxyurea had no statistically significant difference in the extent of sci lesions. the extent of scis in heterozygous (hbs/-thal) scd patients is not age related and may be quite severe even in younger (< 38.4 years) patients. however the extent of scis is not correlated with the severity of clinical disease. |
this report is based on 30 deaths from chronic beryllium disease (cbd) in the united kingdom with details of 19 autopsies. the majority were fluorescent lamp workers and machinists who died from respiratory failure. there were no cases of lung cancer. the survival times ranged from less than 1 to 29 years and was longest in machinists. all of the workers showed interstitial pulmonary fibrosis with varying degrees of cystic change. the majority showed hyalinized, and a few active sarcoid - type, granulomas. extrathoracic granulomas, as in a u.k. sarcoid autopsy series, were rare. a notable difference was the absence of myocardial involvement in cbd compared to an incidence of 20% in the sarcoid autopsies. the detection of beryllium in the criteria for diagnosis is emphasized and the cases classified as definite include 12 of 19 positive analysis, 6 of 19, negative or unavailable analysis. the remaining case was classified as dubious because, despite a positive analysis, granulomas were absent. the main differential diagnosis is sarcoidosis.imagesfigure 1.figure 2.figure 3. |
|
malignant melanoma is a highly metastatic skin cancer characterized by rapid growth, early metastasis, and resistance to chemotherapy and radiotherapy. in the past the high immunogenic capacity of melanoma has fostered the development of immunotherapeutic strategies based on the stimulation of adaptive immunity t cell mediated against specific tumour antigen. however, despite initial promising studies, the overall outcomes of the clinical trials based on immunotherapy are still far from being satisfying. the lack of an effective immune reactivity to tumours may be explained by the protracted inflammation that occurs in melanoma microenvironment, eventually resulting in immunosuppression and thus in the failure of immune cells to reject the tumour [4, 5 ]. the inflammatory microenvironment in the tumour mass is the result of the secretion of inflammatory cytokines by both melanoma and stromal cells [6, 7 ]. it induces cancer cells to acquire a more aggressive phenotype and allows the recruitment in the tumour lesion of different immunosuppressive cells, such as myeloid - derived suppressor cells (mdscs) and, consequently, regulatory t lymphocytes (tregs). various strategies have been used to decrease mdsc amounts and immunosuppressive functions in tumours, including melanomas [4, 8, 9 ]. however, the molecular mechanisms leading to the control of intratumoural mdscs are poorly understood. the elucidation of these aspects may be crucial for the development of new approaches in melanoma treatment aimed at reducing mdsc - mediated immunosuppression. in the last decades, the proapoptotic second messenger ceramide has drawn the attention as a fundamental player in cancer biology [10, 11 ]. ceramide levels are significantly decreased in several tumours including melanomas, colon cancers, ovarian cancers, and gliomas ; interestingly an inverse relationship has been found between ceramide levels and the stratification of tumours with high- and low - grade gliomas containing low and high levels of ceramide, respectively [1214 ]. of interest it seems particularly clear that cancer cells have evolved complex mechanisms to reduce ceramide levels, possibly through the modulation of their generating enzymes [1517 ]. an example of this event is the spontaneous downregulation of the ceramide - generating enzyme acid sphingomyelinase (a - smase) in melanoma cells during tumour progression that accounts for a more aggressive behaviour of melanomas in terms of tumour growth and metastatic ability. this work has been designed to elucidate the possible role of a - smase in determining melanoma immunogenic capacity with a specific attention on the modulation of tumour microenvironment. to this end, we analysed the immune cell infiltration in a mouse model of melanoma syngeneic transplant that is particularly aggressive and, more importantly, that recapitulates the downregulation of a - smase during tumour progression. a clone in which a - smase is maintained at constitutively high levels during melanoma progression was analysed as well. we found that the progressive loss of a - smase enhanced the immunosuppressive capacity of melanoma cells through the recruitment of mdscs and tregs at tumour site and the impairment of dendritic cells (dcs) maturation. of importance, the upregulation of a - smase enhanced the function of immune effector cells as dcs and cytotoxic t lymphocytes. this a - smase - dependent modulation of microenvironment events may have a therapeutic outcome in terms of tumour growth. the cell clones used in our experiments were generated from the murine melanoma cell line b16-f1 of american type culture collection (lgc standards, sesto san giovanni, italy). as described in bizzozero., the low expressing a - smase b16-w6_psil10 clone was generated from a subclone of the parental cell line b16-f1 (i.e., b16-w6) by transfecting the cells with the plasmid psilencer4.1-cmv (invitrogen - life technologies, monza, italy) harbouring a shrna containing a sequence which gave the a - smase silencing. the control clone used in our experiments (b16-psilscr) was generated by transfecting b16-w6 cells with the plasmid psilencer4.1-cmv harbouring a shrna containing a scrambled sequence. the b16-b1a clone overexpressing a - smase was generated as follows : the pef1/myc plasmid (invitrogen - life technologies) containing cdna for a - smase was transfected in b16-f1 cells using the fugene transfection reagent (promega, milano, italy), according to the manufacturer 's protocol. approximately 15 colonies resistant to the antibiotic g418 (500 g / ml) were tested for a - smase expression and activity (see section 3.3). a b16-f1 clone transfected with the empty vector pef1/myc (b16-pef1) was used as control. cells were routinely tested for mycoplasma using a biowhittaker mycoalert mycoplasma detection kit (lonza group, basel, switzerland). cells were cultured in iscove 's modified dulbecco 's medium supplemented with 10% heat - inactivated foetal bovine serum (fbs), glutamine (200 mm), and penicillin / streptomycin (100 u / ml) and grown at 37c in a humidified atmosphere containing 5% co2. female c57bl/6 mice (68 weeks old) were purchased from charles river laboratories (calco, italy), housed in a regulated environment (23 1c, 50 5% humidity) with a 12 h light / dark cycle (lights on at 08.00 a.m.), and provided with food and water ad libitum. all studies were conducted in accordance with the italian law on animal care n 116/1992 and the european communities council directive eec/609/86. all efforts were made to reduce both animal suffering and the number of animals used. injections of 5 10 cells in the lower - right flank on day 0 (ten animals per group at minimum) [18, 19 ]. tumour growth was monitored every 2 - 3 days by means of external calliper measurements and volume calculation (length width/2), until mice reached iacuc euthanasia criteria, as, for instance, clinical signs of tumour or when tumour size exceeded 10% of body weight. for pcr and flow cytometry analysis tumours the analysis of mrna expression was performed as previously described [18, 2022 ]. briefly, total rna from resected tumours and in vitro b16 clones was extracted with the high pure rna tissue kit and the high pure rna isolation kit, respectively (roche applied science, mannheim, germany), according to the manufacturer 's protocol. first - strand cdna was generated from 1 g of total rna using iscript reverse transcription supermix (bio - rad, hercules, ca, usa). as shown in table 1, a set of primer pairs amplifying fragments ranging from 63 to 354 bp was designed to hybridise to unique regions of the appropriate gene sequence. the fold change was determined relative to the control after normalising to gapdh (internal standard) through the use of the formula 2. after surgical excision, a single cell suspension from tumours was obtained by collagenase iv (0.2 mg / ml), dispase (2 mg / ml), and dnase i (0.1 mg / ml) treatment in iscove 's modified dulbecco 's medium, supplemented with 5% fbs, glutamine (200 mm), and penicillin / streptomycin (100 u / ml). after 30 min at 37c in a shaking bath, the cell suspension was filtered (40 m pore - size membrane) and washed in phosphate buffer saline (pbs) added with 1% bovine serum albumin (bsa). unspecific sites were blocked incubating samples for 20 min at room temperature in pbs containing 10% goat serum and 1% bsa. cells were then incubated with fluorophore - conjugated antibodies for the staining of specific cellular markers (table 2) in 1% bsa - pbs solution (1 h on ice). cells were analysed by flow cytometry using a gallios flow cytometer (beckman - coulter, brea, ca, usa) and the software fcs express 4 (de novo system, portland, or, usa). the analysis of protein expression from in vitro b16 clones was performed as previously described [18, 2023 ]. the rabbit polyclonal anti myc - tag (cell signaling technology, danvers, ma, usa) and the mouse monoclonal anti - tata binding protein (tbp) (abcam, cambridge, uk) primary antibodies were used in combination with the appropriate secondary antibodies hrp - conjugated (bio - rad). proteins were visualised using bio - rad clarity western ecl substrate with a bio - rad chemidoc mp imaging system. cells (2 10 cells / ml) were homogenised in the acid lysis buffer (50 mm sodium acetate, 1% triton x-100, and 1 mm edta, ph 5) with freshly added protease inhibitor cocktail (complete, roche applied science). sphingomyelinase activity was measured using the amplex red sphingomyelinase assay kit (molecular probes - life technologies, monza, italy), as described in the manufacturer 's protocol. briefly, adherent cells were detached using enzyme - free cell dissociation buffer (merck millipore billerica, ma, usa), washed twice with cold pbs, and incubated (1 10 cells) with 5 l of fitc - labelled annexin v (life technologies, monza, italy) to detect phosphatidylserine exposure on the outer leaflet of the plasma membrane and 5 l of propidium iodide (pi) (ebioscience, san diego, ca, usa) to exclude necrotic cells, in binding buffer (10 mm hepes, 140 mm nacl, and 2.5 mm cacl2). after 15 min of incubation at room temperature, cells were acquired using a gallios flow cytometer (beckman - coulter, brea, ca, usa) and analysed by the software fcs express 4 (de novo system, portland, or, usa). upon verification of normal distribution, statistical significance of raw data between the groups in each experiment was evaluated using unpaired student 's t - test (single comparisons) or one - way anova followed by the newman - keuls posttest (multiple comparisons). tumour growth was analysed using two - way anova, followed by the bonferroni posttest. the graphpad prism software package (graph software, san diego, ca, usa) was used. results are expressed as means standard error of the mean (sem) of the indicated n values. iscove 's modified dulbecco 's medium, fbs, glutamine, penicillin / streptomycin, hepes, g418, and pbs were purchased from euroclone (pero, italy). dispase and dnase i were obtained from gibco - life technologies (monza, italy) and roche applied science, respectively. flow cytometry antibodies were purchased as follows : cd11b and gr1 from miltenyi biotec, bergisch gladbach, germany ; cd11c, cd80, mhcii, cd4, cd8, cd25, cd44, and foxp3 from ebioscience, san diego, ca, usa. all other reagents were purchased from sigma - aldrich (saint louis, mo, usa). we have previously demonstrated that during b16-f1 melanoma progression a - smase is spontaneously downregulated thus conferring to melanoma cells a more aggressive phenotype. to evaluate the impact of this event on the modulation of tumour microenvironment, mice were subcutaneously injected with b16-w6_psil10 cells, a loss - of - function model of a - smase obtained by the knock - down of a - smase in the parental cell line b16-f1 ; we then analysed the in vivo behaviour of the established skin melanoma in terms of cytokine expression and tumour - infiltrating immune cells. the mrna analysis by qpcr in the explanted melanomas of a panel of different inflammatory factors showed a significant accumulation at b16-w6_psil10 tumour site of interleukin- (il-) 1, il-6, il-10, granulocyte - macrophage colony - stimulating factor (gm - csf), transforming growth factor- (tgf-) 1, and tumour necrosis factor- (tnf-) (figure 1(a)). a sustained secretion and maintenance of inflammatory mediators during tumour progression stimulate the enrichment and activation of mdscs then leading to immunosuppression. thus, we evaluated the presence of mdscs (cd11b / gr1 cells) in the tumour mass by flow cytometry. as shown in figure 1(b), we found a significant increase in cd11b / gr1 cells infiltrating b16-w6_psil10 tumours with respect to control. of notice, the percentage of mdscs in b16-f1 tumours at a late stage of growth, in which a - smase was spontaneously downregulated, was similar to that of b16-w6_psil10 tumours (supplementary figure 1(a) in supplementary material available online at http://dx.doi.org/10.1155/2015/370482). these observations support the role of a - smase downregulation in favouring the recruitment of mdscs at the tumour lesion. mdscs exert their immunosuppressive function through the impairment of dcs (cd11c cells) and cytotoxic t lymphocytes (cd8 cells) [2527 ] and the recruitment of tregs (cd4/cd25/foxp3 cells). flow cytometry analysis of immune cells from explanted melanomas showed a significant decrease of cd11c cells at b16-w6_psil10 tumour site when compared to control (figure 2(a)). interestingly recruited dcs displayed an immature and anergic phenotype as indicated by the reduction of the costimulatory markers cd80 and mhcii (figure 2(b)). although we did not observe a difference in cd8 and cd4 t infiltrating lymphocytes (figures 2(c) and 2(d)), we found a significant increase in the number of tregs in b16-w6_psil10 tumours with respect to control (figure 2(e)). similar results were obtained in b16-f1 melanoma at late stage of growth (supplementary figure 1(b)). taken together, these results indicate that a low expression of a - smase in melanoma cells induces an immunosuppressive tumour microenvironment. to demonstrate unambiguously that a - smase expression by melanoma cells modulates tumour microenvironment, different gain - of - function models of a - smase were generated by stable transfection of a - smase in b16-f1 cells. measurements of a - smase mrna (figure 3(a)), protein expression (figure 3(b)), and activity (figure 3(c)) in these a - smase transfected clones with respect to parental control (b16-pef1) allowed us to select b16-b1a as the cells overexpressing a - smase to be used for in vivo studies as follows. in particular, mice were subcutaneously injected with b16-b1a cells and the explanted melanomas analysed for a - smase expression and the immune cell composition. the cell clone b16-pef1 served as control. as expected, b16-b1a tumour maintained stable levels of a - smase mrna levels during growth (figure 4(a)). of interest, the number of mdscs and tregs decreased significantly in b16-b1a tumour when compared to control (figures 4(b) and 4(c)). this event was paralleled by the increase of dcs infiltrate (figure 5(a)). these cells partially recovered their maturation status as demonstrated by the increase in expression of the costimulatory markers cd80 and mhcii (figure 5(b)). unexpectedly, even cd8 and cd4 t infiltrating lymphocytes as well as the cd8/cd44 activated t lymphocytes were significantly higher in b16-b1a tumours with respect to b16-pef1 ones (figures 5(c)5(e)) ; no differences were observed in the population of cd4/cd44 t lymphocytes (figure 5(f)). these data indicate that a - smase restoration in melanoma cells results in the establishment of an antitumoural microenvironment through both the reduction of protumoural immune cells and the recruitment of antitumoural immune cells at tumour site. the analysis of melanoma apoptosis in vitro revealed that the higher levels of a - smase in b16-b1a correlate with an increase of apoptotic cell number when compared to the b16-pef1 control cells (figure 6(a)), thus confirming the fundamental role played by a - smase in sensitivity to apoptosis. of notice, as shown in the growth analysis in vivo of figure 6, we observed a significant delay in the outgrowth of b16-b1a tumours versus control. these data are in line with our previous results in which the silencing of a - smase resulted in an increase in melanoma growth and confirms the inverse correlation between a - smase expression and melanoma progression. the role of a - smase in the response of tumours to chemotherapy and radiotherapy is a well - established concept. indeed, the enzyme contributes significantly to the cytotoxic effects of several anticancer drugs such as cisplatin, retinoids, and doxorubicin [2832 ]. moreover it has been demonstrated that the peritumoural injection of recombinant a - smase sensitises mouse subcutaneous melanomas to the antineoplastic effects of radiotherapy. recently, a - smase downregulation was shown to favour human and mouse melanoma ability to grow, invade, and metastasise. we now show that change of a - smase expression in cancer cells is sufficient per se to tune in vivo melanoma growth. in addition, our data indicated that a - smase levels modulate immune cells at tumour site, thus suggesting the role of a - smase as an immune - regulating factor of melanoma tumour microenvironment. it is well known that the interactions between immune system components recruited into the tumour microenvironment are crucial for tumour development and progression, relying on inflammatory factors and cells that contribute to cell transformation, support cancerous cell survival, resist immunological destruction, and facilitate invasion and metastasis [6, 34 ]. in keeping with the notion that the protumoural microenvironment can be considered the product of a developing cross talk between cancerous cells and stromal cells, here we demonstrate a close correlation between the extent and type of tumour infiltrate and a - smase levels. specifically, low a - smase in melanoma accounts for the high expression of factors involved in inflammation (i.e., il-1, il-6, gm - csf, and tnf-), which have been positively associated with cancer onset and progression [6, 34 ]. in contrast with the a - smase - mediated inhibitory effect on proinflammatory cytokines we also found that low a - smase in melanoma accounts for the high expression of the anti - inflammatory cytokines il-10 and tgf-1. of interest, both cytokines are generally accepted as major immunosuppressive cytokines expressed in tumours including melanoma, although there is still a debate on their effective role in antitumour immune response [6, 3438 ]. our data indicate that a - smase decrease in melanoma accounts for the establishment of a high immunosuppressive and protumoural microenvironment. in this respect, tumours with low a - smase levels, that is, b16-f1_psil10 and b16-f1 at late stage of development, display an increase of mdscs infiltration, already known to be responsible for the establishment of immunosuppression [5, 39 ]. mdscs accumulation in the tumour mass determines the impairment of dcs and cytotoxic t lymphocytes [25, 27 ] and the recruitment of regulatory tregs. in this line, in low a - smase expressing tumours we found low levels of dcs ; of interest these cells also showed an immature and anergic phenotype, a typical feature of melanoma infiltrating dcs resulting in the inability to trigger the activation of tumour specific cd8 and cd4 t lymphocytes [41, 42 ]. moreover low a - smase expressing tumours displayed increased treg infiltration which is often associated with poor clinical outcome and tumour progression in different cancers. this led to the hypothesis that the naturally occurring a - smase decrease in melanoma cells during tumour progression contributes to the induction of immune tolerance and immunosuppression in tumour microenvironment and eventually in the acquisition of the high aggressive behaviour of melanoma in vivo. in support of this hypothesis, the restoration of a - smase expression in melanoma cells not only reduces tumour growth and immunosuppression, but also accounts for a high recruitment in the tumour microenvironment of effector immune cells with an antitumoural function. indeed, we observed a poor homing of mdscs and tregs in tumours in which a sustained expression of a - smase is maintained during their progression, that is, b16-b1a. as a consequence, we observed the increased recruitment of cd8 and cd4 t lymphocytes at the tumour lesion and especially the infiltration of mature dcs and cd8/cd44 memory / activated t lymphocytes [4446 ]. the accumulation of effector immune cells such as dcs and cd8 t lymphocytes into primary tumour lesions is associated with prolonged survival and a reduced incidence of metastases in patients with several types of solid cancer, including primary cutaneous melanomas [47, 48 ]. based on this evidence, the current preclinical and clinical studies regarding melanoma immunotherapy are centred on the administration of dcs or cd8 cells in the form of dc vaccines or adoptive t cell transfer, preceded by radiotherapy or chemotherapy to induce lymphodepletion and the ensuing elimination of immunosuppressive mdscs and tregs [4952 ]. consistent with these reports, our findings on the role of a - smase upregulation in reprogramming the status of tumour microenvironment open new vistas in therapeutic perspective. in particular, the possibility that a - smase overexpression educates tumour microenvironment against cancer cells encourages the use of therapeutic approaches to increase the enzyme expression / activity. this would create an antitumoural microenvironment suitable either for triggering an appropriate adaptive immune response against melanoma or for improving the efficacy of other immunotherapy strategies. in this respect, restoring a - smase in melanomas by genetic overexpression or by recombinant protein administration, a protocol currently under examination for niemann - pick type b patients, might be considered a useful adjuvant for cancer therapy. the evaluation of the role of a - smase in many pathophysiological processes is a developing field [14, 28, 5461 ]. this study demonstrates for the first time the central role of a - smase expressed by melanoma cells in orchestrating the cross talk with the surrounding microenvironment. the discovery of this a - smase function exerted on the tumour - infiltrating immune cells suggests that the antineoplastic effect of the enzyme goes beyond the well - established role in cancer cell death but involves a more complex network that may be taken into consideration in the setting of therapeutic strategies. | the inflammatory microenvironment induces tumours to acquire an aggressive and immunosuppressive behaviour. since acid sphingomyelinase (a - smase) downregulation in melanoma was shown to determine a malignant phenotype, we aimed here to elucidate the role of a - smase in the regulation of tumour immunogenic microenvironment using in vivo melanoma models in which a - smase was either downregulated or maintained at constitutively high levels. we found high levels of inflammatory factors in low a - smase expressing tumours, which also displayed an immunosuppressive / protumoural microenvironment : high levels of myeloid - derived suppressor cells (mdscs) and regulatory t lymphocytes (tregs), as well as low levels of dendritic cells (dcs). in contrast, the restoration of a - smase in melanoma cells not only reduced tumour growth and immunosuppression, but also induced a high recruitment at tumour site of effector immune cells with an antitumoural function. indeed, we observed a poor homing of mdscs and tregs and the increased recruitment of cd8 + and cd4 + t lymphocytes as well as the infiltration of dcs and cd8+/cd44high t lymphocytes. this study demonstrates that change of a - smase expression in cancer cells is sufficient per se to tune in vivo melanoma growth and that a - smase levels modulate immune cells at tumour site. this may be taken into consideration in the setting of therapeutic strategies. |
a complete denture has been the standard treatment strategy to restore functionality and aesthetics in edentulous patients. from the aesthetic point of view, replacing the missing natural teeth with a complete denture provides satisfactory results. however, it is a great challenge to achieve satisfactory results in terms of reduced pain, increased stability, retentive force, and occlusal load support;12 especially in the case of a mandibular arch presenting severe resorption of the alveolar ridge, the use of a complete denture involves great difficulties.3 since the introduction of the concept of osseointegration by brnemark, various prosthetic treatment options using osseointegrated implants have been applied in the treatment of edentulous patients, with high success rates being demonstrated in longitudinal clinical studies.456 implant treatment options for edentulous patients can be classified into the fixed prosthesis and removable prosthesis types.7 a fixed prosthesis provides psychological stability and greatly improves masticatory performance, but presents disadvantages related to aesthetics and pronunciation, oral hygiene care, and the need for an increased number of implants.8 in contrast, the advantages of a removable prosthesis, such as an implant overdenture, include improved aesthetics and oral hygiene care, easier fabrication of prosthodontic restorations, and cost - effectiveness. disadvantages of this type include the psychological resistance to wearing a removable part and the need for relining, resulting from continuous resorption of the posterior residual ridge.8 a severely resorbed ridge could adversely affect the jaw relation or interocclusal distance, making it difficult to place a sufficient number of implants ; however, a removable prosthesis requiring a small number of implants was proven to be more advantageous than a fixed prosthesis, in terms of biomechanical consequences.9 the 2002 mcgill consensus recommended a mandibular 2-implant overdenture as the first - choice standard of care for edentulous patients.10 moreover, empirical studies have reported that patients wearing implant overdentures display higher masticatory performance and denture - related satisfaction, and experience less problems with the dentures in daily life, compared to patients wearing conventional complete dentures.1112 implant overdentures consist of the implant, an abutment including the attachment, and a denture base, which accommodates counterpart attachment.13 the selection of the appropriate overdenture attachment system greatly influences patient satisfaction, because of its direct association with the stability of the denture and the retentive force.14 the attachment system could be either a bar attachment or a stud attachment.15 the advantages of bar attachment include allowing the splinting of implants and improving the retentive force and stability ; however, it presents difficulties in meeting the oral hygiene requirements.16 in comparison, the stud attachment offers easier oral hygiene management and less problems related to the limited inter - arch space.17 furthermore, due to additional advantages including cost - effectiveness, simple fabrication design, and easy repair, various stud attachments such as the locator attachments are preferred by many practitioners.18 the most common mechanical problem presented by implant overdentures is the loss in retention, caused by wear, deformation, and fracture of the components of the attachment system over time.1920 a number of studies have reported that changes in the attachment surface lead to the loss of frictional contact through the loosening of the attachment components. changes in the mechanical properties of the materials used, especially the hardness and elastic modulus, could affect the wear pattern.21222324 with the popularization of implant overdentures, a wide range of stud attachments of various designs and composed of different materials have been used in clinical settings. despite this widespread use, the wear properties or retention loss resulting from long - term use of attachment are yet to be extensively researched. the purpose of this study was to compare the changes in retentive force and patterns of surface wear of three types of stud attachments by measuring retentive force and evaluating surface changes over repetitive insertion and removal cycles. the upper mounting that accommodated the counterpart attachment of the attachment system was fabricated using an orthodontic acrylic resin block (orthodontic resin ; dentsply, york, pa, usa) with dimensions of 44 27 47 mm (fig. two holes (8 mm in diameter) were prepared on this block, positioned 22 mm apart (fig. 1b).25 an acrylic resin block was fabricated as the lower mounting for placement of the implant fixture, with the same dimension as the upper mounting (fig. two 10 mm length holes (22 mm apart) were drilled parallel to each other and perpendicular to the horizontal surface, using an 4.1 mm drill (osstem implant co., busan, korea). two implant fixtures were inserted (s - clean 4.0 10 mm ; dentis co., daegu, korea) into the holes of the lower mounting and fixed with acrylic resin (orthodontic resin ; dentsply) (fig. an index in the center region of each block was prepared, in order to check whether the upper mounting fits exactly into the lower mounting. three types of stud attachments were investigated : (1) kerator (daekwang idm co., seoul, korea), comprised of a nylon matrix and a cylindrical patrix, (2) o - ring (dentis co., daegu, korea), with a rubber matrix and a ball patrix, and (3) ez lock (samwon co., yangsan, korea), composed of titanium springs and ceramic balls (fig. the abutments including the attachments were screwed into their respective implant fixtures, in accordance with the manufacturer protocols, using the specified drivers and torque wrenches (straumann ag, basel, switzerland). the abutments comprising the kerator and o - ring attachments were fastened with 30 ncm, and that containing the ez lock was fastened with 20 ncm. the black matrix was inserted to the metal housing for the kerator and o - ring attachments, and placed on the corresponding patrix. all spaces between the metal housing and abutment were blocked out using baseplate wax to prevent the flow of acrylic resin into the areas with undercuts and the upper mounting placed accurately upon the lower mounting. an adequate amount of autopolymerizing acrylic resin (pattern resin, gc co., tokyo, japan) was applied to the relief areas of the upper mounting, completely covering the metal housing. after 20 minutes following the separation of the upper and lower mountings, wax and excess acrylic resin were removed with a sharp scalpel. both parts were stored at room temperature for over 24 hours to allow complete polymerization. the black matrices of the kerator and o - ring attachments were then replaced with blue nylon and red rubber for testing, respectively (fig. a total of 15 specimens (5 per attachment system) were prepared in this manner. all specimens were subjected to repeated insertion and removal cycles, and the respective retentive forces measured using a universal testing machine (mts systems co., eden prairie, mn, usa). the lower mounting was seated on the fixed part of this machine, while the upper mounting was attached to the operation part. the specimen was placed in a position such that the force could be applied in a perpendicular direction, verifying the accurate placing of the upper mounting onto the lower mounting. the crosshead speed for the simulation was set at 60 mm / min, which mimicked the speed with which a patient removes his / her denture according to clinical instructions. the mountings were subjected to 2500 cycles of insertion and removal, a value calculated on a 2-year basis, under the assumption that the process of insertion and removal of the denture is repeated by a patient 3 - 4 times a day.26 the retentive force of each attachment system was measured 3 times, at baseline and the end of 100, 250, 500, 1000, 2000, and 2500 cycles. upon completion of the 2500 cycles of insertion and removal, the wear and deformation on each attachment surface was examined by scanning electron microscopy analysis (s-3500, hitachi ltd., tokyo, japan). for statistical analysis of the results, the statistical package for social sciences (spss) software, version 21 (ibm spss statistics, chicago, il, usa) was used. the shapiro - wilk test and levene 's test were performed to validate the normality of distribution and homogeneity of variance, respectively. these were followed by the kruskal - wallis test and pairwise comparison for the validation of statistical significance of the difference according to the attachment system. the pre - post difference after 2500 cycles of insertion and removal was compared by paired - sample t - test. for all values, a significance level of 5% was applied to establish statistical significance. table 2 and fig. 4 present the means and standard deviations of the retentive force for each attachment system, measured during the repeated insertion and removal cycles. the greatest initial retentive force was demonstrated by the kerator (12.80 n), followed by the o - ring (9.19 n) and ez lock (5.93 n) ; there was no statistically significant difference between the kerator and o - ring (p>.05). the greatest final retentive force after 2500 cycles of insertion and removal was demonstrated by kerator (11.87 n), followed by ez lock (5.43 n) and o - ring (3.54 n), with all differences being statistically significant (p.05). on the other hand, upon comparison of the standard deviation and coefficient of variation for the retentive force at each measurement step, the kerator was observed to present higher values compared to the other two systems. scanning electron microscopy (sem) of the surface morphology of the attachments upon completion of 2500 insertion and removal cycles revealed that the nylon matrix of kerator and the rubber matrix of o - ring incurred noticeable deformation and deterioration, whereas the ceramic ball of the ez lock did not exhibit any noticeable signs of wear, except for slight surface scratches (fig. a strip - shaped wear track was observed on the titanium alloy of o - ring, whereas the tin - coated titanium alloy of kerator and ez lock did not display any perceivable surface changes or damages (fig. 8). the implant overdenture is a removable prosthesis obtaining retention and support through attachment, with the choice of attachment system being directly associated with patient satisfaction and prosthetic prognosis. a wide variety of attachment systems are currently available ; each possess their respective advantages and disadvantages, and the selection must be made based on the individual patient dental arch shape, interarch space, ease of adjustment, functional life, and retentive force.13 there has been no clear consensus concerning the optimal retentive force of a denture. however, according to a previous report, a stud attachment should have a retentive force of at least 4 n.27 a 20n retentive force (approximate) is considered to be sufficient for a 2-implant mandibular overdenture, whereas a 5 - 7 n retentive force is believed to support the stabilization of implant overdentures.2829 however, a very limited amount of data with regards to the retentive force of the attachment is provided by the manufacturers. in addition, the literature regarding the initial retentive force of the attachment system varies widely, even for similar types of attachment systems, depending on the experimental conditions, such as the direction of application of force, crosshead speed, and the distance and angle of attachments.24 the mean value of the initial retentive force observed for each of the three types of stud attachments examined in this study was 12.80 n for kerator, 9.19 n for o - ring, and 5.93 n for ez lock. the final retentive force values were 11.87, 5.43, and 3.54 n for the kerator, ez lock, and o - ring attachments, respectively. it might be advisable to improve the retentive force of the dentures containing attachments such as the ez lock (which demonstrates a low initial retentive force) or the o - ring (displaying a large retention loss) according to the functional aspect of the magnitude of retentive force. this could be achieved by securing the largest possible area for the coverage of the denture base, and providing adequate border sealing within the neutral zone between the tongue and cheeks, similar to when producing a conventional complete denture. examinations of the attachments following repeated insertion and removal revealed less retention loss in kerator compared to the o - ring, and a statistically non - significant difference from that of ez lock. the kerator attachment system is a solitary and resilient type, similar to the locator attachment system. it is easy to insert and remove, and constitutes a dual retention system that includes inside and outside of the patrix, with the nylon matrix linked to the implant. moreover, it is comprised of a nylon matrix displaying varied retentive force, allowing for easy adjustment of the retentive force. in this experiment, a blue nylon matrix, expressing similar initial retentive force as the o - ring, was used to minimize the influence of the initial retentive force. despite such similar baseline conditions, an evaluation of the initial retentive force of two kerator specimens demonstrated higher values than the retentive force (5.3 n) presented by the manufacturer. this may be due to a production quality fluctuation ; however, it may also be explained by the intra - matrix redistribution of undercuts for the moment of a force likely to occur despite the vertical removal force applied in the experiment, along with the additive effects of the retentive force obtained by acting as a guiding plane of inner core of the nylon matrix against removal force.26 as depicted in the sem images, the nylon matrix of kerator incurred substantial deformation and deterioration, especially in the central core area, compared to the outer ring area. such surface loss appears to be gross surface deformation and cohesive failure, associated with the specific component composition of nylon. the slight retention loss in the kerator attachment, despite the serious deformation and deterioration, is considered to be consistent with the fact that the outer ring is primarily responsible for the retentive force, rather than the seriously deteriorated core. on the other hand, the increased retention loss may also be expected due to the extensive creep response of nylon (which has a low glass transition temperature) in the 37 humid oral environment, and its strong affinity for water uptake, which triggers additional creep, and accelerates wear and deformation.30 the kerator retention loss pattern, which depends on the cycles of insertion and removal, shows a peculiar fluctuation : an initial decrease in the retentive force, followed by an increase. this phenomenon could be attributed to the increased surface roughness as a result of the surface change caused by repeated insertion and removal. this in turn increases fine mechanical friction, ultimately resulting in the increase in retentive force.31 on the other hand, as previously mentioned, the o - ring showed the highest retention loss after 2500 insertion and removal cycles, with the loss in retentive force increasing linearly in proportion to the number of insertion and removal cycles. the o - ring attachment demonstrated the highest fluidity, with the retentive force being a result of the elasticity of its rubber ring, undercut structure of the patrix, and the frictional resistance between the rubber ring and patrix. rubber generates friction as a result of the contact force on the contact surface, and the deformation of the rubber itself. the frictional force of rubber is comprised of hysteresis and adhesion, and is caused by the visco - elastic properties of rubber. the coefficient of friction between metal and rubber is much higher than that between metal and metal, as are the frictional force and wear speed. while materials such as metal and plastic generate scratches parallel to the wear directions, rubber forms a ridge pattern perpendicular to the wear direction, and concurrently, small rubber debris.32 surface wear or tear resulting from this mechanism may trigger a fine increase in diameter, causing retention loss.33 the wear tracks on the o - ring were detected on the rubber matrix as well as on the titanium patrix at the maximum convexity, which is the primary frictional contact area. this phenomenon, of parallel wear in rubber and metal, can be partially explained by the chemical reaction that occurs on the surface as a result of wear in the rubber. specifically, this reaction arises from the direct attack on the metal by the free radicals of rubber generated as a result of the wear process, which is accelerated with the stabilization of the free radicals.34 this result supports the observations of a previous study, that o - rings must be replaced every 6 - 9 months, depending on the type of the prosthesis, dietary habit, and the degree of ease of insertion and removal.35 ez lock was subject to slight retention loss after repeated insertion and removal. in particular ez lock is a solitary, resilient type of attachment system which was recently developed in south korea, characterized by titanium alloy springs and 3 ceramic balls within the housing. the performance of the ez lock attachment may be attributed to the excellent resistance of the ceramic balls to frictional wear, compared to the polymer structures of the other attachment systems using nylon (kerator) or rubber (o - ring). the better performance of the ez lock could also be because of the lower hardness of the other systems compared to the ceramic and the less intense force exerted by the spring of the ez lock system. based on the smaller standard deviation and coefficient of variation of ez lock, it can be expected to offer more uniform retentive force in the oral environment compared to other systems (which use materials such as plastic, nylon, and rubber). in general, the retention loss of an attachment may be caused by wear, deformation, and fracture of the metal or plastic structures.1920 as demonstrated by the sem images taken in this study, wear and deformation were markedly manifested in rubber structures than in the metal structures. this result is consistent with the results of other studies, where wear was hardly observed on metal structure surfaces in in vitro tests, in contrast to plastic structures.36 specifically, no wear was observed in the tin - coated titanium patrices of kerator and ez lock, presumably due to the effect of the tin - coating, which is known to enhance surface hardness and wear resistance.37 however, the wear in attachments is a complex process that involves adhesive, abrasive, surface fatigue, and corrosive factors, and its mechanism has not been clearly understood ; therefore, the arguments presented thus far are based on speculations.38 the results of this study have limitations in explaining the retention loss, dependent on the initial retentive force and duration of use in the oral environment. while the retention loss was observed in the experiment only as a result of mechanically repeated insertion and removal cycles, numerous other factors could influence the retentive force in the real oral environment. furthermore, the retentive force of a denture can be greatly affected by its functional location, in addition to the number or type of attachment.39 consequently, further studies would be required to investigate the effects of the implant alignment and angulation, as well as the occlusal load, parafunctional factors, foods, saliva, plaque, and denture cleaners. although the limitations of this in vitro study, we concluded that the material and design of attachment are factors that influence the retention loss and wear patterns of the structures. the retention loss of the attachments following repeated insertions and removals, compared to the initial retentive force, may be partially explained by the changes in the surface of the structures, such as wear and deformation. after 2500 insertion and removal cycles, especially, the deviation of retention was appeared as large, and deformation and wear were higher in synthetic polymers matrix. | purposethe aim of this study was to compare the changes in retentive force of stud attachments for implant overdentures by in vitro 2-year - wear simulation.materials and methodsthree commercially available attachment systems were investigated : kerator blue, o - ring red, and ez lock. two implant fixtures were embedded in parallel in each custom base mounting. five pairs of each attachment system were tested. a universal testing machine was used to measure the retentive force during 2500 insertion and removal cycles. surface changes on the components were evaluated by scanning electron microscopy (sem). a kruskal - wallis test, followed by pairwise comparison, was used to compare the retentive force between the groups, and to determine groups that were significantly different (.05). after 2500 insertion and removal cycles, the highest retention loss was recorded for o - ring, and no significant difference between kerator and ez lock (p>.05). also, kerator showed the highest retentive force, followed by ez lock and o - ring, after 2500 cycles (p<.05). based on sem analysis, the polymeric components in o - ring and kerator were observed to exhibit surface wear and deformation.conclusionafter 2500 insertion and removal cycles, all attachments exhibited significant loss in retention. mechanism of retention loss can only be partially explained by surface changes. |
a 10-year - old castrated male domestic shorthair cat was presented for assessment of a gingival mass surrounding the left maxillary third and fourth premolar teeth. the mass was surgically removed by means of a marginal rim excision, and the tissue was submitted for histological assessment. there was proliferation of mineralized eosinophilic material with multiple irregularly placed lacunae and reversal lines, reminiscent of cementum. the cat recovered uneventfully from the anesthesia, and there was no evidence of tumor recurrence 6 months after surgery. cementoblastomas (true cementomas) in domestic animals are rare, with just a few reports in ruminants, monogastric herbivores and rodents. the slow, expansive and constant growth that characterizes these masses may be accompanied by signs of oral discomfort and dysphagia. this case report is intended to increase knowledge regarding this tumor in cats and also highlights the importance of complete excision of the neoplasm. to our knowledge, there are no previous reports in the literature of cementoblastoma in the cat. this tumor is characterized by the formation of an expansive mass of cementum - like tissue intimately associated to the root of a tooth. in humans, the cortical expansive action of the cementoblastoma has been occasionally associated with low - grade intermittent pain. radiographically, the cementoblastoma is observed as a well - defined radiopaque mass surrounded by a radiolucent uniform halo, corresponding to the space of the periodontal ligament. surgical excision, including extraction of the affected tooth is indicated to avoid its recurrence. this case report presents the clinical, radiographic and histological findings, as well as the surgical approach for excision of a cementoblastoma in a 10-year - old castrated male domestic shorthair cat. a 10-year - old castrated male domestic shorthair cat was referred to the dentistry and oral surgery service of the matthew j ryan veterinary hospital of the university of pennsylvania for evaluation of a gingival mass discovered as an incidental finding during a wellness examination 1 month prior to presentation. no previous pertinent medical history was reported, and the patient was not receiving any medications at the time. physical examination, complete blood count and serum biochemistry profile revealed no abnormalities. an approximately 1 cm in diameter, raised, erythematous, firm, ulcerated gingival mass was observed on the buccal aspect of the left maxillary third and fourth premolar teeth (figure 1a). gingivitis and calculus accumulation were more evident on these teeth when compared with the contralateral maxillary premolar teeth. (a) a 10-year - old domestic shorthair cat presented with an erythematous, firm ulcerated gingival mass on the buccal aspect of the left maxillary third and fourth premolar teeth (teeth 207 and 208). (b) the corresponding intraoral dental radiograph showed a well circumscribed, radiopaque mass (arrow) affecting the interproximal region between teeth 207 and 208 ; some tooth resorption and loss of the periodontal ligament space (arrowheads) are evident around the mesiobuccal root of tooth 208 the cat underwent general anesthesia for periodontal probing, dental charting, intraoral radiographic assessment and excision of the gingival mass. a left maxillary nerve block was performed for augmented pain control, using 0.4 ml (0.26 mg / kg) bupivacaine (marcaine ; hospira). periodontal probing of teeth adjacent to the gingival mass showed moderated build up of dental calculus and gingivitis. dental radiographs showed a well - defined mineralized mass at the alveolar margin overlying the distal aspect of the left maxillary third premolar and the mesial aspect of the maxillary fourth premolar. some tooth resorption and loss of the periodontal ligament space were noticed (figure 1b). the oral cavity was rinsed with chlorhexidine gluconate 0.12% solution prior to the mass removal. then, a rim excision was performed, including 5 mm normal - looking tissue away from the gross and radiographic margins of the mass. alveolar and buccal mucosa was raised with a periosteal elevator to expose the underlying bone. osteotomy of the maxilla was performed with a long # 700 carbide bur in a sterile high - speed dental handpiece, taking care not to enter the nasal cavity or the infraorbital canal. remaining root tips of the third and fourth premolar teeth were extracted using a winged dental elevator. sharp alveolar bone edges were smoothed with a # 22 round diamond bur, which was also used to debride the apical area of these sockets. afterwards the wound was first rinsed with 0.12% chlorhexidine and then rinsed with sterile saline. a buccal flap was sutured to palatal mucosa with 5 - 0 poliglecaprone 25 (monocryl ; ethicon) in a simple interrupted pattern (figure 2). intravenous fluid therapy was maintained for the first 12 h after the surgery, at which time the cat ate soft food and drank water. postoperatively, amoxicillin - clavulanate (62.5 mg po q12h for 7 days ; clavamox [zooetis ]) was given orally, while buprenorphine hydrochloride (buprenex ; reckitt benckiser) (0.01 mg / kg sl q12h for 5 days) and robenacoxib (onsior ; novartis) (1 tablet orally q24h for 3 days) were given to provide postoperative analgesia. chlorhexidine gluconate (oral health tooth gel ; crosstex) was applied on the oral cavity twice a day for 2 weeks for antiseptic purpose, while soft food was maintained for the same period of time, until the surgical wound healed properly. (a) buccal and (b) ventral views to the left maxillary area in a 10-year - old domestic shorthair cat. (d) closure buccal flap was sutured over the wound, using an absorbable monofilament in a simple interrupted pattern. (e) a postoperative intraoral radiograph was obtained, showing the affected area after rim excision (arrowheads), the left maxillary second premolar (arrow) and the zygomatic arch (asterisk). remaining root tips were extracted following excision of the mass. because this was a clean - contaminated procedure, no surgical drapes were used. however, aseptic technique, including disposable synthetic or reusable cloth drapes may be used to minimize contamination histopathological examination showed proliferation of mineralized eosinophilic material with multiple, irregularly placed lacunae and reversal lines (figure 3), reminiscent of cementum, between the two premolar teeth. the mass was adhered to the distal root of the left maxillary third premolar near the cementoenamel junction, contiguous with and focally replacing the normal cementum layer. the mass extended from the periodontal ligament region into the overlying gingiva, forming a well circumscribed lesion. no recurrence of the tumor was noted by the owner 6 months after surgical excision. (a) photomicrograph of the submitted specimen showing proliferation of mineralized eosinophilic material (asterisk) that expands the gingiva (arrowheads) (4 magnification, hematoxylin and eosin). (b) there are multiple irregularly placed lacunae (arrowheads) and reversal lines (arrow) (20 magnification, hematoxylin and eosin). (c) the mass is focally adhered to a tooth root near the cementoenamel junction (arrowhead), contiguous with the normal cementum layer (arrow) (4 magnification, hematoxylin and eosin) they include the peripheral odontogenic fibroma, ameloblastoma, ameloblastic fibroma, amyloid - producing odontogenic tumor and feline inductive odontogenic tumor. cementoblastoma or true cementoma is considered to be a benign odontogenic neoplasm originating from the tooth mesenchyme. this is a rare neoplasm in animals, with few reports in horses, hamsters, a bovine, a dama gazelle and a red deer. in people, cementoblastoma is also a rare neoplasm that affects males more often than females, with the mandibular first molar the most commonly affected tooth. it may involve deciduous and permanent teeth, affecting people aged between 8 and 44 years. in animals, owing to the scarcity of reports, there are no statistical data. in people, although more frequently found in the permanent molars, the cementoblastoma has also been reported in impacted or unerupted teeth. cementoblastoma can be associated with intermittent pain due to the progressive expansion of cortical bone in the area of involved teeth. although no signs of oral pain were reported before the initial physical examination, discomfort was evident during palpation of the site. the greater amount of calculus accumulation on teeth of the upper jaw affected by the neoplasm may be related to a reduction of masticatory action on that side of the mouth as a result of pain. although cementoblastomas are considered to be benign tumors, complete excision of the neoplasm is recommended, including the affected teeth, by means of a peripheral osteotomy to prevent tumor recurrence. in people, tumor recurrence occurred between 4 and 24 months when the affected tooth or teeth were not included in the surgical excision. as the previous biopsy report suggested an odontogenic tumor, a rim excision this technique allowed preservation of the integrity of the nasal cavity, the infraorbital canal and the dorsal portion of the maxilla without causing any cosmetic concern. radiation therapy has been used for other types of odontogenic tumors in cats (inductive fibroameloblastoma and amyloid - producing odontogenic tumor) as an adjuvant in cases where the neoplasm could not be completely excised ; however, there are no scientific reports regarding the use of radiation therapy for treatment of cementoblastoma in animals. radiographically, the appearance of cementoblastoma corresponds to a densely radiopaque mass attached to the apical or lateral aspect of the root. tooth resorption and obliteration of the periodontal ligament space, as well as a surrounding radiolucent halo and sclerotic margins, can be observed. dental radiographs permitted the initial approach to the mass in this case ; however, the value of this diagnostic imaging technique is limited because the overlap of anatomic structures results in poor highlighting of the radiographic features of a cementoblastoma. more advanced imaging techniques such as computed tomography scan may provide better anatomical detail and structural resolution by avoiding superimposition of dentoalveolar structures. histologically, the main characteristics of cementoblastomas are the presence of abundant mineralized material with cores of bland spindle - shaped cells and occasional cementoblasts. a major differential diagnosis for cementoblastoma (true cementoma) includes cemento - osseous dysplasia, which is referred to as a reactive, non - neoplastic lesion characterized by a periapical fibro - osseous proliferation that contains variable amounts of cementum or bone. late - stage, sclerotic cemento - osseous dysplasia lesions have been described ; however, they are usually smaller and not symptomatic for the patient unless they become necrotic and secondarily inflamed. there was no evidence of necrosis or secondary inflammation in the sections evaluated of the specimen submitted from the present cat. to our knowledge, this is the first report of a cementoblastoma in a cat. in the presence of a radiopaque oral mass in a cat associated with a tooth root, cementoblastoma must be included in the differential diagnoses. marginal rim excision involving the affected teeth should be encouraged to avoid local recurrence of the neoplasm, as well as to preserve anatomical structures. | case summarya 10-year - old castrated male domestic shorthair cat was presented for assessment of a gingival mass surrounding the left maxillary third and fourth premolar teeth. the mass was surgically removed by means of a marginal rim excision, and the tissue was submitted for histological assessment. it was identified as a benign cementoblastoma (true cementoma). there was proliferation of mineralized eosinophilic material with multiple irregularly placed lacunae and reversal lines, reminiscent of cementum. the cat recovered uneventfully from the anesthesia, and there was no evidence of tumor recurrence 6 months after surgery.relevance and novel informationcementoblastomas (true cementomas) in domestic animals are rare, with just a few reports in ruminants, monogastric herbivores and rodents. cementoblastoma is considered a benign tumor that arises from the tooth root. the slow, expansive and constant growth that characterizes these masses may be accompanied by signs of oral discomfort and dysphagia. this case report is intended to increase knowledge regarding this tumor in cats and also highlights the importance of complete excision of the neoplasm. to our knowledge, there are no previous reports in the literature of cementoblastoma in the cat. |
rosa26 cre - er mice (jackson) and mice carrying a conditional trf2 allele were crossed to generate mouse embryo fibroblasts (mefs). mefs were immortalized with pbabesv40lt, and treated 4-hydroxytamoxifen (0.6 m) to induce cre - mediated recombination. trf chimera constructs were generated by pcr amplification using as templates pbabe - myc - trf1 or pbabe - myc - trf2 constructs (primers used are listed in supplemental table 2). pldt - gfp - rnf8, pldt - gfp - rnf168 and, gfp - mdc1, were a gift from matthew d. weitzman (u. penn). pcdna - myc - mre11 and pcdna - myc - nbs1 were a gift from dr. the following antibodies were used : myc (9b11, cell signaling), chk2 (bd biosciences), hrad50 (novus, nb100 - 154ss), hubr5 (edd) (santa cruz, sc-9562), flag (sigma, f7425) or ha (covance, 16b12), h2ax (millipore, jbw301), 53bp1 (novus, nb 100 - 304), gfp (invitrogen, a6455), brca1 (a gift from dr the following antibodies were used : myc (9b11, cell signaling), flag m2 affinity gel (sigma, a2220). plko lentiviral vectors were used to express shrnas directed against the following targeting sequences : gctcagtatttaccaagaatt (brcc3), gtccatccaagtggagtacat (otub1), cccattcagtatcctggctt (rap80), aaccagatgtctgtactaagg (brca1). hcl at ph 7.5, 150 mm nacl, 1 mm edta, 0.5% tritonx-100) and immunopurified with anti - flag agarose resin (sigma). after washing, proteins were eluted by competition with flag peptide (sigma). for mass spectrometry analysis samples peptide mixtures were analyzed by nanoflow liquid chromatography mass spectrometry using an eksigent nanopump (dublin, ca) and ltq - orbitrap mass spectrometer (thermo scientific, bremen, germany) using a 7 step mudpit separation. ms / ms spectra were collected in a data dependent fashion and resulting spectra were extracted using rawxtract. protein identification was done with integrated proteomics pipeline (ip2) by searching against uniprot human database and filtering to 1% false positive at the spectrum level using dtaselect. rosa26 cre - er mice (jackson) and mice carrying a conditional trf2 allele were crossed to generate mouse embryo fibroblasts (mefs). mefs were immortalized with pbabesv40lt, and treated 4-hydroxytamoxifen (0.6 m) to induce cre - mediated recombination. trf chimera constructs were generated by pcr amplification using as templates pbabe - myc - trf1 or pbabe - myc - trf2 constructs (primers used are listed in supplemental table 2). pldt - gfp - rnf8, pldt - gfp - rnf168 and, gfp - mdc1, were a gift from matthew d. weitzman (u. penn). pcdna - myc - mre11 and pcdna - myc - nbs1 were a gift from dr. the following antibodies were used : myc (9b11, cell signaling), chk2 (bd biosciences), hrad50 (novus, nb100 - 154ss), hubr5 (edd) (santa cruz, sc-9562), flag (sigma, f7425) or ha (covance, 16b12), h2ax (millipore, jbw301), 53bp1 (novus, nb 100 - 304), gfp (invitrogen, a6455), brca1 (a gift from dr. xiaochun yu), rnf168 (a gift from dr. daniel durocher), fk2 (millipore, 04 - 263). for ip the following antibodies were used : myc (9b11, cell signaling), flag m2 affinity gel (sigma, a2220). plko lentiviral vectors were used to express shrnas directed against the following targeting sequences : gctcagtatttaccaagaatt (brcc3), gtccatccaagtggagtacat (otub1), cccattcagtatcctggctt (rap80), aaccagatgtctgtactaagg (brca1). hcl at ph 7.5, 150 mm nacl, 1 mm edta, 0.5% tritonx-100) and immunopurified with anti - flag agarose resin (sigma). after washing, proteins were eluted by competition with flag peptide (sigma). for mass spectrometry analysis samples peptide mixtures were analyzed by nanoflow liquid chromatography mass spectrometry using an eksigent nanopump (dublin, ca) and ltq - orbitrap mass spectrometer (thermo scientific, bremen, germany) using a 7 step mudpit separation. ms / ms spectra were collected in a data dependent fashion and resulting spectra were extracted using rawxtract. protein identification was done with integrated proteomics pipeline (ip2) by searching against uniprot human database and filtering to 1% false positive at the spectrum level using dtaselect. | summarymammalian telomeres repress dna damage activation at natural chromosome ends by recruiting specific inhibitors of the dna damage machinery that form a protective complex termed shelterin. within this complex, trf2 plays a crucial role in end - protection as it is required to suppress atm activation and the formation of end - to - end chromosome fusions1, 2. here, we address the molecular properties of trf2 that are both necessary and sufficient to protect chromosome ends. our data support a two - step mechanism for trf2-mediated end protection. first, the dimerization domain of trf2 is required to inhibit atm activation, the key initial step involved in activation of a dna damage response. next, trf2 independently suppresses the propagation of dna damage signaling downstream of atm activation. this novel modulation of the dna damage response at telomeres occurs at the level of the e3 ubiquitin ligase rnf168 3. inhibition of rnf168 at telomeres involves the de - ubiquitinating enzyme brcc3 and the ubiquitin ligase ubr5 and is sufficient to suppress chromosome end - to - end fusions. this two - step mechanism for trf2-mediated end protection helps to explain the apparent paradox of frequent localization of dna damage response proteins at functional telomeres without concurrent induction of detrimental dna repair activities. |
in the 1970s, korean psychiatrists became puzzled by a malady commonly referred to as hwa - byung (fire - illness) (min 2009a, pp.12). they reported that most patients who sought treatment were poor, middle - aged women with little formal education. the patients had often been tormented by a demoralized husband or a vicious mother - in - law for several decades and exhibited a range of psychosomatic symptoms such as anxiety, obsessive - compulsiveness, anorexia, and irritability. at first glance, korean psychiatrists thought the symptoms similar to those of neurotic disorders (min. 1986, p. 654), but the american psychiatric association s standardized diagnostic manual, dsm - iii, did not appear to have any information on hwa - byung. korean psychiatrists then turned to their indigenous medical heritage in vain, finding that the major classics of korean traditional medicine, such as h chun s (15461615) precious mirror of eastern medicine (tongi pogam, 1613) and yi che - ma s (18381900) longevity and life preservation in oriental medicine (tongi susebown, 1894), did not recognize hwa - byung as a disease category. the character hwa means fire, and hence alludes to centuries - old medical discussions about fire in east asia (li 2002). in particular, chinese physicians from the twelfth century onwards began to emphasize the role of fire as an internal pathogenic agent, thereby articulating the medical understanding of human desires and emotions (furth 2006). sharing a textual tradition with china, korea also adopted the chinese articulation of fire from the sixteenth century on. despite this long history of discourse on fire, hwa - byung was rarely mentioned as a disease category in korean medical texts (min 2009a, pp. 1819). the obscurity of hwa - byung as a textual label contrasts sharply with koreans self - evident experience of the illness in their daily lives kim yl - gyu, a scholar of korean culture, depicts hwa - byung as korea s national illness (kim 2004), while newspaper articles regularly use the term hwa - byung to contextualize the lamentable situation of women in contemporary korea. for instance, chosn ilbo reported that more than 80 % of women fighting various types of cancer are also diagnosed with hwa - byung (march 23, 2011). the condition not only affects anonymous women on the economic and cultural margins of korean society, but also elite women like kim youngju, the wife of famed resistance fighter and national poet kim chi - ha. kim young - ju confessed that she had suffered from hwa - byung for decades before being cured by a practitioner of traditional medicine. after taking medicine prescribed by this elderly gentleman, i felt like a clod of constrained fire (ulhwa in korean or yuhuo in chinese,)1 was suddenly cast out of my chest one of the most well - known, reform - minded kings in korean history, king chngjo (17521800), is known to have perished due to an ulcer aggravated by years of hwa - byung. ten days before his death, the king stated : this symptom is caused by hwa - byung accumulating for many years. the people in this court do not fear anything, so how can fire - qi not be clumping in my chest ? (veritable records of the chosn dynasty, june 16, 1800)hwa - byung first appeared in korean court records in 1603, and a series of terms implying fire - related discomforts showed up more than 50 times between the seventeenth and late nineteenth centuries.2 although medical texts did not explicitly recognize hwa - byung as a name of a disease, past court records and the contemporary circulation of the term provide justification for its reputation as korea s national illness. the people in this court do not fear anything, so how can fire - qi not be clumping in my chest ? (veritable records of the chosn dynasty, june 16, 1800) hwa - byung s ostensible ubiquity in korean society, in contrast to its relative scarcity in professional medical discourse, has provoked various efforts to officially label the problem. in addition to korean psychiatrists, doctors of traditional medicine have also actively joined the effort over the last 30 years to define, diagnose, and cure the affliction koreans know as hwa - byung. the advance of depression as a global disease (watters 2010)combined with korea s rising suicide rate (hangyre sinmun, sep 19, 2006)has encouraged korean medical professionals to study cultural factors that may be detrimental to the mental health of people in korea. this article aims to analyze the process through which hwa - byung draws on both the traditional idea of constrained fire and the dsm s modern identification of depressive disorders to establish hwa - byung as a valid condition within professional medical circles. medical research on hwa - byung has increased rapidly, borrowing terms and theories from across conventional disciplinary boundaries, including traditional medicine, psychiatry, psychology, and medical statistics. the process of labeling an indigenous illness for a broader audience reflects the desire of korean professionals to take the initiative in their field at an international level, and to be seen as both modern and advanced. simultaneously, various interpretations of hwa - byung have emerged and then disappeared without fully stabilizing its definition in medical writings. this article aims to depict the way hwa - byung has been (dis)assembled at the junction of global and domestic flows. how does an experience that is believed to be indigenous gain a classification applicable to both domestic and foreign cases ? what sources did medical professionals utilize to index koreans particular experience in the supposedly universal grid of knowledge ? given the inventive nature of hwa - byung, how can we understand the incessant circulation of the label in contemporary korea ? finally, but not least important, what does this process tell us about the korean pattern of producing medical knowledge about local experience at the margins of a western - centered psychiatry ? past research in anglophone academia has rarely put hwa - byung in its historical context. most medical studies have defined it in accordance with the scheme of contemporary psychiatric etiology ; hence, hwa - byung has been compared to other psychiatric syndromes for identification purposes.3 with a growing interest in multiculturalism, manifestations of hwa - byung among korean - americans have been studied as part of the asian - american psychiatric experience (pang 1990 ; lin. past studies, however, have not fully analyzed the way hwa - byung has been continually transformed by new research findings, nor have they considered the clinical implications arising from the challenges of interdisciplinary study and international recognition. this article does not aim to provide another report on hwa - byung s definition, manifestation, and treatment. rather, this study examines hwa - byung as part of the changing mode of ethnic / indigenous portraits that korean medical professionals use to solidify their knowledge and status and to strengthen their clinical strategies. essentializing the nature of the autochthonous experience in medicine as kapil raj s study concerning botanical exchange between india and europe reveals, purely indigenous forms of knowledge that fail to register with central medical conventions can not be communicated outside the locale (raj 2006). the medical and scientific studies about the indigenous are shaped and modified, reflecting the interest of the intellectual and cultural center. accordingly, the story of hwa - byung demonstrates that medical writing at the margins reveals the desire to catch up with the latest agendas and conventions of the center. terms and idioms produced at the center are carefully selected to appeal to audiences in both the cosmopolitan center and the local context. therefore, narrating indigenous experience often results in shifting strategies, leading to questions such as to what extent should the peculiarities of the indigenous be emphasized or tailored. sensitive to their positions from a global standard, korean medical professionals have been both ambitious and ambiguous in documenting local experience for more authoritative audiences. this article also intends to scrutinize the way in which a few doctors utilize the label of hwa - byung as a tool for criticizing the current state of korean medicine, which they view as reductionist and corporatized. publishing monographs of advice on hwa - byung, recent specialists have begun to argue for a better relationship between doctors and patients. including many first - hand stories about their patients, korean hwa - byung specialists come to highlight life complexity, individuality of illness, and the significance of doctors compassion with their patients. interestingly, these popular texts about hwa - byung remain eclectic in defining the illness and suggesting treatments. for instance, some traditional doctors equate hwa - byung with stress, whereas others equate it with depression.. however, all the popular advice shares a common element in highlighting narratives as a crucial part of the curing process. to treat hwa - byung fully, a korean doctor had to first be a listener and then had to represent their patients illness stories, which can hardly be reduced to tables, numbers, and simple questionnaires. by listening to patients stories over time, doctors also accumulated their own narratives about clinical intervention, which can not be succinctly summed up in the form of a scientific article or medical report. resonating with what arthur kleinman (charon 2006), the contemporary korean hwa - byung discourse serves as a means to expose criticism about existing clinical problems and to conjure up a vision for better clinical communication. considering the evolution of how korean medical professionals have narrated indigenous experience from the 1970s onwards, this article examines the enduring yet unfulfilled desires among doctors, which have also shaped the diagnostic approaches to koreans emotional discomfort. the medical representation of hwa - byung has been flexible, overlapping, and sometimes self - effacing, alluding to those professionals manifold strategies at the global and domestic junctures. yi shi - hyung was the first to posit korean culture as a key factor in determining the etiology of hwa - byung.4 several previous authors had discussed the different manner in which lay people in the countryside and professionals in psychiatric clinics conceptualized hwa - byung. yi went one step further by highlighting unfavorable socio - cultural conditions in korea at large. based on his clinical encounters with female patients, yi specifically depicted hwa - byung as the sickness of an oppressed society in which marginalized women find few means to express their desires and resentment (yi 1977). with the notion of a distinct cultural illness now in place, min sung - kil, a psychiatrist affiliated with yonsei university, one of the most privileged private universities in korea, next began to search for a means to translate what korean patients and their families reported to be hwa - byung into the language of psychiatry in order to establish an objective diagnostic standard.5 min began by interviewing 287 outpatients who visited psychiatric clinics in three different locations in korea for treatment of what (min. 1986, p. 653). to conduct these interviews, he relied on the diagnostic interview schedule, 3rd edition, a tool designed by the national mental health institute (nimh) of the united states but subsequently translated into korean and validated for use with korean patients. min relied on a standardized interview schedule to maximize the reliability of his data. yet, he acknowledged his own modification of it by deleting what he considered to be irrelevant questions while adding others.6 in an attempt to garner more international recognition for his modified schedule, he also invited an american psychiatrist from the pacific / asian - american mental health research center to appropriately train his korean interviewers (min. out of 287 patients, 56 were classified as hwa - byung, with both the patients and their families agreeing with the diagnosis. in a similar fashion, 157 were identified as the non - hwa - byung group. according to the diagnostic categories of the dsm - iii, the hwa - byung patients turned out to belong to multiple diagnostic categories, whereas the non - hwa - byung patients had one or no diagnosis. the most frequently found associated diagnosis for hwa - byung patients was depression (major depression and dysthymic disorder, alone or combined) and somatization disorders combined (min. 1986, p. 661). the overlapping of diagnoses was the major characteristic of hwa - byung. to support his finding, remotely placed near the southwestern coast of korea, residents on the island work mostly in agriculture and are assumed by min to preserve their indigenous culture more successfully than urban residents (min 1986). among 562 surveyed outpatients, min s team was able to interview 138 individuals, identifying 34 as belonging to the hwa - byung group and 67 as belonging to the non - hwa - byung group. the diagnosis of hwa - byung primarily depended on patients answers to the questions the interviewers asked. min argued that hwa - byung is a syndrome with symptoms sufficiently severe to be diagnosed as neurotic disorders and it includes somatization, anxiety, and depression combined (min 1986, p. 466). patients subjective statements were the only grounds for identifying hwa - byung (min 1991, p. 1194). patients were often confused and inconsistent in remembering how serious their psychosomatic problems were and misunderstood terms the psychiatrists used in the interviews (min 1986, p. 464). more fundamentally, he found that the cultural - linguistic barrier hampered the universal application of psychiatric terminologies. min states : it is problematic that our country s psychiatrists rely solely on theories of western medicine in treating our country s patients. socio - cultural factors that cause our patients mental illnesses are different from those of (western) societies. (our patients) manifestation of symptoms, ways of expressing them, and methods of treatments can not be separated from the traditional attributes of our family, society and culture. more to the point, genetic and constitutional difference may not be fully conceptualized by a western standard. our country is developing into a western industrial society, and the term hwa - byung is becoming less familiar to most koreans. however, the socio - cultural attributes of our traditional society will continue to have their repercussions beneath the rapidly changing environment on the surface (min 1986, p. 653). it is problematic that our country s psychiatrists rely solely on theories of western medicine in treating our country s patients. socio - cultural factors that cause our patients mental illnesses are different from those of (western) societies. (our patients) manifestation of symptoms, ways of expressing them, and methods of treatments can not be separated from the traditional attributes of our family, society and culture. more to the point, genetic and constitutional difference may not be fully conceptualized by a western standard. our country is developing into a western industrial society, and the term hwa - byung is becoming less familiar to most koreans. however, the socio - cultural attributes of our traditional society will continue to have their repercussions beneath the rapidly changing environment on the surface (min 1986, p. 653). min did not propose overcoming the limitations of his research by improving his interviewing skills. instead, he expressed his dissatisfaction with the standardized psychiatric disease categories, which are american in origin. because he believed that modern psychiatry is too entangled in its own cultural origins, min continued to express his criticism of the limits of psychiatric language throughout the early 1990s. given this predicament, min longed to find what he considered he felt that korean psychiatrists could not consider the development of symptoms, expressiveness, and the treatment without digging thoroughly into korean family structure and socio - cultural factors. inasmuch as psychiatrists need to know an individual patient s deep - rooted life stories for treatment, the so - called uniquely korean way of life should be examined by (korean) psychiatrists in order to design the appropriate treatment. this partially explains why min became interested in han (), the supposedly korean way of holding grudges and experiencing anger. according to min, hwa - byung and han have an etiological relationship. interviewing 146 outpatients who visited the clinic of psychiatrics at yonsei severance hospital to treat their hwa - byung, he was able to question 125 about their han, and 117 answered that han, to some degree, is relevant to hwa - byung (min 1991, p. 1192). unpleasant experiences in life, min argued, cause either hwa - byung or han. the difference mostly lies in time duration and the inclusion of socio - political vicissitudes. whereas hwa - byung addresses comparatively recent losses and the despair of an individual, the causes of han stem from decades ago, such as personal difficulties due to japanese colonization (19101945) or the korean war (19501953). the most frequently reported emotional reactions among hwa - byung with han patients are mortification, frustration, nihilistic mood, anxiety, and regret. (min 1991, p. 1189) although han helped to explain the origins of hwa - byung, min realized it caused other problems with his research framework. for instance, those who have han without any hwa - byung would need to be further examined to elaborate on this etiological relationship. the impact of stress on han might provide another meaningful point of reference for understanding the relationship between han and hwa - byung. the comparison between han and chng, another indigenous term for the korean feeling of emotion, should also be examined. despite the need for further research, min never hesitated to conclude that hwa - byung can be said to be a pathological condition of han resulting from the failure to overcome it in the long term (min 1991, p. 1198). min felt that han could provide an interpretative frame for understanding koreans collective responses to the accumulated plight. he viewed han as a uniquely national (hanguk minjok,) expression of suffering (min 1991, p. 1195). to properly treat this problem, he called for an ethnic psychiatry that deals with the korean nation s neuro - psychiatry (minjok chngsin ihak). min s elaboration of han as an etiology for hwa - byung continues to be quoted by both psychiatrists and doctors of traditional medicine.7 today, min s work is recognized as playing a significant role in establishing han as an icon of the uniquely korean psychological state. the growing number of studies of han produced by korean historians, theologians, and literary critics up until the 1990s have provided a substantial repertoire for min to argue the etiological significance of han., literary critics began to describe han as the most prevalent theme of korean literary expressions. from the oldest poem to the most contemporary novel, han best exhibits korean s deep - rooted emotional foundation (chn 1993). minjung theology, an indigenous christian theology that came out of the korean human rights movement and social activism during the 1960s, also interpreted han as that which evolved from the korean experience of the oppressed (lee 1994 ; son 1984 ; kim 1994 ; park. studies on korean music trace the origin and modification of sound that expresses han (willoughby 2002). inquiries into korean shamanism never fail to point out that han became the indispensable cause and result of being drawn to shamanism (choe 1991, 1994 ; kim 1999). it is interesting to see that different avenues of korean discourse on han share a twofold desire to situate han in a specific time and place while simultaneously universalizing it. for instance, ko n, a well - known poet and thinker whose ideas represent major claims of the nationalist movement in korean literature, put the origin of han in ancient korea, in kochosn (, circ.1000108 bce), and surveyed han s enduring manifestation through the socio - political vicissitudes in the period of the three kingdoms (circa 57 bce668 ace), the kory (, 9181392 ace), and chosn dynasties (, 13921910 ace). in parallel with han s historicity, however, ko also explores han s general validity. han is compared with the chinese idea of hen (), the mongolian feeling of horosul, the manchurian expression of krosocuka, and the japanese meaning of oorami. this comparative approach, in a sense, puts han in a broader context by encompassing other peoples experience of suffering. han needs to go beyond korea s geo - political boundaries to resonate with other expressions of the oppressed. in other words, these discussions on han from the non - psychiatric disciplines expose the fact that the korean elaboration of koreanness is paralleled by the desire to go beyond the autochthonous. the idea of the indigenous requires a broader register for comparison and circulation. in parallel, the studies on the indigenous conditions for mental health were not entirely oriented toward domestic demands. uniquely korean narratives are inclined toward audiences in the outer world. in retrospect, min confessed that hwa - byung was welcomed more by international audiences than by domestic listeners. psychiatrists abroad found a korean case of culture - bound syndrome meaningful (min 2009a, p. 219). in addition, min acknowledged that american psychiatrists research prior to his own studies actually motivated him to take the initiative to report hwa - byung to global readers. min viewed keh - ming lin s article published in the american journal of psychiatry in 1983 as the first international report on hwa - byung (lin 1983). how come an american psychiatrist is reporting about korean hwa - byung ? he wondered (min 2009a, p. 217). feeling challenged by lin, min began to collect clinical cases about hwa - byung. min s reputation has flourished along with his theories related to hwa - byung. from the late 1990s onward, min has presented his work at numerous conferences held by international societies, such as the association of korean - american psychiatrists, the american psychiatric association, the world psychiatric association, the pacific rim college of psychiatrists, the world association of social psychiatry, and the world congress of cultural psychiatry (min 2009a, pp. the fourth edition of the dsm (dsm - iv) recognized hwa - byung as a culture - bound syndrome in 1994. following this success, the goals of korean psychiatric research have become focused on gaining even more international recognition. biological research, anger - related brain research, development of hwa - byung scale, and drug tests have aimed to verify hwa - byung s autonomous existence (min 2009b, pp. min has put more emphasis on characterizing hwa - byung as an anger disorder, which may be applicable to patients across cultural - ethnic boundaries (min 2009a, p. 176). min s statistically sophisticated research in 2009 argued that hwa - byung could be meaningfully distinguished from symptoms of major depression and should therefore be elaborated on under another novel name, such as an anger disorder (min 2009b, p. 77). he states, hwa - byung, according to biological, psychological, and social model, can be viewed as a psychiatric barrier that has both emotional and somatic / behavior symptoms relevant to anger. hwa - byung can gain a name and be conceptualized in a dsm clinical category (min 2009b, p. 83). one paradox with these efforts to universalize hwa - byung as an anger disorder is that they undermine the uniquely korean cultural etiology of han. min has called for further investigation of attributes associated with anger that are found in many cultures, such as ataques de nervios among hispanics (min 2009a, pp. ironically, min s earlier passion to make the koreanness of hwa - byung visible has now led to his willing extinction of that distinction. beginning with a passion to articulate the culture - bound attributes of hwa - byung in the early 1980s, min ended up with a culture - neutral conceptualization of hwa - byung in the twenty - first century. in his conceptualization of hwa - byung min s earlier survey reveals that doctors of traditional medicine were mostly reluctant to accept hwa - byung s close relationship with factors of korean culture, such as han, while unanimously believing the autonomous status of the illness as a clinical entity. korean psychiatrists, in contrast, paid more attention to indigenous culture as an etiological factor, yet were reluctant to define hwa - byung as a clinical category (min. the discussion below turns to doctors of traditional medicine who adopted changing strategies to help establish hwa - byung as a meaningful diagnostic category. from the early 1990s onward, hwa - byung emerged as a significant research topic of traditional medicine.8 psychiatrists endeavors to examine indigenous etiological factors seemingly challenged the professionals of traditional medicine (kim. more to the point, traditional medicine itself became more specialized during this period, and thus, rushed to establish disciplines of subspecialty, such as pediatric, gynecological, and psychiatric associations.9 the journal of oriental neuropsychiatry, for instance, was first published in 1990. the ascendancy of depressive disorders on a global scale has also motivated traditional medicine to further delve into hwa - byung. according to a government survey, the prescription of antidepressant medication in south korea increased by 52.3 % between 2004 and 2008. nearly a fifth of women in south korea are reported to suffer from depression at some point in their lives, and female use of antidepressant medication was double the male use between 2004 and 2008 (ynhamnyus, july 26, 2009). accordingly, the korean society for depressive and bipolar disorders was first established in 2001.10 traditional medicine s growing interest in hwa - byung should be understood in this milieu of pressing needs to resolve emerging mental health issues in both domestic and global settings. the number of articles containing the word depression or hwa - byung in the journal of oriental neuropsychiatry increased substantially after 2000. following the initiative of korean psychiatrists, the specialization of traditional medicine, and the advance of depression depression and hwa - byung in their korean nomenclatures share a common character, yu (), which has long been a significant etiological concept in traditional medicine in east asia. translated into constraint, the term yu primarily implies something that is stuck, or unable to move or change, because of a blocked qi movement. in east asian medicine, the pathological condition of yu can frequently be a cause of fire, and this relationship between yu and fire is captured in another common name for fire illness, ulhwa - byung (yuhuobing in chinese). as volker scheid demonstrates well in this volume, thus, yu can not be succinctly reduced to any single illness or disease category. the rich textual repertoire and multiple clinical implications of yu actually empowered korean doctors of traditional medicine to enter the discourse surrounding hwa - byung. as latecomers to hwa - byung studies, the professionals of traditional medicine sought primarily to establish their unique diagnostic and clinical approaches by fleshing out the traditional ideas about yu and fire (hwa / huo) (j. kim 2007, pp. one of the most well - known hwa - byung specialists, argued that traditional medicine provides a better explanation of the four main questions about hwa - byung : (1) why hwa - byung is caused by upset, oppression, resentment, anger, and loathing ; (2) why women are more vulnerable to hwa - byung ; (3) why symptoms of hwa - byung seem similar to the traditional discourse on fire ; and (4) why the pathogenic process involves a chronic disease.11 while elaborating on those four issues, kim put forth the liver as central to the pathology of hwa - byung. whereas korean psychiatrists take the heart as the symbolic locus of hwa - byung, thereby linking it to a neuropsychiatric problem, kim differentiated his perspective with the liver (kim and whang 1994, pp. kim explained that once the liver loses its distinctive function to regulate the activities of qi, as the result of excessive anger and frustration, the constraint of liver - qi () tends to occur. if the liver - qi is blocked, then the qi probably transforms into heat - fire (), thereby leading to an upward counter flow () that resembles the symptoms of hwa - byung. kim argued that this explains women s fragility to hwa - byung. due to women s reproductive function, the liver, spleen, kidney, and two jingmai, chongmai () and renmai (), become particularly important for a woman s health. when women reach menopause, both jingmai become weak, the qi of the kidneys decreases, and the internal qi of fire becomes easily agitated. this is called the emptiness of kidney and agitation of fire () (j. kim and whang 1994, pp. kim applied other pathologies, such as rising heart fire (), excessive liver fire (), and flaming stomach fire (), to explain fire as an agent that determines other disease states (kim and whang 1994, p. 11). he argued that fire is the qi of upward tendency (), always drying up yin - qi, thereby creating the wind (), moving the blood (), and causing tumors. furthermore, fire interacts with the heart, and therefore the evil factor of fire disturbs the integrity of the mind - spirit (). kim viewed hwa - byung as immoderate emotions that turned into excessive fire qi (). based on these terms and reasoning, kim argues that traditional medicine provides better pathological and etiological explanations for hwa - byung. to kim, it is an illness with its own unique pathological process, and hence, can not be equated to stress or hysteria. first, his wording of yin - yang and five phases directly refers to the chinese classic, yellow emperor s inner canon (huangdi neijing, inner canon hereafter), and its correlative construction of the human body. kim also relies on contemporary textbooks of korean traditional medicine, which put emphasis on inner canon s holistic worldview. kim s understanding of fire is definitely drawn from the fourteenth century s chinese physician, zhu zhenheng s (, 12811358) conceptualization of fire as an agent of inner physiology. zhu s idea of nourishing yin to balance excess yang was highlighted by kim through precious mirror of eastern medicine (tongi pogam, 1613), which is considered to be one of the first distinctively korean medical texts. precious mirror continues to be the major reference for contemporary korean doctors of traditional medicine. the last important reference for kim is today s traditional chinese medicine (tcm) textbooks from china, which are now available in korea. through his investigation of these textbooks zhangsessentials of medicine (), written by zhang lu (), who lived in seventeenth - century jiangsu china. previously, zhang had not been influential in korea, yet mediated by tcm textbooks, kim was able to draw on ideas from mr. for example, his interest in the manifestations of women s yin qi related diseases came from these textbook presentations of zhang. kim also relied on tcm textbooks from modern china for information about fire s physiological and pathological functions. perhaps most importantly, kim utilized the tcm textbook methodology of pattern recognition and treatment determination, or bianzheng lunzhi, as we will see below. it was not uncommon for korean doctors of traditional medicine during the 1990s to refer to textbooks, journal articles, and monographs from taiwan and china. the textual resources for a korean construction of hwa - byung, thus, include korean psychiatrists early research on hwa - byung, quotes from chinese classics like inner canon, a well - known korean text like precious mirror (which summed up a fourteenth - century chinese elaboration on fire), and contemporary tcm textbook views of fire as a physiological process. korean medicine doctors, as latecomers to the treatment of hwa - byung in korea, benefitted from tcm s resources, thereby enhancing the rationale of using the traditional in treating hwa - byung. relying on the language of modern tcm from china, his research seemed to lack a specific korean ethnic distinction. it became obvious that kim s strategic composition of hwa - byung has a limit in gaining an audience outside korea. unlike min, who made the korean illness visible to international audiences and actively circulated his work outside korea, kim worked with hardly any non - korean psychiatrists, or with any chinese or japanese doctors of traditional medicine. kim recognized the weakness of articulating hwa - byung solely based on the textual language of traditional medicine. to overcome these limitations, kim turned to objective measurements, which he thought would eventually demonstrate traditional medicine s successful diagnosis and treatment of hwa - byung and thereby gain a broader audience. kim underlines, no matter how diligently you may explain hwa - byung, if it is not tested by biological and scientific methods, the research can hardly be widely credited (kim 2007). for instance, in the early 2000s, kim took a position that viewed hwa - byung as a phenomenon related to stress, which enabled him to measure the development of symptoms using an officially acknowledged scale (lim. 2000). relying on and slightly modifying the gars (global assessment of recent stress), forty - eight outpatients were surveyed, and their answers were analyzed by paired sample t test. kim referred to t. h. holmes s the social readjustment rating scale, published in 1967, and camile lloyd s life events and depressive disorder reviewed : events as predisposing factors, published in 1980.12 kim emulated the scale designs of psychological and psychosomatic research. during the 2000s, kim shifted away from stress toward depressive disorders. by equating yu with depression, kim s growing emphasis on a standardized diagnostic manual of traditional medicine suitably exhibits the overall trend to identify yu with depression in korea. after years of interdisciplinary collaboration, kim was able to develop a hwa - byung diagnostic interview schedule (hbdis), which was supported by more sophisticated statistical methods. verified with validity and credibility, his scale was approved by the korean psychological association in 2004. based on this scale, kim was able to make his own argument with a more competent tone (lee. although earlier research in psychiatry described hwa - byung as a combination of multiple symptoms or a strong manifestation of somatic disorders, kim underlines that more than 70 % of his hwa - byung sample patients turned out to be diagnosed according to dsm - iv s major depression disorder and dysthymic disorder (lee. 2005, p. 12). kim s study of hwa - byung as a major depressive disorder also drew on tcm research models from china, in particular, using the clinical standardizations of pattern recognition and treatment determination (bianzheng lunzhi, pattern recognition as eric karchmer has demonstrated, since the late 1950s, pattern recognition has been central to codifying the uniqueness of chinese medicine while also providing a technique, often unacknowledged, for integrating chinese medicine with biomedicine (karchmer 2010, pp. korean practitioners have also recognized the significance of pattern recognition, and since 1995 they have been working on their own set of standardizations, called oriental medicine standard - prime, which is now marketed online.13 in his 2007 article, kim compared 17 hwa - byung - only patients with 20 patients from the hwa - byung and major depression double diagnoses group. for this sample selection, kim used standardized scales, such as hbdis, scid, oms - prime, the hamilton rating scale for depression (hrds), and the montgomery - asberg depression rating scale (madrs). kim examined socio - demographic data and then analyzed two groups pattern recognition. he found no significant differences in the distribution of patients according to major patterns between the two groups. examined by oms - prime, both groups have a tendency to show deficiency of yin and yang of the heart most frequently. based on this analysis, kim concluded that hwa - byung is a syndrome that has many different symptoms, but there is no difference between the hwa - byung group and hwa - byung with major depression group (double diagnosis) in terms of standardized pattern recognition. because kim s research aimed to demonstrate overlaps where others, such as min and other korean psychiatrists, see differences, kim argued that his approach to the study of hwa - byung could be a new model for researching depression in korea. kim added that koreans have a tendency to experience more somaticized symptoms of major depression and express the depression through the language of hwa - byung (kim. he suggested : although hwa - byung and depression are often considered as a single and separate disease entity (chilbyng), if traditional medicine s method of pattern identification is applied, hwa - byung and depression can be conceptualized as a series of various symptoms respectively, but not separate illness entities. this is due to traditional medicine s and western medicine s fundamentally different approaches to disease. and this indicates that western medicine requires complementary research on symptomatic approaches, whereas traditional medicine necessitates further understanding about a disease - centered approach. 2007, p. 12) although hwa - byung and depression are often considered as a single and separate disease entity (chilbyng), if traditional medicine s method of pattern identification is applied, hwa - byung and depression can be conceptualized as a series of various symptoms respectively, but not separate illness entities. this is due to traditional medicine s and western medicine s fundamentally different approaches to disease. and this indicates that western medicine requires complementary research on symptomatic approaches, whereas traditional medicine necessitates further understanding about a disease - centered approach. 2007, p. 12) although kim contrasted traditional medicine with its western counterpart, he never posited traditional medicine as an alternative or complement to a psychiatric (scientific) approach. rather, kim strongly embraced the language of psychiatry, psychology, and statistics, thereby portraying his own version of traditional medicine that was well synchronized with the objective standardizations of biomedicine.14 the korean identification of hwa - byung with depression has been further enhanced by a series of psycho - pharmaceutical research about traditional prescriptions. published mostly after 200 0, those articles equated depression with yu - related illness, to which hwa - byung also belongs. by identifying depression with hwa - byung, those articles were able to apply the experimental model of antidepressants to korean traditional prescriptions, thereby objectively elaborating hwa - byung as a medical entity. chung, for instance, examined coptis decoction to resolve toxicity (huang lian jie du tang), one of the well - known prescriptions for hwa - byung in south korea. chung states that in order to treat depression, traditional medicine can rely on prescriptions that treat fire (pathologies) (chung and kim 2003, p. 2). in addition to chung s finding, substantial research has been carried out since 2000 to emulate the psycho - pharmaceutical research about antidepressants.15 the previous analysis traces the way hwa - byung has been defined, diagnosed, and treated by both korean psychiatrists and doctors of traditional medicine since the 1970s. to make hwa - byung sensible in medical discourse, professionals across fields have utilized various linguistic and numerical resources and have strategically modified hwa - byung s relationship with depressive disorders. needless to say, hwa - byung s autonomous status as an illness entity is related to the authorization of medical professionals and their career building efforts. kim began his research to differentiate traditional medicine s unique approach to hwa - byung in terms of both diagnosis and treatment (kim and whang 1994). as time went by, kim relied more on quantitative methods and less on the language of traditional medicine, aiming to objectively demonstrate hwa - byung s autonomous existence. the advance of depression as a global disease stimulated traditional medicine s equation of yu with depressive disorders, thereby providing a link to interpret hwa - byung as the korean version of depression. although both kim and min agreed that more quantitative and interdisciplinary research was indispensable to fully understanding hwa - byung, min and kim diverged in predicting the future of hwa - byung in a global context. while min argued for transforming hwa - byung into an anger disorder, thereby differentiating it from depression (min 2011, 2012), kim was drawn to equating the illness with depression to a certain degree. both min and kim successfully responded to the rise of cultural psychiatry, thereby making the korean illness visible to international audiences. although the idea of a uniquely korean malady first encouraged min and kim s research, both of them eventually distanced themselves from the ethnic grounding of hwa - byung. although min first celebrated the locally specific experience of the korean psyche, thereby revealing the cultural bias of american psychiatry, he eventually came to argue for a universal label for hwa - byung that goes beyond korea s own cultural - geographical boundary. in a similar vein, kim first delved into the millennium - old textual heritage of traditional medicine, drawing on the language of the inner canon, renowned chinese physicians in the thirteenth century, centuries - old korean medical scholarship, and modern tcm. however, kim strongly desired to have hwa - byung recognized by contemporary psychologists, pharmacologists, and psychiatrists ; thus, he had to remake hwa - byung into an entity that could circulate across cultural, national, and disciplinary boundaries. what medical research about hwa - byung tells us is that there are no essentially korean features of the mental disorder. rather, medical professionals reports on koreanness illustrate the process through which a biography of the local has emerged and been modified, disclosing its (dis)juncture with global trends. in spite of its unstable foundations of indigenity, hwa - byung continues to represent a series of recent publications about hwa - byung for popular audiences exposes the way in which experts academic research, epitomized by min s and kim s cases, is translated into non - academic terms. tracing immediate and personal voices of hwa - byung specialists outside academia, the next section asks, what does the continuing focus on the concept of hwa - byung mean for korean doctors ? simply put, why does hwa - byung continue to be popular in contemporary korea, given the lack of any explicit consensus among doctors ? since 1997, almost a dozen popular texts about hwa - byung have been published. min and kim s research articles were edited then published in monographs in 2009 and 2007, respectively. in addition, since 2006, more than five new volumes about hwa - byung were introduced by doctors of traditional medicine. with their clinical experience and personal endeavor, these primers aptly expose hwa - byung specialists diagnostic strategies and methods of treatments. as non - academic publications however, their (dis)similar voices enable us to view the various ways in which the research initiatives of min and kim are emulated and modified by other medical experts, thereby allowing consideration of the function of hwa - byung as a textual label in expanding and limiting the scope of contemporary management of emotional disorders. four authors and their texts will be examined in the below. hwang i - wan, as a well - established hwa - byung specialist, has treated patients for more than 40 years. he served as chair of the department of neuro - psychiatry at the hospital of traditional medicine at kyung hee university and as president of the korean society of oriental neuropsychiatry (daehan hanbang singyng chngsin kwahakhoe) (hwang 2011). hwang acknowledges that hwa - byung has never signified a single disease category in traditional medicine ; however, the term has long been signified a disease name in korea (hwang 2011, p. 11). as hwang co - authored a couple of articles with kim, hwang s definition of hwa - byung and explanation of symptoms quite overlaps with kim s earlier findings.16 choe yung - jin and his co - authors begin their monograph by defining hwa - byung as uniquely korean disease, then ascribed the major cause to the socio - cultural environment of the country. choe argues that hwa - byung has accompanied korea s long history ; thus, traditional medicine that has been a part of koreans lives for millennia is better situated to deal with the illness. as an alumnus of kyung hee university, one of the top school of traditional medicine in korea, choe shares a common institutional background with hwang and kim. accordingly, the major reasoning and rhetoric choe develops for diagnosis and treatment is not radically different from that of kim and hwang. yun yong - sp, the third author, majored in pharmaceutics at chungnam university in korea, then graduated from nanjing university of medicine () in china in 1997. as the korean government acknowledges only the graduates of domestic institutions of traditional medicine for licensure, yun is not allowed to run his own clinic in korea. while managing his own apothecary, however, he has actively expressed his opinions through printed media and an internet blog. in his second book about hwa - byung, yun explained the illness by heavily relying on research about stress, strongly suggesting a holistic approach, and introducing teachings of zen buddhism. if the roots of hwa - byung and stress are associated with unfulfilled human desires, the ultimate treatment should come from a well - governed mind control. interestingly, yun often criticizes mainstream korean traditional medicine s narrow understanding of major chinese classics. finally, but not least importantly, kang yong - wn introduces kang agrees with kim in viewing the illness as a korean manifestation of depression. criticizing dsm - iv for its superficial approach to hwa - byung, kang highlights that the illness represents a collective trauma that is deeply associated with korea s unprecedented struggle into modernity. employing terms like han and chng, kang illustrates that koreans have not had enough opportunity to treat the emotional problems caused by fast economic development, a competitive educational system, and political vicissitudes (kang 2011, p. 252). the radical division between elite language (chinese in the past and english in the present) and vernacular. it is kang s view that the elites in korean history (at least since seventeenth century) governed their people by monopolizing the written language, degrading any verbal expressions that could not be transformed into classical chinese. although the korean alphabet became the national language in the early twentieth century in line with the growing nationalism and colonialism, yet the gap between written and spoken languages deterred korean medical experts from fully grasping the expressiveness of the bodily complaints by lay people. kang argues for the possibility of turning to korean vernacular with an in - depth knowledge of its semantics and hermeneutics to recover the locally inspired technique of therapeutic colloquiality. authors of recent popular volumes about hwa - byung share a common ground in utilizing the illness label to foster their own clinical intervention. almost no one denies that hwa - byung is a uniquely korean phenomenon (hwang 2011, p. 11 ; choe. as hwa - byung is fundamentally coined with korean locality, kang argues that doctors should diagnose not merely an individual patient but rather the entire all of these views overlap with min s earlier intention to find out the cultural root of hwa - byung in korean patients. given the emphasis on indigenousness, however, hwang, choe, and yun do not specify how the unique elements of korean culture are intertwined with the cause, manifestation, and treatment of the illness. rather, they tacitly equate hwa - byung with stress, thereby establishing a means to utilize theories around stress in rationalizing hwa - byung for lay audiences. for instance, hwang portrays hwa - byung as a state of excessive emotion, particularly caused by anger and anxiety. although intended as a discussion of hwa - byung, more than a half of his book depicts skillful management of stress in everyday life. each chapter fleshes out how stress causes circulatory, respiratory, digestive, endocrine organ, musculoskeletal, skin, genito - urinary, and children s diseases. based on this organization, hwang s explanation competently utilizes a range of biomedical terminologies. except for the brief introduction to his preferred prescription, (p. 64) and his short comment on constitutional medicine choe puts both hwa - byung and stress in his title and regards them as the root of hundreds of diseases. the organization of choe s book does not distinguish the symptoms and treatment of hwa - byung from those of stress. by taking stress as a medium, choi relates hwa - byung with other diseases such as high - blood pressure, obesity, stroke, learning disability, sexual impotence, irritable colon syndrome, and other chronic illnesses. s personal inclination to zen buddhism, his text provides more general advice to control human desires and to cultivate one s mind. unlike the other three authors, kang views hwa - byung as a korean manifestation of depression. yet, kang overlaps with other authors in competently employing biomedical terms for his explanation. in summation, recent popular texts about hwa - byung are consonant with the earlier studies of min and kim. all of the four exemplary authors agree regarding the indigenous nature of hwa - byung and compose the symptoms and treatments of the illness by referring to the dsm - iv definition, stress studies, and depression research. kim, in his earlier studies, intended to benefit from stress studies by emulating the measurement scale (lim. kim s desire to scientize hwa - byung is also resonant with the authors strategic management of bio - medical terms and weak elaboration of traditional medicine. interestingly, the hwa - byung diagnostic interview schedule (hbdis), which was newly designed by kim, has not been well received by the examined authors. in addition, kim s argument to view hwa - byung as korean manifestation of depression found only one advocate, kang. given this adjusted composition of hwa - byung by doctors of traditional medicine, more thought should be given to the role the illness label plays in criticizing the contemporary landscape of korean medicine. if stress and depression aptly replace the manifestation of hwa - byung, why is the label still being used not only among patients but also among health specialists ? what kinds of desires and complaints are associated with the contemporary use of hwa - byung as a meaningful disease name ? one of the most explicit demands by the above authors is to include patients life narratives into a treatment process and establish a better relationship between doctor and patient. treating hwa - byung primarily implies fully delving into patients life stories, and accordingly, all the authors take patients first - hand narratives as a meaningful starting point for treatment. for instance, hwang begins his book by narrating more than 31 cases that appealed for or were diagnosed as hwa - byung (hwang 2011, pp. although they can be viewed as general problems of family conflicts, career failures, death of a beloved, and economic loss, every case has its own unique manifestation. to understand hwa - byung more fully, it is indispensable for doctors to listen to the stories carefully and to respond to them accordingly. today s clinical environment is much too specialized and standardized, alienating both patients and doctors (hwang 2011, appendix 4). he states, the hesitant patient who does not know which department s / he should go for her / his health concern exemplifies one case of human alienation. today s clinics forget the wholeness of human beings and tend to serve as a repair shop. besides, the more medicine develops, the more people are alienated. the clinic as a part feeder becomes corporatized and automatized (hwang 2011, appendix 4). as a solution for hwa - byung, hwang envisions better clinical communication that goes beyond simple questionnaires, tables, and numbers. yun agrees with hwang in emphasizing the significance of dialogues between a healer and a patient. as yun is not a licensed doctor of traditional medicine, the range of conversation yun suggests includes more general principles of self - control, psychotherapy, and religious teachings. interestingly, yun allots almost one - third of his book to introducing the 91 stories of zen (91) as a resource for soothing hwa - byung (yun 2007, pp. although yun does not specify how the zen stories had impact on treating the illness, he argues that the teaching of zen is a reliable means to control stress and hwa - byung. yun believes the stories of illness can only be cured by another set of narratives ; hence, the resonating healing power of zen messages needs to be introduced. he argues : to sum up, our life is nothing but stories, and depression is also a story. it is clear that treatment should be a story (kang 2011, p. 175). his narrative - centered approach calls for counseling that is based on a refined understanding of korean vernacular. kang attempts to analyze the linguistic convention of ordinary koreans, not that of elites, to develop medicine carried out by our own language, healing of counseling by our own language (kang 2011, p. 189). according to kang, colloquial korean puts emphasis on verbs, not nouns, which indicates the language s full capacity to express human dynamics. adjectives are rich ; hence, the concrete details of individuality in things and people are aptly expressed. furthermore, the use of the (non)substantive, a word order that highlights objects, the weakness of making logically connected long sentences, the development of immediacy and sensitivity, the lack of articles and prepositions, the significance of continuation, the qualitative approach, euphemism, and playfulness characterizes the unique nature of colloquial korean (kang 2011, pp. what should be noted here is kang s problematization of the disjointed relationship between language and experience, which reflects the failure of the korean medicine to fully come to grips with the expression of patients suffering. to reach the root of hwa - byung / depression, doctors, as healers, need to develop well - trained listening skills with an empathetic mind. kang insists that inter - subjectivity between doctor and patient will help establish a more corresponding and meaningful relationship in clinical encounters. kang s call for vernacularization of korean clinical language is resonant with min s claim for a koreanized psychiatry in the late 1980s. twenty - five years after min s first call for indigenization, and even after min s decision not to emphasize any ethnic attribute of hwa - byung, opting for a much universal term, anger disorder, kang regurgitates the turn toward indigenousness, thereby conjuring up the alternative in treating koreans emotional disorders. both min and kang hope to understand the fuller and deeper meaning of hwa - byung, which requires an articulation of koreanness in medicine. to kang, this endeavor implies the recovery of clinical colloquiality in korean vernacular. to a certain degree, the underlying desires to make hwa - byung visible parallels a rising demand to make patients stories known and establish them as a clinically meaningful repertoire for treatment. the unique, individual, and irreducible elements of patients experiences need to be fully acknowledged and analyzed with respect. a recent report by los angeles times shows another hunger for making untold stories told. cho man - chul, who has run a mental health program for asians and pacific islanders in los angeles for more than 20 years, found out that korean immigrants who called themselves as hwa - byung patients held on to their experiences of the los angeles riot on april 29 1992. showing a range of symptoms, such as paranoia, delusion, depression, and anger, korean immigrants have accumulated their unexplained resentment and anxiety for dozens of years. instead of moving on, they turned their anger inward, made it a part of their narrative for mundane, and continued calling it hwa - byung (banks 2012). cho put forth the significance of counseling, the process of speaking out and listening to, attempting to make the unaccountable accountable. although cho trained in western psychiatry, he gradually became a representative of hwa - byung treatment. cho insists that treating hwa - byung is nothing but establishing a long - term and reliable relationship of talking and listening. as a listener, cho not only has felt a responsibility to record patients stories, but also hopes to make those stories available for later generations. that is why cho first contacted the reporter to listen to the patient stories he has kept for 20 years. yi shi - hyung was the first to posit korean culture as a key factor in determining the etiology of hwa - byung.4 several previous authors had discussed the different manner in which lay people in the countryside and professionals in psychiatric clinics conceptualized hwa - byung. yi went one step further by highlighting unfavorable socio - cultural conditions in korea at large. based on his clinical encounters with female patients, yi specifically depicted hwa - byung as the sickness of an oppressed society in which marginalized women find few means to express their desires and resentment (yi 1977). with the notion of a distinct cultural illness now in place, min sung - kil, a psychiatrist affiliated with yonsei university, one of the most privileged private universities in korea, next began to search for a means to translate what korean patients and their families reported to be hwa - byung into the language of psychiatry in order to establish an objective diagnostic standard.5 min began by interviewing 287 outpatients who visited psychiatric clinics in three different locations in korea for treatment of what 1986, p. 653). to conduct these interviews, he relied on the diagnostic interview schedule, 3rd edition, a tool designed by the national mental health institute (nimh) of the united states but subsequently translated into korean and validated for use with korean patients. min relied on a standardized interview schedule to maximize the reliability of his data. yet, he acknowledged his own modification of it by deleting what he considered to be irrelevant questions while adding others.6 in an attempt to garner more international recognition for his modified schedule, he also invited an american psychiatrist from the pacific / asian - american mental health research center to appropriately train his korean interviewers (min. out of 287 patients, 56 were classified as hwa - byung, with both the patients and their families agreeing with the diagnosis. in a similar fashion, 157 were identified as the non - hwa - byung group. according to the diagnostic categories of the dsm - iii, the hwa - byung patients turned out to belong to multiple diagnostic categories, whereas the non - hwa - byung patients had one or no diagnosis. the most frequently found associated diagnosis for hwa - byung patients was depression (major depression and dysthymic disorder, alone or combined) and somatization disorders combined (min. the overlapping of diagnoses was the major characteristic of hwa - byung. to support his finding, remotely placed near the southwestern coast of korea, residents on the island work mostly in agriculture and are assumed by min to preserve their indigenous culture more successfully than urban residents (min 1986). among 562 surveyed outpatients, min s team was able to interview 138 individuals, identifying 34 as belonging to the hwa - byung group and 67 as belonging to the non - hwa - byung group. the diagnosis of hwa - byung primarily depended on patients answers to the questions the interviewers asked. min argued that hwa - byung is a syndrome with symptoms sufficiently severe to be diagnosed as neurotic disorders and it includes somatization, anxiety, and depression combined (min 1986, p. 466). patients subjective statements were the only grounds for identifying hwa - byung (min 1991, p. 1194). patients were often confused and inconsistent in remembering how serious their psychosomatic problems were and misunderstood terms the psychiatrists used in the interviews (min 1986, p. 464). more fundamentally, he found that the cultural - linguistic barrier hampered the universal application of psychiatric terminologies. min states : it is problematic that our country s psychiatrists rely solely on theories of western medicine in treating our country s patients. socio - cultural factors that cause our patients mental illnesses are different from those of (western) societies. (our patients) manifestation of symptoms, ways of expressing them, and methods of treatments can not be separated from the traditional attributes of our family, society and culture. more to the point, genetic and constitutional difference may not be fully conceptualized by a western standard. our country is developing into a western industrial society, and the term hwa - byung is becoming less familiar to most koreans. however, the socio - cultural attributes of our traditional society will continue to have their repercussions beneath the rapidly changing environment on the surface (min 1986, p. 653). it is problematic that our country s psychiatrists rely solely on theories of western medicine in treating our country s patients. socio - cultural factors that cause our patients mental illnesses are different from those of (western) societies. (our patients) manifestation of symptoms, ways of expressing them, and methods of treatments can not be separated from the traditional attributes of our family, society and culture. more to the point, genetic and constitutional difference may not be fully conceptualized by a western standard. our country is developing into a western industrial society, and the term hwa - byung is becoming less familiar to most koreans. however, the socio - cultural attributes of our traditional society will continue to have their repercussions beneath the rapidly changing environment on the surface (min 1986, p. 653). min did not propose overcoming the limitations of his research by improving his interviewing skills. instead, he expressed his dissatisfaction with the standardized psychiatric disease categories, which are american in origin. because he believed that modern psychiatry is too entangled in its own cultural origins, he found the identification of hwa - byung elusive. min continued to express his criticism of the limits of psychiatric language throughout the early 1990s. given this predicament, min longed to find what he considered he felt that korean psychiatrists could not consider the development of symptoms, expressiveness, and the treatment without digging thoroughly into korean family structure and socio - cultural factors. inasmuch as psychiatrists need to know an individual patient s deep - rooted life stories for treatment, the so - called uniquely korean way of life should be examined by (korean) psychiatrists in order to design the appropriate treatment. this partially explains why min became interested in han (), the supposedly korean way of holding grudges and experiencing anger. according to min, hwa - byung and han have an etiological relationship. interviewing 146 outpatients who visited the clinic of psychiatrics at yonsei severance hospital to treat their hwa - byung, he was able to question 125 about their han, and 117 answered that han, to some degree, is relevant to hwa - byung (min 1991, p. 1192). unpleasant experiences in life, min argued, cause either hwa - byung or han. the difference mostly lies in time duration and the inclusion of socio - political vicissitudes. whereas hwa - byung addresses comparatively recent losses and the despair of an individual, the causes of han stem from decades ago, such as personal difficulties due to japanese colonization (19101945) or the korean war (19501953). the most frequently reported emotional reactions among hwa - byung with han patients are mortification, frustration, nihilistic mood, anxiety, and regret. (min 1991, p. 1189) although han helped to explain the origins of hwa - byung, min realized it caused other problems with his research framework. for instance, those who have han without any hwa - byung would need to be further examined to elaborate on this etiological relationship. the impact of stress on han might provide another meaningful point of reference for understanding the relationship between han and hwa - byung. the comparison between han and chng, another indigenous term for the korean feeling of emotion, should also be examined. despite the need for further research, min never hesitated to conclude that hwa - byung can be said to be a pathological condition of han resulting from the failure to overcome it in the long term min felt that han could provide an interpretative frame for understanding koreans collective responses to the accumulated plight. he viewed han as a uniquely national (hanguk minjok,) expression of suffering (min 1991, p. 1195). to properly treat this problem, he called for an ethnic psychiatry that deals with the korean nation s neuro - psychiatry (minjok chngsin ihak). min s elaboration of han as an etiology for hwa - byung continues to be quoted by both psychiatrists and doctors of traditional medicine.7 today, min s work is recognized as playing a significant role in establishing han as an icon of the uniquely korean psychological state. the growing number of studies of han produced by korean historians, theologians, and literary critics up until the 1990s have provided a substantial repertoire for min to argue the etiological significance of han., literary critics began to describe han as the most prevalent theme of korean literary expressions. from the oldest poem to the most contemporary novel, han best exhibits korean s deep - rooted emotional foundation (chn 1993). minjung theology, an indigenous christian theology that came out of the korean human rights movement and social activism during the 1960s, also interpreted han as that which evolved from the korean experience of the oppressed (lee 1994 ; son 1984 ; kim 1994 ; park. studies on korean music trace the origin and modification of sound that expresses han (willoughby 2002). inquiries into korean shamanism never fail to point out that han became the indispensable cause and result of being drawn to shamanism (choe 1991, 1994 ; kim 1999). it is interesting to see that different avenues of korean discourse on han share a twofold desire to situate han in a specific time and place while simultaneously universalizing it. for instance, ko n, a well - known poet and thinker whose ideas represent major claims of the nationalist movement in korean literature, put the origin of han in ancient korea, in kochosn (, circ.1000108 bce), and surveyed han s enduring manifestation through the socio - political vicissitudes in the period of the three kingdoms (circa 57 bce668 ace), the kory (, 9181392 ace), and chosn dynasties (, 13921910 ace). in parallel with han s historicity han is compared with the chinese idea of hen (), the mongolian feeling of horosul, the manchurian expression of this comparative approach, in a sense, puts han in a broader context by encompassing other peoples experience of suffering. han needs to go beyond korea s geo - political boundaries to resonate with other expressions of the oppressed. in other words, these discussions on han from the non - psychiatric disciplines expose the fact that the korean elaboration of koreanness is paralleled by the desire to go beyond the autochthonous. the idea of the indigenous requires a broader register for comparison and circulation. in parallel, the studies on the indigenous conditions for mental health were not entirely oriented toward domestic demands. in retrospect, min confessed that hwa - byung was welcomed more by international audiences than by domestic listeners. psychiatrists abroad found a korean case of culture - bound syndrome meaningful (min 2009a, p. 219). in addition, min acknowledged that american psychiatrists research prior to his own studies actually motivated him to take the initiative to report hwa - byung to global readers. min viewed keh - ming lin s article published in the american journal of psychiatry in 1983 as the first international report on hwa - byung (lin 1983). how come an american psychiatrist is reporting about korean hwa - byung ? he wondered (min 2009a, p. 217). feeling challenged by lin, min began to collect clinical cases about hwa - byung. min s reputation has flourished along with his theories related to hwa - byung. from the late 1990s onward, min has presented his work at numerous conferences held by international societies, such as the association of korean - american psychiatrists, the american psychiatric association, the world psychiatric association, the pacific rim college of psychiatrists, the world association of social psychiatry, and the world congress of cultural psychiatry (min 2009a, pp. the fourth edition of the dsm (dsm - iv) recognized hwa - byung as a culture - bound syndrome in 1994. following this success, the goals of korean psychiatric research have become focused on gaining even more international recognition. biological research, anger - related brain research, development of hwa - byung scale, and drug tests have aimed to verify hwa - byung s autonomous existence (min 2009b, pp. min has put more emphasis on characterizing hwa - byung as an anger disorder, which may be applicable to patients across cultural - ethnic boundaries (min 2009a, p. 176). min s statistically sophisticated research in 2009 argued that hwa - byung could be meaningfully distinguished from symptoms of major depression and should therefore be elaborated on under another novel name, such as an anger disorder (min 2009b, p. 77). he states, hwa - byung, according to biological, psychological, and social model, can be viewed as a psychiatric barrier that has both emotional and somatic / behavior symptoms relevant to anger. hwa - byung can gain a name and be conceptualized in a dsm clinical category (min 2009b, p. 83). min has called for further investigation of attributes associated with anger that are found in many cultures, such as ataques de nervios among hispanics (min 2009a, pp. ironically, min s earlier passion to make the koreanness of hwa - byung visible has now led to his willing extinction of that distinction. beginning with a passion to articulate the culture - bound attributes of hwa - byung in the early 1980s, min ended up with a culture - neutral conceptualization of hwa - byung in the twenty - first century. in his conceptualization of hwa - byung, min favorably referred to perspectives of traditional medicine. min s earlier survey reveals that doctors of traditional medicine were mostly reluctant to accept hwa - byung s close relationship with factors of korean culture, such as han, while unanimously believing the autonomous status of the illness as a clinical entity. korean psychiatrists, in contrast, paid more attention to indigenous culture as an etiological factor, yet were reluctant to define hwa - byung as a clinical category (min. the discussion below turns to doctors of traditional medicine who adopted changing strategies to help establish hwa - byung as a meaningful diagnostic category. from the early 1990s onward, hwa - byung emerged as a significant research topic of traditional medicine.8 psychiatrists endeavors to examine indigenous etiological factors seemingly challenged the professionals of traditional medicine (kim. more to the point, traditional medicine itself became more specialized during this period, and thus, rushed to establish disciplines of subspecialty, such as pediatric, gynecological, and psychiatric associations.9 the journal of oriental neuropsychiatry, for instance, was first published in 1990. the ascendancy of depressive disorders on a global scale has also motivated traditional medicine to further delve into hwa - byung. according to a government survey, the prescription of antidepressant medication in south korea increased by 52.3 % between 2004 and 2008. nearly a fifth of women in south korea are reported to suffer from depression at some point in their lives, and female use of antidepressant medication was double the male use between 2004 and 2008 (ynhamnyus, july 26, 2009). accordingly, the korean society for depressive and bipolar disorders was first established in 2001.10 traditional medicine s growing interest in hwa - byung should be understood in this milieu of pressing needs to resolve emerging mental health issues in both domestic and global settings. the number of articles containing the word depression or hwa - byung in the journal of oriental neuropsychiatry increased substantially after 2000. following the initiative of korean psychiatrists, the specialization of traditional medicine, and the advance of depression, more and more clinics marketed their expertise in treating hwa - byung. depression and hwa - byung in their korean nomenclatures share a common character, yu (), which has long been a significant etiological concept in traditional medicine in east asia. translated into constraint, the term yu primarily implies something that is stuck, or unable to move or change, because of a blocked qi movement. in east asian medicine, the pathological condition of yu can frequently be a cause of fire, and this relationship between yu and fire is captured in another common name for fire illness, ulhwa - byung (yuhuobing in chinese). as volker scheid demonstrates well in this volume, thus, yu can not be succinctly reduced to any single illness or disease category. the rich textual repertoire and multiple clinical implications of yu actually empowered korean doctors of traditional medicine to enter the discourse surrounding hwa - byung. as latecomers to hwa - byung studies, the professionals of traditional medicine sought primarily to establish their unique diagnostic and clinical approaches by fleshing out the traditional ideas about yu and fire (hwa / huo) (j. kim 2007, pp. one of the most well - known hwa - byung specialists, argued that traditional medicine provides a better explanation of the four main questions about hwa - byung : (1) why hwa - byung is caused by upset, oppression, resentment, anger, and loathing ; (2) why women are more vulnerable to hwa - byung ; (3) why symptoms of hwa - byung seem similar to the traditional discourse on fire ; and (4) why the pathogenic process involves a chronic disease.11 while elaborating on those four issues, kim put forth the liver as central to the pathology of hwa - byung. whereas korean psychiatrists take the heart as the symbolic locus of hwa - byung, thereby linking it to a neuropsychiatric problem, kim differentiated his perspective with the liver (kim and whang 1994, pp. kim explained that once the liver loses its distinctive function to regulate the activities of qi, as the result of excessive anger and frustration, the constraint of liver - qi () tends to occur. if the liver - qi is blocked, then the qi probably transforms into heat - fire (), thereby leading to an upward counter flow () that resembles the symptoms of hwa - byung. kim argued that this explains women s fragility to hwa - byung. due to women s reproductive function, the liver, spleen, kidney, and two jingmai, chongmai () and renmai (), become particularly important for a woman s health. when women reach menopause, both jingmai become weak, the qi of the kidneys decreases, and the internal qi of fire becomes easily agitated. this is called the emptiness of kidney and agitation of fire () (j. kim and whang 1994, pp kim applied other pathologies, such as rising heart fire (), excessive liver fire (), and flaming stomach fire (), to explain fire as an agent that determines other disease states (kim and whang 1994, p. 11). he argued that fire is the qi of upward tendency (), always drying up yin - qi, thereby creating the wind (), moving the blood (), and causing tumors. furthermore, fire interacts with the heart, and therefore the evil factor of fire disturbs the integrity of the mind - spirit (). kim viewed hwa - byung as immoderate emotions that turned into excessive fire qi (). based on these terms and reasoning, kim argues that traditional medicine provides better pathological and etiological explanations for hwa - byung. to kim, it is an illness with its own unique pathological process, and hence, can not be equated to stress or hysteria. first, his wording of yin - yang and five phases directly refers to the chinese classic, yellow emperor s inner canon (huangdi neijing, inner canon hereafter), and its correlative construction of the human body. kim also relies on contemporary textbooks of korean traditional medicine, which put emphasis on inner canon s holistic worldview. kim s understanding of fire is definitely drawn from the fourteenth century s chinese physician, zhu zhenheng s (, 12811358) conceptualization of fire as an agent of inner physiology. zhu s idea of nourishing yin to balance excess yang was highlighted by kim through precious mirror of eastern medicine (tongi pogam, 1613), which is considered to be one of the first distinctively korean medical texts. precious mirror continues to be the major reference for contemporary korean doctors of traditional medicine. the last important reference for kim is today s traditional chinese medicine (tcm) textbooks from china, which are now available in korea. through his investigation of these textbooks zhangsessentials of medicine (), written by zhang lu (), who lived in seventeenth - century jiangsu china. previously, zhang had not been influential in korea, yet mediated by tcm textbooks, kim was able to draw on ideas from mr. for example, his interest in the manifestations of women s yin qi related diseases came from these textbook presentations of zhang. kim also relied on tcm textbooks from modern china for information about fire s physiological and pathological functions. perhaps most importantly, kim utilized the tcm textbook methodology of pattern recognition and treatment determination, or bianzheng lunzhi, as we will see below. it was not uncommon for korean doctors of traditional medicine during the 1990s to refer to textbooks, journal articles, and monographs from taiwan and china. the textual resources for a korean construction of hwa - byung, thus, include korean psychiatrists early research on hwa - byung, quotes from chinese classics like inner canon, a well - known korean text like precious mirror (which summed up a fourteenth - century chinese elaboration on fire), and contemporary tcm textbook views of fire as a physiological process. korean medicine doctors, as latecomers to the treatment of hwa - byung in korea, benefitted from tcm s resources, thereby enhancing the rationale of using the traditional in treating hwa - byung. relying on the language of modern tcm from china, his research seemed to lack a specific korean ethnic distinction. it became obvious that kim s strategic composition of hwa - byung has a limit in gaining an audience outside korea. illness visible to international audiences and actively circulated his work outside korea, kim worked with hardly any non - korean psychiatrists, or with any chinese or japanese doctors of traditional medicine. kim recognized the weakness of articulating hwa - byung solely based on the textual language of traditional medicine. to overcome these limitations, kim turned to objective measurements, which he thought would eventually demonstrate traditional medicine s successful diagnosis and treatment of hwa - byung and thereby gain a broader audience. kim underlines, no matter how diligently you may explain hwa - byung, if it is not tested by biological and scientific methods, the research can hardly be widely credited (kim 2007). for instance, in the early 2000s, kim took a position that viewed hwa - byung as a phenomenon related to stress, which enabled him to measure the development of symptoms using an officially acknowledged scale (lim. relying on and slightly modifying the gars (global assessment of recent stress), kim applied more advanced statistical methods. forty - eight outpatients were surveyed, and their answers were analyzed by paired sample t test. kim referred to t. h. holmes s the social readjustment rating scale, published in 1967, and camile lloyd s life events and depressive disorder reviewed : events as predisposing factors, published in 1980.12 kim emulated the scale designs of psychological and psychosomatic research. during the 2000s, kim shifted away from stress toward depressive disorders. by equating yu with depression, kim found an effective way to objectify hwa - byung. kim s growing emphasis on a standardized diagnostic manual of traditional medicine suitably exhibits the overall trend to identify yu with depression in korea. after years of interdisciplinary collaboration, kim was able to develop a hwa - byung diagnostic interview schedule (hbdis), which was supported by more sophisticated statistical methods. verified with validity and credibility, his scale was approved by the korean psychological association in 2004. based on this scale, kim was able to make his own argument with a more competent tone (lee. although earlier research in psychiatry described hwa - byung as a combination of multiple symptoms or a strong manifestation of somatic disorders, kim underlines that more than 70 % of his hwa - byung sample patients turned out to be diagnosed according to dsm - iv s major depression disorder and dysthymic disorder (lee. 2005, p. 12). kim s study of hwa - byung as a major depressive disorder also drew on tcm research models from china, in particular, using the clinical standardizations of pattern recognition and treatment determination (bianzheng lunzhi, pattern recognition karchmer has demonstrated, since the late 1950s, pattern recognition has been central to codifying the uniqueness of chinese medicine while also providing a technique, often unacknowledged, for integrating chinese medicine with biomedicine (karchmer 2010, pp. korean practitioners have also recognized the significance of pattern recognition, and since 1995 they have been working on their own set of standardizations, called oriental medicine standard - prime, which is now marketed online.13 in his 2007 article, kim compared 17 hwa - byung - only patients with 20 patients from the hwa - byung and major depression double diagnoses group. for this sample selection, kim used standardized scales, such as hbdis, scid, oms - prime, the hamilton rating scale for depression (hrds), and the montgomery - asberg depression rating scale (madrs). kim examined socio - demographic data and then analyzed two groups pattern recognition. he found no significant differences in the distribution of patients according to major patterns between the two groups. examined by oms - prime, both groups have a tendency to show deficiency of yin and yang of the heart most frequently. based on this analysis, kim concluded that hwa - byung is a syndrome that has many different symptoms, but there is no difference between the hwa - byung group and hwa - byung with major depression group (double diagnosis) in terms of standardized pattern recognition. because kim s research aimed to demonstrate overlaps where others, such as min and other korean psychiatrists, see differences, kim argued that his approach to the study of hwa - byung could be a new model for researching depression in korea. kim added that koreans have a tendency to experience more somaticized symptoms of major depression and express the depression through the language of hwa - byung (kim. he suggested : although hwa - byung and depression are often considered as a single and separate disease entity (chilbyng), if traditional medicine s method of pattern identification is applied, hwa - byung and depression can be conceptualized as a series of various symptoms respectively, but not separate illness entities. this is due to traditional medicine s and western medicine s fundamentally different approaches to disease. and this indicates that western medicine requires complementary research on symptomatic approaches, whereas traditional medicine necessitates further understanding about a disease - centered approach. 2007, p. 12) although hwa - byung and depression are often considered as a single and separate disease entity (chilbyng), if traditional medicine s method of pattern identification is applied, hwa - byung and depression can be conceptualized as a series of various symptoms respectively, but not separate illness entities. this is due to traditional medicine s and western medicine s fundamentally different approaches to disease. and this indicates that western medicine requires complementary research on symptomatic approaches, whereas traditional medicine necessitates further understanding about a disease - centered approach. 2007, p. 12) although kim contrasted traditional medicine with its western counterpart, he never posited traditional medicine as an alternative or complement to a psychiatric (scientific) approach. rather, kim strongly embraced the language of psychiatry, psychology, and statistics, thereby portraying his own version of traditional medicine that was well synchronized with the objective standardizations of biomedicine.14 the korean identification of hwa - byung with depression has been further enhanced by a series of psycho - pharmaceutical research about traditional prescriptions. published mostly after 200 0, those articles equated depression with yu - related illness, to which hwa - byung also belongs. by identifying depression with hwa - byung, those articles were able to apply the experimental model of antidepressants to korean traditional prescriptions, thereby objectively elaborating hwa - byung as a medical entity. chung, for instance, examined coptis decoction to resolve toxicity (huang lian jie du tang), one of the well - known prescriptions for hwa - byung in south korea. chung states that in order to treat depression, traditional medicine can rely on prescriptions that treat fire (pathologies) (chung and kim 2003, p. 2). in addition to chung s finding, substantial research has been carried out since 2000 to emulate the psycho - pharmaceutical research about antidepressants.15 the previous analysis traces the way hwa - byung has been defined, diagnosed, and treated by both korean psychiatrists and doctors of traditional medicine since the 1970s. to make hwa - byung sensible in medical discourse, professionals across fields have utilized various linguistic and numerical resources and have strategically modified hwa - byung s relationship with depressive disorders. needless to say, hwa - byung s autonomous status as an illness entity is related to the authorization of medical professionals and their career building efforts. kim began his research to differentiate traditional medicine s unique approach to hwa - byung in terms of both diagnosis and treatment (kim and whang 1994). as time went by, kim relied more on quantitative methods and less on the language of traditional medicine, aiming to objectively demonstrate hwa - byung s autonomous existence. the advance of depression as a global disease stimulated traditional medicine s equation of yu with depressive disorders, thereby providing a link to interpret hwa - byung as the korean version of depression. although both kim and min agreed that more quantitative and interdisciplinary research was indispensable to fully understanding hwa - byung, min and kim diverged in predicting the future of hwa - byung in a global context. while min argued for transforming hwa - byung into an anger disorder, thereby differentiating it from depression (min 2011, 2012), kim was drawn to equating the illness with depression to a certain degree. both min and kim successfully responded to the rise of cultural psychiatry, thereby making the korean illness visible to international audiences. although the idea of a uniquely korean malady first encouraged min and kim s research, both of them eventually distanced themselves from the ethnic grounding of hwa - byung. although min first celebrated the locally specific experience of the korean psyche, thereby revealing the cultural bias of american psychiatry, he eventually came to argue for a universal label for hwa - byung that goes beyond korea s own cultural - geographical boundary. in a similar vein, kim first delved into the millennium - old textual heritage of traditional medicine, drawing on the language of the inner canon, renowned chinese physicians in the thirteenth century, centuries - old korean medical scholarship, and modern tcm. however, kim strongly desired to have hwa - byung recognized by contemporary psychologists, pharmacologists, and psychiatrists ; thus, he had to remake hwa - byung into an entity that could circulate across cultural, national, and disciplinary boundaries. what medical research about hwa - byung tells us is that there are no essentially korean features of the mental disorder. rather, medical professionals reports on koreanness illustrate the process through which a biography of the local has emerged and been modified, disclosing its (dis)juncture with global trends. in spite of its unstable foundations of indigenity, hwa - byung continues to represent a series of recent publications about hwa - byung for popular audiences exposes the way in which experts academic research, epitomized by min s and kim s cases, is translated into non - academic terms. tracing immediate and personal voices of hwa - byung specialists outside academia, the next section asks, what does the continuing focus on the concept of hwa - byung mean for korean doctors ? simply put, why does hwa - byung continue to be popular in contemporary korea, given the lack of any explicit consensus among doctors ? since 1997, almost a dozen popular texts about hwa - byung have been published. min and kim s research articles were edited then published in monographs in 2009 and 2007, respectively. in addition, since 2006, more than five new volumes about hwa - byung were introduced by doctors of traditional medicine. with their clinical experience and personal endeavor, these primers aptly expose hwa - byung specialists diagnostic strategies and methods of treatments. as non - academic publications however, their (dis)similar voices enable us to view the various ways in which the research initiatives of min and kim are emulated and modified by other medical experts, thereby allowing consideration of the function of hwa - byung as a textual label in expanding and limiting the scope of contemporary management of emotional disorders. four authors and their texts will be examined in the below. hwang i - wan, as a well - established hwa - byung specialist, has treated patients for more than 40 years. he served as chair of the department of neuro - psychiatry at the hospital of traditional medicine at kyung hee university and as president of the korean society of oriental neuropsychiatry (daehan hanbang singyng chngsin kwahakhoe) (hwang 2011). hwang acknowledges that hwa - byung has never signified a single disease category in traditional medicine ; however, the term has long been signified a disease name in korea (hwang 2011, p. 11). as hwang co - authored a couple of articles with kim, hwang s definition of hwa - byung and explanation of symptoms quite overlaps with kim s earlier findings.16 choe yung - jin and his co - authors begin their monograph by defining hwa - byung as uniquely korean disease, then ascribed the major cause to the socio - cultural environment of the country. choe argues that hwa - byung has accompanied korea s long history ; thus, traditional medicine that has been a part of koreans lives for millennia is better situated to deal with the illness. as an alumnus of kyung hee university, one of the top school of traditional medicine in korea, choe shares a common institutional background with hwang and kim. accordingly, the major reasoning and rhetoric choe develops for diagnosis and treatment is not radically different from that of kim and hwang. yun yong - sp, the third author, majored in pharmaceutics at chungnam university in korea, then graduated from nanjing university of medicine () in china in 1997. as the korean government acknowledges only the graduates of domestic institutions of traditional medicine for licensure, yun is not allowed to run his own clinic in korea. while managing his own apothecary, however, he has actively expressed his opinions through printed media and an internet blog. in his second book about hwa - byung, yun explained the illness by heavily relying on research about stress, strongly suggesting a holistic approach, and introducing teachings of zen buddhism. if the roots of hwa - byung and stress are associated with unfulfilled human desires, the ultimate treatment should come from a well - governed mind control. interestingly, yun often criticizes mainstream korean traditional medicine s narrow understanding of major chinese classics. finally, but not least importantly, kang yong - wn introduces culturally embedded counseling as a major therapy for hwa - byung. kang agrees with kim in viewing the illness as a korean manifestation of depression. criticizing dsm - iv for its superficial approach to hwa - byung, kang highlights that the illness represents a collective trauma that is deeply associated with korea s unprecedented struggle into modernity. employing terms like han and chng, kang illustrates that koreans have not had enough opportunity to treat the emotional problems caused by fast economic development, a competitive educational system, and political vicissitudes (kang 2011, p. 252). the radical division between elite language (chinese in the past and english in the present) and vernacular. it is kang s view that the elites in korean history (at least since seventeenth century) governed their people by monopolizing the written language, degrading any verbal expressions that could not be transformed into classical chinese. although the korean alphabet became the national language in the early twentieth century in line with the growing nationalism and colonialism, yet the gap between written and spoken languages deterred korean medical experts from fully grasping the expressiveness of the bodily complaints by kang argues for the possibility of turning to korean vernacular with an in - depth knowledge of its semantics and hermeneutics to recover the locally inspired technique of therapeutic colloquiality. authors of recent popular volumes about hwa - byung share a common ground in utilizing the illness label to foster their own clinical intervention. almost no one denies that hwa - byung is a uniquely korean phenomenon (hwang 2011, p. 11 ; choe. is fundamentally coined with korean locality, kang argues that doctors should diagnose not merely an individual patient but rather the entire all of these views overlap with min s earlier intention to find out the cultural root of hwa - byung in korean patients. given the emphasis on indigenousness, however, hwang, choe, and yun do not specify how the unique elements of korean culture are intertwined with the cause, manifestation, and treatment of the illness. rather, they tacitly equate hwa - byung with stress, thereby establishing a means to utilize theories around stress in rationalizing hwa - byung for lay audiences. for instance, hwang portrays hwa - byung as a state of excessive emotion, particularly caused by anger and anxiety. although intended as a discussion of hwa - byung, more than a half of his book depicts skillful management of stress in everyday life. each chapter fleshes out how stress causes circulatory, respiratory, digestive, endocrine organ, musculoskeletal, skin, genito - urinary, and children s diseases. based on this organization, hwang s explanation competently utilizes a range of biomedical terminologies. except for the brief introduction to his preferred prescription, (p. 64) and his short comment on constitutional medicine choe puts both hwa - byung and stress in his title and regards them as the root of hundreds of diseases. the organization of choe s book does not distinguish the symptoms and treatment of hwa - byung from those of stress. by taking stress as a medium, choi relates hwa - byung with other diseases such as high - blood pressure, obesity, stroke, learning disability, sexual impotence, irritable colon syndrome, and other chronic illnesses. s personal inclination to zen buddhism, his text provides more general advice to control human desires and to cultivate one s mind. unlike the other three authors, kang views hwa - byung as a korean manifestation of depression. yet, kang overlaps with other authors in competently employing biomedical terms for his explanation. in summation, recent popular texts about hwa - byung are consonant with the earlier studies of min and kim. all of the four exemplary authors agree regarding the indigenous nature of hwa - byung and compose the symptoms and treatments of the illness by referring to the dsm - iv definition, stress studies, and depression research. kim, in his earlier studies, intended to benefit from stress studies by emulating the measurement scale (lim. kim s desire to scientize hwa - byung is also resonant with the authors strategic management of bio - medical terms and weak elaboration of traditional medicine. interestingly, the hwa - byung diagnostic interview schedule (hbdis), which was newly designed by kim, has not been well received by the examined authors. in addition, kim s argument to view hwa - byung as korean manifestation of depression found only one advocate, kang. given this adjusted composition of hwa - byung by doctors of traditional medicine, more thought should be given to the role the illness label plays in criticizing the contemporary landscape of korean medicine. if stress and depression aptly replace the manifestation of hwa - byung, why is the label still being used not only among patients but also among health specialists ? what kinds of desires and complaints are associated with the contemporary use of hwa - byung as a meaningful disease name ? one of the most explicit demands by the above authors is to include patients life narratives into a treatment process and establish a better relationship between doctor and patient. treating hwa - byung primarily implies fully delving into patients life stories, and accordingly, all the authors take patients first - hand narratives as a meaningful starting point for treatment. for instance, hwang begins his book by narrating more than 31 cases that appealed for or were diagnosed as hwa - byung (hwang 2011, pp. although they can be viewed as general problems of family conflicts, career failures, death of a beloved, and economic loss, every case has its own unique manifestation. to understand hwa - byung more fully, it is indispensable for doctors to listen to the stories carefully and to respond to them accordingly today s clinical environment is much too specialized and standardized, alienating both patients and doctors (hwang 2011, appendix 4). he states, the hesitant patient who does not know which department s / he should go for her / his health concern exemplifies one case of human alienation. today s clinics forget the wholeness of human beings and tend to serve as a repair shop. besides, the more medicine develops, the more people are alienated. the clinic as a part feeder becomes corporatized and automatized (hwang 2011, appendix 4). as a solution for hwa - byung, hwang envisions better clinical communication that goes beyond simple questionnaires, tables, and numbers. yun agrees with hwang in emphasizing the significance of dialogues between a healer and a patient. as yun is not a licensed doctor of traditional medicine, the range of conversation yun suggests includes more general principles of self - control, psychotherapy, and religious teachings. interestingly, yun allots almost one - third of his book to introducing the 91 stories of zen (91) as a resource for soothing hwa - byung (yun 2007, pp. although yun does not specify how the zen stories had impact on treating the illness, he argues that the teaching of zen is a reliable means to control stress and hwa - byung. yun believes the stories of illness can only be cured by another set of narratives ; hence, the resonating healing power of zen messages needs to be introduced. he argues : to sum up, our life is nothing but stories, and depression is also a story. it is clear that treatment should be a story (kang 2011, p. 175). his narrative - centered approach calls for counseling that is based on a refined understanding of korean vernacular. kang attempts to analyze the linguistic convention of ordinary koreans, not that of elites, to develop medicine carried out by our own language, healing of counseling by our own language (kang 2011, p. 189). according to kang, colloquial korean puts emphasis on verbs, not nouns, which indicates the language s full capacity to express human dynamics. adjectives are rich ; hence, the concrete details of individuality in things and people are aptly expressed. furthermore, the use of the (non)substantive, a word order that highlights objects, the weakness of making logically connected long sentences, the development of immediacy and sensitivity, the lack of articles and prepositions, the significance of continuation, the qualitative approach, euphemism, and playfulness characterizes the unique nature of colloquial korean (kang 2011, pp. what should be noted here is kang s problematization of the disjointed relationship between language and experience, which reflects the failure of the korean medicine to fully come to grips with the expression of patients suffering. to reach the root of hwa - byung / depression, doctors, as healers, need to develop well - trained listening skills with an empathetic mind. kang insists that inter - subjectivity between doctor and patient will help establish a more corresponding and meaningful relationship in clinical encounters. kang s call for vernacularization of korean clinical language is resonant with min s claim for a koreanized psychiatry in the late 1980s. twenty - five years after min s first call for indigenization, and even after min s decision not to emphasize any ethnic attribute of hwa - byung, opting for a much universal term, anger disorder, kang regurgitates the turn toward indigenousness, thereby conjuring up the alternative in treating koreans emotional disorders. both min and kang hope to understand the fuller and deeper meaning of hwa - byung, which requires an articulation of koreanness in medicine. to kang, this endeavor implies the recovery of clinical colloquiality in korean vernacular. to a certain degree, the underlying desires to make hwa - byung visible parallels a rising demand to make patients stories known and establish them as a clinically meaningful repertoire for treatment. the unique, individual, and irreducible elements of patients experiences need to be fully acknowledged and analyzed with respect. a recent report by los angeles times shows another hunger for making untold stories told. cho man - chul, who has run a mental health program for asians and pacific islanders in los angeles for more than 20 years, found out that korean immigrants who called themselves as hwa - byung patients held on to their experiences of the los angeles riot on april 29 1992. showing a range of symptoms, such as paranoia, delusion, depression, and anger, korean immigrants have accumulated their unexplained resentment and anxiety for dozens of years. instead of moving on, they turned their anger inward, made it a part of their narrative for mundane, and continued calling it hwa - byung (banks 2012). cho put forth the significance of counseling, the process of speaking out and listening to, attempting to make the unaccountable accountable. although cho trained in western psychiatry, he gradually became a representative of hwa - byung treatment. cho insists that treating hwa - byung is nothing but establishing a long - term and reliable relationship of talking and listening. as a listener, cho not only has felt a responsibility to record patients stories, but also hopes to make those stories available for later generations. that is why cho first contacted the reporter to listen to the patient stories he has kept for 20 years. contemporary medical discourses on hwa - byung reveal neither the success of biomedicine nor the essence of korean culture. rather, the project of defining a uniquely korean malady reflects a desire among medical professionals to make the indigenous meaningful, thereby guaranteeing a tool for gaining circulation and foreign recognition. a closer look at the studies of korean doctors of traditional medicine and psychiatrists reveals how temporary and unstable the ethnic label was in their portrayal of hwa - byung. the idea of the uniquely korean emotional illness was first conjured up as a response to the rise of cultural psychiatry. doctors of traditional medicine also stressed the korean nature of the illness, arguing that their profession s familiarity with korean culture made them better qualified for effective treatment. however, after years of research, korean medical professionals are disinclined to argue for the ethnic attributes of hwa - byung. the korean distinction as an analytical unit was favorably employed at first, only tentatively used, and then erased from the discourse. the idea of the uniquely korean attributes of hwa - byung has never been established by a clear consensus. despite this fragility, however, the label hwa - byung continues to be utilized by medical professionals as the term partly helps them to account for patients life stories more fully and immediately. embracing narratives as a therapeutic resource, a group of hwa - byung specialists is criticizing mainstream medicine s lack of colloquiality and suggesting better techniques of patient - doctor dialogue. interestingly, the label of hwa - byung signifies a turn toward the indigenous initiative, and now opens room for korean doctors to engage with more general concerns of medicine, such as to respect the stories of illness, and to become better physician listeners. | this article analyzes the process of the making of hwa - byung (fire illness) an internationally recognized term for a korean emotion - related disorder. to index hwa - byung as a valid condition within professional medical circles, koreans draw on both the traditional idea of constrained fire and the dsm s modern identification of depressive disorders. examining the research on hwa - byung since the 1970s, conducted by both korean psychiatrists and doctors of traditional medicine, this article demonstrates how inextricably conceptions of korean - ness in medicine have been tied to the right positioning of korea in a global context. the project of defining a uniquely korean malady reflects the desire of medical professionals to make the indigenous meaningful, thereby guaranteeing a tool for gaining circulation and foreign recognition. studies of hwa - byung since the 2000s have in many ways been a reflection of the endeavor to interpret patients narratives as a therapeutic resource. some hwa - byung specialists have dealt with patients stories of illness over time and argue for establishing better techniques of clinical communication. whereas the label of hwa - byung initiated the indigenous turn during the 1980s, now the term succinctly responds to the recent trend of exploring the colloquial dimension of medicine. this also demonstrates the way in which hwa - byung has been (dis)assembled at the junction of global and domestic flows. |
lung cancer is the most frequent cause of cancer mortality in both men and women. there are 2 main types of primary lung cancer, which are classified according to cellular population involved : non - small cell lung cancer (nsclc) and small cell lung cancer. clinical risk factors for malignancy are age, a history of smoking, hemoptysis, and previous malignancy. computerized tomography and positron emission tomography - computed tomography (pet / ct) are crucial for the diagnosis and follow - up of patients affected by lung cancer [46 ]. the aim of this study was to use mdct and hybrid pet / ct systems to determine whether net enhancement and suvmax were correlated with tumour size and cytology in patients affected by nsclc. our study could thus be of prognostic significance, and could lead to a more appropriate use of surgical adjuvant treatment and better treatment outcomes. we retrospectively reviewed patients with nsclc who underwent staging with total body 16-slice multi - detector ct scanning (brilliance philips) and with pet / ct (biograph 16 siemens medical solutions) over a period of 2 years. we studied a selected group of patients affected by n0n1 and m0 disease and with lesions larger than 3 cm. the final study group consisted of 38 patients (30 men, 8 women, mean age 70 years) with a pulmonary lesion measuring between 3 and 7 cm. all patients underwent multidetector computed tomography (mdct) (brilliance 16, philips medical systems, best, the netherlands) scanning before and after contrast injection using the following technical parameters : 1.5 mm collimation, 120 kvp, 250 ma, pitch 0.9, rotation time 0.5 sec, 2 mm reconstruction thickness, 1 mm interval, and standard reconstruction algorithm. using a biphasic protocol, 120 ml of contrast medium (350 mg of iodine per milliliter) were automatically injected in an antecubital vein : 80 ml at a flow rate of 2 ml / sec, followed by 40 ml at a flow rate of 1.5 ml / sec. a saline bolus of 40 ml at a flow rate of 1.5 ml / sec was injected after contrast media. net enhancement was calculated by drawing a region of interest (roi) that covered about half the diameter of the lesion at the equator, but avoided calcified, cavitary and necrotic areas. all measurements in hounsfield units (hu) were obtained from the mediastinal window images to minimize partial volume averaging. density was calculated before (ct pre) and after contrast medium injection, considering average density of the lesion (ct post average). maximum density (ct - post max) and net enhancement were calculated by subtracting ct - pre values from ct - post average values. all patients underwent fine needle aspiration biopsy (fnab), which is a well - established, safe technique for the diagnostic work - up of lung lesions. the sensitivity of fnab for the diagnosis of lung cancer ranges from 56% to over 90% and specificity is close to 100%. in almost all these studies, the overall positive predictive value was nearly 99%. while the false positive rate was generally less than 1%, a negative result is less reliable, with most studies reporting a false negative rate of around 10%. the injected dose of 18f - fdg varied between 350 and 450 mbq, depending on the patient s weight. in patients with bmi 25 received 400450 mbq. after patients had fasted overnight, we verified that their blood glucose level was below 140 mg before injecting the tracer. during the 60-min uptake phase we used an integrated pet / ct scanner (biograph 16 siemens medical solutions) consisting of an ultrafast ct scanner with a 16-row multislice detector system, and a pet scanner equipped with a full - ring lutetium oxyorthosilicate system (lso) with a crystal size of 44 mm. emission data were acquired for 6 to 8 bed positions, typically from the base apex of the skull to the upper thigh, and acquisition time was usually 3 min / bed position, resulting in a total pet scan time of approximately 2025 min (7 or 8 bed positions), with axial image planes at a 16.2 cm axial field of view per position. the protocol included a low dose (120 kv ; 95 ma) non - enhanced ct scan first for attenuation correction, and the 3d - whole - body pet from the base of the skull to the upper thigh. pet images were reconstructed by using an iterative algorithm (ordered - subset expectation maximization : 2 iterations, 8 subsets on a 128128 matrix and with gaussian post - filtering of 5 mm). the reconstructed pet, ct and fused images were displayed by commercially available software (e - soft/, siemens medical solutions) in axial, coronal and sagittal planes by using a matrix of 128128 pixels for the pet and 512512 pixels for the ct and were analyzed by 3 experts in pet. the data obtained were examined in relation to the size and cytology of the pulmonary lesion. the data reported (tumour size, ctpre average, ctpost average, ctpost max, net enhancement suvmax, age, cytological results) refer to the 38 patients. the p - value was computed by transforming the correlation to create a t - statistic with 36 degrees of freedom. the confidence bounds are based on an asymptotic normal distribution of 0.5log((1+r)/(1r)), with an approximate variance equal to 1/(n3), with n=38. moreover, to gain more insight, we computed the correlation for each pair of variables, and for all combinations of tumour types. the results were subsequently analyzed for subsets of data with more than 10 samples, and with correlation r>0.500 and p 25 received 400450 mbq. after patients had fasted overnight, we verified that their blood glucose level was below 140 mg before injecting the tracer. during the 60-min uptake phase we used an integrated pet / ct scanner (biograph 16 siemens medical solutions) consisting of an ultrafast ct scanner with a 16-row multislice detector system, and a pet scanner equipped with a full - ring lutetium oxyorthosilicate system (lso) with a crystal size of 44 mm. emission data were acquired for 6 to 8 bed positions, typically from the base apex of the skull to the upper thigh, and acquisition time was usually 3 min / bed position, resulting in a total pet scan time of approximately 2025 min (7 or 8 bed positions), with axial image planes at a 16.2 cm axial field of view per position. the protocol included a low dose (120 kv ; 95 ma) non - enhanced ct scan first for attenuation correction, and the 3d - whole - body pet from the base of the skull to the upper thigh. pet images were reconstructed by using an iterative algorithm (ordered - subset expectation maximization : 2 iterations, 8 subsets on a 128128 matrix and with gaussian post - filtering of 5 mm). the reconstructed pet, ct and fused images were displayed by commercially available software (e - soft/, siemens medical solutions) in axial, coronal and sagittal planes by using a matrix of 128128 pixels for the pet and 512512 pixels for the ct and were analyzed by 3 experts in pet. the data obtained were examined in relation to the size and cytology of the pulmonary lesion. the data reported (tumour size, ctpre average, ctpost average, ctpost max, net enhancement suvmax, age, cytological results) refer to the 38 patients. the p - value was computed by transforming the correlation to create a t - statistic with 36 degrees of freedom. the confidence bounds are based on an asymptotic normal distribution of 0.5log((1+r)/(1r)), with an approximate variance equal to 1/(n3), with n=38. moreover, to gain more insight, we computed the correlation for each pair of variables, and for all combinations of tumour types. the results were subsequently analyzed for subsets of data with more than 10 samples, and with correlation r>0.500 and p<0.05. as shown in table 2, there were more male than female patients (n. 30 vs. n. 8), which reflects the prevalence of lung carcinoma in the population. adenocarcinoma (figure 2) accounted for approximately one - third of all lung cancers in our study, and is recognized as the most common histotype of lung cancer in many countries. overall, we identified a weak, albeit significant, correlation between suvmax and tumour size (r=0.323, p=0.048). there was no correlation among the pre - contrastographic density of the lesions, net enhancement, average post - contrast density, maximum density and size of lesions (table 3). the scatter plot of dimension versus suvmax with the linear regression is depicted in figure 3. in particular, we found that the correlation between suvmax and size was stronger for lesions larger than 31 mm (r=0.4515, p=0.0268). regarding the cytological classification, the correlation between tumour size and suvmax was slightly stronger in the case of adenocarcinomas (figure 5). this study was designed to evaluate whether suvmax and net enhancement can be correlated with nsclc in terms of size and histotype in order to assess how these parameters change with tumour size and cytology. we evaluated tumour mass dimension, ctpre - average, ctpost - average, ctpost - max, net enhancement, suvmax, age, and cytological data of 38 patients. recent studies have focused on the relationship between the suv and biological and molecular factors that influence cancer progression or glucose metabolism. malignant cells exhibit increased glucose metabolism and uncontrolled growth : elevated glucose metabolism and high levels of angiogenesis are both associated with increased metastatic potential and poor patient survival. however, as the tumour increases in size, the cells outgrow their blood supply. the subsequent reduction in the delivery of oxygen tumours can adapt to hypoxia by increasing the expression of glucose transporters and by utilizing anaerobic glycolysis a process mediated by hypoxia - inducible factors. some authors have identified a correlation between size and suv [1618 ], whereas others did not. we found a significant correlation between suvmax and size (r=0.32 ; p=0.048) : this correlation was stronger for lesions larger than 31 mm (r=0.4515 ; p=0.0268). we also found a correlation between suvmax and size (r=0.562 ; p=0.019) in adenocarcinomas. the differences between our results and those of others are probably due to our entry criteria. in fact, we evaluated patients with lesions measuring between 3 and 7 cm and with fdg pet - negative metastasis. with respect to the correlation between suvmax and histological type, adenocarcinomas had a slightly lower suvmax than the other histotypes, but the difference was not significant. tumour subtype is known to reflect the differential avidity of 18fdg uptake by cancer cells. glucose transporters mediate fdg uptake, and the expression of these proteins has been found to correlate with fdg uptake. moreover, the expression of glucose transporter type 1 (glut-1) differed substantially between nsclc of different histologies. these tumours have a lower 18fdg uptake and a lower suvmax than squamous cell tumours. however, although glut-1 is the major glucose transporter expressed in nsclc, it is neither the sole nor the rate - limiting determinant of fdg uptake. moreover, at the whole tumour level, fdg depends on such factors as tumour blood flow, intratumoral microvessel density and viable tumour cell number. uptake of fdg in the primary site of nsclc has been correlated with tumour doubling time and proliferation rates. in fact, the doubling time of squamous cell carcinoma is 92 days versus 168 in the case of adenocarcinoma. this would explain why fdg uptake varies depending on lesion size and histotype, and it would also explain why the correlation between suvmax and size is stronger for adenocarcinomas than for other histotypes. according to some studies, the malignant form of pulmonary lesions tends to expand substantially more than the benign form, and perfusion increases proportionally with size. however, our technique of ct examination, performed to stage the lung masses, does not allow a specific evaluation of net enhancement. in fact, lung masses are usually evaluated with a perfusion or dynamic protocol, which could allow the clinician to correlate net enhancement and histotype [2931 ]. however, our subcategories may have been too small to infer any conclusion about this type of parameter. the results we obtained partially reflect the composition of our group of patients, in which there were fewer women (8/38) and the prevalence of adenocarcinoma was higher than in other studies. another problem is the relatively small number of lesions in each group when patients are divided according to histology, particularly in the case of tumours that have a low incidence. we found a significant correlation between tumour size and suv (r=0.32 ; p=0.048) in patients with lesions measuring between 3 and 7 cm, while we did not find any correlation among lesion size and pre - contrastographic density, net enhancement, average post - contrast density and maximum density. we also demonstrate a significant correlation between clinical stage and suvmax for adenocarcinomas, but not for squamous cell carcinomas. our findings should be verified in a larger population, more representative of all histological types and their variants, and taking their different growth patterns and tissue architecture into account. | backgroundpersonalized cancer therapy remains a challenge. in this context, we attempted to identify correlations between tumour angiogenesis, tumour metabolism and tumour cell type. to this aim, we used single = phase multidetector computed tomography (mdct) and hybrid positron emission tomography - computed tomography (pet / ct) to determine whether net enhancement and standardized uptake value (suvmax) were correlated with tumour size and cytology in patients affected by non - small cell lung cancer (nsclc).material / methodsour study included 38 patients (30 men, 8 women, mean age 70) with a nsclc measuring between 3 cm and 7 cm, using a 16-slice multidetector ct (brilliance philips) and with pet - ct (biograph 16 siemens medical solutions). the following lesion parameters were evaluated : maximum diameter, medium density before contrast injection (ctpre), medium density after contrast injection (ctpost average), density in the most enhanced part of the lesion after contrast (ctpost max), net enhancement, suvmax, age, and cytology. correlation coefficient and p - value were computed for each pair of variables. in addition, correlations were computed for each pair of variables, and for all combinations of tumour types. we focused on subsets of data with more than 10 observations, and with correlation r>0.500 and p<0.05.resultsa weak correlation (r=0.32 ; p=0.048) was found between suvmax and tumour size ; the correlation was stronger for masses larger than 31 mm (r=0.4515 ; p=0.0268). no other correlations were found among the variables examined.conclusionsour data may have prognostic significance, and could lead to more appropriate surgical treatment and better treatment outcome. |
parkinson s disease (pd) is a chronic and progressive neurological disorder characterized by resting tremor, rigidity, and bradykinesia, affecting 2% of individuals above the age of 65 years. pd is a result of degeneration of the dopamine - producing neurons of the substantia nigra (sn) and a significant loss of noradrenergic neurons in the locus coeruleus (lc). to classical biogenic amines (or monoamines) may be included : dopamine (da), norepinephrine (ne), and epinenephrine (e), as well as serotonin (5-ht). experimental findings using animal models of pd suggest that ne may protect da neurons from damage. the catecholamines, da, ne, and e belong to a class of chemical neurotransmitters and hormones, and regulate physiological processes as well as leading to the development of neurological, psychiatric, and cardiovascular diseases. in the disease processes in which catecholamines have established roles, the neurodegeneration of central and peripheral catecholamine neural systems is involved. in pd and other related neurodegerative diseases,. mechanisms of catecholamine - induced neurotoxicity involve nonenzymatic auto - oxidation of catecholamines and formation of highly reactive deaminated catecholaldehyde metabolites that may induce the progression of neurodegenerative disease. catechol - o - methyltransferase (comt) and/or mao (monoamine oxidase) further catalyze the metabolism of monoamines. sympathetic nerves contain only mao, but adrenal chromaffin cells contain both mao and comt. monoamine transporters also play a role in maintaining the proper levels of catecholamines. however, the monoamine transporters play an important role in the concentration of monoamines in storage vesicles before their release and also act as a safeguard of neurons against high toxic levels of catecholamines. monoamine transporters for da, ne, and 5-ht - dat, net, and sert, respectively, represent targets for many pharmacological agents that affect brain function, including psychostimulants and antidepressants [4, 6, 7 ]. in pd, polymorphisms of the comt, mao, dat, net, and 5-htt genes may change the levels of biogenic amines and their metabolic products [8 - 12 ]. available therapies in pd improve the symptoms but do not halt progression of the disease. the most effective treatment for pd patients is therapy with l-3,4-dihydroxy - phenylalanine (l - dopa). comt activity is an important factor determining the response to l - dopa treatment [9, 14 - 16 ]. the most effective treatment of patients with pd seems to be combination of l - dopa with inhibitors of aromatic l - aminoacid decarboxylase (aadc), maos and comt, which would effectively correct levels of the drug (l - dopa) and the duration of its action, as well as monoamine concentration. naturally occurring monoamines in the central nervous system (cns) may be divided into two distinct groups depending on their amino - acidic substrate. the amino acid tyrosine (tyr) gives origin to catecholamines, whereas tryptophan (trp) is a substrate for 5-ht biosynthesis. the most significant catecholamines in the human brain are da, ne and e. sympathetic nerve stimulation and e were first described by thomas renton elliott in a 68-page treatise published in 1905. however, almost half a century ago, ulf von euler, julius axelrod, and sir bernard katz described humoral transmitters in the nerve terminals and the mechanism for their storage, release, and catecholamine inactivation. da is synthetized by dopaminergic neurons, mostly located in the sn and other areas of the brain comprising the dopaminergic system [1, 2, 20 ]. ne, and to small extent e, occur in various brain areas and are responsible for alertness, decision - making and other higher brain functions [23, 24 ]. the vesicles packed with monoamines are transported toward a synaptic knob, awaiting a stimulus. the proper action potential, reaching the trigger level, induces ca dependent movement of monoamine vesicles toward the presynaptic membrane, which induces exocytosis. this process is followed by a release of the neurotransmitter into the synaptic cleft, where a portion of the molecules attaches to the proper receptors and triggers an action potential on the postsynaptic membrane, propagating the stimulus along the next neuron. subsequently, several neurotransmitter molecules dissociate from receptors, and sideways with unbound neurotransmitters present in the synaptic cleft to undergo reuptake or enzymatic breakdown. 1), where the first step is tyrosine hydroxylation by a cytosolic enzyme, tyrosine hydroxylase (th). the th enzyme utilizes tetrahydrobiopterin (thbt) as a cofactor and molecular oxygen as a substrate for hydroxyl group formation. this reaction requires the presence of pyridoxal phosphate (active form of vitamin b6), and is catalyzed by the enzyme aadc (also described as l - dopa decarboxylase or 5-htp decarboxylase) [4, 17 ]. vitamin c. ne is then utilized as a substrate for the further step the formation of e, which is catalyzed by the enzyme phenylmethanolamine n - methyltransferase. this reaction requires s - adenosylmethionine (sam) as a co - substrate to provide methyl groups. like da, the biosynthesis of 5-ht occurs with the participation of coupled reactions, but with trp as the primary amino acid substrate. the first reaction is hydroxylation of trp, yielding 5-hydroxytryptophane (5-htp), with thbt as a cofactor. the next step is decarboxylation of 5-htp to 5-hydroxytryptamine (5-ht), and is catalyzed by aadc. the monoamines that are synthesized in the cytoplasm are transported into the monoamine vesicles by specialized enzymes. there are two isoforms of the vmat transporter described in literature : vmat1, which is mostly localized in the neuroendocrine cells, and vmat2, which is primarily located in the cns. vmat2 is localized within the vesicle s membrane and its main role is to actively transport catecholamines, 5-ht and histamine into the monoamine vesicles [27, 28 ]. the vesicles store monoamine neurotransmitters and release them into the synaptic cleft in response to action potential. comt breaks down da, ne and e yielding 3-methoxytyramine, normetanephrine (nmeta), and mentanephrine (meta), respectively (fig. 1). the a isoform of mao metabolizes da, ne, and 5-ht, giving 3,4-dihydroxyphenylacetaldehyde, 3,4-dihydroxymandelic acid, and 5-hydroxyindoleacetic acid, respectively. it is known that metabolic o - methylation of endogenous catecholamines and other catechols are catalyzed by comt. a single comt gene is located on the long arm of chromosome 22q11 and contains six exons [31, 32 ]. most studies of variations in the comt gene refer to missense mutation of this gene in exon 4 (substitution cgtg to catg). single nucleotide polymorphisms (snps) at nucleotide 1947 in the comt gene encode both the acid - soluble (s - comt), and membrane - bound (mb - comt) forms of this enzyme. moreover, there are three major genopytes of the comt gene formed by four snps : one located in the s - comt promoter region (a > g ; rs6269), in the boundary region of intron 3 of the mb - comt gene, and three in the s - comt and mb - comt coding region at codons : two synonymous changes his62his (c > t ; rs4633), leu136leu (c > g ; rs4818), and one nonsynonymous alteration val158 met (a > g ; rs4680). it has been shown that a common snp in codon 158, a substitution of valine (val) by methionine (met), is associated with pain rating and -opioid system responses, cognition and common affective disorders [36 - 38 ]. moreover, genotypes divergent from synonymous snps exhibited the largest difference in comt enzymatic activity, owing to a reduced amount of translated protein. the major comt genotype varies with respect to mrna local stem - loop structures, determining the most stable structure and lower protein levels and enzymatic activity. the comt enzymatic activity in women is 20 - 30% lower than in men ; it should be stated that in women, estrogens downregulate comt gene transcription and may increase the risk of pd. in the comt gene, a substitution of val for met (table 1) has been shown in two loci at codon 158 (val158met) and codon 108 (val108met) [40, 41 ]. the mb - comt form is usually present in cerebral nerve cells, while the cells expressing the s - comt form are found in the liver, blood and kidney. moreover, when nucleotide 1947 in the comt gene is guanine (g), it codes for val and a high activity of thermostable comt is formed, whereas if this nucleotide is adenine (a), it codes for met and a low activity of thermolabile comt is produced. it is known that the homozygous variant met (allele comt) is 3 - 4 times less active and metabolizes da significantly slower than homozygous variant val (comt allele). the study by kunugi. showed that the homozygous comt variant is a genetic risk factor of pd in the japanese population. studies in caucasian and chinese populations did not confirm any association between the comt gene polymorphism and pd [40, 41 ]. the study by biaecka. has shown that there is a statistically lower frequency of the comt genotype in pd in the polish population. moreover, the comt genotype is common in caucasians and southwest asians, with a frequency of 40 - 50%, which is greater than in northeast asians and africans, in whom the frequency is 20 - 30% [41, 42, 44 ]. the study by biaecka. has also shown that there is a higher frequency of the comt allele in the polish population, as 56.7% of the controls carried this allele.. indicated that high, not low, comt activity is a risk factor for pd. it is believed that the comt val158met (a > g ; rs4680) gene encodes genotypes gg, ga and aa. the distribution of comt genotypes is known to differ between various ethnic populations. in a caucasian population the distribution is 25, 50 and 25% for the gg, ga and aa genotypes, respectively [12, 32, 45 ]. in japanese and korean populations, a significantly lower level of subjects with aa genotype and a - allele frequency has been found [9, 42 ]. moreover, the distribution of genotypes in chinese, finnish, korean, and polish studies were not significantly different in the frequencies of different comt genotypes between pd patients and controls [12, 32, 40, 45, 46 ]. however, the japanese and korean studies reported that the aa genotype occurred more frequently in pd patients than in controls and may be a risk factor for pd [9, 41, 42 ]. comt plays a role in the inactivation of many biologically active or toxic catechols and metabolizes hormones and neurotransmitters, such as l - dopa, da, ne and e, modulating susceptibility to pd [4, 43, 47 - 49 ]. it is known that the aa genotype of comt gene encodes the comt enzyme with low activity. similarly to the studies by bugaj., our unpublished data carried out on people of caucasian origin, 49 pd patients (aged 35 - 82 years) and 48 healthy subjects (aged 35 - 82 years) were found to have different plasma levels of the monoamines ne and e and their urine metabolites (nmeta and meta, respectively) in both pd patients and controls with comt gg (15%, 30%), ga (59%, 51%) and aa (26%, 19%) genotypes (c.649g > a ; rs4680). blood from subjects was collected after 5 min. in the upright position (after a minimum 30 min. the polymorphism of the comt gene was determined with the polymerase chain reaction - restriction fragment length polymorphism (pcr - rflp) method and concentrations of plasma ne, e and urine nmeta and meta were estimated using the high performance liquid chromatography system with electrochemical (hplc / ec). our study indicated that the highest plasma level of ne in both pd patients and controls was in subjects with the comt gg genotype (273.9122.8 pg / ml and 349.5163.0 pg / ml, respectively). additionally, in pd patients with the comt aa genotype only, the level of ne was higher than in controls with the same genotype (231.3196.5 pg / ml and 212.3105.7 pg / ml, respectively). in contrast to ne, the plasma concentration of e was higher in pd patients with all analyzed genotypes of the comt gene, but in pd patients with the aa genotype only, the increase was statistically significant as compared to controls (kruskal - wallis test, p t ; rs1137070) and attention - deficit / hyperactivity disorder (adhd) and mental diseases. similarly to bugaj., our unpublished data on 49 pd polish patients (see above) have shown that the mao - a cc and ct (c.1460c > t ; rs1137070) genotypes occur with the same frequency (44%) with each other, and at double the frequency of the rare genotype tt (12%). the mao - b gene polymorphisms in pd are summarized in (table 1). both polymorphisms in intron 13 of the mao - b gene as well as in exon 14 have been reported to be associated with an increased risk of pd in caucasians, while no correlation was found in asian population [43, 59, 60, 62 ]. in the indian population, a strong correlation between the mao - b g variant (intron 13a / g) and pd was demonstrated. hotamisligil. have shown that mao - a polymorphism regulates gene expression and increases enzyme activity and ros generation. maos are involved in the neurodegenerative process in pd through production of ros and oxidative deamination of da. the study by richter described the first step of oxidation, involving the mao enzyme, resulting in the formation of deaminated aldehydes from da, 3,4-dihydroxyphenylace- taldehyde (dopal), and ne, e, 3,4-dihydroxyphenylglyco- laldehyde (dopegal). maos, or oxygen oxidoreductases (deaminating), are mitochondrial - bound proteins catalyzing the oxidative deamination of key brain neurotransmitters, such as da, ne, e, 5-ht, as well as a number of trace amines, such as tyramine and tryptamine. maos exhibit their action with the participation of flavin adenine dinucleotide (fad) as a cofactor, and lead to the formation of toxic aldehydes and ammonium from amines. it is known that aldehyde metabolites of da, ne, and e deaminated by mao undergo further metabolism by other enzymes e.g. comt. however, the main metabolic pathway of 5-ht consists of the conversion of this monoamine into 5-hydroxyindoloacetic acid (5-hiaa) by mao and aldehyde dehydrogenase (aldh) (fig. 1). similarly to studies by bugaj., our unpublished data carried out on 49 pd patients and 48 healthy subjects (as described previously) have shown a different level of the monoamines ne, e, and 5-ht as well as ne and e metabolites (nmeta, meta) in both pd patients and controls with the mao - a cc, ct and tt genotypes (c.1460c > t ; rs1137070). in this study, a polymorphism of the mao - a gene was determined with the pcr - rflp method and concentrations of plasma ne, e, 5-ht and urine nmeta, meta were estimated using the hplc / ec technique. our study indicated that the highest plasma level of ne was observed in mao - a ct heterozygote pd patients (229.9149.7 pg / ml) and in control subjects with the common mao - a cc genotype (289.8172.0 pg / ml). additionally, both pd patients and controls with the mutated mao - a tt genotype have the lowest level of ne (141.667.6 pg / ml and 198.177.4 pg / ml, respectively). in contrast to ne, the plasma concentrations of e and 5-ht were higher in pd patients with all analyzed genotypes of the mao - a gene as compared to controls (the lowest level in all subjects was found in pd and controls with the mutated mao - a tt genotype) but were not statistically significant. our study has also found that the highest urine concentration of the ne metabolite nmeta was in control subjects with the mao - a ct genotype and the lowest level in the control subjects with the mao - a tt genotype (637.4405.7 g/24 hours and 101.5104.8 g/24 hours, respectively). in pd patients with the mao - a cc and ct genotypes, the level of nmeta was significantly lower than in controls (kruskal - wallis test, p g) gene demonstrated that there is no significant association of the specified polymorphism of the dat gene with pd, similarly to the reports by kimura. and lin. (table 1). however, morino. showed a significantly decreased frequency of g the allele of the dat (1215a > g) polymorphism in pd patients and the contribution of dat in the pathogenesis of pd. in addition, it has been shown that polymorphisms in gene coding enzymes such as dat, involved in the detoxication mechanism, oxidative stress, and da regulation, may modify the risk to development of pd. it is known that reduced functional activity of monoamine transporters, e.g. dat and net, may lead to neuronal injury and the development of pd. clinical studies of pd patients have indicated that the norepinergic system may be affected before the dopaminergic system and can have an impact on non - motor preclinical symptoms of this disease, such as rem - sleep disorder and autonomic dysfunction, dementia, and depressive symptoms [97, 98 ]. moreover, the norepinergic system may protect dopaminergic neurons from damage by neurotoxins, e.g. mptp. it is known that increased ne levels reduce the neurotoxic effect of such toxins, but do not completely protect dopaminergic neurons. research carried out post mortem showed that, in the lc of pd patients, there is no compensation system and there is a decrease in norepinenergic function. the net gene, also called slc6a2, is located on human chromosome 16 locus 16q12.2. based on the nucleotide and amino acid sequence, net consists of 617 amino acids. there is evidence that snps in the net gene may be underlying factors in some disorders. park. showed the possible role of the g1287a and a3081 t genotypes of slc6a2 in the pathophysiology of adhd. the net enzyme also mediates norepinergic signaling involved in emotion, neuroplasticity, memory, depression and dementia, which may indicate the role of net as a candidate gene associated with major depression. in the korean population, it has been shown that the polymorphism net (182t > c) is associated with major depression. another polymorphism of the net gene tied to depression is a substitution of g to a at position 1287 in exon 9 (net 1287g > a). depression is common in patients with pd, and it seems that polymorphisms of the net gene may be involved in the pathogenesis of this disease. bugaj. and our unpublished data on 49 pd polish patients and 48 controls (as mentioned previously) have shown that the net gg and ga (c.1287g > a ; rs5569) genotypes occurred with similar frequency in both groups (pd, gg, 33% and 30% ; controls ga, 59% and 55%, respectively) and the mutant aa genotype was almost half as common in pd than in controls (8% and 15%, respectively). net is the main transporter for the removal of ne from the synapse and mainly restricted to the hippocampus and cortex. additionally, deficiency in the norepinenergic system and disturbances in ne levels play a role in the development of pd. similarly to studies by bugaj., our unpublished data carried out on 49 pd patients and 48 healthy subjects (see above) showed different levels of the monoamines ne, e, 5-ht, as well as ne and e metabolites (nmeta, meta) in both pd patients and controls with the net gg, ga and aa genotypes (c.1287g > a ; rs5569). in this study, a polymorphism of net was determined using pcr - rflp, and concentrations of plasma ne, e, 5-ht and urine nmeta, meta were estimated using hplc / ec. our study indicated that the plasma level of ne was lower in pd patients with all analyzed net genotypes than in controls. the highest ne level was in pd heterozygotes net ga (213.0137.1 pg / ml), and the lowest in patients with the net wild - type gg genotype (190.189.8 pg / ml). in contrast to ne, the plasma concentrations of e and 5-ht were higher in pd patients with all analyzed net genotypes as compared to controls (except in pd, e levels with the mutant net aa genotype) but the differences were statistically insignificant. our study also indicated that the urine concentration of nmeta was higher in control subjects with all analyzed net genotypes. however, in pd patients, a statistically significantly lower level of ne was seen only in patients with the net ga genotype (kruskal - wallis test, p a), and other monoamines (5-ht), e.g. mao - a (c.1460c > t), as well as in the transport and release of monoamines (ne), e.g. net (c.1287g > a), can significantly affect the level of biogenic amines and/or their metabolites (nmeta, meta). it seems that, in pd patients, the reduced activity of comt resulting from the (c.649g > a) aa genotype has a stronger impact on the final step of catecholamine biosynthesis (e level) and meta level. moreover, in pd, the mao - a (c.1460c > t) ct genotype is associated with high plasma levels of monoamines (ne, e, 5-ht) and one of the highest levels of their metabolites (nmeta, meta). it also seems reasonable to use mao - a inactivation due to its antidepressant effects (by increased monoamine levels) as an effective strategy in the treatment of pd patients especially with the mutant mao - a (c.1460c > t) tt genotype and with depressive symptoms. our studies indicate the likely impact of genetic determinants of the net (c.1287g > a) gene on the level of biogenic amines (however, not significant) as well as a significant influence on their metabolites in pd, especially in patients with the ga genotype. it is worth noting that the metabolism of catecholamines and 5-ht is conjugated by common factors. decarboxylation of both 5-htp and l - dopa is performed by the same enzyme (aadc) in the neuronal cytoplasm, thus oversupply of either substrate would competitively inhibit formation of da and 5-ht, respectively. such a phenomenon may be observed in pd patients treated with l - dopa, in which a large supply of l - dopa may inhibit the decarboxylation of 5-htp, leading to decreased levels of 5-ht in the human brain. furthermore, an increased level of l - dopa might inflict over - expression of aadc, as discussed earlier, resulting in further da and 5-ht imbalance in pd patients treated with l - dopa. the break down of 5-ht and catecholamines is performed to some extent by both maos, thus increased levels of monoamines in pd patients taking l - dopa would competitively inhibit the metabolism of 5-ht, followed by its increased levels in the patients brains. we still need therapies to provide a robust antiparkinsonian benefit through the day, to eliminate dyskinesias, and to slow down or stop the progress of the disease. perhaps controlling the level of monoamines and their metabolism would help to improve the outcomes of treatment of patients with pd. | epinephrine (e) and sympathetic nerve stimulation were described by thomas renton elliott in 1905 for the first time. dopamine (da), norepinephrine (ne), e, and serotonin (5-ht) belong to the classic biogenic amines (or monoamines). parkinson s disease (pd) is among the diseases in which it has been established that catecholamines may account for the neurodegeneration of central and peripheral catecholamine neural systems. pd is a chronic and progressive neurological disorder characterized by resting tremor, rigidity, and bradykinesia, affecting 2% of individuals above the age of 65 years. this disorder is a result of degeneration of da - producing neurons of the substantia nigra and a significant loss of noradrenergic neurons in the locus coeruleus. in pd and other related neurodegerative diseases, catecholamines play the role of endogenous neurotoxins. catechol - o - methyltransferase (comt) and/or monoamine oxidase (mao) catalyze the metabolism of monoamines. however, the monoamine transporters for da, ne, and 5-ht namely dat, net, and sert, respectively regulate the monoamine concentration. the metabolism of catecholamines and 5-ht involves common factors. monoamine transporters represent targets for many pharmacological agents that affect brain function, including psychostimulators and antidepressants. in pd, polymorphisms of the comt, mao, dat, net, and 5- htt genes may change the levels of biogenic amines and their metabolic products. the currently available therapies for pd improve the symptoms but do not halt the progression of the disease. the most effective treatment for pd patients is therapy with l - dopa. combined therapy for pd involves a da agonist and decarboxylase, maos and comt inhibitors, and is the current optimal form of pd treatment maintaining monoamine balance. |
congenital chylothorax, although rare, is the most common form of pleural effusion in neonates. its etiology is not fully understood, but may be related to maldevelopment of the lymphatic system. overall mortality rates for chylothorax range from 18 to 44%, depending on associated conditions, gestational age and the duration and severity1 - 3). with conservative treatment, complete resolution of pleural fluid can be observed within 30 days for 80% of congenital chylothorax patients. poorer prognosis is associated with hydrops fetalis, large pleural effusions leading to pulmonary hypoplasia, and preterm birth (90%). the infant was initially treated with chest tube drainage and total parenteral nutrition combined with balanced replacement of fluid and albumin losses. however, amounts of right pleural fluid remained high, fluctuating between 30 to 320 ml / day until postnatal day 25. initial dose was 0.5 g / kg / hr and was increased up to a maximum dose of 10 g / kg / hr. however, no significant decrease in right pleural drainage was noted and reaccumulation of left pleural effusion showed up. 0.1 klinische einheit (ke) ok-432 (at a concentration of 1 ke in 10 ml normal saline) was injected into the left pleural cavity on postnatal day 46 and into the right pleural cavity on postnatal day 48. the amount of pleural fluid drainage dramatically decreased right after ok-432 injection, and did not reaccumulate, resulting in the chest tube finally being removed 14 days after the ok-432 instillation (fig. unfortunately, the infant was already suffering from significant oliguria, worsening edema and recurrent hypotension. he died from renal failure, shock, and candida peritonitis related to peritoneal dialysis on postnatal day 72, even though chylothorax had resolved completely after ok-432 pleurodesis. a female preterm infant (case 2, gestation 29 weeks and 6 days weeks, birth weight 1,790 g) was born by c - section with bilateral pleural effusion, diagnosed at 27 weeks of gestation. the infant had been treated with thoracentesis and intrapleural instillation of ok-432 during the fetal period at 28 weeks and 4 days of gestation, but showed recurrence of pleural effusion after seven days of instillation of ok-432 and progressed into hydrops fetalis at 29 weeks and 6 days of gestation. analysis of fetal pleural fluid demonstrated the presence of more than 99% lymphocytes suggesting congenital chylothorax, while culture of the fluid was sterile. fetal karyotype and viral studies were all negative. left pleural effusion was continued at an average rate of 80 ml / day during the first two week, and it was then decreased gradually. right pleural drainage had resolved after three days, and the right chest tube was removed on postnatal day 14. the amount of right pleural fluid drained was 80 to 100 ml / day until postnatal day 25. we performed pleurodesis with ok-432 on the right pleural spaces on postnatal day 26 as a bedside procedure. the amount of pleural fluid drainage promptly decreased after ok-432 instillation and there was no reaccumulation (fig. medium chain triglycerides (mct)-rich formula feeding was successfully switched to regular formula before discharge. a male preterm infant (gestation 33 weeks, birth weight 2,720 g) was born by c - section with hydrops fetalis. a fetal sonogram showed generalized edema, bilateral pleural effusion (right, 2.3 cm ; left, 1.3 cm) and pericardial effusion at 32 weeks gestation. congenital chylothorax was confirmed by analysis of pleural fluid : elevated triglyceride (202 mg / dl) after premature milk feeding, and predominant lymphocyte count (> 90%). the infant was initially treated with chest tube drainage and total parenteral nutrition combined with balanced replacement of fluid and albumin losses. however, amounts of right pleural fluid remained high, fluctuating between 30 to 320 ml / day until postnatal day 25. initial dose was 0.5 g / kg / hr and was increased up to a maximum dose of 10 g / kg / hr. however, no significant decrease in right pleural drainage was noted and reaccumulation of left pleural effusion showed up. 0.1 klinische einheit (ke) ok-432 (at a concentration of 1 ke in 10 ml normal saline) was injected into the left pleural cavity on postnatal day 46 and into the right pleural cavity on postnatal day 48. the amount of pleural fluid drainage dramatically decreased right after ok-432 injection, and did not reaccumulate, resulting in the chest tube finally being removed 14 days after the ok-432 instillation (fig. unfortunately, the infant was already suffering from significant oliguria, worsening edema and recurrent hypotension. he died from renal failure, shock, and candida peritonitis related to peritoneal dialysis on postnatal day 72, even though chylothorax had resolved completely after ok-432 pleurodesis. a female preterm infant (case 2, gestation 29 weeks and 6 days weeks, birth weight 1,790 g) was born by c - section with bilateral pleural effusion, diagnosed at 27 weeks of gestation. the infant had been treated with thoracentesis and intrapleural instillation of ok-432 during the fetal period at 28 weeks and 4 days of gestation, but showed recurrence of pleural effusion after seven days of instillation of ok-432 and progressed into hydrops fetalis at 29 weeks and 6 days of gestation. analysis of fetal pleural fluid demonstrated the presence of more than 99% lymphocytes suggesting congenital chylothorax, while culture of the fluid was sterile. fetal karyotype and viral studies were all negative. left pleural effusion was continued at an average rate of 80 ml / day during the first two week, and it was then decreased gradually. right pleural drainage had resolved after three days, and the right chest tube was removed on postnatal day 14. the amount of right pleural fluid drained was 80 to 100 ml / day until postnatal day 25. we performed pleurodesis with ok-432 on the right pleural spaces on postnatal day 26 as a bedside procedure. the amount of pleural fluid drainage promptly decreased after ok-432 instillation and there was no reaccumulation (fig. medium chain triglycerides (mct)-rich formula feeding was successfully switched to regular formula before discharge. the clinical course of chylothorax is highly variable and ranges from spontaneous resolution to progression into hydrops fetalis and fetal death. if congenital chylothorax is severe or develops in the second trimester, it may lead to pulmonary hypoplasia as a result of impaired lung growth by compression13). standard treatment algorithms are based on adequate drainage of the pleural fluid, in combination with parenteral nutrition or feeding with mct - rich formula. with conservative treatment, complete resolution of pleural fluid however, there are no definite guidelines about which treatment is the most useful for persistent congenital chylothorax. some authors recommend that surgical intervention may be necessary in cases with massive (50 ml / kg / day) or persistent (> 4 weeks after onset of the chylothorax) pleural drainage4,15). recent reports have suggested octreotide or pleurodesis as an alternative medical therapy for infants with persistent chylothorax. octreotide, a somatostatin analogue, has been used effectively in postoperative cases of chylothorax in both adult and pediatric patients. there have been several previous reports of the use of octreotide as a second - line treatment of congenital chylothorax that did not resolve with conservative treatment16,17). however, caution is advised for patients prone to necrotizing enterocolitis because of the detrimental effects of somatostatin on splanchnic blood flow, especially for premature babies. in our first case study, octreotide infusion was initially started up to a maximum dose of 10 g / kg / hr for about two weeks, but no significant decrease in chest tube drainage was noted. ok-432 (picibanil) is a lyophilized preparation of a low - virulence strain of group a s. pyogenes of human origin, inactivated by heating with penicillin g, and has been proposed as a sclerosing agent. ok-432 has been widely used to treat postoperative chylothorax and cystic lymphangioma in children5 - 7). recently, in fetal chylothorax, intrapleural administration of ok-432 has had favorable outcomes ; 22 of 25 patients showed remission of pleural effusion after intrapleural injection since 20018 - 11). for its first use in neonates, matsukuma.12) reported the successful use of ok-432 for the treatment of persistent congenital chylothorax which is resistant to octreotide infusion as second line therapeutic option. long - lasting chyle drainage could put patients at increased risk for malnutrition, nosocomial infections, and fluid and electrolyte imbalances1,18). ergaz.3) reported that two of 11 neonates died after resolution of chylothorax from deteriorating renal failure and a high rate of nosocomial infections that occurred in six out of 11 neonates with congenital chylothorax. therefore, based on our first case experience, we decided to apply pleurodesis earlier for the second case. as a result, earlier removal of the chest tube was possible and the duration of hospitalization was reduced without any complications. few complications related to ok-432 have been reported in adults, with the exception of signs of inflammatory reactions such as fever, pain, and local erythema. there have been no adverse effects of fetal therapy with ok-432, with the exception of one report of transient fetal tachycardia8,9). however, cowie.19) recently described that intrapleural infusion of ok-432 was associated with transient suppression of fetal electroencephalographic activity, breathing and body movements in fetal sheep. in addition, bennet.20) reported that a single injection of ok-432 can be associated with a risk of focal cerebral injury in the preterm fetus. since the case numbers for treatment with ok-432 are small and limited, a prospective randomized study in newborns will be required to prove its effectiveness, and ascertain side effects and safety of use. long term postnatal follow - up of neonates treated with ok-432 is also needed. in conclusion, we report that intrapleural injection of ok-432 was successful in two preterm infants with persistent chylothorax that was refractory to conservative treatment. if used appropriately, this option has the potential to reduce the morbidity related to prolonged pleural effusion and hospital stay, as well as early removal of the chest tube and a reduction in surgical intervention. in addition, this treatment involves simple and minimally invasive drug delivery with a chest tube in place, and can be carried out as a bedside procedure without the requirement of anesthesia. | ok-432 (picibanil) is an inactivated preparation of streptococcus pyogenes that causes pleurodesis by inducing a strong inflammatory response. intrapleural instillation of ok-432 has recently been used to successfully treat neonatal and fetal chylothorax. here we report a trial of intrapleural instillation of ok-432 in two preterm infants who were born with hydrops fetalis and massive bilateral pleural effusion. both cases showed persistent pleural effusion, refractory to conservative treatment, up to postnatal days 26 and 46, respectively. an average of 80 to 140 ml of pleural fluid was drained daily. in case 1, the infant was treated with ok-432 during the fetal period at gestation 28 weeks and 4 days of gestation, but showed recurrence of pleural effusion and progressed into hydrops. within two to three days after ok-432 injection, the amount of pleural fluid drainage was dramatically decreased and there was no reaccumulation. we did not observe any side effects related to ok-432 injection. we suggest that ok-432 should be considered as a therapeutic option in infants who have persistent pleural effusion for more than four weeks, with the expectation of the early removal of the chest tube and a good outcome. |
the burden of end stage renal disease (esrd) is increasing in sub - saharan african (ssa) countries [1, 2 ]. this is attributed to the rising prevalence of noncommunicable diseases and infection - related nephropathies [2, 4 ]. in spite of this increasing burden, care for esrd in ssa is suboptimal, compared with esrd care in europe and north america, where esrd care is often in accordance with kidney disease quality - of - life guidelines (kdoqi) [57 ]. esrd care in most of the ssa countries is characterized by gross lack of access to optimal care [58 ], with a rudimentary and unorganized institutional and human resource base for care. virtually, all esrd care inputs are imported into ssa countries and are thus quite expensive [5, 8 ]. the cost of care is also prohibitive and outside the reach of majority of the victims [2, 5, 8 ]. the bulk of the patients with esrd belong to the lower socioeconomic group and are thus unable sustain maintenance dialysis for longer than three months of entry into the esrd program. affordability and access to erythropoietin stimulating agents (esa) is extremely poor while opportunities for kidney transplant are also limited [9, 10 ]. for the majority of ssa countries, there is hardly any, government - driven or government - supported esrd care program. as a result, the mortality rate within 90 days of commencing renal replacement therapy (rrt) of esrd patients in ssa countries is as high as over 90%, compared with patients in europe and north america where it is less than 4% [911 ] the objective of this paperis to use a single - center esrd care experience in nigeria, to demonstrate the prevailing lack of access to esrd care in order to advocate the need for a global funding mechanism for esrd populations in sub - saharan africa. the demographic and clinical data of all consecutive patients, aged 15 years and above, who commenced maintenance haemodialysis treatment at the university of port harcourt teaching hospital, port harcourt, nigeria between the january 1, 1996 to december 31, 1999 (4 years) and january 1, 2007 to december 31, 2009 (3 years), due to the interruption of dialysis services between january 1997 and december 2006 for technical problems, were retrospectively analyzed. the diagnosis of esrd was based on the kdoqi guidelines for diagnosis and classification of ckd. the data for analysis included the biodata, overall clinical status, blood pressure measurements and the haematologic and biochemical indices (relevant to esrd) at first presentation. others included the duration of stay on the maintenance haemodialysis programme, the total number of haemodialysis sessions received during the period, and the average urea reduction ratio (urr) attained. other parameters were the average kt / v ratio attained before dropout, patient 's actual annual incomes, and their sources of funding for esrd care. four end points of the study were the proportion of the esrd patients that were alive and still on the program at 3 months, 6 months, and 1 year from the date of entry into the esrd program, the proportion that had dropped out of the program and lost to followup at the stated periods above, the proportion of who died at the given periods and referral for kidney transplant for the period under study. the literature search was done using manual search of relevant nigerian and african medical journals and electronic search of medical research database through pubmed, hinari, and google. the search keywords used were esrd ; rrt ; outcomes and sub - saharan africa. data was analyzed using descriptive statistics and presented as mean standard deviation and percentages. the data for 320 consecutive esrd patients who satisfied the inclusion criteria were suitable for analysis. they consisted of 200 males and 120 females (m / f = 1.6 : 1), with a mean age of 46.2 17.6 years, and age range 1579 years (table 1). they had a bimodal peak age pattern, with an early small peak in the 2029 year age group and a second larger peak in the 5059 and 6069 year age groups, respectively. the results of the evaluation of the income status of a cohort 40 esrd patients in 2009 (table 2) show that majority of the subjects were predominantly from the lower and middle socioeconomic classes, with 40% of them in socioeconomic classes v and vi, 45% in social classes iii and iv and only 15% from the upper social classes i and ii, as defined by the following income range based on annual family incomes. lower or social classes v and vi earning 800 to 2,460 united states dollars (usd) or 0.120.4 million nigerian naira (ngn) ; middle class or social classes iii and iv earning 4,677 to 7,333 usd or 0.7 to1.2 million ngn ; upper or social classes i and ii earning 14,000.0 to 26,667 usd or 2.1 m to 4 million ngn. the computed annual cost of haemodialysis treatment, per patient, during the period under study was 15,600.00 usd (2,340,000.00 ngn). the result shows the wide disparity between the annual incomes of the patients and the annual cost of haemodialysis treatment per patient. chronic glomerulopathy (45.6%), hypertensive nephropathy (29.7%), and diabetic nephropathy (17.5%) were the three leading causes of esrd in the patients (see figure 1). the diagnosis of the cause of ckd was clinical, as most of the patients presented in esrd when a biopsy is of little value and determining if hypertension is a cause or effect of the kidney disease is difficult. however, the duration of hypertension, duration of diabetes, evidence of nephritis, the patient 's age, and a history of prior renal disease such as acute glomerulonephritis (agn) and ultrasound determined renal size were guides to determining the aetiology. their mean e - gfr was 6.2 5.8 mls / min/1.73 m. anaemia was found at presentation in over 90% of the subjects with a mean hematocrit (hct) of 20.8 6.8% and a range of 1035%. their mean systolic and diastolic blood pressures were 171.2 31.9 mmhg, range (107240 mmhg) and 102.5 27.4 mmhg, range 70140 mmhg, respectively. using the jnc-7 criteria, 88.5% of the patients were hypertensive with 70.3% presenting with grade ii hypertension. at presentation, 85% of the patients were in an unstable clinical state, characterized by gross edema, anemia, severe hypertension, pulmonary edema, cardiovascular instability, and uraemic encephalopathy. the duration of maintenance haemodialysis before loss to the program ranged from 1 to 37 weeks, with a mean duration of 5.2 7.6 weeks. table 4 shows the distribution of the patients in accordance with the length of time spent in the dialysis program. majority of the patients 314 (98.1%) could not sustain dialysis for more than 12 weeks. only three patients (0.9%) could sustain dialysis for over 26 weeks before they were lost to followup. all patients achieved an aggregate mean urea reduction ratio (urr) of 48.7 22%, range 888% and an aggregate the 320 patients received a total of 1,476 haemodialysis sessions during the seven - year period under consideration, translating to an average weekly dialysis rate of 0.013 dialysis sessions (0.05 hour per week) per patient compared to the expected 3 sessions (12 hours) per week per patient. most of the patients 285 (89.1%) could only achieve an average of 19 dialysis sessions before dropping out of the program, while the remaining 35 (9.9%) achieved an average of 10 to 20 dialysis sessions before dropping out of the program. within 12 weeks of commencing maintenance dialysis, forty percent of this number were confirmed dead, 41.8 percent absconded and were presumed dead, making a total of 81.8% deaths within 12 weeks of entry into the program. eight patients (2.5%) who were able to raise funds were at various times referred out of the country for renal transplant. analysis of the source of funding for esrd care in the subjects showed that 65% of these patients funded their maintenance dialysis treatment from direct out of pocket payment, 17.5% received some support from extended family sources to fund treatment, while the remaining 17.5% of the patients obtained some support from philanthropic individuals or organizations such as church groups. none of the patients were covered by insurance payments, and there was no government subsidy for the payment of maintenance dialysis of the patients (figure 2). the results from this single - center esrd care experience show that esrd patients in our center are predominantly young adults and middle - aged people from the lower socioeconomic group with abysmally poor access to esrd care, grossly suboptimal esrd care, and minimal access to kidney transplant. their incomes fall far below the cost of esrd care, resulting in a 90-day mortality rate of almost 100% from the point of entry into the esrd program. the dominant factors for this poor outcome are economic deprivation and the lack of structured government socioeconomic support. this pattern is consistent with single - center experiences in other centers in nigeria and other ssa and african countries with the exception of south africa. menakaya. in a retrospective study of 454 esrd patients on maintenance dialysis, during a ten - year period (19811994) at the lagos university teaching hospital (luth), southwestern nigeria, recorded 29.7% in hospital mortality with 65% percent of cases abandoning the treatment and subsequently presumed dead within three months of entry into the esrd the program. arogundade., in ile - ife, southwestern, nigeria, reported 77.8% mortality within 3 months of commencing maintenance dialysis in 540 esrd patients over a period of 15 years. similarly, chijioke. and bosan and ibrahim in two different teaching hospitals in the northern parts of nigeria reported mortality rates of 66.7% and 90.8% respectively, all within three months of entry into maintenance dialysis program ; while arodiwe. in enugu, southeastern nigeria reported a mortality rate of 67.3% within three months of entry. in all these studies, none of the esrd patients was able to sustain maintenance dialysis for longer than six months. available data from other ssa countries indicate the gross paucity of kidney care facilities and very poor access to esrd care. the number of patients on dialysis in some ssa countries, shown in a 2003 report, indicates the following number of patients per country : mauritania (50), senegal (2030), mali (20), burkina faso (18), ivory coast (130), and ghana (30), respectively. others are zimbabwe (59), kenya (100), and sudan (200). south africa is the only ssa country with a more reliable esrd data and much higher access to organized esrd care. by 1998, south africa had 1525 esrd patients registered in the south african renal dialysis and transplantation registry (sadtr) on regular dialysis with esrd - care financed by the government. the data shown above makes it evident that hundreds of thousands of esrd patients in most ssa countries have practically no access to effective esrd care, compared with their counterparts in the developed countries. the over 90-percent case fatality rate within 90 days of diagnosis of esrd is unacceptable in the present state of knowledge and global development in nephrology care. furthermore, the direct and indirect human and socioeconomic cost of the high mortality associated with esrd in ssa will continue to affect the economy of ssa countries adversely. the prevailing situation of esrd care in ssa described above is a challenge for the global renal community, as action is required to prevent an expected worsening, in view of the increasing incidence and prevalence of ckd and esrd. short periods of maintenance dialysis and early transplant for esrd patients in ssa countries has been advocated [5, 8 ] in response to the current situation. as reasonable as this option may be firstly, even in the developed countries, less than 50% of esrd patients are transplanted as data from the united states and european renal transplant registries indicate that only 16% to 48% of esrd patients on the transplant waiting list get transplanted per year [19, 20 ]. the reasons for the relatively low transplant rate include the shortage of donor kidneys for transplant, hla- compatibility problems as well as some medical morbidity that may contraindicate transplant [21, 22 ]. secondly, the same reason of high cost, which prevents access to maintenance dialysis, will also prevent access to transplant in ssa countries. from experience in nigeria, live - donor kidney transplant costs between 7 and 10 million ngn (33,000.076,000.0 usd) excluding costs of immunosuppressive agents. therefore, in the absence of any government support only very few persons can access live - donor transplant in nigeria. this situation can be extrapolated for most ssa - countries, considering the existing high poverty rate in these countries. thirdly, getting both related and unrelated live donors in ssa countries is difficult due to cultural barriers, religious beliefs, and lack of monetary incentives for donors among other reasons. finally in most ssa countries ' health systems do not have capabilities for nonheart beating kidney donations and are not likely to do so in the foreseeable future. resultantly, it is evident that early live - donor kidney transplant program may not provide an adequate solution to the grim realities facing esrd patients in ssa countries. as is the practice in the developed countries of the world, maintenance dialysis through capd and or haemodialysis remains the cornerstone of esrd care for the following reasons. not all eligible esrd patients can benefit from transplant ; therefore, the rest must remain on maintenance dialysis to keep alive. for reasons such as age, debility, certain comorbid disorders, and hla - incompatibility [21, 22 ], more so patients with graft failure will return to maintenance dialysis until another suitable kidney can be found. therefore, all countries irrespective of economic status must necessarily have viable and sustainable maintenance dialysis programs. it is certain that individual patients can not afford self - funding of esrd care in ssa countries as was the case for developed countries before now. it was in realization of this fact that the american congress in 1973 passed the legislation that led to the birth of an end - stage renal disease (esrd) program, which was later followed by the us organ transplant act of the us congress that enabled esrd patients benefit from kidney transplant [23, 24 ]. the annual estimate of government expenditure for esrd care in developed countries also justifies this as the us government spent about $ 12.04 billion in annual medicare spending on esrd in 1998, not including an additional out - of medicare $ 4.7 billion spending by employer group health plan for the sustenance of the esrd program. it stands to reason that if esrd patients in ssa - countries are to benefit from effective esrd care there should be some mechanisms in place to enable all esrd patients have access to optimal esrd care in order to improve the survival and quality of life. the ssa country self - reliance strategy would involve the ssa countries taking the initiative and challenge to institute their own models of esrd care that will enable universal access to optimal esrd care of their citizenry. some emerging countries like brazil and singapore [26, 27 ] have established mechanisms that ensure universal access to esrd care for their populations. while the brazilian government provides esrd care free to all affected persons, singapore adopted a public - private partnership option in realizing the same objectives. in both countries, there is the political will by the governments to ensure universal access to optimal esrd care for their citizenry. few countries in the ssa which are relatively richer such as nigeria may be able to adopt the same strategy with adequate political will by government. it would be expected that a country like nigeria that earned an average of 59 billion usd in 2010 from crude oil export sales should have the capacity to make esrd care universally accessible for its citizenry ; however, this is not the case. the maintenance dialysis data in nigeria as shown above is a clear indication of the lack of political will by the government. in addition to the lack of political will by governments in most ssa countries, other political, social, and economic factors which impede optimal esrd care such as the high poverty rate among the populace, the reliance on importation of almost all esrd care products, the relative lack of human capacity, and lack of reliable health data for planning also pose enormous challenges. in the present political and economic state of affairs in most ssa countries highlighted above, it is very doubtful if the hindrances can be addressed in the projected future on the short and medium terms. the second strategy proposed is the institution of an international society of nephrology (isn) and or who - driven global fund for comprehensive esrd care programs in ssa countries. such a fund could be patterned along the lines of the global funds initiative for hiv / aids, tuberculosis and malaria with modifications as necessary. the fund should be a counterpart fund in which the international global contributors, host ssa country governments, esrd - care products industry, as well as the esrd patients and families shall be stake holder contributors. the contributions of the esrd care industry can be in the form of donations of some percentage of their annual operational profits or turnover or through price discounts on their products. host ssa countries could also create incentives for these industries to establish production factories for some of their products in host ssa countries. other corporate concerns such as petroleum and major manufacturing companies doing business in host ssa countries can be encouraged to contribute to the fund as part of their community and corporate social responsibilities. esrd patients shall contribute through payments of subsidized fee for service either directly or through insurance arrangements. however, it will be important to develop mechanisms which ensure that truly indigent and disadvantaged esrd patients could be treated for free to ensure universal access and lack of discrimination. the isn and the ssa country regional kidney associations and foundations should serve as facilitators and regulators of the program to ensure strict compliance by host ssa countries to the terms of engagement. the proposed fund should be disbursed in appropriate proportions to cover direct patient treatment (dialysis, transplants, and immunosuppressive agents), human capacity development for renal care, equipment and infrastructural developments as well as advocacy and the prevention of ckd and research. the global fund for the treatment and control of hiv / aids, tuberculosis, and malaria has achieved tremendous success since its inception in 2005. the prevalence of hiv / aids in most global funds beneficiary ssa countries are on the decline. in nigeria data from the united nations against aids (unaids) showed that by 2006 an estimated 1.3 million people in ssa countries were on antiretroviral therapy (art). at the end of 2 years of commencing art, 60% of the hiv / aids patients on art were alive. the unaids states that three years after the creation of the global fund it is proving to be the engine behind the scale up of the fight against the pandemic worldwide. fatalism, inevitability and stigma are being replaced with hope and greater openness about hiv / aids. such a global fund mechanism could also promote wider access to esrd care, develop needed the capacity for kidney disease care, enhance renal care infrastructure as well as promote prevention of ckd in the ssa countries. this option seems to provide hope for sustainability as the ssa countries may be left to take on the responsibility for the program on the long term using the already established framework of the global initiative. esrd patients in ssa countries have very minimal access to optimal care as a result of poverty, very low capacity for esrd care, and the absence of any government input in the care of esrd. this has resulted in an above one - year mortality rate after diagnosis of almost 100%. ssa countries in the present state of poor governance, weak economies, poor economic management, and seeming lack of proper direction and priority setting, have not demonstrated any willingness to intervene in esrd care as their counterparts in the developed countries and some emerging countries. an isn - driven global fund initiative for esrd care in ssa countries, as is the case with the global fund for hiv / aids which has shown significant success is recommended. global partners, ssa host countries, esrd care products industry, esrd patients, and isn / regional kidney societies shall constitute the stake holders. the global fund strategy will aim to provide direct esrd care, human and infrastructural capacity development for ckd care as well as ckd preventive programs. it is expected that this strategy will change the prevailing unacceptable outcomes of esrd care in ssa. | background. a single - center esrd care experience in a nigerian teaching hospital is presented as a surrogate case to demonstrate the prevailing esrd care situation in nigeria and most ssa countries. methods. the data of 320 consecutive esrd patients undergoing maintenance haemodialysis treatment during a seven - year period were retrospectively analyzed. results. over 80% of the subjects funded dialysis treatments from direct out of pocket payment. the mean duration on dialysis before dropout was 5.2 7.6 weeks, with majority 314 (98.1%) of the patients unable to sustain dialysis above 12 weeks. total dialysis sessions during the 7-year period was 1476 giving an average weekly dialysis session of 0.013 (0.05 hour / week) per patient per week. one hundred and twenty - eight (40%) patients died within 90 days of entry into dialysis care. conclusions. esrd care in this single centre was characterized by gross dialysis inadequacy and case fatality due to the inability to access and afford care. the opportunities for kidney transplantation are also very low. poverty and the absence of government support for esrd care are responsible for the poor outcomes. a global focus on esrd care in ssa countries has thus become imperative. |
cases that involve bleeding from the midgut present a much more significant challenge in terms of detection and treatment. methods of evaluation include small bowel endoscopy, arteriography, and gastrointestinal contrast studies. the differential diagnosis includes arteriovenous malformations, angiodysplasia, ulcers, and small bowel tumors. we will demonstrate that both the evaluation and treatment of these lesions may be accomplished using minimally invasive techniques. a case of occult gastrointestinal bleeding from a polypoid hemangioma located in the distal jejunum is presented. laparoscopic small bowel resection after angiographic localization was successful in removing the jejunal polypoid hemangioma. a laparoscopic approach is an appropriate and beneficial treatment modality in a bleeding midgut lesion provided the lesion can be localized preoperatively and an oncologic resection is maintained. gastrointestinal bleeding that originates in the small intestine is often difficult to diagnose and treat. angiography is frequently used to identify the source of bleeding and may also be used to locate the source of bleeding by injecting the surrounding tissue with methylene blue. when successful, this should allow a laparoscopic approach to small bowel resection and eliminate the need to manipulate the entire length of the small intestine in hopes of palpating the lesion. a 62-year - old female was found to have anemia during a routine screening exam by her primary care physician. her past medical history is significant for severe valvular heart disease secondary to rheumatic fever. she has prosthetic mitral and aortic valves, a history of a tricuspid annuloplasty, and takes coumadin. an esophagogastroduodenoscopy revealed only mild gastritis that did not account for her degree of blood loss. colonoscopic findings were unremarkable. a ugi / sbft demonstrated poor gastric motility but otherwise no abnormalities. over the 6-week course of her evaluation, she received a total of 10 units of packed red blood cells. angiographic evaluation of the superior mesenteric artery demonstrated a lesion with rapid venous filling in the distal jejunum (figure 1). laparoscopy was successful in identifying the location of the dye, and a mass was appreciated within the lumen of the small bowel.. these neoplasms may represent either a benign or malignant process with a wide range of symptoms that are often nonspecific. surgical series report an equal frequency of benign and malignant tumors, whereas autopsy series heavily favor benign tumors as the most common. this is usually occult and generally requires an extensive gastrointestinal evaluation before a diagnosis is obtained. modalities used include plain films, ugi / sbft, enteroclysis, computed tomography, routine and extended upper endoscopy, tagged rbc scanning, and angiography. this requires the lesion to be easily identified and amenable to passage of an intravascular catheter to within close proximity. methylene blue must then be injected into the surrounding tissue allowing the location of the lesion to be identified from an extramural vantage point. minimally invasive surgery using laparoscopy laparoscopic small bowel resection is an established technique and is performed by exteriorization of the diseased segment of bowel. this provides a resection identical to historical control while decreasing the invasive nature of the procedure. compromise of the surgeon 's ability to perform an adequate oncologic resection, however, mandates conversion to an open procedure. the incidence of malignancy is too high in this group of tumors to allow complacency. this offers a minimally invasive treatment with established techniques that is well tolerated by the patient and reduces recovery time. conservatism, however, necessitates the surgeon to consider that up to 50% of bleeding lesions of the small bowel may represent a malignant process, and an adequate oncologic technique should be preserved. | objectives : occult gastrointestinal bleeding can originate from the foregut, midgut, or hindgut. the evaluation of the foregut and hindgut are well established. cases that involve bleeding from the midgut present a much more significant challenge in terms of detection and treatment. methods of evaluation include small bowel endoscopy, arteriography, and gastrointestinal contrast studies. the differential diagnosis includes arteriovenous malformations, angiodysplasia, ulcers, and small bowel tumors. we will demonstrate that both the evaluation and treatment of these lesions may be accomplished using minimally invasive techniques.methods:a case of occult gastrointestinal bleeding from a polypoid hemangioma located in the distal jejunum is presented. diagnosis and treatment was accomplished using angiographic localization with laparoscopic resection.results:laparoscopic small bowel resection after angiographic localization was successful in removing the jejunal polypoid hemangioma. the patient experienced no further gastrointestinal bleeding.conclusions:we will discuss the technique of localization and treatment used in this unusual case. a laparoscopic approach is an appropriate and beneficial treatment modality in a bleeding midgut lesion provided the lesion can be localized preoperatively and an oncologic resection is maintained. |
a 63-year - old housewife presented with sustained knee pain and a palpable mass on her popliteal fossa that had lasted more than a year. after failed control of the pain with medication, a primary physician referred this patient to our clinic after taking an ultrasonography with the impression of an ' unusual soft tissue tumor in the popliteal fossa. ' physical examination revealed a soft, non - tender mass in the posteromedial area of the left knee. the mass was non - movable, without evidence of palpable pulsation, erythema or venous congestion. overall alignment of the lower extremity was varus by a finger breadth, and the left knee joint had a mild effusion without any instability or tenderness. the range of motion of the knee was slightly decreased, and the patient complained of some discomfort with forced flexion. lateral plain radiography of the left knee revealed a round, soft tissue density lesion containing bony fragments on the popliteal fossa (fig. 1). ultrasonography showed a solid mass of the dimensions 4 5 3 cm, well - encapsulated with heterogeneous echogenicity in the popliteal fossa (fig. investigation showed a well - defined round mass located just behind the posterior capsule, in close proximity to the popliteal neurovascular bundle (fig. the mass was mixed with hypointense and hyperintense lesions on both t1-weighted and t2-weighted images, and heterogeneous enhancement of the lesion was observed. due to the fact that the mass was located relatively far from the tibial nerve, but near to the joint capsule, and contained both fat and bone components, a tumor of neural origin or a vascular mass, can be excluded. with a tentative diagnosis of malignant mesenchymoma, synovial sarcoma, or teratoma, an ultrasound - guided needle biopsy was performed, and five pieces of whitish gray linear specimen obtained. a cytological examination revealed fragments of fibro - collagenous tissue with myxoid stromal change of a benign nature. the mass was located near the medial head of the gastrocnemius, under a superficial fascia. the joint capsule was adhered to the mass in certain areas, otherwise separation from the surrounding soft tissue was relatively easy. finally, a moderately solid and yellowish mass was excised and sent to a pathologist. the mass was well - circumscribed and the cut surface was yellow and fatty with traversing whitish fibro - chondroid bands and nodules (fig. microscopically, the specimen showed chondroid matrix and chondrocytes arising in the fibromyxoid band, as well as lamellar bone with osteoblasts and osteoclasts within the chondroid nodule (fig. two months postoperative, the patient had showed improvement of the chronic discomfort, and no calcified density remained on a plain radiograph. the common evaluation steps of a popliteal mass are physical examination, plain radiography, and aspiration of cystic fluid. the most common popliteal mass is a baker 's cyst, and the prevalence rate is between 5% and 19% in a large series of knee mri studies.4,5) the diagnosis of a baker 's cyst is easily made using these procedures. however, many papers in the literature have reported unpredictable disease of the popliteal area, therefore differential diagnosis and evaluation of a popliteal mass should be performed in some cases in the case of a lipoma in the popliteal area, it is generally less renitent on palpation compared with the tightness of a popliteal cyst. when the popliteal mass is accompanied by erythema with leg edema, deep vein thrombosis or popliteal vein aneurysm can be considered as a diagnosis. in addition, a pulsatile popliteal mass may be caused by pseudoaneurysm of the popliteal artery. tseng.6) reported a nerve sheath ganglion of the tibial nerve in the popliteal area. due to the fact that their case showed a positive tinel 's sign and a moderate degree of paresthesia if the character of the mass appears unusual upon physical examination, the next step should include ultrasonography or mri. ultrasonography is a very useful imaging method to identify the nature of a cystic or solid mass, and arterial or venous origin, however sometimes it is not sufficient. fiori.3) reported that a popliteal venous aneurysm in the popliteal fossa demonstrated only a mixed echogenicity mass, with no evidence of an arterial or venous nature, using color - doppler ultrasonography. tatari.7) reported a well - circumscribed mass, resembling a baker 's cyst, using ultrasonography ; however, it was finally confirmed to be pigmented villonodular synovitis. needle biopsy of the mass described in our study was performed with a view to uncovering important information about the nature of mass. shin.8) reported a case of synovial sarcoma that was located at the popliteal fossa, adjacent to the proximal tibia, and which failed to show any abnormalities on a plain radiograph. the soft tissue mass accompanied by bony lesions in close proximity to the neurovascular structure was uncovered during an mri scan. mri has the additional advantage of being able to show the anatomical orientation, important for excision of the mass. in this case, histological findings were a well - encapsulated mass containing a mixture of adipose, fibrous, and chondroid tissue, with bone formation. the lipoma area is composed of mature fat, and there is no atypical adipocyte or lipoblast to be concerned with liposarcoma, including any dedifferentiated cells. on the basis of fat necrosis adjacent to the chondroid and osseous differentiation, this osteochondroid feature is thought to be metaplasia, related to fat necrosis in a longstanding lipoma. certain authors regard this tumor as a benign mesenchymoma, due to the presence of various cell types. however, the predominant components encapsulated within the lipoma are fat tissue, cartilage and bone, thus it was finally diagnosed as osteochondrolipoma. differentiation into a diverse set of mesenchymal elements, such as blood vessels, fibrous tissue or muscle is relatively common. only a few cases of osteochondrolipoma have been reported, particularly in the thigh and chest wall, but never in the popliteal fossa.9,10) it is apparent from this case that popliteal masses are not always popliteal cysts, and careful evaluation of any mass in the popliteal fossa is essential. the following are a few suggestions to keep in mind when being presented with a popliteal mass. careful physical examination is essential to check the nature of the mass including tenderness, pulsation and a tingling sensation that do not usually exist with a simple cyst. if there are any abnormal findings upon the physical examination or plain radiography, do not hesitate to perform further imaging investigations such as ultrasonography or mri. needle biopsy should be chosen primarily over open excisional biopsy if a malignant lesion is suspected from the imaging investigation. as described earlier, the popliteal mass that was initially misdiagnosed as a simple popliteal cyst, finally turned out to be osteochondrolipoma. therefore, whenever we encounter a popliteal mass, being open to all diagnostic possibilities and evaluation procedures is paramount. | here, we describe a popliteal mass that was initially misdiagnosed as a simple popliteal cyst, which finally turned out to be osteochondrolipoma. a 63-year - old housewife presented with sustained knee pain in association with a palpable mass on the popliteal fossa. the mass was in the posteromedial area and soft, non - tender, non - movable in the posteromedial area. using plain radiography, the mass appeared as a round, soft tissue density lesion containing bony fragments. we performed an ultrasound - guided needle biopsy in conjunction with magnetic resonance imaging, followed by an open excisional biopsy. microscopically, histological sections showed a lipoma with cartilaginous and osseous differentiation, finally diagnosed as osteochondrolipoma. in conclusion, popliteal masses are not always simple cysts, and the evaluation of masses in the popliteal fossa is always necessary. |
primary pancreatic lymphoma is rare, comprising 0.2~4.9% of all pancreatic malignancies and less than 1% of non - hodgkin 's lymphoma (nhl)2 - 4). treatment and prognosis of these tumors are different. however, the diagnosis of primary pancreatic lymphoma is very difficult, because the clinical symptoms and signs resemble those of pancreatic adenocarcinoma. we report a rare presentation of diffuse large b cell lymphoma, appearing as a primary tumor of the pancreas. a 61-year old female was admitted to the hospital with the complaint of right upper abdominal pain in february 2003. on admission, the patient had a temperature of 36.9, blood pressure of 115/58 mmhg, and a pulse of 68 beats per minute. physical examination revealed a palpable non - tender mass in the right upper abdomen and icteric sclera. the hemoglobin was 8.2 g / dl with 6,400 leukocytes / mm and 247,000 platelets / mm. the alanine aminotransferase was 129 u / l (normal range (nr), 5 - 40 u / l) and aspartate aminotransferase was 65 u / l (nr, 35 - 129 u / l) and gamma - glutamyltranspeptidase was 212 u / l (nr, 8 - 61 u / l). the total bilirubin was 16 mg / dl with 12 mg / dl of direct bilirubin. the serum carbohydrate antigen 19 - 9 (ca19 - 9) was 36.9 u / ml (nr, 0 - 37 u / ml). the abdominal ultrasound demonstrated a hypoechoic 3.4 cm sized mass located at the head of pancreas ; there was dilatation of the bile duct and the gallbladder appeared to be filled with sludge. computed tomography (ct) of the abdomen showed a well defined mass located at the head of the pancreas which was slightly enhanced during the arterial phase (figure 1). endoscopic retrograde cholangiopancreatography (ercp) revealed stenosis of the distal common bile duct by extrinsic compression. percutaneous transhepatic biliary drainage was performed because of the clinical signs of fever and leukocytosis, suggesting acute cholangitis. laparotomy was performed, revealing a prominent mass located at the head of the pancreas accumulated with the duodenum and the portal area. a frozen section of pancreas revealed lymphoma and partial excision of the mass located at the pancreatic head was performed instead of the whipple procedure. microscopic examination revealed a malignant lymphoma which consisted of large anaplastic lymphocytes (figure 2a). tumor cells showed strong membrane staining for the b cell marker protein (cd20) and were negative for the t cell marker protein (cd3) (figure 2b). therefore, according to the ann arbor classification, the patient had stage ie disease. six cycles of chop chemotherapy (cyclophophamide, doxorubicin, vincristine, and prednisone) were administered without any further complications. follow - up abdominal ct showed no visible mass in the pancreas (figure 3). nhl frequently occurs at extranodal sites, most commonly in the gastrointestinal tract and rarely in the pancreas5). in this case the criteria for the definition for primary pancreatic lymphoma as used by behrns and associates, were satisfied7). these criteria include : no superficial or mediastinal adenopathy, normal leukocyte count, and findings confined to peripancreatic disease (ann arbor stage i or ii) without hepatic or splenic involvement6, 7). clinical manifestations of pancreatic lymphoma include abdominal pain (75%), a palpable abdominal mass (54%), weight loss (50%), jaundice (40%), night sweats (22%) and fever (20%)3, 6). double - contrast enhanced spiral ct is the imaging modality of choice and demonstrates the presence of a pancreatic mass in virtually all patients6). lymphoma should be suspected in the presence of a large, rapidly growing pancreatic mass4, 8). it is unlikely to have a pancreatic adenocarcinoma above 10 cm in size ; about 60% of pancreatic lymphomas are greater than 6 cm in diameter3). the presence of lymphadenopathy in the peri - pancreatic area, splenomegaly and as well as a large tumor, generally without encasement of the superior mesenteric artery, are suggestive of lymphoma. the location of the tumor in the pancreas does not appear to be helpful in determining whether the mass is carcinoma or lymphoma. in the absence of any pathognomonic clinical or radiological features the use of a ct guided fine needle aspiration (fna) has the advantage of not requiring an open surgical procedure but has the disadvantages of sampling error, difficulty in evaluating obtained sample (false positive / false negative) and the inability to subclassify the lymphoma3, 5). in a review of 269 percutaneous biopsies of pancreatic lesions with ct or ultrasound guidance, the combined accuracy in the diagnosis of malignancy was 93%, major complications were seen in three cases and no biopsy related death occurred9, 11). recently, endoscopic ultrasonography with fna has also been used successfully to identify and biopsy pancreatic lymphoma6, 10). open biopsy of the pancreas provides more tissue and allows direct visualization of the lesion and other abdominal organs and lymph nodes, but carries the morbidity and mortality associated with a surgical procedure3). with the availability of less invasive diagnostic modalities, operating to obtain tissue for pathologic diagnosis should be reserved for the rare instance when all other available modalities have failed to provide a final tissue diagnosis6). advised a more aggressive surgical approach including pancreatic resection or tumor debulking, in view of the poor survival rate with radiotherapy and chemotherapy7). currently, many institutions with a large experience of operative management for pancreatic disease have reported mortality rates of 5% or less after major pancreatic resection with an acceptable morbidity rate of 30%6, 8). however webb. reported that no evidence supported a role for extensive resection in the management of patents with pancreatic lymphoma, and that the majority of patients should be managed with chemotherapy and without surgery4, 8). extensive surgery frequently causes a variety of complications which may prevent patients from receiving chemotherapy. radiation remains a suggested general adjuvant to chemotherapy to increase the local control regardless of anatomic location6). bouvet and colleagues reported the use of radiation therapy in all cases of lymphoma of the pancreas not treated with surgery ; they reported four of eight patients with long term survival after standard chemotherapy and radiotherapy5). local failure either from residual or recurrent disease has been noted by multiple authors and accounts for more than 85% of deaths (28 of 32). because of these frequent local failures therefore, it is very important to establish a definitive diagnosis and stage of disease, to plan the modality of treatment. the range of survival time is wide and few conclusions are available since the data is not directly comparable3). the primary treatment for patients in whom the diagnosis of lymphoma can be established, with minimally invasive techniques, is combination chemotherapy with involved - field radiotherapy5). surgical resection may play a beneficial role in the treatment of localized pancreatic lymphoma6). lymphoma is an uncommon cause of obstructive jaundice, and the management for this diagnosis is controversial. operative decompression of the bile ducts, with biliary - enteric bypass, has been recommended as it allows for rapid resolution of jaundice before initiation of chemotherapy. others have observed equally rapid resolution of jaundice with a short course of radiotherapy or nonhepatotoxic chemotherapy (cyclophosphamide and prednisone). nhl is curable in more than 50% of patients with anthracycline containing combination chemotherapy regimens and radiotherapy. webb. reported complete remission in six of nine patients treated with chemotherapy at a median follow - up of 24 months. in another report, a 40% relapse - free survival was reported in 14 patients treated with chemotherapy and radiation6, 8, 11). adnan. reported that all five patients studied achieved a complete remission, and only one relapsed at 12 months after treatment ; while the others remain in remission at 84, 26, 24 and 21 months11). it is important to differentiate between primary lymphoma and the more common adenocarcinoma of the pancreas as treatment and prognosis differ significantly. primary pancreatic lymphoma should be considered in the differential diagnosis of pancreatic tumors and an attempt to obtain tissue diagnosis is always necessary before proceeding to radical surgery, especially on young patients. | primary pancreatic lymphoma is rare, comprising 0.2~4.9% of all pancreatic malignancies and less than 1% of cases of non - hodgkin 's lymphoma. many patients are diagnosed with lymphoma after radical resection. we report a rare presentation of diffuse large b cell lymphoma, appearing as a primary tumor of the pancreas. a 61-year old female was admitted to the hospital with the complaint of right upper abdominal pain. computed tomography of the abdomen showed a well defined mass located at the head of the pancreas. a frozen section of pancreas, during laparotomy, revealed lymphoma. the patient received 6 cycles of chemotherapy and is currently in complete remission. this case underscores the importance of differentiating primary lymphoma from the more common adenocarcinoma of the pancreas as treatment and prognosis differ significantly. primary pancreatic lymphoma should be considered in the differential diagnosis of pancreatic tumors and an attempt to obtain a tissue diagnosis is always necessary before proceeding to radical surgery, especially on young patients. |
recent international population and non - population studies reported overactive bladder (oab) in 10 - 17% of the adult population, depending on sex.1,2,3,4 in the u.s., a population - based study reported that 16.0% of men and 16.9% of women experienced oab.5 no study has examined the prevalence of oab in the urologic population, which is expected to be much higher. some studies have reported association of oab with age (men and women), body mass index - bmi (female), menopause (female), constipation (female), episiotomy (female), and beer consumption (men). 2, 6,7,8 in this prospective cohort study, we assess the prevalence of oab in urologic male veterans population, the need for oab screening, and risk factors for oab. an irb - approved self - administered questionnaire on urinary symptoms was given to male patients who visited the general urology outpatient clinic at a veterans administration hospital in brooklyn, ny. it included questions on lower urinary tract symptoms (luts) with 0 - 5 point scale and on quality of life with 0 - 6 (best to worst) point scale (based on a modified validated overactive bladder 8-question screener (oab - v8)9). questions on luts included urinary frequency (2 questions), urgency (2), nocturia (1), incontinence (2) and emptying (1). the questionnaire also included medical and surgical history, demographic data, bmi, medications and visit diagnosis. oab - v8 total score that was equal to or greater than 6 for men was defined as oab positive. subsequent questionnaires from the same patient were excluded. to determine the relationship between oab and other factors (age, bmi, smoking, race, diabetes, hypertension, congestive heart failure, chronic obstructive pulmonary disease, diuretic medications and hepatitis), covariates were first individually evaluated using the chi - square test. statistically significant (p < patients were excluded from a specific analysis if they did not report on the variable to be analyzed. results are presented as odds ratio and 95% confidence interval (95% ci) 10. statistical analyses were performed using stata 8.2 (statacorp, college station, tx). the major ethnicities were european american (44%), african american (37%) and hispanic american (11%). 48% had not been diagnosed with or treated for oab, luts or benign prostatic hypertrophy (bph). those with oab had a worse quality of life score. mean quality of life score for those with oab was 3.4 of 6, and those without oab 1.6. furthermore, 59% reported urge incontinence, 76% urgency, 90% frequency and 85% nocturia. there was no association of oab with bmi (p=0.61), smoking (p=0.87), race (p=0.32), diabetes (p=0.83), hypertension (p=0.10), congestive heart failure (p=0.74), chronic obstructive pulmonary disease (p=0.69), and diuretic medications (p=0.91). the risk of oab increased with age : 49% in men aged 40 - 49 years to 79% in men aged 70 - 79 years (p<0.001, or=3.9). interestingly, there was a statistically significant association between oab and hepatitis (p=0.03, or=2.2). it is expected to be much higher in the urologic setting since urinary complaint is a common reason for urologic visit. since oab is a compilation of lower urinary tract symptoms, the prevalence of luts should be higher. irwin.2 in their 5-country population study reported the prevalence of any luts to be 62.5% whereas the prevalence of oab to be 10.8%. the increase in our study is consistent with irwin. 's epidemiologic study. although a higher prevalence of oab is expected in our study population, the increase may also be compounded by variation in oab definition. most reported population studies had used the 2002 international continence society definition of oab. our study is based on a validated oab screener questionnaire (oab - v8). as with any screening tool, the sensitivity should be high but specificity may not be high. the oab - v8 questionnaire has only been validated in a primary care setting. our study showed that among those with oab, only 52% had been diagnosed with or treated for urinary symptoms (oab, luts and/or bph). furthermore, those with oab had a worse quality of life score. mean quality of life score for those with oab was 3.4 of 6, and those without oab 1.6. thus, the 48% of men with oab that are undiagnosed or untreated may benefit from better detection and treatment initiation. we found that oab increased with age : 49% in men aged 40 - 49 years to 79% in men aged 70 - 79 years (p<0.001, or=3.9). our study also found an association between oab and hepatitis (or=2.2, p=0.03). unlike previous studies by teleman.8, we found no association between oab and bmi. we also found no association with smoking, race, diabetes, hypertension, congestive heart failure, chronic obstructive pulmonary disease, and diuretic medications. the prevalence of oab in the male urologic veterans is almost five fold higher than that reported for the general population. furthermore, our study shows that oab is associated with age and a history of hepatitis. | purpose : we assess the prevalence of overactive bladder (oab) and its risk factors in a male urologic veterans population. materials and methods : validated self - administered questionnaire was prospectively given. results : among 1086 patients, oab was present in 75%, of which 48% had not been diagnosed / treated. the risk of oab increased with age. oab was not associated with bmi, smoking, race, diabetes, chf, and copd. conclusions : the prevalence of oab in this population is under - diagnosed and under - treated. |
starting from the first description of alternative splicing and constitutive splicing processes in 1977 [13 ], the importance of this process that guarantees the correct flow of information from transcription to translation in eukaryotic cells has continued to grow exponentially. in particular, one major branch of research in this area has the aim to investigate and characterize the cellular macromolecular machine (i.e., the spliceosome) that is physically responsible for the cutting and joining of intronsexons by catalyzing two transesterification reactions [4, 5 ] and the mechanisms that ensure its fidelity. as a result, research in spliceosome composition and functioning has been complemented by studies aiming to understand the sequences and molecules that determine under which conditions a particular exon or intron is selectively recognized and included in the mature transcript. therefore, after the basic elements that define introns and exons and are composed by donor and acceptor splice sites plus the branch point sequence, there was the discovery of enhancer and silencer elements that can affect either positively or negatively the way these basic elements are recognized by the spliceosome [79 ]. usually, enhancer and silencer elements are bound by members of the sr and hnrnp protein families, respectively. the recruitment of these proteins to specific sites is crucial for their activity as depending on their position with respect to the basic elements their roles can be antagonistic or, in some case, agonistic [10, 11 ]. global analyses of the ways these factors cooperate and influence each other in shaping the splicing process has only recently begun to shed light on how they promote or hinder exon recognition in a co - ordinated manner [1214 ]. rather unexpectedly, these studies have shown that sr proteins interact not only with alternatively spliced exons but also with constitutively spliced exons, and that their major role consists in recruiting the splicing machinery to splice sites [15, 16 ]. on the other hand, hnrnp proteins bind to nascent pre - mrna and influence splicing decision through a complex and finely tuned network of protein / protein interactions. the mechanisms of hnrnps actions on splicing is generally less defined than those of sr proteins. in addition to these elements, we now also know that splicing choices are affected by a myriad of other factors, ranging from chromatin modifications [18, 19 ], transcriptional factors, rna secondary structure, short noncoding rnas [22, 23 ], and various cellular stresses. in parallel to these mechanistic studies, another branch of splicing research has also addressed the functional importance of alternative splicing processes in biological pathways and in particular the way that alternative splicing isoforms of proteins can acquire different or even antagonistic biological properties [25, 26 ]. because of this ability to expand the proteome of cells, alternative splicing has represented a very useful and powerful tool that allows cells to execute the various expression programs which underlie many fundamental needs of higher organisms : from general needs such as controlling normal development and tissue - specific expression of proteins, to highly specialized processes such as dna damage response or microrna biogenesis [2733 ]. moreover, the rearrangements that a pre - mrna undergoes during the splicing process are also advantageous in terms of providing a longer half - life and better translational capacity, something that has recently begun to be exploited by the biotechnology industry. considering all these necessities and advantages, it is therefore not surprising that the number of genes that are subject to alternative splicing in eukaryotic organisms has been steadily growing. indeed, it was recently estimated that more than 90% of mammalian protein coding genes can produce at least one splicing - derived isoform expressed at potentially significant biological levels. the complexity of this system, however, also puts spliceosome functioning at risk of being impaired by the occurrence of single - point mutations in splicing regulatory elements, deletions / insertions, genomic rearrangements, and alterations at the splicing factor expression level. any of these alterations can result in a variety of aberrant splicing outcomes that usually include aberrant exon skipping, cryptic splice site selection, intron retention, and pseudoexon activation [37, 38 ]. as expected, many of these changes can lead directly to the occurrence of disease in humans, and it has now been estimated that a sizable proportion of all gene mutations leading to disease can be directly connected with the presence of a splicing defect [7, 39 ]. importantly, the introduction of novel technologies that allow fast profiling of the transcriptome seems promising for simplifying investigation of which genomic variability and plasticity events allow cancer cells to tailor specific functional units from the available exons of a gene. for example, recent rna sequencing of the breast cancer transcriptome has revealed many new splicing alterations that were not previously described. in particular, for example, it was reported that 423 primary transcripts (derived from 377 genes) were differentially spliced in triple - negative breast cancer samples (generating 496 novel isoforms). by analyzing non - triple - negative breast cancer samples, the same study found that 270 and 460 primary transcripts (derived from 242 and 387 differentially spliced genes, resp.) it has become clear that in several human pathologies, including cancer, the alternative splicing profile is aberrantly modified in a specific manner and in ways that can favor the growth and survival of cancer cells [4144 ]. the generation of these aberrant splicing profiles can occur in many ways, such as through the re - expression of developmentally regulated isoforms that had previously been shut off following early developmental stages [45, 46 ], by affecting the splicing profiles of genes that are implicated in tumor progression [47, 48 ], or through other mechanisms that generally have anti - apoptotic / metastatic consequences and that can affect response to therapies [49, 50 ]. in addition, several studies have defined that cancer - associated splicing alterations arise not only from mutations in the cancer - related genes but derive also from variations in the expression and/or activity of splicing regulatory factors. for example, it has been well established that the levels of sr- and hnrnp - proteins undergo changes associated with transformation and progression of cancers [44, 52 ]. strikingly, it has been recently reported that some members of the sr protein family of splicing factors and other components of the spliceosomal cellular machinery can actually act as oncoproteins and play a direct role in promoting tumor origin and progression [5355 ] and that external stimuli such as hypoxia can cause the aberrant redistribution of important splicing factors such as tra2 and promote the expression of tumor - promoting splicing isoforms. the case of bcl - x (bcl2l1) gene, belonging to the bclii family and implicated in the control of mitochondrial breakdown during apoptosis, is emblematic of this concept. for example, two splicing bcl - x isoforms can arise from the use of two alternative 5 splice sites within exon 2 and lead to the synthesis of a short apoptosis - promoting protein (bcl - xs) and to a long antiapoptotic form (bcl - xl). different splicing factors, including sam68, hnrnpa1, sf2/asf, hnrnp f / h, hnrnp k, sap155, and srp30c have been found to be involved in the selection of the two competing alternative 5 splice sites that give rise to these two isoforms [5861 ]. in addition, recent studies have shown that the elongation and splicing - related factor tcerg1 can bind to the bcl- x pre - mrna and promote the proapoptotic bcl - xs 5 splice site in a promoter - dependent manner. finally, the production of the proapoptotic bcl - xs splice variant seems to be improved by the core (y14 and eif4a3) and auxiliary (rnps1, acinus, and sap18) components of the exon junction complex (ejc), suggesting that ejc - associated components can regulate apoptosis at the alternative splicing level and represent a further level of vulnerability of cancer. therefore, one of the most interesting research areas in this field consists in the identification of cancer - specific splice variants or the aberrant expression of splicing - affecting proteins that could lead to their generation. examples of both these events, in fact, have already been shown to occur in some individual types of cancer, such as breast and ovarian cancer [64, 65 ]. another interesting research area in aberrant splicing events connected with tumors is the occurrence of particular types of splicing defects that involve the inclusion of new sequences (known as pseudoexons) in the mature mrna of cancer - related genes. rather more rarely, the opposite has also been shown to occur : the aberrant recognition of intronic sequences (pseudointrons) within normal exons. in this review, we have also decided to provide particular attention to these events as they are probably more common than previously considered and have not yet been the subject of particular attention. one of the reasons why these two events are particularly interesting is that these types of defects are ideally suited for novel therapeutic effector molecules that are based in rna biology. in the case of pseudoexons and pseudointrons, in fact, the major advantage of targeting this type of inclusion events is that the antisense oligonucleotides would be targeted against normal intronic sequences and thus would not remain bound to the mature mrna (possibly to interfere with later stages of rna processing such as export / translation). in the pre - mrna splicing field, the term pseudoexon has been introduced to describe exonic - like sequences that are present within intronic regions but are ignored by the spliceosomal machinery. a closer look at these sequences has often provided a reason for their inability to be recognized as normal exons : the presence of intrinsic defects in their apparently viable donor and acceptor sites or of silencer elements [6769 ] and the formation of inhibiting rna secondary structures [7072 ]. from a functional point of view, in most cases of pseudoexon insertion, the presence of an extraneous exon within the mature mrna causes either the disruption of the translational reading frame or the insertion of novel amino acid sequences following translation. as a result, the normal biological properties of the resulting protein are very likely disrupted, and this can be associated with the development of disease. unfortunately, it is still quite hard to identify reliable pseudoexon insertion events in human genes implicated in cancers by just performing a general interrogation of databases (matching 22719 ensembl protein coding genes versus 31057 entries of cangem gene list). in fact, at present, it is only possible to retrieve strong candidates for alternative splicing events in protein coding genes (table 1). as expected, a similar situation was seen when pseudogenes were investigated (defined as genomic dna sequences similar to normal genes but nonfunctional, although some can still be transcribed). in this case, inspection of 14775 pseudogenes returned a list of alternative splicing hits from which it is not easy to distinguish real events in expressed pseudogenes (table 1). more recently, some bioinformatic studies have tried to extrapolate the presence of pseudoexons in cancer tissues by developing new analysis methods of genechip gene expression array data [74, 75 ]. in this way, by comparing normal cerebellum and medulloblastoma tumors, it was possible to predict 811 significantly different expressed pseudoexons (derived from 577 genes). in addition, when nonmetastatic and metastatic medulloblastomas were compared, 13 pseudoexonic sequences were significantly expressed in a differential manner (derived from 8319 strong candidates). however, it should be noted that no experimental validation was carried out to support these predictions. therefore, presently, manual annotations remain the most reliable system for identifying real pseudoexons. fortunately, the scientific community has recently identified a certain number of cases where pseudoexon inclusion has been validated in detail. for this reason, table 2 reports all the cryptic exons described in the literature that are localized within genes whose expression was altered in cancer. first of all, regarding the mechanisms underlying pseudoexon activation, it is interesting to note that these phenomena are caused by inherited mutations resulting in the insertion of intronic sequences in the mature mrna. in this respect, it is interesting to note that among the genes presenting pseudoexon awakening directly associated with cancer origin (table 2), the creation of new splicing donor (12 events) and acceptor (7 events) sites represents the more frequent occurrence (48% and 28% of the listed events, resp.). some of the most paradigmatic examples of cancer genes such as brca1, brca2, nf1, and atm are included in these two sets. on the other hand, among pseudoexons described in cancer - related genes (table 3), the creation of 5 splice sites and of 3 splice sites comprise 55% and 15% of the listed records, respectively. moreover, pseudoexon insertion can also be triggered by the deletion of nearby donor or acceptors splice sites (4 events in both lists), highlighting the importance of the genetic milieu in splicing decisions. a deeper look into the mechanisms underlying pseudoexon activation has revealed the involvement of hnrnps in regulation of these events. in particular, the partial inclusion of a pseudoexon of nf1 gene has been found to arise from a novel intronic mutation c.31279a > g intron 30, creating a new acceptor splice site and activation of a cryptic 5 splice site. it has been found that both ptb and nptb play an active role in the pseudoexon splicing by repressing its inclusion. this finding is particularly interesting since it further supports the hypothesis that ptb / nptb might have a general role in repressing weak exons and in particular most of pseudoexons. another example of mutation causing pseudoexon activation consists in the creation of novel branch site (table 2, one event). this latter case is associated with a peculiar mutation (ivs5 ds + 232 ga) that leads to pseudoexon inclusion in nf2 gene by creating a consensus branch point. in particular, it has been found that the g > a transition, occurring at position 18 from the acceptor site of nf2 ivs5, works in combination with existing consensus splice acceptor and donor sites and causes the formation of an extra exon 5a in the nf2 gene that introduces a premature stop codon. finally, in spite of being lowly represented, gross genomic rearrangements can bring together or expose splice site sequences that would normally be very distant from each other or absent form the original sequence (one event). pseudoexon activation can also be caused by mutations that cause the creation / deletion of splicing regulatory elements (sres, 6 events). among these events, one of the most representative examples of the complex regulatory networks that can underlie pseudoexon insertion is represented by the identification of an unusual splicing defect directly related with neoplasia (figure 1). in the case of this particular event, a patient affected by ataxia - telangiectasia was found to carry a 4 nt - deletion (gtaa) within intron 20 of atm gene. this deletion, termed intron - splicing processing element (ispe), caused the inclusion of a 65 nucleotide the mechanism through which this occurs has been well characterized in recent studies. in normal conditions, the repression of the 3ss in the wild - type pseudoexon sequence (atm wt) was shown to be a direct consequence of u1snrnp binding in correspondence to the ispe sequence. the importance of this u1snrnp binding was twofold : first of all, to sterically hinder 3ss recognition by u2snrnp and secondly, to also inhibit binding of the srsf1 splice factor to the stem - loop sequence formed by this pseudoexon (figure 1(b)) [71, 72 ]. as a result, this internal u1snrnp binding event to the ispe sequence causes an unproductive u2snrnp association with the 3ss that results in the complete inhibition of pseudoexon inclusion in normal conditions (figure 1(b)). following the deletion of the guaa motif observed in the patient, u1snrnp binding to the ispe is relieved, and srsf1 is also free to bind to the internal enhancer site that becomes available (figure 1(c)). taken together, these two events result in efficient recruitment of u2snrnp to the branchsite and a better recruitment of u1snrnp to the rather inefficient 5gc splice site that lead to efficient inclusion of the pseudoexon in the mature atm mrna. this example clearly shows the complexity of pseudoexon activation events that relies on a variety of factors well beyond the simple initial mutation (i.e., 5ss or 3ss creation), and that can include the eventual presence of enhancer and silencer elements within the cryptic exon or intro, rna secondary structures, and probably several other mechanisms that have not yet been described in detail. pseudointrons (psis) represent an intriguing set of intron - like sequences localized within exons that can undergo alternative splicing and that therefore can be included in or excluded from the orf within the final mrna species. although the examples of pseudointrons reported in the review are not associated with activating mutations, we have included them because of the peculiarity of events insofar that they do not represent simple intron retention events, but rather alternatively spliced intraexonic sequences whose behaviour can resemble that of introns under particular circumstances (e.g., occurrence of previous splicing events in the processed transcript). it is this regulated use of the intraexonic splice sites that fits well with the idea that these intraexonic splice site represent false introns, even in the absence of genetic alterations. in general, however, pseudointrons are less well described compared withpseudoexons probably because of the difficulty in detecting them using available technology (a situation that may well soon change for the better because of the introduction of more sensitive and comprehensive technical approaches such as rna sequencing). at the moment, only three examples of psi have been characterized, and for at least two of these pseudointrons there are data supporting their relevance in the pathogenesis of cancer. fibronectin (fn) is an extracellular matrix protein whose functions range from cell adhesion and migration to wound healing and oncogenic transformation. the functional complexity of fn is related to the structural diversity arising from cell type - specific alternative splicing. the fibronectin pre - mrna undergoes alternative splicing primarily at three sites : two extra domain exons encoding extra structural repeats and a region of nonhomologous sequence called the type - iii connecting segment (iiics). the iiics domain is divided into three subdomains of 75 bp, 192 bp, and 93 bp, respectively, that can be alternatively spliced, thus generating up to fivevariant mrnas in humans [147, 148 ]. the subdomains of 75 bp and 93 bp encode for two cell - specific binding sites, cs1 (residues 125 of the iiics), and cs5 (residues 90109 of the iiics), respectively, that interact with the integrin 41 with different affinity [149, 150 ]. indeed, the cs1 site has approximately 20-fold higher affinity for integrins than the cs5 site. because of its intraexonic localization and splicing behavior, the 93 bp segment can be considered a pseudointron (figure 2(a)). different tissue - specific and disease - associated changes in the variants of the iiics region have been reported [152154 ], and the cs5 pseudointron is upregulated in foetal tissue and in adult liver. for the purpose of this review, it is important to note that alternative splicing of the iiics - cs5 subdomain can influence the onset and progression of cancers by affecting fibronectin activities related to tissue organization and cell - ecm interactions. in keeping with this hypothesis, in vitro studies have shown that cs5 can modulate the spreading of melanoma cells. acetylcholinesterase is a serine specific hydrolase that hydrolyzes acetylcholine, and its main function is related to the clearance of the neurotransmitter from the synaptic cleft. nonetheless, the observation that the expression of ache is not limited to cholinergic tissues has suggested the presence of additional functions. from the splicing process point of view, mammal ache has been shown to undergo alternative splicing resulting in expression of 3 isoforms, called r (readthrough), h (hydrophobic), and t / s (tailed or synaptic), that differ in their subcellular localization, tissue distribution, and developmental pattern of expression. whereas, ache - h or ache - t is the most abundant and common isoforms, the ache - r expression is low and restricted in specific cell lines, cell differentiation stage, or muscle development [159, 160 ]. interestingly, the ache - r mrna arises by retention of pseudointron4, that leads to generation of the e1-e2-e3-e4-i4-e5 mrna transcript (figure 2(b)). since pseudointron 4 includes a stop codon when it is included in mature rna, the resulting protein will be prematurely terminated by a c - terminus translated from the 5 region of i4. this variant is expected to remain monomeric. in general, the ache - r transcript can be coexpressed with the ache - t or ache - h transcripts, and variations in their relative levels seem to be important for modulation of ache functions, as well as for the pathogenesis of neurological and autoimmune disorders [161, 162 ]. intriguingly, recent studies have found that ache - r mrna accumulates in primary human astrocytomas, and that its presence is correlated with their grade of aggressiveness. in human u87 mg glioblastoma cells, it was found that ache - r protein variant can support proliferation of glioblastoma tumors by forming a complex with the scaffold protein rack1 and protein kinase ce. in addition, increased levels of an n - terminally extended n - ache - r isoform were detected in human testicular tumors indicating that the generation of the ache - r variant can be associated with the utilization of an alternative promoter in the transformed cells. finally, related functional studies have suggested that both ache - r variants (ache - r and n - ache - r) might be crucial for increasing the cellular atp levels and might support selective metabolic advantages as well as genotoxic resistance by altering p73 gene expression. although it is not yet clear whether the ache - r (as well as the other ache splicing variants) can be related directly to tumorigenesis, the observed downregulation of all these splicing isoforms in colorectal carcinoma suggests a crucial role for tumor development. a third example of pseudointron possibly implicated in cancer pathogenesis is found within the thrombopoietin (thpo) gene. thpo is the most important cytokine for regulation of platelet production, and its expression has also been reported in skeletal muscle, ovary, testis, and central nervous system (cns) [167169 ]. the thpo gene shows a complex pattern of alternative splicing ; among the six splice variants that can be generated, three of them (thpo-3, thpo-5, and thpo-6) show the peculiar alternative splicing of 116 nucleotides within exon 6 (that can therefore be classified as a pseudointron) (figure 2(c)). contrary to the fibronectin iiics - c5 and ache - r pseudointrons, the involvement in cancerogenesis of the variants deriving from the alternative splicing of the 116 nt pseudointron is less characterized. nonetheless, functional studies have demonstrated that the protein translated from mouse thpo-3 is not secreted efficiently [172174 ]. these results have suggested that thpo-3 might be implicated in the fine regulation of thpo full - length levels and in the modulation of several biological functions beyond thrombopoiesis. interestingly, parallel studies have also shown an altered expression pattern of the thpo-3, thpo-5, and thpo-6 splicing variants in human carcinomas. as a result, these observations have led researchers to hypothesize that alterations in alternative splicing of the 116 nt - thpo pseudointron might be employed as biomarker of tumor formation or progression. in conclusion, although currently there are few examples of pseudointron removal, at least three of these events have been associated with different levels of cancerogenesis, ranging from transformation to cancer progression. therefore, it is advisable that future high throughput screening analysis should be able to better associate the alternative splicing process of these pseudointrons with tumoral events. in particular, with regard to their use as possible biomarkers of transformation or of cancer staging / grading. regarding therapies, it is likely that all this information on the importance of alternative splicing for tumor development and progression may soon become extremely important for the development of novel therapeutic effectors in the fight against cancer [176, 177 ]. indeed, one of the reasons why these defects are particularly interesting is the opportunity they provide for rna therapies and the chance to actually make the jump from the bench to the bedside. currently, the field of rna therapy is rapidly growing especially in the inhibition of undesirable splice site choices by the use of antisense oligos [178180 ]. this technique, pioneered by dominski and kole, is based on the use of suitably modified antisense oligonucleotides that target specific sequences within introns and exons and block the recognition by their cellular binding factors. therefore, they are ideally suited to block unwanted splice sites that may become activated following their creation or activation. it is interesting that the role of using antisense strategies to regulate exon inclusion also occurs in physiological conditions. an example of this is snorna hbii-52 in the regulation of exon vb inclusion in the serotonin receptor 2c. to this moment, a few pilot studies aimed at inhibiting the inclusion of a pseudoexon in patient cell lines have already been reported. in particular, antisense oligonucleotides have been used to target newly created 5 or 3 splice sites deep within intronic regions of the nf1 gene to restore the normal splicing profile [91, 92 ]. similar approaches have also been successfully used to target deep intronic mutations causing pseudoexon activation within brca2 intron 12 (c.6937 + 594t > g), atm intron 11 (c.1236405c > t), and atm ivs19 (c.2639384a > g). recent advances in antisense - mediated exon skipping for dmd suggest that not only the splice sites but also exonic splicing enhancer sites or branch points might represent potential targets for inducing pseudoexon skipping [183, 184 ], and that the action of asos might be potentiated by coadministration of drugs, as shown for duchenne muscular dystrophy. an intriguing variation on the theme of the antisense oligonucleotides, successfully tested for inhibiting the 5 splice site of bcl - xl, might consist in the use of tailed oligonucleotides containing a portion annealing to sequences immediately upstream of the target donor splice site joined to a nonhybridizing 5 tail that includes binding sites for the hnrnp a1/a2 proteins. in spite of being prominent, antisense technologies are not the only possibility available for targeting these aberrant splicing events. an alternative to antisense usage is the development of sirna molecules capable of targeting the newly created system. in this manner, only the mrnas containing the pseudoexon might be selectively degraded leaving any residual normal mrna to be properly processed. the disadvantage of simply degrading the pseudoexon - bearing transcript (rather than acting on the splicing event itself) is that everything depends on the level of pseudoexon inclusion (less than 100%) and on the status of the other allele (i.e., whether it is normally expressed or not). finally, small molecule compounds might be also considered as possible therapeutic options in order to prevent the recognition of pseudoexons or modulate the recognition of pseudointrons. for example, it has been shown that sodium butyrate, an histone deacetylase inhibitor known to upregulate the expression of htra2-beta1 and sc35, promotes skipping of the pseudoexon activated by the cftr 3849 + 10kbc > t mutation and can restore functional cftr channels. in addition, the splicing of different nf1 skipped exons as a result of mutations in cis - acting sequences has been restored with administration of the small molecule kinetin. more recently, a growing body of research indicates that tale nucleases (talens) have been used with great success in a number of organisms to generate site - specific dna variations. as a result, this approach is another good candidate for an innovative therapeutic anticancer strategy for correction of deep intronic mutations that create novel splice sites. of course, crossing the difficult gap between the bench to the bedside will not be immediate even in the presence of highly efficient therapeutic molecules, whether antisense oligos, sirnas, or others. indeed, before any of these can be used in humans to treat cancer, several additional factors need to be considered. first of all, there is the development of an efficient and safe carrier system to deliver these compounds into the human body. secondly, these systems will need to be optimized in order to achieve the best balance between successful delivery, intrinsic toxicity (if any), and avoidance of undesired immune responses (in the case of antisense oligos). finally, even when all these achievements are met, there will still be the need to optimize recurrent - administration protocols to determine the uptake levels, clearance, and accumulation in various tissues (this is an often overlooked, since none of these methods will cause permanent correction of mrna splicing defects). nonetheless, the first results of this exciting news strategy are available, and there is the distinct possibility that rna - based treatment of cancer may soon enter the application stage. | in all eukaryotic organisms, pre - mrna splicing and alternative splicing processes play an essential role in regulating the flow of information required to drive complex developmental and metabolic pathways. as a result, eukaryotic cells have developed a very efficient macromolecular machinery, called the spliceosome, to correctly recognize the pre - mrna sequences that need to be inserted in a mature mrna (exons) from those that should be removed (introns). in healthy individuals, alternative and constitutive splicing processes function with a high degree of precision and fidelity in order to ensure the correct working of this machinery. in recent years, however, medical research has shown that alterations at the splicing level play an increasingly important role in many human hereditary diseases, neurodegenerative processes, and especially in cancer origin and progression. in this minireview, we will focus on several genes whose association with cancer has been well established in previous studies, such as atm, brca1/a2, and nf1. in particular, our objective will be to provide an overview of the known mechanisms underlying activation / repression of pseudoexons and pseudointrons ; the possible utilization of these events as biomarkers of tumor staging / grading ; and finally, the treatment options for reversing pathologic splicing events. |
lowering of plasma low - density lipoprotein - cholesterol (ldl - c) concentrations by chronic ldl apheresis therapy retards coronary atherosclerotic plaque progression and reduces the risk of future coronary events in patients with familial hypercholesterolemia (fh) who are refractory or intolerant to other lipid - lowering therapies. indeed, plasma ldl - c concentrations decrease by 70% immediately following a single ldl apheresis treatment session, followed by a return to pretreatment levels within 2 weeks, suggesting that chronic therapy is necessary to reduce cardiovascular disease (cvd) risk in fh patients. a single ldl apheresis session improves vascular endothelial function (vef) measured by acetylcholine - induced forearm vasodilation in fh patients undergoing chronic treatment. this effect occurs, at least in part, by decreasing oxidative stress responses that otherwise inhibit nitric oxide (no) synthesis, an antiatherogenic mediator. the duration of these benefits in chronically treated patients following a single ldl apheresis session has not been investigated. brachial artery flow - mediated dilation (fmd), a noninvasive measure of vef that is predictive of future cvd events, reflects no bioavailability, suggesting that therapies that mitigate oxidative stress would increase no synthesis, improve fmd, and reduce cvd risk. we hypothesized that fmd responses would improve following a single session of ldl apheresis in hypercholesterolemic patients undergoing chronic treatment by lowering oxidative stress and improving no bioavailability, and these benefits would persist until the subsequent apheresis session 14 d later. to test this hypothesis, hypercholesterolemic patients underwent testing of vef and biomarkers of oxidative stress and no metabolism prior to, immediately following, and 1, 3, 7, and 14 d following a single ldl apheresis session. five (4 men ; 1 postmenopausal woman) of 16 active patients in the hartford hospital ldl apheresis program agreed to participate and provided written, informed consent. all five patients had presence of coronary artery disease, including prior coronary artery bypass graft surgery (n = 2), percutaneous transluminal coronary angioplasty (n = 1), and/or myocardial infarction (n = 1). three patients had hypertension, one had prior stroke, and one had congestive heart failure. patients had undergone biweekly ldl apheresis for 3 months to 9.6 y (table 1). patients fasted for 8 h and were asked to refrain from taking dietary supplements or any medications that target the cardiovascular system (e.g., beta blockers, nitrates, calcium channel blockers, and angiotensin - converting - enzyme inhibitors) on the morning of each study visit. body mass was measured to the nearest 0.1 kg on a calibrated scale and height was measured using a stadiometer. blood pressure and heart rate were measured twice, separated by 2 min, using an automated blood pressure monitor (welch allyn ; skaneateles falls, ny) after resting for 10 min in the supine position. brachial artery fmd and plasma biomarkers were measured prior to treatment (pre), within 1 h of completion (post) of a single ldl apheresis session, and at 1, 3, 7, and 14 d post. during the ldl apheresis session, blood was removed from the patient, lipid - rich plasma separated from whole blood, apolipoprotein b - containing lipoproteins cleared by dextran sulfate adsorption (dsa) (liposorber system ; kaneka pharma america, llc ; new york, ny), and lipid - poor plasma returned to the patient. each ldl apheresis session lasted 3 - 4 h. following measurements at pre, patients were permitted a light snack and noncaffeinated beverages during the 4 h treatment session. brachial artery fmd and plasma biomarkers were measured in the morning at 1, 3, 7, and 14 d post and occurred at the same time of day (1 h) as measurements obtained at pre. brachial artery fmd was measured following established guidelines as described [9, 10 ]. briefly, following a 10 min of supine rest, the right brachial artery was imaged 13 inches proximal to the olecranon process using a 5 to 12 mhz multifrequency linear - array transducer attached to a high - resolution ultrasound machine (terason t3000 ; burlington, ma). resting brachial artery diameter and velocity were simultaneously measured for 1 min before rapid inflation (200 mmhg, 5 min) of a pneumatic cuff placed around the forearm immediately distal to the olecranon process. diameter and velocity recordings resumed 1 min before cuff deflation and continued for 3 min after deflation. end - diastolic arterial diameters and velocities were analyzed using brachial analyzer software (medical imaging applications llc ; coralville, ia). brachial fmd was calculated as the absolute and percent change in diameter from resting to peak diameter. velocity matched to the corresponding diameter was used to calculate shear rate (4velocity / diameter), an estimate of shear stress without blood viscosity. to quantify the stimulus underlying fmd, postocclusion area under the shear rate curve (srauc) was calculated, using simultaneous diameter and velocity measurements until the time that peak diameter was observed [11, 12 ]. tubes were centrifuged, plasma was collected, and cryovials were sent to clinical laboratory partners at hartford hospital for analysis of lipids or stored at 80c until analyzed. hplc - grade solvents, ascorbic acid, dtpa, methylmonoarginine, o - phthalaldehyde, pca, potassium hydroxide, and potassium phosphate were purchased from fisher scientific (pittsburgh, pa, usa). vitamin e (as - and -tocopherol) and nitro--tocopherol were measured as described, with minor modifications. plasma was extracted with hexane following saponification in the presence of ascorbic acid and then analyzed on a prominence uplc - ms system (shimadzu) equipped with an autosampler maintained at 4c (sil-30ac), a degassing unit (dgu-20a5), a column oven set to 35c (cto-30a), two lc-30ad pumps, and a lcms-2020 single quadrupole mass spectrometer. instrument control was performed using shimadzu labsolution (version 5.4). separation was performed at 0.3 ml / min on a kinetex c18 column (100 2.1 mm, 2.6 m ; phenomenex) using 60 : 40 acetonitrile : methanol as the mobile phase. detection was performed by single ion monitoring following negative ionization with a dual ion source at the following mass - to - charge ratios (m / z) : -t, 429.4 ; -t, 415.4 ; nitro--t, 460.4 ; and dl - tocol, 387.4 (internal standard). nebulizing and drying gases were supplied at 1.5 and 15 l / min, respectively, and heating block and desolvation line temperatures were 500c and 300c. plasma malondialdehyde (mda), a marker of lipid peroxidation, was measured as described, with minor modifications using a hplc - fl system consisting of a waters alliance 2695 separations module with a waters 474 scanning fluorescence detector (532/553 nm, excitation / emission). hplc separation was performed at 1.0 ml / min on a luna c18(2) column (250 4.6 mm, 5 m ; phenomenex) using 50 : 50 methanol and 25 mm phosphate buffer (ph 6.5) as the mobile phase. arginine (arg), the amino acid required for no biosynthesis, and asymmetric dimethylarginine (adma), an endogenously produced competitive inhibitor of no synthase (nos), were simultaneously measured by hplc as described, with minor modifications. in brief, arg and adma were extracted from plasma (100 l) by solid - phase extraction on a polymeric cation - exchange column (hypersep retain - cx spe column ; 30 mg, 1 ml ; fisher scientific) using ammonia : water : methanol (10 : 40 : 50, v : v : v). hplc separation was performed isocratically at 1.3 ml / min on a shimadzu lc-20adxr system equipped with a rf-20axl fluorescence detector programmed to 340/455 nm (excitation / emission) and a kinetex xb - c18 column (50 3.0 mm, 2.6 m ; phenomenex). o - phthalaldehyde - derivatives of arg and adma were eluted using 50 mmol / l potassium phosphate buffer (ph 6.5) and 6.5% (v : v) acetonitrile as the mobile phase. after the peak of arg eluted from the column, the gain setting was increased at 3 min to enable the detection of adma. after the last peak of interest eluted, the column was washed with 50% acetonitrile for 2 min and the system was equilibrated for 2 min before the next injection. analytes were quantified on the basis of peak area relative to internal standard (methylmonoarginine). data (means sd) were analyzed by spss version 19.0 (spss inc., time effects for fmd and plasma responses were evaluated using 1-way repeated measures anova with bonferroni correction to evaluate pairwise differences. multiple linear regression, controlling for with - subject repeated measures, was used to calculate correlation coefficients (r) as described. two patients completed the final study visit at d 13 and 15 following the initial ldl apheresis session because of scheduling difficulties. two patients were prescribed atorvastatin in combination with ezetimibe and niacin (n = 1) or niacin alone (n = 1). the remaining three patients were considered statin intolerant due to previous muscle complaints with statin use, with one of these statin intolerant patients taking ezetimibe. one patient reported taking vitamin e (400 iu) and a multivitamin daily. relative to pre, total c (figure 1(a)) and ldl - c (figure 1(b)) concentrations were lower 61% and 70%, respectively, at post (time : p 0.11). resting brachial artery diameter, peak brachial artery diameter, time to peak dilation of the brachial artery, or srauc (i.e., the stimulus underlying fmd) did not differ from pre at any time point following treatment (p = 0.13) (table 2). fmd responses were also unaffected by ldl apheresis (time : p = 0.70) (table 2) and individual responses showed little to no change in fmd immediately following treatment (figure 2). multiple linear regression controlling for within - subject repeated measures indicated that fmd was not related to plasma total (r = 0.03, p = 0.90) or ldl - c (r = 0.02, p = 0.93), suggesting that the reduction in circulating lipids following ldl apheresis does not immediately affect vef. plasma concentrations of - and -tocopherol were 52 and 63% lower (p 0.05). compared to post, percent plasma -tocopherol was higher (p < 0.01) at 1, 3, 7, and 14 d, whereas -tocopherol was higher (p < 0.01) relative to post at 3 and 7 d. relative to pre, nitro--tocopherol decreased (p < 0.01) by 69% immediately following ldl apheresis treatment and remained 49% and 41% lower (p < 0.01) at 1 and 3 d, respectively (table 3). compared to post, plasma nitro--tocopherol was higher (p < 0.01) at 3, 7, and 14 d. plasma - (r = 0.86, p < 0.01) and -tocopherol (r = 0.63, p < 0.01) concentrations were directly related to plasma ldl - c, probably because tocopherol is transported in ldl particles. furthermore, plasma nitro--tocopherol concentrations were also directly related to plasma ldl - c (r = 0.77, p < 0.01), suggesting that acute cholesterol lowering decreased nitrative stress. plasma tocopherols were not related to fmd (r = 0.070.14, p = 0.490.75), suggesting that reductions in antioxidants and nitrative stress following ldl apheresis do not alter vef. plasma mda, arg, and adma concentrations, and the ratio of adma : arg, were unaffected by treatment (table 3). duration of ldl apheresis treatment was not related to changes in fmd or plasma biomarkers. the low volume of patients receiving ldl apheresis therapy (~400 in the us), particularly at a single medical center, and the inconvenience of multiple follow - up visits, limited the number of participants available for the present study. nonetheless, contrary to our hypothesis, findings of this study in patients treated chronically for hypercholesterolemia indicate that, despite substantially lowering ldl - c, vef and plasma markers regulating vascular homeostasis are unaffected by a single session of ldl apheresis. indeed, we show that ldl apheresis had no effect on shear - induced fmd responses or biomarkers of no status (arg, adma) or the lipid peroxidation marker mda. thus, while ldl apheresis is effective in lowering cvd risk, the mechanism by which this occurs is likely independent of no - dependent vef and improvements in lipid peroxidation. impaired brachial artery fmd, but not structural atherosclerosis, is present in children with fh compared to age- and sex - matched controls, suggesting that hypercholesterolemia increases cvd risk even at a young age. chronic ldl apheresis is a treatment option for fh patients who display markedly elevated ldl - c levels despite maximally tolerated lipid - lowering medications. there are currently two ldl apheresis systems approved in the us : dsa and heparin - induced extracorporeal ldl precipitation (help). both systems are similarly effective in lowering ldl - c concentrations, but it is unclear if these two methods are representative in terms of effects on vef. a single ldl apheresis session by dsa increased forearm blood flow responses to intra - arterial acetylcholine infusion in seven hypercholesterolemic patients, and this increase was associated with reduced plasma oxidized ldl concentrations, suggesting that ldl apheresis decreases oxidative stress responses that otherwise impair no - dependent vef. compared with before treatment, ldl apheresis increased acetylcholine - induced, but not basal, concentrations of plasma no metabolites by 82%, suggesting that ldl apheresis in the absence of a direct pharmacologic stimulus does not augment no production in patients treated chronically for hypercholesterolemia. we measured arg and adma concentrations by hplc and calculated adma : arg, an indirect index of no biosynthesis. we observed no change in arg and adma concentrations following ldl apheresis by dsa, further supporting a lack of change in no - mediated vef. our observation that marked reductions in ldl - c levels by dsa do not improve shear stress - induced vef is in agreement with prior data showing that fmd was unaffected in six hypercholesterolemic patients treated chronically with help. in the prior study, fmd measured pretreatment (7.6%) and posttreatment (8.2%) was similar to that of a normocholesterolemic group (n = 12 ; ~9%), suggesting that chronic ldl apheresis therapy normalizes vef, thus minimizing acute changes in shear stress - induced vasoactivity with each treatment. individual patient responses in the present study revealed little to no change in fmd immediately following ldl apheresis, suggesting that statistically significant improvements in vef would be unlikely to occur even if our sample size was increased. the variability inherent to fmd testing and lack of an appropriate control group at baseline limits our interpretation that long - term ldl apheresis treatment normalizes vef. future studies should determine if vef is improved in newly diagnosed patients following their first ldl apheresis treatment session and whether improvements in vef with long - term ldl apheresis therapy, additive of chronically lowered ldl - c concentrations, contribute to decreased cvd risk. vitamin e functions as a chain - breaking antioxidant and is carried in plasma as part of circulating lipoproteins. mol / l) receiving chronic (3 mo9 y) ldl apheresis treatments compared to normocholesterolemic controls (23.7 3.9 mol / l). following a single session of ldl apheresis by dsa, serum concentrations of very - low - density lipoprotein (vldl) + ldl - c and vitamin e decreased by 74% and 63%, respectively. in the present study, plasma - and -tocopherol concentrations decreased by 5263% immediately following ldl apheresis, and -tocopherol remained 36% lower relative to pretreatment at 1 d. both - and -tocopherol scavenge reactive oxygen species, whereas -tocopherol additionally scavenges reactive nitrogen species. nitro--tocopherol is a nitrative stress marker resulting from -tocopherol mediated scavenging of reactive nitrogen oxides. we observed that plasma ngt remained 41% lower relative to pretreatment levels at d 3. further study is warranted to determine if -tocopherol supplementation prevents ldl apheresis - induced lowering of vitamin e and improves vef. prior studies investigating the effect of ldl apheresis on oxidative stress have produced conflicting data, effects potentially attributable to the heterogeneity of patients studied, influence of other lipid - lowering therapies (i.e., statins) on oxidative stress, or the variety of biomarkers used to assess oxidative stress. decreased plasma oxidized ldl following ldl apheresis suggests a beneficial effect of ldl apheresis on oxidative stress despite acute reductions in circulating antioxidants. in contrast, plasma concentrations of the oxidative stress marker 8-iso - prostaglandin - f2 were unaffected by ldl apheresis in six fh patients. similarly, we observed no effect of a single ldl apheresis on the plasma lipid peroxidation marker mda. in conclusion, acute cholesterol reduction by ldl apheresis did not alter vef, oxidative stress, or no homeostasis in patients treated chronically for hypercholesterolemia. additional study is needed to define how alterations in vitamin e status and nitrative stress following ldl apheresis potentially regulate future cvd risk. | objective. to investigate vascular endothelial function (vef) responses to a single low - density lipoprotein (ldl) apheresis session in hypercholesterolemic patients undergoing chronic treatment. methods. we measured brachial artery flow - mediated dilation (fmd), plasma lipids, vitamin e (- and -tocopherol), markers of oxidative / nitrative stress (malondialdehyde (mda) and nitro--tocopherol (ngt)), and regulators of no metabolism (arginine (arg) and asymmetric dimethylarginine (adma)) prior to (pre) and immediately following (post) ldl apheresis and at 1, 3, 7, and 14 d post in 5 hypercholesterolemic patients (52 11 y). results. relative to pre, total cholesterol (7.8 1.5 mmol / l) and ldl - cholesterol (6.2 1.2 mmol / l) were 61% and 70% lower (p < 0.01), respectively, at post and returned to pre levels at 14 d. brachial fmd responses (6.9 3.6%) and plasma mda, arg, and adma concentrations were unaffected by ldl apheresis. plasma -tocopherol, -tocopherol, and ngt concentrations were 5269% lower at post (p < 0.01), and -tocopherol remained 36% lower at 1 d whereas ngt remained 41% lower at d 3. conclusions. acute cholesterol reduction by ldl apheresis does not alter vef, oxidative stress, or no homeostasis in patients treated chronically for hypercholesterolemia. |
health during adolescence and adulthood is completely related to family behavior patterns during childhood and adolescence (1). family health and functioning can also play a significant role in children s future behavior (2). studies show that parental psychological symptoms and problems as risk factors are related to externalizing and internalizing problems in children (3, 4). physical and psychological characteristics, as well as conditions governing family member relationships (such as depression, aggression, and emotional coldness) endangers the physical and psychological health of family members, especially children. those living in families with high levels of conflict, misbehavior, coldness, and lack of support will suffer poor mental health (5, 6) and face a wide range of physical and mental health problems (7). in a study on children with eating disorders, bosco. (8) found that there was a relationship between parental psychological symptoms and children s psychological symptoms. appropriate dietary patterns is another factor that affects well - being and enjoyment of a long healthy life (7). family environment and parents play a significant role in dietary patterns and eating behaviors (9). children s first experiences towards their eating habits and behaviors occur in the family environment, and this behavioral modeling is under the influence of parents (10). in his studies, bruch and touraine (11) found that parental, especially maternal, mental disorders (anxiety and depression) are related to high levels of dietary intake. in another study on children with eating disorders, laporte and stunkard (12) found that parents understanding and awareness of dietary behaviors are related to the successful treatment of their children. about half of premature deaths under the age of 65 are related to dietary factors (13). healthy eating, intake of nutrients required for the body, and having a healthy lifestyle are among the factors associated with the outbreak of chronic diseases such as cancer, hypertension, and cardiovascular diseases. accountability and individual choices play a significant role in creating a healthy lifestyle and dietary pattern during life. the statistical population of this descriptive - correlational study includes all guidance school and high school students of shiraz and their parents. the study aimed to investigate the relationship of parental mental health and dietary pattern with adolescent mental health. the samples included 250 individuals who were selected using random cluster sampling from the schools in four educational districts in shiraz. then, two classes out of each school were selected, and all students and their parents were investigated. in addition to a demographic characteristics checklist, the food frequency questionnaire (ffq) and the general health questionnaire (ghq-28) were used in this study. the food frequency questionnaire (ffq) is generally the most appropriate long - term assessment method. ease of use, relatively low cost, and comparitvely quick assessment of people s usual intake have turned this questionnaire into a fully functional tool. since this questionnaire is the best possible tool to classify people based on their usual food and nutrition intake, accurately measuring intake through the questionnaire is very important (14). this questionnaire consists of 54 food items accross the six major food groups (breads and cereals, dairy products, fruits, vegetables, meats and proteins, and others). the questionnaire was assessed by some nutrition experts. as previously mentioned, the questionnaire is able to assess family dietary patterns. chronbach s alpha was used to assess the reliability of the questionnaire, which included 0.6, 0.43, 0.85, 0.77, 0.32, and 0.82 respectively. the general health questionnaire (ghq-28) this questionnaire has been translated into 138 different languages, and many studies have been conducted in 70 countries using this questionnaire (16). questions 1 - 7, 8 - 14, 51 - 21 and 22 - 28 are related to the subtests of physical symptoms, anxiety, social dysfunction, and depression, respectively. taghavi (17) calculated the validity of this questionnaire through factor analysis with varimax rotation and presented coefficients between 0.71 and 0.84 for the above - mentioned subscales. the study also assessed the reliability of this test using chronbach s alpha and reported that this coefficient was 0.84, 0.71, 0.84 and 0.84 for the subscales of physical symptoms, anxiety, social functioning, and depression, respectively. given these coefficients and the emphasis on repeated administration of the general health questionnaire in iranian society, the validity and reliability of the questionnaire has been confirmed. in addition to a demographic characteristics checklist, the food frequency questionnaire (ffq) and the general health questionnaire (ghq-28) were used in this study. the food frequency questionnaire (ffq) is generally the most appropriate long - term assessment method. ease of use, relatively low cost, and comparitvely quick assessment of people s usual intake have turned this questionnaire into a fully functional tool. since this questionnaire is the best possible tool to classify people based on their usual food and nutrition intake, accurately measuring intake through the questionnaire is very important (14). this questionnaire consists of 54 food items accross the six major food groups (breads and cereals, dairy products, fruits, vegetables, meats and proteins, and others). chronbach s alpha was used to assess the reliability of the questionnaire, which included 0.6, 0.43, 0.85, 0.77, 0.32, and 0.82 respectively. the general health questionnaire (ghq-28) was designed by goldberg and hillier in 1979 (15). this questionnaire has been translated into 138 different languages, and many studies have been conducted in 70 countries using this questionnaire (16). questions 1 - 7, 8 - 14, 51 - 21 and 22 - 28 are related to the subtests of physical symptoms, anxiety, social dysfunction, and depression, respectively. taghavi (17) calculated the validity of this questionnaire through factor analysis with varimax rotation and presented coefficients between 0.71 and 0.84 for the above - mentioned subscales. the study also assessed the reliability of this test using chronbach s alpha and reported that this coefficient was 0.84, 0.71, 0.84 and 0.84 for the subscales of physical symptoms, anxiety, social functioning, and depression, respectively. given these coefficients and the emphasis on repeated administration of the general health questionnaire in iranian society, the validity and reliability of the questionnaire has been confirmed. the samples consisted of male students (33%) and female students (67%). the results of dietary pattern analysis in the students showed that the highest and lowest intakes belonged to dairy products and vegetables with an average of 2.57 and 2.04, respectively. simultaneous entry multiple regression analysis was used to assess the relationship between parental mental health and adolescent mental health. parental mental health and adolescent mental health were analyzed as predictor and criterion variables, respectively. it explains 22% of the variance in children s mental health. to assess the relationship between parental mental health and children s mental health, the results of simultaneous entry multiple regression analysis showed that physical anxiety, social functioning, depression, and general health dimensions predicted 13%, 24%, 11%, 24%, and 23% of the variance of criterion variables, respectively. these results also showed that each parental mental health dimension is related to the same dimension in adolescent mental health. simultaneous entry multiple regression analysis was also used to assess the relationship between dietary pattern and adolescent mental health. first, dietary pattern and children s mental health dimensions were analyzed as predictor and criterion variables, respectively. in analyzing the findings in the physical (r = 0.04, r= 0.19), anxiety (r = 0.2, r= 0.04), and social functioning (r = 0.22, r = 0.05) dimensions, no significant relationship was observed between the dimensions of dietary pattern and children s mental health. among dietary pattern dimensions, only vegetable intake had a significant negative relationship with adolescent depression (r = 0.27, r= 0.07). in other words, increased vegetable intake is accompanied by decreased adolescent depression. on the whole, the results showed that the two pattern dimensions of fruit (r = 0.15, p < 0.05) and vegetable (r = 0.16, p < 0.05) intake have a significant negative relationship with overall parental mental health. in other words, increased fruit and vegetable intake is accompanied by increased parental mental health. the results also showed that parental depression has a significant positive relationship with meat intake. predictor variables explain 4% of the variance in this criterion variable (table 4). there is no significant relationship between the dimensions of parental mental health and dairy products intake. according to the results shown in table 4, there is a significant negative relationship between the anxiety and social dysfunction dimensions and fruit intake. in other words, the results of simultaneous regression analysis to predict vegetable intake in terms of parental mental health showed that the intake of vegetables (r = 0.21, r = 0.04), breads and cereals (r = 0.15, r = 0.02), and other foods (r = 0.09, r = 0.01) has no significant relationship with the dimensions of parental mental health. this study aimed to investigate the relationship between parental mental health and dietary pattern of adolescents. parental mental health, and the mental and emotional atmosphere within families, have a significant relationship with children s mental health. studying risk factors shows that parents psychological symptoms and problems are related to the externalizing and internalizing of problems in children (3, 4, 7). stressors resulting from parental psychopathology, family conflicts and disputes, marital discord, and emotional coldness can cause and intensify children s psychological problems (4, 18). through environmental impacts, tension and aggression (20 - 24), emotional coldness (24), neuroticism (6), marital discord and economic constraints (8, 9), stress, anxiety, and depression (6, 25 - 27) are among the factors influencing the mental health of family members, especially children. in a study entitled the relationship between parental psychological problems and characteristics with obesity in adolscents, favaro and santonastaso (6) found that maternal neurotic traits and expressed anxiety through physical (somatic) symptoms were related to some degree to obesity in children. perceived parent - induced stress by children can be related to nutritional behavior and food pattern (25 - 27) and intake. sometimes, changes in healthy food intake patterns and high - energy, high - fat, and high - sugar foods can be also considered as an avoidance coping mechanism against stress (28). johnson. (29) also considered family dietary patterns as a coping mechanism against negative emotions in adolescents. through the increasing of negative mood and feeling of loss of control therefore, a family s quality and functioning, as well as their psychological health, can be considered an important predictor variable that is related to emotional and behavioral problems in adolescents (31, 32), including poor dietary habits (25, 26), obesity and weight gain (30), risky behaviors and substance abuse (33). in studying family and parent - child pshychodynamics, three states are most highlighted : 1) parenting practices and creating a healthy lifestyle without useless rules, strict regulations, and emotional coldness (22, 24) ; 2) parental, especially maternal, mental health (6, 11) ; and 3) children s problems concerning education and learning, which sometimes includes irritable mood and internal reaction (feeling of anxiety, depressed mood, psychosomatic symptoms) or external reaction (suicidal behavior, aggression, oppositional behavior) (34). in the individual vulnerability model inadequate care, attachment, low self - esteem, and poor social skills are mentioned. according to this model, parental psychopathology and parenting practices are more effective in increasing the risk of eating disorders. parental feeding practices (35 - 37) and intake of different types of foods are under the influence of the family (38 - 41). in addition to modeling food choice, the family creates feeding practices and food acceptance patterns. in the psychopathological model, the first stage is to help patients with eating disorders using cognitive approaches and stopping unhealthy diets. the next stages deal with management, stress control, problem solving, and impulse control techniques in order to increase self - control (30). therefore, it is necessary to pay attention to psychological factors in treatment programs and eating disorder prevention. given the limitations of this study, such as retrospective data collection, there might be some errors in recalling past behaviors. | backgroundtoday, ensuring people s health and well - being has become a concern for societies. health status results from an interaction of an individuals various psychological, social, and physical aspects.objectivesthis study aims to investigate the relationship of parental mental health and dietary pattern with adolescent mental health.patients and methodsin this study, 250 high school students in shiraz were selected using random cluster sampling. the samples were analyzed using the food frequency questionnaire (ffq) and the general health questionnaire (ghq-28).resultsaccording to the findings, parental mental health explains 22% of the variance in children s mental health, so that in simultaneous regression, physical dimensions, anxiety, social functioning, and depression predicted 13%, 24%, 11%, and 24% of the variance of criterion variables, respectively. no significant relationship was observed between dietary pattern and adolescent mental health dimensions. there was a significant negative relationship only between depression and vegetable intake. moreover, fruit (r = 0.15, p < 0.05) and vegetable (r = 0.16, p < 0.05) intake had a significant relationship with parental mental health dimensions.conclusionsparents mental health and their psychological characteristics can be related to children s mental health and affect their dietary intake patterns. |
neuropathic pain caused by a lesion or disease of the somatosensory system is refractory to routine analgesic measures [1, 2 ]. following nerve injury, the sensory nervous system undergoes maladaptive changes that result in neuronal hyperexcitability [35 ]. the spinal dorsal horn is a relay station in which sensory information from dorsal root ganglia (drg) is received, integrated, and relayed to several brain regions. multiple alterations distributed widely across the peripheral and central nervous system contribute to the development of neuropathic pain. the peripheral nervous system is subject to damage, and the alterations are evident in the drg. despite the fact that intensive research activity is focused on the changes of ion channels, growth factors, cytokines, and glia cells in the drg, matrix metalloproteinases (mmps) are a family of zinc - dependent endopeptidases that play crucial roles in a wide range of proteolytic processes. more than 20 members of the family were reported, such as collagenase-1 (mmp-1), stromelysin-1 (mmp-3), matrilysin (mmp-7), gelatinase a (mmp-2), gelatinase b (mmp-9), and mt1-mmp (mmp-14) [6, 7 ]. recent studies suggested that mmps are widely implicated in inflammation and tissue remodeling associated with various neurodegenerative diseases through the cleavage of the extracellular matrix and enhancement of cytokines, chemokines, growth factors, cell surface receptors, and cell adhesion molecules [5, 6 ]. meanwhile, they are also involved in supporting regeneration and vascular remodeling processes [79 ]. when the nervous system is injured, transcription and synthesis of mmps in several cell types will increase to promote local repair, remyelination, regeneration, and even angiogenesis [1013 ]. moreover, recent studies demonstrated that mmps also play crucial roles in nociception and hyperalgesia [10, 14 ], especially in the neuropathic pain and migraine [10, 15 ]. extracellular matrix metalloproteinase inducer (emmprin) plays a key regulatory role in several mmps activities [1719 ]. cd147 (human), ox47 (rat), basigin, m6 antigen, neurothelin, ht7, and gp42 are different names for emmprin in different species [1720 ]. numerous studies have shown that emmprin display a remarkable repertoire of biological functions, including cell growth and migration, tissue regeneration, and cell differentiation and adhesion. excessive expression of emmprin was demonstrated to increase the invasiveness of tumor cells and play a role in the pathophysiology of various disease processes [2124 ], such as atherosclerosis, acute myocardial infarction [26, 27 ], and transient and permanent focal cerebral ischemia. in vivo study showed that altered mmp expressions of tumor stromal fibroblasts were closely correlated with the expression level of cd147 [3032 ]. relevant studies manifested that fibroblasts transfected with restructuring cd147 adenovirus vector upregulated the expressions of mmp-1 and mmp-3. the role of emmprin in the development of neuropathic pain induced by nerve injury is not clear. the present study examined the expression changes of ox47 in the drg and spinal dorsal horn in neuropathic pain condition induced by peripheral nerve injury. male sprague - dawley rats (200220 g), purchased from animal center of fourth military medical university, were housed in groups of six under the constant temperature (25 1)c and 12 h light / dark cycle with free access to food and water. behavioral tests were conducted by an observer blind to the behavioral analysis and drug treatments. all the operating procedures, in accordance with ethical guidelines, were approved by the animal care committee. all animals were deeply anesthetized with sodium pentobarbital (40 mg / kg) by intraperitoneal injection. then the l5 spinal nerve ligation (snl) surgery was conducted as previously described. briefly, the l5 spinal nerve was isolated through the removal of spinal transverse process. subsequently, the l5 nerve was tightly ligated with 5 - 0 silk thread twice in 0.3 cm interval. all animals were transmitted to feeding room, where they were closely monitored to recover from the operation. control surgery was subjected to the same procedure except for the ligation of l5 spinal nerve. rats were placed individually in cages (30 cm 30 cm 30 cm) with a wire mesh bottom (1 cm 1 cm 1 cm) and fully habituated three times prior to the assessment of paw withdrawal mechanical threshold (pwmt) with a frequency of one hour every day. one day before the snl surgery, the baseline of pwmt was measured. one day after surgery, the pwmt was measured again to exclude the unsuccessful model (motor dysfunction or pain threshold value did not decrease obviously) followed by measurement at different postoperative days (1 d, 3 d, 7 d, 14 d, and 21 d). after acclimatization (30 min), mechanical nociceptive thresholds were determined by paw withdrawal to stimulation of the glabrous surface of the paw. calibrated von frey filaments (stoelting, 1, 1.5, 2, 4, 6, 8.3, 11.1, 16.5, and 26 g) were applied with enough force to cause buckling of the filament. if rats appeared to shake the foot, lick foot, or show withdrawal behavior within 5 s, then it was defined as positive reaction. at the same force once more than sixty percent of measurement appeared as positive reaction, the minimal force was determined as the paw withdrawal mechanical threshold. rats were transcardially perfused with 0.1 m pbs after deep anesthesia with sodium pentobarbital. the l5 drgs and spinal cord segments were then rapidly removed, followed by being homogenized in a ripa lysis buffer (beyotime inc., nantong, china) containing a proteinase inhibitors phenylmethanesulfonyl fluoride (pmsf, 1 mm) (beyotime inc., protein concentrations were measured by the bca assay (pierce biotechnology) and 15 g proteins were loaded, separated on a 12% sds - page, and transferred to polyvinylidene difluoride membranes (pvdf). the pvdf membranes were subsequently immunoblotted with the appropriate primary antibodies including mouse monoclonal antibody to ox47 (1 : 500, santa cruz biotech, us) and anti - rat actin mouse monoclonal antibody (20 g / ml, chemicon international, inc.). after being extensively washed, the membranes were incubated with a horseradish peroxidase - conjugated goat anti - mouse secondary antibody (zhongshanqinqiao, beijing, china). signals were detected by an ecl kit (pierce biotechnology) according to the manufacturer 's instructions. cdna was synthesized by superscript first strand synthesis kit (invitrogen, us) according to the manufacturer 's standard protocol. ox47 and glyceraldehyde-3-phosphate dehydrogenase (gapdh) mrna expression levels were measured by mini - opticon real - time pcr detection system (bio - rad, hercules, ca, usa) in sybr green master mix (takara, otsu, japan) according to a standard protocol. finally, all data were analyzed by opticon monitor software (version 3.1 ; bio - rad). all primers were synthesized by the shanghai sangon biological engineering technology and services co. ltd. the sequences of pcr primers are listed : ox47 : 5-gtttgtgaagctgatctgcaag-3 5-acagctcaggcgtggatataat-3 5-gtttgtgaagctgatctgcaag-3 5-acagctcaggcgtggatataat-3 gapdh : 5-ggcaagttcaatggcacagt-3 5-tggtgaagacgccagtagactc-3 5-ggcaagttcaatggcacagt-3 5-tggtgaagacgccagtagactc-3 the rats were deeply anesthetized with sodium pentobarbital (40 mg / kg) and perfused through the ascending aorta with saline followed by 4% paraformaldehyde. the l5 spinal cord and dorsal root ganglion were postfixed with the same fixative for 2 h and then cryoprotected in a solution of 20% sucrose in 1% phosphate buffer (ph 7.4) overnight at room temperature. the serial coronal sections (40 m) were cut by a cryostat microtome (cm1900, leica, germany). in double labeling experiments, all sections were blocked with 2% goat serum and incubated overnight at 4c with mouse monoclonal antibody to ox47 (1 : 500, santa cruz biotech, us), polyclonal rabbit anti - glial fibrillary acidic protein (1 : 1000, dako, us), anti - collagen iv (1 : 1000, sigma, us), and anti - laminin (1 : 1000, sigma, us). subsequently, the slices were washed with 0.01% pbs three times and incubated with the respective cy3-conjugated or fitc - conjugated (1 : 1000, sigma, us) secondary antibody for 30 minutes in the dark at room temperature. eventually, the sections were observed by using a laser scanning confocal microscope (olympus fv1000, tokyo, japan). shanghai, china) was used to generate short hairpin rna (shrna) specific for rat emmprin (ox-47). four different regions of ox47 mrna (gene i d nm 001109882) were selected as the rnai target sites, namely, 394412 bp, 756774 bp, 900918 bp, and 12061220 bp. another pair of oligonucleotides (designated as shrna - control) encoding a nonspecific shrna, a negative control, was also synthesized. these oligonucleotides were annealed and subcloned into the age i and ecor i restriction endonuclease sites of pmagic 4.1 lentiviral vector (sunbio, shanghai, china), which included the green fluorescent protein (gfp) tag. hek293 cells and madb106 mammary adenocarcinoma cells were cultured in medium containing rpmi 1640 (gibco, brl life technologies, karlsruhe, germany) with 10% foetal bovine serum (fbs, gibco) at 37c under a mixture of 95% air and 5% co2. hek293 cells were cotransfected with these lentiviral vectors together with packaged plasmid pmd2.g (addgene plasmid # 12259) and pspax2 (addgene plasmid # 12260) by lipofectamine 2000 (invitrogen, carlsbad, ca, usa) according to the manufacturer 's instructions. forty - eight hours post transfection, harvested madb106 cells were then infected with 1 ml of viral stock containing 5 g / ml polybrene and enhanced infection solution (eni.s) for 48 h. then this medium was replaced by normal culture medium. the shrna oligonucleotides with maximum effect (75%) of silencing for ox47 were listed below : 5-ccggggacacaggcacttatgaattcaagagattcataagtgcctgtgtccttttttg -3 5-aattcaaaaaaggacacaggcacttatgaatctcttgaattcataagtgcctgtgtcc-3 5-ccggggacacaggcacttatgaattcaagagattcataagtgcctgtgtccttttttg -3 5-aattcaaaaaaggacacaggcacttatgaatctcttgaattcataagtgcctgtgtcc-3 lentivirions expressing either gfp or shrna against ox47 were injected into drg in vivo using a published method modified version. briefly, lentiviral preparations (1 10 transfection units per ml) were diluted with 20% mannitol in a ratio of 1 : 1 and injected unilaterally into l5 drgs (6 l per drg, or 3 10 transfection units per drg) in deeply anesthetized condition. at second day after viral infection rats were sacrificed on 722 days after snl ; then the l4-l5 drgs were rapidly isolated and subjected to western blot analysis for ox47 and -actin. student 's t - test or analysis of variance (anova) for random measures was performed followed by post hoc fisher 's test to determine statistically significant differences. qrt - pcr and western blot were used to assess the changes of ox47 expression in drg and spinal cord after snl. ox47 molecules include glycosylated (mw 5672 kd) and nonglycosylated (mw 25 kd) forms. the expression level of both mrna (figure 1(a)) and protein (figures 2(a) and 2(c)) of ox47 in the ipsilateral (snl) l5 drg was significantly increased compared to the contralateral side. particularly, the nonglycosylated ox47 with 25 kd was exceptionally enhanced. the increased expression of mrna and protein occurred from the first day after snl, reached the peak at the fourteenth day, and was maintained at a relatively stable level for at least 21 days (figures 1(a) and 2(c)). however, the expression level of both mrna (figure 1(b)) and protein (figure 2(b)) of ox47 in the spinal dorsal horn showed no significant difference between the ipsilateral and contralateral sides. in line with the mrna expression, only the glycosylated rather than nonglycosylated ox47 was detected with low level expression in western blotting (figure 2(b)). taken together, these data indicated that peripheral nerve injury significantly augmented the expression of emmprin in spinal drg. to further characterize the cellular localization of ox47 in drg, we carried out double - labeled immunostaining of ox47 with glial fibrillary acidic protein (gfap), a marker of astrocyte (satellite glial cell in drg). in the nave rat, three days after snl, the activated satellite glial cells (sgcs) encircled and surrounded large-, medium-, and small - sized drg neurons (figure 4). ox47 immunoreactivity was mainly detected in the extracellular matrix around drg neurons and partially overlapped with flattened sgcs positive for gfap (figure 4). we next performed double labeling of ox47 with collagen iv and laminin. indeed, ox47 immunoreactivity was overlapped with collagen iv in drg 's capsule and extracellular matrix (figure 5(a)), while the laminin immunoreactivity was mainly colocalized with ox47 in drg 's capsule (figure 5(b)). overall, the colocalization with collagen iv, sgcs, and laminin suggested that ox47 was mainly expressed in the extracellular matrix of drg. to further shed light on the functional role of ox47 in neuropathic pain condition, we constructed a shrna lentiviral vector and completed packaging the lentivirus. seven days after injection of the shrna into drg, the expression of ox47 mrna in the drg was significantly suppressed (figure 6(a)). in contrast to the ox47 shrna, the control rna did not significantly alter the ox47 mrna expression. pretreatment of ox47 shrna significantly increased the paw withdrawal threshold as compared with control rna - treated animals and thus attenuated the mechanical allodynia as expected (figure 6(b)). these data indicated that pretreatment with ox47 shrna markedly attenuated the development of mechanical allodynia after nerve injury. the present study provided evidence that upregulation of emmprin in the dorsal root ganglion was involved in the development of mechanical allodynia after nerve injury. firstly, the expression of emmprin mrna and protein was apparently increased in drg after snl, which is consistent with the notion that drg neurons undergo significant plastic changes in neuropathic pain conditions. secondly, emmprin was colocalized with collagen iv, laminin-1, and sgcs, indicating that emmprin was mainly expressed in the extracellular matrix of drg. drg neurons were surrounded by the flattened sgcs and basal laminae of the extracellular matrix [37, 38 ]. the basal lamina consists of various types of molecules including type iv collagen, laminins, entactin / nidogen, and heparan sulfate proteoglycans [3941 ]. sgcs are linked to each other by adherent gap junctions and contain several ion channels, receptors, and adhesion molecules. following peripheral nerve injury, sgcs underwent changes in cell number, structure, and function [38, 4245 ]. several reports demonstrated that gfap expression was upregulated in sgcs after snl [4648 ]. the upregulation of emmprin in extracellular matrix suggested that nerve injury induced significant changes of molecular content in extracellular matrix surrounding the neuron - sgc units. finally, administration of the emmprin shrna significantly suppressed mechanical allodynia induced by spinal nerve injury. it was well accepted that the neuron - glia - neuron positive feedback loop leads to the generation and maintenance of neuropathic pain. after nerve injury, proinflammatory cytokines such as il-6, il-1, and tnf- were released from activated glial cells in drg, whereby these factors led to peripheral sensitization by enhancing excitability of drg neurons [16, 4953 ]. the present study suggested that the extracellular matrix may be also involved in the development of neuropathic pain ; that is, the formation of extracellular matrix - glia - neuron interactive network may be involved in the development of neuropathic pain. emmprin, the crucial component of extracellular matrix within drg, may potentially become a novel target for the treatment of neuropathic pain. inhibition of emmprin may provide a hopeful therapeutic approach for curing neuropathic pain. in conclusion, rna interference against ox47 significantly suppressed the expression of ox47 mrna and the development of mechanical allodynia. the altered expression of ox47 may contribute to the development of neuropathic pain after nerve injury. further research is needed to explore which signal pathway emmprin mainly affects during the development of neuropathic pain. | matrix metalloproteinases (mmps) are widely implicated in inflammation and tissue remodeling associated with various neurodegenerative diseases and play an important role in nociception and allodynia. extracellular matrix metalloproteinase inducer (emmprin) plays a key regulatory role for mmp activities. however, the role of emmprin in the development of neuropathic pain is not clear. western blotting, real - time quantitative rt - pcr (qrt - pcr), and immunofluorescence were performed to determine the changes of messenger rna and protein of emmprin / ox47 and their cellular localization in the rat dorsal root ganglion (drg) after nerve injury. paw withdrawal threshold test was examined to evaluate the pain behavior in spinal nerve ligation (snl) model. the lentivirus containing ox47 shrna was injected into the drg one day before snl. the expression level of both mrna and protein of ox47 was markedly upregulated in ipsilateral drg after snl. ox47 was mainly expressed in the extracellular matrix of drg. administration of shrna targeted against ox47 in vivo remarkably attenuated mechanical allodynia induced by snl. in conclusion, peripheral nerve injury induced upregulation of ox47 in the extracellular matrix of drg. rna interference against ox47 significantly suppressed the expression of ox47 mrna and the development of mechanical allodynia. the altered expression of ox47 may contribute to the development of neuropathic pain after nerve injury. |
during a study of ascomycetes colonizing submerged, decomposing woody and herbaceous debris in freshwater habitats along an elevational gradient in per extending from the peruvian amazon to the peruvian andes (20102012), numerous freshwater mitosporic fungi were encountered. (2007) divided the freshwater mitosporic fungi into three ecological groups : (1) freshwater hyphomycetes ; (2) aeroaquatic hyphomycetes ; and (3) freshwater miscellaneous mitosporic ascomycetes. this study deals with one aeroaquatic hyphomycete (cancellidium applanatum), and four species of miscellaneous mitosporic ascomycetes (cordana abramovii, sporoschisma saccardoi, s. juvenile, and s. uniseptatum). cancellidium is typified by c. applanatum, which was originally collected from submerged wood blocks of ochroma pyramidale in kobe, japan. cancellidium applanatum has been reported from many paleotropical localities (webster & davey 1980, shaw 1994, ho. multiple collections of cancellidium applanatum (pe0063) were recovered from low and middle altitudes along the elevational gradient, but not from high altitude aquatic habitats. however, they noted that a connection to hypocreales was dubious due to the questionable nature of the culture from which the dna was extracted (yeung. one 28s sequence was generated from a peruvian specimen and the identity was corroborated with two 28s sequences generated from thai material. another dematiaceous fungus, closely resembling cordana abramovii, was found in 33 of 86 collections from a range of sites. the type is described as acervular, possibly due to the cushiony appearance of the aggregated sporing structures and setae on the substrate (preuss 1851). the majority of the taxa belonging to the genus are not described as such ; rather, conidia simply form on erect conidiophores with surrounding setae. the peruvian specimens of cordana abramovii (pe0053) are characterized by pale brown to brown, cylindrical, septate conidiophores with swollen conidiogenous zones ; terminal and intercalary polyblastic conidiogenous cells ; and golden brown to dark brown, 1-septate, thick - walled, verruculose conidia. two additional species, c. musae and c. pauciseptata, have previously been reported from per (matsushima 1993). several species of sporoschisma were collected from multiple sites, including s. uniseptata (15 collections), s. saccardoi (13), s. juvenile (9), and s. parcicuneatum (2). sporoschisma uniseptata has 1-septate, rarely 2-septate, reddish brown, verruculose conidia ; s. saccardoi has brown, 5-septate, doliiform, smooth walled conidia ; s. juvenile has brown 5-septate, cylindrical, verruculose conidia ; and s. parcicuneatum has brown, 1(3)-septate, cuneiform, verruculose conidia (goh. sexual reproductive structures of melanochaeta hemipsila were found among conidiophores of s. saccardoi from substrates collected in cusco and junin. melanochaeta hemipsila has been connected to s. saccardoi based on studies in which the asexual morph was produced from colonies derived from ascospores (mller. the sexual morph of the peruvian specimens is characterized by : gregarious, superficial, dark brown to black ascomata with short conical beaks ; numerous, septate, capitate setae arising from the external ascomal wall ; clavate, unitunicate, 8-spored asci with an i- refractive apical apparatus ; biseriate, cylindrical to curved, 5-septate ascospores with olivaceous to brown central cells, hyaline end cells, lacking sheaths or appendages. the goals of this study were to : (1) describe, illustrate, and provide voucher specimens and sequences for the foregoing species of freshwater mitosporic fungi for which pure cultures were obtained ; (2) compare and contrast these fungi with morphologically similar and genetically related taxa ; and (3) construct a molecular phylogeny using 28s large subunit (lsu) nrdna to elucidate the evolutionary relationships of these fungi with other ascomycota. submerged woody and herbaceous debris was collected from a variety of freshwater habitats that included rivers, streams, backwaters, swamps, and inundated trails. approximately 30 pieces of debris were put into a sealable plastic bag along with a wet paper towel at each of 86 sampling sites along an altitudinal gradient stretching from 2183566 m. samples were shipped to our laboratory at the university of illinois at urbana - champaign. in the laboratory, substrates were placed in moist chambers (sealable plastic boxes lined with moist paper towels) and incubated at room temperature (~25 c) with 12/12 h light / dark conditions. samples were examined for reproductive structures within one week of arrival and periodically thereafter for 12 mo with an ao stereomicroscope. digital images of fruiting structures were taken on an olympus szx7 stereomicroscope (olympus optical tokyo) fitted with a spot rt colour camera using spot advanced software (diagnostics instruments, sterling hts, mi). ascomata were removed from the substrate with a dissecting needle and gently teased apart in a drop of distilled water. conidiophores and conidia were removed in the same manner and gently placed in a drop of distilled water. fungal tissue was then sandwiched between 25 25 and 18 18 mm cover slips in distilled water, and placed on a microscope slide for examination. glycerin was added after examination in preparation for permanent preservation in our herbarium (ill) according to the protocol of volkmann - kohlmeyer & kohlmeyer (1996). examination of fungal structures was performed on an olympus bhs microscope (olympus optical, tokyo) equipped with nomarski interference and phase optics. digital micrographs were obtained with the spot insight 12 mp colour camera and spot advanced software. for single spore isolation, sterile dissecting needles were used to spread ascospores or conidia on antibiotic water agar (awa ] : 20 g agar (difco), 0.5 g streptomycin sulfate, 0.5 g penicillin g (sigma) and 1000 ml deionized h2o. single germinated ascospores or conidia were transferred to pyg+ab agar plates : 1.25 g peptone, 1.25 g yeast extract, 18 g agar (difco), 5 g d - glucose (acros), 0.5 g streptomycin sulfate, 0.5 g penicillin g (sigma), and 1000 ml deionized h2o. dna extraction was performed on mycelium scraped with a sterile spatula from pyg+ab agar plates. mycelium was first ground into a fine powder in liquid nitrogen with a sterile mortar and pestle and dna was extracted with a dneasy plant mini kit (qiagen sciences, valencia, ca) according to the manufacturer s instructions. pcr of extracted dna was performed using illustra ready - to - go pcr beads (ge healthcare) using the primer pair lror and lr6 (rehner & samuels 1994, vilgalys & hester 1990) on an mj research ptc-200 thermocycler using the following parameters : initial denaturation at 95 c for 5 min, followed by 40 cycles at 95 c for 30 s, 50 c for 15 s, 72 c for 10 s, with a final extension step of 72 c for 10 min. pcr products were purified using qiaquick pcr purification kit (qiagen sciences, valencia, ca) according to the manufacturer s instructions. sequencing reactions (11 l) using the primers lror, lr3, lr3r, and lr6 (rehner & samuels 1994, vilgalys & hester 1990) were carried out using the bigdye sequence terminator kit 3.1 (applied biosystems, foster city, ca). sanger dna sequencing was performed on an ab 3730xl dna analyzer at the w. m. keck center for comparative and functional genomics at the university of illinois at urbana - champaign. in addition to the sequences generated in this study (table 1), sequences used in a study of melanochaeta (mugambi & huhndorf 2008) were downloaded from genbank. a taxonomic search of cordana in genbank yielded seven lsu sequences as well as a sequence from the sexual morph of porosphaerella, represented by p. borinquensis. two members of magnaporthales and one from lulworthiales were used as outgroup taxa (table 2). sequences were assembled and initially aligned in sequencher v. 4.9 (gene codes, ann arbor, mi). alignment was performed using muscle v. 3.6 (edgar 2004) followed by visual correction. characters at the 5 and 3 ends were excluded due to missing data for some taxa, resulting in a final alignment length of 1062 base pairs. for maximum likelihood and bayesian analyses, jmodeltest v. 0.1.1 (posada 2008) was used to determine the best - fit model of nucleotide evolution for the data set. base pair frequencies were : freqa = 0.2250, freqc = 0.2513, freqg = 0.3204, and freqt = 0.2033. the analysis estimated a rate matrix of transitions and transversions in which r[ac ] = 0.8185, r[ag ] = 2.3648, r[at ] = 1.8097, r[cg ] = 0.5711, r[ct ] = 7.3857, and r[gt ] = 1. invariable sites comprised 0.416 of the data set and the gamma shape parameter was 0.427. maximum likelihood analysis was performed with raxml v. 7.0.4 (stamakis. 2008) on the lsu dataset on the cipres bayesian analysis was conducted using mrbayes v. 3.1.2 with two runs and four chains under default settings (huelsenbeck & ronquist 2001, ronquist & huelsenbeck 2003). a total of 10 000 000 generations were run with trees sampled every 1 000 generations, resulting in a total of 10 000 trees. the first 1 000 trees were discarded as burn - in, and the remaining 9 000 trees were used to calculate posterior probabilities (pp). raxml analyses of the dataset produced a single most likely tree (ln -9231.511787) on which bootstrap support (> 75) and pp values (> 95) are indicated on the tree. sequences generated in this study and the alignment used for phylogenetic analysis were deposited respectively in genbank and in treebase (www.treebase.org, submission 15251). submerged woody and herbaceous debris was collected from a variety of freshwater habitats that included rivers, streams, backwaters, swamps, and inundated trails. approximately 30 pieces of debris were put into a sealable plastic bag along with a wet paper towel at each of 86 sampling sites along an altitudinal gradient stretching from 2183566 m. samples were shipped to our laboratory at the university of illinois at urbana - champaign. in the laboratory, substrates were placed in moist chambers (sealable plastic boxes lined with moist paper towels) and incubated at room temperature (~25 c) with 12/12 h light / dark conditions. samples were examined for reproductive structures within one week of arrival and periodically thereafter for 12 mo with an ao stereomicroscope. digital images of fruiting structures were taken on an olympus szx7 stereomicroscope (olympus optical tokyo) fitted with a spot rt colour camera using spot advanced software (diagnostics instruments, sterling hts, mi). ascomata were removed from the substrate with a dissecting needle and gently teased apart in a drop of distilled water. conidiophores and conidia were removed in the same manner and gently placed in a drop of distilled water. fungal tissue was then sandwiched between 25 25 and 18 18 mm cover slips in distilled water, and placed on a microscope slide for examination. glycerin was added after examination in preparation for permanent preservation in our herbarium (ill) according to the protocol of volkmann - kohlmeyer & kohlmeyer (1996). examination of fungal structures was performed on an olympus bhs microscope (olympus optical, tokyo) equipped with nomarski interference and phase optics. digital micrographs were obtained with the spot insight 12 mp colour camera and spot advanced software. for single spore isolation, sterile dissecting needles were used to spread ascospores or conidia on antibiotic water agar (awa ] : 20 g agar (difco), 0.5 g streptomycin sulfate, 0.5 g penicillin g (sigma) and 1000 ml deionized h2o. single germinated ascospores or conidia were transferred to pyg+ab agar plates : 1.25 g peptone, 1.25 g yeast extract, 18 g agar (difco), 5 g d - glucose (acros), 0.5 g streptomycin sulfate, 0.5 g penicillin g (sigma), and 1000 ml deionized h2o. dna extraction was performed on mycelium scraped with a sterile spatula from pyg+ab agar plates. mycelium was first ground into a fine powder in liquid nitrogen with a sterile mortar and pestle and dna was extracted with a dneasy plant mini kit (qiagen sciences, valencia, ca) according to the manufacturer s instructions. pcr of extracted dna was performed using illustra ready - to - go pcr beads (ge healthcare) using the primer pair lror and lr6 (rehner & samuels 1994, vilgalys & hester 1990) on an mj research ptc-200 thermocycler using the following parameters : initial denaturation at 95 c for 5 min, followed by 40 cycles at 95 c for 30 s, 50 c for 15 s, 72 c for 10 s, with a final extension step of 72 c for 10 min. pcr products were purified using qiaquick pcr purification kit (qiagen sciences, valencia, ca) according to the manufacturer s instructions. sequencing reactions (11 l) using the primers lror, lr3, lr3r, and lr6 (rehner & samuels 1994, vilgalys & hester 1990) were carried out using the bigdye sequence terminator kit 3.1 (applied biosystems, foster city, ca). sanger dna sequencing was performed on an ab 3730xl dna analyzer at the w. m. keck center for comparative and functional genomics at the university of illinois at urbana - champaign. in addition to the sequences generated in this study (table 1), sequences used in a study of melanochaeta (mugambi & huhndorf 2008) were downloaded from genbank. a taxonomic search of cordana in genbank yielded seven lsu sequences as well as a sequence from the sexual morph of porosphaerella, represented by p. borinquensis. two members of magnaporthales and one from lulworthiales were used as outgroup taxa (table 2). sequences were assembled and initially aligned in sequencher v. 4.9 (gene codes, ann arbor, mi). alignment was performed using muscle v. 3.6 (edgar 2004) followed by visual correction. characters at the 5 and 3 ends were excluded due to missing data for some taxa, resulting in a final alignment length of 1062 base pairs. for maximum likelihood and bayesian analyses, jmodeltest v. 0.1.1 (posada 2008) was used to determine the best - fit model of nucleotide evolution for the data set. base pair frequencies were : freqa = 0.2250, freqc = 0.2513, freqg = 0.3204, and freqt = 0.2033. the analysis estimated a rate matrix of transitions and transversions in which r[ac ] = 0.8185, r[ag ] = 2.3648, r[at ] = 1.8097, r[cg ] = 0.5711, r[ct ] = 7.3857, and r[gt ] = 1. invariable sites comprised 0.416 of the data set and the gamma shape parameter was 0.427. 2008) on the lsu dataset on the cipres portal v. 2.0 (miller. 2010) using default settings and gtr with 1000 fast bootstrap searches. bayesian analysis was conducted using mrbayes v. 3.1.2 with two runs and four chains under default settings (huelsenbeck & ronquist 2001, ronquist & huelsenbeck 2003). a total of 10 000 000 generations were run with trees sampled every 1 000 generations, resulting in a total of 10 000 trees. the first 1 000 trees were discarded as burn - in, and the remaining 9 000 trees were used to calculate posterior probabilities (pp). the consensus of the trees was viewed in dendroscope v. 2.7.4 (huson. raxml analyses of the dataset produced a single most likely tree (ln -9231.511787) on which bootstrap support (> 75) and pp values (> 95) are indicated on the tree. sequences generated in this study and the alignment used for phylogenetic analysis were deposited respectively in genbank and in treebase (www.treebase.org, submission 15251). the entire results of field collections will be reported in a separate paper on elevational distribution patterns of freshwater ascomycetes. for this study, five species of dematiaceous hyphomycetes were selected for morphological and molecular phylogenetic study, as noted above (p. 425). cancellidium applanatum, cordana abramovii, s. juvenile, and s. uniseptatum are reported here as new records for per. specimens examined are listed in the taxonomy portion of this paper with collection numbers whose details are given in table 3. a single most likely tree from raxml analysis (fig. 1) indicated that cancellidium applanatum groups with other freshwater sordariomycetidae, its closest sequenced relative being thyridium vestitum. the three sequences used in this analysis form a strongly supported monophyletic clade, with the peruvian specimen separated from a clade containing two specimens from thailand. inclusion of the c. pinicola sequence from genbank (dq144048) places that sequence firmly in hypocreales (results not shown) as yeung. (2006) reported. a blast search using that sequence produces a 100 % match to trichoderma koningiopsis, suggesting contamination of the c. pinicola isolate. the results of this analysis indicate that the taxonomic placement of c. applanatum is in sordariomycetes incertae sedis at this time. cordana abramovii clusters with other cordana species in a well - supported monophyletic clade (fig. cordana has been linked to porosphaerella via porosphaerella cordanophora and was first placed in trichosphaeriaceae (mller & samuels 1982) and later chaetosphaeriaceae (rblov. 1999). rblov & winka (2000) provided molecular evidence that did not support the inclusion of cordana in chaetosphaeriaceae, and this study supports their conclusion. porosphaerella borinquensis is closely related, but basal to, cordanaceae in this analysis, not nesting within the clade. porosphaerella borinquensis has a pseudobotrytis terrestris asexual morph, and it has been suggested that the mitosporic morph may be a compound form of basic cordana features (fernndez & huhndorf 2004). sporoschisma saccardoi has long been linked via cultural studies to melanochaeta hemipsila and our study supports the sexual - asexual morph connection using lsu sequences from both states. multiple attempts to sequence the 28s 5 and 3 ends of m. hemipsila (kf833362) were made without success. the peruvian specimen is placed in a well - supported clade with m. hemipsila and m. aotearoae within chaetosphaeriaceae, agreeing with prior molecular studies (fernandez. the entire results of field collections will be reported in a separate paper on elevational distribution patterns of freshwater ascomycetes. for this study, five species of dematiaceous hyphomycetes were selected for morphological and molecular phylogenetic study, as noted above (p. 425). cancellidium applanatum, cordana abramovii, s. juvenile, and s. uniseptatum are reported here as new records for per. specimens examined are listed in the taxonomy portion of this paper with collection numbers whose details are given in table 3. 1) indicated that cancellidium applanatum groups with other freshwater sordariomycetidae, its closest sequenced relative being thyridium vestitum. the three sequences used in this analysis form a strongly supported monophyletic clade, with the peruvian specimen separated from a clade containing two specimens from thailand. inclusion of the c. pinicola sequence from genbank (dq144048) places that sequence firmly in hypocreales (results not shown) as yeung. that sequence produces a 100 % match to trichoderma koningiopsis, suggesting contamination of the c. pinicola isolate. the results of this analysis indicate that the taxonomic placement of c. applanatum is in sordariomycetes incertae sedis at this time. cordana abramovii clusters with other cordana species in a well - supported monophyletic clade (fig. cordana has been linked to porosphaerella via porosphaerella cordanophora and was first placed in trichosphaeriaceae (mller & samuels 1982) and later chaetosphaeriaceae (rblov. 1999). rblov & winka (2000) provided molecular evidence that did not support the inclusion of cordana in chaetosphaeriaceae, and this study supports their conclusion. porosphaerella borinquensis is closely related, but basal to, cordanaceae in this analysis, not nesting within the clade. porosphaerella borinquensis has a pseudobotrytis terrestris asexual morph, and it has been suggested that the mitosporic morph may be a compound form of basic cordana features (fernndez & huhndorf 2004). sporoschisma saccardoi has long been linked via cultural studies to melanochaeta hemipsila and our study supports the sexual - asexual morph connection using lsu sequences from both states. multiple attempts to sequence the 28s 5 and 3 ends of m. hemipsila (kf833362) were made without success. the peruvian specimen is placed in a well - supported clade with m. hemipsila and m. aotearoae within chaetosphaeriaceae, agreeing with prior molecular studies (fernandez. japan 16 : 358 (1975). description : colonies on pyg+ab agar 2 cm diam at 30 days, white to pale yellow, becoming dark grey at the center as conidia are formed, mycelium immersed with scant aerial hyphae, margin entire, discrete, reverse whitish to buff to pale yellow. conidiophores micronematous, mononematous, arising terminally or laterally from the hyphae, simple, erect, hyaline, smooth walled. conidia bulbils formed as inflated ends of conidiophores, 160220 5198 (x = 183.4 74.9 m, n = 30), shiny, silver to black when young, brown with age, obovate to obcordate, composed of parallel rows of septate rectangular cells radiating from point of attachment with conidiophore, outer cells surrounding strings of monilioid cells. specimens examined : c-1709, pe0063 - 1 ; c-1715, pe0063 - 3 ; c-1753, pe0063 - 4 ; c-1714, pe0063 - 5 ; c-1719, pe0063 - 6 ; c-1742, pe0063 - 7 ; c-1742, pe0063 - 8 ; c-1705, pe0063 - 10 ; c-1715, pe0063 - 12 ; c-1698, pe0063 - 13 ; c-1717, pe0063 - 14 ; c-1723, pe0063 - 15 ; c-1713, pe0063 - 16 ; c-1716, pe0063 - 18 ; c-1700, pe0063 - 19 ; c-1699, pe0063 - 20 ; c-1712, pe0063 - 21 ; c-1752, pe0063 - 23 ; c-1745, pe0063 - 26 ; c-1734, pe0063 - 27 ; c-1744, pe0063 - 28 ; c-1732, pe0063 - 29 ; c-1730, pe0063 - 30 ; c-1729, pe0063 - 31 ; c-1697, pe0063 - 36 ; c-1755, pe0063 - 38 ; c-1751, pe0063 - 42 ; c-1736, pe0063 - 44 ; c-1735, pe0063 - 45 ; c-1747, pe0063 - 46 ; c-1749, pe0063 - 47 ; c-1739, pe0063 - 48 ; c-1737, pe0063 - 50 ; c-1733, pe0063 - 52 ; c-1748, pe0063 - 56 ; c-1740, pe0063 - 63 ; c-1731, pe0063 - 68 ; c-1741, pe0063 - 70 ; c-1777, pe0063 - 81 ; c-1769, pe0063 - 82 ; c-1772, pe0063 - 83 ; c-1832, th0063 - 1 ; c-1827, th0063 - 2. distribution : known from australia, brazil, china, hong kong, japan, malaysia, per, and thailand. notes : this fungus was recovered from a variety of habitats representing a range of environmental conditions. the specimens examined in this study are characterized by the production of bulbils on the surface of the substrate that appear silver, brown, or black depending on age, and are composed of parallel rows of cells encapsulating strings of monilioid cells. surprisingly, this fungus was not reported by matsushima (1993, 1995), who studied the fungi colonizing decomposing plant debris along the same river system we sampled. it was recovered from altitudes ranging from 218817 m. as the fungus was not recovered from higher elevations and its distribution appears to be mainly tropical (with the exception of the type locality, which has a subtropical climate), it may be that c. applanatum is adapted to warmer habitats. description : conidiophores gregarious, erect, straight or flexuous, to 6-septate, smooth, brown, paler towards the apex, 620990 m long 56.5 m wide (between conidiogenous swellings), base to 18 m diam. conidiogenous cells polyblastic (to 8), terminal and intercalary, one swelling per cell (8.513 m wide), denticulate. conidia enteroblastic, verruculose, tan to reddish brown, pyriform to obovate, thick walled (to 3.0 m), transversely uniseptate with a septal pore, and tapered base bearing the scar of schizolytic abscission, 2129 m long 11.516 m wide (x = 24.6 14.4, n = 30). specimens examined : c-1714, pe0053 - 1 ; c-1741, pe0053 - 3 ; c-1750, pe0053 - 4 ; c-1746, pe0053 - 5 ; c-1719, pe0053 - 9 ; c-1713, pe0053 - 11 ; c-1720, pe0053 - 12 ; c-1716, pe0053 - 13 ; c-1711, pe0053 - 14 ; c-1722, pe0053 - 15 ; c-1708, pe0053 - 16 ; c-1712, pe0053 - 17 ; c-1755, pe0053 - 18 ; c-1736, pe0053 - 20 ; c-1735, pe0053 - 21 ; c-1753, pe0053 - 22 ; c-1739, pe0053 - 23 ; c-1782, pe0053 - 24 ; c-1779, pe0053 - 25 ; c-1748, pe0053 - 26 ; c-1770, pe0053 - 27 ; c-1730, pe0053 - 28 ; pe0053 - 30 ; c-1754, pe0053 - 34 ; c-1733, pe0053 - 40 ; c-1745, pe0053 - 42 ; c-1744, pe0053 - 43 ; c-1777, pe0053 - 44 ; c-1833, th0053 - 1. distribution : known from brunei, per, russia, seychelles, and thailand. notes : morphologically, the peruvian specimens reported and described herein most closely match the description of c. abramovii. the conidiophores in the peruvian specimens are thinner than the type (56.5 vs. (8)1012.5 m), as are the swellings of the conidiogenous zones (8.513 m vs. 18 m). conidia are thick walled and approximately the same size (2129 11.516 m vs. 2731 1515.5 m) as the type. the peruvian specimens, however, have verruculose wall ornamentation, a feature not noted by seman & davydkina (1983). these morphological differences, as well as the geographic distance between the collection localities, suggest that the peruvian specimens may represent a variation of c. abramovii s. str. or even a new species. hyde & goh (1998) provide evidence of a similar situation in their reports of c. abramovii var. seychellensis, an anatomically similar taxon possessing conidia with a purple, pitted episporium, and c. abramovii var. these variants were collected in the old world tropics, while the type was reported from northern ossetia. further molecular evidence should be gathered to increase our understanding of the phylogenetic affinities of these highly similar taxa as well as other members of cordanaceae. information from additional geographically separated specimens as well as additional molecular data, especially its, would shed light on whether c. abramovii represents a species complex with geographical variation, or whether these are distinct species. this fungus was recovered from a variety of habitats with a range of environmental conditions. its habit is thus far known to be saprobic on submerged woody and palm debris in lentic and lotic habitats. description : colonies on pyg + ab 2 cm diam at 30 d, effuse, velutinous, with mixed tufts of conidiophores and sterile capitate setae. capitate setae arising from a bulbous stroma 4560 m diam or from ascoma, pale brown, becoming paler towards the apex, straight or slightly flexuous, 56 septate, 150200 m long, 56.5 m with subhyaline terminal swelling 1012 m wide. ascomata superficial, 284400 m high 280370 m wide (x = 325 m 325 m, n = 10), globose to subglobose, dark brown to black, gregarious, with capitate setae. paraphyses to 7 m wide at base, tapering to a rounded apex ~ 3.5 m wide, as long as asci, free at apices, hyaline, septate, constricted at septa, unbranched. asci 165230 13.522 m (x = 186.6 16.8, n = 10), cylindrical to cylindro - clavate, 8-spored, biseriate, pedicellate, with an i- refractive apical apparatus 22.5 m high 4.55.5 m wide (x = 2.3 5.2, n = 10). ascospores 4457 79.5 m (x = 51 8 m, n = 30), cylindrical, bent, 5-septate, not constricted at septa, smooth walled, with lipid droplets in each cell, apices rounded, central cells olivaceous to brown, end cells hyaline, without sheaths or appendages. conidiophores scattered to gregarious, arising from substrate or directly from ascomata, up to 190 m long. conidiogenous cells monophialidic, 913 m wide below venter and 1720 m wide above, venter to 22 m wide, dark brown, paler at the torn apex, simple, erect, dark brown, smooth walled. conidia formed enteroblastically inside the tubular collarette of the conidiogenous cell and emerging in a chain, doliiform, 4860 1113.5 m (x = 55.5 12.5 m, n = 30), 5-septate, occasionally constricted at septa, central cells brown, end cells hyaline. specimens examined : c-1727, pe0177 - 1 ; c-1726, pe0177 - 2 ; c-1710, pe0177 - 3 ; c-1750, pe0177 - 4 ; c-1756, pe0177 - 5 ; c-1739, pe0177 - 6 ; c-1755, pe0177 - 7 ; c-1740, pe0177 - 10 ; c-1775, pe0177 - 15 ; c-1757, pe0177 - 12 ; c-1797, pe0177 - 21. distribution : known from australia, brunei darussalam, ecuador, europe, hong kong, indonesia, kenya, malaysia, per, south africa, taiwan, and thailand. notes : this fungus was recovered from a variety of habitats with a range of environmental conditions. it was recovered from altitudes ranging from 6263566 m. the new combination is required as the epithet hemipsila takes precedence over saccardoi. as neither name is widely used, we see no case for not following the rule of priority under the icn. description : setae interspersed among conidiophores, erect, straight or flexuous, to 6-septate, smooth, brown, paler towards apex, 100150 46 m, apex 57 m wide, apex hyaline, capitate, coated with mucilage. conidiophores scattered to gregarious, arising from dark interwoven hyphae, straight or flexuous, cylindrical, 110280 m long, 710 m wide just above substrate, dark brown, smooth. conidiogenous cells monophialidic, terminal, integrated, lageniform, consisting of a slightly swollen venter 1420 m wide and a tubular collarette 80110 9.512 m. conidia produced in basipetal chains, cylindrical, ends rounded, 3444 10.514.5 m (x = 38 12.93, n = 30), 3-septate, pale brown, verruculose. specimens examined : c-1705, pe0127 - 1 ; c-1720, c-1727, pe0127 - 2 ; c-1728, pe0127 - 3 ; c-1725, pe0127 - 4 ; c-1720, pe0127 - 5 ; c-1756, pe0127 - 6 ; 1751, pe0127 - 7 ; c-1726, pe0127 - 12. distribution : known from australia, czechoslovakia, france, hong kong, per, seychelles, and the uk. notes : this fungus was recovered from a variety of habitats with a range of environmental conditions, and at altitudes ranging from 2442562 m. water temperature ranged from 9.722 c and ph ranged from 6 - 8.3. synonym : melanochaeta garethjonesii sivichai & hywel - jones, mycol. res. 104 : 481 (2000). description : conidiophores dark brown, erect, straight or flexuous, septate, cylindrical, terminating with phialidic conidiogenous cells, 125190 m long 911 m wide, to 22 m wide at the swollen venter. capitate setae present among conidiophores, erect, straight or flexuous, 36 septate, smooth, pale brown, paler towards the sub - hyaline apex, 120175 x 810 m, swollen apex 613 m wide, surrounded by mucilage. conidia 25.532.5 1114 m (x = 30.8 12.6 m, n = 30), formed in chains, cylindrical, truncate at both ends, slightly verruculose, 1-septate, pale brown, uniform in colour. specimens examined : c-1704, pe0172 - 1 ; c-1696, pe0172 - 2 ; c-1702, pe0172 - 3 ; c-1722, pe0172 - 4 ; c-1715, pe0172 - 5 ; c-1705, pe0172 - 6 ; c-1746, pe0172 - 7 ; c-1755, pe0172 - 8 ; c-1735, pe0172 - 9 ; c-1758, pe0172 - 12 ; c-1750, pe0172 - 10 ; c-1740, pe0172 - 14 ; c-1736, pe0172 - 16 ; c-1784, pe0172 - 20. distribution : known from australia, brunei darrusalam, canada, china, ecuador, french guiana, hong kong, india, indonesia, italy, malaysia, per, seychelles, south africa, sri lanka, taiwan, and thailand. notes : the fungus was recovered from a variety of habitats with a range of environmental conditions, and altitudes ranging from 218757 m. water temperature ranged from 1931.4 c and ph ranged from 5.98.0. | a survey of freshwater ascomycetes conducted along an elevational gradient in per in the districts of cusco, junn, and madre de dios yielded specimens of cancellidium applanatum, cordana abramovii, sporoschisma juvenile, s. uniseptatum, and s. saccardoi. with the exception of s. saccardoi, these are new records for per. molecular data was generated for three previously unsequenced species : cancellidium applanatum, cordana abramovii and sporoschisma saccardoi. these taxa are reported herein from the neotropics with an accompanying phylogeny based on partial 28s nuclear ribosomal large - subunit sequence data. the sexual morph of s. saccardoi has previously been linked to melanochaeta hemipsila through cultural studies. molecular data from ascospores and conidia of m. hemipsila and s. saccardoi, respectively, were used to demonstrate a genetic connection of the sexual and asexual morphs of these fungi for the first time, resulting in the new combination sporoschisma hemipsila being made. |
fractures of long bones constitute the majority of emergency operating room procedures in most trauma centers. of these long bone injuries, the national center for health statistics (nchs) reports an annual incidence of 492,000 fractures of the tibia and fibula per year in the united states. patients with tibial fractures remain in hospital for a total of 569,000 hospital days and incur 825,000 physician visits per year in the united states. the lack of a circumferential soft tissue envelope around the bone makes the bone ends more likely to fail unit (nonunion). other complications include infection, malunion, malalignment, etc that sometimes necessitate additional operations. management strategies to best minimize these frequent complications and resulting re - operations have proved controversial. over the last 20 years, surgeons have used 4 management approaches for tibial fractures : intramedullary nail fixation (interlocking intramedullary nails and simple intramedullary rods), plate fixation, external fixation and casting or functional bracing. while it may be preferable to cast a closed tibial shaft fracture, most surgeons agree that in certain unstable fracture patterns, casts will not maintain adequate fracture alignment. in recent years surgeons have moved away from plates and external fixators in favor of intramedullary nails in the operative treatment of both closed and open tibial fractures. given the published clinical data, intermedullary (i m) nailing techniques were developed to minimize surgical insult to the fracture and adjoining soft tissues. it has become standard care for the majority of displaced tibial shaft fractures, but it has also been associated with some complications in these patients ; therefore, some orthopaedic surgeons prefer plate fixation for tibial shaft fractures [1418 ]. minimally invasive plating techniques reduce surgical trauma and maintain a more biologically favorable environment for fracture healing. to the best of our knowledge, there is insufficient evidence from previous studies to consider post - operative complications in relation to both surgical methods and the types of fractures ; there is also no data establishing how the characteristics of the patients and the quality of their fractures should be considered in choosing an appropriate mode of treatment. the purpose of this study is to report our experience with the efficacy and complications associated with diverse surgical methods of different patterns of tibial shaft fractures in adults. in this retrospective observational study we reviewed all charts of patients with tibial fractures which have been admitted to our center between january 2003 and december 2006 in a census method. those aged 14 years and over, with at least 1 fracture in the shaft of the tibia, who had comprehensive personal and medical background, and at least a 1-year follow - up after treatment were invited by telephone or mail to visit our center. out of 457 eligible patients, 387 patients who accepted our invitation those candidates with articular fractures and extra - articular fractures within 5 cm of the proximal or distal end of the tibia were excluded from the study. charts were reviewed for demographic information, sites, types and patterns of fractures, follow - up care, complications and other clinical data. all the patients were examined by 1 orthopaedic surgeon, and the results including knee and ankle range of motion (rom), infection, malalignment, non - union, delayed union, pain, sensory - motor loss, limb shortening, etc. were registered. the previous radiographies were reviewed and a new one was ordered for the fracture location, then these were compared with each other and the results were recorded. four different surgical methods had been used in these patients : intramedullary interlocking nails (int), simple intramedullary rods (imr), plating (plt) and external fixation (ef). the outcome of different surgical methods is demonstrated by studying the complications during the first month after the operation (early complications) and those during a period of at least 1 year after the surgery (late complications). in a later stage, by applying delphi method and consulting with 16 orthopaedic surgeons in our educational center, the complications were listed alphabetically. next, the same surgeons were asked to give a score to each of the complications according to its importance. the patients were classified according to the particular method of surgery. in order to compare different methods, we multiplied the frequency of complications in each group by the mean scores. based on these results, in our survey, out of all the reviewed charts, 387 patients (348 men and 39 women) were included into our study. about 45% of fractures were open, and the most frequent fracture was comminuted with the incidence rate of 31%. table 2 shows demographic information of the patients in different patterns of fractures. among 387 patients, 57.8% (227 patients) had undergone open reduction and 41.3% (160 patients) closed reduction. one - hundred forty - seven patients were treated with intramedullary interlocking nailing (int) method, 132 with plating (plt), 53 with intramedullary rod (imr), 48 with external fixation, and 7 with screws. the rates of fractures were 12.4% in proximal part, 39.8% in middle, 38% in distal, and 9.8% in more than 1 part. in the int method the most noticeable complications were delayed union (26%), pain (21%), nonunion (18%) and infection (9%). no vascular disorder was noticed, neurological disorders were less than 4.1% and device failure was approximately 2%. the complication rates of this method for treatment of fractures in upper, middle and the lower third of the tibia were 54%, 51% and 57%, respectively, and the rate for segmented fracture was 33%. according to the delphi method the complication rates in the int method were, in descending order, open oblique, closed segmented, open segmented, open comminuted and closed oblique fractures. table 4 shows the proposed methods of treatment according to complications in different patterns of fractures. in the simple intramedullary rods without locking method (imr) the most frequent complications were pain in the proximal and distal ends of the nails and fracture site, non - union and limitation in knee range of motion (rom), with frequencies of 19%, 9% and 9%, respectively the complication rates of this method in treatment of upper, middle and lower third fractures of the tibia were 0%, 41% and 16%, respectively, and the most frequent complications were seen in butterfly, comminuted and transverse fractures, particularly in open type ones. in the plating method (plt) the most noticeable complications were pain, infection, nonunion and malalignment, with frequencies of 14%, 12%, 10% and 5%, respectively. the complication rates for treatment of fractures in the proximal, middle and distal third of tibia were 37%, 31% and 37%, respectively, and this rate for segmented fracture was 60%. the complications in this procedure are open comminuted, closed spiral and closed oblique, in descending order. finally, in the external fixation method (ef) the most frequent complications were nonunion, infection, delayed union and limitation in ankle rom, with the rates of 46%, 38%, 19%, and 17% percent, respectively. malalignment was seen in about 13% of patients, and the most frequent complications were seen in the patients with oblique, comminuted and segmented fractures. the most noticeable complications after int method were delayed union, pain, nonunion and infection. the neurological disorders were less than 4.1%, no vascular disorder was seen, and device failure was around 2% ; these complications were highest in the open oblique fractures. in the imr method the most frequent complications were pain in the proximal and distal ends of the nails and fracture site, non - union, and limitation in knee - rom ; these complications were highest in butterfly fractures. in the plt method the most common complications, in descending order, were pain, infection, nonunion, and malalignment. these complications were superior in the open comminuted fractures. finally, in ef technique the most considerable complications were nonunion, infection, delayed union and limitation in ankle rom. christine compared external fixation (ef) versus intramedullary rod fixation (imr) in gustilo grade iiib tibial fractures that required microvascular free flaps. they studied 38 patients, of whom 18 underwent external fixation and 20 had intramedullary rodding. the intramedullary rod group had higher incidences of non - union, wound infection and osteomyelitis (40%, 25% and 25%, respectively) than the external fixation group (17%, 6%, and 11%, respectively). the study was confined to just 2 methods of treatment and 1 type of fracture, and their results differ with ours. in our research, the rates of complications such as non - union, infection and osteomyelitis were greater than in the ef method (45.8%, 37.5% and < 3%, respectively) than in imr (9.4%, 0% and 0%, respectively). they evaluated 37 patients with complex proximal tibia fractures that were treated with locking plates in a retrospective case series study. twelve fractures (32%) healed without any complications, 8 patients (22%) developed deep infections, 8 cases (22%) had postoperative malalignment, 3 cases (8%) had loss of alignment into varus during healing, and the rest had other complications. the report showed that the complication rates, particularly infection, were higher than in previous reports. other complications such as hardware prominence, malalignment, and loss of alignment were similar to those of historical controls. we found the 12.1% infection rate after plating to be the highest complication rate after pain (13.6%). huang. evaluated the effect of tibial shaft fracture treatment with plate - screw (plt) versus intramedullary interlocking nail (int). they treated 35 fractures with intramedullary interlocking nail and 45 fractures with plate - screw system. operation time, range of motion, time of bone union, and complications after a mean follow up of 13 months (range 8 to 26 months) were evaluated. they concluded that plt osteosynthesis could attain satisfactory results in uncomminuted tibial shaft fractures, and that int is more appropriate in comminuted fractures. in our study the results showed that for comminuted fractures int is better than plt, but the best choice is imr, and for the other types of fractures (uncomminuted) int and imr were better methods than plt, and only in transverse fractures was plt better than int. fernandez. conducted a prospective, randomized study to compare patients with closed, multi - fragmented (comminuted) tibial diaphyseal fractures that were treated with nonreamed interlocking intramedullary nails or bridging plates. they compared similar groups and reported that the clinical and radiological parameters (articular function, deformities, infection, and pseudarthrosis) were similar in both groups. healing time was the only significant difference, and was earlier in patients receiving bridging plates compared with patients who were treated with nonreamed interlocking intramedullary nails. they only assessed the comminuted fractures with 2 different surgical methods, thus their study was more limited than ours. we did not evaluate healing time in our study. however, in other aspects that we considered, the plt method was better than the int method in the closed multi - fragmented (comminuted) fracture. in the literature, the most important complication following the int method is pain, with a prevalence of 52%, but in our study the most important complication was delayed union, and pain was second most important complication. although previous studies have mentioned neurovascular disorders subsequent to the interlocking method ranges from 2% to 30%, we had no vascular disorders, and the neurological complication rate was less than 4.1%. furthermore, we had much less device failure (2%) in comparison with the 4% to 20% frequency that is reported by others. according to our observations the most noticeable complications of the plt method were pain, infection, nonunion and malalignment, with frequencies of 14%, 12%, 10% and 5%, respectively, but in 1 other study the highest percentages were joint stiffness (11%) and infection (10%). for the ef technique our results showed the most frequent complications were nonunion, infection, delayed union and limitation in ankle rom, with rates of 46%, 38%, 19%, and 17%, respectively. malalignment was seen in about 13% of patients, but those which have been reported in some previous studies include malalignment, infection and nonunion, with the incidence rates of 050%, 20% and 641%, respectively. overall, in our study imr was the treatment of choice because it causes fewer complications, and int was the better choice only for segmented and spiral fractures. our conclusions differ from some of the other studies that state the int method is the treatment of choice in tibial diaphyseal fractures. to our knowledge there is no comprehensive study that considers all types of fractures and different surgical method complications, and we could only find some studies that had compared just 1 or 2 specific fractures with different methods of treatment. lack of enough samples in some types of fractures and poor cooperation of some patients were some of the problems that we faced in this study our results showed that the best method to treat oblique fractures is imr and the next best choice is plt. due to the highest numbers of complications and adverse effects, int can not be suggested as a preferred treatment for oblique fractures (especially at the proximal 3 of tibia). for butterfly fractures, imr can be a minimally invasive method ; if imr is not possible, the other choices are int and plt. to treat spiral fractures, int is a good candidate, but plt is not recommended as a first choice. identifying treatment alternatives that reduce the risk of need for a subsequent operation, as well as costs to the health care system, will be a significant contribution to the practice of orthopaedics. | summarybackgroundtibial fractures constitute a large number of emergency operations in most trauma centers. there are different approaches for tibial fractures. to our knowledge, there is insufficient evidence to consider post - operative complications in relation to both surgical methods and the types of fractures. our purpose is to report our experience regarding the efficacy and complications associated with diverse surgical methods of different patterns of tibial shaft fractures in adults.material/methodswe studied 387 adult patients. the patients information was registered from the charts and after examination. the methods used were intramedullary interlocking nails, simple intramedullary rods, plating and external fixation. early and late complications were recorded and by applying the delphi method different treatments were compared. finally, the safest mode of treatment is proposed.resultsin the intramedullary interlocking nails method the most noticeable complication was delayed union and the highest rate of complications was seen in open oblique fractures. in the simple intramedullary rods method the most frequent complication was pain, and in the with butterfly fractures the complications were the most. in the plating method the most frequent complication was pain, and most of the complications were seen in open comminuted fractures. finally, in the external fixation method the most frequent complication was non - union and complications were the highest in the patients with oblique, comminuted and segmented fractures.conclusionsthe proposed method to treat transverse, oblique and butterfly fractures is simple intramedullary rods ; whereas intramedullary interlocking nails is the better method for comminuted, segmented and spiral fractures. |
nursing education should train qualified nurses to respond to the needs of clients, based on the changes in the health - care system and its objectives. the performance of the community health nurse depends on a comprehensive combination of scientific and practical competencies which are acquired during the nursing course. clinical courses are the crucial parts of nursing education by which students acquire real experience and apply theory in practice. quality of community health nursing education is dependent on the quality of the education of nursing students in related fields. nursing is a practice - based discipline, and clinical courses play a key role in the development of nursing skills. of the 36 credits of externship and internship course in the bachelor program of nursing the internship course was introduced as a community - oriented instructional method by the nursing and midwifery branch of cultural revolution in 1990 ; later, it was revised and finally approved with the aim to train nurses who had knowledge, attitude, and skills for providing the necessary care to the individual, family, and community as a member of the health - care team. the general goal of the of bachelor program of nursing education is to train nurses who would be able provide nursing care in the areas of health, education, research, consultation, management, support, and rehabilitation to provide, maintain, and promote the health of the individual, family, and community. however, in spite of planning extensive and holistic goals in community - oriented educational system for nursing students, the achievement has not been satisfactory. most nursing schools accommodate community health and primary care in their educational plans to some extent. however, they still train their students for playing a traditional nursing role, and the students graduate traditionally with few or limited abilities in out - of - hospital care. in this respect, the national league for nursing has suggested that nurses at all educational levels should be prepared for working in the community - oriented health - care system. in other words studies by dehghani (2005) and mahmoudifar (2009) showed that the majority of instructors and students evaluated the internship course from rather weak to heravi (2011) demonstrated that the ability for playing different roles of a community health nurse is not developed by these courses. saberian (2003) studied the opinion of graduates and final - term students of nursing by a cross - sectional descriptive study. based on heravi (2011), borzou (2008 - 2009), and azar barzin (2007), there is a gap between theory, practice, and nursing services, that is, the community health courses has no application in clinical nursing service. these problems necessitate studying and understanding the process of the current community health nursing education and ask the question why implementation of current education does not achieve the predefined goals for the bachelor program. the present study could be considered as the first step in the formulation of this theory. determining the objectives of community health nursing education could be useful for the nursing profession because it would lead to discover the present concepts of community health nursing education, explore the characteristics and effective factors in formulating the education process, provide effective, quality community - oriented education, revise educational programs, train competent nurses for out - of - hospital care, train skilful, expert, and motivated nurses, define a definite position for nurses in the health - care system, and finally promote community health. although community health nursing has been considered as a part of the syllabus of the bachelor program, there are no clear concepts and theories in this course. obviously without clear concepts, there are serious problems and barriers for formulating and developing theories in this discipline. moreover, the experience of researchers in community health education and involvement with different problems, as well as literature reviews reveal a lack of information about the nature of education, quality of nursing students, and experience of instructors in education. it seems that qualitative research studies could provide the necessary knowledge for teachers, students, educational planners, and other related individuals about community health and similar education. on the other hand, a few studies have been conducted in iran on community health nursing education and educational planners need a comprehensive understanding of nursing education ; so, the present study aimed at exploring the experiences of nursing students in their community health nursing clinical clerkship. a qualitative approach using a grounded theory was used for achieving the goals of this study. grounded theory studies the social process of humanistic interactions. this method, developed by glazer and strauss in 1960, is rooted in interpretive school of symbolic interaction. one of the main applications of grounded theory is when there are insufficient research findings on the subject of study. thus, as concepts of community health nursing are vital in the educational process and these have not been explored and understood as variables in iranian nursing education, it is rational to use the grounded theory to clarify and develop concepts of this phenomenon. twelve students studying in the fifth and eighth terms of the bachelor program at the mashhad faculty of nursing, aged 2025 years (mean age : 22.2 years) with an equal ratio of male and female participated in this study ;, only one was married and all of them had successfully completed one clinical course in community health nursing. in addition, 10 nursing instructors of and 13 health - care staff members who worked in three health - care centers participated in this study. all the nursing instructors and health - care workers were married and were between 40 and 50 years (mean age : 43.6 years) and their average job experience was 18.4 years. in - depth and the interview questions were asked in an open - ended manner, in no fixed order. they were based on an interview guide, which was formulated from a critical review of the literature, peer review, and pilot study. first, each participant was asked to describe one of his / her own typical work days, then specifically to explain his / her own perceptions and experiences during the nursing clinical clerkship in community health and the factors influencing it. the interviewer probed participants by using questions or statements, such as could you say something more about that ?, what did you think then ? or all the participants were interviewed in their own or in the office of the principal investigator (based on their preference) in the community health center or faculty of nursing and midwifery. continuous comparative analysis and open, axial, and selective coding based on the method of strauss and corbin, were used for analysis. in open coding step, the interview transcribed was read several times and compared with codes of other interviews to find similarities and differences ; then, the similar codes were categorized. in the next step, axial coding, the coding paradigm was used which focuses on cases such as casual conditions of phenomena, intervening conditions, action / interaction, and consequences which are used for connecting categories. it is here that the main category the ambivalence of motivation in community health settings was verified. permission to conduct this study was given by the ethics committee of the mashhad faculty of nursing and midwifery, according to a formal letter of introduction from the vice dean for research of the university of medical sciences, serving as the legal authority in this area (january 2011). we emphasized confidentially, informed consent, right to exit from study at any time, selection of time and place of interview, and anonymity. permission, as oral informed consent, was sought from the participants for the audiotaped interviews. twelve students studying in the fifth and eighth terms of the bachelor program at the mashhad faculty of nursing, aged 2025 years (mean age : 22.2 years) with an equal ratio of male and female participated in this study ;, only one was married and all of them had successfully completed one clinical course in community health nursing. in addition, 10 nursing instructors of and 13 health - care staff members who worked in three health - care centers participated in this study. all the nursing instructors and health - care workers were married and were between 40 and 50 years (mean age : 43.6 years) and their average job experience was 18.4 years. the interview questions were asked in an open - ended manner, in no fixed order. they were based on an interview guide, which was formulated from a critical review of the literature, peer review, and pilot study. first, each participant was asked to describe one of his / her own typical work days, then specifically to explain his / her own perceptions and experiences during the nursing clinical clerkship in community health and the factors influencing it. the interviewer probed participants by using questions or statements, such as could you say something more about that ?, what did you think then ? or when you mention... what you mean ? all the participants were interviewed in their own or in the office of the principal investigator (based on their preference) in the community health center or faculty of nursing and midwifery. continuous comparative analysis and open, axial, and selective coding based on the method of strauss and corbin, were used for analysis. in open coding step, the interview transcribed was read several times and compared with codes of other interviews to find similarities and differences ; then, the similar codes were categorized. in the next step, axial coding, the coding paradigm was used which focuses on cases such as casual conditions of phenomena, intervening conditions, action / interaction, and consequences which are used for connecting categories. it is here that the main category the ambivalence of motivation in community health settings was verified. permission to conduct this study was given by the ethics committee of the mashhad faculty of nursing and midwifery, according to a formal letter of introduction from the vice dean for research of the university of medical sciences, serving as the legal authority in this area (january 2011). we emphasized confidentially, informed consent, right to exit from study at any time, selection of time and place of interview, and anonymity. permission, as oral informed consent, was sought from the participants for the audiotaped interviews. the categories that emerged from the data of this study are all related to the community health nursing clerkship. after the reduction and integration of similar codes, one main and five subcategories were revealed. all the themes are related to each other and reveal the pattern of community health nursing clerkship. in fact, these themes describe the phenomenon of education in community health nursing settings and the variables affecting it. therefore, in response to the research question, we can say that there is an ambivalence of motivation in community health nursing clerkship due to professional identity, educational atmosphere, educational management, motivation - based approaches, and inadequate productivity. these concepts help the reader to understand the reality of nursing education in the community health - care settings. this paper presents the process of community health nursing clerkship from the perspective of students, including narratives from participants [figure 1 ]. the community health nursing clinical education process the main casual conditions for ambivalence of motivation were the role of the community health nurse, attitude toward the course, and medical orientation. most participants stated that there is no definite position for nurses in health - care centers. one of participants said the role of nurse is unclear in a health center(s 11). from the aspect of attitude toward the course, participants considered it as a break. it was a good course ; we thought it is a break for the next clinical course which is difficult. (s10) the participants were medically oriented and differentiated between nurses and health - care workers. one participant said we are nurses, not health personnel (s1) and believed that there was no need for them to do this course. the comments of this participant confirmed itok, we conclude that there is no need, this is not our responsibility, our task, and it is not a nurse 's task(s1). based on the findings, lack of prerequisite skills / knowledge, poor administrative planning, and insufficient activity for students are the barriers to motivation. the category of lack of prerequisite skills / knowledge indicated preparedness of the students both theoretically and practically before starting the course. one of participants stated : we did nt know how we should measure height, weight and head circumference of infants, we did nt know of the practical methods for them (s10). they could not participate in some sections such as maternal - neonatal health and the midwifery part. we would like to visit midwifery section, but we ca nt (s3). besides, duration of the course in health - care centers was limited, and in field courses, most of the time was spent on the way. one of students said : we were just one to one hour and half in the villages the other barrier was insufficient activity for students.. they said that they had nothing to do during their course. one of them said : usually we had nothing to do after 10 am (s10). based on the analyses, one of the facilitating factors was rotation of students in different sections : vaccination, midwifery, environmental health, and handling diseases. one of the participants said : in health care center, we were divided into different groups ; we vaccinated, worked in children s section as well as midwifery section ; we spent three days in each part the participants applied different strategies for learning such as passiveness, providing services to clients, and responsibility. the experience of passiveness indicated the lack of importance for the course and lack of effort toward learning. i said to myself, if you are not supposed to work here, how important it is to ask a patient why this happens or why head circumference is low or is it familial or related to special problem ? their comments confirmed their lack of involvement : we were just observers in maternal neonatal section (s5), we were as observers(s3). most of them were mothers and children : we measured weight and blood pressure of mothers(s4). i tried to review the community health nursing credit i and ii, tried to be informed of the events there (s5). one of participants said : for the homework we should make some power point slides about leishmania (s8). the above strategies lead to the lack of adequate productivity in clerkship. this category indicates lack of using the full potential of the course and lack of efficacy in most health - care centers. care center instead of direct observation, each head explained ; if a person is allowed to visit directly it is more effective. another participant said : the visits to, for example, the capital center, had no use for us : there was something wrong with our teacher and she could not come with us to assess the health issues in a factory. the main casual conditions for ambivalence of motivation were the role of the community health nurse, attitude toward the course, and medical orientation. most participants stated that there is no definite position for nurses in health - care centers. one of participants said the role of nurse is unclear in a health center(s 11). from the aspect of attitude toward the course, participants considered it as a break. it was a good course ; we thought it is a break for the next clinical course which is difficult. (s10) the participants were medically oriented and differentiated between nurses and health - care workers. one participant said we are nurses, not health personnel (s1) and believed that there was no need for them to do this course. the comments of this participant confirmed itok, we conclude that there is no need, this is not our responsibility, our task, and it is not a nurse 's task(s1). based on the findings, lack of prerequisite skills / knowledge, poor administrative planning, and insufficient activity for students are the barriers to motivation. the category of lack of prerequisite skills / knowledge indicated preparedness of the students both theoretically and practically before starting the course. one of participants stated : we did nt know how we should measure height, weight and head circumference of infants, we did nt know of the practical methods for them (s10). they could not participate in some sections such as maternal - neonatal health and the midwifery part., duration of the course in health - care centers was limited, and in field courses, most of the time was spent on the way. one of students said : we were just one to one hour and half in the villages the other barrier was insufficient activity for students.. they said that they had nothing to do during their course. one of them said : usually we had nothing to do after 10 am (s10). based on the analyses, one of the facilitating factors was rotation of students in different sections : vaccination, midwifery, environmental health, and handling diseases. one of the participants said : in health care center, we were divided into different groups ; we vaccinated, worked in children s section as well as midwifery section ; we spent three days in each part the participants applied different strategies for learning such as passiveness, providing services to clients, and responsibility. the experience of passiveness indicated the lack of importance for the course and lack of effort toward learning. i said to myself, if you are not supposed to work here, how important it is to ask a patient why this happens or why head circumference is low or is it familial or related to special problem ? their comments confirmed their lack of involvement : we were just observers in maternal neonatal section (s5), we were as observers(s3). most of them were mothers and children : we measured weight and blood pressure of mothers(s4). i tried to review the community health nursing credit i and ii, tried to be informed of the events there (s5). one of participants said : for the homework we should make some power point slides about leishmania (s8). this category indicates lack of using the full potential of the course and lack of efficacy in most health - care centers. care center instead of direct observation, each head explained ; if a person is allowed to visit directly it is more effective. another participant said : the visits to, for example, the capital center, had no use for us (s1). according to a participant : there was something wrong with our teacher and she could not come with us to assess the health issues in a factory. this study explored the process of the community health nursing clinical education based on the experiences of the students. based on findings, lack of the role of the community health in health - care centers, medical orientation, and attitude toward the course influenced their motivation, and consequently the applied strategies such as passiveness, providing service to clients, and responsibility leading to inadequate productivity. lack of prerequisite skills / knowledge, lack of activity for students, and poor administrative planning were barriers to motivation. despite the program syllabus, students considered hospitals as the work place for nurses and differentiated between nurses and health - care workers. although there is a focus on orientation toward the community in the syllabus, practically, they are taught medical orientation and this is not in agreement with the goals of the course. this type of view leads to lake of enough motivation for good practice and leads to weak attitude toward community orientation. based on the study by borzou (2008 - 2009), graduate nurses assigned the least score to applicability of community health nursing courses. hervi (2011) demonstrated that the participants focused on finding a proper position for community health nurses for providing services and said the present program was limited in this sense. in terms of a role for community health nurses, delshad (2005) said one of the main challenges for community - oriented nursing care is lack of position for community health nurses. they regarded this course as a break and thought there is no need for them to pass this course. it should be noted that their attitude affected their behaviour ; so, they lacked motivation for active participation in this course. the findings of saberian (2003) revealed that 20.51% of the participants believed that community health nursing is irrelevant to the nursing profession. in the study by dalir (2011), internal motivation of students decreased during their study. lack of prerequisite skills / knowledge, lack of activity for students, and poor administrative planning accounted as barriers to motivation. lack of preparedness of students is conducive to a decrease in motivation and leads to a decrease in confidence of clients. in a study by leh (2006), students had nothing to do during the course and because of limitations for male students, students could not acquire the necessary competencies for providing services and this could be risky for the health of clients. the findings of the present study showed that lack of adequate productivity is an important factor to consider in community health nursing. in a study by delaram (2011), inadequate productivity in five areas of clinical education the findings of heravi (2011) also showed that clinical education of nursing students in the area of community health does not lead to active participation and individual and professional development based on expected outcomes. however, according to a study by hossieni (2005), most students evaluated clinical education well. this difference could be related to a lack of motivation in community health nursing students. the present findings are not consistent with the principles of community health nursing, because this kind of education plays an important role in training competent nurses. so, modification of the factors influencing lack of adequate productivity could promote community health. according to the findings, productivity of clerkship in community health nursing is low ; consequently, it leads to a weak attitude toward community orientation and low ability to provide out - of - hospital care and becomes conducive to a less important role for nurses in the health - care system. the findings revealed main problems and determinants of community health nursing education. for increasing the productivity of clerkship, the following strategies are suggested : establish a role for nurses in community health centers.improve attitude of students toward community health nursing by workshops or films before clerkship.provide initial education for students before clerkship.choosing health - care centers with sufficient number of clients. | background : the performance of the community health nurse depends on a combination of scientific and practical competencies acquired by educational experiences during the nursing course. curriculum planners of nursing education need to understand nursing education to train professional and community - oriented nurses. the aim of this article is to explore the experiences of nursing students during their community health nursing clinical clerkship courses.materials and methods : a grounded theory approach was used to conduct this study. twelve nursing students, 13 health - care staff members, and 10 nursing instructors were interviewed individually in 2011 - 2012. the interviews were tape - recorded and later transcribed verbatim. the transcriptions were analyzed using the method of strauss and corbin.results:ambivalence of motivation was the main category and included five subcategories : professional identity, educational atmosphere, educational management, motivation - based approaches, and inadequate productivity. this paper presents the aspects of the community health nursing clerkship course from the viewpoint of students in areas such as the role of the community health nurse, attitude toward the course, medical orientation, prerequisite skills / knowledge, poor administrative planning, rotation of students, insufficient activity for students, passiveness, providing service to clients, responsibility, and inproductivity. these categories could explain the nature of the community health nursing clerkship of the mashhad faculty of nursing and probably others in iran.conclusions:the findings revealed inadequate productivity of the community health nursing education ; so, it is suggested to define a position for nurses in this setting and remove barriers and provide conditions for them to play more important roles in the promotion of community health. |
mental disorders including schizophrenia are widely recognized as a leading cause of the disability worldwide (1). schizophrenia is a major clinical syndrome which is characterised by multiple signs and symptoms and is associated with complex and heterogeneous manifestations including the emotional, cognitive, and behavioural disturbances. the onset of symptoms often occurs during adolescence or young adulthood and persists throughout the lifetime. despite the substantial advances in the field of schizophrenia research, the underlying pathophysiology of the disease is still not fully understood. in this sense, several etiological models have been proposed to explain the biological basis of the disease including the neurodevelopmental, neurodegenerative, and cortical or subcortical disconnection models (2). the putative neurotransmitter dopamine is the most implicated neurochemical substrate in the pathogenesis and pharmacotherapy of schizophrenia (3). meanwhile, it has been shown that an imbalance between several neurotransmitter systems is involved in the neuropathology of schizophrenia (4). neurotransmitter systems are usually modulated by neuropeptides (5), therefore, any alteration in neuropeptide transmission may contribute to the pathophysiology of psychiatric disorders including schizophrenia. in this context, targeting the neuropeptide systems might be a promising therapeutic approach against the psychiatric disorders. neurotensin, a gut - brain neuropeptide which was first isolated from bovine hypothalamus (6), is implicated in various physiologic and pathologic processes and has shown beneficial effects against the inflammatory disorders (7, 8). this endogenous neuropeptide is widely distributed throughout the central nervous system (cns) of many mammals including humans and regulates glutamate, gamma - aminobutyric acid (gaba) and serotonin pathways (9, 10). in brain dopaminergic pathways, neurotensin is co - localized with dopamine and modulates dopamine transmission. in this respect, neurotensin - dopamine interactions have been demonstrated in several anatomical, behavioural and pharmacological studies (11, 12). neurotensin appears to be implicated in the pathophysiology and pharmacotherapy of schizophrenia (13, 14). based on the previous reports, neurotensin content in the cerebrospinal fluid (csf) of drug - free schizophrenic patients is reduced and there is a correlation between the csf concentration of neurotensin and the severity of schizophrenia symptoms (15, 16). schizophrenic patients with low csf concentrations of neurotensin are usually lithium non - responders and show a greater degree of thought disorders, hallucinations, and impaired behavioural performance (17). in animal experiments, central administration of neurotensin has shown behavioural and biochemical effects similar to those of antipsychotic drugs (18). however, studies investigating the regulatory effects of antipsychotics on brain neurotensin levels have provided conflicting results (19, 20). in addition, the mechanism(s) of the regulatory effects of neuroleptics on brain neurotensin content have not been fully elucidated. based on this background, we aimed to investigate the implication of neurotensinergic system in the mechanism of action of fluphenazine and amisulpride. fluphenazine is a typical antipsychotic drug which blocks the postsynaptic dopaminergic d1 and d2 receptors in the mesolimbic system and controls the symptoms in schizophrenia, dementia, agitation, and manic phases of dipolar disorder. the atypical antipsychotic, amisulpride, was initially developed as a selective d2 and d3 receptor antagonist for the treatment of schizophrenia, meanwhile, it has shown antidepressant effect via the antagonism at 5-ht7a receptors (14, 20). in order to have a mechanistic approach, we focused on the role of the endocannabinoid signalling in the potential regulatory effects of amisulpride or fluphenazine on brain neurotensin. in recent years, the endocannabinoid system and its regulatory functions in both central and peripheral nervous systems have attracted a growing interest. this ubiquitous signalling system is engaged in a plethora of physiological functions (21) and pathophysiology or treatment of depression (22). moreover, the endocannabinoid system is involved in the mechanism of action of various psychotropic agents (23 - 27). according to rodrguez - gaztelumendi, cannabinoid cb1 receptors and the enzymes involved in the synthesis and degradation of endocannabinoid ligands are located in the brain regions crucial for the emotionality and stress regulation (28). interestingly, the endocannabinoid system interacts with both neurotensinergic and dopaminergic systems (29, 30). based on a recent study, therefore, it may be reasonable to speculate that cb1 receptors are involved in the regulatory effects of antipsychotic drugs on brain neurotensin content. male wistar rats weighing 220 - 250 g were obtained from pasteur institute of iran, tehran, iran and housed three per cage under controlled conditions of temperature (22 2c), humidity (55 10%), and 12 hr light - dark cycle with ad libitum access to food and water. groups of rats (n=6) received intraperitoneal (ip) injections of 0.5, 1, and 3 mg / kg typical antipsychotic fluphenazine dihydrochloride (sigma - aldrich, germany) (32) which was dissolved in 0.9% saline or 3, 5, and 10 mg / kg atypical antipsychotic amisulpride (sigma - aldrich, germany) (33) dissolved in 70% ethanol and 0.9% saline (3:7) for either one day or 28 consecutive days. animals in control groups received the equivalent amount of vehicle (n=6). in the case of any significant alteration in brain neurotensin content due to the administration of antipsychotics, the cb1 receptor antagonist am251 (tocris bioscience, uk) was dissolved in tween 80 (sigma aldrich, germany), dimethyl sulfoxide (sigma aldrich, germany), and 0.9% saline (1:1:8) and injected ip at the doses of 1, 2 and 3 mg / kg (34, 35) either alone or 30 min before the administration of antipsychotic (n=6). drugs were injected between 9:00 and 10:00 a.m. at a total volume of 1 ml / kg. dissection of the brain regions twenty four hours after the last injection of drug or vehicle (36), animals were sacrificed by exposing their heads to a focused beam of microwave irradiation for 3.5 sec. this method has the advantage over the decapitation in minimizing post - mortem changes of neurotensin content by rapid thermal inactivation of tissue enzymatic activities (37). animals were sacrificed between 10:00 a.m. and 1:00 p.m. in order to minimize the variability due to diurnal fluctuations. the brain of each animal was quickly and carefully removed from the skull and dissected on ice into the prefrontal cortex, nucleus accumbens, anterior and posterior caudate nuclei, substantia nigra, amygdala and hippocampus (38, 39). tissue samples were immediately frozen on dry ice, weighed and kept in 500 l polyethylene microcentrifuge tubes and stored at -70c until extracted. data are expressed as mean sem of n=6/group pfc : prefrontal cortex, na : nucleus accumbens, acn : anterior caudate nucleus, pcn : posterior caudate nucleus, sn : substantia nigra, amg : amygdala, hip : hippocampus quantification of neurotensin the concentration of neurtensin in the tissue supernatants was determined by a sensitive and specific radioimmunoassay (40). briefly, each brain region was homogenized by ultrasonic disruption in 500 l of ice - cold 1 m hcl and centrifuged at 10 g for 15 min at 4c. the supernatant was transferred to a microcentrifuge tube and vortexed, and duplicate aliquots of 100 ml were transferred to borosilicate glass tubes and stored at -70c. upon the assay performance, the frozen aliquots were lyophilized, reconstituted in the assay buffer including 10 mm nah2po4, 0.15 m nacl, 0.01% nan3, 0.1% gelatin, 2.5 mm edta, and 0.05% triton x-100 adjusted to ph 7.6 with naoh. neurotensin antiserum (peninsula laboratories, uk) which is directed toward the middle portion of the neurotensin molecule, was used at a final dilution of 1:13,000 that provides 30% zero binding of the i - labeled neurotensin (amersham international, uk). free and antibody - bound neurotensin were separated by 50 l goat anti - rabbit antibody (peninsula laboratories, uk) as the secondary antibody. samples were left for 30 min at room temperature, then, the reaction was blocked with 1 ml distilled water. after centrifugation at 3000 g for 20 min at 4c, the supernatants were decanted and the radioactivity in the pellets was determined using a gamma counter (lkb wallac, finland) with a 2min / tube counting time and a 67% counting efficiency. the assay has a sensitivity of 1.25 pg / tube and an ic50 of 80 pg / tube. tissue pellets were resuspended in 1 m naoh by sonication and assayed for total protein (41). data were analysed by analysis of variance (anova) followed by tukey s post hoc test. the effects of acute administration of fluphenazine or amisulpride on brain regional levels of neurotensin single injection of 0.5 mg / kg fluphenazine or 3 mg / kg amisulpride did not affect brain neurotensin content as compared to the corresponding vehicles (figure 1, p>0.05). acute administration of the higher doses of drugs did not result in a remarkable effect (not shown). the effect of chronic treatment with fluphenazine on brain neurotensin content and the role of am251 in this regard. 28-day treatment with fluphenazine 3 mg / kg resulted in a brain region - specific enhancement of neurotensin contents. this was prevented due to the daily pre - application of the cb1 receptor antagonist am251 (3 mg / kg). (am / flu : injection of am251 30 min before the exposure to fluphenazine). pfc : prefrontal cortex, na : nucleus accumbens, acn : anterior caudate nucleus, pcn : posterior caudate nucleus, sn : substantia nigra, amg : amygdala, hip : hippocampus the effect of chronic administration of amisulpride on brain neurotensin levels and the role of am251 in this regard. four - week daily administration of amisulpride 10 mg / kg elevated neurotensin level in a brain region - specific fashion that was prevented by am251 (3 mg / kg) pre - treatment. data represent mean sem of n=6/group.p0.05). the effect of chronic treatment with amisulpride on brain neurotensin content and the role of am251 in this regard four - week daily administration of the lower doses of amisulpride did not affect neurotensin content in any brain region investigated (not shown). as shown in figure 3, 24 hr after the last injection of the highest dose of amisulpride, a significant enhancement of neurotensin levels was observed in the prefrontal cortex (p0.05). a : single injection of 3 mg / kg am251, b : 28-day treatment with 3 mg / kg am251. data represent means sem of n=6/group pfc : prefrontal cortex, na : nucleus accumbens, acn : anterior caudate nucleus, pcn : posterior caudate nucleus, sn : substantia nigra, amg : amygdala, hip : hippocampus the effect of am251 on brain regional content of neurotensin acute or 28-day treatment with am251 (3 mg / kg) alone did not alter neurotensin content in any brain region analyzed (figure 4a and b, p>0.05). during the last decades, targeting the neuro - peptide systems which are capable of regulating several neurotransmitter systems, has been the focus of intense research in order to develop more effective antipsychotic drugs. in this context, neurotensinergic neurotransmission has attracted a growing interest (13, 14, 19, 20, 36). based on the neuroleptic effect of neurotensin, it has been suggested that neurotensin inhibits dopaminergic neurotransmission in dopamine - rich regions of brain such as the prefrontal cortex and nucleus accumbens (18). in addition to the direct action, neurotensin can indirectly affect dopaminergic transmission through its association with other neurotransmitter systems including the glutamatergic, gabaergic, and serotonergic systems. enhancement of gaba release due to the activation of neurotensin receptors may result in the reduction of dopamine release via the activation of gaba receptors located on dopamine terminals (11, 12, 29). as mentioned before, antipsychotic drugs may attenuate dopamine neurotransmission through the elevation of neuro - tensin. meanwhile, the previously conducted studies represent different, sometimes conflicting, data (13, 19, 20, 36). in the present study, we have investigated the potential implication of neurotensin in the mechanism of action of the typical and atypical antipsychotic drugs, fluphenazine and amisulpride. as shown in figure 1, neurotensin is distributed in brain regions which are associated with the pathophysiology of schizophrenia and acute administration of fluphenazine or amisulpride did not affect neurotensin content in these parts. however, four - week daily administration of these neuroleptics increased neurotensin levels in a dose - dependent and brain region - specific fashion (figures 2 and 3). this finding may be in accordance with the delay in the onset of clinical efficacy after the treatment with neuroleptics. moreover, enhance - ment of neurotensin content in dopamine - rich brain regions following chronic administration of fluphenazine or amisulpride may represent a compensatory mechanism as part of the adaptive response to the prolonged dopamine receptor blockade. according to adachi, neurotensin may bind to dopamine leading to the reduction of its availability (42). meanwhile, the interaction of neurotensin with other neurotransmitter systems should not be excluded. chronic treatment with fluphenazine or amisulpride elevated neurotensin content in the prefrontal cortex and nucleus accumbens (figures 2 and 3). these findings provide evidence for a role of increased corticolimbic neurotensin neurotransmission in the mechanism of action of both of these typical and atypical antipsychotics. it appears that the neurochemical effects shared by fluphenazine and amisulpride may mediate their therapeutic efficacies. as previously reported, the deficits in neurotensin neurotransmission are associated with functional and behavioural disruptions similar to those seen in schizophrenic patients and may also be linked to deficits in sensorimotor gating (43). therefore, normalization of neurotensin neurotransmission following antipsychotic therapy may cause a recovery of such deficits. as demonstrated in figures 2 and 3, fluphenazine, but not amisulpride, elevated neurotensin content in the nigrostriatal regions, indicating that the therapeutic effects of amisulpride, at least in part, may be due to its effects on the neurotensin neurotransmission in the mesolimbic system but its actions in the nigerostriatal regions are much less potent. the latter finding also suggests that dopamine projections which terminate in the nigrostriatal regions are affected differentially by fluphenazine and amisulpride consistent with their differential liabilities to induce extrapyramidal side effects. the nigrostriatal regions control planning and execution of motor behaviours (44) and may be associated with the extrapyramidal side effects which usually occur following the treatment with typical antipsychotics. as previously reported, activation of nigral neurotensin receptors contributes to the inhibition of the nigrothalamic gabaergic pathway (45). this may result in the disinhibition of the excitatory glutamatergic drive to the motor cortex and justify the extrapyramidal side effects induced by typical antipsychotics including fluphenazine. as a whole, enhancement of neurotensin content in the nigrostriatal and mesocorticolimbic brain regions following chronic treatment with fluphenazine or amisulpride suggests that neurotensinergic pathways convey distinct information to these dopamine - rich regions of brain that may lead to the regulation of different physiological processes. in this context, neurotensin may be considered as a neuroanatomically - selective neuropeptide which mediate the therapeutic as well as the extrapyramidal side effects of antipsychotics. chronic administration of the highest dose of fluphenazine or amisulpride did not affect neurotensin contents in the amygdala and hippocampus (figures 2 and 3), indicating that neurotensinergic neurotransmission in these brain regions is not involved in the mechanism of action of these antipsychotics. meanwhile, based on a study conducted by gruber, the typical antipsychotic haloperidol elevated neurotensin concentration in the hippocampus (19). moreover, clozapine in contrast to amisulpride reduced neurotensin content in the prefrontal cortex (36). one likely explanation for the discrepancies between our findings and those of others may be due to the methodological differences such as the animal species, different dissection techniques or the neuroleptic regimens followed. it is possible that the neurotensin system in dopamine - rich brain regions reacts differently in response to dopamine - altering drugs. according to the heterogeneity of antipsychotic drugs such as their different binding affinities, they may regulate the neurotensinergic system by different mechanisms. in this context, meanwhile, the previously published data and ours might have important implications for the understanding of the functional association between dopamine- and neurotensin - containing cells in the cns as well as the mechanisms of action of antipsychotic drugs. the cb1 receptor antagonist am251 (3 mg / kg) prevented the neuroleptic - induced enhancement of neurotensin contents via blocking the endogenous cannabinoid activity (figures 2 and 3). on the other hand, am251 showed no effects by itself (figure 4). these findings suggest that fluphenazine and amisulpride affect brain neurotensin neurotransmission under the regulatory drive of cb1 receptors. we have also shown the implication of cb1 receptors in the neurotrophic effects of antipsychotic drugs (25). these findings indicate the critical role of the endocannabinoid system in the pathophysiological mechanisms underlying schizophrenia as well as its possible help in leading us toward the development of more effective drugs. our findings indicate that the increased mesolimbic neurotensin contents is implicated in the mechanism of action of both fluphenazine and amisulpride. the differential effects of fluphenazine and amisulpride on neurotensin neurotransmission in the nigrostriatal dopaminergic system may underlie the differences between the therapeutic profile of these neuroleptics as well as the extrapyramidal side effect liability of fluphenazine. this study shows once again the importance of neurotensin hypothesis in the etiopathogenesis and/or treatment of schizophrenia and argues for the cb1 receptor - mediated up - regulation of brain neurotensin content by amisulpride or fluphenazine. | objective(s): targeting the neuropeptide systems has been shown to be useful for the development of more effective antipsychotic drugs. neurotensin, an endogenous neuropeptide, appears to be involved in the mechanism of action of antipsychotics. however, the available data provide conflicting results and the mechanism(s) by which antipsychotics affect brain neurotensin neurotransmission have not been identified. therefore, we aimed to investigate the effects of fluphenazine and amisulpride on brain regional contents of neurotensin considering the role of cannabinoid cb1 receptors which interact with neurotensin neurotransmission. materials and methods : fluphenazine (0.5, 1, and 3 mg / kg) or amisulpride (3, 5, and 10 mg / kg) were administered intraperitoneally to male wistar rats either for one day or 28 consecutive days. twenty four hours after the last injection of drug or vehicle, neurotensin contents were determined in the mesocorticolimbic and nigrostriatal dopamine regions by radioimmunoassay. in the case of any significant change, the effect of pre - treatment with cb1 receptor antagonist, am251 was investigated. results : chronic, but not acute, treatment with the highest dose of fluphenazine or amisulpride resulted in significant enhancement of neurotensin contents in the prefronatal cortex and nucleus accumbens. fluphenazine also elevated neurotensin levels in the anterior and posterior caudate nuclei and substantia nigra. neither amisulpride nor fluphenazine affected neurotensin contents in the amygdala or hippocampus. pre - treatment with am251 (3 mg / kg) prevented the neuroleptic - induced elevation of neurotensin. am251 showed no effect by itself. conclusion : the brain neurotensin under the regulatory action of cb1 receptors is involved in the effects of amisulpride and fluphenazine. |
human t - cell leukemia virus type i (htlv - i), hepatitis b virus (hbv), hepatitis c virus (hcv), and kaposi s sarcoma - associated herpes virus (kshv) are four bloodborne, sexually transmissible viruses that can cause human cancers such as adult t - cell leukemia / lymphoma (atl), hepatocellular carcinoma (hcc), and kaposi sarcoma (1, 2). these viruses usually are transmitted via sexual contact or exposure to the infected blood, through either blood transfusion or sharing contaminated needles or transmission from mother to child (3 - 7). htlv - i belongs to retroviridae family and is associated with adult t - cell leukemia (atl) and the inflammatory condition of htlv - i - associated myelopathy / tropical spastic paraparesis (ham / tsp). razavi khorasan province (with 6.9 million populations) located in the northeast of iran is an endemic region for this virus (8). over two percent (2.12%) of residents in mashhad, the capital of razavi khorasan province, are htlv - i carriers (9, 10). according to recent studies, 5 provinces in iran are endemic for this virus (9, 11 - 13). hbv infection is among the top ten causes of death worldwide due to chronic liver disease and accounts for an estimated 370 million chronic infections (14, 15). hcv is a positive - stranded rna virus, which belongs to the flaviviridae family. more than 180 million people are infected with hcv worldwide (2, 16). this tumor virus is identified as the cause of kaposi s sarcoma (ks) and uncommon primary - effusion lymphoma (pel) and multicentric castleman 's disease (mcd) (7). the prevalence of the virus in the northeast of iran is around 1.7% (17). the routine screening tests for most of the viruses usually are based on antibody detection (serology) tests such as elisa and molecular detection methods such as pcr. after viral encounter, 90% of the patients show detectable specific anti - viral antibodies in three months and the remaining may take longer, despite the presence of viremia. therefore, the chances of false negativity and false positivity are common. in addition, in most of viral infections, around 10% - 15% of infected subjects can clear virus and remain serologically positive for lifelong. therefore, the positive tests do not show the presence of infection (18). the pcr analysis makes possible the diagnosis of viral infection through the sensitive detection of specific viral nucleic acids and represents the presence of viral infection in the body (19). therefore, to evaluate the presence of viral infection (prevalence) or the possibility of exposure to the virus (sero - prevalence), it is necessary to choose appropriate methods (20). taken together, our epidemiological knowledge of bloodborne infections is based on serological tests which demonstrate the exposure to these viruses (sero - prevalence) ; although the method is useful for epidemiological studies, it is not a perfect method to have a precise estimation of the current infection. therefore, the pcr test is applied to identify the current virus infection (prevalence) (21). about thirty million inmates usually go back to their respective community each year and this could potentially threaten the community health (22, 23). most of the prisoners originate from marginal socio - economic rural areas and are subject to extreme poverty, pervasive social health problems, limited educational opportunities, and illegal behaviors, such as drug injection and unsafe sexual activities. up to 35% of the prisoners are addicted to drugs and they may transmit these infections to others while they return home (24). the prevalence of hcv infection in prisoners in lebanon, hungary, spain, indonesia, and croatia was reported about 3.4%, 4.9%, 22.7%, 18.6%, and 8.3%, respectively (25 - 29). furthermore, the prevalence of hbv infection in the same countries were reported to be about 2.4%, 1.5%, 2.6%, 5.8%, and 11.3%, respectively (25 - 29). the prevalence of hcv among prisoners in tehran, iran, was 34.5% in injection drug users (idus), which was strongly associated with female gender, length of imprisonment, and use of shared needles, drug injection frequency of more than once per day, drug usage for more than 10 years, and unmarried status (30). based on other iranian studies conducted in nahavand and birjand, the histories of surgery, imprisonment, tattooing, extramarital sexual intercourses, and drug addiction were the main risk factors for hbv and hcv infections (31). the significant growth rates in prison coupled with related risky behaviors among prisoners and the high - rate of returning to communities emphasize the necessity of detection and treatment of these tumor virus infections. the study was carried out in razavi khorasan province (northeast of iran) with a population around 6.9 million according to the 2006 census. mashhad, the capital of razavi khorasan province, is the second largest city in iran, a holly pilgrimage city with a population about 2.2 million and a mobile population of visitors around 25 million a year (census, 2006). the motives of mobility, the process of the international movement, particularly those from countries at war such as iraq and afghanistan and heterogeneity of domestic population render this region in need of management of life threatening viruses. furthermore, the most populated prisons in this region are located in the holly city of mashhad they assumed that cancers were more prevalent among the prisoners in recent years and granted the study. the aim of the present study was to evaluate the prevalence, sero - prevalence, and risk factors for bloodborne tumor viruses including htlv - i, hbv, hcv, and kshv among inmates of two central prisons in the northeast of iran. all prisoners had full rights to decide whether they wanted to participate in the study. cases having risk factors or symptoms of diseases were referred to the prison health center for medical attention. this descriptive / cross - sectional study was conducted between april and september 2008 upon 1114 prison inmates from 11170 prisoners in two central prisons, mashhad, iran. prisoners were selected randomly according to stratified sampling method and divided into two strata (female and male). the total sample size, by assuming a less than 5% refusal rate amongst the prisoners, amounted to 1175 that was chosen based on statistical test of population proportion, frequencies of risk factors among the population and previous published studies. the research ethics committee of mashhad university of medical sciences (mums) approved this study (number : 86675). after taking permissions from the prison administration and biomedical ethics committee, all participants were interviewed using a standard questionnaire that included demographic information and risk factors e.g., addiction to drugs, various ways of drugs usage, alcohol consumption, tobacco consumption, and infection to htlv - i, hbv, hcv, and kshv. medical history and related signs and symptoms were meticulously recorded. after obtaining informed consent, 5 ml blood sample serum samples were tested for the presence of anti - htlv - i (dia.pro, italy), anti - hcv (dia.pro, italy), anti - kshv (biotrin, ireland), and the surface antigen of hepatitis b virus (radim, italy), by enzyme - linked immunosorbent assay (elisa) according to manufacturers instructions. all serological and molecular tests were performed in inflammation and inflammatory diseases research center laboratory, mums, iran. the positive specimens were further confirmed by polymerase chain reaction (pcr) using specific primers for hcv, hbv, htlv - i (tax and ltr), and kshv. dna and rna were extracted using available commercial kits (dna blood mini kit and viral rna mini kit, qiagen, germany). the hcv rna was reverse transcribed using a revert aid tm h minus first strand cdna synthesis kit (fermentas, germany). the reverse transcription was carried out at 42c for 60 minutes followed by rt inactivation at 70c for 5 minutes. the cdna was kept at -20c until use and was used as a template in the nested pcr method for amplification of a gene fragment of hcv with the following protocol : 25 l reaction of 10x buffer, mgcl2 (1.5 mm), dntps (200 m), 10 pm of each primer, 0.5-u of taq dna polymerase, and 3 l cdna. the hbv pcr amplification was carried out in a tube containing 25 l reaction of 10x buffer, mgcl2 (2 mm), d ntps (200 m), 10 pm of each primer, 0.5-u of taq dna polymerase, and 100 ng dna. to confirm htlv - i infection, a conventional pcr the pcr amplification was carried out in a tube containing 25 l reaction of 10x buffer, mgcl2 (2 mm), d ntps (200 m), 10 pm of each primer, 0.5-u of taq dna polymerase, and 100 ng dna. table 1 shows the sequence of primers and pcr conditions for these viruses. data on demographic characteristics, medical history, and physical examination, related to risk factors, were analyzed by spss software version 11.5. chi - square test was used to examine the association of demographical and behavioral variables with hcv, hbv, htlv - i, and kshv infections. odd ratios (ors) and their 95% confidence interval (95% ci) were calculated for each risk factor in univariate analysis. all prisoners had full rights to decide whether they wanted to participate in the study. cases having risk factors or symptoms of diseases were referred to the prison health center for medical attention. this descriptive / cross - sectional study was conducted between april and september 2008 upon 1114 prison inmates from 11170 prisoners in two central prisons, mashhad, iran. prisoners were selected randomly according to stratified sampling method and divided into two strata (female and male). the total sample size, by assuming a less than 5% refusal rate amongst the prisoners, amounted to 1175 that was chosen based on statistical test of population proportion, frequencies of risk factors among the population and previous published studies. the research ethics committee of mashhad university of medical sciences (mums) approved this study (number : 86675). after taking permissions from the prison administration and biomedical ethics committee, a random sampling was carried out. all participants were interviewed using a standard questionnaire that included demographic information and risk factors e.g., addiction to drugs, various ways of drugs usage, alcohol consumption, tobacco consumption, and infection to htlv - i, hbv, hcv, and kshv. after obtaining informed consent, 5 ml blood sample was collected from each of the participants in edta- containing sterile tubes. serum samples were tested for the presence of anti - htlv - i (dia.pro, italy), anti - hcv (dia.pro, italy), anti - kshv (biotrin, ireland), and the surface antigen of hepatitis b virus (radim, italy), by enzyme - linked immunosorbent assay (elisa) according to manufacturers instructions. all serological and molecular tests were performed in inflammation and inflammatory diseases research center laboratory, mums, iran. the positive specimens were further confirmed by polymerase chain reaction (pcr) using specific primers for hcv, hbv, htlv - i (tax and ltr), and kshv. dna and rna were extracted using available commercial kits (dna blood mini kit and viral rna mini kit, qiagen, germany). the hcv rna was reverse transcribed using a revert aid tm h minus first strand cdna synthesis kit (fermentas, germany). the reverse transcription was carried out at 42c for 60 minutes followed by rt inactivation at 70c for 5 minutes. the cdna was kept at -20c until use and was used as a template in the nested pcr method for amplification of a gene fragment of hcv with the following protocol : 25 l reaction of 10x buffer, mgcl2 (1.5 mm), dntps (200 m), 10 pm of each primer, 0.5-u of taq dna polymerase, and 3 l cdna. the hbv pcr amplification was carried out in a tube containing 25 l reaction of 10x buffer, mgcl2 (2 mm), d ntps (200 m), 10 pm of each primer, 0.5-u of taq dna polymerase, and 100 ng dna. to confirm htlv - i infection, a conventional pcr the pcr amplification was carried out in a tube containing 25 l reaction of 10x buffer, mgcl2 (2 mm), d ntps (200 m), 10 pm of each primer, 0.5-u of taq dna polymerase, and 100 ng dna. table 1 shows the sequence of primers and pcr conditions for these viruses. data on demographic characteristics, medical history, and physical examination, related to risk factors, were analyzed by spss software version 11.5. chi - square test was used to examine the association of demographical and behavioral variables with hcv, hbv, htlv - i, and kshv infections. odd ratios (ors) and their 95% confidence interval (95% ci) were calculated for each risk factor in univariate analysis. the majority of participants were imprisoned for drug - related crimes (50%) and robbery (30%). the mean length of imprisonment was 53.37 54.9 months (median : 33, 25 percentile : 12 and 75 percentile : 81). 615 individuals (58.2%) were reported as drug users (data not shown). the study population consisted of 992 (89%) males and 122 (11%) females. the mean age of males and females was 34.42 10.95 years and 40.67 14.2 years, respectively. the data showed that 72.6% of males and 100% of females were married. according to the serology tests, sero - prevalence of hcv, hbv, htlv - i and kshv was 24.5%, 4.2%, 3.4%, and 3.2%, respectively. according to the results of pcr, the prevalence of hcv, hbv, htlv - i, and kshv was 19.1%, 2.1%, 2%, and 3% respectively (figure 1). the sero - prevalence of hcv, hbv, htlv - i, and kshv among females was 19.5% (22), 3.5% (4), 4.4% (5), and 1.8% (2), respectively, while in males was 25.1% (247), 4.3% (42), 3.2% (32), and 3.2% (33), respectively. no significant differences were existed in sero - prevalence of these viruses between females and males (p > 0.05). as shown in table 2, there was a significant association between hcv, htlv - i, and kshv infections and history of imprisonment. hbv infection was associated just with the length of imprisonment and hcv infection was significantly associated with the length of imprisonment, number of prisoners inside the cell, and number of prisoners inside in the wing. table 3 shows the univariate analysis of behavioral risk factors for hcv, hbv, htlv - i, and kshv infections among prisoners. there were statistically significant differences between hcv, htlv - i, and kshv infections among addict and non - addict, drug injecting, and shoplifting in this study (table 3). moreover, a statistically significant difference was observed among prisoners with hcv and htlv - i infections who consumed tobacco versus who did not, and also those who committed robbery (table 3). table 4 shows odd ratios (or) and corresponding 95% confidence intervals (ci) for hcv, hbv, htlv - i, and kshv positive cases who were drug users. hbv, hcv, htlv - i, and kshv co - infections among prisoners are shown in table 5. the results showed that hcv - kshv co - infection was the most common co - infection among prisoners (31, 2.8%). hcv - htlv - i co - infection and hbv - hcv co - infection were observed in 16 (1.5%) and 14 (1.3%) of prisoners, respectively. hcv - kshv and hbv - hcv co - infections were more common among males than females. triple co - infection was also observed in seven cases and one case had all of four infections. the majority of participants were imprisoned for drug - related crimes (50%) and robbery (30%). the mean length of imprisonment was 53.37 54.9 months (median : 33, 25 percentile : 12 and 75 percentile : 81). 615 individuals (58.2%) were reported as drug users (data not shown). the study population consisted of 992 (89%) males and 122 (11%) females. the mean age of males and females was 34.42 10.95 years and 40.67 14.2 years, respectively. according to the serology tests, sero - prevalence of hcv, hbv, htlv - i and kshv was 24.5%, 4.2%, 3.4%, and 3.2%, respectively. according to the results of pcr, the prevalence of hcv, hbv, htlv - i, and kshv was 19.1%, 2.1%, 2%, and 3% respectively (figure 1). the sero - prevalence of hcv, hbv, htlv - i, and kshv among females was 19.5% (22), 3.5% (4), 4.4% (5), and 1.8% (2), respectively, while in males was 25.1% (247), 4.3% (42), 3.2% (32), and 3.2% (33), respectively. no significant differences were existed in sero - prevalence of these viruses between females and males (p > 0.05). as shown in table 2, there was a significant association between hcv, htlv - i, and kshv infections and history of imprisonment. hbv infection was associated just with the length of imprisonment and hcv infection was significantly associated with the length of imprisonment, number of prisoners inside the cell, and number of prisoners inside in the wing. table 3 shows the univariate analysis of behavioral risk factors for hcv, hbv, htlv - i, and kshv infections among prisoners. there were statistically significant differences between hcv, htlv - i, and kshv infections among addict and non - addict, drug injecting, and shoplifting in this study (table 3). moreover, a statistically significant difference was observed among prisoners with hcv and htlv - i infections who consumed tobacco versus who did not, and also those who committed robbery (table 3). table 4 shows odd ratios (or) and corresponding 95% confidence intervals (ci) for hcv, hbv, htlv - i, and kshv positive cases who were drug users. hbv, hcv, htlv - i, and kshv co - infections among prisoners are shown in table 5. the results showed that hcv - kshv co - infection was the most common co - infection among prisoners (31, 2.8%). hcv - htlv - i co - infection and hbv - hcv co - infection were observed in 16 (1.5%) and 14 (1.3%) of prisoners, respectively. hcv - kshv and hbv - hcv co - infections were more common among males than females. triple co - infection was also observed in seven cases and one case had all of four infections. cancer is the leading cause of death in developed countries and the second most cause of death in developing countries. according to report of cancer incidence and mortality, 14.1 million new cancer cases and 8.2 million cancer deaths occurred in 2012 worldwide (32). human tumor viruses are associated with a variety of human malignancies ; and around 15% of human cancers are virus - related (33). low socioeconomic level, high risk behaviors like tattooing, using drugs, needle sharing, and sexual activity of prisoners put them at a high risk of infection with tumor viruses such as hbv, hcv, htlv - i, and kshv. beside these risk factors, the inadequate living conditions such as overcrowding along with the absence of early diagnosis and treatment in the prisons may be involved in the spread of infection among inmates at a faster pace. subsequently, when prisoners are released, they may transfer these infections to the general population (1, 26, 34, 35). in this study, we evaluated the sero - prevalence, prevalence, and risk factors of hbv, hcv, htlv - i, and kshv infections among prisoners in mashhad, iran. this study showed higher overall prevalence of hbv, hcv, htlv - i, and kshv among prisoners compared to the general population of iran (9, 36 - 38). it is possibly because of their behavioral patterns and frequent use of risky behaviors (such as drug abuse, alcohol consumption, and sexual practices). however, the sero - prevalence of hcv and kshv was dramatically higher compared to the general population in khorasan provinces. the results of the present study showed that the sero - prevalence of tumor viruses for hcv, hbv and kshv was two times more in prisoners than the general population ; however, for htlv - i it was nearly same as the general population. these differences between the spread ratio of htlv - i and that of hbv, hcv, and kshv in prisoners may be due to the differences in infectivity and amount of these viruses which are necessary factors for the mounting an infection. in addition, htlv - i transmits via viable htlv - i infected cells through the specialized sites of cell - to - cell contact called virological synapses (39). apart from htlv - i and kshv, for hbv and hcv, other studies around the world have demonstrated similarly a higher prevalence of these viral infections in prisoners than the general population (1, 26, 34, 40, 41). furthermore, the prevalence of hbv (4.2%), hcv (19.1%), and htlv - i (3%) among prisoners in the present study was higher than the ratios reported by a similar study conducted in brazil (2.4%, 6.4%, and 1.09%, respectively) (42). these higher rates of prevalence might be due to the larger sample size in the present study, different methodologies, and the effect of infection accumulation progressing with age. moreover, the brazilian study was carried out on a teenage population (11 - 18 years old). the sero - prevalence of hbv (8.1%) and hcv (31.1%) infections among the inmates of a prison in bologna, italy, was higher compared to the present study. the higher rates might be due to that the majority of the prisoners in italy were addicted to drugs and 33.9% of them were idus (43). the present study also demonstrated that hcv infection was significantly associated with the number of prisoners inside the cell, history of imprisonment, number of inmates in the wing, length of imprisonment, tobacco consumption, and methods of using drugs. hbv infection was significantly related to the length of imprisonment while kshv infection showed a statistical association with history of imprisonment. furthermore, there was a significant association among htlv - i with history of imprisonment, number of inmates in the wing, and tobacco consumption. our findings indicated that, the majority of hcv and htlv - i and kshv positive prisoners were addicted to drugs. additionally, 29.6% of kshv positive prisoners and 37.6% of hcv positive prisoners were injection drug user which can be the cause of higher prevalence of hcv among inmates. moreover, hcv and kshv infections were statistically correlated with the type of crime committed. among hcv positive inmates, drug - related crimes and robbery and among kshv positive inmates, robbery and drug - related crimes were more frequent. in a study conducted on ghanaian prison inmates aged 17 - 46 years who had hcv, hbv, hiv and syphilis infections, the main risk factors were unmarried status, illiteracy, female gender, being incarcerated for longer than median time served of 36 months, history of homosexuality, history of intravenous drug use, history of sharing syringes, drug paraphernalia, history of participation in paid sexual activity, and history of sexually transmitted diseases (1). also, in a study conducted to evaluate the sero - prevalence, co - infection, and risk factors of hiv, hbv, and hcv among inmates in nasarawa state, nigeria, the length of incarceration, previous incarceration (for hiv, hbv, and hcv), intra - prison anal sex, multiple sex partners (for hiv and hbv), and ignorance of transmission modes, blood transfusion, and alcohol consumption (for hbv and hcv) were risk factors among the population of study (44). in our study, hcv co - infection was more common than other co - infections amongst the prisoners. we observed hcv - kshv co - infection in 2.8%, hcv - htlv - i co - infection in 1.5%, and hcv - hbv co - infection in 1.3% of prisoners. among prisoners who were addicted to drugs, 2.8% had hcv - kshv co - infection and 1.5% had hcv - htlv - i co - infection. furthermore, approximately all prisoners with hbv - hcv and hcv - kshv co - infections were injection drug users. these results emphasis the transmission mode of these co - infections (possibly through infected needles and syringes shared) among prisoners. co - infection results found in this study are different from those of other studies. for example, hcv - hbv co - infection with the rate of 3.83% (30 cases) among prisoners in lahore was more prevalent compared to our study (45). in contrast, hcv - hbv co - infection of prisoners (the prevalence of 0.7%) in nasarawa state, nigeria, was lower than the rate found in our study (44). this lower rate of co - infection was expected because none of the inmates in the mentioned study were exposed to drug use. in the present study, the co - infected prisoners had no symptoms ; however, they were referred to qaem hospital, affiliated to mums, for monitoring. in summary, this study demonstrated that tumor virus infections (particularly hcv infection) are highly prevalent in the prison population. hcv was the most contagious viral infection and htlv - i was the weakest one in prisoners. apart from kshv infection which its prevalence in prisoners was as twice as the prevalence in the general population, the prevalence of hbv and htlv - i was nearly in ranges of the general population. rubbery and drug injection were the main risk factors for hcv, kshv, and htlv - i infections. the high rate of hcv infection (and kshv infection in a lower extent) among inmates is an important health concern. health education, regular testing, routine screening of infected prisoners with high - risk behaviors particularly among injection drug users and facilitating access to treatment are essential to mitigate the associated risks and curb its spread within the infected population. prisoners are special population to study, and it needs much coordination with different organizations to obtain their informed consent. any transportation was prohibited ; the authorities did not allow our team of researchers to enter the prison, except the main researcher. therefore, we had to educate their physicians and health center employees to take part. due to loss of samples, the researchers had to consider 20 percent attrition rate to calculate the sample size. | backgroundprisoners are at high risk of blood borne and sexually transmitted infections due to their high involvement in risky behaviors. in this descriptive / cross - sectional study, the prevalence, sero - prevalence, and risk factors for bloodborne tumor viruses including htlv - i, hbv, hcv, and kshv were evaluated among inmates of two central prisons in the northeast of iran.methodsblood samples of 1114 inmates were analyzed for the presence of anti htlv - i, kshv, and hcv antibodies and hbsag by elisa. pcr tests were performed to confirm the presence of these viruses in plasma and identify the current infections.resultsthe sero - prevalence of hcv, hbv, htlv - i, and kshv was 24.5%, 4.2%, 3.4%, and 3.2% and the prevalence of hcv, hbv, htlv - i, and kshv was 19.1%, 2.1%, 2%, and 3%, respectively. hcv infection was significantly associated with history of imprisonment, tobacco consumption, alcohol consumption, intravenous drug use, length of imprisonment, and type of crime committed. thirty one (2.8%) prisoners had hcv - kshv co - infection, 16 (1.5%) had hcv - htlv - i co - infection, and 14 (1.3%) had hbv - hcv co - infection. triple co - infection was observed in seven cases and one case had four infections concomitantly.conclusionsthis epidemiological study indicated different rates and transmission risks for these viruses. hcv was the most contagious viral infection and htlv - i was the weakest in the prisoners. apart from kshv infection which its prevalence was as twice as in the general population, the prevalence of hbv and htlv - i in prisoners was nearly in ranges of the general population. |
endometriosis, a term first used by sampson, is defined as the presence of endometrial glands and stroma outside the uterus.1 this ectopic finding affects 7%10% of women of reproductive age and commonly occurs in the pelvic organs, presenting with dysmenorrhea, menorrhagia, pelvic pain, and infertility.1,2 furthermore, ectopic endometrium occurs in the abdominal wall in 0.03%1.08% of women with anamnesis of obstetric or gynecologic procedures.1 however, spontaneous abdominal wall endometriosis is any ectopic endometrium found superficial to the peritoneum with no previous scar (iatrogenic or not). an umbilical endometrioma is a rare condition, with an estimated incidence of 0.5%1% in all patients with endometrial ectopia.2 it can occur following laparoscopic or other surgical procedures involving the umbilicus. primary umbilical endometriosis is an even rarer and more unusual condition with unclear pathogenetic mechanisms.14 this is a report of a rare case of primary umbilical spontaneous abdominal wall endometriosis. a 44-year - old parous woman presented to the outpatient clinic of our department with an umbilical skin lesion accompanied by pain one week before her menses every month during the previous year. she also reported that this umbilical mass had first appeared 56 years previously and had enlarged during the previous year. the patient had regular and painless menstrual periods and she had experienced two spontaneous vaginal deliveries. she had no history of bleeding from the umbilical mass or swelling in the umbilical area, abdominal pain, dyspareunia, or infertility. clinical examination revealed a skin - colored, mobile umbilical nodule measuring approximately 0.6 0.6 cm. there was no strong diagnostic evidence of abdominal wall endometriosis, and hence the patient did not report any association between her menstrual period and bleeding or swelling of this umbilical lesion., the mass was found approximately 10 mm below the skin surface and was excised with a healthy margin (excision area 2 2 cm, figure 1). surgical pathology revealed a 2.0 2.0 3.0 cm area of endometriosis with negative margins at the umbilicus. histopathologic features of cutaneous endometriosis and endometrial glands with mucinous - type metaplasia in a fibrous eosinophilic stroma were noted within the dermis. additionally, small diffuse foci of stromal lymphovascular tissue consistent with mild inflammation and plasma cells were present, suggesting endometritis. the risk of recurrence and scar endometriosis were explained to the patient. when followed up 4 weeks after surgery she was found to be asymptomatic, with the appearance of the umbilicus being satisfactory. the patient was referred to the outpatient clinic of the department of obstetrics and gynecology for evaluation and a potential further consultation. however, clinical and magnetic resonance imaging (mri) examinations did not reveal pelvic endometriosis lesions, and given that the umbilical endometrioma was totally excised, no further treatment with hormonal therapy was proposed for the patient. three years after excision, the patient remains free of disease and no recurrence has been observed. endometriosis due to the presence of ectopic tissue can be found in almost any organ and cavity of the female body, including the lungs, bowel, ureter, and brain, but the most frequent location is the abdominal wall.16 abdominal wall endometriosis is commonly associated with abdominal surgical scars, especially those associated with cesarean section, laparoscopy, and amniocentesis. however, the definition of abdominal wall endometriosis includes lesions that are not due to previous surgical procedures, and such cases are referred to as spontaneous abdominal wall endometriosis.1 no large prospective or retrospective studies have investigated spontaneous abdominal wall endometriosis. a literature review by horton revealed that abdominal wall endometriosis was associated with surgical scars in only 48% of 445 patients with the condition. although cesarean section is associated with abdominal wall endometriosis in 0.03%1.7% of all cases, spontaneous abdominal wall endometriosis is less common than scar - related endometriosis, and according to horton, represents only 20% of all cases.1,5 however, the incidence of spontaneous abdominal wall endometriosis in the literature reportedly lies in the range of 0%38%.1,6 the most common locations of spontaneous abdominal wall endometriosis appear to be the umbilicus and groin.1,2 the first description of an umbilical endometrioma is accredited to villar in 1886, and since then this condition has been referred to as a villar s nodule. umbilical endometriosis is a rare condition accounting for up to 30%40% of all cutaneous endometriosis cases, having an estimated incidence of 0.5%1% in all cases of endometrial ectopia.3,6,7 according to the literature, a total of only 109 cases of umbilical endometriosis has been described, but most reportedly developed secondary to surgical scars.2,7 a primary umbilical endometriotic lesion without any surgical history is an even rarer condition, with an estimated overall incidence of less than 0.5%1% among all endometriosis cases.7 to our knowledge, there is not any systematic literature review on published cohorts of patients or case reports having primary umbilical endometrioma. furthermore, primary umbilical endometriosis is a condition of specific interest to the general surgeon, because diagnosing any extrapelvic spontaneous abdominal wall endometriosis can be difficult in patients without any symptoms associated with menstruation.1,6,7 there has been considerable speculation regarding the pathogenesis of endometriosis, and several theories have been proposed.13,5,6 in 1953, latcher classified all theories into three main categories, ie, the embryonic rest theory, the coelomic metaplasia theory, and the migratory pathogenesis theory.2 the embryonic rest theory attributes endometriosis adjoining the pelvic viscera to a specific stimulus to a mullerian origin cell nest.13,5,6 in 1927, sampson first described the implantation or retrograde menstruation theory, which states that during menses, refluxed endometrial cells escape from the fallopian tubes and implant on the surrounding pelvic structures.13,5,6 the direct transplantation theory can explain the endometriosis occurring on surgical scars, but does not explain the rare locations of endometriomas in distant organs, such as the brain or lungs. this prompted halban to develop the dissemination theory of vascular migration of endometrial cells to ectopic sites, which explains the dispersion of endometrial tissue by direct extension via vascular or lymphatic channels and also in surgical procedures.2,5 the second theory of coelomic metaplasia or induction theory is based on embryologic studies, and involves metaplasia of cells in the abdominal wall into endometrial cells, which also suggests that sloughed endometrium produces substances that form endometriosis. this metaplasia may be induced by hormonal manipulation, inflammation, or trauma.1,3,5 the most recent theory of cellular immunity proposes cellular proliferation of ectopic endometrial cells. the actual mechanism remains unclear, but none of the suggested theories should be excluded until convincing experimental data are obtained. as a result, some investigators advocate a combination of the aforementioned theories.3,6 furthermore, in cases of spontaneous abdominal wall endometriosis (as in the case report presented herein), the implantation theory, the direct transplantation theory, and the induction theory seem incapable of explaining the pathogenesis, while the dissemination theory through lymphatic or vascular spread can explain the occurrence of endometriosis at distant locations. moreover, in the development of umbilical endometriosis, some authors hypothesize that the umbilicus acts as a physiologic scar with a predilection for endometrial tissue.3 extragenital endometriosis has various presentations and remains a difficult condition to diagnose and treat. in abdominal wall endometriosis, the chief symptom is usually a mass at the site of maximum tenderness, which varies in size following the menstrual cycle, while the typical characteristic is cyclic pain associated with menses.1,3 there are reports that the pain can be constantly present without any association with the menstrual cycle, but this is generally regarded as atypical, which may explain why abdominal wall endometriosis is often misdiagnosed clinically. in such atypical cases, and especially in cases of spontaneous abdominal wall endometriosis, symptoms and signs may occur singly, which always hinders an accurate diagnosis. in published series, the reported preoperative diagnosis rate has varied between 20% and 50%.4 this diagnostic failure could be due to general surgeons, who often make the diagnosis, not being sufficiently familiar with abdominal wall endometriosis. another possible explanation is the atypical presentation of the disease along with the possible differential diagnoses, including lipoma, sarcoma, lymphoma, primary or metastatic cancer, cysts, and inguinal or incisional hernia.14 clinical diagnosis is often difficult in cases of umbilical endometriosis. patients suffering from this condition are usually of reproductive age and often present with an umbilical mass associated with swelling, pain, discharge, or cyclical bleeding.2 the umbilical nodule has been described as being flesh - colored, brownish, dark - bluish, or simply a subcutaneous mass, with a size that typically varies from 0.5 cm to several centimeters, but can be enormous.1,3,4 there may be associated symptoms of coexistent pelvic endometriosis, although the incidence of pelvic disease in abdominal wall endometriosis is within the same range as the general population (8%15%).2,5 due to the variable macroscopic appearance of umbilical endometriomas, these lesions can initially be confused with malignant tumors, such as melanoma. nevertheless, any condition presenting with a subcutaneous mass or discoloration of umbilical skin should be considered, including pyogenic granuloma, nodular melanoma, primary or metastatic adenocarcinoma, hernia, residual embryonic tissue, and cutaneous endosalpingosis.13 while the diagnosis is primarily performed clinically, diagnostic procedures such as ultrasound, computed tomography, and mri have also been used. ultrasound is useful for determining whether the mass is cystic or solid, but it is not specific for abdominal wall endometriosis.1,2 computed tomography and mri can be useful for showing the extent of the abdominal wall endometriosis, and usually show a solid well circumscribed mass, that appears homogeneously hyperintense in t1-weighted mri sequences. mri also has the advantage over laparoscopy in its ability to evaluate pelvic and extraperitoneal disease.1,2 fine - needle aspiration is generally inconclusive, although it may be of some value in cases of scar endometriomas.1,4 according to catalina - fernandez, dermoscopy can be helpful in cases of cutaneous or subcutaneous endometriosis, with cytologic smears revealing high cellularity with hemosiderin - laden macrophages and sheets of stromal and epithelial cells on a hemorrhagic background.3 the histologic diagnosis of endometrioma requires two of the three following features : endometrial - like glands, endometrial stroma, or hemosiderin pigment.1 the preferred treatment in all cases of abdominal wall endometriosis is wide local excision of the mass, while some investigators propose the addition of hormonal therapy whenever severe pelvic disease is assumed or demonstrably present.14 therefore, surgical resection of an umbilical endometrioma with safety and clear margins is the treatment of choice, and offers the highest probability of both a definitive diagnosis and a favorable outcome. preservation of the umbilicus is preferred, but if the umbilicus has to be completely removed in order to achieve radical excision, certain methods can provide adequate reconstruction.3 complete excision of the umbilical lesion may necessitate partial resection of the underlying fascia. this is recommended, because local recurrence is likely if the surgical excision is inadequate. therefore, wide excision with a margin of at least 1 cm is considered the treatment of choice, even for recurrent lesions.1,3,4 several authors have advocated the use of hormonal therapy with a gonadotropin - releasing hormone analog (eg, danazol or progesterone), with the aim of decreasing the size of the mass and facilitating surgery. furthermore, these hormones can be added to surgical treatment in cases of severe pelvic disease.2,4 medical management can not be enthusiastically recommended, due to its reported success rate being low, with it offering only temporary alleviation of the symptoms, and serious adverse effects often being followed by recurrence after cessation of drug intake.1,4 it is also known that both abdominal wall and scar endometriosis are less responsive to hormonal therapy.4 malignant transformation of abdominal wall endometriosis is a very rare complication (in 1% of cases).4 spontaneous abdominal wall endometriosis is usually diagnosed by pathology, especially in cases without the typical triad of mass, pain, and cyclic symptomatology, as in the case report presented herein. spontaneous abdominal wall endometriosis is currently regarded as a rare disease entity accounting for 20% of all cases of abdominal wall endometriosis. however, abdominal wall endometriosis may occur more frequently than is generally assumed, primarily affecting women between 20 and 40 years of age after a cesarean section. careful history - taking and physical examination are essential to making the correct diagnosis, although this can be difficult in atypical presentations, and so other causes of umbilical lesions should be considered. complete excision and histology is highly recommended for obtaining a definitive diagnosis and to rule out malignancy. | umbilical endometrioma is a rare condition, with an estimated incidence of 0.5%1% in all patients with endometrial ectopia. spontaneous abdominal wall endometriosis is an even rarer and more unusual condition with unclear pathogenetic mechanisms. a 44-year - old parous woman presented with an umbilical skin lesion, and no history of bleeding from the umbilical mass or swelling in the umbilical area. the initial clinical diagnosis was granuloma, and excision was planned. pathology examination revealed endometrial glands with mucinous - type metaplasia surrounded by a disintegrating mantle of endometrial stroma. clinical examination and magnetic resonance imaging did not reveal pelvic endometriosis lesions, and given that the umbilical endometrioma was totally excised, no further treatment with hormonal therapy was proposed for the patient. three years after excision, she was free of disease and no recurrence has been observed. complete excision and histology is highly recommended for obtaining a definitive diagnosis and optimal treatment in spontaneous abdominal wall endometriosis. |
echinostomes (family echinostomatidae) are parasitic intestinal flukes which infect a wide range of vertebrates including humans. among the species, cinetorchis was first discovered from rats in japan, and then from dogs and rats in taiwan and the republic of korea (= korea). this human intestinal fluke is morphologically characterized by a head crown with 37 - 38 collar spines including 5 end group ones on each side, and abnormal location and/or disappearance of testis. echinostomiasis is a foodborne intestinal trematodiasis caused by a total of 20 species belonging to 9 genera in the family echinostomatidae. it is endemic in southeast asia and the far east, i.e., malaysia, philippines, indonesia, thailand, lao pdr, cambodia, mainland china, taiwan, india, and korea. in the genus echinostoma, more than 7 species are known to be zoonotic, i.e., e. angustitestis, e. cinetorchis, e. ehinatum, e. hortense, e. ilocanum, e. macrorchis, and e. revolutum. among them, echinostoma hortense is the predominant species with several endemic foci in korea. clinical cases of e. hortense infection have been sporadically diagnosed by the recovery of adult worms in gastroduodenal endoscopy. however, human cases of e. cinetorchis infection were not many and never diagnosed through endoscopy. in this study, we report a clinical case of e. cinetorchis infection diagnosed by colonoscopy. a 68-year - old korean man, residing in geoje - si, gyeongsangnam - do, was admitted to the gyeongsang national university hospital with complaint of intermittent right lower quadrant abdominal pain for 5 days. he underwent surgical resection of esophageal tumor ; thereafter, he took chemotherapy with r - chop regimen of 6 cycles as a diagnosis of diffuse large b - cell lymphoma 4 years ago. several times fecal examinations were performed, but the results were negative for occult blood and parasites. in particular, he had eaten raw frogs 2 months ago. at the time of admission, his body temperature was 36.2 and laboratory data included the followings : hemoglobin 14.7 g / dl (normal : 13.0 - 17.0), hematocrit 30.3% (39 - 52%), platelet 220,000/mm (130,000 - 400,000/mm), white blood cell count 4,870/mm (4,000 - 10,000/mm), and eosinophil 20.7% (1 - 5%). abdominal ct showed mild intrahepatic and common bile duct dilatation and diverticulum - like lesion at the ascending colon with adjacent mesenteric infiltration. one worm was found in the proximal ascending colon and the other was in the mid - ascending colon. the live parasites were transferred to the department of parasitology and tropical medicine, gyeongsang national university for the identification of worms. microscopic examinations of endoscopic biopsy specimens revealed chronic non - specific colitis with lymphoid aggregation in the colonic mucosa. the patient was treated with praziquantel, 25 mg / kg, given orally 3 times in a day, and thereafter his symptoms disappeared. the number of white blood cells was 4,990/mm and the percentage of eosinophil decreased markedly to 5.4% in 2 months. the recovered worms were morphologically observed under a light microscope with a micrometer after fixation with 10% formalin under the cover slip pressure and staining with semichon 's acetocarmine (fig. they were elongated, spindle shaped, and 5,600 m (in average) long and 1,563 m wide (maximum) at the ovarian level. its characteristic head crown was reniform (180 by 438 m), and had 37 collar spines in 2 rows including 5 end - group spines on each side. the ventral sucker was well developed (615 by 580 m) and located at 1,300 m from the anterior end. two ceca was bifurcated in front of the cirrus sac and extended to near the posterior end of the body. the cirrus sac was oval (310 m long and 175 m wide), located median between the preacetabular and cecal bifurcation. the ovary was transversely oval (235 by 380 m) and located equatorial in the median line. vitellaria were follicular and distributed mainly at lateral fields from behind the posterior margin of the ventral sucker to the posterior end. the present case is the first e. cinetorchis infection diagnosed by colonoscopy in the literature. until now, in korea, a total of 6 human e. cinetorchis infections have been reported based on adult worm recovery. with regard to e. hortense, the dominant species, it is known to be endemic in some areas of eumseong - gun (chungcheongbuk - do), yeongwol - gun (gangwon - do), cheongsong - gun (gyeongsangbuk - do) and geochang - gun (gyeongsangnam - do) in korea. several clinical cases of e. hortense were sporadically diagnosed by extracting worms through gastroduodenal endoscopy. in our case, the worm recovery from the colon is quite interesting, considering that the main habitat of e. cinetorchis is the small intestine as shown in experimental and natural definitive hosts. it is unknown whether the colon is a favored habitat of e. cinetorchis worms in the human host. recovery of worms in other endoscopy and autopsy cases will be helpful to determine it, and clinicians should pay attention to this fluke in colonoscopic examinations. freshwater snails, hippeutis cantori and segmentina hemisphaerula, were experimentally confirmed as the first and second intermediate hosts of e. cinetorchis. other freshwater snails, including radix auricularia coreana, physa acuta, austropeplea ollula, corbicula fluminea, pisidium coreanum, and cipangopaludina chinensis malleata, were reported to be the second intermediate hosts. accordingly, the infection source of this case may be raw frogs under the circumstances of the past history of the patient and the biological characteristics of this fluke. generally, a single dose of 10 mg / kg praziquantel is recommended as the regimen for the treatment of intestinal fluke infections. in the present study, the patient was treated with praziquantel, 25 mg / kg, given orally 3 times in a day. this regimen is equal to the treatment regimen for clonorchiasis and may be too much for intestinal trematodes. | human cases of echinostomiasis have been sporadically diagnosed by extracting worms in the endoscopy in korea and japan. most of these were caused by echinostoma hortense infection. however, in the present study, we detected 2 live worms of echinostoma cinetorchis in the ascending colon of a korean man (68-year old) admitted to the gyeongsang national university hospital with complaint of intermittent right lower quadrant abdominal pain for 5 days. under colonoscopy, 1 worm was found attached on the edematous and hyperemic mucosal surface of the proximal ascending colon and the other was detected on the mid - ascending colon. both worms were removed from the mucosal surface with a grasping forceps, and morphologically identified as e. cinetorchis by the characteristic head crown with total 37 collar spines including 5 end - group ones on both sides, disappearance of testes, and eggs of 10860 m with abopercular wrinkles. the infection source of this case seems to be the raw frogs eaten 2 months ago. this is the first case of endoscopy - diagnosed e. cinetorchis infection in korea. |
due to its distinctive layer structure and electronic properties, the inorganic fullerene - like structure of ms2(m = mo, w) has been attracting considerable attention and has been investigated extensively for various applications. the properties of the metal disulfide nanomaterials with novel morphology are better than those of their bulk forms. ws2 and mos2 nanomaterials have shown excellent properties and have potential applications in various fields, such as scanning probe microscopy, solid - state lubricants, heterogeneous catalysis, and electrochemical hydrogen storage. in order to investigate their properties and applications in these fields systematically, several methods have been reported to prepare nanoscale ms2, such as gas solid or gas phase reaction, pulsed laser deposition, a self - transformation process, and sulfidation of the moo3 nanofibers under a h2s / h2 steam at 350600c. however, almost all the methods are based on utilizing high temperature reactions or dangerous gases, such as h2 and h2s. on the other hand, the formation of nanosized mos2 or ws2 polyhedral or onion crystals is, similar to the case of carbon onion crystals, a rare event. from this point of view, it is interesting and valuable to find a new large - scale approach to synthesize metal disulfide nanoparticles. since the 1970s, lamellar disulfide has been intensively studied, especially via the intercalation technique [10 - 12 ]. during intercalation, the coordination patterns of lamellar disulfide change greatly, and numerous defects are introduced, which enable doping of other ions. on the other hand, after transition metal cations have entered the ws2 or mos2 matrix, there are changes in the bonding properties of the matrix and the s m golub. described room temperature preparation of new ternary metal sulfides mxmos2 (m = cu, ag) by exfoliation first, the mos2 powder is exfoliated into lamellae or monolayers by n - butyllithium to form lixmos2. they supposed that ternary metal sulfides mxmos2 could be obtained using (mos2) single layers dispersed in aqueous media and salts of metals which could favor the formation of m s rather than m thus, the (mos2) single layers in the dispersions have henceforth to be considered not only as macroanions but also as reducing agents. for the mos2, the negative charge of (mos2) and consequently the cluster structure of s mo mo metal bonding can be effectively stabilized in restacked compounds by introduction into the structure of counterions covalently bonded to the matrix. so it is possible the same reason for the ws2, the introduction of cobalt ion into the matrix of ws2 can stabilize the ws2. utilized these bond changes and fabricated transition metal - doped disulfide nanotubes successfully by exfoliation intercalation through hydrothermal adulteration, using lamellar metal disulfide as the precursors. ws2 and mos2 could be electrode materials for rechargeable batteries due to the existence of van der waals forces across the gaps between the s m s sheets, which can provide the space for guest reactants in intercalation reactions. a few attempts have been made to investigate the electrochemical activity of ms2 (m = mo, w, etc.) for example, feng reported that ws2 nanoflakes prepared by a rheological phase reaction had better lithium intercalation / deintercalation behavior than other forms of ws2. wang prepared ws2 nanotubes and reported that the ws2 nanotube electrode delivered a lithium insertion capacity of 915 mah g, which is much higher than for ws2 powder. as other approach to explore new electrode materials for li - battery, nanosized transition metal oxides have been attracting much attention in recent years. reported the high performance as anode materials in lithium ion batteries for nanosized transition metal oxides such as nickel oxide, cobalt oxide, and iron oxide. among them, cobalt oxide demonstrated the best electrochemical properties. in this regard, co - containing species can be promising intercalants to modify the lamellar disulfides. in this paper, bamboo - like co - doped ws2 nanorods were synthesized on a large scale by an approach involving exfoliation intercalation hydrothermal treatment, using lamellar tungsten disulfide as the precursor, and the morphology, chemical components, and raman spectrum are reported. the cobalt - doped ws2 nanorods can reversibly store lithium with a capacity of 568 mah g over a voltage range of 0.013.0 v versus li / li and show good cycling stability. to the best of our knowledge, this is the first time that transition metal - doped ws2 nanorods have been synthesized and their applications in lithium ion batteries systematically investigated. under n2 atmosphere at room temperature for a week, 8.2 g of ws2 powder was exfoliated by 2.9 m of n - butyllithium (15 ml) in a container, rinsed in hexane six times, and vacuum dried at 80c overnight. then, 0.6 g of lixws2 was put into a 50 ml autoclave with a teflon - lined inner wall, and 30 ml of 0.2 m cocl2 aqueous solution was added into the autoclave and stirred for 15 min. the temperature of the autoclave was raised to 180c, and it was maintained at that temperature for 48 h before being cooled down to room temperature. the products were filtrated, rinsed in deionized water several times, and dried at 80c overnight. x - ray diffraction (xrd) was performed with a rigaku x - ray diffractometer at room temperature, using a quartz monochromator cu k radiation source (= 0.1541 nm) under a voltage of 40 kv and a current of 30 ma. transmission electron microscopy (tem) was performed with a fei / tecnai g microscope. before characterization, the samples were dispersed ultrasonically in ethanol and dropped onto a cu grid coated with a carbon membrane. energy - dispersive x - ray spectroscopy (edx) was performed on an s-4800 scanning electron microscope. raman spectra were collected under ambient conditions using a rm 2000 microscope confocal raman spectrometer equipped with a microscope (renishaw plc, england). electrochemical measurements were carried out using a 2032-type coin cell fabricated in an argon - filled glove box (mbraun, germany). the working electrode was fabricated in the ratio of 70:20:10 (w / w) active material / carbon black / polyvinylidene difluoride, while lithium foil served as counter and reference electrode. the electrolyte was 1 m lipf6 dissolved in 1:1 ethylene carbonate (ec) and dimethyl carbonate (dmc). constant current charge / discharge cycling was conducted on a land battery tester (ct2001a) in the voltage range between 3.0 and 0.01 v. cyclic voltammetry (cv) was performed on a chi660c electrochemical workstation at a scan rate of 0.1 mv s. under n2 atmosphere at room temperature for a week, 8.2 g of ws2 powder was exfoliated by 2.9 m of n - butyllithium (15 ml) in a container, rinsed in hexane six times, and vacuum dried at 80c overnight. then, 0.6 g of lixws2 was put into a 50 ml autoclave with a teflon - lined inner wall, and 30 ml of 0.2 m cocl2 aqueous solution was added into the autoclave and stirred for 15 min. the temperature of the autoclave was raised to 180c, and it was maintained at that temperature for 48 h before being cooled down to room temperature. the products were filtrated, rinsed in deionized water several times, and dried at 80c overnight. x - ray diffraction (xrd) was performed with a rigaku x - ray diffractometer at room temperature, using a quartz monochromator cu k radiation source (= 0.1541 nm) under a voltage of 40 kv and a current of 30 ma. transmission electron microscopy (tem) was performed with a fei / tecnai g microscope. before characterization, the samples were dispersed ultrasonically in ethanol and dropped onto a cu grid coated with a carbon membrane. energy - dispersive x - ray spectroscopy (edx) was performed on an s-4800 scanning electron microscope. raman spectra were collected under ambient conditions using a rm 2000 microscope confocal raman spectrometer equipped with a microscope (renishaw plc, england). electrochemical measurements were carried out using a 2032-type coin cell fabricated in an argon - filled glove box (mbraun, germany). the working electrode was fabricated in the ratio of 70:20:10 (w / w) active material / carbon black / polyvinylidene difluoride, while lithium foil served as counter and reference electrode. the electrolyte was 1 m lipf6 dissolved in 1:1 ethylene carbonate (ec) and dimethyl carbonate (dmc). constant current charge / discharge cycling was conducted on a land battery tester (ct2001a) in the voltage range between 3.0 and 0.01 v. cyclic voltammetry (cv) was performed on a chi660c electrochemical workstation at a scan rate of 0.1 mv s. figure 1 shows the xrd patterns of the raw ws2 powder and the co - doped ws2 nanorods. all the peaks are agreement with the bragg positions for a hexagonal structure (jcpds card 08 - 0237) for both samples. the co - doped ws2 nanorods, however, show significantly broadened peak shapes, indicating that the crystallite size is much smaller than that of the raw ws2 powder. the edx analysis (fig. 2) indicates that these nanorods have a co : w : s atomic ratio of 3.54:31.4:58.03. taking into account the error of the measurement, xrd patterns of the raw ws2 powder (a) and the co - doped ws2 sample (b) edx results on co - doped ws2 nanorods. the silicon peak comes from silicon wafer supporting the sample figure 3a shows a tem image of the raw ws2 particles. the selected area electron diffraction (saed) pattern reveals that the raw ws2 consists of single crystals of 2h - ws2. as shown in fig. 3b, the morphology of the co - doped ws2 particles is that of bamboo - like nanorods with a diameter of about 20 nm and a length of around 200 nm, so the aspect ratio of these nanorods is about 10. the corresponding saed pattern reveals that the nanorods are polycrystalline 2h - ws2, which is different from the raw ws2 particles. the nanorods have somewhat irregular shape, in which the ends of a nanorod are smaller in diameter than its middle part, as shown in fig. tem images of the raw ws2 (a), the co - doped ws2 (b), and the co - doped ws2 at higher magnification (c, d). the insets in a and b show the corresponding saed patterns the raman spectrum of the sample was collected using a he / ne laser with a wavelength of 632.8 nm, which is capable of supplying power of 1 mw. the raman spectrum of the co - doped ws2 nanorods displays two peaks around 348.6 and 419.6 cm, and no other additional peaks are observed, as shown in fig. this result is similar to that for ws2 bulk material and is consistent with reference, indicating the local lattice structure of the co - doped nanorods is comparable with that of the bulk ws2 crystals in spite of its poor crystallinity. raman spectrum of co - doped ws2 nanorods the electrochemical properties of the co - doped ws2 nanorods were compared with those of the raw ws2 powder. figure 5a, 5b show cyclic voltammograms for the two samples. in the first cycle, a reduction peak is observed at ~0.55 v and an oxidation peak at ~2.4 v for both samples. the reduction and the oxidation peaks correspond to li lithium intercalation / deintercalation behavior in ws2 for two samples, respectively, as described in eq.. cyclic voltammograms of a coin cell (vs. li) for selected cycles of the raw ws2 electrode (a), the co - doped ws2 electrode (b), and the co - doped ws2 at different potential scan rates (v s) (c), (d) show dependence of the peak height on the square root of the potential scan rate for the oxidation peak in the second cycle, the reduction peak at 0.55 v has disappeared, while new reduction peaks appear in the potential range from 1.62.2 v. this change can be explained by the formation of a gel - like polymeric layer. there was no significant change in the potentials of the redox peaks afterward for co - doped ws2. the main difference between two cyclic voltammograms is the relative change in the redox current with the cycle number ; the current of the redox peak for the co - doped ws2 electrode decreases more slowly than that of the raw ws2 electrode. as a result, a better cycling performance can be obtained from the co - doped ws2 electrode, as shown in fig. 6a. typical first and second charge / discharge curves of the co - doped ws2 electrode (a), typical cycling performance of the precursor ws2 and the as - prepared co - doped ws2 electrode (b) and coulombic efficiency versus cycle number of the raw and co - doped ws2 (c). current density : 50 ma g figure 5c shows cyclic voltammograms of the co - doped ws2 at potential scan rates,, from 20 to 500 v s. the relationship between the oxidation current peak values and is depicted in fig. the peak currents are proportional to, which may indicate a semi - infinite diffusion mechanism on the electrode. the relationship to peak current ip can be expressed by the classical sevcik equation : where n is the number of electrons per species reaction, a is the apparent surface area of the electrode, d0 is the diffusion coefficient of li in the solid state, is the scan rate, and c0 is the change in li concentration in the active material. figure 6a shows the charge / discharge curves of the electrode containing the co - doped ws2 nanorods. in the first cycle, the ws2 electrode delivered a lithium insertion capacity of about 668 mah g when the discharge / charge current density was 50 ma g. the first discharge curve shows the insertion plateaus at 1.0 v and 0.75 v. in the second cycle, a lithium insertion plateau at ~2.2 v was observed, as well as a slope starting from 1.75 v and running down to the cut off voltage of 0.01 v. there is a clear distinction in the charge discharge profile between 02 v (~300 mah g) and 23 v (~250 mah g). thus, this material can be regarded as a possible anode material for li - ion battery in the 02 v range and as a cathode material in li - metal cell technology. the charge capacity obviously decreases with cycling, from 520 mah g for the first cycle to 287 mah g at the 40th cycle. (the capacity retention is ~55% after 40 cycles.) for the co - doped ws2 electrode, an irreversible capacity of 668 mah g is observed in the first cycle, along with a reversible capacity of 568 mah g, which is reduced to 446 mah g after 20 cycles and 380 mah g after 40 cycles. the co - doped ws2 electrode shows a better cycling stability compared with the ws2 precursor electrode. the first cycle coulombic efficiency of the raw ws2 is 81.5%, and it increases with the cycle number, reaching 98.2% by the 40th cycle. for the co - doped ws2, the coulombic efficiency of the first cycle is 84.7% and over 98% from the 4th cycle, shown in fig. the improved electrochemical performance of the co - doped ws2 sample may be attributed to the small particle size and its one - dimensional structure. however, the charge / discharge capacities of the co - doped ws2 electrode are lower than those reported for ws2 nanoflakes and ws2 nanotubes. the formation mechanism for the nanorods is similar to the synthesis of transition metal - doped moxw1xs2 nanotubes. first, the ws2 powder is exfoliated into lamellae or monolayers by n - butyllithium to form lixws2, with the process introducing a large amount of defects, along with large changes in the coordination patterns of the lamellar disulfide, which enables doping with other ions. then, the cocl2 aqueous solution is added into the above mixture, a dispersion of single - layer ws2 is formed by the reaction of lixws2 with water. after co cations enter into the ws2 matrix, the bonding properties of the matrix and the bond angles of s w s are changed, especially on the sides of layers, which causes the lamellar structure to curl into bamboo - like nanorods. the decreased capacity of this transition metal - doped ws2 electrode may be because the intercalation of transition metal ions into the ws2 matrix can decrease the distance between layers, which limits the amount of lithium ions electrochemically inserted into the co - doped ws2. based on previous research [19 - 21 ], lithium ions intercalate into ws2 nanoclusters and defect sites in ws2 nanorods, but these sites are partly saturated with co, so the amount of intercalation of lithium ions will be decreased, and the capacity could thus also be decreased. it can be deduced that for ws2 samples without transition metal - doping or mesoporous ws2, this exfoliation restacking method will both enhance the charge / discharge capacity and achieve better ws2 cycling stability. further work is needed in order to further improve the electrochemical performance of ws2 samples via exfoliation and restacking, as well as other modifications. bamboo - like co - doped ws2 nanorods were synthesized by an exfoliation intercalation hydrothermal method. ws2 co cations were doped into the ws2 matrix through a hydrothermal process in cocl2 aqueous solution. this method is expected to be applied to other layered materials to obtain the desired morphologies. the co - doped ws2 nanorods can reversibly store lithium with a capacity of 568 mah g over a voltage range of 0.013.0 v versus li / li. the co - doped ws2 electrode shows much better cycling stability compared with the raw ws2 electrode. this work was supported partially by the state key laboratory breeding base of green chemistry - synthesis technology, zhejiang university of technology and the priority research centers program through the national research foundation of korea (nrf) funded by the ministry of education, science and technology (2009 - 0094047). this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited. this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited. | cobalt - doped tungsten disulfide nanorods were synthesized by an approach involving exfoliation, intercalation, and the hydrothermal process, using commercial ws2 powder as the precursor and n - butyllithium as the exfoliating reagent. xrd results indicate that the crystal phase of the sample is 2h - ws2. tem images show that the sample consists of bamboo - like nanorods with a diameter of around 20 nm and a length of about 200 nm. the co - doped ws2 nanorods exhibit the reversible capacity of 568 mah g1 in a voltage range of 0.013.0 v versus li / li+. as an electrode material for the lithium battery, the co - doped ws2 nanorods show enhanced charge capacity and cycling stability compared with the raw ws2 powder. |
bartter syndrome is an autosomal recessive disease manifested by a defect in chloride transport in the thick ascending loop of henle, known to have different genetic origins and molecular pathophysiology. however it shares the same clinical feature of failure to thrive, dehydration, and biochemical findings of renal salt wasting, metabolic alkalosis, hypokalemia, and hypercalciuria, with normal serum magnesium values. an 8-week - old female infant presented to the emergency department (ed) with a 5-day history of intermittent nonbilious vomiting. the initial character of the emesis was consistent with gastroesophageal reflux, but subsequently, it became more forceful. prior to presentation, the infant, who was exclusively breastfed, was hungry and eager to feed between episodes of vomiting. there was no history of fever, upper respiratory tract symptoms, diarrhea, or rash, and no known contact with sick individuals. on the day of presentation, the parents reported that the infant was becoming less interested in feeding and required frequent stimulation to remain awake. the infant had been born to a healthy 38-year - old g3p2 mother, at 38 weeks gestational age. there was no other significant past medical history ; the family history was also unremarkable. furthermore, there were no developmental concerns. on initial exam in the ed, the patient was determined to be moderately dehydrated. following fluid resuscitation with 20 ml / kg normal saline, the patient became more alert. her blood pressure was 80/65 mmhg, and her heart rate was regular at 140 beats per minute. at this point, the patient s weight was 3.85 kg (fifth percentile), and she was nondysmorphic in appearance. her abdomen was soft and mildly distended, with no palpable masses and no hepatosplenomegaly. initial serum biochemistry revealed the following : potassium 2 mmol / l, sodium 131 mmol / l, chloride 57 mmol / l, bicarbonate 51 mmol / l, and glucose 7.1 mmol / l. the patient s venous blood gas values were ph 7.59, pco2 of 52 mmhg, po2 50 mmhg, and hco3 50 mmol / l, with a base excess of + 15 meq / l, consistent with metabolic alkalosis. an ultrasound of the abdomen was normal ; specifically, there was no evidence of hypertrophic pyloric stenosis. our patient had a normal serum magnesium (0.74 mmol / l) concentration and a urinary ca2+/cr ratio of 0.98 (95th percentile for this age is 0.7), suggestive of bartter syndrome. an elevated plasma renin level of 126.6 ng / l / s (0.1390 ng / l / s) and an elevated aldosterone level of 2,900 pmol / l (90 mmol / l).4 individuals with this condition require lifelong fluid and electrolyte replacement therapy. hypochloremic metabolic alkalosis in infants should also prompt one to consider a diagnosis of cystic fibrosis (cf). as a result of excess salt loss in sweat, hyponatremia often accompanies electrolyte imbalance in cf patients.5 in the absence of classic respiratory or gastrointestinal symptoms, cf may be suggested in early infancy, based on failure to thrive, lethargy, and dehydration due to the degree of gastrointestinal losses. even in cases diagnosed as negative for cf, a sweat chloride test should be obtained in any infant with signs and symptoms suggestive of this disease.6 renal causes of chloride wasting may include prolonged use of thiazide diuretics, excessive mineralocorticoid syndromes, and renal tubular losses resulting from bartter or gitelman syndrome. a patient s blood pressure can help to distinguish between primary mineralocorticoid excess, which causes hypertension, and bartter or gitelman syndrome, in which patients remain normotensive. our patient maintained a normal blood pressure throughout her admission. to differentiate between bartter and gitelman syndromes, two genetic causes of potassium - losing nephropathies, attention should be paid to the serum magnesium and urine calcium levels. in bartter syndrome, the serum magnesium level is usually normal, whereas the urine calcium is elevated, sometimes causing nephrocalcinosis. in gitelman syndrome, the serum magnesium is low, and the urinary calcium level is low. initial management focused on correcting the fluid and electrolyte imbalance. despite relatively good oral intake of formula, the patient showed signs of moderate dehydration. mmol / l), and low serum osmolality (260 mmol / kg h2o). mmol / l) and potassium (22 mmol / l) levels relative to the deficiencies of these electrolytes in the blood. once stabilized, our patient was maintained on oral potassium and sodium supplementation, as well as indomethacin and spironolactone, two drugs that may be helpful for this condition. several outpatient visits at the general pediatrics and nephrology clinics have shown a well - hydrated, thriving infant, with no evidence of nephrocalcinosis on serial ultrasound. in early infancy, a handful of diseases may present with hypochloremic metabolic alkalosis (table 1).7 although bartter syndrome is a rare condition, health care providers should consider this when excessive chloride losses appear to be renal in origin and the patient has normal blood pressure and high levels of serum renin and aldosterone. treatments, including indomethacin, spironolactone, and aggressive fluid and electrolyte replacement, may prevent renal failure in children with bartter syndrome. | bartter syndrome is an autosomal recessive disease manifested by a defect in chloride transport in the thick loop of henle, with different genetic origins and molecular pathophysiology. children with bartter syndrome generally present in early infancy with persistent polyuria and associated dehydration, electrolyte imbalance, and failure to thrive. although early diagnosis and appropriate treatment of bartter syndrome may improve the outcome, some children will progress to renal failure. we report a case of an 8-week - old infant who was admitted for electrolyte imbalance and failure to thrive. laboratory studies revealed hypochloremic metabolic alkalosis with severe hypokalemia. health care providers should consider bartter syndrome when excessive chloride losses appear to be renal in origin and the patient has normal blood pressure and high levels of serum renin and aldosterone. treatments, including indomethacin, spironolactone, and aggressive fluid and electrolyte replacement, may prevent renal failure in children with bartter syndrome. molecular genetics studies are indicated to identify the primary genetic defect. |
the term subclinical hypothyroidism (sht) indicates the presence of thyroid dysfunction without obvious symptoms of thyroid deficiency. however, the clinical manifestations of sht vary widely, from minimal, nonspecific (often subjective), or even absent signs, to clear presentation of hypothyroidism, largely related to the degree of deterioration of the thyroid gland, disease duration, and individual sensitivity to thyroid hormone deficiency, as well as the presence of comorbidities, especially heart and peripheral arterial diseases and depression. in adults, sht is known to be associated with an increased risk of coronary and other heart diseases, as well as various biochemical disturbances (e.g., elevated ldl - cholesterol) [3, 4 ]. in children and adolescents, subtle proatherogenic abnormalities were found in only one study, conducted by cerbone., and required a further scrupulous observation towards metabolic disorders. in the clinical practice, sht is diagnosed in the presence of mildly elevated serum concentrations of tsh with normal concentrations of serum - free and total triiodothyronine (t3) and thyroxine (t4). sht is common in the adult population, with a prevalence of 3 to 8% in patients without known thyroid disorder [7, 8 ] ; it tends to be higher in the elderly and in women. in the pediatric population the main complication of sht, both in adults and children, is progression to overt hypothyroidism, which may actually occur considerably less frequently than expected. the 2001 review of studies in adult and elderly patients showed that although subclinical hypothyroidism is mild thyroid gland failure, it is clinically important, with adverse clinical consequences, and should be treated with l - thyroxine in most, if not all, cases. most of the available longitudinal studies on the natural course of subclinical hypothyroidism in children and adolescents are retrospective. the published data are controversial and do not offer a conclusive solution regarding the reasons, if any, for treatment of subclinical thyroid disease in younger population. thus the debate on the indications for l - thyroxine therapy in children and adolescents with sht continues. the aim of our retrospective observational study was to evaluate the course of subclinical hyperthyrotropinemia in children and adolescents and estimate the medical care of the patients with sht : the rationale for administering l - thyroxine to young patients with sht was investigated. the study methodology was based on a retrospective review of the charts of 261 patients. the patients were referred to the endocrinology outpatient clinic of the medical university with suspicion of subclinical hypothyroidism and were examined between 2009 and 2014. children and adolescents diagnosed with subclinical thyroid disease who were under concomitant therapy with lithium salts, antiepileptic agents, glucocorticoids, or iodinated drugs, as well as children with positive screening for congenital hypothyroidism, were not enrolled into the study. other exclusion criteria were (1) serum concentration of thyroid - stimulating hormone (tsh) below 10 miu / ml, (2) hashimoto 's thyroiditis, (3) trisomy 21 and/or diabetes mellitus, (4) earlier treatment of previously diagnosed sh, (5) one / incidental finding of elevated tsh level between 4.0 and 10.0 miu / ml, (6) palpable goiter, (7) age under 2 years, and (8) lack of anthropometric data. we collected the following data : gender, age at presentation of subclinical hypothyroidism (sht), auxological data : height and weight, serum concentrations of thyroid - stimulating hormone (tsh), free thyroxine (ft4), and free triiodothyronine (ft3), titer of anti - thyroid autoantibodies : antiperoxidase (anti - tpo) and antithyroglobulin (anti - tg), positive family history, absence or presence of clinical symptoms suggesting thyroid disease, and length of follow - up at the outpatient clinic. serum concentrations of tsh and ft4 were measured with a chemiluminescent immunometric assay (siemens, immulite 2000 free t4, immulite 2000 third - generation tsh, usa). the concentrations of anti - thyroid peroxidase antibody (anti - tpo abs) and autoantibodies to thyroglobulin (anti - tg ab) were determined with enzyme - labeled, chemiluminescent sequential immunometric assay (siemens, immulite 2000 anti - tpo ab, immulite 2000 anti - tg ab, usa). the reference levels for ft4 were 11.522.7 pmol / l (0.81.9 ng / dl). anti - tg abs and anti - tpo abs were considered undetectable below 40 and 35 iu / ml, respectively. thyroid ultrasound examination was performed at least once during the follow - up period, using acuson antares (siemens medical solution usa, inc.) with a vfx 13 - 5 linear transducer. subclinical hypothyroidism was diagnosed in patients with no evident clinical manifestation of hypothyroidism, regardless of their age, if tsh was between 4.0 and 10.0 miu / ml in at least two consecutive assays and ft4 remained within the normal range. overt hypothyroidism was diagnosed if tsh was higher than 10.0 miu / ml and ft4 was below the lower limit of the reference range. thyroid autoimmunity was documented by the presence of thyroid autoantibodies (anti - tpo abs and/or anti - tg abs). hashimoto 's thyroiditis (autoimmune thyroid disease) was diagnosed in the presence of anti - tpo abs and/or anti - tg abs, with concomitant subclinical or overt hypothyroidism. hsds (height standard deviation scores) were calculated from population standards for healthy children using the following formula : hsds = child 's height height for 50 pc/0.5 (height 50 pc height 3 pc). body mass index (bmi) was expressed as kg / m, whilst bmi z - score, also called bmi standard deviation (sd) score, was calculated using measures of relative weight adjusted for age and sex. given a child 's age, sex, bmi, and the appropriate reference standard, the bmi z - score the tool is available at the website of the children 's hospital of philadelphia, research institute http://stokes.chop.edu/web/zscore/ and is dedicated to patients aged between 2 and 20 years. a bmi z - score over + 2.0 sd was classified as obesity, between + 2.0 and + 1.0 sd as overweight, between 1.0 and 2.0 as weight deficiency, and under 2.0 sd as significant weight deficiency. clinical presentations suggesting subclinical hypothyroidism, such as constipation, impaired concentration, cold intolerance, chronic fatigue, menstrual disorder, dry skin, and hair loss, were detected at physical examination or during anamnesis. a cumulative dose of l - thyroxine was expressed as a mean dosage, using the recommended amount of lt-4 on the first and last available visit in relation to body weight and was presented as g per kg per day. categorical variables were presented as percentages (%) ; continuous variables were ordered as means standard deviations (sd) and medians. the comparison between continuous variables was examined with student 's t - test for normal distribution and with the nonparametric mann - whitney test for nonnormal distribution. the final study group consisted of 55 children and adolescents who presented serum tsh concentrations between 4.0 and 10.0 miu / ml, with ft4 and ft3 within their reference ranges (group - sht). the median age in the sht group was 9.92 years, mean 9.45 4.25 years (range from 2.0 to 17.33 years). the median tsh concentration was 5.51 miu / ml, mean 5.67 1.20 miu / ml (range from 4.00 to 9.40). positive family history towards thyroid gland disease was reported in 4 (7.30%) patients. the bmi z - score was 0.30 1.64, and the hsds was 0.35 1.79. the baseline comparison between girls and boys showed no significant differences regarding age, mean tsh level concentration, positive family history, mean bmi z - score, or hsds. out of 55 sht patients, 33 (60.0%) started l - thyroxine therapy. table 2 shows the baseline comparison between patients who received treatment (sht - t1) and those who did not (sht - t0). there were no statistically significant differences between the groups regarding the mean age at the first visit (range from 2.87 to 15.6, median age 9.95 years versus range from 2.0 to 17.33, median age 9.62 years, t1 and t0, resp.), bmi z - score, and hsds values. t1 patients had higher serum tsh concentrations than t0 patients, but the difference was not statistically significant (p = 0.09). the two groups differed with regard to the length of follow - up (p < 0.01). four (11.8%) children in group t1 and none in group t0 had a positive family history of thyroid disorders. the patients ' clinical presentations detected at the first examination are presented in table 3. nine (27.3%) patients in group t1 and five (22.7%) in t0 showed more than one clinical symptom suggesting hypothyroidism. the mean cumulative dose of l - thyroxine used in 33 patients was 0.82 0.48 g / kg / day, median dose : 0.71 g / kg / day, range from 0.25 g / kg / day to 2.41 g / kg / day. during the observation period 15 (68.2%) children and adolescents without treatment became euthyroid (tsh < 4.0 miu / ml) : 11 within three months from the last determination of tsh level, 1 at 36 months, and 3 at 612 months. in 7 (31.8%) patients, the tsh concentration remained above the reference range but under < 10.0 miu / ml at the end of follow - up. in our study, 4 (7.3%) patients (3 girls and 1 boy) had baseline tsh levels over 7.5 miu / ml, of whom only 1 showed progression to overt hypothyroidism. the patient, a 5.5-year - old girl, had baseline tsh of 8.14 miu / ml, positive family history towards thyroid gland disease, and a bmi z - score of 1.84. the treatment involved a cumulative l - thyroxine dose of 1.06 g / kg / day. we identified a group of 31 children and adolescents, with a mean age of 8.7 4.24 years, in whom an elevated tsh serum concentration was detected only once (non - sht group). during the second / control measurement in this group, the tsh concentration was within its reference range. non - sht patients were then compared with patients with confirmed subclinical hypothyroidism (sht group) (table 4). the non - sht patients were referred to the outpatient clinic due to abnormal tsh results (range from 4.0 to 8.73 miu / ml) with or without symptoms suggesting hypothyroidism and without history of an active or recent acute illness that could cause a transient drop in thyroid hormone production. at baseline, the sht and non - sht groups did not differ with regard to age, bmi z - score, hsds, or positive family history ; however, serum tsh was significantly lower in non - sht patients (table 4). our retrospective study aimed to evaluate the course of sht in children and adolescents and to establish the rationale for substitutional therapy induction in this group of patients. the results of our analysis showed that there was no clear clinical or laboratory explanation as to why treatment was initiated in young patients with subclinical hypothyroidism. positive family history seemed to be the only discriminant ; sht patients with l - thyroxine therapy more frequently had family members with diagnosed thyroid disorders. despite the small size of the study group, we confirmed a low incidence of conversion of sht to overt hypothyroidism. according to the literature, the prevalence of subclinical hypothyroidism in the young population is estimated to be less than 2%. in our study, out of 261 patients referred to the outpatient clinic between 2009 and 2014 with suspicion of subclinical hypothyroidism ; only 55 (21.7%) children and adolescents met the criteria of sht. the obtained results can not be generalized to the entire population of silesian children as the data came from a large but single clinical center. the cut - off point of tsh concentration at which pediatricians should diagnose their patients with subclinical hypothyroidism has not as yet been determined. in our center, the diagnosis is made when the tsh level is at least 4.0 miu / ml (reference limit), regardless of age. the cut - off point in the study by lazar. was 5.5 miu / ml, whilst wasniewska. found the upper reference limit of tsh level of 4.1 miu / ml to be more compatible with clinical experience and a reasonable compromise. indeed, patients in a euthyroid state are difficult to distinguish from patients with thyroid hormone deficiency because the clinical manifestation is affected by disease duration, its severity, and individual sensitivity to thyroid hormone deficiency. patients who report many or newly developed symptoms are most likely to have subclinical or overt hypothyroidism. in their review, gawlik. presented several studies, in which sht either was confirmed as a result of clinical presentation, or was diagnosed incidentally, and only then assessed clinically for typical manifestation. the data available in the literature are still controversial regarding the indications and effects of substitution therapy on improving the growth status of children with short stature and subclinical hypothyroidism. in their prospective study of 39 patients with short stature and sht, cetinkaya. showed that both prepubertal and pubertal patients experienced a significant improvement in growth after 612 months of treatment with l - thyroxine. conducted a cross - sectional controlled study involving 36 children with sht who had never been treated with l - thyroxine and 36 age- and sex - matched healthy children. the patients were followed longitudinally for a mean of 3.3 years, revealing that untreated long - standing sht was not associated with deterioration in growth and bone maturation. moreover, all the recruited children with sht and short stature were diagnosed with familial short stature and/or possible constitutional delay of growth and puberty. therefore, when deciding on treatment modality in children with sh and short stature, the expected benefits as well as side effects of l - thyroxine and the possibility of iatrogenic hyperthyroidism should be considered. the recommendations concerning overweight young patients with sht are more precise : pharmacological treatment should be avoided, since moderately elevated levels of tsh are a consequence rather than a cause of overweight. in obese children with sht, first, a dietary - behavioral management intervention should be recommended in order to reduce weight, irrespective of the use of levothyroxine [1820 ]. other nonpathognomonic symptoms were only reported by single patients, which raises the question whether subclinical hypothyroidism actually causes symptoms or whether their presence is a coincidence. in our study, the vast majority of patients 44/55 (80.0%) showed at least one nonpathognomonic symptom, some of them suggesting hypothyroidism. analyzing overweight, obesity, and short stature, we noticed a similar incidence between patients who were referred for lt-4 therapy and those who were not. the type of symptoms did not affect the decision whether to initiate treatment. there are no clear guidelines on the management of subclinical hypothyroidism in young patients, the frequency of tsh measurements, and the length of follow - up in patients without therapy. according to the european thyroid association guidelines for the management of subclinical hypothyroidism in pregnancy and in children for 2014, the decision whether or not to treat should be made after discussing with the parents the side effects and risks as well as the potential benefits of therapy with l - thyroxine. the 2014 cross - sectional, controlled study by cerbone. showed that untreated mild long - lasting idiopathic sht may be associated with subtle proatherogenic disturbances, although it is difficult to establish whether such mild abnormalities represent the early steps in the initiation of atherogenesis. currently, there is little evidence to recommend treatment in most children with sht in whom serum tsh is < 10.0 miu / ml, with ft4 within its normal range. in his review, kaplowitz showed that a pediatric endocrinologist may decide to start thyroid hormone therapy immediately after confirmation of elevated tsh, or may recommend frequent monitoring of tsh for prolonged periods, or may suggest that, unless a follow - up test shows a further significant rise in tsh or a subnormal free t4 concentration, no action is required. bona. concluded that sht in children and adolescents is often a self - remitting process and its treatment should be considered only when tsh values are higher than 10 miu / ml, when clinical signs or symptoms of impaired thyroid function or goiter are detected, or when sht is associated with other chronic diseases. our study aimed to analyze the management of patients diagnosed with sht and to establish the factors that encouraged physicians to prescribe thyroid hormones. there were no differences with regard to age at baseline, tsh level, bmi z - score, hsds, and presence of clinical symptoms suggesting hypothyroidism between patients who underwent therapy with lt-4 and those who did not. our study shows that the pediatric endocrinologists in our clinical center made subjective decisions whether or not to treat, relying only on their own experience and, possibly, on positive family history towards thyroid disease. the mean dosage of l - thyroxine applied in our patients, sufficient to maintain tsh within its normal ranges, was 0.82 0.48 g / kg / day ; the lowest dose was 0.25 g / kg / day and the highest was 2.41 g / kg / day. in the first prospective study conducted by wasniewska. in 92 children with lt-4, the initial dose was 2.0 g / kg / day and was further adjusted on the basis of ft4 and tsh serum concentrations. in her review, bona. mentioned five articles [16, 2427 ] regarding replacement therapy with lt-4, in which the mean dosage of lt-4 varied from 2 to 4 g / kg / day [2426 ]. in two studies [16, 27 ], information on the dose of levothyroxine was not provided. these data confirm the lack of clearly established guidelines as to what dosage of lt-4 may protect children from proceeding to overt hypothyroidism. g / kg / day administered to our patients was sufficient to maintain tsh in its reference range. in our study, a vast majority (68.2%) of patients without therapy with l - thyroxine normalized their tsh concentration and became euthyroid during their follow - up period. at the end of follow - up, none of the patients showed a highly elevated tsh serum level above 10 miu / ml, though 31.8% still had tsh above the upper limit of the reference range. : 41.3% of patients normalized their tsh at the end of a 2-year follow - up period. out of the remaining patients 11.9% had a further increase in tsh over 10 miu / ml. based on the obtained results, the authors concluded that there was a progressive decrease of the natural course of sh. in another recently published longitudinal study, wasniewska. assessed the natural course of sht in 127 girls according to the etiology of subclinical thyroid disease. at the end of the 5-year follow - up, girls diagnosed with idiopathic sht had a higher rate of normalization of tsh levels than girls with sht related to hashimoto 's thyroiditis (61.9% versus 10.6%). our study raises the following questions : how often should tsh concentrations be determined in order to accurately and reliably evaluate the course of sht ? multiple tsh determinations are associated with stress and discomfort connected with blood collection and medical visits. the economic aspect should not be disregarded either : too frequent and unnecessary visits generate costs, which is a serious limiting factor in health care. moreover, tsh assessment must be performed in appropriate measurement conditions (without infection symptoms, etc.) and can not be used as a routine laboratory test. in our study, out of the 55 patients who met the criteria for sht, only 1 (1.8%) girl proceeded to overt hypothyroidism. according to the longitudinal study conducted by lazar., out of 121,052 children and adolescents, less than 1% proceed to overt thyroid dysfunction, either hypothyroidism or hyperthyroidism. baseline tsh level above 7.5 miu / ml and female gender are risk factors for developing overt hypothyroidism, which is consistent with our findings., girls with turner syndrome or trisomy 21 with sht related to hashimoto 's thyroiditis are at a higher risk of proceeding to overt hypothyroidism than girls with isolated or idiopathic sht. due to the small size of the group, the main limitation of our study was its retrospective character and the small number of patients ; however our center is the largest one in the southern poland. only one patient during the follow - up developed an overt thyroid dysfunction ; therefore the survival analysis was not performed in this study. the study with its limitations was aimed at being another contribution to the debate on the desirability of creation the algorithms for appropriate care of patients with sh. further prospective, longitudinal, and case - controlled studies are warranted in order to establish final treatment indications, if any, and the recommended mean dosage of lt-4. the optimal dose should on the one hand prevent children and adolescents with sht from proceeding to overt thyroid disease and on the other hand not cause an excess of thyroid hormones, which may affect the body 's metabolic processes. to this end, our center has just begun a 2-year prospective controlled study approved by the ethics committee. | the main purpose of our retrospective study was to evaluate the medical care of the patients with subclinical hypothyroidism (sht) and to investigate the rationale for administering l - thyroxine (lt-4) to young sht patients. patients and methods. based on a retrospective review of the charts of 261 patients referred to the endocrinology outpatient clinic between 2009 and 2014 with suspicion of sht, 55 patients were enrolled for further analysis. data collected was baseline age, anthropometric measurements, serum tsh, ft4, ft3, anti - thyroid autoantibodies, positive family history, absence / presence of clinical symptoms, length of follow - up, and data concerning lt-4 therapy (therapy : t1 ; no therapy : t0). results. t1 encompassed 33 (60.0%) patients. there were no differences between t1 and t0 (p > 0.05) with regard to age, tsh concentrations, bmi z - score, and hsds values, though follow - up was longer in t1 (p < 0.01). four (11.8%) children in t1 and none in t0 had a positive family history of thyroid disorders. fifteen (68.2%) patients in group t0 became euthyroid. one (1.8%) girl (t1) developed overt hypothyroidism. conclusions. a small percentage of patients can proceed to overt hypothyroidism. only positive family history seemed to influence the decision to initiate lt-4 therapy. further prospective studies are warranted in order to establish treatment indications, if any, and the mean recommended dosage of lt-4. |
despite the success of the current public health services and hygiene control in the water supply and sanitation, diarrhea remains the second leading cause of death around the world for children under 5 years of age. recent studies have estimated that diarrheal disease is responsible for 17% of mortality among children under five years of age all over the world. human rotaviruses are the major etiological agents of acute gastroenteritis in infants and young children worldwide. this virus is associated with 111 million episodes of gastroenteritis, 25 million clinical visits, 2 million hospitalizations and 352,000 - 592,000 deaths among children aged < 5 years worldwide, each year. virtually all children are infected at least once within the first 5 years of life, with the peak incidence widely quoted as occurring between 6 and 24 months of age [4, 5 ]. rotaviruses belong to the reoviridae family and are composed of three protein layers surrounding 11 segments of double stranded rna. the rotaviral outer capsid is composed of a protease sensitive protein designated as vp4 and a glycoprotein designated as vp7. the nature of two outer capsid proteins of the virus, vp4 and vp7, elicits the production of neutralizing antibodies to the virus and allows defining the p (for protease sensitive) and g (for glycoprotein) serotypes of the virus. each group is based on its antigenic properties of shared epitopes on the major structural protein, vp6. of these, group a rotavirus has been identified as the leading cause of severe diarrhea disease in infants and young children worldwide. the clinical spectrum of rotavirus illness ranges from mild, watery diarrhea of limited duration to severe diarrhea with vomiting and fever that can result in dehydration with shock, electrolyte imbalance, and death. hospital - based studies conducted in developing and developed countries have revealed that group a rotavirus infection is responsible for 13 - 50% of all cases of diarrhea in children < 5 years old [1014 ]. despite the impact of rotavirus infection in children morbidity and mortality worldwide, however, several epidemiological studies have shown that rotavirus is a major cause of 27% to 46% of cases of acute diarrhea among infants and children these days, rotavirus vaccines have been developed to reduce the morbidity associated with severe rotavirus diarrhea. before a rotavirus vaccine program can be implemented, information is needed on the current burden of rotavirus disease and the distribution and frequency of rotavirus strains circulating in different regions of the country. the aim of this study was to monitor the disease burden associated with rotavirus and determine the g genotypes of rotavirus circulating in children aged < 5 years in marvdasht, iran. sampling : this cross sectional descriptive study was done on 141 stool specimens from children aged < 5 years who were hospitalized for acute gastroenteritis in motahary hospital, marvdasht, iran, during january 2007 to december 2008. the fecal specimens were transported to the infectious disease unit laboratory and stored at -80c until use for the detection of group a rotaviruses. information regarding age, sex, type of nutrition (breast - fed and/or bottle - fed), hospitalization and clinical symptoms such as diarrhea, vomiting, fever and convulsion, were recorded for each child. according to who 's recommendation, all children presenting with gastroenteritis were classified in specific age groups (e.g. 02, 35, 68, 911, 1217, 1823, 2435, 3647 and 4859 months) so that age - specific incidence rates of hospitalization could be calculated. rotavirus detection : the specimens were tested by a solid - phase sandwich - type enzyme immunoassay method (rotavirus ag elisa, drg, germany). od values above the cut off value (0.15+od of the negative control) were considered positive for rotavirus antigen. viral genome extraction : dsrna was extracted from stool specimens by using rnx - plus kit (cinnagen, tehran, iran), according to the manufacturers protocol. reverse transcription - polymerase chain reaction : briefly, 5 l of dsrna was added with mix of dmso, 5x rt buffer, dntps, primers beg9, end9, dw, denatured at 97c for 5 min, then followed by addition of rt enzyme and rnase inhibitor to a final volume of 20 l. the rt - pcr reaction was carried out for 60 min at 42c to produce the complementary (cdna) used for pcr amplification rotavirus. nested multiplex pcr for g genotyping : briefly, 10l of viral cdna was added to a mix containing mgcl2, dntps, 10x pcr buffer, taq dna polymerase and the forward primer beg9 and the reverse primer end9 to a final volume of 50 l. the thermocycler program was carried out at 94c for 1 min, followed by 30 cycles at 42c for 2 min, 72c for 2 min and a final extension at 72c for 5 min. 5 l of the resulting amplicons of 1062 bp were then used as a template in the second round of pcr. the multiplex reaction mix also included each of the g - type - specific primers, abt1 (g1), act2 (g2), aet3 (g3), adt4 (g4), aat8 (g8) and aft9 (g9), provided by world health organization. cycling was done with 20 cycles of the same cycling profile of the first reaction. all pcr products were analyzed by electrophoresis in 1.2% agarose gel that contained ethidium bromide (0.5g / ml) and visualized under uv illumination. statistical analysis : data were statistically analyzed by spss version 16 (spss inc., chicago, il, usa). chi - square, anova and binomial tests were used to determine the significance of difference observed between two different groups of patients. ethical issues : the study was approved by ethical and research committee of the shiraz university of medical sciences, iran. a verbal consent was taken from either parent of the enrolled child prior to the interview and collection of stool samples. serology of rotavirus infection : a total of 141 stool samples were collected from children aged < 5 years. rotavirus was confirmed in 40 of 141 (28.37%) stool specimens analyzed for the presence of group a rotavirus antigen by eia. rotavirus and demographic data : rotavirus was detected more often (16.31%) in boys than in girls (12.05%). there was no statistically significant difference in the sex distribution between these populations (p=0.4). the age group analysis of rotavirus - positive cases revealed that the highest infection rate was among children less than 24 months of age with 72.91% prevalence. children between 12 - 17 months of age were the most affected (40.0%), while those within the age bracket of 0 - 2 and 48 - 59 months were the least affected, because no rotavirus infection was detected (p=0.04). the study of clinical manifestations in rotavirus gastroenteritis cases showed that most children with infection had diarrhea (96.25%), vomiting (82.50%) and fever (45.0%). convulsion was not identified in children with rotavirus infection (p=0.08). according to the season distribution, it was observed that rotavirus infection was detected throughout the year but the relative frequency of rotavirus gastroenteritis was highest in summer. the seasonal distribution of rotavirus infection was as follows : 20.0% in spring, 52.50% in summer, 20.0% in autumn, and 7.50% in winter. a significant relationship was also found between rotavirus infection and seasonal distribution (p=0.02) (table 1). the highest rate of detection of rotavirus gastroenteritis was found in september (25.0%) and the lowest in the months february to april, in which no infection was detected (p=0.04) (fig. 2). age distribution of rotavirus gastroenteritis in children monthly distribution of human rotaviruses distribution of g genotypes in different seasons nta : non - typeable genotypes rotavirus genotyping : genotyping was performed on 40 rotavirus positive stool samples by using nested rt - pcr. the most common circulating genotypes in the population under surveillance were mixed genotypes, being identified in 24 strains out of 40 samples (60%), followed by non - typeable (12.50%), g2 (12.50%), g4 (10.0%) and g1 (5.0%). the most prevalent mixed genotypes in children with rotavirus infection are shown in table 2. the most frequent detected genotypes were mixed genotypes in both females (58.82%) and males (60.87%). no statistically significant differences between the genotype distribution and gender were observed (p=0.6). the most prevalent rotavirus genotype reported was mixed infection in spring (15.0%), summer (30.0%), autumn (15.0%) and g4 in winter (5.0%) seasons. statistically significant differences were found for the distribution of the genotypes and seasons (p=0.03) (table 1). in this study, we describe the results of a survey in marvdasht, iran to determine the importance and epidemiological features of rotavirus infections in a specific geographic area (marvdasht and surrounding rural area) and a target population (children under 5 years old). this result is comparable to the disease burden of rotavirus seen in previous investigations in iran and various other countries, being associated with 13 to 50% of all cases of gastroenteritis [1012, 1517 ]. in the present study, the prevalence of rotavirus in the first 24 months of life was significantly higher than that in older age groups. this age distribution is comparable to previous reports in the other parts of the world [5, 12, 13, 15, 21 ]. the high burden of rotavirus infection in young children highlights the need for vaccine to offer optimal protection against severe rotavirus disease in children aged younger than 2 years. epidemiological studies in different regions of the world have indicated that in temperate climates, rotavirus diarrhea occurs predominantly during the cooler months and rarely in the summer months [15, 2123 ]. however, seasonal patterns in tropical climates have shown rates of rotavirus infection throughout the year with seasonal trends that are less well defined [5, 13, 23, 24 ]. our data demonstrated that there was a significant correlation between the seasonal distribution and rotavirus - positive cases. during the study 's surveillance period, rotavirus gastroenteritis occurred throughout the year, with more cases occurring in the summer months and a seasonal peak observed in the months of july and august. this result may have been due to the collection of more samples in the summer. however, extensive epidemiological studies over longer periods of time should be encouraged to determine more accurately the seasonal pattern of rotavirus infection in marvdasht, iran. during this study, diarrhea was the symptom most commonly reported in association with rotavirus diarrhea, followed by vomiting and fever. these findings are similar to those results observed in iran and other countries [11, 21, 2527 ]. currently, analysis of rotavirus strains / genotypes is the key to evaluating the suitability of mass vaccination of children around the world. the observation of g and p distribution and diversity contribute to a better understanding of rotaviruses in circulation and help to characterize the various antigenic shifts that could reduce vaccine efficiency. in the present study, the most frequent circulating genotypes in the population under surveillance were mixed genotypes. the proportion of mixed infections (60.0%) detected among children with acute gastroenteritis, was relatively high compared to that reported for children from iran (2.6%), albania (2.0%), denmark (12%) and indonesia (23.0%). high mixed infection with different rotavirus strains may reflect frequent contamination of water resources with rotavirus strains that facilitate generation of novel rotavirus strains through a re - assortment process. the second most common genotype was the non - typeable genotypes, present in 12.50% of the evaluated samples. analysis of rotavirus genotypes has reported the prevalence of non - typeable genotypes in children with acute diarrhea in other regions of iran, as well as in other countries [15, 16, 2831 ]. the non - typeable rotavirus strains for the g genotype could be related to the presence of novel strains, the failure of the genotyping due to the presence of the other genes not investigated in this survey ; for example, rare genotypes such as g5, g6, g11, and failure in rt - pcr technique. numerous epidemiologic studies have shown the g2 genotype as one of the most prevalent rotavirus genotypes worldwide [11, 24, 28, 32 ]. in this study, serotype g2 strains were identified in five children with severe diarrhea, and represented 12.50% of the total strains identified. in recent years g4 strain has been detected at relatively high frequency from south korea, to italy, to brazil and some regions of iran[15, 33 ]. however, g4 was detected as the fourth genotype only in 10.0% of all children with rotavirus gastroenteritis. molecular epidemio - logical studies globally have indicated that g1 is the most common circulating genotype [5, 14, 16, 30 ]. however the g1 genotype was observed only in 5.0% of all children with rotavirus gastroenteritis. in the current study, neither the g3 nor the g8 genotypes were detected individually. these findings are distinct from those results observed in sierra leone and china, where these g types have been identified as the most common genotypes in children. recently, g9 has appeared as the common genotype in albania, cuba, but in our study it was not identified. the emergence of g9 as an important genotype in developing and industrialized countries necessitates the inclusion of g9 in future rotavirus vaccines. one limitation of the present study is the possibility that study population may not be representative of the disease burden of rotavirus among all 05-year - old iranian children. this was because we identified the prevalence of rotavirus gastroenteritis from only one city in iran and the period of surveillance was limited to a period of 12 months. therefore, in order to have a comprehensive picture of strain distribution in the country, it is necessary to continue strain characterization in other regions of iran. another possible limitation is that true rotavirus prevalence can be higher than estimated here (28.37%), because in this study only hospitalized children with moderate to severe diarrhea have been evaluated and the proportion of rotavirus infections among children with only home care or outpatient visits have not been estimated. results of this study provide strong support to the concept that rotavirus vaccination of infants may have a major impact in reducing rotavirus gastroenteritis morbidity as well as pressure on healthcare services concerning acute diarrhea among young children in iran. frequencies of mixed genotypes are indicating severe infection because of low sanitation and transmission of recombinant strains transferred from animals to humans. the noticeable frequency of non - typeable genotypes indicates the necessity of using another primer for characterization of unusual genotypes. diagnosis of the high prevalence of group a rotavirus infection in hospitalized patients with diarrhea and genotyping of single and co - infection of circulating rotavirus isolates, provide useful data for designing future related research needed to formulate new effective vaccines, especially for infants less than 5 years old. | objectivethis study was conducted to evaluate the prevalence of rotavirus disease and to investigate the genotypes of rotavirus strains causing acute gastroenteritis among children aged < 5 years old in marvdasht, iran.methodsone hundred and forty - one children, aged 1 month to 5 years, afflicted with severe diarrhea were enrolled during january 2007 to december 2008. their stool samples were studied with enzyme immunoassays (eia) for group a rotaviruses. rotavirus - positive specimens were genotyped by the nested rt - pcr using different types of specific primers.findingsout of total collected samples rotavirus infection was detected in 40 (28.37%). of the rotavirus episodes, 72.91% occurred during the first 2 years of life (p=0.038). the highest prevalence of infection was identified in summer (52.50%) and the lowest in winter (7.50%). the most common clinical features included diarrhea (96.25%), vomiting (82.50%) and fever (45.0%). mixed genotypes were the predominant g type (60.0%), followed by non - typeable (12.50%), g2 (12.50%), g4 (10.0%) and g1 (5.0%) genotypes. g3/g8 mixed infection is the first of these rotavirus genotypes to be reported in iran.conclusionregarding high frequency of rotavirus infection, continuous surveillance is needed to inform diarrhea prevention programs as well as to provide information about the occurrence of new rotavirus strains. this will assist policy makers in decision making on rotavirus vaccine introduction. |
globally, salmonella has been one of the most commonly reported causes of food - borne pathogens from distant and recent times [13 ]. according to a recent study commissioned by the world health organization (who) on the global disease burden of food - borne diseases in humans, food - borne illnesses from diarrheal and invasive nontyphoidal salmonella enterica, resulted in the largest disease burden, highlighting the significant public health importance of salmonella infections and the urgency for control, particularly in low- and middle - income countries where most burden of diseases and occurrence of mortality cases are reported. in sub - saharan africa, nontyphoidal salmonellae are the most common causes of bacterial bloodstream infections in both adults and children presented with fever and are associated with case fatality rate of 2025%. infections can occur most often via ingestion of contaminated meat, eggs, raw milk, fruits, and vegetables [68 ]. contamination of these foods can occur during production, processing, distribution, and retail marketing. nontyphoidal salmonellae, including s. dublin, are known to cause bacteremia and other infections in humans in sub - saharan africa [1013 ]. s. dublin is primarily cattle - adapted, but it can also less frequently cause infections in other domestic animals, including ovines [14, 15 ]. food - producing animals, including bovines and ovines, serve as reservoirs of nontyphoidal salmonella serotypes that can be transmitted to humans [16, 17 ]. wild animals can also serve as reservoirs of salmonella increasing its transmittance to free - ranging food animals and then to humans through cross contamination [18, 19 ]. an increasing proportion of salmonella isolates is resistant to commonly used antibiotics in both developing and developed countries [20, 21 ], and this increase is seen in both veterinary and public health sectors [2224 ]. the increasing proportion of single and multiple antibiotic - resistant salmonella strains isolated from human salmonellosis cases has been associated with the widespread use of antibiotics in food animals. a recent review indicated that, overall, several factors contribute to high antibiotic resistance in ethiopia, including ease of access to and high frequency of antibiotic use, use of antibiotics at subtherapeutic levels, overprescription at health facilities, close contact between animals, high antibiotic use in animals in small production systems, and contamination during handling animal products ; but another study indicated the exact extent of use of antimicrobials in food animals in ethiopia is not clearly defined. however, levels of antibiotics in beef have been found to be high in ethiopia. the antibiotics excessively used in ethiopia and other african countries include tetracyclines, -lactams, chloramphenicol, quinolones, nitrofurans, and macrolides. tetracycline levels have been found to be especially high in meat and kidney samples from several abattoirs in ethiopia, exceeding the who limits. for example, fecal excretion of salmonella can be a source of contamination both at farm and at abattoir levels. abattoir workers can spread the contamination during evisceration and handling meat without proper hand disinfection. some studies carried out on meat samples, minced meat, meat swab, and humans in ethiopia showed that salmonella is quite prevalent in various food animals (e.g., bovines, ovines, poultry, and pigs), animal products (e.g., beef, poultry, and milk), and human beings [2832 ]. animals and humans get salmonella contamination in several ways. animals get infected with salmonella via the fecal - oral route through consumption of feeds, water, grass, and so forth, contaminated with feces from other infected animals, as well as through direct contact with infected animals. salmonella can colonize animals at various sites, such as the intestines of food animals and the reproductive tract and egg of chicken, leading to contamination of various animal products. humans become infected with salmonella after consuming raw or improperly cooked animal products, such as contaminated meat, poultry, pork, and milk, as well as through direct contact with contaminated animals and household pets [16, 17, 33, 34 ]. in ethiopia, as in other developing countries, it is difficult to evaluate the burden of food - borne diseases, because of the limited scope of studies and lack of coordinated epidemiological surveillance systems. in addition, underreporting of cases and the presence of other diseases considered to be of higher priority may have overshadowed the problem of food - borne diseases including salmonellosis. therefore, the objectives of this study were to isolate and identify salmonella in slaughtered bovines and ovines, estimate the prevalence, and investigate the susceptibility pattern of isolates to commonly used antibiotic agents using disk diffusion method. the study was conducted from december 2014 to april 2015 at addis ababa abattoir enterprise, ethiopia. it lies in the central highlands at an altitude of 2324 m (7625 ft) above sea level. the city 's main supply of meat is provided by slaughter of bovines drawn from all corners of ethiopia. healthy bovines and ovines were slaughtered at addis ababa abattoir enterprise after an average of 2472 h upon arrival at the slaughterhouse. most of the bovines slaughtered at the abattoir are adult males of local zebu breed. different organs and carcasses are inspected after slaughter, mainly for presence of tuberculous lesions, whereas no tests are conducted to detect salmonella and other pathogens. for isolation and identification of salmonella, the sample size was calculated based on 8.5% and 7.7% expected prevalence in bovine and ovine samples, respectively, with 5% desired absolute precision and 95% confidence interval using the formula recommended by thrusfield : (1)n = z2pexp1pexpd2,where n is required sample size, z is 1.96, pexp is expected prevalence, and d is desired absolute precision of 0.05. accordingly, the minimum sample size calculated was 120 and 109. to increase the precision of the estimate, the sample size was inflated and a total of 280 samples were considered. these samples included 140 from bovines (70 from carcass swab and 70 [35 each ] from lung and liver) and 140 from ovines (70 from carcass swab and 70 [35 each ] from lung and liver). a cross - sectional study was conducted on randomly selected samples collected from addis ababa abattoir. samples were collected using random sampling properly labelled by date of collection, sources, and sample type. twenty - five grams of liver and lung samples was put in sterile plastic bags and kept in an ice box containing ice packs. the sampling areas were delineated by using sterile aluminum foil templates (10 10 cm). a sterile cotton tipped swab (2 3 cm) fitted with wooden shaft was first soaked in 10 ml of sterile buffered peptone water (bpw) (oxoid, england) and swabbed over the delineated area horizontally and then vertically several times on the abdomen (flank), thorax (lateral), crutch, and breast (lateral). up on completion of the swabbing process, the swab was placed into the bpw within test tube and the upper tip of the shaft was broken and disposed of leaving the cotton swab. the samples were kept in ice box containing ice packs and immediately transported to the microbiology laboratory at aklilu lemma institute of pathobiology. the samples were processed upon arrival. the technique recommended by the international organization for standardization iso 6579 overnight frozen samples were allowed to thaw for 3 to 5 hrs at room temperature before analysis. the bacteriological media used for the study were prepared following the instructions of the manufacturer. each 25 g of sample was put in a sterile stomacher bag and 225 ml of buffered peptone water (oxoid, england) was added (one to nine proportion) and homogenized using a laboratory blender (oxoid, england) for 2 minutes. the preenriched samples were incubated for 18 to 24 hrs at 37c. following this, 1 ml and 0.1 ml of the preenrichment broths were transferred aseptically into 10 ml of muller kauffmann tetrathionate (merck, germany) and 10 ml of rappaport - vassiliadis (rv) broth (oxoid, england), mixed, and then were incubated for 18 to 24 hrs at 37c and 42c, respectively. following incubation, a loop - full of each culture was streaked onto the surface of xylose lysine deoxycholate (xld) (oxoid, england) and brilliant green agar (bga) (oxoid, england) medium and incubated at 37c for 24 to 48 hrs. if growth is slight or if typical colonies of salmonella were not present, the plates were reincubated for a further 18 to 24 hrs and reexamined for the presence of typical salmonella colonies. the formation of red colonies with black centers and of pink colonies with a red zone was inspected on xld and bga plates, respectively. all gram - negative isolates were further identified by motility test (by the hanging - drop method), biochemical tests, pcr amplification, and serotyping. all suspected salmonella colonies were picked from the agar plates and inoculated into the following biochemical test tubes for confirmation : triple sugar iron (tsi) test (presumptive salmonella colonies produce black colonies or colonies with black centers and red medium on tsi agar) (oxoid, england), citrate test (presumptive salmonella colonies produce blue colour for the citrate test), urease test (presumptive salmonella colonies produce purple - red colour for the urease test), lysine decarboxylase (ldc) agar (oxoid, england) test (presumptive salmonella colonies produce purple - coloured colonies on ldc agar), and indole test (presumptive salmonella colonies produce violet - coloured colonies for the indole test). colonies were also tested for catalase production. a genus - specific polymerase chain reaction (pcr) amplification targeting histidine transport operon using pairs of primers 5actggcgttatccctttctctggtg3 and 5atgttgtcctgcccctggtaagaga3 was conducted to test the identity of the bacterial isolates using pcr conditions as described in cohen.. the bacterial isolates positive by the genus - specific pcr were serotyped by slide agglutination test targeting specific flagellar antigens. the disc diffusion test was done for each isolate on mueller - hinton agar (oxoid, england). approximately 20 ml of medium was poured into 90 mm diameter sterile petri dishes to a depth of 4 mm and left at 37c overnight to check for sterility. five ml tryptic soya broth (oxoid, england) was inoculated with test isolates and incubated at 35c for 4 hr. culture of each isolate was compared with 0.5 mcfarland turbidity standards (if necessary adjusted by adding sterile saline into tubes). isolates were inoculated on mueller - hinton agar using swabs and inoculated plates were left at room temperature for 30 min to allow drying. salmonella isolates were tested for susceptibility to the following 14 antibiotics (oxoid, england) : amikacin (10 g), amoxicillin / clavulanic acid (30 g), ampicillin (10 g), ceftriaxone (30 g), chloramphenicol (30 g), ciprofloxacin (30 g), gentamycin (10 g), kanamycin (30 g), nalidixic acid (30 g), nitrofurantoin (30 g), streptomycin (10 g), trimethoprim / sulfamethoxazole, and tetracycline (30 g) using the disk diffusion method according to guidelines set by the clinical laboratory standards institute (clsi). antibiotic impregnated discs were dispensed on the surface of cultures of muller - hinton agar and incubated at 35c for 20 hrs. the diameters of the zones of inhibition were recorded to the nearest mm and classified as resistant, intermediate, or susceptible according to established interpretive chart. the following quality control strains were used : escherichia coli atcc 25922 for positive control and proteus mirabilis atcc 35659 for negative control in the ldc and indole tests ; klebsiella pneumoniae atcc 700603 for positive control and e. coli atcc 25922 and uninoculated for negative control in the citrate and urease tests ; and salmonella typhimurium atcc 14028 were used. k. pneumoniae atcc 700603 and e. coli were used as positive and negative controls, respectively, for the citrate tests. the sterility of prepared media was checked by incubating some randomly selected plates for 24 hrs at 37c. e. coli atcc 25922 and k. pneumoniae atcc 700603 were used as positive and negative controls in the motility test. e. coli atcc 25922 was used as a reference strain in the disk diffusion susceptibility tests. data collected in the study and the results of laboratory investigations were entered into microsoft excel, edited, coded, and analyzed by statistical methods using statistical software program (spss version 15.0). percentage to measure the prevalence of salmonella was used and p value 2-fold higher in retail markets than in abattoirs. although s. dublin is known to be cattle - adapted, it can infect other domestic animals including ovines [14, 15, 45 ]. it primarily affects the mammary glands of cows and can be shed into milk subsequently causing infection in humans consuming unpasteurized dairy products [4649 ]. consumption of raw milk is very common largely because of the impracticability in most cases of boiling milk before consumption. many people in ethiopia also recognize the richness of liver in nutrients and consume it raw with hot pepper or spices. thus, it is reasonable to assume that meat, milk, and liver can serve as vehicles for extensive transmission of salmonella to humans. s. dublin can cause disease in animals and invasive disease and mortality in humans [5153 ]. nontyphoidal salmonella, including s. dublin, cause bacteremia, bloodstream, and other infections in humans in sub - saharan africa [10, 11 ]. s. dublin causes enteritis by inducing infiltration of neutrophils into the intestinal epithelium, induction of inflammatory responses, and fluid secretion mediated by secretion systems that translocate secreted effector proteins into eukaryotic cells [52, 57 ]. s. dublin is considered highly pathogenic to humans, especially in immunocompromised individuals [1214 ]. resistance of bovine and ovine isolates of salmonella to two or more major antibiotics was observed in 11 (84.6%) of isolates in this study. this resistance to antibiotics has significant importance because these antibiotics are also commonly used in human medicine in ethiopia. for example, ciprofloxacin, nalidixic acid, and ceftriaxone are indicated against bacillary dysentery ; chloramphenicol, trimethoprim / sulfamethoxazole, and ciprofloxacin are indicated against gastroenteritis ; the latter two drugs are also used to treat cholera ; amoxicillin, gentamycin, and ceftriaxone are among the agents used to treat pneumonia ; trimethoprim / sulfamethoxazole and amoxicillin / clavulanic acid are used against sinusitis. moreover, prescriptions are usually made without prior isolation and drug susceptibility testing of infectious agents. furthermore, the potential for horizontal transmission of resistance traits and other virulence factors or plasmids from salmonella to other microbes, including within the human gut, may exist. resistance traits in salmonella can be genetically determined and may involve chromosomal mutations or may be plasmid - mediated and may be exchanged with other enterobacteriaceae [5962 ]. the magnitude of all these is not known in the prevailing conditions in ethiopia since misdiagnosis and underdiagnosis can be common and prescriptions are virtually empirical. large - scale intensive farming combined with use of antibiotics (which is empirical in most developing countries) in animals is expected to increase in the coming decades, thereby promoting on - farm selection of antibiotic - resistant strains and markedly increasing the human health risks associated with consumption of contaminated meat products [24, 25 ]. to our knowledge, this is the first study to have complete (100%) resistance to streptomycin in all studied isolates being reported among bovine or ovine isolates of salmonella in ethiopia. thus, it is of significant concern, since our study involves all randomly selected samples. resistance of salmonella from food items, animals, and humans to streptomycin was reported by several studies in ethiopia [35, 36, 50, 6365 ], but the level of resistance to streptomycin ranged from 46 to 86%. this extremely high level of resistance of salmonella and other pathogens (e.g., similar high level resistance to streptomycin has also been reported in ethiopian tuberculosis patients, including in newly diagnosed patients (and references therein)) to streptomycin in ethiopia should be cause for high concern as it might also cause cross - resistance to other drugs with similar mechanism of action. gentamycin was effective on almost all isolates in this study, similar to that of garedew. and alemu and zewde who analyzed salmonella from slaughtered bovines, raw meat, and swab samples from butcher shops ' utensils and meat handlers. inclusion of possible salmonella isolates from humans in the abattoir and the internal abattoir environment would have strengthened this study. the results of this study are indicative of salmonella risk in meat from the abattoir, but more detailed studies should be conducted including possible routes of transmission of salmonella as well as amplification of antibiotic resistance transfer. the present study indicated detection of salmonella from healthy slaughtered bovine and ovine samples at addis ababa abattoir enterprise with an overall prevalence of 4.64%. the results of the present study indicate poor evisceration process and hygienic practices of workers, which could result in the contamination of carcass and cross contamination from positive animals. contamination with salmonella can be further amplified when one considers the possibilities for more contamination as meat passes through the many steps from slaughterhouse to the final consumer [29, 68 ]. hygiene status must be enhanced to minimize cross contamination of salmonella from utensils, cutting boards, and knifes as well as from abattoir workers who are involved in the slaughtering process. even if s. dublin were a bovine pathogen only, it would still be a highly significant problem to the economy and livelihood of people in general and farmers in particular. proper decontamination and disinfection measures should be enhanced including at the entrance to slaughterhouses to reduce contamination. further recommended measures to control contamination include carcass trimming to remove visible contamination, washes using ambient or hot water, organic acids, and other chemicals, as well as hide dehairing and frequent hand washes and disinfection. to minimize the risk of cross contamination and food - borne infections caused by salmonella spp., control measures along the meat processing chain, namely, slaughterhouses, meat processing plants, distributors, and consumers, should be undertaken. care should be taken in selecting antibiotics to treat salmonella infection in animals and humans to avoid subtherapeutic levels of (appropriate) antibiotics and use of inappropriate antibiotics (e.g., antibiotic(s) to which an infectious agent may be resistant). finally, larger studies are recommended to elucidate the magnitude of infection of animals with salmonella, the extent of zoonotic transmissions, and the antibiotic resistance problem. a pubmed search using combinations of key words such as addis ababa, abattoir, salmonella, bovine, antibiotic resistance returned no published articles. we hope the results of this study could serve as basis for initiation of further and larger studies in ethiopia that will shed light on the types, levels, frequency, and appropriateness of antibiotic use in farm animals as well as transmission of pathogens and antibiotic resistance from animals to humans, which will be important for the benefit of animal and human health. such studies require implementation of carefully designed experiments to determine and trace associations between causes and effects and effects of subtherapeutic levels of antibiotics. thus, collaborative efforts with combined inputs of both expertise and resources would be needed. | salmonellae are ubiquitous, found in animals, humans, and the environment, a condition which facilitates transmission and cross contamination. salmonella enterica serotypes exert huge health and economic impacts due to their virulence or carriage of antibiotic resistance traits. to address this significant issues with regard to public health, availability of adequate information on the prevalence and antibiotic resistance patterns of salmonella, and establishment of adequate measures to control contamination and infection are needed. a cross - sectional study was conducted to assess the level of salmonella infection in slaughtered bovines and ovines at addis ababa abattoir. samples were collected randomly and processed for identification and antimicrobial susceptibility testing of salmonella spp. from 280 animals examined, 13 (4.64%) (8 bovines and 5 ovines) were positive, with most samples (12/13, 92%) comprising salmonella dublin. very high level of resistance to some antibiotics used in human medicine was detected. most isolates were susceptible to gentamycin and amikacin. nine (69%) of all isolates were resistant to multiple antibiotics. serotyping revealed 12 of 13 isolates to be of the dublin serotype with 9,12:g, p:- antigenic formula. this study emphasizes the importance of improving the evisceration practice during slaughtering and restricting the use of antibiotics in farm animals. |
cobb 's collar or moormann 's ring is a largely underestimated cause of male bulbar urethral strictures. it can potentially lead to acute urinary retention, upper urinary tract dilatations, enuresis, infection, poor streaming, and hematuria. embryologically, this focal bulbar urethral stricture develops due to failure of canalization of the cloacal membrane during fetal development. in cobb 's collar, the site of obstruction is more distal than that seen with posterior urethral valves (puv). a prompt diagnosis with minimally invasive treatment may avoid upper and lower tract deterioration in these patients. we present two cases of congenital bulbar urethral obstruction (cobb 's collar) occurring in brothers. the anatomy, embryology, and clinical features are discussed in order to turn the spotlight on to this rare disease. a 30-year - old man presented with a long history of a worsening urinary stream and a sense of incomplete voiding and straining at micturition. there was no history of traumatic injury, instrumentation of the urethra, or sexually transmitted disease. abdominal and genitourinary examination revealed an enlarged and distended urinary bladder with normal - looking external genitalia. renal function tests and urine routine examination were within normal limits, and urine culture showed no growth. usg of the abdomen revealed bilateral mild hydronephrosis [figure 1a ], presence of hydroureters, a dilated prostatic urethra, and a thick - walled over - distended bladder. pre - void (1972 ml), first (957 ml) and second post - void (790 ml) residual volumes were significantly raised [figure 1b ]. urodynamic study could not be performed as catheterization failed due to the tightness of the urethral stricture. subsequent retrograde urethrogram (rgu) showed a 3-cm stricture in the bulbar urethra [figure 2a ]. micturating cystourethrogram (mcu) using the suprapubic route showed a narrowing in the proximal bulbar urethra, without reflux into the collecting system [figure 2b ]. suprapubic catheterization (spc) with visual internal urethrotomy (viu) was performed and the patient was discharged. later, he was readmitted for a voiding trial and teflon dilatation. in view of the persistent urinary problems, the postoperative course was uneventful, and the patient voids without complaints at 6 months follow - up. (a) bilateral mild hydronephrosis (b) significant post - void urine residue (case 1) (a) retrograde urethrogram demonstrating a narrowing in the proximal bulbar urethra, (b) micturating cystourethrogram (mcu) showed a narrowing in the proximal bulbar urethra (white ring) (case 1) the first case 's 25-year - old younger brother also complained of poor urinary stream and straining at micturition. usg showed mild hydronephrotic changes, hydroureters, and a thickened bladder wall, with significant post - voiding residue. rgu was performed which showed a short segment stricture in the bulbar urethra [figure 3 ]. the patient is asymptomatic at 6 months follow - up, with normal serial usg evaluations. a 30-year - old man presented with a long history of a worsening urinary stream and a sense of incomplete voiding and straining at micturition. there was no history of traumatic injury, instrumentation of the urethra, or sexually transmitted disease. abdominal and genitourinary examination revealed an enlarged and distended urinary bladder with normal - looking external genitalia. renal function tests and urine routine examination were within normal limits, and urine culture showed no growth. usg of the abdomen revealed bilateral mild hydronephrosis [figure 1a ], presence of hydroureters, a dilated prostatic urethra, and a thick - walled over - distended bladder. pre - void (1972 ml), first (957 ml) and second post - void (790 ml) residual volumes were significantly raised [figure 1b ]. urodynamic study could not be performed as catheterization failed due to the tightness of the urethral stricture. subsequent retrograde urethrogram (rgu) showed a 3-cm stricture in the bulbar urethra [figure 2a ]. micturating cystourethrogram (mcu) using the suprapubic route showed a narrowing in the proximal bulbar urethra, without reflux into the collecting system [figure 2b ]. suprapubic catheterization (spc) with visual internal urethrotomy (viu) was performed and the patient was discharged. later, he was readmitted for a voiding trial and teflon dilatation. in view of the persistent urinary problems, the postoperative course was uneventful, and the patient voids without complaints at 6 months follow - up. (a) bilateral mild hydronephrosis (b) significant post - void urine residue (case 1) (a) retrograde urethrogram demonstrating a narrowing in the proximal bulbar urethra, (b) micturating cystourethrogram (mcu) showed a narrowing in the proximal bulbar urethra (white ring) (case 1) the first case 's 25-year - old younger brother also complained of poor urinary stream and straining at micturition. usg showed mild hydronephrotic changes, hydroureters, and a thickened bladder wall, with significant post - voiding residue. rgu was performed which showed a short segment stricture in the bulbar urethra [figure 3 ]. the patient is asymptomatic at 6 months follow - up, with normal serial usg evaluations. the proximal prostatic and membranous part of the male urethra is formed by endodermal tissues and the penile part is formed from the phallic portion of the urogenital sinus. congenital idiopathic urethral stricture may result from incomplete rupture of the cloacal membrane at the junction of membranous and bulbar urethra which may correspond to submeatal stenosis in girls. 1968) were the first to draw attention to the entity of congenital stricture of the bulbar urethra. they analyzed 52 cases of proximal bulbar urethral obstruction in male patients for a 3-year period. twenty - six out of 52 patients were boys under 16 years of age ; of these 26 boys, 16 had a trabeculated bladder, 15 showed a dilated prostatic fossa, whereas 6 had a secondary hydroureter, and the most frequently referred symptoms were enuresis, urinary tract infection, hematuria, and failure to thrive. all these forms of obstruction are located just below the external sphincter [figure 4 ]. it can appear either as a ridge of tissue (cobb 's collar i) or as a definite stricture in the area described (cobb 's collar ii) or even as a very tight pinhole opening (cobb 's collar iii). p, prostate ; s, external sphincter ; c, cobb 's collar such strictures of the bulbar urethra had been underestimated for many years until the first half of the 1990s when dewan. and later nonomura. redefined and classified the bulbar urethral narrowing by reviewing video - recorded cystoscopies as well as radiological pictures in the patients. both studies showed that the majority of patients were below 1 year of age with a large number showing vesicoureteral reflux (vur), with no history of urethral trauma, catheterization, or instrumentation. vur in association with clinical findings and endoscopic findings of vestigial remnants at the level of bulbar urethra indicates that this narrowing has a congenital onset. presentation at a later age, as occurred in our cases, may represent delayed presentation of a congenital stricture. their response to treatment is clearly different from that of the under 1 year olds, since majority require buccal mucosal onlay urethroplasty or scrotal or penile island flap urethroplasty. the more common causes of congenital urethral stricture are different types of posterior urethral obstruction, which was originally described as puv (three types) by young., but these obstructions were found to be diaphragmatic obstruction as suggested by parkkulainen on endoscopic studies. congenital attachment of the verumontanum to the anterior wall of the posterior urethra is the embryologic forerunner to the congenital obstruction of the posterior urethra. congenital obstructing posterior urethral membrane (copum), first described by dewan. more distal bulbar urethral abnormality without folds running up to the verumontanum is likely to be a remnant of urogenital diaphragm, commonly known as cobb 's collar., in their series of 12 pediatric patients with bulbar or posterior urethral stenosis, identified a sort of bimodal distribution of age at presentation, with 50% of patients presenting during the first year of life, whereas 5 of the remaining 6 patients presented after the age of 11. this late presentation may represent a delayed presentation of a congenital stricture, or may be due to a forgotten urethral trauma or asymptomatic inflammation. clinical presentation may be variable and, often, may be related to the use of blind urethral catheterization in these patients. chronic urinary retention and bilateral hydronephrosis may be a presenting feature in some patients, as in our case. late presentation of cobb 's collar (caused by a persistence of urogenital membrane) can be differentiated from acquired stricture by the absence of the characteristic folds between copum anomalies and verumontanum. pediatric urologists continue to debate whether the cobb 's collar or moormann 's ring represents a true urethral stricture or not. some consider cobb 's collar to be a benign physiological narrowing of the bulbar urethra, easily passable with a cystoscope, although cobb describes a series of bulbar strictures in a pediatric population in his original paper. so, although rare, cobb 's collar has to be considered in the differential diagnosis of progressive urinary flow obstruction and enuresis, especially in pediatric and adolescent patients where acquired traumatic, iatrogenic, or inflammatory strictures are more common. radiologically indistinguishable dysfunctional voiding due to involuntary contraction of urethral sphincter or pelvic floor muscles and hinman syndrome (functional non - neurogenic bladder) are also important differential diagnoses to be considered. contrast - enhanced conventional radiological studies can identify this anomaly and also be helpful in postoperative follow - up of this entity which can be easily treatable by minimally invasive endoscopic corrective surgery. familial occurrence of cobb 's collar is exceedingly rare and only few cases are reported in the literature, indicating that this entity may have a familial basis. screening for family members is an important part of managing these patients. in the absence of traditional risk factors if the biopsy of the stricture and histological examination shows a normal urethral mucosa and the absence of any inflammation or fibrosis, then cobb 's collar becomes the likely diagnosis. from the limited data available and from the cases reported here, it is clear that urethral strictures often present with an unknown etiology. although extremely uncommon, in cases of adolescent or pediatric patients presenting with symptoms of progressive urinary obstruction and enuresis with or without urinary tract infection and/or hematuria, a bulbar urethral obstruction such as cobb 's collar should be considered. | most urethral strictures arise from iatrogenic, traumatic, or inflammatory causes. we report the familial occurrence of a congenital bulbar urethral stricture in two brothers. retrograde and voiding cystourethrography was performed. a cobb 's collar was diagnosed after radiological and endoscopic evaluation in both cases and was successfully managed with urethroplasty. cobb 's collar is a rarely recognized cause of a membranous stricture of bulbar urethra that can lead to several urinary problems. in cases of adolescent and young adults presenting with symptoms of progressive urinary obstruction and enuresis with or without urinary tract infection, cobb 's collar can be seen as a minor constriction in the bulbar urethra, but is not frequently symptomatic, and the familial occurrence of such a stricture is even rarer. |
brains are modular, interconnected structures optimized for transmission and processing of information at a level compatible with the survival and reproduction of each particular species (hilgetag and kaiser, 2004 ; koch and laurent, 1999 ; sporns, 2002 ; sporns., 2004). information is progressively altered as it flows through the brain as a consequence of : (i) the processing performed by each individual neuron ; (ii) the interconnection between the neurons along the path of the information flow, which implements the mixture of different signals ; and (iii) interferences at the neurons or interconnection links (e.g. noise and cross - talk). while great attention has been focused on information processing in the brain, specially at the neuronal level, relatively fewer investigations have addressed the equally important issue of how signals are disseminated, while being integrated, through the several brain areas. indeed, a great deal of the brain hardware (sporns and ktter, 2004), especially the white matter, is responsible for conveying signals along considerable distances from their origin, typically to several destinations, where they are modified, blended, and transmitted further. brain connectivity can be effectively represented, modeled and simulated in terms of graphs (e.g. barabsi and albert, 2002). more specifically, each neuron or cortical region can be mapped as a node of a graph, while the synaptic or inter - regional connections are represented as directed links. though a more complete understanding of information processing in the brain ultimately requires the integration of the non - linear processing taking place at each neuron, valuable insights can be nevertheless obtained by adopting some simpler (e.g. linear) dynamics and focusing on the interconnectivity and signal modification between neurons or cortical areas, as represented by graphs and networks (watts and strogatz, 1998). several linear approximations to non - linear problems have been reported in the literature, most of which related to linear synchronization dynamics (e.g. zemanova., 2008 ; zhou., 2006, 2007) and active media (e.g. biktasheva., 2009 ; ermentrout and edelstein - keshet, 1993 ; hramov., one element of particular importance in such investigations regards the interplay between structure and function. for instance, it has been established that the neural systems seem to form networks whose structures lie at the critical regime between local and global synchrony (percha., 2005). in this way, the appearance of connections in damaged regions may lead to the onset of epileptic seizures (nadkarni and jung, 2003). it should be also observed that, as in the present work, linear approaches can be applied to model the collective dynamics of whole cortical regions, defining a more macroscopic investigation. in such cases, the explicit non - linearity of individual neuronal firing are averaged among several cells, yielding signals which are more graded and more propitious to being represented by linear approximations, especially during short periods of time. this property is ultimately one of the main justifications for the relatively large number of works in the literature in which brain activity is approached in terms of linear synchronization. it is also possible that the macroscopic propagation of cortical activation amongst different cortical regions could exhibit dynamics similar to traditional diffusion. nevertheless, it should always be borne in mind that linear models of cortical activations may not reflect all the important dynamical features, especially those involving longer time intervals. while synchronization is inherently important in the sense of being related to the brain workings, other linear approaches can be equally applied in order to reveal complementary aspects of the relationship between structure and function in the brain. one particularly interesting possibility which has been mostly overlooked is the investigation of signal transmission and processing in terms of signal processing approaches. founded on a well - established, sound mathematical framework, signal processing research (e.g. mcclellan., 2002 ; proakis and manolakis, 2006) focuses on the representation and analysis of signals and systems in terms of frequencies and filters. the generality of such an approach stems from the fact that any real - world signal can be represented in terms of its respective fourier series, namely a linear combination of basic harmonic components (sines and cosines) with different, well - defined frequencies. linear systems typically modify such signals by changing the intensity of each component, such as in filters. for instance, a low - pass filter will attenuate the high - frequency harmonic components, while allowing the lower frequency components to pass with little or no alteration. the application of such an approach to signal transmission and processing in the brain paves the way to a series of promising possibilities. for instance, the alterations undergone by information as it proceeds from a specific origin neuron or cortical region to a specific target can be approximated as a kind of filter. provided the properties of such a filter can be obtained, this approach allows modeling of the alterations undergone by the information while going from origin to destination. in other words, such a filter would replicate the functionality of the whole portion of brain hardware comprised between the origin and destination. in addition to its simplicity and elegance, such a filter modeling approach would also clearly characterize the way in which the information is altered in an intuitive and meaningful way, i.e. in terms of the alterations of the magnitudes of specific harmonic components. for instance, in case a specific portion of the brain is found to correspond to a low - pass filter, it becomes immediately clear that the high - frequency content of the signal is being attenuated, which corresponds to a smoothing operation implying loss of its details, therefore suggesting that that particular processing is focusing on the slower variations of the signal. in addition, low - pass filters are immediately related to the operation of integrating signals along time. in this respect, the smoothing could be a consequence of too intense mixing of several delayed versions of the signal, therefore providing valuable information about the level of blending of the signals as they passed through the network topology. interestingly, the dynamical effect of low- and high - pass filters can be to a large extent summarized in terms of their respective cutoff frequency, namely the frequency where the attenuation reaches 1/2 of the amplitude of the largest harmonic component. such an approach allows the function of the whole portion of brain in question to be effectively summarized in terms of a single real value. in the case of a low - pass filter, the higher the cutoff frequency, the smaller the alteration and intermixing undergone by the signal. the current work describes a signal processing approach to the integration of brain structure and functionality which relies on the adoption of linear dynamics, namely diffusion. this type of dynamics underlies several natural systems and also participates in a large variety of non - linear dynamics (e.g. reaction - diffusion giordano and nakanishi, 2005). more specifically, at each time step, the signals arriving at each cortical region are added and redistributed among the respective outgoing links. the specific way in which such alterations take place are intrinsically related to the specific topology of the portion of the network comprised between the origin and destination nodes. in this way, the signals are blended as they are propagated along the brain in a way that is analogue to several sources of sound going through an environment as the sound signals reverberate and intermix, giving rise to constructive and destructive interferences. as such, this approach provides a nice complementation of other linear approximations to brain functionality, such as synchronization, by emphasizing the intermixing of signals as they progress through specific pathways along the intricate brain topology. though we focus on cortical networks, this approach is immediately extensible to neuronal networks. as reported recently (rodrigues and da fontoura costa, 2009), non - conservative diffusion dynamics, more specifically the situation where each outgoing edge produces unit activation, in cortical networks can be effectively modeled in terms of finite impulse response digital filters (fir). interestingly, the coefficients of the fir associated to a given network undergoing that type of dynamics are completely defined by the number of walks between the origin and destination areas, therefore establishing a clear - cut relationship between network structure and dynamics. the present work extends and explores these possibilities much further by assuming conservative diffusion with and without time decay in the cat and macaque cortical networks. the manuscript starts by presenting the concepts of complex networks and digital signal processing, as well as the adopted cortical databases. next, results obtained with respect to macaque and cat cortical networks are presented and discussed. a directed complex network, composed by a set of n nodes connected by e edges, can be represented by its adjacency matrix a, whose elements aij are equal to unity if the node j sends a connection to node i, and equal to zero otherwise. two nodes i and j are said to be adjacent or neighbors if aij 0. two non - adjacent nodes i and j can be connected through a sequence of m edges (i, n1),(n1, n2),...,(nm1, j). such a set of edges between i and j is called a walk of length m. the special case of a walk where no nodes are repeated is called a path. there are many methods for community identification and their choice depends on specific needs, e.g. accuracy against fast execution (da fontoura costa., 2007). in the current work, we considered the method based in random walks called walktrap (pons and latapy, 2005), because such approach is intrinsically related to diffusion dynamics, which also underlies our modeling approach. the characterization of the properties of a given network can be performed in terms of structural (e.g. da fontoura costa., 2007) and dynamical measurements (e.g. da fontoura costa and rodrigues, 2008). structural measurements includes, for instance, the node degree, clustering coefficient, average shortest path length and assortativity coefficient (da fontoura costa., 2007). on the other hand, dynamical measurements depend on the specific dynamic process that is being executed in the network, such as synchronization (e.g. pikovsky., 2002), random walks (e.g da fontoura costa and sporns, 2006 ; da fontoura costa and travieso, 2003), opinion formation (e.g rodrigues and da fontoura costa, 2005) and epidemic spreading (e.g newman, 2002). the structure and dynamics of complex networks as shown in the current work, the relationship between structure and function of networks can also be addressed by using signal processing approaches. signals are assumed to spread throughout the network by random walks initiating from a given source node (e.g. barber and ninham, 1970 ; giordano and nakanishi, 2005). such a dynamical process, which is inherently related to diffusion (barber and ninham, 1970), involves the progressive dissemination and intermixing of the signals along time and network space, closely reflecting the specific topology of the network. therefore, the signal arriving at a given destination node depends strongly on the structure of the portion of the network comprised between the source and destination nodes (da fontoura costa and rodrigues, 2008). it has been shown recently (rodrigues and da fontoura costa, 2009), with respect to a specific non - conservative diffusion dynamics, that such a strong interplay between network structure and dynamics can be fully modeled in terms of finite impulse response filters (firs). more specifically, the coefficients of such digital filters are given by the number of walks between the source and destination nodes. the diffusion of activations in complex networks can be obtained by considering the transition matrix s, which can be calculated from the adjacency matrix a as each element s(i, j) gives the probability of moving from the node i to node j. in this way, if a given signal is injected into a network, we can determine its diffusive propagation by repeatedly applying the transition matrix. more specifically, the probability of transition between the source and a destination at n edges of distance can be immediately obtained from the matrix similarly, the number of walks of length n between two nodes can be determined by the elements of the matrix dn = a. the above dynamics is conservative, as there is no loss in the activations (all signals in the present work are formed by zeroes and ones). on the other hand, it is also possible to adopt a decay parameter that reduces the amplitude of the received activation along time. in this case, the matrix hn, which gives the probability of transition between the source and destination nodes separated by walks of length n, is given as (3)hn=(n+1)sn where (n + 1) = (1)(n), (1) = 1 and 0 1. the coefficient can be understood as the rate of decay according to the distance from the source of signal propagation. such a dynamics, which is no longer conservative, has biological backing in the sense that sensory brain activations tend to diminish with time. in the current work, we show that the fir approach to modeling the cortical networks can easily incorporate time decay, allowing the investigation of the diffusion dynamics without and with decay. a discrete - time signal is a time series consisting of a sequence of discrete values. the process of converting a continuous - valued discrete - time signal into a digital (discrete - valued discrete - time) signal is known as quantization (orfanidis, 1996). this implies that if a given input is inserted into the system and causes a definite output, if we repeat the same process at another time, an equally delayed version of the previous output will be obtained. a linear, time - invariant system (lti) can be fully classified in terms of its finite impulse response (fir) and infinite impulse response (iir), depending on whether the inserting signal has finite or infinite duration. more specifically, given the impulse response, the output produce for any input signal can be immediately calculated in terms of the convolution between the input signal and the impulse response. a filter can be defined as any medium that can modify the signal in some way (smith, 2007). a digital filter operates on discrete - time signals by taking a sequence of values (the input signal) and producing a new discrete - time signal (the filtered output signal). the main objective underlying the current work is to model the dynamics of signal transmission and integration between pairs of nodes in terms of digital signal processing concepts (mcclellan., 2002 ; more specifically, the signal processing between pairs of nodes (source and destination of signal) is modeled as a fir digital filter structure whose coefficients correspond to the total probability of transition of walks of different lengths between the source and destination (see figure 1). this approach extends and complements a preliminary investigation assuming non - conservative diffusion dynamics, where the signals were propagated by using the adjacency, instead of transition, matrix (rodrigues and da fontoura costa, 2009). the fir model of the dynamics between a pair of nodes in a given network. the signal x(t) is injected into the network until t = 3. the signal at each time instant in the destination y(t) corresponds to a linear combination of the input signal and the coefficients h(n) given by the probability of transition for walks of varying lengths between the source and destination. if a signal is injected into a network from a given source node i, the activation of each node at time t implied by the diffusion dynamics can be represented in terms of the system state vector (da fontoura costa, 2008) (4)y(t)=(y1(t),y2(t),,yn(t)) where yj(t) represents the state of the node j at the time t. given the state of a network at time t, the subsequent state can be calculated by (5)y(t+1)=sy(t)+s(t) where s(t)=(s1(t),s2(t),,sn(t)) is the vector representing the forcing signal injected at each node i. note that in the case where only one node i receives activation at each time t, we have si(t) = 1, while all the other elements of s are equal to zero. the forcing signal x injected into the network is assumed to have length l and be composed of elements which are equal to zero or one. at each time step, one element of this vector is injected into the source node i, i.e. si(t) = x(t). thus, by considering this dynamics, signals are diffused, distributed and intermixed along the network. more specifically, the signal arriving at a node j after t time steps is a linear combination of the original signal values after undergoing all possible delays (smaller or equal to t) and combinations along the portion of the network comprised between the source and destination nodes, i.e. (6)yj(t)=h(0)x(t)+h(1)x(t1)+ +h(t)x(0) where yj(t) is the activation of the node j at the time t and the elements h(n) represent the probability of transition between the source i and the destination j, considering all random walks of length t between the source and destination. 6 corresponds to a fir filtering structure, such as that illustrated in figure 1. indeed, this equation is equivalent to the convolution between the injected signal and the finite impulse response sequence h of a digital filter considering some initial period of time. therefore, the dynamic of signal transmission between each pair of nodes i and j is effectively summarized, for a given finite period of time, by the respective fir structure, which is completely specified in terms of the coefficients of h, respectively given by eq. 2. thus, the coefficients defining the fir structure are fully specified by the transition matrix describing the diffusion dynamics for each specific network topology. the z - transform converts a discrete time - domain signal, which is a sequence of real or complex numbers, into a complex domain representation. the z - transform is closely related to the laplace transform, from which it can be obtained through the variable change z = e (mcclellan., the z - transform is also related to the fourier transform. given a discrete time signal x(t), its z - transform is defined as corresponding to the following series (sirovich, 1988), (7)x(z)=n=0lx(n)zn we can recover x(t) from x(z) by extracting the coefficient of the n - th power of z and placing that coefficient in the t - th position in the sequence x(t). note that the inverse z - transform may not be unique unless its region of convergence is specified. the inverse z - transform can be computed using the contour integral (mcclellan., 2002) (8)x(n)=12jcx(z)zn1dz among the main features of the z - transform that facilitate the analysis of linear systems we have : (i) linearity, (ii) delay representation, and (iii) the convolution property. in the case of the cortical networks, the fir representation makes it clear how the existence of several paths of different lengths between the source and destination nodes, by defining distinct transition probabilities, completely specifies the functionality of the fir as well as of the respective cortical network (rodrigues and da fontoura costa, 2009). the convolution property is fundamental in fir analysis, since it can be easily calculated by a simple multiplication in the transformed space, i.e. (9)y(t)=h(t) x(t)y(z)=h(z)x(z) where h(t) is the impulse response sequence of a digital filter. as the z - transform of a time - delay function (t p) is known to be z, we have that the system function h(z) (i.e. the z - transform of the finite impulse response) for the network modeled as a fir structure is given as (10)h(z)=n=0h(n)zn where is the fir size and h(n) represents the probability of transition between the source and the destination for walks of length n, i.e. the elements of hn = s. figure 2 illustrates the dynamics in a network as modeled by the fir approach. example of fir modeling of the dynamics between a pair of nodes in the network (a). the signal x=(1,0,1,0) is injected into the red node and the output is observed at the yellow node along the first 8 time steps. the output, y=(0,0,0.111,0.166,0.216,0.166,0.104,0), can be obtained by considering the fir structure, as illustrated in (b). mathematically, the numerator of h(z) has m roots (corresponding to the zeros of h) and the denominator has q roots (corresponding to poles). the roots and poles of the system function h(z) determine it to within a constant. in particular, as the fir always have multiple poles at zero, the system is always stable (mcclellan., 2002). the poles are the values of z at which h(z) is undefined (infinite). the transfer function can be written in terms of poles and zeros (11)h(z)=(1q1z1)(1q2z1)(1qmz1)(1p1z1)(1p2z1)(1pqz1) where qn is the n - th zero and pn is the n - th pole. the zeros and poles are commonly complex and, when plotted on the complex plane (z - plane), they define the so - called pole - zero plot (see figure 5, for instance). it follows from the above results that all the intricacies of the diffuse dynamics in complex networks can be summarized in terms of the respective poles and zeroes of the system function. moreover, the frequency response of the system, as well as the respective cutoff frequencies, can be immediately obtained from the pole - zero representation. the cutoff frequency, summarizes to a great extent the overall function of the respective low- or high - pass filter. the frequency response is highly dependent of the network structure, as shown in figure 3. indeed, the mixture of signals tends to reduce the amplitude of the frequency response and therefore the cutoff frequency. the frequency response is defined as the spectrum of the output signal divided by the spectrum of the input signal (orfanidis, 1996 ; smith, 2007). observe that such formulations refer to the stationary state of the system, which is henceforth approximated by using several periods of a given input signal. the frequency response is typically characterized by the magnitude and phase of the system 's response in terms of frequency. the frequency response magnitude is given by the transfer function h(z) evaluated along the unit circle in the z - plane. in other words, the frequency response of a linear time - invariant system is equal to the fourier transform of the impulse response (smith, 2007). the input and output nodes are represented in red and yellow, respectively. in case (a), the sequence of nodes defining a chain present a low - pass filter with cutoff frequency value equal to fc = 0.18. in the case (b), the low - pass filter presents fc = 0.13. therefore, the first case leads to less intermixing of differently delayed versions of the signal, and consequently a less intense alteration of the original signal. a directed complex network, composed by a set of n nodes connected by e edges, can be represented by its adjacency matrix a, whose elements aij are equal to unity if the node j sends a connection to node i, and equal to zero otherwise. two nodes i and j are said to be adjacent or neighbors if aij 0. two non - adjacent nodes i and j can be connected through a sequence of m edges (i, n1),(n1, n2),...,(nm1, j). such a set of edges between i and j is called a walk of length m. the special case of a walk where no nodes are repeated is called a path. there are many methods for community identification and their choice depends on specific needs, e.g. accuracy against fast execution (da fontoura costa., 2007). in the current work, we considered the method based in random walks called walktrap (pons and latapy, 2005), because such approach is intrinsically related to diffusion dynamics, which also underlies our modeling approach. the characterization of the properties of a given network can be performed in terms of structural (e.g. da fontoura costa., 2007) and dynamical measurements (e.g. da fontoura costa and rodrigues, 2008). structural measurements includes, for instance, the node degree, clustering coefficient, average shortest path length and assortativity coefficient (da fontoura costa., 2007). on the other hand, dynamical measurements depend on the specific dynamic process that is being executed in the network, such as synchronization (e.g. pikovsky., 2002), random walks (e.g da fontoura costa and sporns, 2006 ; da fontoura costa and travieso, 2003), opinion formation (e.g rodrigues and da fontoura costa, 2005) and epidemic spreading (e.g newman, 2002). the structure and dynamics of complex networks as shown in the current work, the relationship between structure and function of networks can also be addressed by using signal processing approaches. signals are assumed to spread throughout the network by random walks initiating from a given source node (e.g. barber and ninham, 1970 ; giordano and nakanishi, 2005). such a dynamical process, which is inherently related to diffusion (barber and ninham, 1970), involves the progressive dissemination and intermixing of the signals along time and network space, closely reflecting the specific topology of the network. therefore, the signal arriving at a given destination node depends strongly on the structure of the portion of the network comprised between the source and destination nodes (da fontoura costa and rodrigues, 2008). it has been shown recently (rodrigues and da fontoura costa, 2009), with respect to a specific non - conservative diffusion dynamics, that such a strong interplay between network structure and dynamics can be fully modeled in terms of finite impulse response filters (firs). more specifically, the coefficients of such digital filters are given by the number of walks between the source and destination nodes. the diffusion of activations in complex networks can be obtained by considering the transition matrix s, which can be calculated from the adjacency matrix a as each element s(i, j) gives the probability of moving from the node i to node j. in this way, if a given signal is injected into a network, we can determine its diffusive propagation by repeatedly applying the transition matrix. more specifically, the probability of transition between the source and a destination at n edges of distance can be immediately obtained from the matrix similarly, the number of walks of length n between two nodes can be determined by the elements of the matrix dn = a. the above dynamics is conservative, as there is no loss in the activations (all signals in the present work are formed by zeroes and ones). on the other hand, it is also possible to adopt a decay parameter that reduces the amplitude of the received activation along time. in this case, the matrix hn, which gives the probability of transition between the source and destination nodes separated by walks of length n, is given as (3)hn=(n+1)sn where (n + 1) = (1)(n), (1) = 1 and 0 1. the coefficient can be understood as the rate of decay according to the distance from the source of signal propagation. such a dynamics, which is no longer conservative, has biological backing in the sense that sensory brain activations tend to diminish with time. in the current work, we show that the fir approach to modeling the cortical networks can easily incorporate time decay, allowing the investigation of the diffusion dynamics without and with decay. a discrete - time signal is a time series consisting of a sequence of discrete values. the process of converting a continuous - valued discrete - time signal into a digital (discrete - valued discrete - time) signal is known as quantization (orfanidis, 1996). this implies that if a given input is inserted into the system and causes a definite output, if we repeat the same process at another time, an equally delayed version of the previous output will be obtained. a linear, time - invariant system (lti) can be fully classified in terms of its finite impulse response (fir) and infinite impulse response (iir), depending on whether the inserting signal has finite or infinite duration. more specifically, given the impulse response, the output produce for any input signal can be immediately calculated in terms of the convolution between the input signal and the impulse response. a filter can be defined as any medium that can modify the signal in some way (smith, 2007). a digital filter operates on discrete - time signals by taking a sequence of values (the input signal) and producing a new discrete - time signal (the filtered output signal). the main objective underlying the current work is to model the dynamics of signal transmission and integration between pairs of nodes in terms of digital signal processing concepts (mcclellan., 2002 ; more specifically, the signal processing between pairs of nodes (source and destination of signal) is modeled as a fir digital filter structure whose coefficients correspond to the total probability of transition of walks of different lengths between the source and destination (see figure 1). this approach extends and complements a preliminary investigation assuming non - conservative diffusion dynamics, where the signals were propagated by using the adjacency, instead of transition, matrix (rodrigues and da fontoura costa, 2009). the fir model of the dynamics between a pair of nodes in a given network. the signal x(t) is injected into the network until t = 3. the signal at each time instant in the destination y(t) corresponds to a linear combination of the input signal and the coefficients h(n) given by the probability of transition for walks of varying lengths between the source and destination. if a signal is injected into a network from a given source node i, the activation of each node at time t implied by the diffusion dynamics can be represented in terms of the system state vector (da fontoura costa, 2008) (4)y(t)=(y1(t),y2(t),,yn(t)) where yj(t) represents the state of the node j at the time t. given the state of a network at time t, the subsequent state can be calculated by (5)y(t+1)=sy(t)+s(t) where s(t)=(s1(t),s2(t),,sn(t)) is the vector representing the forcing signal injected at each node i. note that in the case where only one node i receives activation at each time t, we have si(t) = 1, while all the other elements of s are equal to zero. the forcing signal x injected into the network is assumed to have length l and be composed of elements which are equal to zero or one. at each time step, one element of this vector is injected into the source node i, i.e. si(t) = x(t). thus, by considering this dynamics, signals are diffused, distributed and intermixed along the network. more specifically, the signal arriving at a node j after t time steps is a linear combination of the original signal values after undergoing all possible delays (smaller or equal to t) and combinations along the portion of the network comprised between the source and destination nodes, i.e. (6)yj(t)=h(0)x(t)+h(1)x(t1)+ +h(t)x(0) where yj(t) is the activation of the node j at the time t and the elements h(n) represent the probability of transition between the source i and the destination j, considering all random walks of length t between the source and destination. 6 corresponds to a fir filtering structure, such as that illustrated in figure 1. indeed, this equation is equivalent to the convolution between the injected signal and the finite impulse response sequence h of a digital filter considering some initial period of time. therefore, the dynamic of signal transmission between each pair of nodes i and j is effectively summarized, for a given finite period of time, by the respective fir structure, which is completely specified in terms of the coefficients of h, respectively given by eq. thus, the coefficients defining the fir structure are fully specified by the transition matrix describing the diffusion dynamics for each specific network topology. the z - transform converts a discrete time - domain signal, which is a sequence of real or complex numbers, into a complex domain representation. the z - transform is closely related to the laplace transform, from which it can be obtained through the variable change z = e (mcclellan., 2002). as a consequence, the z - transform is also related to the fourier transform. given a discrete time signal x(t), its z - transform is defined as corresponding to the following series (sirovich, 1988), (7)x(z)=n=0lx(n)zn we can recover x(t) from x(z) by extracting the coefficient of the n - th power of z and placing that coefficient in the t - th position in the sequence x(t). note that the inverse z - transform may not be unique unless its region of convergence is specified. the inverse z - transform can be computed using the contour integral (mcclellan., 2002) (8)x(n)=12jcx(z)zn1dz among the main features of the z - transform that facilitate the analysis of linear systems we have : (i) linearity, (ii) delay representation, and (iii) the convolution property. in the case of the cortical networks, the fir representation makes it clear how the existence of several paths of different lengths between the source and destination nodes, by defining distinct transition probabilities, completely specifies the functionality of the fir as well as of the respective cortical network (rodrigues and da fontoura costa, 2009). the convolution property is fundamental in fir analysis, since it can be easily calculated by a simple multiplication in the transformed space, i.e. (9)y(t)=h(t) x(t)y(z)=h(z)x(z) where h(t) is the impulse response sequence of a digital filter. as the z - transform of a time - delay function (t p) is known to be z, we have that the system function h(z) (i.e. the z - transform of the finite impulse response) for the network modeled as a fir structure is given as (10)h(z)=n=0h(n)zn where is the fir size and h(n) represents the probability of transition between the source and the destination for walks of length n, i.e. the elements of hn = s. figure 2 illustrates the dynamics in a network as modeled by the fir approach. example of fir modeling of the dynamics between a pair of nodes in the network (a). the signal x=(1,0,1,0) is injected into the red node and the output is observed at the yellow node along the first 8 time steps. the output, y=(0,0,0.111,0.166,0.216,0.166,0.104,0), can be obtained by considering the fir structure, as illustrated in (b). mathematically, the numerator of h(z) has m roots (corresponding to the zeros of h) and the denominator has q roots (corresponding to poles). the roots and poles of the system function h(z) in particular, as the fir always have multiple poles at zero, the system is always stable (mcclellan., 2002). the poles are the values of z at which h(z) is undefined (infinite). the transfer function can be written in terms of poles and zeros (11)h(z)=(1q1z1)(1q2z1)(1qmz1)(1p1z1)(1p2z1)(1pqz1) where qn is the n - th zero and pn is the n - th pole. the zeros and poles are commonly complex and, when plotted on the complex plane (z - plane), they define the so - called pole - zero plot (see figure 5, for instance). it follows from the above results that all the intricacies of the diffuse dynamics in complex networks can be summarized in terms of the respective poles and zeroes of the system function. moreover, the frequency response of the system, as well as the respective cutoff frequencies, can be immediately obtained from the pole - zero representation. the cutoff frequency, summarizes to a great extent the overall function of the respective low- or high - pass filter. the frequency response is highly dependent of the network structure, as shown in figure 3. indeed, the mixture of signals tends to reduce the amplitude of the frequency response and therefore the cutoff frequency. the frequency response is defined as the spectrum of the output signal divided by the spectrum of the input signal (orfanidis, 1996 ; smith, 2007). observe that such formulations refer to the stationary state of the system, which is henceforth approximated by using several periods of a given input signal. the frequency response is typically characterized by the magnitude and phase of the system 's response in terms of frequency. the frequency response magnitude is given by the transfer function h(z) evaluated along the unit circle in the z - plane. in other words, the frequency response of a linear time - invariant system is equal to the fourier transform of the impulse response (smith, 2007). the input and output nodes are represented in red and yellow, respectively. in case (a), the sequence of nodes defining a chain present a low - pass filter with cutoff frequency value equal to fc = 0.18. in the case (b), the low - pass filter presents fc = 0.13. therefore, the first case leads to less intermixing of differently delayed versions of the signal, and consequently a less intense alteration of the original signal. we investigate the cortical networks of macaque and cat, which contain predominantly isocortical brain regions (sporns., 2007). all data sets consist of binary matrices describing the interconnectivity between the brain regions given by inter - regional pathways. the macaque network, including 47 nodes connected by 505 links, incorporates the visual, somatosensory and motor cortical regions (felleman and van essen, 1991). (1999), and excludes the hippocampus, all thalamic regions and the thalamo - cortical pathways (sporns., 2007). the communities were identified by using the walktrap method (pons and latapy, 2005), which is founded on random walk dynamics. both cat and macaque cortical networks were split into four communities characterized by modularity (e.g newman and girvan, 2004) equal to q = 0.25 for the cat, and q = 0.28 for the macaque. the adjacency matrices of cat and macaque with the highlighted community connections are shown in figure 4. we named the communities in terms of their main functions. in the case of the cat, the identified communities are formed by the following cortical regions : the adjacency matrix of (a) cat and (b) macaque. for the cat cortical network, the colors represent the following communities : (i) black : cognitive, (ii) blue : visual, (iii) green : auditory, and (iv) red : sensory system. for the macaque, (i) black : memory, (ii) blue : visual, (iii) green : motor, and (iv) red : detection of movement. cognitive : area 20b, area 7, anterior ectosylvian sulcus, posterior part of the posterior ectosylvian gyrus, medial area 6, lateral area 5b, infralimbic medial prefrontal cortex, dorsal medial prefrontal cortex, lateral prefrontal cortex, agranular insula, granular insula, anterior cingulate cortex, posterior cingulate cortex, retrosplenial cortex, area 35 of the perirhinal cortex, area 36 of the perirhinal cortex, presubiculum, parasubiculum and postsubicular cortex, subiculum, and entorhinal cortex ; visual : area 17, area 18, area 19, posterolateral lateral suprasylvian area, posteromedial lateral suprasylvian area, anteromedial lateral, surpasylvian area, anterolateral lateral suprasylvian area, ventrolateral suprasylvian area, dorsolateral suprasylvian area, area 21a, area 21b, area 20a, and posterior suprasylvian area ; auditory : primary auditory field, secondary auditory field, anterior auditory field, posterior auditory field, ventroposterior auditory field, and temporal auditory field ; sensory system : area 3a, area 3b, area 1, area 2, second somatosensory area, fourth somatosensory area, area 4, areas 4f, 4sf and 4d ; lateral area 6, medial area 5a, lateral area 5a, medial area 5b, inner (deep) suprasylvian sulcal region of area 5, outer suprasylvian sulcal region of area 5. the communities identified in the macaque cortical network are : memory : area 35, area 36, area 46, area 5, insular cortex, area 6, area 7a, area 7b, anterior inferotemporal (dorsal), frontal eye field, insular cortex (granular), medial dorsal parietal, medial intraparietal, retroinsular cortex, superior temporal polysensory (anterior), superior temporal polysensory (posterior), tf, and th;visual : anterior inferotemporal (ventral), central inferotemporal (dorsal), central inferotemporal (ventral), posterior inferotemporal (dorsal), posterior inferotemporal (ventral), visual area 4, and ventral occipitotemporal;motor : area 1, area 2, area 3a, area 3b, area 4, secondary somatosensory area, and supplemental motor area;detection of movement : dorsal preluneate, floor of superior temporal, lateral intraparietal, medial superior temporal (dorsal), medial superior temporal (lateral), middle temporal, posterior intraparietal, parieto - occipital, visual area 1, visual area 2, visual area 3, visual area v3a, v4 transitional, and ventral intraparietal. memory : area 35, area 36, area 46, area 5, insular cortex, area 6, area 7a, area 7b, anterior inferotemporal (dorsal), frontal eye field, insular cortex (granular), medial dorsal parietal, medial intraparietal, retroinsular cortex, superior temporal polysensory (anterior), superior temporal polysensory (posterior), tf, and th ; visual : anterior inferotemporal (ventral), central inferotemporal (dorsal), central inferotemporal (ventral), posterior inferotemporal (dorsal), posterior inferotemporal (ventral), visual area 4, and ventral occipitotemporal ; motor : area 1, area 2, area 3a, area 3b, area 4, secondary somatosensory area, and supplemental motor area ; detection of movement : dorsal preluneate, floor of superior temporal, lateral intraparietal, medial superior temporal (dorsal), medial superior temporal (lateral), middle temporal, posterior intraparietal, parieto - occipital, visual area 1, visual area 2, visual area 3, visual area v3a, v4 transitional, and ventral intraparietal. we start by illustrating the several concepts of the digital signal processing approach to the cortical networks. a signal of length 20 was injected into the largest hub of the cat (posterior cingulate cortex, cgp) and macaque (visual area 4, v4) networks. such hubs were chosen for this first experiment because they tend to act as connectors between different cortical regions (sporns., 2007). the length of the signal was chosen so as to be larger than the diameter of the cortical networks, which is equal to four in both cat and macaque. figure 5 presents the zeros and poles obtained with respect to having the destination at each of the nodes in the cat and macaque, given this specific signal length, without time decay. the nodes in figure 5 are color - coded according to the respective community to which they belong. recall that the values of the zeros and poles depend only of the fir size and the network topology between the source and destination, and not of the specific content of the injected signal. though the positions of the zeroes are similar in both cat and macaque, a wider dispersion is observed for the latter case. interestingly, the zeroes found for each community tend to have similar positions in the complex plan, implying that those regions receive versions of the original signal modified in similar ways. the zeroes and poles obtained for the cat (a) and macaque (b) cortical networks. the poles is represented by. the unit radius circle is shown by the continuum line. figure 6 shows the frequency response curve (magnitude) obtained for one of the pairs of nodes of the macaque network, together with the respective zeroes, which are internal to the unit radius circle. the fact that such curves are determined by the zeroes and poles is clear from this figure, where each low valley along the frequency response is associated to a respective zero in the complex plan (i m, re). after all, by definition the zeroes are the values of z for which the system function h(z) becomes zero. the maximum magnitude along the unit circle is obtained between the two most spatially separated zeroes, at the lowest frequencies. relationship between the zeroes of the system function and the frequency response (magnitude). the balls represent the zeroes of the system function obtained from a signal transmitted between the region v4 and central inferotemporal regions, in the macaque cortical network. figure 7 shows the frequency response curves (magnitude) obtained for the previous configuration, i.e. with the signal injected at the largest hubs of each network. the frequency responses obtained for the cat (figure 7a) are remarkably similar to one another. this is to a great extent a consequence of the intense uniformity and high density of the connections characterizing this specific network. a much more varied set of curves is observed for the macaque (figure 7b), suggesting a greater diversity of cortical organization and functioning. the curves obtained for each community tend to appear clustered, reflecting their similar zeroes positions. both networks are characterized by intense low - pass filtering, revealing strong smoothing and mixing of the original signal. the frequency response without cutoff for the cat (a) and macaque (b). each line represents the frequency response of a destination node, and each color represents a different community. in order to analyze a more realistic situation, we considered a decay parameter that reduces the amplitude of the system state along time. in this case, the matrix hn, which gives the probability of transition between the source and destination separated by walks of length n, and therefore defines the coefficient of the system function h(z), is given by eq. figure 8 presents the zeroes and poles obtained for the cat and macaque after injecting a signal of length 20 into the cgp and v4 regions of cat and macaque, respectively. observe that this corresponds to the same situation as above, but now with time decay. the obtained results are similar to those obtained previously (e.g. figure 5), except that the zeroes were displaced towards the center of the complex plan. figure 9 shows the obtained frequency response curves (magnitude) for the cat and macaque cortical networks. it is clear from these curves that the time decay promotes diversity of filter action, as revealed by the more diverse curve shapes. note that the time decay makes the zeroes to move away from the unit circle towards the origin in the zero - pole plot (compare figures 5 and 8), therefore changing the respective gain magnitude. the zeroes and poles obtained for the cat (a) and macaque (b) cortical networks considering time decay = 0.25. the communities are identified by different colors. the frequency response considering cutoff = 0.25 for the cat (a) and macaque (b). each curve represents the frequency response (magnitude) of a node, while each color identifies the respective community. the outlier in figure 9b, which presents the highest magnitudes, corresponds to the central inferotemporal (dorsal) region, which happens to be connected to the input region (v4) and two other hubs, i.e. posterior inferotemporal (ventral) and anterior inferotemporal (dorsal). from each of the frequency response (magnitude) curves for generality 's sake, we assume signals being injected from all vertices of the networks (one at each simulation), instead of only from the largest hubs. figures 10 and 11 present the distribution of the cutoff frequencies without and with decay, respectively. the cutoff frequencies obtained for both the cat and macaque networks without decay are rather similar, agreeing with the similar zeroes positions identified previously. however, the cutoff frequencies obtained in presence of time decay exhibit greater diversity, which is a consequence of the displacement of the zeros inwards the unit circle. as shown in the insets of figure 11, although the shape of the cutoff distributions obtained for the cat and macaque are visually similar, only a clear power - law degree distribution has been verified only for the cat. (2009), which combines maximum - likelihood fitting methods with goodness - of - fit tests based on the kolmogorov, we used a maximum likelihood estimators for fitting the power - law distribution of the cutoff frequencies obtained for the cat and macaque networks and calculated the p - value through the kolmogorov the obtained p - value for the cat was equal to p = 0.2 and for the macaque, p = 0 (values larger than 0.05 indicates a power - law distribution). thus, while the cat cortical networks present cutoff frequencies that follows a power law (p(x) x) with coefficient = 3.72), the macaque does not present such feature. in fact, we tested other distributions, including exponential, log - normal, stretched exponential, and power law with cutoff, and none of the revealed to be a suitable fitting to the distribution of the cutoff frequencies of the macaque. though the macaque and cortical networks differ with respect to the distribution of the cutoff frequencies, both networks present a high variability in the cutoff frequency values. more specifically, most nodes present small cutoffs, while a few of the present high cutoffs. therefore, the majority of the cortical areas receive signals with a high degree of modification. the inset represents the zoom of the region that concentrates the greatest part of the distribution. the distribution of the cutoff frequencies for the cat and macaque in presence of decay with = 0.25. the insets show the respective log log curves. in order to perform a more detailed analysis of the cutoff frequencies characterizing each community, we determined their cumulative distribution in the macaque and cat networks. several simulations were performed while injecting signals from all nodes in the network and monitoring the response for nodes inside each community. figure 12a shows the cumulative distributions of cutoff frequencies obtained for the cat cortical network with respect to each community, considering time decay (the situation without decay is not discussed here because of its uniform response). the signals arriving at the sensory system, which include the somatosensory areas, are heavily filtered, indicating greater respective modifications and blending of differently delayed versions of the original signal. this suggests that signals coming from sensory modalities such as touch, temperature, proprioception (body position), and nociception (pain) are strongly intermixed, eliminating higher frequencies. the community involved in cognition, which includes the ectosylvian gyrus, prefrontal cortex, insula, cingulate cortex, perirhinal cortex and entorhinal cortex also presents small cutoff frequency and therefore receives strongly mixed versions of the original signal. on the other hand, communities 2 and 3, involved in perception of complex motion (rudolph and pasternak, 1996) and representing the auditory field, respectively, tend to receive signals with the overall smallest modifications, and therefore smallest degrees of modifications and blending. the cumulative distribution of the cutoff frequencies for the cat (a) and macaque (b) communities considering time decay with = 0.25. in the case of the macaque cortical network, shown in figure 12b, the visual community, representing the inferotemporal and ventral occipitotemporal areas, receives signals with the lowest level of changes, with the highest cutoff frequencies. the inferotemporal area is thought to be the final visual area in the ventral stream of cortical areas responsible for object recognition (tanaka, 1996). the same effect is observed in the occipitotemporal cortical areas of the macaque, which are known to be important for normal object recognition and for selective attention (walsh and perrett, 1994). on the other hand, the motor area community, i.e. motor and somatosensory areas, which are highly integrated one another (kaas, 2004), tends to receive highly modified versions of the original signal. the movement detection community, which incorporates the somatosensory cortex, perirhinal cortex, insular cortex, parietal cortex, intraparietal cortex, polysensory and frontal eye field, also receives signals with high levels of alterations and intermixing. in addition to the analysis of signal transmissions and intermixing with respect to communities, we can also systematically investigate the transmission of signals between different cortical areas. the cutoff frequencies were determine between all pairs of nodes in the cat and macaque networks. we determined the 20 connections that result in the highest cutoff frequencies for the cat and macaque cortical networks, therefore corresponding to the smallest levels of signal alternations and intermixing. table 1 presents the input and output nodes, as well as the respective communities that they are included, yielding the highest cutoff frequencies among all combinations of nodes for the cat cortical network. the suprasylvian area (localized in the visual community) is the dominant motion - processing region of the parietal cortex (shen., 2006), being sensitive to texture and the distance between edges defined by motion (robitaille., 2008). areas in the cognitive community are involved in cognitive performance (infralimbic medial prefrontal cortex (van aerde., 2008)), specific roles in the cognitive functions and pathological deficits of the hippocampal formation (subiculum area de la prida., 2006), as well as spatial memory which helps to reduce errors when navigating in the dark (retrosplenial cortex cooper., 2001). the highest cutoffs are therefore observed for transmissions between regions involved mainly in visual, cognitive and audio processing. the 20 connections with the highest cutoffs (cf) in the cat cortical network. table 2 shows the 20 connections that result in the highest cutoff frequencies for the macaque cortical network. areas in communities 1 and 2, which include the visual, occipitotemporal and inferotemporal areas, are involved in image processing and object detection and recognition (dicarlo and maunsell, 2003 ; felleman., for instance, the posterior intraparietal area is involved in visually guided, object - related and hand movements (shikata., 2003). the ventral posterior areas are also related to visual processing. at the same time, areas in memory community participate in object recognition and memory (e.g. the insular cortex (bermudez - rattoni., 2005)). therefore, interconnections between visual processing - related regions in the macaque cortex tend be characterized by the smallest low - pass filtering modifications. this fact is related to a relatively small mixture of signals between the source and visual reals. a given cortical region presents a high cutoff frequency because there are little alterations of signals going from the source to such region. therefore, the more independent the walks between the source and destination, higher the frequency cutoff. the 20 connections with the highest cutoffs (cf) in the macaque cortical network. the relationship between brain organization and function corresponds to one of the most fundamental and challenging issues in neuroscience currently., 2008 ; zhou., 2006, 2007), have been extensively considered in order to investigate the structure - function paradigm in the brain. for instance, it has been observed that the onset of epileptic seizures can be induced by addition of random connections that tend to decrease the small - world character of the brain (e.g. nadkarni and jung, 2003 ; percha., 2005). in the current work, we described a methodology to investigate diffusive signal propagation and blending between pairs of areas in cortical networks in terms of digital signal processing concepts and methods. under these assumptions, the whole dynamics of brain propagation between each pair of nodes (source and destination) can be described by the convolution between the input signal and the probabilities of transition for walks of different lengths between the respective source and destination, a processing which can be neatly summarized in terms of finite - impulse - response filters (firs). we applied the z - transform in order to effectively perform these convolutions in terms of products. this approach also paves the way to the recovery, under certain conditions, of the original signal given the respective fir structure. in addition, the z - transform approach allows the identification of the zeroes and poles of the system function (the z - transform of the finite impulse response). this is important because the zeroes and poles define completely the system response, and therefore can be used for the characterization of the functionalities implemented by the diffusion in the respective cortical topologies. the obtained dynamics for the cat and macaque cortical networks was found to correspond to low - pass filtering, which tends to attenuate high - frequency harmonic components and allow the lower frequency components to pass with little or no alteration. in this way, the signal alterations undergone between the source and destination node can be summarized in terms of their respective fir cutoff frequency. by analyzing signals received at each community, it was found that the areas involved in object recognition tended to suffer the smallest modifications in both the cat and macaque networks. in addition, in the cat, the areas related to sound processing were also verified to receive signals with smaller modifications than the other regions. the extension of the current work to other cortical networks, such as human and rat, is immediate. in addition, it would be interesting to investigate how failures and attacks to the original networks induce changes in the respective filtering. the validation of the proposed approach involves monitoring several specific brain regions while a known input is fed into a giver region. for instance, a known stimulus can be applied in the auditory system of a macaque and be measured at different brain regions by electrode insertion. a comparison between the input and output signals in such experiments could be used to validate our theory. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. | this work reports a digital signal processing approach to representing and modeling transmission and combination of signals in cortical networks. the signal dynamics is modeled in terms of diffusion, which allows the information processing undergone between any pair of nodes to be fully characterized in terms of a finite impulse response (fir) filter. diffusion without and with time decay are investigated. all filters underlying the cat and macaque cortical organization are found to be of low - pass nature, allowing the cortical signal processing to be summarized in terms of the respective cutoff frequencies (a high cutoff frequency meaning little alteration of signals through their intermixing). several findings are reported and discussed, including the fact that the incorporation of temporal activity decay tends to provide more diversified cutoff frequencies. different filtering intensity is observed for each community in those networks. in addition, the brain regions involved in object recognition tend to present the highest cutoff frequencies for both the cat and macaque networks. |
proteostasis represents the functional balance of the proteome, which is permanently challenged by environmental stress and alterations in physiology. a decline in proteostasis leads to progressive aggregation of misfolded proteins, overwhelming the cellular protein quality control (pqc) networks. the maintenance of pqc mechanisms provided by molecular chaperones and proteolytic pathways is not only a long - term challenge for individual cells but also for the entire organism, given that damaged proteins dramatically accumulate with progressive aging (lpez - otn., 2013). the quality - control e3 ubiquitin ligase chip acts along with molecular chaperones and degradation machineries to keep the cellular balance between protein folding and degradation (arndt., 2007, connell., 2001, cyr., 2002, murata., 2003). chip provokes the ubiquitylation of damaged proteins consigned by chaperone partners to induce disposal through endocytic - lysosomal pathways (okiyoneda., 2010, 2012), proteasomal degradation (connell., 2001, cyr., 2002, murata., 2003), and autophagy (arndt., 2010). in agreement with its role in protein quality control, chip prevents an age - related pathologic accumulation of protein aggregates (connell., 2001, petrucelli., 2004). surprisingly, however, chip deletion mice exhibit normal embryonic development and unaffected turnover of many known chip substrates, suggesting functional redundancy among quality - control ubiquitin ligases (min., 2008,, chip deficiency accelerates aging (min., 2008), which points to the existence of at least one critical chip - specific substrate that controls longevity. however, the mechanistic link between proteostasis decline and aging has remained unexplained so far. insulin and insulin - like growth factor 1 (igf1) signaling (iis) represents an evolutionarily conserved pathway that senses nutrient supply and determines longevity in multicellular organisms (barbieri., 2003). reduced insulin signaling extends lifespan and improves proteotoxic stress resistance via the activation of multiple transcription factors (cohen., 2010, daf-2 has been identified as a membrane bound receptor regulating the iis pathway in caenorhabditis elegans. mechanistically, downregulation of daf-2 function activates the foxo transcription factor daf-16, causing dramatic lifespan extension (kenyon., 1993). besides extensive genetic analyses of the iis pathway, however, the impact of daf-2 protein level regulation on aging has not been addressed. here we identify a degradation pathway that controls the level of active daf-2/insr in c. elegans, drosophila melanogaster, and human cells. the key regulator of this conserved mechanism is the ubiquitin ligase chip, which fine - tunes iis via monoubiquitylation and subsequent endocytic - lysosomal degradation of the insulin receptor. upon proteotoxic stress and during aging, however, chip is preferentially shuttled towards quality - control pathways for degradation of damaged proteins, causing a stabilization of the insr. accordingly, proteotoxic accumulation of damaged proteins or aberrant chip function attenuates insr degradation and affects metabolism and longevity through increased iis. in conclusion, our results demonstrate a competition between proteostasis and lifespan regulation through chip - assisted proteolysis, providing an evolutionarily conserved concept for understanding the impact of proteome imbalance on aging. to obtain insight into the physiological function of chip, we examined its role in aging, using c. elegans as a model organism. interestingly, the loss - of - function alleles chn-1(by155) and chn-1(tm2692), both lacking the single chip worm ortholog chn-1, showed reduced lifespan (figures 1a and s1a ; table s1). the short lifespan phenotype of both deletion mutants was also recapitulated by rnai depletion of chn-1 (figure s1b ; table s1). chn-1(by155) worms exhibited reduced body size, which often reflects limited nutrient uptake (figure 1b). therefore, we investigated the effect of chn-1 depletion in context of the well - established longevity pathway triggered by dietary restriction (dr). dr can be reproduced genetically by using eat-2(ad465) mutants, which exhibit reduced pharyngeal pumping rates, causing lower food intake, smaller body size, and extended lifespan (lakowski and hekimi, 1998). however, deletion of chn-1 only partially shortened the lifespan of eat-2(ad465) mutant worms, suggesting that chn-1 acts parallel to dr in a different longevity pathway (figure 1c ; table s1). iis is well known to regulate both lifespan and metabolism in c. elegans (perez and van gilst, 2008). hence, the phenotypes we observed in the chn-1 deletion mutants could also be linked to this conserved signaling pathway (kimura., 1997). reduced activity of the daf-2/insr mobilizes the downstream foxo transcription factor daf-16, resulting in enhanced metabolism and extended lifespan of nematodes (lin., 2001, ogg., 1997). nuclear localization of daf-16 can be triggered by its overexpression to support transcriptional activity and longevity (henderson and johnson, 2001). in fact, transgenically expressed daf-16::gfp was able to suppress both chn-1(by155) and chn-1(tm2692) deletion mutants and extended lifespan (figures 1d and 1e ; table s1). conversely, short lifespan caused by rnai - mediated downregulation of daf-16 was not further reduced by chn-1 deletion. the combined depletion of both genes rather resulted in almost identical lifespan curves, suggesting an epistatic relationship (figure 1f ; table s1). in light of this genetic interaction, we further monitored daf-16 nuclear localization as visual readout to test whether insulin signaling is increased in the absence of chn-1. in fact, localization of daf-16::gfp into the nucleus was delayed in the chn-1(by155) deletion mutant (figures 1 g and s1c ; table s2), whereas it was enhanced by transgenic overexpression of chn-1::flag (figures 1 g, s1c, and s2a ; table s2). we wondered whether the reduced lifespan and daf-16 mobility of chn-1 deletion worms might reflect reduced transcriptional activity of daf-16. recent studies identified several target genes of daf-16 important for lifespan regulation (lee., 2003). following mrna expression levels by real - time pcr, we identified reduced amounts of sod-3 and sip-1 mrnas in worms lacking chn-1, similar to daf-16 loss - of - function, suggesting that chn-1 is important for efficient activation of daf-16 (figure 1h). given the evolutionarily conserved function of insulin signaling (barbieri., 2003), we wondered whether chip depletion provides similar short - lived phenotypes in d. melanogaster. in fact, rnai - mediated downregulation of drosophila chip (dchip) strongly reduced the lifespan of flies (figure 1i ; table s1). whereas the reduction of chn-1 and dchip levels diminished longevity, overexpression did not enhance lifespan of worms and was even toxic in flies (figures s2a s2d ; table s1). overexpression of the chaperone - associated ubiquitin ligase might cause an excessive routing of chaperone clients onto degradation pathways and might lead to non - physiological changes of the chaperone network given the hsf-1 regulating activity of chip (dai. lifespan regulation critically depends on iis signaling, which is activated upon ligand binding to the insr at the plasma membrane and involves a cascade of intracellular phosphorylation events (van der horst and burgering, 2007). given the impact of chip depletion on lifespan regulation and genetic correlation with iis, we wondered whether any of the iis downstream targets are regulated by chip - mediated degradation. in fact, depletion of chip did not influence the protein level of pdk1, akt, or mtor ; also, the level of the chaperone hsp90 remained unchanged in human embryonic kidney (hek293) cells (figure s2e). however, it increased akt kinase phosphorylation in flies (s505, p - akt) and human cells (s473, p - akt) (figures 1j and 1k), providing further evidence for increased insulin signaling upon depletion of chip (su., 2011). collectively, these results suggest that chip provides a conserved role in the regulation of iis activity. given our genetic epistasis data placing chn-1 function upstream of daf-2, we performed western blot analysis to monitor the daf-2 protein level in vivo (figure s2f). intriguingly, daf-2 abundance increased specifically later in life and was significantly enhanced in chn-1(by155) mutants especially at day 10 of adulthood (figures 2a and 2b). given that chn-1 teams up with the related ubiquitin ligase ufd-2 in another degradation pathway regulating turnover of the myosin chaperone unc-45 (hoppe., 2004), we tested whether ufd-2 would be additionally involved in daf-2 regulation. loss - of - function ufd-2(tm1380) mutants displayed reduced unc-45 turnover (figure 2c). importantly, however, in contrast to chn-1(by155), ufd-2(tm1380) mutants did not exhibit a stabilization of daf-2 (figure 2c). to rule out unspecific consequences of chn-1 depletion on overall protein turnover, we compared the total amount of ubiquitylated proteins in wild - type and chn-1(by155) mutant worms at days 1 and 10 of adulthood. since there was no increase of ubiquitylated proteins detected in worm lysates lacking chn-1 (figure 2d), the stabilization of daf-2 suggests a substrate - specific role of chn-1 in iis regulation rather than a general defect in ubiquitin - dependent protein degradation. in flies, the observed induction of akt kinase phosphorylation upon loss of dchip was also accompanied by an increase of the dinsr level (figures 1j and 2e). in agreement with increased insulin signaling activity, the stabilized receptor did not accumulate in detergent - insoluble aggregates (figure 2f). finally, depletion of human chip in hek293 cells resulted in a significant increase in the protein amount of human insr, whereas transcript levels remained unchanged (figure 2 g). conversely, overexpression of chip caused reduced protein levels of insr (figure 2h). these data demonstrate that chip plays a conserved role in limiting insr levels. regarding the correlation between chn-1 and daf-2 protein levels indeed, we found that flag - tagged chn-1 binds daf-2 in immunoprecipitation assays by using lysates of transgenic worms expressing chn-1::flag (figures 3a, 3b, and s3a). intriguingly, the interaction was most obvious at day 10 of adulthood, which correlates with the timing of daf-2 protein level increase in worms lacking chn-1 (figures 2a and 2b). this interaction is evolutionarily conserved given that we also detected binding between the insr and chip in human cell lysates (figure 3c). regarding the direct interaction, we tested whether the insr is a target for chip ligase activity and performed in vitro ubiquitylation assays with recombinantly expressed proteins. indeed, we detected efficient ubiquitylation of daf-2, dinsr, or insr either by chn-1, dchip, or human chip, respectively (figures 3d3 g). this reaction was completely blocked by a h218q point mutation within the conserved u - box domain of chn-1, essential for e3 ligase catalytic activity (u - box), or complete deletion of the entire domain (u - box) (figures 3d, s3b, and s3c) (rosser., 2007). the amino - terminal tetratricopeptide repeat (tpr) domain of chip mediates interaction with hsp70 and hsp90, and is required for the intrinsic ability of chip to recognize substrate proteins (rosser., 2007). mutation of the tpr domain also inhibited receptor ubiquitylation, revealing that the domain contributes to the direct recognition of insr by chip in the chaperone - free reaction (figures s3c and s3d). in contrast to the role of chn-1/chip, daf-2 was not modified by the related ubiquitin ligases ufd-2 (hoppe., 2004) or wwp-1, a hect domain protein implicated in control of dr - dependent longevity (figures 3d and s3b s3d) (carrano., 2009). different lysine (k) residues of ubiquitin are used for isopeptide bond formation between single ubiquitin molecules to form polyubiquitin chains with distinct linkages (komander and rape, 2012). regardless of the use of wild - type (ub) or a mutant form of ubiquitin without lysines (ub), we obtained a similar pattern of ubiquitylation on daf-2 or the insr in our defined in vitro studies, indicating that chn-1/chip mediates multiple monoubiquitylation of the insr rather than polyubiquitylation (figures 3f and 3 g). these experiments suggest a conserved role of chip in monoubiquitylation of the insr in worms, flies, and human cells. the lysine residues that are ubiquitylated were identified by mass spectrometric analyses of modified daf-2/insr obtained from independent in vitro experiments. k1047 was preferentially used for insr ubiquitylation in vitro and clusters with the additional conserved conjugation site k1057 (figure s3e). in support of our findings, recent proteomic studies also identified k1047 as a major residue targeted for receptor ubiquitylation in human cells (kim., 2011). in contrast to the insr, chip is not able to ubiquitylate the insulin - like growth factor receptor 1 (igf1r) (figure 3h). together, these findings highlight the substrate - specific role of chip in insr degradation both in vitro and in vivo. notably, proteasomal inhibition by mg132 did not affect insr stability in hek293 cells (figure 4a). in contrast, the amount of insr increased upon treatment of human cells with the lysosomal inhibitors bafilomycin a1 (bafa1) and chloroquine, or a dynamin inhibitor that blocks endocytosis (figure 4a). moreover, dynamin inhibition reversed the reduced insr level boosted by chip overexpression (figure 4b). these findings would be consistent with an endocytic - lysosomal or autophagic degradation pathway for insr. to distinguish between these possibilities, we depleted the essential autophagy factor atg7 from human hek293 cells by sirna and monitored insr level (komatsu., efficient depletion of atg7 significantly inhibited autophagy, as evident from p62 accumulation and reduced levels of lipidated lc3 (lc3-ii) (figure 4c). yet, atg7 depletion did not affect insr stability, thus excluding a critical contribution of autophagy to insr degradation. importantly, the chip - targeted lysine k1047 of the insr is crucial for receptor degradation in human cells given that the conservative k1047r amino acid substitution stabilized the insr to the same extent as inhibition of lysosomal degradation by chloroquine treatment (figures 4d, 4e, and s3e). taken together, our data reveal an endocytic and lysosomal pathway for insr turnover initiated by chip - dependent monoubiquitylation. we further assessed the physiological relevance of the ubiquitin ligase activity by expressing wild - type and mutated variants of chn-1 in the chn-1(by155) deletion strain. unlike wild - type chn-1, the catalytically inactive chn-1(u - box) mutant defective in daf-2 ubiquitylation was not able to rescue the shortened lifespan phenotype of chn-1(by155) worms (figures 5a, 5b, and s3a). this result supports the idea that chn-1-dependent ubiquitylation of daf-2 is tightly linked to regulation of longevity. to further clarify whether the level of daf-2 strictly correlates with lifespan, we analyzed its protein amount in different c. elegans daf-2 mutant alleles (figure 5c) (kimura., 1997, malone and thomas, 1994, patel. the hypomorphic daf-2(e1368) mutant promotes longevity and is able to extend the short lifespan of chn-1-deficient worms (figure 5d). this genetic suppression further supports the idea that the shortened lifespan of chn-1 depletion is caused by daf-2 stabilization (figures 2a and 2b). in contrast to e979 and e1391 temperature - sensitive mutant proteins, the daf-2 protein amount is elevated at day 5 of adulthood (figure 5c). when combined with chn-1(by155), daf-2(e1368) lifespan was slightly reduced, which is in line with further increase of daf-2 level in the chn-1(by155) mutant background (figures 5d and 5e). contrary to all other long - lived loss - of - function alleles, the daf-2(gk390525) allele (thompson., 2013, bulger., 2017) displayed increased daf-2 level already at day 1 of adulthood and shortened lifespan (figures 5c and 5f). intriguingly, daf-2(gk390525) harbors a single point mutation in k1614e, one of the lysine residues in daf-2 targeted for chn-1-dependent ubiquitylation (figures 3d and s3e). thus, defective ubiquitylation seems to result in an elevated daf-2 protein level and premature aging. indeed, the reduced lifespan of daf-2(gk390525) worms can be extended again by rnai - mediated depletion of daf-2 (figure 5 g). moreover, the daf-2 level was not further increased and lifespan of daf-2(gk390525) is not more diminished when combined with the chn-1(by155) mutation, again highlighting the substrate - specific role of chn-1 in daf-2 ubiquitylation and turnover (figures 5h, 5i, and s4a). these observations further indicate that chn-1-mediated ubiquitylation regulates daf-2 stability, insulin signaling, and longevity. to address the physiological relevance of chn-1/chip - dependent insr degradation, chn-1 was downregulated either during larval development of worms or from day 1 of adulthood onward. it turned out that chn-1 is most important in adult life because its depletion specifically shortened life expectancy when applied post - developmentally (figures s5a and s5b). chn-1 mutants are sensitive to heat stress, which might be linked to the age - related decline in proteostasis known to cause high abundance of misfolded proteins (figure s5c) (murata., 2003, walther., 2015) in contrast to molecular chaperones, chn-1 levels remained unchanged during aging and were not upregulated in response to different proteotoxic conditions (figures 2a and s5d). a decline in proteostasis would thus redirect chn-1 activity toward degradation of misfolded proteins and limit monoubiquitylation of daf-2. indeed, worms shifted to high temperature at the beginning of adulthood (d1) showed elevated levels of daf-2 protein similar to those of chn-1 lacking mutants grown at normal conditions (figures 2a, 6a, and 6b). in line with a central role in proteostasis, depletion of chn-1/dchip in worms and flies caused high sensitivity to oxidative stress induced by paraquat treatment (figures 6c and 6d). moreover, in flies and human cells we also detected elevated level of the insr upon oxidative stress (figures 6e and 6f). this increase most likely reflects reduced receptor turnover caused by limited disposability of chip under proteotoxic stress. in support of this hypothesis, insr levels could be restored in paraquat - treated human cells by overexpression of chip (figure 6f). thus, ubiquitin ligase activity of chip seems to be limited under proteotoxic stress conditions. in addition, we also tested the impact of canavanine on dinsr stability in flies. incorporation of this non - proteinogenic amino acid leads to aberrantly folded polypeptides and increased proteotoxicity (dasuri., 2011, rosenthal., similar to increased oxidative stress, canavanine treatment strongly stabilized dinsr, providing additional support for the correlation between proteotoxic stress and insr stability (figure s5e). the age - related collapse of proteostasis networks often induces aggregation of damaged and metastable proteins (lpez - otn., 2013, walther., 2015). by transgenic expression of aggregation - prone fluorescently tagged polyglutamine (polyq) expansions in intestinal and muscle cells (morley., 2002, mohri - shiomi and garsin, 2008), we found that acute depletion of chn-1 by rnai caused early - onset protein aggregation and cellular toxicity in c. elegans (figures 6 g and s5f). this observation is in line with recent findings (kalia., 2011,, 2013, min., 2008, rosser., 2007), reflecting an important role of chip in maintenance of the cellular proteome. we next addressed the role of chip in protein aggregation by using human cells expressing an extended polyglutamine repeat sequence fused to gfp (polyq103-gfp). polyq103-gfp formed large, intracellular inclusion bodies that efficiently recruited cytosolic chip (figure 6h). the recruitment toward protein aggregates diminished the pool of chip throughout the cytosol, which did not affect the amount of igf1r, but specifically led to a strong increase of insr level (figure 6i). the observed increase could be attributed to reduced insr turnover by monitoring the mrna to protein ratio (figure s5 our findings illustrate that chip integrates proteolysis of damaged proteins, which accumulate under proteotoxic stress conditions or during aging, with regulation of insr turnover and iis activity (figure 7). this study uncovered a balanced crosstalk between proteostasis maintenance and longevity, which paves the way toward understanding how proteome instability contributes to aging. a central node of this conserved mechanism is the quality - control e3 ubiquitin ligase chip, which tightly cooperates with the molecular chaperones hsp70 and hsp90 in the degradation of damaged proteins (arndt., 2007, connell., 2001, cyr., 2002, murata., 2003, we demonstrate here that chip mediates ubiquitin - dependent degradation of the insr and thereby modulates insulin signaling and longevity. chip ubiquitylated the insr in vitro in the absence of its partner chaperones, pointing to a specific and direct recognition of the receptor, distinct from the reported role in chaperone - dependent processing of misfolded proteins (zhang., 2005, the substrate specificity of the observed interaction is further highlighted by the fact that chip does not ubiquitylate or induce the degradation of the closely related igf1r (figures 3h, 3i, and 6i). moreover, insr ubiquitylation could not be induced by other ubiquitin ligases such as wwp-1 or ufd-2, which cooperates with chn-1/chip on muscle - specific degradation pathways. in agreement with a specific functional interplay, daf-2/insr was stabilized by chn-1/chip depletion or by mutations of daf-2/insr ubiquitylation sites utilized by chip (figures 2a, 2b, 2e, 2 g, 4e, 5c, and s3e). in all cases, receptor stabilization significantly shortened lifespan, illustrating the close interdependence of chip - mediated insr degradation and longevity regulation. in contrast to the reduced lifespan caused by chn-1 or dchip depletion, overexpression did not enhance longevity of worms and was even toxic in flies (figures s2a2d ; table s1). chip is known to modulate the proteotoxic stress response by activating the transcription factor hsf-1 (heat shock factor 1) and by reducing the level of hsp70 after heat shock (dai. thus, the rather toxic effect of elevated chip level might be caused by non - physiological changes of the chaperone network with deleterious consequences (yan. endogenous chn-1 protein amounts also remained unchanged during aging or in response to proteotoxicity (figures 2a and s5d). chn-1-dependent daf-2 turnover was also not affected by dietary interventions (figure s6a). these observations suggest an intricately balanced regulation of chn-1/chip activity to avoid excessive rerouting of chaperone substrates toward degradation. irrespective of organismal changes, however, overexpression of chip directly affected insr protein levels and compensated the stress - induced stabilization of the receptor in human cells (figures 4b and 6f). chn-1(by155) mutants were sensitive to heat stress, oxidative stress, and protein aggregation, similar to what we observed upon inactivation of chip (figures 6c, 6d, 6 g, s5c, and s5f). moreover, these proteotoxic conditions also caused elevated daf-2/insr levels (figures 6a, 6e, 6f, 6i, s5e, and s5 g). given these findings, it is intriguing to speculate that chip integrates proteolysis of damaged proteins with insr degradation to control metabolism and longevity (figure 7). accumulation of damaged proteins upon proteotoxic conditions and during aging challenges the dynamic equilibrium of quality - control networks and shuttles chip into pqc pathways to degrade damaged proteins, causing stabilization of the functional insr and consequently lifespan reduction (figure 7). from the organismal perspective, the prioritization of proteome stability is highly beneficial and ensures reproduction early in life, but this is provided at the expense of aging. chn-1 activity seems to be most important later in life (figures 2a, 2b, 6a6c, 6 g, s5a, and s5b), suggesting that other recently identified quality - control ubiquitin ligases might help to maintain proteostasis during development (fang., 2014, heck., 2010). like c. elegans and drosophila, chip - deficient mice develop normally but exhibit reduced lifespan associated with age - related pathophysiological defects (min., 2008). with regard to the conserved regulation, it is intriguing that mutations in the orthologous human gene stub1 are linked to accelerated aging (heimdal., 2014). given the importance of insulin signaling for metabolic regulation, it is also interesting that liver cells of chip - null mutant mice develop insulin resistance (kim., 2016). moreover, a single point mutation in k1095e, a lysine residue in the human insr that we identified to be ubiquitylated, is also associated with severe insulin resistance of patients suffering from diabetes (ardon., 2014, orahilly., 1991). these strong functional similarities suggest an evolutionarily conserved coordination of proteostasis and aging regulated by chip - assisted degradation. a detailed understanding of how insr degradation is adjusted to metabolic insults might lead to efficient therapies for age - related diseases, including obesity and diabetes. reagent or resourcesourceidentifierantibodiesmouse monoclonal anti - hisqiagencat # 34660rabbit polyclonal anti - daf-2this studyn / arabbit polyclonal anti - chn-1this studyn / amouse monoclonal anti - flagsigma - aldrichcat # f3165 ; rrid : ab_259529rabbit anti - unc-45gazda., 2013n / amouse monoclonal anti - alpha tubulin (clone dm 1a)sigma - aldrichcat # t9026 ; rrid : ab_477593mouse monoclonal anti - alpha tubulin (clone b-5 - 1 - 2)sigma - aldrichcat # t6074 ; rrid : ab_477582peroxidase - conjugated affinipure goat anti - mouse igg+igmjackson immuno researchcat # 115 - 035 - 003 ; rrid : ab_10015289peroxidase - conjugated affinipure mouse anti - rabbit igg+igmjackson immuno researchcat # 211 - 035 - 109 ; rrid : ab_2339150donkey anti - rabbit irdye 800cw/680li - corcat # 926 - 32223 ; rrid : ab_621845donkey anti - mouse irdye 800cw/680li - corcat # 926 - 32212 ; rrid : ab_621847mouse monoclonal anti - actinabcamcat # ab8224 ; rrid : ab_449644rabbit polyclonal anti - aktcell signalingcat # 9272 ; rrid : ab_329827rabbit monoclonal anti - phospho akt (ser473)cell signalingcat # 4060s ; rrid : ab_2315049rabbit polyclonal anti - phospho drosophila akt (ser505)cell signalingcat # 4054s ; rrid : ab_331414rabbit monoclonal anti - atg7novus biologicalscat # nbp1 - 95872 ; rrid : ab_11011190rabbit polyclonal anti - chicken iggsigma - aldrichcat # c2288 ; rrid : ab_258791rabbit polyclonal anit - chipmiliporecat # pc711 ; rrid : ab_2198058rat monoclonal anti - gfpchromotekcat # 3h9, abin398304 ; rrid : ab_10773374mouse monoclonal anti - histidine - tagseroteccat # mca1396 ; rrid : ab_322084rat monoclonal anti - hsp90abcamcat # ab13494 ; rrid : ab_300398rabbit polyclonal anti - lc3bnovus biologicalscat # nb100 - 2220 ; rrid : ab_10003146mouse monoclonal anti - p62santa cruzcat # sc-28359 ; rrid : ab_628279rabbit anti - pdk1cell signalingcat # 3062 ; rrid : ab_2236832rabbit polyclonal anti - mtorabcamcat # ab45989 ; rrid : ab_944296rabbit monoclonal anti - igf1rcell signalingcat # 9750s ; rrid : ab_10950969rabbit polyclonal anti - insrsanta cruz biotechnologycat # sc-711 ; rrid : ab_631835goat polyclonal anti - gamma tubulinsanta cruz biotechnologycat # sc-7396 ; rrid : ab_2211262rabbit polyclonal anti - stub1 (chip)abcamcat # 69451 ; rrid : ab_2198071rabbit polyclonal anti - dinsrthis studyn / abacterial and virus strainsbl21-codonplus (de3)-rilnew england biolabscat # c2530hop50cgcn / aht115cgcn / achemicals, peptides, and recombinant proteinscompletetablets edta freesigma - aldrichcat # 4693132001ubch5bboston biochemcat # e2 - 622flag::ubiquitinboston biochemcat # u-120e1 activating enzymeenzo life sciencescat # bml - uw9410 - 0050ubiquitin conjugation reaction bufferenzo life sciencescat # bml - kw9885 - 0001atp regeneration solutionenzo life sciencescat # bml - ew9810 - 0100ubiquitinsigma - aldrichcat # u6253ubk0boston biochemcat # um - nokflag m2 affinity gelsigma - aldrichcat # a22203x flag peptidesigma - aldrichcat # f4799bafilomycin a1lc - labscat # b1080chloroquine diphosphate saltsigma - aldrichcat # c6628dynamin inhibitor v-34 - 2calbiochemcat # 324414methylviologen dichloride hydratesigma - aldrichcat # 856177-cas75365 - 73 - 0mg132peptanovacat # 3175-vl - canavaninesigma - aldrichcat # c1625paraquat dichloride hydratesigma - aldrichcat # 36541ru486 (mifepristone)sigma - aldrichcat # m8046vsv::chn-1::6histhis studyn / avsv::chn-1 h218q::6histhis studyn / avsv::chn-1 u - box::6histhis studyn / avsv : chn-1 n9d, k13a, k73a::6histhis studyn / aufd-2::6histhis studyn / a6his::daf-2 c terminus (aa 1205 - 1928)this studyn / awwp-1::6histhis, 2005n / ainsr full lengththis studyn / ainsr k1047rthis studyn / adinsr (aa 1815 - 2144)this studyn / ainsr c terminus (aa 987 - 1428)this studyn / atrizolinvitrogencat # 15596026critical commercial assaysecl kitge healthcarecat # rpn2232quickchange lightning site - directed mutagenesis kitagilent technologiescat # 210519invitrap spin universal rna mini kitstrateccat # 1060100300jetprime transfection reagentpeqlabcat # 114 - 75high - capacity cdna reverse transcription kitapplied biosystemscat # 4368814brilliant iii ultra - fast sybr green qpcr master mixagilent technologiescat # 600882sso fast evagreen supermixbio - radcat # 1725201iscript cdna synthesis kitbio - radcat # 1708891rneasy mini kitqiagencat # 74104experimental models : cell lineshek293 (human embryonic kidney cells)sigma - aldrichcat # 85120602hela (epitheloid cervix carcinoma cells (female))sigma - aldrichcat # 93021013experimental models : organisms / strainsc. elegans : daf-16(m26)icgcwormbase i d : wbvar00088538c. elegans : ufd-2(tm1380)iicgcwormbase i d : wbvar00250374c. elegans : dgex80[pams66 vha-6p::q44::yfp + rol-6(su1006)]mohri - shiomi and garsin, 2008n / ac. melanogaster : uas - dchipverena arndtn / aoligonucleotidessee table s3 for primer sequencesthis studyn / asirna human chip 5qiagencat # si00081963sirna human chip 5qiagencat # si03109659sirna human atg7 1qiagencat # si04194883sirna human atg7 3qiagencat # si04231360allstars negative control sirnaqiagencat # si03650318recombinant dnapet21a - vsv::chn-1::6histhis studyn / apet21a- vsv::chn-1 h218q::6histhis studyn / apet21a- vsv::chn-1 u - box::6histhis studyn / apet21a- vsv : chn-1 n9d, k13a, k73a::6histhis studyn / apet21a - ufd-2::6histhis studyn / apt7 - 6his::daf-2 c terminus (aa 1205 - 1928)this studyn / apet21a, 2005n / apcmv - tag2b - insr full lengththis studyn / apcmv - tag2b - insr k1047rthis studyn / apetm-11-dinsr (aa 1815 - 2144)this studyn / apmal - c2-insr c terminus (aa 987 - 1428)this studyn / apegfp - polyq-25westhoff.,, 2005n / asoftware and algorithmsgraphpad prism 5graphpad softwarehttps://www.graphpad.com / scientific - software / prism / image studio 4.0li - cor bioscienceshttps://www.licor.com / bio / products / software / image_studio / excel 2013microsofthttps://products.office.com / en - us / excelxlstatxlstathttps://www.xlstat.com / en / imagej 1.48vwayne rasband (nih)https://imagej.nih.gov / ij/ further information and requests for reagents may be directed to and will be fulfilled by thorsten hoppe ([email protected]). the following strains were used in this study : bristol (n2) strain as wild - type (wt) strain, chn-1(by155)i, chn-1(tm2692)i, daf-16(mgdf47)i, daf-16(mu86)i, daf-16(m26)i, ufd-2(tm1380)ii, eat-2(ad465)ii, daf-2(e1368)iii, daf-2(e1370)iii, daf-2(m212)iii, daf-2(m596)iii, daf-2(m579)iii, daf-2(sa193)iii, daf-2(e979)iii, daf-2(e1391)iii, daf-2(m577)iii, daf-2(gk390525)iii, unc-119(ed4)iii, zis356[daf-16p::daf-16::gfp ], dgex80[pams66 vha-6p::q44::yfp + rol-6(su1006) ], rmis133[unc- 54p::q40::yfp ]. unless otherwise stated mutant strains were at least six times outcrossed against the wild - type strain to provide isogenic conditions. nematodes were grown at 20c (unless otherwise stated) on nematode growth medium (ngm) agar plates seeded with escherichia coli op50 spread over the surface as a food source (brenner, 1974). transgenic animals expressing the chn-1p::chn-1::flag were constructed by pcr amplification (table s3) of the wild - type genomic dna (567 bp chn-1 promoter and 2783 bp chn-1 genomic dna) and the unc-54 3utr (877 bp) and cloned into the pbsk vector containing the unc-119(+) marker for selection of transgenic worms. flag tag was fused to the c terminus of the gene by using the quikchange lightning site - directed mutagenesis kit (agilent technologies) (table s3). deletion of the u - box domain, mutation of the u - box (h218q), or tpr (n9d, k13a, k73a) domain was introduced by quikchange lightning site - directed mutagenesis kit (table s3). the constructs were particle bombarded into unc-119(ed4)iii mutants as described previously (praitis., 2001). unc-119(ed4) hermaphrodites was carried out using a biorad biolistic pds-1000/he with 1/4gap distance, 9 mm macrocarrier to screen distance, 28 inches of hg vacuum, and 1350 p.s.i. rupture disc. for each bombardment, 1 l of 12 g/l plasmid dna was coupled to 0.6 mg of 1.0-m microcarrier gold beads, and bombarded onto a monolayer of 10,000 unc-119(ed4) l4 and adult hermaphrodites (a-70 - 80 l pellet) placed on 90-mm ngm plates. worms were allowed to recover for 1 hr after bombardment and were then transferred onto ten 90-mm ngm plates seeded with op50 e. coli and grown at 20c. because unc-119 mutants can not form dauers, they die in the absence of food (maduro and pilgrim, 1995), making it easy to identify the non - unc rescued transformants 14 days after bombardment. from each plate containing animals rescued for the unc-119(ed4) mutation, individual transformed animals were cloned and their f1 progeny scored for presence of unc-119(ed4) mutants. homozygous stable lines were identified by the complete absence of unc-119(ed4)iii mutant progeny over several generations. heterozygous lines were identified based on the presence of three distinct classes of progeny : heterozygous transformed animals, homozygous untransformed animals, and a third class of sterile or inviable animals. to ensure that each line was the result of an independent transformation event, we retained only one transformed line from each ngm plate. transgenic strains generated in this study are as following : unc-119(ed4)iii ; hhis136[unc-119(+), chn-1p::chn-1::flag ], unc-119(ed4)iii ; hhis145[unc-119(+) ; chn-1p::chn-1(u - box)::flag ]. the following strains were used in this study : w were used as wild - type flies, dchip - rnai (vdrc stock number 10538), actin - gal4 (# bl-3954, bloomington stock center), uas - dchip (kindly provided by verena arndt, university of bonn), tigs-2 (kindly provided by scott pletscher, university of michigan). flies were maintained on standard drosophila jazz - mix instant food (fisher scientific) at 25c and 65% humidity in a 12 hr light/ 12 hr dark incubator. control flies are of the genotype actin - gal4/w. for overexpression of dchip in adult midguts uas - dchip flies expression of dchip was induced by placing flies of the same genetic background on ru486-containing (induced) or ethanol - containing (non - induced) food. for food preparation, a 25 mg / ml stock solution of ru486 (mifepristone, sigma) was made in 100% ethanol. appropriate volumes of the 25 mg / ml ru486 stock solution were diluted with water and ethanol to a final ethanol concentration of 2% to avoid ru486 precipitation. 500 l of the diluted solution with the desired concentration of ru486 was added onto the surface of standard fly food. the vials were then allowed to dry at room temperature for 2436 hr depending on the ambient humidity. for paraquat or canavanine food the indicated concentration was solved in 1 ml water and applied onto the surface of standard fly food and further processed as mentioned above. hek293 cells were cultured at 37c under 5% co2 in dulbecco s modified eagle s medium (dmem) supplemented with 10% fetal bovine serum, l - glutamine, penicillin / streptomycin (ps), sodium pyruvate and non - essential amino acids (neaa). hela cells were cultured at 37c under 5% co2 in dulbecco s modified eagles s medium (dmem) supplemented with 10% fetal bovine serum and penicillin / streptomycin (ps). in lifespan assays, first day of adulthood was defined as day 1. from day 0 on, synchronized worm populations (50 worms per plate for a total of 200 individuals per experiment) were transferred daily to fresh ngm plates seeded with op50 e. coli until egg laying ceased. for rnai based lifespan assays 50 synchronized l1 stage worms were fed with op50 e. coli or with gene - specific rnai expressing ht115 e. coli bacteria. worms were examined every day for touch - provoked movement and pharyngeal pumping, until death. animals that crawled off the plates or died owing to internal hatching of progeny or extruded organs were censored. for lifespan measurement in d. melanogaster, male flies were collected within 24 hr from eclosion and maintained at standard density (up to 30 flies per vial) on drosophila jazz - mix instant food or in case of induced expression on either ru486-containing (induced) or ethanol - containing (non - induced) food. for each genotype, at least 5 independent cohorts of flies raised at different times from at least 5 independent crosses were analyzed. the experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. rnai in c. elegans was performed using the rnai feeding method (timmons and fire, 1998). l1 or l4 larvae of wild - type worms were placed on ht115 e. coli bacteria expressing daf-2 or daf-16-specific double - stranded rna (dsrna). as wild - type control, bacteria transformed with the empty ppd129.36 vector were used as food source. for developmental or post - developmental silencing of chn-1 rnai in flies was induced by binary uas - gal4 system (brand and perrimon, 1993). relative body length of worms was measured by taking images of worms with a leica m165fc stereomicroscope (10x eye piece, 0.75 - 6.0 zoom ratio) using 50 x magnification. images were transformed to jpeg format and body length of worms was determined by drawing a line on the longitudinal axis of each worm in imagej 1.48v software. relative values of body length was calculated by using the mean body length value of at least 20 single worms of each genotype and normalizing these values against wt worms mean body length. individual day-1 adult worm was placed in 50 l m9 buffer on a microscope slide and the number of left and rightward body bends in 30 s were counted, where one leftward and one rightward bend is equal to one stroke. 100 day-1 old adult worms were transferred to small plates (35x10 mm) seeded with op50 and subjected to 35c heat shock for indicated time in water bath and immediately visualized using zeiss axio zoom.v16 microscope. worms were classified into two categories based on the extent of daf-16::gfp nuclear - cytoplasmic distribution. fluorescence and dic images of worms were taken with an axio imager z1 microscope mounted with axiocam 503 mono camera (carl zeiss), and processed with the analysis software zen 2012 sp1 (carl zeiss). hela cells were transfected with pcmv - tag2b - chip and pegfp - polyq-25 or pegfp - polyq-103 for 48 hr. cells were then washed two times with pbs, followed by fixation in 4% paraformaldehyde for 15 min. after another washing step, cells were permeabilized for 10 min in pbs containing 0.2% triton-100. cells were blocked in 3% bovine serum albumin for 30 min and afterward washed 3 times in pbs. alexa - labeled secondary antibodies (invitrogen) were used in a 1500 dilution for 1 hr. worms were washed off the plates using m9 buffer and 1 ml trizol, and silica beads (1 mm diameter) were added to the samples and homogenized by precellys tissue homogenizer. chloroform was added and samples were vortexed vigorously before phase separation through centrifugation. the aqueous phase was transferred on the qiagen rneasy mini kit and rna was isolated according to manufacturer s instructions. cdna was synthesized using the high - capacity cdna reverse transcription kit (applied biosystems). gene expression levels were determined by real - time pcr using brilliant iii ultra - fast sybr green qpcr master mix (agilent technologies) and biorad cfx96 real - time pcr detection system. relative gene expressions were normalized to act-3 (t04c12.4) and tbg-1 (f58a4.8). mrna levels. rnai isolation from hek293 cells was performed by the use of invitrap spin universal rna mini kit (stratec). cdna was synthesized from 0.5 g rna using iscript cdna synthesis kit from bio - rad. quantitative pcr (qpcr) was performed using ssofast evagreen supermix (bio - rad) with transcript levels for gapdh and beta-2-microglobulin (b2 m) being monitored as reference transcripts. the specificity of the pcr amplification was verified by melting curve analysis of the final products using bio - rad cfx 3.1 software. in each experiment three the primer sequences used in the rt pcr reactions are shown in table s3. co - immunoprecipitations were performed on sonicated lysates from wild - type or mutant c. elegans that were resuspended in ip buffer [50 mm tris ph 8.0, 100 mm nacl, 0.5 mm edta, 4% glycerol and 1% triton x-100, 2 mm pmsf and complete edta - free protease inhibitor (roche) ]. for immunoprecipitation of chn-1::flag we used anti - flag m2 affinity gel (sigma) incubated with 1 mg of worm extract for 2 hr at room temperature. the immunoprecipitates were washed with 50 mm tris ph 8.0, 50 mm nacl, eluted with 3x flag peptide (sigma) and resolved by sds - page followed by immunoblotting. to prepare drosophila protein extracts, 10 male flies per genotype were shock frozen in liquid nitrogen and grinded with a pestle until white powder remained. 200 l of ripa buffer [25 mm tris - hcl, ph 8.0, 150 mm nacl, 0.5% sodium deoxycholate, 1% nonidet p-40, 0.1% sds, 10% glycerol, complete edta - free protease inhibitor (roche) ] was added and lysates were incubated for 15 min on ice. afterward lysates were centrifuged at 16,000 g for 30 min at 4c. protein concentration of supernatant was measured by bradford protein assay (bio - rad) and 40 g protein per genotype were analyzed by sds - page and immunoblotting. for gut preparation and evaluation of akt signaling, dchip depleted flies and control flies were aged for 5 weeks respectively and 20 guts per genotype were collected in icecold pbs buffer. pbs buffer was removed and guts were resuspended in 50 l ripa for proper lysis. guts were grinded with a pestle until a homogeneous solution remained and immediately sonicated 3 20 s at 100% amplitude. gut lysates were incubated for 15 min on ice and afterward centrifuged at 8,000 g for 20 min at 4c. supernatants were collected and protein concentrations were measured by bradford protein assay (bio - rad). 30 g protein per genotype was analyzed by sds - page and immunoblotting. for monitoring dinsr protein level in paraquat and canavanine treated adult flies (3 weeks old), 20 heads each were collected in 60 l ripa buffer and prepared as described above. for differential centrifugation dchip depleted flies and control flies were aged for 5 weeks and 20 heads per genotype were lysed in 200 l ripa buffer containing 1% sds, followed by centrifugation at 3,000 g for 5 min to discard tissue debris. the supernatant was subjected to centrifugation at 100,000 g for 1 hr at 4c to separate soluble and insoluble protein fractions. the sds - insoluble pellet fraction was resuspended in 100 mm tris, ph 8, 8 m urea, sonicated three times for 20 s at 100% amplitude, and afterward boiled at 97c for 10 min. to prepare human cell extracts hek293 cells were lysed 48h after transfection in ripa and incubated for 5 min on ice. lysates were sonicated and after additional 15 min incubation on ice lysates were centrifuged at 16,000 g for 20 min at 4c. supernatants were collected, protein concentration was measured by bradford protein assay (bio - rad) and samples were analyzed by sds - page (40 g protein loaded per lane) and immunoblotting using specific antibodies. if not indicated otherwise, cells were treated with 10 m mg132 (peptanova), 200 nm bafilomycin a1 (lc - labs), 100 m chloroquine (sigma - aldrich), or 10 m dynamin inhibitor v34 - 2 (calbiochem) for 16 hr before lysis. paraquat (sigma - aldrich) treatment (20 mm) was done for 20 hr. for immunoprecipitation of insr, hek293 cells were lysed in ripa buffer without sds. after 20 min of incubation on ice, the lysate was sonicated and centrifuged at 16,000 g for 20 min at 4c. supernatant was then adjusted to a protein concentration of 10 mg / ml using mops / kcl buffer [20 mm mops - koh, ph 7.2, 100 mm kcl, complete edta - free protease inhibitor (roche) ] at a ratio 1:1 with ripa buffer. antibodies directed against insr or control antibody (rabbit anti - chicken igg, sigma) were added to a final concentration of 4 g / ml extract and incubated for 1 hr at 4c. 20 l protein g - sepharose was added and samples were incubated for an additional 1 hr at 4c. sepharose was washed six times with washing buffer (20 mm mops - koh, ph 7.2, 100 mm kcl, 0.5% tween) and 2 times with washing buffer without tween. sepharose - bound proteins were eluted using 0.1 m glycine - hcl, ph 3.5, precipitated with 10% tca (trichloroacetic acid) and resolved in sds sample buffer. co - immunoprecipitated proteins were analyzed by sds - page and immunoblotting. hek293 or hela cells were seeded at approximately 30%40% confluency and transfected 24 hr after plating. after incubation over - night, cell medium was removed and fresh medium was added to the cells. 48 hr after transfection cells were lysed either for protein extraction or rna purification. for expression of wild - type insr in hek293 cells prt3-insr - wt (addgene) was used as template for cloning full - length cdna of human insr into pcmv - tag2b vector (clonetech) (table s3). the k1047r mutation was introduced into pcmv - tag2b - insr by site - directed mutagenesis (table s3). for overexpression of chip pcmv - tag2b - chip vector was used (arndt., 2005). expression of poly - q proteins was induced by transient transfection with plasmids pegfp - polyq-25 and pegfp - polyq-103 (westhoff., 2005). for efficient depletion two different sirnas were used per gene (flexitube sirnas chip 1 + 5 and flexitube sirnas atg7 1 + 3 (qiagen)). 10 g of purified recombinant protein : his::chip, his::chn-1, his::chn-1(u - box), his::chn-1(u - box), his::(tpr)chn-1, wwp-1::his or ufd-2::his was mixed with 1 g of recombinant protein corresponding to the c terminus of human insr (amino acids 987 - 1428), dinsr (amino acids 1815 - 2144) or daf-2 (amino acids 1205 - 1928), and e1 (25 ng), e2 (ubch5b ; 400 ng), 2 g of flag::ubiquitin or lysine lacking variant (ub), energy regenerating solution (boston biochem) and ubiquitin conjugation reaction buffer (enzo life sciences). samples were incubated at 30c for 1 hr, terminated by boiling for 5 min with sds - sample buffer, and resolved by sds - page followed by immunoblotting using anti - insulin r antibody (santa cruz) to monitor ubiquitylation of insr, anti - daf-2 antibody to monitor ubiquitylation of daf-2, and anti - flag antibody (sigma) to monitor e3 ligase activity. for oxidative stress assay, survival of worms was monitored every day after transfer and scored as described for the lifespan assays. in heat shock experiments day 1 adult worms were transferred on chn-1 dsrna expressing or control empty vector expressing ht115 bacteria seeded plates and incubated at 35c in water bath for the indicated time. survival of worms was scored as described for the lifespan assays. for ubiquitous dchip depletion rnai flies were crossed to actin - gal4 driver line and collected after 2 days of adulthood and placed on 20 mm paraquat (methylviologen (sigma - aldrich)) containing food. wild - type flies were collected after 2 days of adulthood and placed on either h2o or 20 mm l - canavanine (sigma - aldrich) containing food to induce protein misfolding. kaplan and meier survival curves of the lifespan analysis and median lifespan values were calculated using graphpad prism 5 software and xlstat for excel. the log - rank (mantel cox) data obtained for changes in protein level are presented as fold change compared to the control with the control value determined in each independent experiment set to 1. statistical significance was assessed by two - tailed paired student s t test using excel software (microsoft). stress resistance assays and polyq - aggregation assays were evaluated by two - tailed paired student s t test. r.t., w.p., and e.k. designed, performed, and analyzed the experiments w.p. performed in vitro ubiquitylation assays, mass spectrometric analyses, and most final experiments for the revisions. | summaryaging is attended by a progressive decline in protein homeostasis (proteostasis), aggravating the risk for protein aggregation diseases. to understand the coordination between proteome imbalance and longevity, we addressed the mechanistic role of the quality - control ubiquitin ligase chip, which is a key regulator of proteostasis. we observed that chip deficiency leads to increased levels of the insulin receptor (insr) and reduced lifespan of worms and flies. the membrane - bound insr regulates the insulin and igf1 signaling (iis) pathway and thereby defines metabolism and aging. insr is a direct target of chip, which triggers receptor monoubiquitylation and endocytic - lysosomal turnover to promote longevity. however, upon proteotoxic stress conditions and during aging, chip is recruited toward disposal of misfolded proteins, reducing its capacity to degrade the insr. our study indicates a competitive relationship between proteostasis and longevity regulation through chip - assisted proteolysis, providing a mechanistic concept for understanding the impact of proteome imbalance on aging. |
breast tissue develops from bilateral ectodermal ridges, also known as the milk line, extending from the axilla to the inguinal region. ectopic breast tissue (ebt) occurs when there is incomplete regression of the ridges, can occur anywhere along the line and less commonly outside involving areas such as the face, neck, shoulder, chest, back, perineum and thigh region (fig. the incidence of ebt has been reported to range from 0.2 to 6%, higher in asians compared to caucasians, with the majority of cases (6070%) found in the axilla, and only 5.3% of cases in men. primary ectopic breast carcinomas (pebc) are even rarer accounting for only 0.20.6% of all breast cancers (bc). here we describe an unusual case of male axillary pebc. figure 1:possible sites of ebt. a previously fit and well 52-year - old caucasian gentleman presented to his general practitioner (gp) with bilateral skin lesions in his axilla that had been present for the last 2 years. he had a positive family history of bc, with two paternal aunts and a cousin affected. examination revealed an area of suspected keratosis located in the left axilla, with a probable pigmented nevus in the right axilla. the patient re - presented 6 months later complaining of discomfort from the lesion in the right axilla. on second examination, the nodule had increased in size from 0.5 to 1.5 cm in diameter, and was becoming marginally red and prominent. immunohistochemistry of the tumour cells returned strongly positive for e - cadherin, ck7, oestrogen receptor (er) and progesterone receptor (pr). histological examination demonstrated a 6 mm focus of invasive ductal carcinoma with narrow excisional margins (figs 2 and 3). mammogram and ultrasound scan of the breast and axilla post - surgery revealed no residual cancer. staging computed tomography examination of the thorax, abdomen and pelvis demonstrated no evidence of metastasis. figure 2:low power image demonstrating the skin surface and dermal nests of tumour completely filling the tissue. figure 3:high power image of the dermal nests of tumour showing solid islands of invasive breast carcinoma. low power image demonstrating the skin surface and dermal nests of tumour completely filling the tissue. high power image of the dermal nests of tumour showing solid islands of invasive breast carcinoma. a re - excision of the right axillary scar with a sentinel lymph node biopsy and a wide local excision of the left axillary nodule were performed. final histology of the right re - excision revealed no residual malignancy or any nodal involvement. it has been postulated that risk factors for bc may also apply for ectopic tissue. suspicious mass around the axilla can be the result of several aetiologies including benign or malignant lymphadenopathy, lymphoma or metastatic carcinoma. the two most common histological diagnoses is invasive ductal carcinoma (4070%), followed by invasive lobular carcinoma (12%), which is similar in eutopic bc. the presence of malignant cells in the excised nodule with normal surrounding breast tissue that was er and pr positive confirmed the diagnosis. to date, there are only six cases of pebc reported in males. due to its rarity and low index of suspicion especially in males, it is often not on the differential diagnoses list which leads to delayed diagnosis. it is worth noting that pebc can occur in various parts of the body and may require further investigation on the lymphatic drainage with an individualized management plan. the prognosis of pebc is contentious ; some consider it similar to bc but others argue that it has worst prognosis due to higher chance of lymph node involvement [6, 7 ]. the difficulty in diagnosis contributing to the rare incidence and lack of reporting in literature precludes detail evaluation of the management and prognosis. we have reported a rare case of pebc of the axilla in a male patient. in the presence of an enlarged axillary nodule, the possibility of pebc | primary ectopic breast carcinoma in male is very rare. we report a case on a 52-year - old gentleman who presented initially with bilateral lesions in his axilla and after delayed diagnosis the right lesion was confirmed as an ectopic breast carcinoma. we reviewed the literature and discussed the significance of the case. |
they included morning nausea, bloating, frequent flatulence, burping, occasional pyrosis, alternating diarrhea and constipation. the patient consulted a primary care physician who prescribed symptomatic treatment that resulted in temporary relief. the following treatment was prescribed : four tablets of 500 mg tinidazole (2,000 mg) taken orally in a single dose and repeated ten days later. it is a heavily under - diagnosed and as a result under - treated disease. contamination is usually indirect via water or vegetables, but can occur from dirty hands and though oro - anal sex. the only severe complication is malabsorption - a disorder only occurring in children of endemic areas. dyspeptic symptoms are often prominent and can be mistaken as stemming from viral hepatitis or peptic ulcer. diagnosis is made by parasitological stool exams showing cysts or mobile trophozoites. because there are periods when parasites are not excreted in feces, it is necessary to repeat stool exams. the most effective treatment is provided by nitroimidazole compounds such as ornidazole, tinidazole, and secnidazole. for adults, individually, prevention rests upon : i) body hygiene, particularly washing hands before eating ; ii) drinking encapsulated or boiled water ; iii) avoiding vegetables in endemic areas. collectively, prevention relies on : i) the improvement of sanitary infrastructure and water networks like sewage ; ii) the encouragement of breast feeding, particularly in urban areas ; iii) the discontinuation of human feces used as fertilizer in many asian countries. | we present the case of a 32-year - old french man who presented with morning nausea, bloating, frequent flatulence, burping, occasional pyrosis, and alternating diarrhea and constipation two weeks after a trip to morocco. the diagnosis was established by a parasitological stool exam that revealed cysts of giardia lamblia. he was successfully treated with tinidazole. |
rheumatoid arthritis (ra) is a chronic disease characterized by articular erosions, periarticular bone loss, and chronic inflammation leading to increased risk of osteoporosis. systemic bone loss associated with ra is multifactorial : glucocorticoids, decrease of physical activity, and the disease itself, particularly when uncontrolled. bone loss, whether periarticular or systemic, shares, at least partially, similar mechanisms. from the very early stages of ra, bone loss in ra joint erosions measured with larsen 's score are correlated with bone mineral density (bmd) and vertebral deformities [15 ]. relevant literature on bone remodelling markers in ra patients and the effect of biologic agents on bone remodelling were identified using pubmed database with bone remodelling markers, biologic agents, and rheumatoid arthritis as key words. among mechanisms involved in bone loss, proinflammatory cytokines play a major role in explaining hyper - osteoclastosis. the nuclear factor - kappa b (nfkappab) signaling pathway regulates the expression of hundreds of genes which are involved in diverse processes like inflammation. receptor activator of nfkappab ligand (rankl) is a membrane protein secreted by osteoblasts that binds to the rank receptor on osteoclast precursors and provokes maturation of osteoclast cells (figure 1). its natural decoy receptor osteoprotegerin (opg) produced by osteoblasts and stromal cells binds to and confines rankl and prevents differentiation of osteoclasts [7, 8 ]. various proinflammatory cytokines regulate expression of rankl including tumor necrosis factor (tnf) and interleukin-1 (il-1) [912 ]. rankl values can predict the therapeutic response to anti - tnf therapy in ra patients, which is not the case for opg, whereas opg expression is increased in synovium of anti - tnf treated patients : with both infliximab and etanercept. in contrast, rankl is not influenced by the treatment, showing that the ratio rankl / opg is of major importance in regulating bone resorption rather than each of the markers taken alone. then, it is not surprising that deleterious effects of rankl on bmd can be prevented by denosumab which is an anti - rankl monoclonal antibody, increasing bmd and reducing bone turnover in ra patients. bone formation is also decreased during inflammation as shown in mice. when dkk-1, a protein that is a member of the dickkopf family, is increased by tnfalpha, it exerts its negative regulation on wnt pathway, blocking osteoblast differentiation and inducing expression of sclerostin (scl), leading to the death of osteocytes. higher levels of dkk-1 are associated with an increased risk of articular erosions independent of age, baseline radiologic features, c - reactive protein (crp), or disease activity. interleukin-6 (il-6) directly induces the production of rankl by synoviocytes in ra patients through the pathway of janus kinase / stat, phosphorylation of stat3 and erk1/2 [19, 20 ]. bone matrix is mainly composed of type i collagen and type i collagen telopeptide fragments : i - ctx and ictp can be measured in both serum and urine. they are very sensitive and specific markers of bone degradation [21, 22 ]. these two telopeptides are released from type i bone collagen by two different enzymatic systems : (1) ictp, which is derived from matrix metalloprotease activity (mmp) and is very effective in bone erosions associated with ra, and (2) i - ctx, produced by cathepsin k which on the contrary is involved in systemic bone resorption. in ra the ratio of synovial fluid to serum fluid is increased for ictp but not for i - ctx. this suggests that ictp is a sensitive marker of periarticular bone resorption linked to mmps activity of various cells like synoviocytes. ii - ctx is not a bone remodeling marker but a marker of cartilage degradation, even if the two phenomena are closely related in ra. this is illustrated by the cobra study where high levels of i - ctx and ii - ctx measured early in ra predicted an increased risk of further articular damage. randomized clinical trials have clearly demonstrated that biological agents are able to prevent partial or even total articular erosions in ra patients. this raises the question of their ability to prevent as well the generalized bone loss associated with inflammation encountered in ra patients. this preventive effect might be demonstrated by variation of bone remodeling markers or bone mineral density (bmd) during the course of treatment. in ra patients, bone formation rather than resorption markers better showed the bone response to anti - tnfalpha. an open cohort study of 102 ra patients treated during one year with infliximab showed both the variations of bone loss at lumbar spine, hip, and hands and the variation of bone remodeling induced by the anti - tnfalpha. when bmd at lumbar spine and hip did not vary, it did incur a significant decrease of 0.8% at the hand (p = 0.01), giving evidence that metacarpal cortical bone loss is continuing. in ra treated patients with good eular response, variation of bmd was favorable compared to other patients. serum ctx and rankl hugely decreased in comparison with baseline values at the same time as the decrease of das score and crp. another multicentric and prospective cohort study included 48 women with an average age of 54.2 years (2.1 sd) suffering from severe ra for 10 years (11.4 7.8 sd) who initiated infliximab treatment after the failure of one nonbiologic agent (dmard). bmd was not modified during the year of the study but serum i - ctx rapidly and significantly decreased by 30% at the 22nd week before going back to the baseline values. inversely, pinp values remained stable with a p1np / ctx ratio in favor of bone formation. the ii - ctx, witnessing the cartilage degradation, was not modified in the study group but slightly decreased in patients with values above normal before the biologic agent. in the best study, four different therapeutic strategies have been evaluated in 218 early ra patients : (1) sequential monotherapy, (2) combined treatment step up, (3) combined treatment with glucocorticoids, and (4) treatment with infliximab. bmd was measured at lumbar spine, hip, and hands (from 2nd to 4th metacarpal) after 1 and 2 years. after 2 years for all treated groups there was a bone loss at each of these regions. it should be noted though that there was less bone loss in hands for groups treated with either prednisone or infliximab. progression of erosions was correlated with the decrease of bmd at both hand and hip regions. a search in pubmed database to identify studies analyzing the effects of anti - tnfalpha treatments on bmd and bone remodeling markers in ra patients has been able to identify four studies [2932 ] in which bmd was either stabilized or increased at lumbar spine (up to 2.8%) or at hip (up to 13.1%). variations of bone remodeling markers were heterogeneous but showed a slight decrease of resorption and an increase of bone formation. in vitro, il-6 blockade reduces osteoclastic differentiation and bone resorption in monocytes cultures stimulated by rankl or rankl plus tnfalpha. in transgenic mice, formation of osteoclasts is also strongly inhibited by the anti - inflammatory effects of il-6 blockade. a pilot study compared 22 healthy nonosteopenic control women with 22 women suffering from active ra treated by perfusions of 8 mg / kg tocilizumab (tcz). at baseline, the opg / rankl ratio was 5 times lower in ra patients than in controls. higher levels of dkk-1, sclerostin, serum betactx, and osteocalcin were seen related to a hyper remodeling status and slowing down of bone formation in ra patients. in serum, thanks to tcz, opg / rankl increase was particularly significant in 10 patients who were in remission or in a low activity state in contrast with other 12 patients with still active ra. on the other hand, variations of dkk-1 and sclerostin were similar in both groups. thus, inflammation suppression by anti - il-6 rapidly corrects bone homeostasis troubles due to ra. they were 416 of 623 patients suffering from moderate suffering from moderate to severe ra who were selected because of an inadequate response to methotrexate. methotrexate administration alone was compared to the administration of an association of methotrexate and tcz (4 mg to 8 mg / kg every 4 weeks). tcz reduced in a dose - dependent way the levels of procollagen type ii n - terminal propeptide (piinp), collagen helical peptide (helix - ii), and matrix metalloproteinase-3 (mmp-3) after 4, 16, and 24 weeks. among bone formation markers, only serum aminoterminal propeptide of type i collagen (pinp) significantly increased in comparison with placebo, when 1-ctx and ictp, markers of bone resorption, decreased. tcz increases bone formation by increasing the expression of opg when nonbiological agents have no effect. this is shown in a study of bone biopsies from subjects undergoing a prosthesis replacement of the knee. finally, tcz also decreases the levels of dickkopf and normalizes the ratio opg / rankl. in radiate study tcz decreased c - reactive protein levels and significantly inhibited cathepsin k - mediated bone resorption, as measured by a decrease in ctx - i with a significant decrease in the ctx - i / oc ratio. furthermore, the samurai study showed that tocilizumab monotherapy is more effective at one year in reducing radiological progression in patients presenting with risk factors for rapid progression than in low - risk patients according to four independent predictive markers for progressive joint damage (urinary c - terminal crosslinking telopeptide (uctx - ii), urinary pyridinoline / deoxypyridinoline (upyd / dpd) ratio, body mass index (bmi), and joint - space narrowing (jsn) score at baseline). b lymphocyte depletion obtained by using rituximab results in a decrease of resorption bone markers and inhibition of ra induced osteoclastosis ; this effect is obtained by a reduction of the number of osteoclast precursors in synovium and thus increases the ratio opg / rankl in serum and as such could protect bmd. in a prospective study with a follow - up of 315 months after rituximab therapy there was no significant change of the bone formation markers (bap) and ictp. however, a nonsignificant tendency of decrease of rankl (with no change of opg) and a significant decrease of the bone degradation marker deoxypyridinoline crosslinked collagen i were observed. ctla4-ig inhibits linking of ctla-4 with the monocyte surface receptor cd80/cd86 and could downregulate differentiation and maturation of osteoclasts acting directly on genes [44, 45 ]. ctla-4 dose - dependently inhibits rankl- as well as tumour necrosis factor- (tnf-) mediated osteoclastogenesis in vitro without the presence of t cells. furthermore, in mice, abatacept protects against bone loss induced by pth giving an explanation to the protective effect of abatacept in ra. bone loss in ra is well documented and is a frequent comorbidity needing diagnosis and prevention. bone remodeling markers are surrogates to evaluate bone formation, resorption, and further risk of fractures. so far, there is no consensus about their role in helping physicians in a clinical point of view. in addition to specific antiosteoporotic agents, when needed, biologic agents add their own nonspecific effect to protect ra patients against bone loss and osteoporotic fractures by reducing inflammatory - linked bone loss. | bone loss in rheumatoid arthritis (ra) patients results from chronic inflammation and can lead to osteoporosis and fractures. a few bone remodeling markers have been studied in ra witnessing bone formation (osteocalcin), serum aminoterminal propeptide of type i collagen (pinp), serum carboxyterminal propeptide of type i collagen (ictp), bone alkaline phosphatase (bap), osteocalcin (oc), and bone resorption : c - terminal telopeptide of type 1 collagen (i - ctx), n - terminal telopeptide of type 1 collagen (i - ntx), pyridinolines (dpd and pyd), and tartrate - resistant acid phosphatase (trap). bone resorption can be seen either in periarticular bone (demineralization and erosion) or in the total skeleton (osteoporosis). whatever the location, bone resorption results from activation of osteoclasts when the ratio between osteoprotegerin and receptor activator of nuclear factor kappa - b ligand (opg / rankl) is decreased under influence of various proinflammatory cytokines. bone remodeling markers also allow physicians to evaluate the effect of drugs used in ra like biologic agents, which reduce inflammation and exert a protecting effect on bone. we will discuss in this review changes in bone markers remodeling in patients with ra treated with biologics. |
breast cancer is by far the most frequent cancer among women with an estimated 1.38 million new cancer cases diagnosed in 2008 (23% of all cancers) and ranks second overall (10.9% of all cancers) [1, 2 ]. breast cancer is estimated to be responsible for around 458,500 female deaths in 2008 or nearly one in seven (around 14%) of all cancer deaths in women. therefore, early detection in order to improve breast cancer outcome and survival remains the cornerstone of breast cancer control. the extracellular matrix (ecm) is composed of highly variable and dynamic components that regulate cell behavior. the protein composition and physical properties of the ecm govern cell fate through biochemical and biomechanical mechanisms. this requires carefully orchestrated and thorough regulation. in breast cancer, many ecm proteins are significantly deregulated and specific matrix components promote tumor progression and metastatic spread. several ecm proteins that are associated with breast cancer development overlap substantially with a group of ecm proteins induced during the state of tissue remodeling such as mammary gland involution. understanding the regulatory role of the ecm stromal tissue is composed of supporting cells and connective tissue, comprises a large component of the local microenvironment of many epithelial cell types, and influences several fundamental aspects of cell behaviour through both tissue interactions and niche regulation. the breast mesenchyme is comprised of complex connective tissue composed of heterogeneous cell types, including fibroblasts, adipocytes, immune cells, endothelial cells, pericytes, nerve cells, and acellular matrix components, such as collagen i, collagen iii, collagen iv, proteoglycans, and glycoproteins. the mammary gland is a dynamic tissue that undergoes significant changes throughout a woman 's lifetime, especially during pregnancy and following the menopause. the development of the breast is exquisitely sensitive to interactions between the epithelium and the stroma. the formation of vascular stroma in breast carcinoma is a process that involves complex reciprocal interactions among tumour cells, endothelial cells, and stromal cells. epithelial tumours lose their tissue organisation, become differentiated, and secrete abnormal quantities of ecm in a process that resembles wound healing and that is connected to the invasive and metastatic capacity of the primary tumour. underlying these events is a process known as epithelial - mesenchymal - transition (emt) which can be activated during chronic inflammation, for example, in chronic wounds or in cancer tissues. key cellular alterations that occur during emt include the loss of cell - cell adhesions and the change in the supporting cellular polarity. these changes affect the cells ability to support collective or individual cell migration. in the emt processes, epithelial cells gain mesenchymal properties and exhibit reduced intercellular adhesion and increased motility ; they can also break through the basal membrane and migrate over long distances owing to profound changes in their cytoskeleton architecture. this review focuses on how breast cancer cells undergo changes that enable them to become motile and break free of the basement membrane in a process that can lead ultimately to metastasis. tumours can be defined by their uncontrolled and invasive growth but their phenotype is regulated in a complex fashion based on interactions of the malignant cells with the tumour stroma including the ecm, the vasculature, and the resident immune system. initially, a cell within a colony is instructed to disrupt cadherin - based intercellular junctions and acquire a fibroblastoid, motile phenotype, initiating detachment from the primary site. this is enhanced by proteases which digest the basal lamina components and facilitate cell movement through the ecm. cadherins are a family of adhesion molecules that function in cell recognition, tissue morphogenesis, and tumour suppression. normal epithelial cells depend on the formation of intercellular adhesion contacts to form a continuous sheet of stratifying cell layers that are attached to one another both horizontally and vertically. cadherins forming these contacts are abundant in adherens and desmosomal junctions which allow epithelial cells to move together as a sheet during wound repair and angiogenesis. this is known as collective migration and can be found in certain epithelial cell tumours. as epithelial cancer cells progress, the function of cell - cell junction protein is suppressed allowing individual cells to separate and migrate independently. this is known as individual cell migration, which can be subdivided into mesenchymal and amoeboid migration. in mesenchymal migration, the cell forms membrane protrusions at the leading edge and adheres to the substrate in an integrin - dependent manner. amoeboid migration occurs when the cell substrate adhesion is weak and is independent of integrin function. cells move by actin - myosin contractile forces and move within the ecm by squeezing the cell body. cadherins have a large extracellular domain that binds to the same molecule on an adjacent cell. this results in dimerization of two cadherins on the same cell surface resulting in strong and stable adhesive forces. e- and p - cadherins are responsible for light cell - to - cell junctions in epithelia known as adherens junctions. n - cadherin, found mainly in neural tissues and fibroblasts, is less stable and more dynamic. the loss of e - cadherin in epithelial cancers leads to disruption of tight junctions. this disrupts cell adhesion plaques enabling tumour cells to disengage from the primary mass and disseminate by individual cell migration. in the mammary gland, e - cadherin is cleaved by targeted expression of stromelysin-1 : matrix metalloproteinase 9 (mmp 9). this is due to the interaction of n - cadherin with the fgf receptor on the cell surface that increases transcription of mmp 9 leading to increased cellular invasiveness. in experimental models using mice over expression of e - cadherin impairs invasiveness of tumour cells. n - cadherin mediated cell - cell adhesion, in contrast to e - cadherin, is required for collective cell migration. normally membrane extensions are suppressed in cells that are in contact with at least two neighbouring cells at the anterior and posterior ends. n - cadherin mediated cell - cell adhesion allows cells to move in sheets and functions in directional migration and contact inhibition. upregulated n - cadherin in breast cancer cells creates a state of dynamic adhesion that allows both attachment and detachment of individual cells from the primary tumour. p - cadherin adhesion is important in mammary gland growth control and when disrupted can enhance cell invasion and tumour aggressiveness. the matrix metalloproteinases (mmps) are a family of at least 28 zinc dependent endopeptidases. they are synthesised both by breast cancer cells and the surrounding stromal cells that may interact with each other, and it is likely that cancer cells are able to stimulate production by fibroblasts in a paracrine fashion. in the normal breast, ecm remodelling is a prerequisite to ductal progression, and mmp activity facilitates this progression by removing or breeching the basement membrane and stromal matrix. mmps are implicated in cancer invasion and metastasis and can be subdivided into four groups depending on their substrate specificity and domain organisations. once the ecm has been degraded, it paves the way for cells to move within its framework. reorganisation of cortical actin filaments is regulated by a highly integrated signalling cascade that transduces extracellular stimuli to the actin filaments. rho family gtpases regulate cytoskeletal dynamics by cycling between inactive gdp - bound and active gtp - bound states. when cells are stimulated by growth factors, bound gdp is exchanged for gtp. in the gtp - bound state, rho gtpase members, including rhoa, cdc42, and rac, act as molecular switches on which signalling inputs converge and are transduced into a coordinated array of output pathways leading to actin polymerisation and control of the formation of filopodia (cdc42), lamellipodia (rac), and stress fibres (rho). this causes asymmetry in the internal signalling of the cell establishing cell polarity which defines the leading edge of the cell. during cell movement, rac and cdc42 stimulate the formation of protrusion at the leading edges of the cells and rho a induces retraction at the tail ends of the cells. activated rac and cdc42 induce reorganisation of the actin cytoskeleton at the leading edge. localised actin polymerisation at the leading edge pushes the membrane forward generating the locomotive force in migrating cells. rhoa regulates stress fibre formation and focal adhesion assembly that results in actomycin contractility and contraction at the rear of the cell which leads to translocation of the cell body. these extensions are used to explore the extracellular space and find their way towards their targets in chemotactic location. branched actin filaments are normally associated with cortical areas and nonbranched actin filaments such as stress fibres that are frequently associated with focal adhesions, adherent junctions, and filopodia. filopodia are thin cylinders containing tight bundles of long actin filaments which protrude from the cell extending tens of microns from the main cortex. parallel actin bundles form the core structure packed tightly with noncontractile bundles cross - linked by f - actin binding proteins. lamellipodia are thin propulsive sheets that dominate the leading edges of fibroblasts and other motile cells. lamellipodia have characteristic ruffle edges due to the leading edges lifting up from the substrate and moving backwards. actin filaments in lamellipodia are oriented in a cross - weave pattern between two sets of filaments oriented approximately forty - five degrees to the direction of propulsion. podosomes are cell substrate adhesion sites which are usually observed in adhesive cells, for example, osteoclasts and macrophages. as invadopodia persist longer than podosomes, podosomes are thought to be the precursors of invadopodia. the formation of cell protrusions is driven by assembly of actin filaments at the leading edge. during development, dynamic remodelling of the cytoskeleton allows the precise placement and orientation of developing tissues. although rac and cdc42 are known to be essential for cell movement, the downstream molecules involved in actin filament reorganisation are known as the wasp family of proteins. wiskott - aldrich syndrome is an x - chromosome linked hereditary disease that is characterised by thrombocytopenia, eczema, and immunodeficiency. the gene that was mutated was isolated and named wiskott - aldrich syndrome protein (wasp). to date, five mammalian wasp family proteins have been identified ; wasp, neural wasp (n - wasp), and wave (wasp family verprolin - homologous proteins) 1, 2, and 3. these proteins have been identified as the link between the small gtpases and the actin cytoskeleton. wasp binds to cdc42 through its gbd / crib (gtpase binding domain / cdc42 and rac interactive binding domain). this brings about a conformational change in the wasp protein exposing the vca (verprolin homology, cofilin homology, and acidic region) enabling g - actin and the arp2/3 complex to promote actin nucleation and formation of protrusive structures such as filopodia and lamellipodia. this complex binds to the sides of actin filaments and is concentrated at the leading edge of motile cells. wasp, n - wasp, and wave share common biochemical features that enable them to form a tripartite unit with g - actin and the arp2/3 complex. it is responsible for the dendritic filament array observed in lamellipodia and drives the leading edge of migrating cells. the arp2/3 activating region of the wasp family protein binds with an active monomer resulting in rapid atp hydrolysis on arp2 and the nucleation of a new actin filament on the side of a preexisting filament. breast cancer with high histological grade has irregular morphology consisting of excessive protrusions due to the assemblages of branched actin filaments. aberrant expression of arp2/3 in breast cancer leads to multiple branched actin filaments and leads to an increase in both local progression and poor disease outcome. cortactin is an actin associated scaffolding protein that regulates cell migration. in the presence of both cortactin and wasp proteins, cortactin facilitates the release of activated wasps by binding directly to the arp2/3 complex and activates it to promote nucleation of actin filaments promoting and stabilising branched actin filaments. in breast cancer cells, cortactin is associated with the invadopodium, and overexpression of cortactin leads to increased cellular motility and invasiveness. cortactin was found to be overexpressed in mammary tumours where its expression correlates with increased tumour invasiveness. research into wasps and their interactions with other downstream effectors has shown them to be a hugely complex and highly integrated signalling cascade that transduces extracellular stimuli to the actin filaments. there are multiple genes involved in wasp related cell motility which are deregulated in human breast cancers. it has been widely shown that breast tumours contain marked leukocytic infiltration that significantly correlates with poor prognosis. the majority of these cells are macrophages and csf-1 (colony stimulating factor-1) is the main chemoattractant for these cells. tams have been shown to promote the migratory phenotype of carcinoma cells, and macrophages are known to form podosomes and invadopodia. in normal tissues, injury results in the local expression of a wide variety of growth factors one of which is csf-1. csf-1 was first identified as a haematopoietic growth factor that stimulates the proliferation, differentiation, and survival of monocytes, macrophages, and their bone progenitors. in damaged tissues, csf-1 attracts monocytes and stimulates them to differentiate into macrophages in order to mediate an immune response, kill pathogens, stimulate angiogenesis, and affect tissue repair. in the lactating breast epithelium, very high levels of csf-1 are expressed compared to undetectable levels found in resting breast epithelium as csf-1 produced by macrophages is implicated in the development of terminal end buds which grow out of the mammary breast ducts. 85% of invasive breast carcinomas expressed high levels of csf-1, and this expression was clearly localised in the neoplastic epithelial cells of the tumours as well as in the stromal macrophages. pollard (2004) suggests that there is a correlation between the expression of csf-1 and poor prognosis in breast cancers which is due to the availability of csf-1 to recruit and modulate the behaviour of tams. tams comigrate with carcinoma cells due to the presence of a csf-1 egf paracrine loop ; carcinoma cells secrete csf-1 and express the egf receptor and macrophages secrete egf and express the csf-1 receptor stimulating each other to migrate via egf activation of the n - wasp signalling pathway and formation of invadopodia. tumours require angiogenesis to grow beyond a certain size and tams have been shown to cluster in avascular areas correlating with high levels of angiogenesis and decreased relapse - free and overall survival rates in patients with breast carcinoma. hypoxia upregulates local cytokines and csf-1, and these are chemotactic to the tams which migrate to the area where they stimulate angiogenesis by expressing vegf and other growth factors and recruit haematopoietic cells such as mast cells and neutrophils. high levels of macrophage infiltrate in breast tumours correlate with a poor prognosis, and hypoxic tumours have a higher invasive capacity and poorer prognosis than well - oxygenated tumours. macrophages secrete mmp 9 and their podosomes are capable of directly degrading the pericellular ecm. upa initiates a proteolytic cascade that results in the conversion of plasminogen to plasmin which mediates proteolysis. upa further recruits mmps 9 and 2 enabling the remodelling of collagen type iv, the major constituent of basement membranes. breast tumour cells are then free to flow out of the ductally constrained tumour mass into the surrounding stroma and subsequently gaining access to the vasculature with the ability to colonise distant sites. high levels of upa are associated with poor prognosis in breast cancer, and an elevated serum upa is an established prognostic factor used for determining treatment - based decisions in early breast cancer. as this review has highlighted, the movement of cells within the breast stroma is a hugely complex and a highly integrated process. there are multiple genes related to cell motility and these become dysregulated in breast cancers allowing cells to break down intercellular adhesive forces, cleave molecules in the ecm, and form motile invadopodia facilitating progression through the stroma. they are chemotactic and recruit other cells to stimulate angiogenesis, growth factors, and proteolysis enabling the breast cancer cells to break free of the basement membrane, gain access to the vasculature, and colonise distant sites. | in the normal breast, cellular structures change cyclically in response to ovarian hormones. cell proliferation, apoptosis, invasion, and differentiation are integral processes that are precisely regulated. normal epithelial cells depend on the formation of intercellular adhesion contacts to form a continuous sheet of stratifying cell layers that are attached to one and other horizontally and vertically. cells migrate by extending membrane protrusions to explore the extracellular space locating their targets in a chemotactic manner. the formation of cell protrusions is driven by the assembly of actin filaments at the leading edge. reorganisation is regulated by a highly integrated signalling cascade that transduces extracellular stimuli to the actin filaments. this signalling cascade is governed by gtpases which act as molecular switches leading to actin polymerisation and the formation of filopodia and lamellipodia. this process is linked to downstream molecules known collectively as wasp proteins, which, in the presence of cortactin, form a complex leading to nucleation and formation of branched filaments. in breast cancer, the cortactin is over expressed leading to increased cellular motility and invasiveness. this hugely complex and integrated signalling cascade transduces extracellular stimuli. there are multiple genes related to cell motility which are dysregulated in human breast cancers. |
in type 1 diabetes (t1d), insulin - producing cells are progressively and specifically eliminated by an autoimmune attack. a number of self - antigens specific to these cells are targeted by cd4 and cd8 t cell responses as well as by autoantibodies. in non - obese diabetic (nod) mice, strong evidence points toward a specific insulin epitope (b923) as an initial driving antigen, with an immune response later diversifying to other insulin epitopes and to other cell antigens. in humans, there are multiple antigens involved,2, 3 although it is unclear whether there is a common initial antigen because patients are more genetically diverse than nod mice. regardless, a large number of overlapping t cell epitopes and autoantibody - targeted antigens have been described in both species. isolation of diabetogenic t cell clones from insulitic lesions has not always led to easy identification of their cognate antigen, with particular t cell clones being poorly responsive to peptides derived from native antigens. recently, post - translational modifications of antigens4, 5 and generation of hybrid peptides6, 7 have been shown to generate neo - epitopes that constitute more efficient and physiologic antigens for the stimulation of these particular t cell clones, which previously required mimotopes identified from peptide libraries for stimulation.8, 9 thus, attempts to target diabetogenic t cells for tolerance by simply delivering native protein antigens may be futile, and this may explain the poor efficacy of antigen - specific immunotherapy (asit) trials so far. in contrast, preclinical evaluation of native peptides versus mimotopes in disease prevention (nod mice) and humanized mouse models has demonstrated the superior ability of mimotopes to target t cells for tolerance induction, at least in the case of insulin b923 peptide.11, 12 furthermore, tetramer reagents incorporating insulin mimotopes also identify more circulating insulin - reactive t cells than those made with the native insulin epitope. these observations strongly support the use of epitope - based strategies for t1d asit, whereby epitopes and mimotopes appropriate for specific patients would be combined, integrated, and properly presented for effective engagement of diabetogenic t cells. although delivery of epitopes / mimotopes in the form of peptides is a straightforward approach, peptides have drawbacks related to their short half - life, solubility, rapid dilution in vivo, and production costs. expression of peptides within antigen - presenting cells (apcs) from nucleic acids (exogenous dna or rna) generates an antigen reservoir for more sustained presentation, provided there is appropriate subsequent processing of the expressed epitopes. endogenous expression of cd8 epitopes by a variety of major histocompatibility complex class i (mhc - i) cells can effectively mediate deletion of autoreactive cd8 t cells.14, 15, 16, 17 moreover, endogenous cd4 epitopes can be re - directed to endosomes or lysosomes18, 19, 20, 21, 22 and may contribute to induction of tolerance.21, 22 co - expression of multiple cd4 and cd8 epitopes offers the unique possibility of bridging potentially pathogenic t cells and regulatory t cells (tregs) to enable linked suppression.23, 24 in the present study, we have explored the endogenous delivery of epitopes / mimotopes from multiple cell antigens into dendritic cells (dcs) and stromal cells (scs) and determined conditions for the optimal recognition of all expressed epitopes by both cd4 and cd8 t cells. with a novel construct design, we integrated, within a single construct, strong native epitopes along with mimotopes not found within native proteins and delivered a sufficient antigen load per cell, allowing, for example, non - professional apcs such as scs to induce and/or selectively expand tregs. these constructs can be used, for example, to modify tolerogenic dcs ex vivo or as tolerogenic dna vaccines in vivo. their application goes beyond the treatment of t1d to cover other organ - specific autoimmune diseases as well as immunogenic dna / rna vaccines to treat infections and malignancies. we chose to express five epitopes recognized by t cells that can be isolated from t cell receptor (tcr)-transgenic mice : the overlapping insb923 and insb1523 from insulin, chga358371 (also known as we14) from chromogranin a, igrp206214 from islet - specific glucose-6-phosphatase catalytic subunit - related protein, and gad65286300 from glutamate decarboxylase (figure 1 ; table s1). (neo). to make the native epitopes + mimotopes (nem) constructs, the insb923 and chga358371 epitopes were replaced by the insb923 r22e mimotope25, 26 and 1040 - 79 mimotope, which emulate more disease - relevant mhc - peptide binding conformations or neo - epitopes (figures 1a and 1b ; table s1). the synthesized dna sequences for these constructs were cloned into our lentiviral (lv) vector co - expressing gfp by themselves or alongside one of four possible targeting signals (tss) for endosomes or lysosomes. sequences tfr1118 (tfr, from transferrin receptor),19, 20 ii180 (ii short, from the invariant chain), and ii1214 (ii long, from the invariant chain), corresponding to endosome - targeting signals (etss), were placed upstream of the epitopes (figure 1). the lysosome - targeting signal (lamp1, from lysosomal - associated membrane protein 1) consisted of the lamp-1166382 tail placed downstream of the epitopes and a cd16123 leader sequence upstream. in light of our initial data, we subsequently developed a new construct design (nms), whereby cd4 and cd8 epitopes from nem were rearranged within the construct and separated by a t2a cleavage site, allowing the generation of two polypeptides upon translation (figure 1c). constructs in lv vectors were transduced into bone marrow - derived dc or sc lines that were then sorted based on an intermediate level of gfp overlap between all groups (figure s1). these apcs were then co - cultured with one of the five purified t cell clones listed in table s1. although high concentrations of we14 have been shown to stimulate bdc2.5 t cells, no response was measured when expressed by any neo constructs (figure 2 ; figures s2a, s2b, s3a, s3b, s4a, and s4b), comparable with control dcs without antigen (data not shown). in contrast, the 1040 - 79 mimotope (nem constructs) elicited modest t cell recognition in the absence of tss and significantly enhanced recognition with all etss but not lamp1 (figure 2 ; figures s3a, s3b, s4a, and s4b). likewise, the response of bdc12 - 4.1 t cells to the native insb923 peptide (neo constructs) was not measurable beyond the background seen with untransduced dcs (data not shown), even with tss (figures s2c, s2d, s3c, s3d, s4c, s4d, and s5). engagement of the r22e mimotope (nem constructs) was evident with all etss but not lamp1, and no response was measured in absence of etss, in contrast to the 1040 - 79 mimotope. the response of g286 cd4 t cells to the gad65286300 peptide without ets was the most robust among all cd4 t cell clones tested but was still greatly improved with the tfr ets (figure s6). the similar response measured in neo and nem constructs was consistent with the epitope being the same (figures 1a and 1b). the maximal response of igrp206214-specific ny8.3 cd8 t cells was seen with dcs expressing the neo or nem construct without any ts, whereas this response was significantly reduced with any of the ts tested (figure 3 ; figures s7 and s8), except with ii short in one occurrence (figure s8). similarly, although g9c8 cd8 t cells are weak responders to the insb1523 epitope, they were more efficiently engaged without ts than with tss (figure s9). because both neo and nem constructs carry the same igrp206214 epitope (figures 1a and 1b), the responses were very similar within each ts group (figure 3 ; figures s7 and s8). in contrast, the insb1523 epitope was overlapping with the insb923 epitope ; thus, it was affected by the r22e mutation in the nem constructs. although this mutation improved engagement of the cd4 t cell clone, it abrogated that of the cd8 t cell clone (compare neo and nem, figure s9). when the nms constructs were used (figure 1c), the response of cd4 t cell clones was as good as with the nem constructs with ets, if not better (figure 2 ; figures s2 and s5). using the nms constructs with ets, the response of cd8 t cell clones was rescued in most instances compared with nem constructs with ets, to a level similar to nem constructs without ets (figures 3a3c ; figures s7 and s9c). thus, optimal presentation of all epitopes was achieved only when epitopes of interest were arranged and produced as two separate polypeptides, one containing cd4 epitopes that is targeted to endosomes and another one containing cd8 epitopes that is expected to remain cytosolic for proteasome processing. given the potential of various types of scs to present antigens to t cells in a tolerogenic fashion, we asked whether our constructs could be used to allow such scs to engage t cells. for these studies, we used two different cell lines of fibroblastic lineage : dapg7 cells, which are derived from i - a mice and stably overexpress i - a, and pcrc-5 cells, which are immortalized nod lymph node scs expressing k but have no detectable basal i - a expression. dapg7 cells expressed i - a, pd - l1, and cd40 and no icosl or cd86 (figure s10). using these cells as apcs, bdc2.5 cd4 t cells were stimulated only with the mimotope - expressing nem constructs (figure 4). however, the response to the mimotope in the absence of ts was lower than what was seen with dcs. as part of these studies, we also started to use cd4 t cells from bdc12 - 4.1 mice on a nod.tcrko background, which prevents unwanted pairing between the transgenic v chain and endogenous v chains. on this genetic background, the t cell responses were greatly enhanced in amplitude, and some response to mimotope without ts was evident (compare figure s11 with figures s2c, s5b and s5c). a significant increase in the stimulation of both cd4 t cell clones was seen with all etss but not lamp1 (figures 4d and 4e ; figures s11d and s11e). pcrc-5 cells were characterized as fibroblastic reticular cells, being positive for podoplanin, pdgfr, and sca1 and negative for the endothelial marker cd31 and epithelial marker cd326 (figure s12a). these cells were differentiated fibroblasts (negative for the mesenchymal progenitor maker cd90) positive for k and negative for i - a. some variability was seen in the expression of gfp and k between transduced cell lines (figure s12b), and because the cd8 epitopes were the same between all constructs, we picked constructs between neo and nem that were most uniform phenotypically for the studies. consistent with the observations made with dcs, the presentation of cd8 epitopes, based on the response of ny8.3 t cells, was severely blunted by all tss unless cd8 epitopes were segregated from ets / cd4 epitopes (figure 5). in contrast, g9c8 cd8 t cells failed to respond with any transduced sc line and only responded to beads coated with anti - cd3/cd28 (data not shown). these data suggest that the differential processing of epitopes from our constructs is equivalent between dcs and scs and that both types of apcs benefited from the new construct design, allowing efficient engagement of both cd4 and cd8 t cells. because epitopes are typically delivered in vitro to apcs in the form of soluble peptides, we sought to determine how the response to endogenously produced peptides compares with that obtained with various concentrations of exogenous peptide. the profile of the response of three t cell clones (bdc2.5, bdc12 - 4.1/tcrko, and ny8.3) to peptide - pulsed scs was the same whether t cell division or cd25 upregulation was measured (figure s13). bdc2.5 and ny8.3 t cells were confirmed to be the most responsive (they are also the most pathogenic in vivo), whereas bdc12 - 4.1 t cells exhibited a lower affinity to antigen, even with the mimotope peptide. cd25 expression and t cell division in response to exogenous peptides were highly correlated (figure 6). the cd4 t cell responses to transduced dapg7 cells fall on the same trend line as soluble peptide : the best constructs (nms with tfr or ii short) gave a response equivalent to 10 m soluble insb923 r22e mimotope and to 0.11 m soluble 1040 - 79 mimotope, whereas the response to the weakest constructs (nem without ets) was equivalent to 10- to 100-fold lower exogenous peptide concentrations (figures 6a, 6b, and 7c). thus, these constructs proved to be very efficient for scs, eliciting cd4 t cell responses otherwise achieved with very high concentrations of soluble peptide. the cd8 t cell response to transduced pcrc-5 cells, surprisingly, did not follow the trend line of the exogenous peptide (figure 6c) : these t cells responded by cd25 upregulation with minimal proliferation. the extent of cd25 expression was comparable with that achieved with 110 nm igrp206214 peptide. we repeated the analysis of bdc12 - 4.1 cd4 t cell responses to dcs transduced with different constructs, this time using t cells from bdc12-4.1.tcrko mice. we also compared these responses with one of our nms constructs that was produced as mrna for electroporation (a technique more amenable to clinical translation than viral vectors) and with serial dilutions of exogenous peptide. the response of these t cells was more robust than their counterpart isolated from nod wild - type mice, with some response now seen with nem / no ets (compare figure s14 with figures s5b and s5c). moreover, the t cell response to the mrna version was comparable with its lv counterpart under the transfection conditions used (figure s14). the lv and mrna versions of nms / tfr were comparable in the induction of cd25 (equivalent to 0.11 m soluble insb923 r22e mimotope) but induced more proliferation than any of the exogenous peptide concentrations (figure s15a). the response of bdc2.5 cd4 t cells to both lv and mrna versions of nms / tfr was equivalent to 10100 nm soluble 1040 - 79 mimotope, with cd25 expression and t cell division highly proportional (figure 7a ; figure s15b). finally, the responses of ny8.3 and g9c8 cd8 t cells to peptide - pulsed dcs had a very different profile than with peptide - pulsed scs. at the lowest concentrations (10100 pm), the t cells proliferate vigorously with minimum cd25 upregulation, whereas, at higher concentrations (from 1 nm to 1 mm), proliferation decreases as cd25 increases (figures s15c and s15d). in contrast, the response of ny8.3 cd8 + t cells to endogenous epitopes showed a linear correlation between cd25 and proliferation (figure s15c). the reduced proliferation of cd8 t cells at high concentrations of exogenous peptide was not due to a deficit of secreted interleukin-2 (il-2) (figures s15e and s15f). however, the response to the igrp206214 epitope after mrna delivery was weaker than with the lv construct (figure s15c). furthermore, endogenous epitopes induced substantially less proliferation of cd8 t cells than soluble peptides at comparable cd25 levels (figures s15c and s15d), which is reminiscent of what was seen with pcrc-5 cells as apcs (figure 6c). given that one of the major goals of asits is to generate treg populations in response to delivered epitopes, we used cd4 t cells from bdc2.5.foxp3/gfp reporter mice to evaluate whether the type of antigen delivery (endogenous versus exogenous), the antigen dose, and the type of apcs have any influence on the upregulation of foxp3 after t cell engagement. because the cd4 t cell responses appeared to be equivalent in dcs transduced with lv and dcs electroporated with mrna (1 g/10 cells), we only used electroporated dcs thereafter. we compared two doses of antigen mrna (0.4 and 2 g/10 cells) that were completed to a total of 20 g mrna/10 cells with gfp mrna for normalization. the response of bdc2.5.foxp3/gfp, based on cd25 expression and cell division, was identical to that of bdc2.5 mice (compare figure 7a with figure s15b and figure 7c with figure 6b). however, the cd25 depletion step performed previously as part of cd4 t cell enrichment only removed foxp3 cells, whereas some cd25 foxp3 cells remained present (figure s16). t cells stimulated with dcs experienced a small (less than 2-fold) but significant (p < 0.02) increase in foxp3 cells at low peptide concentrations (0.110 nm) but not at higher concentrations (figure 7b ; figure s17a). in contrast, those stimulated with dapg7 cells saw a 5-fold increase in the proportion of foxp3 cells (p < 0.04) at the highest peptide concentrations (0.11 m) (figure 7d ; figure s17a). when delivered endogenously (mrna or lv), this cd4 epitope induced the highest percentage of foxp3 cells in both types of apcs with the most significant increase (p < 0.003) (figures 7b and 7d). dcs induced fewer foxp3 cells that nonetheless expressed higher levels of foxp3 (compared with dapg7 cells as apcs, p < 0.03) (figures 7e and 7f). it was not clear whether these foxp3 t cells were de novo - induced or the result of a preferential expansion of the few foxp3 cd25 t cells present at the beginning of the culture. our data suggest that endogenous epitope delivery to dcs and scs led to at least as many foxp3 cells that would be obtained with variable doses of soluble peptide, although these foxp3 cells may differ phenotypically and functionally depending on the type of apc involved. because the induction of foxp3 was relatively modest, we explored whether cd4 t cells engaged by stromal cells were tolerized in other ways and whether they had any suppressive ability. we found that lag-3 expression mirrored cd25 expression and cell division in percentage (figures s17b s17e), but t cells stimulated by dapg7 scs expressed higher levels of lag-3 relative to cd25 than those stimulated by dcs (figures 7e and 7f ; figures s17e and s17f). furthermore, cd4 t cells cultured with antigen - expressing dapg7 cells secreted il-10 (figure 8a), whereas the same cd4 t cells cultured with anti - cd3/cd28 beads in the presence of transforming growth factor (tgf-) and il-2 expressed higher levels of foxp3 (figure 8b) but no lag-3 (data not shown) and no il-10 (figure 8a). we next stimulated carboxyfluorescein succinimidyl ester (cfse)-labeled polyclonal cd25-depleted thy1.1 nod t cells (containing cd4 and cd8 t cells) with anti - cd3/cd28-coated beads in the presence of polyclonal nod cd25-depleted thy1.2 cd4 t cells or sorted populations from bdc2.5 thy1.2 cd4 t cells previously stimulated with dapg7 cells with or without nms / ii short lv to assess the suppressive potential of il-10 lag-3 cells at different target / regulator ratios. in these secondary cultures, we observed greater il-10 levels and greater suppression with bdc2.5 t cells that had divided at least once, irrespective of foxp3 levels, whereas those that did not divide contributed less il-10 and were less suppressive (figures 8c8f). thus, delivery of our constructs to scs that are mhc - ii enable efficient antigen presentation that results in tolerance. tolerogenic apcs need to engage autoreactive t cells through presentation of self - antigen - derived epitopes to mediate deletion, anergy, or treg programming. one of the prerequisites for the success of asits is the efficient delivery of relevant antigens to these apcs, of which there are two types that are known to perform some or all of the above functions. the first group of target apcs is dcs, which are efficient at acquiring exogenous protein antigens and presenting peptides onto mhc - ii and, to a more limited extent, mhc - i, depending on their cross - presentation capabilities. these cells can potentially become immunogenic under inflammatory conditions, and researchers have explored the possibility of generating stably tolerogenic dcs in vitro for cell therapy to treat autoimmunity, with a few initial clinical studies recently completed.31, 32 the ability of these cells to specifically engage autoreactive t cells for tolerance induction may rely on the presentation of appropriate epitopes. scs constitute the second group of target apcs. because they lack the extensive endocytic activity of dcs, their antigen presentation relies on endogenous expression, which is essentially limited to mhc - i. subsets of scs also express mhc - ii and can process endogenous peptides onto mhc - ii primarily through autophagy (as epitomized by medullary thymic epithelial cells). although these cells are less amenable for cell therapy, lacking the motility and migratory properties of dcs, they tend to be more easily transfected than dcs using a variety of non - viral vectors and may, therefore, constitute better targets for delivery strategies such as tolerogenic dna vaccines. in clinical trials for t1d asit, delivery of antigens in the form of proteins however, the disappointing results of such trials have led us to question whether the use of a single antigen is sufficient to restore tolerance to all targeted antigens. in theory, a regulatory response to one epitope can help promote a regulatory response to other epitopes (infectious tolerance) as long as these epitopes are linked ; that is, presented by the same apc. although linkage is obvious for epitopes derived from the same antigen, the chance that apcs simultaneously present epitopes from different cell antigens is low when a single antigen is provided and still not guaranteed when different antigens are co - administered. hybrid proteins made of epitope - containing regions of several autoantigens can be produced and appear to be more efficient than soluble peptides at promoting tolerance. recombinant proteins for asit cost more to produce than dna and may not undergo certain post - translational modifications during production. many epitopes recognized by autoreactive t cells turn out to be modified or hybrid peptides,3, 4, 6, 7, 39 which further suggests that conventional asit strategies are suboptimal and limited. thus, incorporation of hybrid peptides or mimotopes emulating post - translationally modified peptides identified in human patients will be required to more efficiently engage and tolerize diabetogenic t cells. finally, protein antigens are not acquired by scs, thereby excluding an important group of tolerogenic apcs as players. nucleic acid - based systems, on the other hand, allow endogenous delivery of antigens, most efficiently in scs. dna vaccines expressing proinsulin lead to delayed loss of c - peptide and reduced frequency of proinsulin - specific cd8 t cells in human patients, which is consistent with good mhc - i presentation of endogenous peptide. however, the effect on cd4 t cells is more limited unless the antigen is targeted for secretion. endogenous epitopes and mimotopes can also be targeted to endosomes or lysosomes18, 19, 20, 21 to allow tolerization of specific diabetogenic cd4 t cells directly by the transfected apc. we proposed that endogenous delivery of multiple epitopes would have several advantages : targeting more types of apcs as opposed to the protein version of multi - epitope constructs, easy generation of expression constructs as dna or rna that incorporate non - native sequences to target neo - epitopes, and targeting epitopes from different antigens to favor intermolecular linkage and more effective immunoregulation, all with the convenience of a single construct. although tss have been known for some time to enhance the presentation of endogenous cd4 epitopes, it was not clear whether there was a need to optimize the concomitant presentation of endogenous cd4 and cd8 epitopes. we tested endogenous delivery to dcs and scs of polypeptides containing five epitopes targeted in nod mice. presentation of all expressed epitopes was confirmed based on stimulation of their respective specific t cell clone, indicating that all peptides were processed correctly for presentation. for the cd4 t cell clones that were tested against both native peptide and mimotope, we only saw stimulation with the mimotope. this is consistent with the pronounced immunological and clinical differences seen between native insb923 and its mimotope using peptide vaccination in animal models.11, 12 likewise, the naturally processed chga358371 (we14) epitope is poorly immunogenic on its own, but, when fused with insulin - derived peptide to form a neo - epitope resembling the previously identified mimotope, it strongly stimulates bdc2.5 t cells. ets from the transferrin receptor and the invariant chain significantly enhanced the engagement of cd4 t cell clones, as measured by t cell proliferation and cd25 upregulation, the latter being the most sensitive response. the short invariant chain ets was as good, if not better, than the longer form ; however, the shorter form is preferred because smaller constructs are easier to package and provide more epitope copies per total amount of dna / rna. in contrast, the lysosome - targeting lamp1 ts did not enhance presentation of our cd4 epitopes. it is possible that the polypeptide(s) expressed by our constructs is / are differentially processed in the lysosomes because of different protease content. indeed, antigens targeted to endosomes and lysosomes can be skewed toward a different peptide repertoire. a study using the ts of another lysosome protein (lysosomal integral membrane protein ii) to target another bdc2.5 mimotope found an increased response of bdc2.5 cd4 t cells. different mimotopes, tss, and contexts (in vitro versus in vivo) may account for this difference. cd8 t cell responses were also suboptimal when tss were used in conjunction with mixed cd4/cd8 epitopes, suggesting that cd8 epitopes were being diverted away from proteasome processing. in a few instances, although not consistently, the short invariant chain ets gave a cd8 t cell response comparable with the no ts group, with epitope segregation. interestingly, although the lamp1 ts did not improve cd4 t cell engagement, it was able to hinder engagement of cd8 t cells, further suggesting that the lack of an effect by the lamp1 ts may be a processing rather than a targeting issue. g9c8 cd8 t cells are very - low - affinity t cells requiring high concentrations of insb1523 peptide for stimulation. these t cells responded when the most efficient constructs were delivered to dcs, but not scs, and only to the non - mutated version of the epitope. the low affinity of these t cells may be sufficiently compensated by high - avidity presentation by dcs (high mhc - ii levels), whereas scs may be unable to stimulate because of lower levels of mhc - ii. although cd4 t cells responded in the same way to exogenous and endogenous epitopes (relative cd25 expression and proliferation), we observed that endogenous epitopes tend to induce less proliferation of cd8 t cells despite similar engagement, based on cd25 expression. it is possible that mhc / peptide complexes in this case are better stabilized by constant direct binding of exogenous peptides and that cd25 upregulation and proliferation require a different duration of engagement controlled by mhc complex density and renewal rate. responses to soluble peptides in vitro are not a good reflection of in vivo responses because dissociated peptides may be more readily replaced by direct binding of other identical peptides in static culture. in contrast, endogenously delivered epitopes provide a more sustained presentation both in vitro and in vivo via continuous replenishment of mhc / peptide complexes on the cell surface. constructs expressing multiple epitopes endogenously not only ensure antigen linkage within apcs but may also increase the chance of productive encounters with specific t cells when presentation is more durable. injected soluble peptides (and multi - epitope proteins) are expected to disperse in vivo and target a large number of apcs with a diluted and limited load of antigen per apc. in contrast, plasmid dna delivered naked or using vectors will target fewer apcs because of limited transfection efficiency but, at the same time, will ensure that a higher amount of antigen is presented per cell. our data suggest that a high antigen load was required to achieve a high proportion of foxp3 cells with scs. dosing of 5 g / mouse / day of soluble insulin mimotope11, 12 would reach a maximal theoretical blood concentration of 2 m (based on 1.5 ml of blood in an adult mouse), which would allow dcs, but not scs, to effectively engage specific t cells. mhc - ii expression in lymph node scs is usually low and/or inducible but plays a role in the maintenance of tolerance and treg numbers. pd - l1, expressed by some of these cells, has been implicated in cd8 t cell tolerance and may also contribute to treg induction.44, 45 because dapg7 cells express pd - l1 and low levels of mhc - ii, data from these cells may be extrapolated to some lymph node sc subsets. at comparable levels of cd25 induction, dapg7 scs induced higher lag-3 expression in t cells than dcs with endogenous antigen and highest concentrations of soluble peptide. this is likely attributable to differences in the type and level of costimulatory and coinhibitory ligands on the surface of these apcs. after culture with antigen - presenting dapg7 scs, cd4 t cells secreted il-10 and acquired suppressive functions. bone marrow - derived dcs were relatively inefficient at inducing foxp3 by simply presenting the mrna - derived epitopes to t cells. however, because the amount of mrna needed to obtain substantial t cell stimulation is small relative to the total amount of mrna that can be loaded into dcs (10%), it is possible to modulate the tolerogenic properties of these dcs with complementary mrna to overexpress tolerogenic products. given the increasing clinical use of mrna - modified dcs in cancer immunotherapy, this approach is applicable to cell - based asit. these extensive in vitro studies, using multiple cd4 and cd8 t cell specificities and two types of apcs, demonstrate the potential of tandem epitope constructs to express select epitopes (or mimotopes) from multiple antigens targeted in t1d. while conducting an extensive comparison of targeting signals for the mhc - ii pathway, we determined that optimal presentation of all epitopes generally requires cd4 and cd8 epitopes to be segregated so that only cd4 epitopes are driven by these targeting signals. likewise, overlapping cd4 and cd8 epitopes, as exemplified by insb923 and insb1523, should be duplicated and segregated. weaker epitopes may also be incorporated in higher copy numbers within the construct to further improve recognition. endogenous delivery of these constructs is applicable to tolerogenic dc therapy and dna vaccines, all approaches that have proven safe in patients with t1d and other autoimmune diseases31, 32, 36 but whose efficacy is not yet established. in particular, dna vaccines are more likely to implicate scs than approaches using exogenous protein antigens because scs have poorer endocytic activity but are more efficiently transfected by dna compared with dcs. follow - up in vivo studies, as currently undertaken in our lab, will need to demonstrate the clinical benefit of delivering cd4/cd8 epitopes from multiple antigens as opposed to a single antigen or a single cd4 mimotope. unless otherwise noted, all mice were purchased from the jackson laboratory and bred in our barrier facility. male or female nod mice (jax # 001976) were used as bone marrow donors for the generation of dcs. the tcr - transgenic mice used for most experiments were bdc2.5 (jax # 004460), bdc12 - 4.1 (jax # 006303 and # 006304), and ny8.3 (jax # 005868). nod.foxp3/gfp mice (jax # 025097) were crossed with bdc2.5 mice to produce bdc2.5.foxp3/gfp mice. nod.tcrko mice were derived from g9c8 (tcrko) mice and crossed with bdc12 - 4.1 mice to generate bdc12-4.1.tcrko mice. kristin tarbell (nih national institute of diabetes and digestive and kidney diseases [niddk ]). nod.thy1.1 congenic mice (jax # 004483) were used as donors for suppression assays. epitope and targeting signal - containing constructs (figure 1) were codon - optimized and synthesized by geneart (thermo fisher scientific) and then sub - cloned into the phr lv system downstream of a cytomegalovirus (cmv) promoter and upstream of internal ribosomal entry site (ires)-gfp. lv particles were produced by calcium / phosphate - based transfection of 293 t cells, followed by 100150 concentration of supernatant collected after 4860 hr, and titrated as described previously. an mrna version of the nms / tfr construct was designed and produced by trilink technologies as codon - optimized, anti - reverse cap analog (arca)-capped mrna fully substituted with 5-methylcytosine and pseudouridine. these modifications enhance protein production and minimize the immunogenicity of mrna, which is more appropriate for the purpose of tolerance induction. pcrc-5 cells are nod lymph node scs immortalized in our lab by overexpression of human papilloma virus e6/e7 proteins. dcs were generated in vitro from the bone marrow of nod mice depleted of t cells, b cells, and granulocytes after 67 days of culture in the presence of gm - csf and il-4 (peprotech, 10 ng / ml). dapg7 and pcrc-5 cells were transduced with the different lv particles, sorted based on similar gfp levels between transduced lines. dcs were transduced overnight with lv particles at moi 1520 on days 45 of culture, washed on days 56 of culture, and harvested on days 67 for sorting. because of variable transduction efficiencies and expression levels, dcs were sorted based on intermediate gfp mfi to normalize expression between all groups. dcs were also electroporated with tandem epitope - expressing mrna using a genepulser electroporator (bio - rad). dcs (5 10 cells) were electroporated in a 4-mm cuvette with up to 20 g mrna using a square wave pulse of 10 ms at 325 v (optimized conditions). spleen and pooled lymph nodes (inguinal, brachial, axillary, cervical, pancreatic, and mesenteric) were isolated by negative selection from donor tcr transgenic mice. cd4 cd25 t cells were purified from bdc2.5, bdc12 - 4.1, and g286 mice using the easysep mouse cd4 t cell isolation kit (stemcell technologies) supplemented with biotinylated anti - cd25. cd8 t cells were purified from ny8.3 and g9c8 mice using the easysep mouse cd8 t cell isolation kit. the t cell purity was confirmed by flow cytometry and was 94%99% for strains on a nod background (see figure s16a for an example) and 75%85% for strains on a nod.tcrko background. the percentage of cd25 cells among isolated cd4 was reduced to less than 1% after depletion (see figure s16b for an example). prior to culture, purified t cells were labeled with a green (cfse) or violet cell proliferation dye (vcpd) (ebioscience). 5 10 t cells were co - cultured with 0.51 10 transduced dapg7 cells, 2 10 transduced pcrc-5 cells, or 2 10 transduced dcs in technical or biological replicates for 3 days (round - bottom wells for dcs and flat - bottom wells for scs unless otherwise noted). gfp - transduced dapg7 cells, pcrc-5 cells, and dcs were used as negative controls. gfp - transduced dapg7 and pcrc-5 pulsed with cognate peptides, untransduced dcs pulsed with cognate peptides, and anti - cd3/anti - cd28-coated latex beads were used as positive controls. some culture supernatant was collected for elisa, and then t cells were analyzed by flow cytometry for cd4 and/or cd8, gfp, cd25, and/or lag-3 expression (all antibodies and elisa kits were from biolegend) and for cfse and/or vcpd levels. for suppression assays, a total of 5 10 t cells comprising thy1.1 target t cells (cfse - labeled) and thy1.2 t cells tested for suppressor function at a ratio ranging from 1:1 to 9:1 were co - cultured with 2 10 anti - cd3/anti - cd28-coated latex beads for 3 days. culture supernatant was collected for elisa, and then t cells were analyzed by flow cytometry for cd4, cd8, and cfse. | antigen - specific immunotherapy of type 1 diabetes, typically via delivery of a single native cell antigen, has had little clinical benefit to date. with increasing evidence that diabetogenic t cells react against multiple cell antigens, including previously unappreciated neo - antigens that can be emulated by mimotopes, a shift from protein- to epitope - based therapy is warranted. to this end, we aimed to achieve efficient co - presentation of multiple major epitopes targeting both cd4 + and cd8 + diabetogenic t cells. we have compared native epitopes versus mimotopes as well as various targeting signals in an effort to optimize recognition by both types of t cells in vitro. optimal engagement of all t cells was achieved with segregation of cd8 and cd4 epitopes, the latter containing mimotopes and driven by endosome - targeting signals, after delivery into either dendritic or stromal cells. the cd4 + t cell responses elicited by the endogenously delivered epitopes were comparable with high concentrations of soluble peptide and included functional regulatory t cells. this work has important implications for the improvement of antigen - specific therapies using an epitope - based approach to restore tolerance in type 1 diabetes and in a variety of other diseases requiring concomitant targeting of cd4 + and cd8 + t cells. |
due to advances in the treatment of chronic renal failure (crf) during the last two decades, survival of patients on dialysis has increased. but new problems including concerns of oral health have occurred.[14 ] the common oral health problems are dry mouth, uremic odor, change in taste, dental calculus, low salivary flow rate, and dental caries.[357 ] these manifestations may be related to a variety of factors, such as a relative state of immune suppression, medications, restriction of oral fluid intake, poor oral hygiene, malnutrition, and mouth breathing. for the evaluation of the hemodialysis (hd) effect on oral and dental health status, it is important to know the oral health status in patients with good dialysis adequacy (kt / v) compared with poor dialysis adequacy. hd patients as well as related dentists and nephrologists should be aware of oral health care in this condition. poor oral care in this group, especially those who are candidates of kidney transplant, could expose the patients to a high risk of serious problems. we aimed to determine dental and oral health status of our hd patients and related risk factors. this is an observational, cross - sectional study based on data collected from hd patients treated at two different dialysis centers of shiraz university of medical sciences in fars province, southern iran. seventy - two patients (age ranged from 18 to 85 years) under hd for more than 3 months were randomly selected. the patients were dialyzed for 4 h using fresenius 4008b machines. for each patient, this form consisted of demographic information, medical history, laboratory findings (gathered from medical records), and dental and oral health status (such as frequency of the brushing, visiting a dentist, time of the last dentist visit, experiencing a sensation of dry mouth, bad taste, or malodor mouth). intraoral examination was also done by two trainee dentists with a mouth mirror and light at bedside while the patients attended the hd. the dmft index was obtained as the sum of decay (d), missing (m), and filled (f) teeth in accordance with the criterion suggested by who. kt / v has been criticized as an accepted method for dialysis adequacy measurement that was calculated from the daugirdas formula { ln(r0.03) + [(43.5r) (ufw)]}. the target of dialysis adequacy, which was based upon the k / doqi clinical practice guidelines, was kt / v 1.2. data were analyzed by statistical package for the social sciences software version 15.0 (spss inc. comparison of the quantitative data was made using the student t - test or mann whitney and kruskal wallis tests as nonparametric tests. a chi - square test was performed for the comparison of the qualitative data. a p - value of < 0.05 was considered statistically significant. this is an observational, cross - sectional study based on data collected from hd patients treated at two different dialysis centers of shiraz university of medical sciences in fars province, southern iran. seventy - two patients (age ranged from 18 to 85 years) under hd for more than 3 months were randomly selected. the patients were dialyzed for 4 h using fresenius 4008b machines. for each patient, this form consisted of demographic information, medical history, laboratory findings (gathered from medical records), and dental and oral health status (such as frequency of the brushing, visiting a dentist, time of the last dentist visit, experiencing a sensation of dry mouth, bad taste, or malodor mouth). intraoral examination was also done by two trainee dentists with a mouth mirror and light at bedside while the patients attended the hd. the dmft index was obtained as the sum of decay (d), missing (m), and filled (f) teeth in accordance with the criterion suggested by who. kt / v has been criticized as an accepted method for dialysis adequacy measurement that was calculated from the daugirdas formula { ln(r0.03) + [(43.5r) (ufw)]}. the target of dialysis adequacy, which was based upon the k / doqi clinical practice guidelines, was kt / v 1.2. data were analyzed by statistical package for the social sciences software version 15.0 (spss inc. comparison of the quantitative data was made using the student t - test or mann whitney and kruskal wallis tests as nonparametric tests. a chi - square test was performed for the comparison of the qualitative data. a p - value of < 0.05 was considered statistically significant. a total of 72 adult hd patients were evaluated, 48 men (66.7%) and 24 women (33.3%) with a mean age of 53.415.3 years ; the mean of hd time and kt / v was 36.933.8 months and 1.40.6, respectively. table 1 summarizes the distributions, mean values, standard deviations, dmft score regarding categorical groups, statistical tests, and significance of patient 's variables. of 72 patients, 35 (48.6%) complained of dry mouth, 33 (49.3%) of taste change, 22 (31%) of malodor mouth, and 30 (46.9%) had some degree of dental calculus. these patients had a higher dmft score than those who had not complaints of any sign and/or symptom (p=0.04). levels of demographic data of study subjects distribution of dental and oral signs or symptoms among hd patients women, singles, and those with low kt / v, low educational level, and lesser dialysis time had a significantly higher dmft score (p<0.05) ; the dmft score was significantly different by gender (16.69.9 in men vs. 22.48.9 in women ; p=0.01), marital status (20.39.4 in singles vs. 9.97.9 in married ; p=0.01), educational level (p=0.04 ; table 1), dialysis time per week (21.198 in those who had dialysis three times per week vs. 15.69 in those who had dialysis less than three times ; p=0.03), and dialysis adequacy (20.910.3 in those had kt / v < 1.2 vs. 18.89.6 in others, p=0.003). the dmft score was lower in those who had dental calculus than patients without dental calculus (13.27.2 vs. 23.09.8 ; p=0.001). kt / v was significantly lower among those who had dry mouth (1.00.6 vs. 1.80.4 ; p=0.04) and dental calculus (1.10.5 vs. 1.70.4 ; p=0.01). kt / v was lower in patients who had bad taste and malodor than who had not, but it was not significant (p=0.07 and p=0.40, respectively). there was a positive significant correlation between the dmft score and age (r=0.6, p=0.001). but no statistically significant correlation was seen between dmft - score and hd time (r=0.2, p=0.07). kt / v and dmf - t score had a negative significant correlation (r=0.4, p=0.004). only 20 (27.8%) of the hd patients brushed their teeth daily and 6 (8.3%) said that they never brush their teeth [table 2 ]. none of the patients in the study group had a routine dental check - up and all of them reported that they went for a dental visit only when they had a dental problem. only 12 (16.7%) patients visited a dentist in the past 6 months due to their dental problems. majority of our patients showed oral sign and/or symptoms. in agreement with some studies, in most cases they were taste change, dry mouth, malodor, and dental calculus. dry mouth in hd patients can be caused by uremic involvement of the salivary glands and dehydration due to the restriction of fluid intake, also use of mouth washes containing alcohol, adverse effects of drug therapy, or mouth breathing. bad taste is caused by xerostomia and the presence of urease - splitting oral organisms, which metabolize urea and elaborate ammonia. the uremic fetor, an ammoniacal odor, is typical of uremic patients and is caused by a high concentration of urea in the saliva. results from the present study showed that the dmft score in hd patients was 18.69.9. it is similar to the results of marinho. who reported the dmft score as 17.17.8 compared to 15.237.07 in the controls. in the netherlands, the dmft score was 13.37.5 in adult hd patients. in kerman, there are different reports regarding the dmft score in hd patients compared with the general population. in this research, we did not have a control group for comparison and it was a limitation in our study, but the dmft score in our hd patients was higher than the reported dmft scores in the controls of some studies in the literature including kalsbeek. who reported a score of 14.76.4 in 808 dentate subjects (aged 2554 years), brito. who showed a dmft score of 13.9 in 74 healthy subjects (mean age 40.312.9), and marinho. who determined a score of 15.237.07 in 64 controls (mean age 6011 years) however, we could not have a precise statistical analysis to test the significance of these observed differences due to confounding variables, especially age, sex, and educational level, not matching. in our study, these results could be caused by a poor oral hygiene level among hd patients probably resulted from the low socioeconomic status of patients. an altered serum phosphorus calcium balance might be responsible with increased calculus deposition resulting from changes in salivary composition as well. it could be related to a possible antibacterial effect of urea or increased calculus. in agreement with the same study, our patients reported brushing infrequently and also none of them had ever had a routine dental check - up. this may be related to loss of motivation, low socioeconomic status, and high cost of dental care services. our patients had poor dental hygiene and a high dmft score, especially women, singles, those with low dialysis adequacy, and with a low educational level. these results would imply further emphasis on the effective implementation of an oral health promotion program. the oral health maintenance plan for patients receiving dialysis should be reinforced by the dialysis team and dentists. further studies regarding the comparison of the dmft score of hd patients and general population are needed. our study was limited by study setting ; intraoral examination was done only at bedside. because of not using probing and radiography, the number of decayed teeth reported in our study could have been underestimated. also we did not have the status of dentition and oral hygiene prior to the hd for the detection of the actual severity of oral hygiene and dmft during the hd. this health situation analysis showed that dental care of dialysis patients in our center is neglected. the awareness of oral care should be raised among dialysis patients, their nephrologists, and dentists in our centers. | due to increased survival among hemodialysis (hd) patients, new problems including concerns of oral health have appeared. in this study, we aimed to evaluate the oral health status and related risk factors in iranian hd patients. demographic information, medical history, laboratory findings, and dental health status were gathered. the decayed, missing and filled teeth (dmft) index in accordance with the world health organization (who) criteria was obtained. kt / v was calculated for patients. a p - value of < 0.05 was considered statistically significant. seventy - two patients were evaluated, with a mean age and hd time of 53.415.3 years and 36.933.8 months, respectively. thirty - five (48.6%) complained of dry mouth, 33 (49.3%) of taste change, 22 (31%) of malodor mouth, and 30 (46.9%) had dental calculus. the overall mean dmft score was 18.69.9. dmft score had a negative significant correlation with kt / v (r=0.4, p=0.004). women and singles as well as patients with a low educational level and/or lesser dialysis time had a significantly higher dmft score (p<0.05). kt / v was significantly lower in patients suffering from dry mouth and dental calculus (p<0.05). interestingly dmft score was significantly lower in patients with dental calculus compared to patients without it (p=0.001). it seems that our patients have a poor dental hygiene level and high dmft score especially women, singles, patients with low kt / v and a low education level. the oral health maintenance program for a patient receiving dialysis should be reinforced in our centers. |
aside from the symmetry of homomeric complexes, many protein domains are made of repeating units that are arranged in a symmetric manner. proteins with such internal symmetry are interesting objects to study. since gene duplication is a relatively frequent event, it is possible that proteins with repeating units were the first complex structures to arise in the evolution of protein structures. internally symmetric proteins have a diverse array of function (1) and are probably good starting structures for a de novo design of protein structures with a desired function. the interface between the repeating units serves as a prototype of general protein protein interaction interface. generally, detecting internal symmetry enhances our understanding of the protein structure, folding and function. the recent study on the proton - gated urea channel from helicobater pylori (2) is an example in which symd was used to detect and characterize the internal symmetry of the molecule. many algorithms have been described for detecting the internal symmetry of a protein structure (37). rcsb pdb server (http://source.rcsb.org/jfatcatserver/symmetry.jsp) allows users to examine internal pseudo - symmetry from structures in pdb (8) or scop (9,10), but not the users own structural files. the gangsta+ server (http://agknapp.chemie.fu-berlin.de/gplus/index.php?page=symmetry) takes structures from pdb, scop or the local drive, but does not output the symmetry axis nor does it give the order (fold) of the symmetry. the symd webserver is a web application we built on the galaxy platform, which runs the symd algorithm. a brief description of the symd algorithm is given below and a full description can be found in our previous publication (1). symd algorithm works by trying many different transformations (rotation and translation) that will result in a large number of residues structurally aligned between the original and the transformed structures. the structure is judged to be symmetric if one or more of these trial transformations result in a large number of residues superimposed. more specifically, the algorithm first duplicates the structure of interest, circularly permutes the sequence numbering by k residues and generates the k - th initial sequence alignment by aligning residue i of the original structure with residue i of the permuted structure for all i or all i greater than k. this initial alignment is then fed into the rse program (11) to obtain the optimal structure - based sequence alignment. symd repeats this procedure for each initial shift k, from 1 to n-3, (alignment scan) where n is the number of residues of the structure. the goodness of the alignment is measured by t - score, which is a weighted number of aligned residue pairs (12) : \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation } t = \sum\limits_{ij,|i - j| { > } s\ ; } { \frac{1}{{1 + \left ({ \frac{{d_{ij } } } { { d_0 } } } \right)^2 } } } \end{equation } \end{document}where dij is the c distance between the aligned residue pair i and j, which are more than s residues apart where s = 3 to avoid self - alignments. the distance cut - off d0 can be varied by the user (the default value is 2) and the summation is over all aligned residue pairs. symd reports the transformation matrix and the sequence alignment that produced the best t - score for each initial shift k. it also calculates the position and orientation of the (potential) symmetry axis, as well as the rotation angle and the translation along the symmetry axis from the calculated transformation matrix. symd webserver is accessed in a standard web browser and is therefore independent of any operating system and requires no installation. it allows users to upload their own structure files in pdb format as well as to retrieve structures from pdb (http://www.rcsb.org/pdb/) or domain databases such as cath (13) or scop as inputs. symd webserver uses the galaxy (14) platform, which has been used extensively in genomics research. here we take advantage of the tool for running a workflow and of the extensibility the galaxy platform provides and apply it on protein symmetry studies. the symd webserver is hosted in a vmware vsphere virtualized ubuntu 12 server with an apache webserver front - end proxy. jmol (http://www.jmol.org) is used for structure visualization and jalview (15) for sequence alignment visualization and analysis. similar to other galaxy systems, the symd webserver always has three panels : tools on the left for selecting input, initiating a computation, and viewing instructions ; details in the middle for managing tool settings and displaying data and history on the right for a list of input and output files as well as visualization tools. users can upload their own structures of interest in pdb format or retrieve a chain or a domain from the scop, cath or pdb database, by selecting one of the options under provide data for computation in the left tools panel. structures that are successfully fetched will be listed in the history panel on the right. the content of the file can be displayed in the middle detail panel by clicking on the eye icon in the history panel. the structure can be viewed in jmol by clicking the jmol link in the history panel., the user can choose the option perform symd calculation in the left tools panel. the names of the stored structures are then shown in the drop - down list in the middle, detail, panel, from which the user can choose one structure for symd computation. users may input different d0 cut - off (range from 0.0 to 6.0) for t - score calculation. when the initial shift value, which is the number of residues initially shifted for circular permutation and initial alignment, is explicitly specified, optimal alignment using only the specified initial shift will be calculated. otherwise, symd will perform the alignment scan and report the best shift alignment which has the highest z - score. the color changes from grey to green if computation is done successfully, or red if a problem is encountered. symd program generates three output files, which are listed in the history panel on the right when the calculation is finished. they are the alignment scan information file (x-info.txt), two superposed structures, one original and the other best (highest scoring) transformed structure, with the corresponding symmetry axis (x-trfm.pdb), and the sequence alignment file for the best transformation (x-best.fasta), where x is the name of the structure. each of these files can be viewed directly (by clicking the eye icon) or downloaded (by clicking the disc icon). users can always retrieve the data later by opening the symd webpage and clicking the file name in the history panel. the alignment scan information file (figure 1a) gives information on the optimal alignment obtained from each initial shift. the items included in the default output are the t - score, z - score, the number of residues aligned, and the rotation angle and the translation along the rotation axis obtained from the optimal transformation matrix. the rotation axis of the transformation that produced the best t - score overall is considered the symmetry axis of the molecule. transformations from all other initial shifts in the alignment scan are considered as signal or noise depending on whether the rotation axis of the transformation aligns with that of the symmetry axis within a certain tolerance (angle between the rotation axes is less than 18 = arcos(0.95)). (b) clicking the scatterplot hyperlink displays the z - score versus initial shift and the z - score versus angle interactive scatter plots. the six signal peaks in the example plot indicate that the domain has a 7-fold symmetry. hovering the cursor over a point in the scatter plot in addition to the information in the table format, symd webserver also displays two interactive scatter plots : z - score versus initial shift and z - score versus rotation angle (figure 1b). the number of signal peaks shown in the z - score versus rotation angle plot is equal to the number of repeating units of the symmetric protein minus one. upon rotating every 90 degrees, the structure superposes to the original structure and produces a high z - score. the x and y values of each point in the scatter plot can be displayed by hovering the cursor over the point. for proteins with open, helical symmetry, such as superhelices, e.g. 1bk5a, the signal peaks show more distinctly in the z - score versus initial shift plot. the transformed structure and the symmetry axis (figure 2a) can be downloaded in pdb format by clicking the disc icon in the x-trfm.pdb section in the history panel. to visualize the symmetry of the structure directly, the symmetry axis along with the original and the superposed transformed structures can be displayed in jmol (figure 2b). (a) clicking the eye icon displays the pdb - format file in the detail panel. (b) clicking the jmol hyperlink displays the original and transformed structures and the symmetry axis in jmol. the coordinates of the structures and the axis can also be downloaded by clicking the disc icon. the sequence alignment generated by rse between the original and transformed structures is displayed in jalview for examination (figure 3b). the fasta format alignment file can also be viewed by clicking the eye icon under x-best.fasta section and downloaded by clicking the disc icon (figure 3a). (a) clicking the eye icon displays the fasta format file in the detail panel. in addition to the text explanation of different parameters and different results, the example run video in help section also provides interactive instruction for symd users. the webserver also has a link where users can download the symd executable to run off - line. the symd webserver is hosted in a vmware vsphere virtualized ubuntu 12 server with an apache webserver front - end proxy. jmol (http://www.jmol.org) is used for structure visualization and jalview (15) for sequence alignment visualization and analysis. similar to other galaxy systems, the symd webserver always has three panels : tools on the left for selecting input, initiating a computation, and viewing instructions ; details in the middle for managing tool settings and displaying data and history on the right for a list of input and output files as well as visualization tools. users can upload their own structures of interest in pdb format or retrieve a chain or a domain from the scop, cath or pdb database, by selecting one of the options under provide data for computation in the left tools panel. structures that are successfully fetched will be listed in the history panel on the right. the content of the file can be displayed in the middle detail panel by clicking on the eye icon in the history panel. the structure can be viewed in jmol by clicking the jmol link in the history panel., the user can choose the option perform symd calculation in the left tools panel. the names of the stored structures are then shown in the drop - down list in the middle, detail, panel, from which the user can choose one structure for symd computation. users may input different d0 cut - off (range from 0.0 to 6.0) for t - score calculation. when the initial shift value, which is the number of residues initially shifted for circular permutation and initial alignment, is explicitly specified, optimal alignment using only the specified initial shift will be calculated. otherwise, symd will perform the alignment scan and report the best shift alignment which has the highest z - score. the color changes from grey to green if computation is done successfully, or red if a problem is encountered. symd program generates three output files, which are listed in the history panel on the right when the calculation is finished. they are the alignment scan information file (x-info.txt), two superposed structures, one original and the other best (highest scoring) transformed structure, with the corresponding symmetry axis (x-trfm.pdb), and the sequence alignment file for the best transformation (x-best.fasta), where x is the name of the structure. each of these files can be viewed directly (by clicking the eye icon) or downloaded (by clicking the disc icon). users can always retrieve the data later by opening the symd webpage and clicking the file name in the history panel. the alignment scan information file (figure 1a) gives information on the optimal alignment obtained from each initial shift. the items included in the default output are the t - score, z - score, the number of residues aligned, and the rotation angle and the translation along the rotation axis obtained from the optimal transformation matrix. the rotation axis of the transformation that produced the best t - score overall is considered the symmetry axis of the molecule. transformations from all other initial shifts in the alignment scan are considered as signal or noise depending on whether the rotation axis of the transformation aligns with that of the symmetry axis within a certain tolerance (angle between the rotation axes is less than 18 = arcos(0.95)). (b) clicking the scatterplot hyperlink displays the z - score versus initial shift and the z - score versus angle interactive scatter plots. the six signal peaks in the example plot indicate that the domain has a 7-fold symmetry. hovering the cursor over a point in the scatter plot displays the x- and y - coordinates of the point. in addition to the information in the table format, symd webserver also displays two interactive scatter plots : z - score versus initial shift and z - score versus rotation angle (figure 1b). the number of signal peaks shown in the z - score versus rotation angle plot is equal to the number of repeating units of the symmetric protein minus one. for example, 1gena is a 4-bladed -propeller with a 4-fold internal symmetry. upon rotating every 90 degrees, the structure superposes to the original structure and produces a high z - score. the x and y values of each point in the scatter plot can be displayed by hovering the cursor over the point. for proteins with open, helical symmetry, such as superhelices, e.g. 1bk5a, the signal peaks show more distinctly in the z - score versus initial shift plot. the transformed structure and the symmetry axis (figure 2a) can be downloaded in pdb format by clicking the disc icon in the x-trfm.pdb section in the history panel. to visualize the symmetry of the structure directly, the symmetry axis along with the original and the superposed transformed structures can be displayed in jmol (figure 2b). (a) clicking the eye icon displays the pdb - format file in the detail panel. (b) clicking the jmol hyperlink displays the original and transformed structures and the symmetry axis in jmol. the coordinates of the structures and the axis can also be downloaded by clicking the disc icon. the sequence alignment generated by rse between the original and transformed structures is displayed in jalview for examination (figure 3b). the fasta format alignment file can also be viewed by clicking the eye icon under x-best.fasta section and downloaded by clicking the disc icon (figure 3a). (a) clicking the eye icon displays the fasta format file in the detail panel. in addition to the text explanation of different parameters and different results, the example run video in help section also provides interactive instruction for symd users. the webserver also has a link where users can download the symd executable to run off - line. symd webserver is the first web - based application allowing users to upload proteins of interest or retrieve them from various databases, and analyze the symmetry property of the protein. it provides not only the numerical data in different formats but also a visual analysis of the symmetry axis in jmol, and interactive text and video tutorials. the webserver is useful for synthetic biological design and for studying protein structure, function and evolution. intramural research program of the nih, national cancer institute, center for cancer research. | internal symmetry of a protein structure is the pseudo - symmetry that a single protein chain sometimes exhibits. this is in contrast to the symmetry with which monomers are arranged in many multimeric protein complexes. symd is a program that detects proteins with internal symmetry. it proved to be useful for analyzing protein structure, function and modeling. this web - based interactive tool was developed by implementing the symd algorithm. to the best of our knowledge, symd webserver is the first tool of its kind with which users can easily study the symmetry of the protein they are interested in by uploading the structure or retrieving it from databases. it uses the galaxy platform to take advantage of its extensibility and displays the symmetry properties, the symmetry axis and the sequence alignment of the structures before and after the symmetry transformation via an interactive graphical visualization environment in any modern web browser. an example run video displays the workflow to help users navigate. symd webserver is publicly available at http://symd.nci.nih.gov. |
in the previous issue of critical care, niklason and colleagues use computer modeling to point out that blood flowing through unventilated regions of the lung (a shunt) will increase arterial partial pressure of carbon dioxide (pco2) if ventilation remains constant. this will increase the calculated physiological dead space accordingly (above that normally present due to the volume of air in the conducting airways). they also show that the increase in pco2 can be avoided by even modest increases in total alveolar ventilation (although the calculated dead space will remain elevated). while this is not an entirely novel discovery (west performed very similar calculations in 1969 as did mecikalski and colleagues in 1984), it is well worth having niklason and colleagues remind us that physiological dead space not only can be caused by the development of regions with a high ventilation / perfusion ratio (va / q), but also can come from areas of low va / q and a shunt. after all, physiological dead space is simply the difference between arterial and mixed expired pco2 divided by the arterial pco2. first, it should be remembered that, since introduced by riley and cournand more than 50 years ago, physiological dead space is a virtual concept wherein the lung is conceived as a two - compartment organ in which one compartment is normal and the other is completely unperfused. physiological dead space, then, is the percentage of the tidal volume that must be distributed to the alveolus that is completely unperfused (and which thus delivers no co2 to the expired gas) to account for the difference between measured arterial and mixed expired pco2. physiological dead space in actual patients may be increased even when no alveoli are completely unperfused as is the case here in the presence of a shunt. it is useful as a general parameter quantifying gas exchange disturbances but must not be overinterpreted as necessarily implying the existence of unperfused alveoli. second, as niklason and colleagues show, the relationship between shunt and physiological dead space is nonlinear, especially when shunts are high. a shunt of 20% of the cardiac output increases dead space by just 5%, a shunt of 40% raises it to approximately 11%, but a shunt of 60% produces a dead space of about 20%. this is because basic mass balance considerations show that the increase in arterial pco2 caused by a shunt depends on the factor qs/(100 - qs), where qs is the percentage shunt. thus, for co2exchange, the importance of shunts of less than approximately 30% is not great, but as shunts approach and exceed 50%, the potential for hypercapnia increases rapidly. third, very modest increases in alveolar ventilation can return the arterial pco2 to normal : an increase from just 5 to 7 l / minute will restore normocapnia (assuming no other changes have occurred or abnormalities exist as ventilation is increased), even when the shunt is 60% of the cardiac output. fourth, va / q inequality is generally a cause of greater physiological dead space than shunt is (figure 1) (calculations using algorithms from). for example, it takes a very large, 60% shunt to increase dead space by 20% but a log - normal pattern of only moderate va normal log sdq is less than 0.6, and the highest log sdq values seen are about 2 to 2.5. log sdq is a parameter defined for quantifying va / q inequality in the multiple inert gas elimination technique and is the second moment (dispersion) of the va / q distribution on a log scale. comparison of effects of shunt (top) and ventilation / perfusion ratio (va / q) inequality (bottom) on calculated physiological dead space. in general log sdq, second moment (dispersion) of the ventilation / perfusion distribution on a log scale. fifth, niklason and colleagues show that, for any given value of shunt, additional perturbations commonly seen in the intensive care unit influence arterial pco2 and therefore will increase calculated dead space. this also means that a high cardiac output will reduce the dead space effect of shunt, as will alkalosis. the clinical message is that observed changes in dead space may reflect changes in cardiac output or acid / base state rather than changes in the shunt itself. in summary, the calculations of niklason and colleagues serve to point out the complexity of gas exchange in critical illness and the challenges we face in trying to interpret apparently simple measurements as indicators of the lung 's ability to carry out its primary responsibility gas exchange. co2 = carbon dioxide ; log sdq = second moment (dispersion) of the ventilation / perfusion distribution on a log scale ; pco2 = partial pressure of carbon dioxide ; va / q = ventilation / perfusion ratio. | since around 1950, physiological dead space the difference between arterial and mixed expired pco2 (partial pressure of carbon dioxide) divided by the arterial pco2 has been a useful clinical parameter of pulmonary gas exchange. in the previous issue of critical care, niklason and colleagues remind us that physiological dead space, while easily measured, consolidates potentially very complex physiological derangements into a single number. the authors show how shunts raise arterial pco2, thereby increasing dead space, and how changes in other variables such as cardiac output and acid / base state further modify it. a solid understanding of respiratory physiology is required to properly interpret physiological dead space in the critically ill. |
extensive epidemiological studies suggest that certain types of cancers show a higher prevalence rate and a higher risk of mortality in a patient population suffering from diabetes mellitus (dm). liver and pancreatic cancers show a strong relationship with dm, and both of these organs play a central role in the pathophysiology of diabetes. other cancers, such as colorectal, breast, endometrial and renal, and renal cancer also show an association with dm, whereas prostate cancer appears to have a negative association with dm. thus, it is now evident that a higher cancer risk and mortality rate is observed in dm patients compared to euglycemic individuals. furthermore, dm and cancer are frequently diagnosed in the same individuals, suggesting that those two diseases share the common risk factors and pathophysiological mechanisms. the underlying mechanisms behind this association have not been fully elucidated ; however, plausible connections consist of hyperinsulinemia, insulin resistance, chronic inflammation, oxidative stress, and hyperglycemia ; all of these factors potentially promote tumor progression in various ways. the impact of insulin, insulin - like growth factor-1 (igf-1) and chronic inflammation in cancer progression has been extensively studied, whereas effects of hyperglycemia on cancer have received less attention, although hyperglycemia is one of the most widely studied metabolic changes in dm. hyperglycemia is defined as a state of excess glucose concentration in circulation, a hallmark for both type 1 dm and type 2 dm. due to insufficient insulin production in pancreatic cells additionally, the increase of systemic insulin resistance in type 2 dm leads to hyperglycemia as well. hyperglycemia indirectly influences cancer cells through an increase in the levels of insulin / igf-1 and inflammatory cytokines in circulation. beyond that, there are reasons to believe that hyperglycemia per se has a direct impact on cancer cell proliferation, apoptosis and metastasis. high glucose activates various signaling pathways that cooperate to control cancer cell behavior, such as proliferation, migration, invasion and recurrence. furthermore, epigenetic modulations of oncogenic pathways induced by high glucose result in prolonged activation of cancer cell proliferation. however, these direct effects of high glucose in cancer cell behavior are relatively unexplored, and more needs to be learned about which signaling pathways are involved and how they are controlled. below, we will discuss the potential mechanisms linking hyperglycemia to cancer progression, with a special focus on tumor cell proliferation, apoptosis, invasion and the epigenetic variations in cancer cells upon hyperglycemic exposure. this will by necessity also require a discussion of the efficacy of dm therapeutics for cancer growth. enhanced glucose uptake in cancer cells is a well - established hallmark of cancer cells. the enhanced glucose metabolism in cancer cells is referred to as the warburg effect, which comprises the increase in aerobic glycolysis in cancer cells defined by warburg. in this respect, hyperglycemia could provide a high glucose fuel source for cancer cells supporting rapid proliferation. indeed, in vitro studies with cancer cell lines indicate that high concentrations of glucose levels regulate enhanced expression of genes associated with promoting cancer cell proliferation, invasion, and migration. in vivo animal studies are plagued by technical limitations to evaluate the effects of hyperglycemia on cancer cells. this is due to the fact that in order to induce hyperglycemia in these rodent models, streptozotocin is used to destroy pancreatic -cells. this leads to hyperglycemia, but obviously also prompts the loss of insulin in circulation. insulin is an intrinsic mitogen affecting tumor growth. in humans, elevated glucose levels in circulation serve as an established predictor of poor survival in cancer patients. in line with that multiple proteins have been implicated as mediators of hyperglycemia and cancer cell proliferation (fig. 1). recent in vitro studies suggest that the expression of glucose transporters, such as the glut1 and glut3 isoforms, is regulated under hyperglycemic conditions in jar cells, a choriocarcinoma cell line. hyperglycemic conditions in vitro (such as 25 mm d - glucose) trigger increased glucose uptake in jar cells due to a transcriptional increase and enhanced protein levels for glut1 and glut3. growth factors, such as epidermal growth factor (egf) levels are augmented by high glucose treatment in pancreatic cancer cell lines, such as bxpc-3 and panc-1, and subsequently activate its receptor, the epidermal growth factor receptor (egfr), a well - known oncogenic pathway. in addition, the levels of protein kinase c (pkc) and peroxisome proliferator - activated receptors (ppars) are stimulated under hyperglycemic conditions in mcf-7 human breast cancer cells. high glucose accelerates the cell cycle through regulating the levels of key proteins, such as cyclin - dependent kinase 2, e2f, cyclina, and cycline, resulting in increased proliferation. furthermore, hyperglycemic conditions augment the levels of glial cell line derived neurotophic factor (gdnf) and its tyrosine kinase receptor gene, the rearranged during transfection (ret) gene, in human pancreatic cancer cells, such as bxpc-3 and mia paca-2 cells. gdnf is a cytokine related to the transforming growth factor- family, enhancing the survival and differentiation of midbrain dopaminergic neurons as well as promoting pancreatic cancer cell proliferation and invasion mediated through a protein complex of ret / gdnf - family receptor -1 (gfr -1). taken together, these data strongly implicate hyperglycemia as a contributing factor leading to enhanced cell proliferation. apoptosis, the process of programmed cell death, is a genetically regulated process that is essential for multicellular organisms. the connection between hyperglycemia and cancer cell apoptosis is unclear ; however, there are several possible connections suggested (fig. many tumors are exposed to hypoxia due to limited oxygen supplies during rapid anabolic cell proliferation. in response to hypoxia, hypoxia inducible factor-1 (hif1), a key transcriptional regulator of the hypoxic response, this leads to the increased expression of genes associated with glucose metabolism, angiogenesis and survival / antiapoptotic processes. under normoxic conditions, hif1 is degraded by hif prolyl hydroxylase (phd) enzymes, and this process is oxygen dependent. hyperglycemia regulates the stability and function of hif1 through interfering with the degradation of hif1 by phd enzymes, which causes increased cancer cell survival and conveys antiapoptotic qualities upon the tumor. recent studies also suggest that glucose metabolism in cancer cells protects cytochrome c - mediated apoptosis. glutathione is one of the main antioxidant mediators of cells, which is reduced by nicotinamide adenine dinucleotide phosphate (nadph) derived from enhanced glucose metabolism, such as the pentose phosphate pathway. epidemiological data suggest that metastatic growth is the main cause of deaths in 90% patients carrying solid tumors. metastatic growth ensues when cancer cells become invasive through an altered phenotype, penetrating into the circulatory system, and taking hold in a distant organ. epithelial - mesenchymal transition (emt), a multifaceted process critical for the acquisition of migration, invasiveness and pluripotent stem cell - like phenotype, plays a pivotal role in the metastatic process. several studies suggest that high glucose induces cancer cell invasiveness and migration through stimulating emt (fig. high glucose decreases e - cadherin levels, an epithelial cell marker, and increases the pkc- pathway, leading to a more invasive phenotype. recently, dong. suggested that hyperglycemia induces the emt phenotype and the expression of cancer stem cell markers in basal luminal breast carcinoma, which leads to reduced reactive oxygen species (ros) generation and increased cell survival. hydrogen peroxide has been implicated in the migration and invasive activity of pancreatic cancer cells under hyperglycemic conditions. the migration and invasion of pancreatic cancer cell lines, such as bxpc-3 and panc-1 cells, are all augmented by superoxide dismutase (sod) which catalyzes the conversion of the superoxide anion to hydrogen peroxide under hyperglycemic conditions. the mrna expression of urokinase plasminogen activator, one of the mediators involved in cell migration, is also up - regulated under high glucose levels with sod. hyperglycemia is thought to promote migration of breast cancer cells via zinc and its transporters, zrt / irt - like protein 6 (zip6) and zrt / irt - like protein 10 (zip10). thus, high glucose increases zinc uptake, and the expression of zip6 and zip10 transporters in breast cancer cells, such as mcf-7. zip6 regulates emt, and zip10 is known to be involved in cancer cell migration. chronic hyperglycemic conditions may cause epigenetic changes in oncogenic pathways in cancer cells (fig. a recent study suggested that epigenetic silencing of the critical gluconeogenic enzyme, fructose-1,6-biphosphatase through the emt - related transcription repressor snail, increases glycolysis and nadph production via the pentose phosphate pathway and a reduction in oxidative phosphorylation. these metabolic alterations induced by hyperglycemia contribute to lower ros generation and increase of -catenin / tcf4 activation, a key pathway for the acquisition of a cancer stem cell phenotype, leading to better survival. recent studies show that transient hyperglycemia induces the recruitment of the transcription factor set7 to the nuclear factor-b (nf-b) p65 promoter. the recruitment of set7 to p65 promoter enhances histone 3 lysine 4 monomethylation within the promoter, resulting in increased nf-b activation and increased inflammation. after cancer cells are exposed to hyperglycemic conditions, a subset of oncogenic pathways are permanently activated, even after hyperglycemic conditions are normalized to euglycemic conditions. however, the specific molecular mechanism how a cancer cell gets permanently " rewired " and the hyperglycemic memory instilled is still unclear. we suggested that the neuregulin-1 (nrg1)-her3 pathway is up - regulated in tumors derived from hyperglycemic patients or rodents. nrg1 belongs to a family of egf - like ligands for her3, itself a member of the egfr of receptor tyrosine kinase, related to cancer cell proliferation, survival and metastasis. once activated, these cancer cells originating from hyperglycemic conditions grow faster than control cells even under euglycemic conditions. given these strong epidemiological connections seen in patients suffering from dm with a higher risk to develop some types of cancer, these increased risks need to be taken into account and prophylactic screening is warranted. however, an additional question is whether antidiabetic therapeutic approaches also reduce the risk of associated cancers. there are a variety of antidiabetic interventions, including sulfonylureas, -glucosidase inhibitors, biguanides, and thiazolidinediones (tzds). the major groups of antidiabetic drugs increase the level of circulating insulin, thereby reducing hyperglycemia by various mechanisms. especially, compounds such as metformin inhibit hepatic gluconeogenesis to reduce the level of circulating glucose and increasing insulin sensitivity through the 5'amp - activated protein kinase and akt / mtor pathway. it can also exert anticancer effects via modulation of dicer (also known as endoribonuclease dicer or helicase with rnase motif) activity, via mir33a up - regulation, and via targeting c - myc (myc proto - oncogene protein). despite a lot of excitement and attention, clinical data inferring anti - mitogenic effects of antidiabetic drugs and their effects on cancer incidence and mortality remain somewhat controversial. as such, some studies suggest that insulin and insulin glargine can increase cancer incidence, while other studies conclude that there is no effect. similarly, tzds have been reported to exert both tumor growth supporting and inhibitory roles, whereas metformin and other biguanides decrease the cancer incidence or have no impact. another drawback of treating cancers in the context of dm is at the level of the memory effects of hyperglycemia and the associated epigenetic alterations in key oncogenic pathways in cancer cells. thus, merely managing blood glucose levels per se might not be sufficient to obtain a full therapeutic impact. we need to expand our understanding of the key specific target genes and pathways affected by hyperglycemia within tumors, such that these pathways may be targeted in a more directed approach. for instance, the finding that the nrg1/her3 axis is specifically and disproportionately activated in women diagnosed with breast cancer and found to be hyperglycemic at the time of diagnosis may suggest an effective first line of treatment with neutralizing her3 antibodies which would not necessarily be the first choice in the context of other types of breast cancer. enhanced glucose uptake in cancer cells is a well - established hallmark of cancer cells. the enhanced glucose metabolism in cancer cells is referred to as the warburg effect, which comprises the increase in aerobic glycolysis in cancer cells defined by warburg. in this respect, hyperglycemia could provide a high glucose fuel source for cancer cells supporting rapid proliferation. indeed, in vitro studies with cancer cell lines indicate that high concentrations of glucose levels regulate enhanced expression of genes associated with promoting cancer cell proliferation, invasion, and migration. in vivo animal studies are plagued by technical limitations to evaluate the effects of hyperglycemia on cancer cells. this is due to the fact that in order to induce hyperglycemia in these rodent models, streptozotocin is used to destroy pancreatic -cells. this leads to hyperglycemia, but obviously also prompts the loss of insulin in circulation. insulin is an intrinsic mitogen affecting tumor growth. in humans, elevated glucose levels in circulation serve as an established predictor of poor survival in cancer patients. in line with that multiple proteins have been implicated as mediators of hyperglycemia and cancer cell proliferation (fig. 1). recent in vitro studies suggest that the expression of glucose transporters, such as the glut1 and glut3 isoforms, is regulated under hyperglycemic conditions in jar cells, a choriocarcinoma cell line. hyperglycemic conditions in vitro (such as 25 mm d - glucose) trigger increased glucose uptake in jar cells due to a transcriptional increase and enhanced protein levels for glut1 and glut3. growth factors, such as epidermal growth factor (egf) levels are augmented by high glucose treatment in pancreatic cancer cell lines, such as bxpc-3 and panc-1, and subsequently activate its receptor, the epidermal growth factor receptor (egfr), a well - known oncogenic pathway. in addition, the levels of protein kinase c (pkc) and peroxisome proliferator - activated receptors (ppars) are stimulated under hyperglycemic conditions in mcf-7 human breast cancer cells. high glucose accelerates the cell cycle through regulating the levels of key proteins, such as cyclin - dependent kinase 2, e2f, cyclina, and cycline, resulting in increased proliferation. furthermore, hyperglycemic conditions augment the levels of glial cell line derived neurotophic factor (gdnf) and its tyrosine kinase receptor gene, the rearranged during transfection (ret) gene, in human pancreatic cancer cells, such as bxpc-3 and mia paca-2 cells. gdnf is a cytokine related to the transforming growth factor- family, enhancing the survival and differentiation of midbrain dopaminergic neurons as well as promoting pancreatic cancer cell proliferation and invasion mediated through a protein complex of ret / gdnf - family receptor -1 (gfr -1). taken together, these data strongly implicate hyperglycemia as a contributing factor leading to enhanced cell proliferation. apoptosis, the process of programmed cell death, is a genetically regulated process that is essential for multicellular organisms. the connection between hyperglycemia and cancer cell apoptosis is unclear ; however, there are several possible connections suggested (fig. many tumors are exposed to hypoxia due to limited oxygen supplies during rapid anabolic cell proliferation. in response to hypoxia, hypoxia inducible factor-1 (hif1), a key transcriptional regulator of the hypoxic response, this leads to the increased expression of genes associated with glucose metabolism, angiogenesis and survival / antiapoptotic processes. under normoxic conditions, hif1 is degraded by hif prolyl hydroxylase (phd) enzymes, and this process is oxygen dependent. hyperglycemia regulates the stability and function of hif1 through interfering with the degradation of hif1 by phd enzymes, which causes increased cancer cell survival and conveys antiapoptotic qualities upon the tumor. recent studies also suggest that glucose metabolism in cancer cells protects cytochrome c - mediated apoptosis. glutathione is one of the main antioxidant mediators of cells, which is reduced by nicotinamide adenine dinucleotide phosphate (nadph) derived from enhanced glucose metabolism, such as the pentose phosphate pathway. epidemiological data suggest that metastatic growth is the main cause of deaths in 90% patients carrying solid tumors. metastatic growth ensues when cancer cells become invasive through an altered phenotype, penetrating into the circulatory system, and taking hold in a distant organ. epithelial - mesenchymal transition (emt), a multifaceted process critical for the acquisition of migration, invasiveness and pluripotent stem cell - like phenotype, plays a pivotal role in the metastatic process. several studies suggest that high glucose induces cancer cell invasiveness and migration through stimulating emt (fig. high glucose decreases e - cadherin levels, an epithelial cell marker, and increases the pkc- pathway, leading to a more invasive phenotype. recently, dong. suggested that hyperglycemia induces the emt phenotype and the expression of cancer stem cell markers in basal luminal breast carcinoma, which leads to reduced reactive oxygen species (ros) generation and increased cell survival. hydrogen peroxide has been implicated in the migration and invasive activity of pancreatic cancer cells under hyperglycemic conditions. the migration and invasion of pancreatic cancer cell lines, such as bxpc-3 and panc-1 cells, are all augmented by superoxide dismutase (sod) which catalyzes the conversion of the superoxide anion to hydrogen peroxide under hyperglycemic conditions. the mrna expression of urokinase plasminogen activator, one of the mediators involved in cell migration, is also up - regulated under high glucose levels with sod. hyperglycemia is thought to promote migration of breast cancer cells via zinc and its transporters, zrt / irt - like protein 6 (zip6) and zrt / irt - like protein 10 (zip10). thus, high glucose increases zinc uptake, and the expression of zip6 and zip10 transporters in breast cancer cells, such as mcf-7. zip6 regulates emt, and zip10 is known to be involved in cancer cell migration. chronic hyperglycemic conditions may cause epigenetic changes in oncogenic pathways in cancer cells (fig. a recent study suggested that epigenetic silencing of the critical gluconeogenic enzyme, fructose-1,6-biphosphatase through the emt - related transcription repressor snail, increases glycolysis and nadph production via the pentose phosphate pathway and a reduction in oxidative phosphorylation. these metabolic alterations induced by hyperglycemia contribute to lower ros generation and increase of -catenin / tcf4 activation, a key pathway for the acquisition of a cancer stem cell phenotype, leading to better survival. recent studies show that transient hyperglycemia induces the recruitment of the transcription factor set7 to the nuclear factor-b (nf-b) p65 promoter. the recruitment of set7 to p65 promoter enhances histone 3 lysine 4 monomethylation within the promoter, resulting in increased nf-b activation and increased inflammation. after cancer cells are exposed to hyperglycemic conditions, a subset of oncogenic pathways are permanently activated, even after hyperglycemic conditions are normalized to euglycemic conditions. however, the specific molecular mechanism how a cancer cell gets permanently " rewired " and the hyperglycemic memory instilled is still unclear. we suggested that the neuregulin-1 (nrg1)-her3 pathway is up - regulated in tumors derived from hyperglycemic patients or rodents. nrg1 belongs to a family of egf - like ligands for her3, itself a member of the egfr of receptor tyrosine kinase, related to cancer cell proliferation, survival and metastasis. once activated, these cancer cells originating from hyperglycemic conditions grow faster than control cells even under euglycemic conditions. given these strong epidemiological connections seen in patients suffering from dm with a higher risk to develop some types of cancer, these increased risks need to be taken into account and prophylactic screening is warranted. however, an additional question is whether antidiabetic therapeutic approaches also reduce the risk of associated cancers. there are a variety of antidiabetic interventions, including sulfonylureas, -glucosidase inhibitors, biguanides, and thiazolidinediones (tzds). the major groups of antidiabetic drugs increase the level of circulating insulin, thereby reducing hyperglycemia by various mechanisms. especially, compounds such as metformin inhibit hepatic gluconeogenesis to reduce the level of circulating glucose and increasing insulin sensitivity through the 5'amp - activated protein kinase and akt / mtor pathway. it can also exert anticancer effects via modulation of dicer (also known as endoribonuclease dicer or helicase with rnase motif) activity, via mir33a up - regulation, and via targeting c - myc (myc proto - oncogene protein). despite a lot of excitement and attention, clinical data inferring anti - mitogenic effects of antidiabetic drugs and their effects on cancer incidence and mortality remain somewhat controversial. as such, some studies suggest that insulin and insulin glargine can increase cancer incidence, while other studies conclude that there is no effect. similarly, tzds have been reported to exert both tumor growth supporting and inhibitory roles, whereas metformin and other biguanides decrease the cancer incidence or have no impact. another drawback of treating cancers in the context of dm is at the level of the memory effects of hyperglycemia and the associated epigenetic alterations in key oncogenic pathways in cancer cells. thus, merely managing blood glucose levels per se might not be sufficient to obtain a full therapeutic impact. we need to expand our understanding of the key specific target genes and pathways affected by hyperglycemia within tumors, such that these pathways may be targeted in a more directed approach. for instance, the finding that the nrg1/her3 axis is specifically and disproportionately activated in women diagnosed with breast cancer and found to be hyperglycemic at the time of diagnosis may suggest an effective first line of treatment with neutralizing her3 antibodies which would not necessarily be the first choice in the context of other types of breast cancer. strong epidemiological data is at hand suggesting an increase of both cancer risk and mortality in dm patients. this is especially relevant for cancers of the liver, pancreas, mammary gland, and the endometrium. hyperglycemia and associated hyperglycemic memory effects and their impact on key cancer cell pathways, such as cell proliferation, apoptosis, migration, and invasion offer new therapeutic avenues. these combined with traditional chemotherapeutic approaches may offer strong synergistic effects towards curbing growth of primary tumors and metastatic lesions. unquestionably, with the ever increasing prevalence of diabetes in the population, affecting younger individuals more than ever before, the interface of metabolic dysregulation and cancer moves increasingly to the forefront and represents as much of a challenge as it is an opportunity for novel therapeutic approaches. | as the prevalence of diabetes mellitus is substantially increasing worldwide, associated diseases such as renal failure, cardiovascular diseases, fatty liver, and cancers have also increased. a number of cancers such as pancreatic, liver, breast, and female reproductive cancers have shown an increased prevalence and a higher mortality rate in diabetic patients compared to healthy subjects. thus, this suggests an association between diabetes, especially type 2 diabetes and cancer incidence and progression. recent studies have suggested that hyperinsulinemia, chronic inflammation and hyperglycemia, all frequently seen in diabetics, may lead to increased tumor growth ; the underlying molecular mechanisms of this association are not fully understood. in particular, chronic hyperglycemic episodes could serve as a direct or indirect mediator of the increase in tumor cell growth. here, we will discuss our current understanding how hyperglycemia and cancer risk may be linked, and what the implications are for the treatment of diabetic cancer patients. |
neonatal herpes simplex virus (hsv) infection, although relatively rare, has a high mortality and morbidity. most (85%) neonatal hsv infections are acquired during delivery, although in utero (5%) and postnatal (10%) infections do occur. neonatal herpes can be localized, skin, eyes, and mouth (sem) infection, central nervous system (cns) disease, or can cause disseminated infection involving multiple organs. disseminated infection is the most severe form of neonatal herpes, with a mortality rate of 85% for untreated neonates. intravenous acyclovir given in a high dose and early in the course of the disease significantly improves prognosis. early diagnosis may be difficult as the characteristic vesicular rash is absent in up to 40% of the neonates who acquire the infection. early symptoms are often nonspecific and the majority of their mothers lack a history of genital herpes infection.[57 ] severe hepatitis may cause potentially fatal, acute liver failure in neonates with disseminated disease. liver transplantation has been carried out successfully in a few reported neonates with fulminant hepatic failure associated with disseminated neonatal hsv disease. approximately, 80% of survivors of disseminated neonatal hsv disease may have normal neurologic development. the risk of neurodevelopmental abnormalities is increased among infants with seizures at or before the initiation of antiviral therapy. we report a case of disseminated hsv with fulminant liver failure who survived without liver transplantation and with a good neurodevelopmental outcome. a 3-kg male was born at term to a healthy mother after a normal pregnancy. the infant was born after 17 h of ruptured membrane with an apgar score of 9 and 9 at 1 and 5 min, respectively, and physical examination at birth was unremarkable. on the fourth day of life, the infant developed fever, lethargy, and moderate respiratory distress. he was admitted to the pediatric intensive care unit, and sepsis workup was performed. he was treated with ampicillin and cefotaxime along with oxygen therapy through a nasal cannula. initial laboratory investigations showed a normal leukocyte count (10200 cells/l), a slightly elevated c- reactive protein level (18 mg / l), and elevated levels of liver enzymes (ast : 270 u / l, alt : 161 u / l), and chest x - ray showed bilateral infiltrates. on the same day, a vesicular eruption in the left groin area with redness of the umbilical stump was noted. on the fifth day of life, he was still febrile and the severity of the respiratory distress was increasing requiring a nasal cpap ; then subsequently, he was intubated and placed on conventional mechanical ventilation. however, due to severe desaturation and respiratory failure, he was shifted to high - frequency oscillatory ventilation (hfov). subsequent laboratory investigations showed thrombocytopenia (49,000 cells/l), leukopenia (2000 cells/l), elevated c - reactive protein level (33 mg / l), ast 6763 u / l, alt : 1174, and marked coagulopathy. the skin eruption, respiratory failure, fulminate hepatic failure, in combination with leukopenia, thrombocytopenia, and fever, raised the possibility of viral infection such as disseminated herpes simplex virus infection. intravenous acyclovir treatment 20 mg / kg / dose every 8 h was commenced on day 2 of admission after obtaining the blood and csf sample for the hsv pcr test. in addition to acyclovir, the infant was treated with the infusion of ffp, platelet, prbc, clotting factors, gcsf, and ivig. on day 6 of admission, the result of blood and csf hsv pcr was positive for hsv - ii virus. retrospectively, both mother and father were tested for hsv and both came as positive for hsv - ii antibody. despite the early initiation of acyclovir and maximum medical support, he underwent complicated course of illness. he developed severe ards with bilateral pneumothorax with bilateral effusion necessitating hfov and bilateral chest drains for almost 24 days. abdominal ultrasound [figure 1 ] showed derangement of the liver parenchymal architecture with fine nodular patterns best reflected on the liver surface with a hypertrophied left hepatic lobe ; no intrahepatic duct dilatation was seen, the gallbladder was tortuous with sludge inside, the spleen was mildly enlarged, and there was an evidence of portal hypertension. he was treated with n - acetylcysteine, ursodiol, carnitine, cholestyramin with lactulose, and propranolol. his liver enzymes were trending down very slowly until almost normalized by the age of 5 months (ast : 56 u / l, alt : 56, total bilirubin : 8 he was fed parentally for about 24 days, and enteral feed was introduced gradually till full feed through ngt. the patient was then shifted to oral feed as breast feeding. repeated abdominal ultrasound at age of 5 months revealed a complete recovery of the hepatic hemodynamics and the nodularity of the liver surface and in the parenchyma was rudimentary with remaining prominence of the left hepatic lobe, complete recovery of the portal hypertension, and no gallbladder or bile duct pathology, and no sludge identified in the gallbladder. liver ultrasound showed derangement of the liver parenchyma architecture with fine nodular patterns on the liver surface with a hypertrophied left hepatic lobe ; no intra hepatic duct dilatation was seen fortunately, his renal function and urine output remained normal throughout the course of the illness apart from urinary tract infection with klebsiella on day 39 of admission which was treated with meropenem and amikacin. neurologically, he did not develop any abnormal movement or seizure, and brain mri was done and reported as normal along with fundoscopic examination of both eyes. he completed almost a 4-week course of intravenous (iv) acyclovir and the last hsv pcr result from csf and blood was negative. one week later, he started to have skin relapse in the form of skin eruption over the left groin, so iv acyclovir was restarted and hsv pcr from the skin lesion and blood was done, which came positive. he was continued on iv acyclovir for 2 weeks and was then shifted to oral acyclovir as suppressive treatment. he was discharged at the age of 2 months on oral acyclovir and on full breast feeding. he was kept on oral acyclovir till the age of 6 months, but 3 days after stopping it, he had another skin relapse over his left foot, left arm, and over the pubic area, so oral acyclovir was started for 1 week and stopped. today, he is off any treatment and with no more relapses documented and with normal neurodevelopment. all but few survivors have neurological impairment (abnormal neurologic status at 1 year was 92% in untreated patients and 86% in treated patients with disseminated disease). to the best of our knowledge, our patient is the first survived case of disseminated hsv with fulminant liver failure without liver transplant and with normal neurodevelopment at 1 year of age. moreover, the indications for the initiation of empiric acyclovir have not been standardized yet. prompt diagnosis was difficult initially because of the early appearance of nonspecific symptoms and signs, but due to clinical deterioration and multiple organ failure in a very short period, in addition to skin lesions, acyclovir was started early at the course of illness. there are some case reports of successful treatment of fulminant neonatal hepatitis caused by disseminated hsv [table 1 ]. cases of fulminant hepatitis caused by disseminated hsv disseminated and cns disease should be treated for a minimum of 21 days, because the persistence of hsv dna in the cerebrospinal fluid (csf) is associated with poor outcome ; repeat lumbar puncture to obtain csf hsv dna pcr near the end of therapy is recommended to make sure that hsv dna pcr is negative and that csf parameters have returned to normal.[101519 ] even after successful parenteral treatment, the recurrence of hsv can occur and may be a lifelong problem for the patient and family. however, recurrent vesicles at sites in the skin, eyes, and mouth are common and occur in 60 - 80% of neonates, with 1 - 12 episodes in the first year of life. therefore, some experts recommend long - term suppressive therapy with oral acyclovir to reduce skin or eye recurrences during infancy. the recurrence of cns disease, as well as emergence of acyclovir - resistant hsv mutants, has occurred in neonates who were receiving oral acyclovir suppression. although our patient received iv acyclovir for 4 weeks, and csf and the blood samples were negative for the hsv pcr test, he developed skin relapse, for which he needed a prophylaxis course of oral acyclovir till the age of 6 months, but even then he continued to have skin relapses after 6 months of age till 1 year of age. the effectiveness of long - term suppression with oral acyclovir to reduce the risk of cns recurrence after neonatal hsv disease is unknown, and cns recurrence in neonates receiving long - term oral suppression has been documented. oral acyclovir suppression therapy is associated with dose - dependent reversible neutropenia in one - half to two - thirds of infants, and an emergence of hsv mutants that are acyclovir resistant has been documented. severe hepatitis, caused by either hsv strains, may cause potentially fatal, acute liver failure in neonates with disseminated disease. liver transplantation has been carried out successfully in a few reported neonates with fulminant hepatic failure associated with disseminated neonatal hsv disease. our patient developed fulminant liver failure and he was a candidate for liver transplant, but with full medical support his liver failure was almost completely resolved, and he is the first known case to the best of our knowledge who survived disseminated hsv with fulminant liver failure without liver transplant. | disseminated neonatal herpes simplex virus (hsv) infection is characterized by progressive multiple organ failure and high mortality rates up to 85% for untreated neonates. it can result from infection with either hsv-1 or hsv-2. we report the first known case of disseminated neonatal herpes associated with fulminant liver failure caused by hsv-2 who survived without liver transplant. |
impacted biliary stones wider in diameter than the distal common bile duct (cbd), and biliary stones failing removal by mechanical lithotripsy are considered complicated biliary stones, which are associated with lower clearance rates or require more invasive extraction techniques. intracorporeal lithotripsy can facilitate fragmentation, but stone and duct visualization are important for accurate targeting. current peroral cholangioscopes (poc) are limited by fragility, restricted mobility or moderate visual resolution. recently, a novel digital single - operator poc, spyglass ds digital controller and catheter (boston scientific, marlborough, united states), was introduced. with high - resolution integrated digital imaging, and 60 % wider field of view, superior visualization of the bile duct can be achieved compared to an earlier - generation device. we present early results of the efficacy and safety of this novel digital poc for guidance of laser lithotripsy of complicated biliary stones. this prospective series included consecutive consenting adult non - pregnant patients with either : 1) an impacted biliary stone > 1.5 cm in diameter and wider than the more distal cbd on endoscopic retrograde cholangiopancreatography (ercp) ; or 2) a biliary stone that failed capture or crushing by basket mechanical lithotripsy (bml), from june 2015 to may 2016 at the prince of wales hospital in hong kong. patients with ongoing cholangitis or biliary pancreatitis, intrahepatic segmental stones, known history of biliary stricture, prior history of altered gastrointestinal / biliary anatomy, refractory bleeding tendencies (platelet count 1.5 despite correction with platelet or fresh frozen plasma transfusions), and contraindications to endoscopy due to comorbidities were excluded. the spyglass ds digital controller houses the video processor and light source as a single unit. on connection to the single - operator spyscope ds cholangioscope, poc - guided holmium : yttrium aluminum garnet (ho : yag) laser lithotripsy was performed as follows. ercp was performed with pre - procedural intravenous (iv) antibiotics, under conscious sedation with iv midazolam or diazemuls and meperidine, and with co2 insufflation. after cannulation and outlining of the stone and cbd by contrast, wire - guided biliary sphincterotomy (if not already performed) was followed by endoscopic papillary balloon dilation with a cre dilation balloon (boston scientific, marlborough, united states) to the diameter of the distal cbd. the single - use 10fr cholangioscope would then be introduced through the working channel of a tjf 260 duodenoscope (olympus medical systems, tokyo, japan), and into the cbd by free - hand technique under direct endoscopic vision to identify the biliary stone target. the 1.8fr ho : yag laser fiber (lumenis, yokneam, israel) was inserted into the cholangioscope s 1.2-mm working channel for lithotripsy underwater and direct visualization with the following laser parameters : energy 1.2 j, rate 10 hz, power 12 w. when ho : yag laser was not available, a 3fr electrohydraulic laser (ehl) delivery fiber (olympus optical, tokyo, japan) was used in conjunction with the lithotron el 27 compact generator (walz elektronik, rohrdorf, germany) with the following power settings : energy up to 950mj, and automatic pulse frequency between 5 hz and 60 hz. laser was applied until fragments of the target stone were no longer lumen filling, and could be dispersed with fluid irrigation (video 1). fragmented stones were then removed with conventional extraction devices, which may include bml to accelerate duct clearance at the discretion of the treating endoscopist. in cases where stone clearance was incomplete, a plastic biliary stent study outcomes were clinical success, defined as visualization, targeting and clearance of intended biliary stone, and the incidence of adverse events (aes) as defined by cotton. within 72 hours after the procedure 1. seventeen patients (10 men, 7 women) with median age of 76 years (range : 45 88 years) consecutively underwent spyglass ds poc - guided laser lithotripsy of 19 complicated biliary stones (17 stones by ho : yag laser, and 2 stones by ehl due to unavailability of ho : yag laser) from june 2015 to may 2016 at the prince of wales hospital (table 1). lithotripsy was performed on 8 of the 17 patients due to an impacted stone with a diameter > 1.5 cm, which was also wider than the distal cbd (fig. 1). nine of 17 patients underwent lithotripsy due to prior failure of the bml to capture or crush their stones. median size of target biliary stone was 2 cm (range : 1 4.5 cm), with the majority of stones located along the common hepatic or common bile duct. one stone was at the central right intrahepatic duct and another at the cystic duct stump. median number of stones was 1 (range : 1 10) per patient. excellent visualization of stone permitting accurate laser targeting was achieved in all cases (fig. complete biliary stone clearance was successful in 94 % of patients (16/17) over a median of 1 endoscopic procedure (range : 1 3). clearance of the target stone could be achieved at the index laser lithotripsy session in 10/16 (63 %) patients. among these 10 cases, median duration of ercp and laser lithotripsy, from duodenoscope intubation to withdrawal, was 90 minutes (range : 40 165 minutes). in the remaining 6 patients who required more than 1 endoscopic session, on test, success of stone clearance at the index lithotripsy procedure was not associated with patient age, indication for lithotripsy, stone size or number of stones. bml was used to facilitate clearance of lithotripsy fragmented stones in 75 % (12/16) of patients. poc, peroral cholangioscope cholangiogram during ercp showing a large common hepatic duct stone, impacted against a more narrow common bile duct impacted biliary stone. b newly diagnosed biliary stricture with thick papillary projections, as visualized by spyglass ds cholangioscope the 1 patient who did not have complete stone clearance had a 2-cm common hepatic duct stone and a new cbd stricture, visualized on cholangioscopy as thick papillary projections (fig. while stone visualization, laser targeting, and stone fragmentation was initiated, complete stone clearance was not performed in view of the need for a plastic biliary stent. due to advanced age and patient comorbidities, no further investigations or interventions were performed. the patient remains well nearly 8 months after lithotripsy. during the 72 hours after laser lithotripsy procedures, one patient had a 3 cm stone impacted at the mid cbd, while the other had a 1-cm cystic duct stone which could not be captured with conventional extraction devices. with conservative management, the patient with concomitant biliary stone and stricture had underlying chronic obstructive pulmonary disease, and developed respiratory distress post - procedure managed by supplemental oxygen and chest physiotherapy. we present one of the earliest clinical series on the role of a new digital single - operator poc to guide laser lithotripsy of complicated biliary stones, demonstrating a 94 % clinical success rate and good safety profile, even among our patients who were predominantly older than 75 years old. we showed this technique effective for managing 2 categories of difficult biliary stones, namely cases of impacted stones larger than the more distal cbd and choledocholithasis failing conventional extraction by bml. currently, individuals with stone / duct mismatch would be subjected to repeated ercps, as impacted large stones have lower bml clearance rates 2 3 4. bml extraction of large stones also has a complication rate of 4 % to 5 % even among experienced endoscopists 5. recently, we demonstrated that spyglass ds poc - guided ho : yag laser lithotripsy was effective for rescue of an impacted extraction stone and basket 6. for stones refractory to bml, intracorporeal lithotripsy can be facilitated by a number of devices, such as the dual - operator mother - daughter system, the single - operator poc or ultraslim gastroscopes. the spyglass poc (boston scientific, marlborough, united states) has the advantages of requiring only a single operator, and the 4-way tip deflection can likely better facilitate cannulation of the papilla and central intrahepatic ducts, as well as allow more specific targeting of sites for biopsies, and stones for lithotripsy. while the first - generation device (spyglass direct visualization system) was limited by moderate visual resolution due to reliance on a 6000-pixel reusable optical probe, the second - generation device (spyglass ds), which is the poc that was evaluated in the current study, has a charged couple device for digital imaging and wider field of view. biliary cannulation is, however, more challenging compared to the other devices, in part due to gastric looping, despite multiple techniques like overtubes or balloon anchors. successful cannulation is, however, rewarded by the availability of narrow - band imaging, which permits more refined characterization of intraductal lesions. a systematic review and meta - analysis on the efficacy of various forms of poc for difficult bile duct stones the larger case series of dual - operator poc, single - operator poc and ultraslim endoscope - guided laser lithotripsy are compared in table 2 8 9 10 11 12. of note, our 94 % clearance rate is comparable to that reported by navaneethan., who evaluated the role of spyglass ds - guided laser lithotripsy in 31 patients with difficult biliary stones 8. however, the stones in that series likely represented a lower risk and less complex group, as the mean patient age was younger at 62 years, the mean stone size was smaller at 1.4 cm, and there were fewer impacted stones (36 %) compared to our cohort. further, that series did not specify the type of laser lithotripsy used (ho : yag, freddy laser lithotripsy or ehl). the only patient in our study who did not achieve ductal clearance had a 2-cm chd stone and a newly diagnosed cbd stricture, managed by partial stone fragmentation followed by stenting. there were no patients with concomitant biliary stone and strictures included in the other study 8. our results are also comparable to those of ho : yag laser lithotripsy and ehl guided by the first - generation spyglass device 9 10. ehl, electrohydraulic lithotripsy ; freddy laser, frequency doubled double pulse neodymium : yag laser ; nr, not reported specifically. our aes included 2 incidents of cholangitis, and a respiratory decompensation in a copd patient, all of whom recovered after conservative measures. cholangitis was likely related to a showering effect of fragmented stones throughout the biliary tree from lithotripsy. due to endoscopic papillary balloon dilation, fluid injected for bile duct clearance may leak out across the papilla, accumulating in the stomach or distal digestive tract and contributing to aspiration risk or fluid overload. this highlights the importance of controlled use of irrigation during the procedure, suctioning of injected fluid washing out from the papilla, and consideration of using the cholangioscope s suction port to aspirate residual fluid in the biliary tree at the end of a procedure. overall, the 4-way 30 tip deflection and digital imaging of the novel spyglass ds cholangioscope enabled simple cannulation of the papilla, with successful localization, clear visualization, and precise targeting of stones throughout the biliary tree, including stones at the central right intrahepatic duct, cystic duct stump, and those proximal to a stricture, all sites associated with more difficult stone extraction. depending on bile duct width, light diffusion can be variable, and light intensity should be adjusted. in contrast to an earlier study, we did not preload the ho : yag laser lithotripsy fiber into the working channel of the spyglass ds cholangioscope before cannulation of the papilla 8. even without preloading, we rarely encountered resistance passing the laser fiber across the tip of the duodenoscope. by advancing the spyglass ds cholangioscope deeper into the biliary tree, the laser fiber can be carried forward into the distal bile duct as confirmed by fluoroscopy. finally, laser lithotripsy may cause a drilling effect without immediate fragmentation, especially when the laser probe tip is too close to the stone surface. the fiber should be withdrawn to 1 mm to 2 mm away from the stone surface to achieve a better effect. although our institution performs high - volume biliary endoscopy, the endoscopists involved had limited prior experience with this device. the high success rate reflects a quick learning curve, and likely generalizability to other centers. limitations of our study included the small sample size, small number of endoscopists involved, and limited use of ehl. nevertheless, our results comprise one of the earliest series showing high efficacy and safety of spyglass ds poc - guided laser lithotripsy for complex biliary stones. in the future, comparative studies evaluating this technique s efficacy as a first - line therapy for difficult biliary stones are warranted. | background / study aims laser lithotripsy can effectively fragment complicated biliary stones, but current cholangioscopes are limited by fragility, restricted mobility or moderate visual resolution. the efficacy and safety of a new digital single - operator peroral cholangioscope to guide laser lithotripsy were evaluated. patients and methods in this prospective single - center series, consecutive patients with complicated biliary stones, defined as impacted stones > 1.5 cm in size and wider than the more distal common bile duct, or stones that failed extraction by basket mechanical lithotripsy, underwent ercp and spyglass ds peroral cholangioscope (boston scientific, marlborough, united states)-guided laser lithotripsy. stone clearance rate and incidence of adverse events were determined. results seventeen patients (10 men, 7 women ; median age 76 years) with a median biliary stone size of 2 cm underwent predominantly holmium : yttrium aluminum garnet laser lithotripsy, achieving a 94 % stone clearance rate over 1 median procedure. lithotripsy was performed in 8 of 17 patients due to an impacted biliary stone. the remaining patients underwent lithotripsy due to prior failure of the basket mechanical lithotripter to capture or crush their stones. post lithotripsy, 2 patients developed cholangitis and 1 patient with underlying copd developed respiratory distress, all resolved with conservative management. there were no hemobilia, perforations, pancreatitis nor any deaths. conclusion spyglass ds peroral cholangioscopy - guided laser lithotripsy is an efficient and safe modality for management of complicated biliary stones. |
currently, it is believed that the pterygium is a growth disorder characterized by conjunctivalization of the cornea due to localized ultraviolet - induced damage to the limbal stem cells. aggressive pterygial fibroblasts are also responsible for corneal invasiveness.1 the indications for surgery include reduced vision due to encroachment on the visual axis and irregular astigmatism, chronic irritation, recurrent inflammation, restrictive ocular motility, and cosmetic purposes. numerous surgical techniques including bare sclera excision with or without the use of adjuncts like beta irradiation, thiotepa eye drops, intra- or postoperative mitomycin c (mmc), amniotic membrane transplantation, and conjunctival autograft have been described.2 pterygium represents a local limbal deficiency. thus, inclusion of limbal epithelium in the conjunctival graft for pterygium surgery would achieve better anatomic and functional reconstruction after pterygium removal by restoring barrier function of the limbus.3 mmc is an antitumor antibiotic that was first isolated from streptomyces caespitosus by wakaki in 1958, and it acts by inhibiting dna synthesis. the mechanism of action seems to be inhibition of fibroblast proliferation at the level of the episclera.5 the benefit of mmc is that it has the prolonged if not permanent effect which indicates its toxicity to the cells.6 adjunctive mmc for pterygium surgery was first described by kunitomo and mori7 in japan in 1963 and in the united states by singh in 1988 as postoperative topical mmc of concentration ranging from 0.4 to 1 mg / ml. although multiple studies have reported recurrence rates of ~5%12% with the use of topical mmc,9,10 this technique has been associated with rare but significant conjunctival, sclera, and corneal toxicity.9 in an attempt to decrease ocular morbidity, intraoperative use of mmc was suggested.11 advantages of this technique include decreasing the mmc dosage and application directly to the area of pathology rather than to the entire ocular surface. a combined pterygium removal with intraoperative mmc and conjunctival autografting was described.12 the purpose of this study was to evaluate the role of mmc injection directly into the surgical site 1 month before limbal - conjunctival autograft transplantation (l - cat) in recurrent pterygia. this study included 39 eyes (33 patients ; 27 unilateral and 6 bilateral) complaining of recurrent pterygium of variable size, duration, and number of recurrences, which are mentioned in table 1. surgeries carried out prior to our study were bare sclera technique for 28 eyes and conjunctival rotational flap for 11 eyes. exclusion criteria were patients with symblepharon, cicatricial conjunctival diseases, limbal stem cell deficiency diseases, and other intraocular diseases. subjects were recruited from outpatient clinic of kasr el aini university and international eye hospital in cairo. they were allocated into 2 groups : group a included 19 eyes of 15 patients (11 males and 4 females ; 4 bilateral and 11 unilateral) all operated by pterygium excision and free autologous limbalconjunctival autograft transplantation (l - cat) without mmc and group b included 20 eyes of 18 patients (9 males and 9 females ; 2 bilateral and 16 unilateral) all had injection of mmc 1 month before l - cat surgery. both uncorrected and best - corrected visual acuities (ucva and bcva, respectively) were measured using decimal system with equivalent standard logarithm of the minimum angle of resolution values. full ophthalmic examination was performed including intraocular pressure measurement with goldmann s applanation tonometry and indirect ophthalmoscopy for fundus. pterygium examination was performed to identify its nature (fleshy or fibrotic) and its corneal encroachment. it was graded according to growth onto the cornea : grade 1 (02 mm), grade 2 (24 mm), and grade 3 (more than 4 mm). anesthesia was given by peribulbar injection of debocaine 2.0% (lidocaine hcl 20 mg ; el nasr chemicals, cairo, egypt) and marcaine (bupivacaine hcl 0.5% ; astrazeneca ab, sodertartalje, sweden) in a ratio of 1:1. excision of the whole pterygium was carried out followed by hemostasis using wet - field cautery. in group a, a superficial circumferential incision (around 100-m depth) in the cornea, 0.5-mm from the superotemporal limbus, was performed to include limbal epithelium to the conjunctival graft. the limbal - conjunctival graft was placed in the correct orientation in the scleral bed and sutured using eight 8/0 vicryl anchoring sutures, conjunctivaepisclera conjunctiva. postoperative treatment given was mixed antibiotic - steroid drops (dexaflox, ofloxacin 3.0 mg / ml and dexamethasone 1.0 mg / ml ; jamjoom, jeddah, saudi arabia) and ointment (tobradex, tobramycin 0.3 mg / ml and dexamethasone 1 mg / ml ; alcon, cairo, egypt) with gradual tapering of medications over 1 month postoperatively. in group b, 1 month before carrying out the previously described surgery, under an operating microscope and by using a 30-gauge needle, 0.2 ml of 1% lidocaine anesthetic with epinephrine was injected into the head of the pterygium at the limbus, which caused mild swelling of the conjunctiva. five minutes after the lidocaine injection, subconjunctival injection at site of pterygium was done using a 30-gauge needle on a tuberculin syringe containing mmc (0.1 ml of 0.15 mg / ml), followed by previously described eye drop and ointment for 1 week. patients were examined at postoperative days 1, 7, 14, and 30, then every 3 months for 1 year with the exception of 9 eyes which completed only 6 months follow - up. evaluation is for the occurrence of any complications, such as corneal epithelial toxicity, sclera thinning, or graft sloughing, and for recurrences. figures 1 and 2 show photographs for 2 cases of groups a and b, respectively. both uncorrected and best - corrected visual acuities (ucva and bcva, respectively) were measured using decimal system with equivalent standard logarithm of the minimum angle of resolution values. full ophthalmic examination was performed including intraocular pressure measurement with goldmann s applanation tonometry and indirect ophthalmoscopy for fundus. pterygium examination was performed to identify its nature (fleshy or fibrotic) and its corneal encroachment. it was graded according to growth onto the cornea : grade 1 (02 mm), grade 2 (24 mm), and grade 3 (more than 4 mm). anesthesia was given by peribulbar injection of debocaine 2.0% (lidocaine hcl 20 mg ; el nasr chemicals, cairo, egypt) and marcaine (bupivacaine hcl 0.5% ; astrazeneca ab, sodertartalje, sweden) in a ratio of 1:1. excision of the whole pterygium was carried out followed by hemostasis using wet - field cautery. in group a, a superficial circumferential incision (around 100-m depth) in the cornea, 0.5-mm from the superotemporal limbus, was performed to include limbal epithelium to the conjunctival graft. the limbal - conjunctival graft was placed in the correct orientation in the scleral bed and sutured using eight 8/0 vicryl anchoring sutures, conjunctivaepisclera conjunctiva. postoperative treatment given was mixed antibiotic - steroid drops (dexaflox, ofloxacin 3.0 mg / ml and dexamethasone 1.0 mg / ml ; jamjoom, jeddah, saudi arabia) and ointment (tobradex, tobramycin 0.3 mg / ml and dexamethasone 1 mg / ml ; alcon, cairo, egypt) with gradual tapering of medications over 1 month postoperatively. in group b, 1 month before carrying out the previously described surgery, under an operating microscope and by using a 30-gauge needle, 0.2 ml of 1% lidocaine anesthetic with epinephrine was injected into the head of the pterygium at the limbus, which caused mild swelling of the conjunctiva. five minutes after the lidocaine injection, subconjunctival injection at site of pterygium was done using a 30-gauge needle on a tuberculin syringe containing mmc (0.1 ml of 0.15 mg / ml), followed by previously described eye drop and ointment for 1 week. patients were examined at postoperative days 1, 7, 14, and 30, then every 3 months for 1 year with the exception of 9 eyes which completed only 6 months follow - up. evaluation is for the occurrence of any complications, such as corneal epithelial toxicity, sclera thinning, or graft sloughing, and for recurrences. figures 1 and 2 show photographs for 2 cases of groups a and b, respectively. recurrence was defined as progressive fibrovascular corneal encroachment after surgery. data were coded and entered using the statistical package spss (version 17 ; spss inc, chicago, il). the study included 39 eyes of 33 patients (20 males and 13 females). age ranged from 15 to 65 years (mean 43 1.5 years) for group a and from 27 to 59 years (mean 39 2 years) for group b. preoperatively, mean ucva measured for groups a and b was 0.6 0.1 and 0.56 0.2, respectively. mean bcva measured for groups a and b was 0.9 0.07 and 1 0.1, respectively. postoperatively at 1 month follow - up, mean ucva measured for groups a and b was 0.58 0.08 and 0.57 0.15, respectively. mean bcva measured for groups a and b was 0.87 0.09 and 1.1 0.08, respectively. in group a, the mean of 16 0.5 mm hg measured preoperatively changed postoperatively at 1 month follow - up to a mean of 15.8 0.2 mm hg. in group b, the mean of 17.1 0.4 mm hg measured preoperatively changed postoperatively at 1 month follow - up to a mean of 16.9 0.1 mm hg. a total of four cases of recurrences were recorded for group a, two at 3 months, one at 6 months, and one at 12 months follow - up. one case of recurrence was recorded for group b at 6 months follow - up. for group a (19 cases), recurrence in 4 cases (21.1%) (p = 0.012, within the group) was observed. for group b (20 cases), recurrence in 1 case (5%) (p < 0.001, within the group) was observed. the incidence of recurrence in group a (4 cases) represents 80% of the total recurrent cases (5 cases) and in group b (1 case) represents 20% of the total recurrent cases. comparing the recurrence incidence of the two groups was favorable for group b (only 1 case of recurrence), but p value was 0.134 (statistically nonsignificant) ; however, it should be stated that the low number of recurrences in this study may have affected the statistical results of comparing the 2 groups. the study included 39 eyes of 33 patients (20 males and 13 females). age ranged from 15 to 65 years (mean 43 1.5 years) for group a and from 27 to 59 years (mean 39 2 years) for group b. preoperatively, mean ucva measured for groups a and b was 0.6 0.1 and 0.56 0.2, respectively. mean bcva measured for groups a and b was 0.9 0.07 and 1 0.1, respectively. postoperatively at 1 month follow - up, mean ucva measured for groups a and b was 0.58 0.08 and 0.57 0.15, respectively. mean bcva measured for groups a and b was 0.87 0.09 and 1.1 0.08, respectively. in group a, the mean of 16 0.5 mm hg measured preoperatively changed postoperatively at 1 month follow - up to a mean of 15.8 0.2 mm hg. in group b, the mean of 17.1 0.4 mm hg measured preoperatively changed postoperatively at 1 month follow - up to a mean of 16.9 0.1 mm hg. preoperatively, mean ucva measured for groups a and b was 0.6 0.1 and 0.56 0.2, respectively. mean bcva measured for groups a and b was 0.9 0.07 and 1 0.1, respectively. postoperatively at 1 month follow - up, mean ucva measured for groups a and b was 0.58 0.08 and 0.57 0.15, respectively. mean bcva measured for groups a and b was 0.87 0.09 and 1.1 0.08, respectively. in group a, the mean of 16 0.5 mm hg measured preoperatively changed postoperatively at 1 month follow - up to a mean of 15.8 0.2 mm hg. in group b, the mean of 17.1 0.4 mm hg measured preoperatively changed postoperatively at 1 month follow - up to a mean of 16.9 0.1 mm hg. a total of four cases of recurrences were recorded for group a, two at 3 months, one at 6 months, and one at 12 months follow - up. one case of recurrence was recorded for group b at 6 months follow - up. for group a (19 cases), recurrence in 4 cases (21.1%) (p = 0.012, within the group) was observed. for group b (20 cases), recurrence in 1 case (5%) (p < 0.001, within the group) was observed. the incidence of recurrence in group a (4 cases) represents 80% of the total recurrent cases (5 cases) and in group b (1 case) represents 20% of the total recurrent cases. comparing the recurrence incidence of the two groups was favorable for group b (only 1 case of recurrence), but p value was 0.134 (statistically nonsignificant) ; however, it should be stated that the low number of recurrences in this study may have affected the statistical results of comparing the 2 groups. for group a (19 cases), recurrence in 4 cases (21.1%) (p = 0.012, within the group) was observed. for group b (20 cases), recurrence in 1 case (5%) (p < 0.001, within the group) was observed. the incidence of recurrence in group a (4 cases) represents 80% of the total recurrent cases (5 cases) and in group b (1 case) represents 20% of the total recurrent cases. comparing the recurrence incidence of the two groups was favorable for group b (only 1 case of recurrence), but p value was 0.134 (statistically nonsignificant) ; however, it should be stated that the low number of recurrences in this study may have affected the statistical results of comparing the 2 groups. pterygium, a worldwide degenerative corneal disease with a multifactorial etiology, is particularly common in tropical countries ; the main complication of pterygium treatment is the unpredictable rate and timing of recurrences.13,14 the pterygia recurrence rate reported for patients treated with the bare sclera technique ranges from 24% to 89%,15,16 whereas that reported after conjunctival autograft transplantation ranges from 1.6% to 33%.17,18 amniotic membrane graft has been used as an alternative to conjunctival autograft transplantation, but the recurrence rate was still as high as 37.5% for recurrent pterygia.19 recurrent pterygium presents a significant surgical problem. repeated surgical intervention in the limbal area causes severe barrier function destruction. to treat this complicated disorder, conjunctival transplantation, lamellar keratoplasty, and limbal autograft transplant have been performed.20 in our study, the idea of using mmc 1 month preoperatively is to further decrease the dosage and morbidity associated with mmc when applied as topical or at time of surgery and to increase its effectiveness by applying the medication in a low concentration and low volume (0.1 ml of 0.15 mg / ml) subconjunctivally 1 month before surgery directly to the target tissue of activated fibroblasts. over a follow - up period of 12 months, four cases of recurrences (21.1%) for group a and one case (5%) for group b were reported. the superiority of using mmc could be explained by its inhibitor and toxic effect on fibroblasts, and using it 1 month before surgery maximized its effect despite the low dose used.21 other studies showed rather similar results compared to this study. donnenfeld and colleagues reported a recurrence rate of 6% on using mmc as a single injection 1 month before surgery with same concentration used in our study ; however, all cases operated were primary pterygia.21 boberg - ans and colleagues22 proposed limbal autograft transplantation for the treatment of recurrent and advanced pterygia and reported a 7.4% recurrence rate. however, gris and colleagues2 noted no recurrences after l - cat. akura and colleagues23 also investigated a smaller excision graft combination employing a 4-mm window excision with subepithelial pterygium removal, but used intraoperative mmc. their technique produced no recurrences in 66 patients with follow up ranging from 6 to 32 months. although the combined mmc injection followed by l - cat procedure is time consuming and technically demanding, our reported favorable recurrence rate encouraged us to use this technique for recurrent pterygium treatment. further long - term, multicenter, and randomized trials with higher numbers of cases are needed to determine the best treatment method. the results of our study show that both treatment modalities achieved success in the prevention of recurrent pterygium. | purposethe purpose of this study is to evaluate and compare recurrence rates upon using mitomycin c (mmc) with limbal - conjunctival autograft for treating recurrent pterygia.methodologyan interventional, prospective, comparative clinical study was performed in 30 eyes (26 patients) with recurrent pterygia, allocated into two groups : group a (19 eyes) operated by pterygium excision and limbal - conjunctival autograft transplantation (l - cat) without mmc and group b (20 eyes) operated with injection of 0.1 ml of mmc 0.15 mg / ml 1 month before l - cat surgery. exclusion criteria included patients with symblepharon, cicatricial conjunctival diseases, limbal stem cell deficiency, and other intraocular diseases.resultsa total of four cases of recurrences for group a (p = 0.012) and one case of recurrence for group b (p < 0.001) were recorded.conclusionspreoperative injection of mmc in low dose and concentration improves the results of l - cat in recurrent pterygium. |
idiopathic granulomatous lobular mastitis (iglm) is an inflammatory disease of the breast with an obscure etiology. it occurs mainly in women of reproductive age, and the lesion mimics carcinoma of the breast both clinically and radiologically we present the case of a 29-year - old female who visited our hospital in kancheepuram, tamil nadu, with a 4 3 cm lump in the upper outer quadrant of her left breast. the clinical and radiological findings were indicative of a malignant lesion ; however, fine - needle aspiration cytology (fnac) revealed features of granulomatous mastitis, and the subsequent histology of the excised lump confirmed the diagnosis of iglm. iglm should be considered as one of the differential diagnoses when granulomas are encountered in breast fnac and biopsy. a definitive diagnosis of iglm can be made by identifying its characteristic histomorphology and ruling out other causes for granulomatous inflammation. an exact diagnosis is essential since the treatment for different granulomatous conditions of the breast varies. idiopathic granulomatous lobular mastitis (iglm), which was first reported in 1972 by kessler and walloch, is a rare chronic granulomatous inflammatory lesion of the breast lobules with an unknown etiology (1). it is commonly seen in women of reproductive age with a mean age at presentation of 34 years (1). clinically these patients present with a painful, unilateral breast lump, but cases with bilateral presentations have also been reported (2). some patients also have associated skin changes, lymphadenopathy, nipple discharge, ulcers, and draining sinuses, thus mimicking malignancy. along with a literature review, we present a case of iglm that masqueraded as a breast tumor in a non - lactating young woman.table 1. summary of iglm cases in literaturestudy groupno of casessex(mean) ageclinical presentationother findingsgurleyik. (1)19f34large irregular painful mass in 15 cases, 3 cases had ulcerative skin lesion, 2 had axillary lymphadenopathy.eight patients had history of contraceptive pill usage.altintoprak. (2)26f37.5pain, swelling, and inflammation on the affected breast, along with superficial erosion or open fistulae on the breast skinthree patient had history of oral contraceptive use and six had history of smokingreddy km. (4)case reportf27breast mass, nipple discharge and nipple retractionhistory of breast cancer in the familyergin ab. (5)case reportf40painful swelling 4.6 1.8 4.6, erythema, nipple dischargenilakahane. (6)9f362.4 - 10.0 cm palpable lumps, skin thickening, or axillary lymphadenopathyseven patients were diagnosed within 5 years of their most recent pregnancylai. (8)case reportf399 6 cm breast lump with localized rednessassociated prolactinemiaour casecase reportf294 3 cm painful mass, firm in consistency with restricted mobilitynil a 29-year - old female presented to our hospital (shri sathya sai medical college and research institute, kanchipuram, tamil nadu) with a painful breast lump measuring 4 3 cm in the left upper outer quadrant that had been for the past 6 months. mammography showed a 3.5 3 cm mass with an ill - defined margin that was classified as bi - rads category 3. because of the clinical suspicion of breast cancer, fine - needle aspiration cytology (fnac) was done. the fnac smears showed a few cohesive clusters of ductal epithelial cells along with a focal collection of epithelioid histiocytes, scattered polymorphs, and lymphocytes in the background (figure 1). cytologically, a diagnosis of granulomatous mastitis was given, and the mass was subsequently surgically excised and sent for histopathological examination. grossly, the mass was well circumscribed, firm to hard with a nodular surface. the cut surface color ranged from gray to tan with focal yellowish areas (figure 2). microscopy showed granulomatous inflammation centered around the lobules, which were composed of epithelioid histiocytes and langhans giant cells, admixed with neutrophils, lymphocytes, and plasma cells. a clear space rimmed by a thin band of neutrophils was seen at the center of the granulomas (figures 3 and 4). the sections were stained using a ziehl neelsen method and gomori s methenamine silver (gms) and viewed with a polarizing microscope to rule out mycobacterial, fungal, and foreign body etiology, respectively. based on the above findings, the diagnosis of idiopathic granulomatous lobular mastitis was given. the patient was later treated with corticosteroids, and there was good clinical recovery from the disease. though several hypotheses have been suggested, the one that is most widely accepted is damage to the mammary ducts by various factors, including trauma, local irritants, and infections that allow luminal material to leak into the stroma thus evoking a granulomatous inflammation (9). the association of iglm with pregnancy, lactation, the use of oral contraceptive pills (ocp), trauma, and autoimmune diseases has been documented. additionally, recent studies have highlighted the involvement of hyperprolactinemia and galactorrhea with iglm (10, 11). there are increased mammary acinar secretions with these conditions, which may lead to distension, rupture of the acini, and extravasation of the luminal contents causing a granulomatous response. (12) proposed an autoimmune etiology due to the response of iglm to corticosteroids ; however, they were ultimately unable to prove the existence of an autoimmune origin. (2) evaluated the anti - nuclear antibody (ana) and extractable nuclear antigen (ena) levels in patients with iglm by indirect immunofluorescence (iif). their results also failed to support an autoimmune basis for iglm. according to akahane. (6) the most common presenting symptoms of iglm are mastalgia and breast mass. they also reported that 58.3% of the cases in their study had diffuse multiple lesions. features like breast lumps, pain, diffuse involvement of the breast, and lymph node enlargement are of concern to clinicians because of high suspicion for inflammatory carcinoma of the breast. (9) reported that neither mammography nor doppler sonography helps in the diagnosis of ilgm, and it can only be confirmed by histopathology. ilgm is histologically characterized by granulomas that are non - caseating and centered around lobules. a characteristic clear space rimmed by neutrophils is typically seen at the center of the granuloma. this clear space is due to the lipid material from the degenerated cells dissolved during tissue processing (13). the final diagnosis is made by identifying ilgm s characteristic histological pattern and excluding other causes of granulomas, such as tuberculosis, sarcoidosis, wegener 's granulomatosis, a fungal infection, or a foreign body (4). in kok.s (14) study, only 17% of the iglm patients were diagnosed by fnac alone, while akahane. this highlights the limitations of fnac in diagnosing iglm due to the lack of features characteristically seen in histopathology. in our case, the fnac diagnosis was granulomatous mastitis ; however, a final diagnosis of iglm could only be made by histopathology after ruling out other possible causes of granulomas. the definitive treatment of this condition is still unclear although corticosteroids remain the mainstay of treatment in patients with iglm due to their anti - inflammatory action. patients with minimal symptoms are better managed conservatively by close, regular surveillance without surgery (7). nevertheless, gurleyik. (1) reported that none of their patients treated with corticosteroids had a complete clinical recovery from the disease. they recommended that local excision of the remaining lesion after steroid therapy would give a better result and decrease the chances of recurrence. unnecessary mastectomies should not be done for this condition as mastectomy is strictly reserved for cases with multiple recurrence and persistent lesions. in cases with multiple recurrence, secondary causes including prolactinemia due to pituitary adenoma or drugs like risperidone should be ruled out (8). a diagnosis of iglm should be made cautiously since erroneously diagnosed cases, if treated with steroids, will aggravate granulomatous disease of an infectious etiology. similarly, cases of iglm, if misdiagnosed as infectious granulomatous conditions, will never respond to antibiotics. iglm should be considered as one of the differential diagnoses when granulomas are encountered in fine - needle breast aspirates, but the final diagnosis should only be made by histopathology with the aid of special techniques and by ruling out other possible causes. iglm should be considered as one of the differential diagnoses when granulomas are encountered in fine - needle breast aspirates, but the final diagnosis should only be made by histopathology with the aid of special techniques and by ruling out other possible causes. | introductionidiopathic granulomatous lobular mastitis (iglm) is an inflammatory disease of the breast with an obscure etiology. it occurs mainly in women of reproductive age, and the lesion mimics carcinoma of the breast both clinically and radiologicallycase presentationwe present the case of a 29-year - old female who visited our hospital in kancheepuram, tamil nadu, with a 4 3 cm lump in the upper outer quadrant of her left breast. the clinical and radiological findings were indicative of a malignant lesion ; however, fine - needle aspiration cytology (fnac) revealed features of granulomatous mastitis, and the subsequent histology of the excised lump confirmed the diagnosis of iglm.conclusionsiglm should be considered as one of the differential diagnoses when granulomas are encountered in breast fnac and biopsy. a definitive diagnosis of iglm can be made by identifying its characteristic histomorphology and ruling out other causes for granulomatous inflammation. an exact diagnosis is essential since the treatment for different granulomatous conditions of the breast varies. |
an approach for minimizing surgery - related stress and reducing subsequent complications during the preoperative period was introduced in 2005 by fearon. as the enhanced recovery after surgery (eras) protocol, and the protocol has been considered to be a useful means for preoperative management of patients before surgery 1. the eras protocol recommends practices such as shortening preoperative fasting time, reducing the dose of laxatives, and intake of clear fluids containing carbohydrates in order to enhance postoperative recovery of patients. espen (european society for clinical nutrition and metabolism) guidelines in 2009 mentions that preoperative fasting from midnight is unnecessary in most patients (grade a recommendation), and oral intake of carbohydrate - rich drink before surgery is beneficial and recommended in most patients (grade a recommendation) 2. since may 2009, patients undergoing stomach surgery at our hospital have been managed according to the eras protocol, now essentially shifted to preoperative management with shorted fasting time and reduced laxative medication. in terms of patient satisfaction, shortening the fasting time (and taking clear fluid or appropriate food instead) is well accepted by patients scheduled for elective surgery, which helps decrease feeling of preoperative discomfort, feeling of dry mouth, and feeling of hunger. for preoperative fluid management, it is of significant to elucidate how the shortened fasting before surgery may affect total body water (tbw). in the present study, we hypothesized that the preoperative amount of tbw would be maintained appropriately by reducing preoperative fasting time and laxative medication. this study was approved by the institutional review board of the institution (kanagawa cancer center, japan) and was conducted in accordance with the declaration of helsinki. patients were those with physical status classification i or ii of the american society of anesthesiologists physical status (asaps), who were scheduled to enter the operating room at 8:45 to undergo elective surgery for stomach cancer. patients, who had to be supported by intravenous therapy due to the inability of oral intake before surgery, were excluded from the study. patients were divided into two groups (the control group managed by conventional preoperative procedure with conventional fasting time and the eras group managed by the eras protocol with shortened fasting time). as mentioned in the introduction section, since may 2009, our hospital has been shifting the preoperative management from the conventional procedure to the eras protocol in the patients undergoing stomach surgery. with regard to the patients in this study, 15 patients, who gave their consent to the study, were allocated to the control group, while 15 patients, who gave their consent to the study, were allocated to the eras group. schedule for the study (such as intake of diets, intake of clear liquids, and laxative medication) is shown in figure 1. in the control group, on the day before surgery, patients consumed a liquid diet at 7:00 for breakfast and at 12:00 for lunch (totaling 650 kcal / day and 20 g protein / day), after which the patients fasted. with regard to fluid intake on the day before surgery, clear fluids (such as water, oral rehydration solution [ors ], coffee or tea without milk, and juice not containing dietary fibers) were permitted, not limiting the volume of intake, and after 18:00, patients were permitted to consume ors only (limiting to the maximum intake to 1500 ml) until 1:00 on the day of surgery. laxatives were medicated at 10:00 (10 ml of 0.75% sodium picosulfate hydrate) and 15:00 (150 g of magnesium citrate, with 700 ml of water) on the day before surgery. if there was no defecation at 6:00 on the surgery day, 110 ml of 50% glycerin enema was prescribed as an additional medication. in the eras group, on the day before surgery, patients consumed 30%-rice porridge at 7:00 for breakfast, 12:00 for lunch, and 18:00 for dinner (totaling 1000 kcal / day and 45 g protein / day), followed by a fast thereafter. for fluid intake on the day before surgery, clear fluids were permitted until before dinner, not limiting the volume of intake, and after dinner, ors only was permitted up to 1500 ml until 6:30 on the day of surgery. laxatives were taken orally at 13:00 (1000 mg of magnesium oxide) and administered anally at 19:00 (500 mg sodium bicarbonate combined with 680 mg of monobasic sodium phosphate, anhydrous) on the day before surgery. the consumed amount of solid foods (liquid diet in the control group and 30%-rice porridge in the eras group) was checked after each meal by ward nurses and recorded in nursing records in a 4-rating criteria (all consumed, 1/2 consumed, 1/3 consumed, and no consumption). caloric intake in each patient was calculated based on the calorie value of each solid food and the amount that the patient consumed. the amount of fluids consumed was self - reported to nurses by patients and recorded in the nursing records. tbw and body weight were measured twice (at noon before lunch on the day before surgery and at 8:00 on the day of surgery). body weight was measured by a body composition innerscan bc-560 (tanita corporation, tokyo), and values were input into a multi - frequency impedance apparatus mlt-100 (sekisui chemical co., ltd., tbw was measured by a multi - frequency impedance apparatus mlt-100 using a frequency of 2.5 khz to 350 khz (140 kinds of frequency, 100 arms)3. the apparatus was corrected according to its specification 30 min before measurement. for the measurement, the patients rested on the floor for 5 min, and then rested in a supine position spreading the axilla and thigh. silver electrodes (which were developed for this measurement) were tightly placed to the designated sites of the body after wiping the skin surface well with alcohol cotton. there were two sites for electrode placement : one on the central part of the dorsal side between the styloid process of the ulna of the right upper limb and the styloid process of the radius in the right upper limb and the other on the central part of the dorsal side between the medial malleolus and the lateral malleolus of the fibula in the right lower limb. the detection electrode was placed 5 cm away from the current source electrodes on the elbow side or knee side 4, 5. the equation for calculating tbw 1) percent changes in tbw and body weight were obtained at 2 measurement points (at 12:00 before lunch on the day before surgery and 8:00 on the day of surgery) ; 2) defecation times were checked from 10:00 on the day before surgery up to the time before entering the operating room. defecation, if observed at 30 min or later after the previous one, was counted as the new defecation ; and 3) frequencies of vomiting and aspiration were checked at the induction of general anesthesia. if vomiting and regurgitation of gastric contents were noted in the oral cavity, it was regarded as vomiting, and then the presence and absence of aspiration into the tracheal tube were checked. data for changes in tbw and body weight, calorie intake from solid food, consumption of clear fluids, age, and bmi (body mass index) were analyzed using the unpaired t - test (two - sided at =0.05). data for sex difference, asaps, surgical procedure, and occurrence of vomiting or aspiration at the induction of general anesthesia were analyzed using the test (two - sided at =0.05). for statistical analysis, a software package spss15.0 (spss japan, tokyo) was used. thirty patients were enrolled in the study (15 in the control group and 15 in the eras group). patient baseline characteristics are shown in table 2. in the control group, one patient (7%) caught a cold on the day before surgery, and three patients (30%) were prescribed laxatives other than protocoled laxatives for additional laboratory examinations. no differences were noted for sex difference, age, bmi, and asaps between the groups. consumption of solid food on the day before surgery was greater in the eras group than in the control group (16.42.9 kcal / kg for the eras group and 9.92.1 kcal / kg for the control, p<0.001). consumption of clear fluids was also greater in the eras group than in the control group (21.92.3 ml / kg for the eras group and 13.95.6 ml / kg for the control group, p<0.001) (fig. defecation times (from 10:00 on the day before surgery up to the entry to the operation room) were less in the eras group than in the control group (2.52.0 times for the eras group and 5.02.1 times for the control group, p<0.001), and two patients in the control group were prescribed additional laxatives on the day of surgery (fig. 3). tbw and body weight were changed in both groups, but the changes were less in the eras group (12 patients) than in the control group (14 patients) (tbw, 10.64.6% in the control group and 2.46.8% in the eras group, p<0.001 ; body weight, 2.00.8% in the control group and 1.01.1% in the eras group, p<0.01) (fig. 4). besides, no significant differences were noted in the tbw values between the two groups in the measurement on the day before surgery (30.61.4 kg in the control group and 30.11.7 kg in the eras group, p=0.89) and in the measurement on the day of surgery (27.21.1 kg in the control group and 31.02.0 kg in the eras group, p=0.21).vomiting and gastric aspiration associated with general anesthesia were not noted in both groups. eras protocol was first proposed in the late 1990s in the northern european countries, specifically intended for enhanced recovery after surgery, and based on evidences from more than 800 scientific literatures 1. multimodal analgesia, multimodal surgery, and multimodal rehabilitation eras protocol was initially applied to laparotomic colorectal surgery and has now been applied to cases of other surgeries. conventionally, mechanical bowel preparation (mbp) using lengthy preoperative fasting and excessive laxative medication have been the standard practice so that feces and dietary residue may not remain in the gastrointestinal tract. however, eras protocol recommends that the mbp should be used as less as possible 1, 7. in addition, preoperative carbohydrate loading and positive postoperative management such as pain control, early ambulation, and early oral feeding help alleviate the preoperative stress response. 5) by improving insulin resistance and normalizing gastrointestinal function. as the effectiveness of eras, reduced postoperative morbidity, safety, shortened hospitalization, and cost reduction have been reported 8. in the present study, we hypothesized that preoperative total body water would be maintained appropriately by shortening the fasting time and reducing the laxative medication. the results show that the amount of water in the body was favorably maintained in the eras group compared with the control group, encouraging the introduction of the two procedures, shortened fasting time and beneficial effects and safety of eras protocol have been reported in many studies 9 - 11. with regard to the preoperative fasting time, there are now much evidence to advocate the shorter fasting duration 12, 13, and societies of anesthesiology in the united states and most european countries have changed the practice guidelines for preoperative fasting 14, so that oral intake of solids is permissible up to 6 to 8 hr before surgery and clear fluids are permissible up to 2 to 3 hr before surgery (table 3). in this study, solid foods were consumed in the eras group up to 6 hr later than in the control group, and clear fluids were consumed in the eras group up to 5 hr and 30 min later than in the control group. with regard to safety associated with the induction of general anesthesia, vomiting did not occur in any patients, although the number of patients enrolled in this study was small. although there are no practice guidelines for preoperative fasting management in japan authorized by medical societies, our previous studies have confirmed the safety of the preoperative consumption of ors in more than 1000 patients 15, 16. in this study, only ors was used as the clear fluid to be consumed before surgery, because its safety is already confirmed in previous studies. next, with regard to the preoperative management with the use of laxatives in lower intestinal tract surgery such as colon, negative results have been reported in multicenter cooperative studies, suggesting that laxative medication would rather not be encouraged 10. the reason lies in that the structure of intestinal mucosa membrane wall may be disturbed or infection may occur during surgery due to liquefaction of feces 17. however, with regard to the upper intestinal tract surgery investigated in the present study, there is still no evidence. tbw and body weight were changed in both groups, but the changes were less in the eras group than in the control group. two interventions (shortened fasting and reduced laxatives) practiced in the eras group are considered to have contributed to such results. first, the amounts of consumed solid foods and fluids were large in the eras group, because the duration of fasting was shortened. clinically, maintenance of preoperative tbw may help prevent a decrease of blood pressure associated with the use of anesthesia - induction agents or local epidural anesthetics, which would likely minimize the necessity of acute administration of parenteral solution for the maintenance of circulating blood volume. if tbw is decreased, a decrease in blood pressure may be induced, so that acute infusion of parenteral solution or administration of pressor agent becomes necessary. excessive administration of parenteral solutions in perioperative periods may contribute to increasing perioperative complications such as suture failure, cardiopulmonary complications, etc. and would prolong the duration of hospitalization 18. in this regard, eras clinical protocol recommends that excessive loading of water and sodium should be avoided 8. on the other hand, earlier postoperative recovery has been reported in patients who were treated with a relatively large amount of parenteral solutions, not restricting the dose of parenteral solutions during surgery, in laparoscopic cholecystectomy 19. yet, there are not definite answers concerning the doses of parenteral solutions during surgery. further studies are necessary to investigate the preoperative anesthetic management in association with the maintenance of preoperative tbw, and also the effect on long - term prognosis should be clarified. with regard to the appropriateness of multi - frequency impedance analysis used for the measurement of tbw in this study, there are a number of studies 3, 4. the espen guidelines (2004) for bioelectrical impedance analysis the espen guidelines mention that accuracy of measurements may be decreased in patients with serious fluid and electrolyte abnormalities. in the present study, although electrolyte abnormality was not observed in any subjects, the data of tbw include those of the subjects who had about 10% dehydration. in japan, only a few institutions are practicing the eras protocol at present. guidelines for preoperative fasting are not yet established by scientific organizations such as medical societies, and thus anesthesiologists just hesitate to shorten the duration of preoperative fasting 20. besides favorable effects of shortened fasting on tbw, intake of carbohydrates helps decrease preoperative discomfort, feeling of dry mouth, and feeling of hunger 21. furthermore, the duration of fasting time may relate to the reduction of insulin resistance 22, prevention of postoperative nausea and vomiting 23, and maintenance of immunocompetence 24. guidelines for preoperative fasting time should be established in japan so that anesthesiologists may not be unnecessarily concerned about the duration of preoperative fasting. we would like to recommend preoperative management with shorted fasting period, and anticipate timely establishment of the perioperative guidelines for early postoperative recovery of surgical patients. in conclusion, the results suggest that preoperative management with shorted fasting time and reduced administration of laxatives is effective in the maintenance of the amount of tbw before surgery. | aim : preoperative fasting is an established procedure to be practiced for patients before surgery, but optimal preoperative fasting time still remains controversial. the aim of this study was to investigate the effect of shortened preoperative fasting time on the change in the amount of total body water (tbw) in elective surgical patients. tbw was measured by multi - frequency impedance method.methods : the patients, who were scheduled to undergo surgery for stomach cancer, were divided into two groups of 15 patients each. before surgery, patients in the control group were managed with conventional preoperative fasting time, while patients in the enhanced recovery after surgery (eras) group were managed with shortened preoperative fasting time and reduced laxative medication. tbw was measured on the day before surgery and the day of surgery before entering the operating room. defecation times and anesthesia - related vomiting and aspiration were monitored.results : tbw values on the day of surgery showed changes in both groups as compared with those on the day before surgery, but the rate of change was smaller in the eras group than in the control group (2.46.8% [12 patients ] vs. 10.64.6% [14 patients ], p<0.001). defecation times were less in the eras group. vomiting and aspiration were not observed in either group.conclusion : the results suggest that preoperative management with shorted preoperative fasting time and reduced administration of laxatives is effective in the maintenance of tbw in elective surgical patients. |
vaginitis is the most common gynecological problem, for which women seek treatment [1, 2 ]. four types of infectious vaginitis are commonly found in women seventy - five percent of women suffer from vulvovaginal candidiasis at least once during their lives, almost 45% of women experience the disease twice or more annually and approximately 5% of women are diagnosed with chronic and recurrent infections [46 ]. a variation in the incidence of vulvovaginal candidiasis in various communities has been reported in iran. the prevalence of vulvovaginal candidiasis in mashhad was reported to be 43% in 2005 ; in 1997, it was reported to be 19.8% in kerman, 22.3% in kashan, and 26.7% in sari. candida albicans is the most commonly found genera in the genitalia in 8090% of cases of vulvovaginal candidiasis. c. glabrata is the second most common cause of the disease and is found in 5%15% of cases [6, 7 ]. use of antibiotics, oral contraceptives, corticosteroids, and immunosuppressive drugs increases the risk of contracting this disease ; pregnancy and diabetes in combination with normal changes in the vaginal flora are also risk factors for vulvovaginal candidiasis [2, 7, 9 ]. although this disease is not life - threatening, symptoms such as itching, irritation, pain during intercourse, and secretion cause physical discomfort to occur, and the treatment is expensive. in addition, mental and psychological damage can occur, especially in chronic, untreated, and recurrent cases, because of the burden of living with these symptoms. vulvovaginal candidiasis may also influence sexual functions and disrupt an individual 's sex life [4, 6, 10 ]. several types of antifungal agents exist for vulvovaginal candidiasis, including nystatin and any pharmaceutical agent containing an azole product, such as miconazole, clotrimazole, or fluconazole, some of which come in the form of suppositories, creams, and vaginal pills. use of vaginal medication can be difficult because it may cause local irritation or stimulation. once the symptoms reduce, treatment is often left incomplete before the disease is eradicated [10, 12 ]. fluconazole is an antifungal agent that includes azole and has the same effect as vaginally administered products in the treatment of vulvovaginal candidiasis. some researchers have suggested that vulvovaginal candidiasis leads to destruction of the vaginal flora ; therefore, the efficacy of lactobacilli (probiotics) in avoiding vaginal infections has been investigated [4, 13 ]. probiotics are live microorganisms that have beneficial effects on the health of the host [5, 14 ]. lactobacilli administered within the genital tract act as prophylaxis, improving and strengthening the genital microflora and defending against bacterial infections. two major groups of these microorganisms include probiotic lactobacillus and bifidobacterium [16, 17 ]. some studies have suggested that the effects of probiotic lactobacilli in the treatment of candidiasis are vulvovaginal [4, 15 ]. however, the effects are as yet unproven and remain controversial [9, 18, 19 ]. suggested beneficial effects of probiotics include anticholesterol and antioxidative activity, reduced risk of colon cancer and diarrhea caused by rotavirus and use of antibiotics, reduced incidence of infection due to helicobacter pylori, reduced constipation, alleviation of symptoms of inflammatory bowel disease, fewer urinary tract, vaginal, and respiratory infections ; and treatment and prevention of allergy symptoms [9, 14, 17, 20 ]. the high prevalence of vulvovaginal candidiasis, the multiple complications associated with use of chemical agents, the increase in microorganism resistance to antibacterial drugs, and the need for a diet to improve the efficacy of existing therapies all contributed to the decision to conduct this research. this study was designed to compare the effects of combination treatment with fluconazole - oral protexin and fluconazole - placebo in the treatment of vulvovaginal candidiasis. a double - blind clinical trial was conducted, involving 90 women who were referred to the obstetrics unit of the clinic affiliated with shahid beheshti university of medical sciences in iran. initially, 102 women were enrolled in the study according to the following specifications : 1840 years of age ; married ; in a monogamous relationship ; not pregnant or lactating ; not menstruating at the time of referral ; receiving clotrimazole ; absence of condition improvement ; not using any vaginal medication, antibiotics, immunosuppressive drugs, or exogenous hormones, including oral contraceptives, during the 2 weeks before study initiation ; abstaining from intercourse or vaginal douche in the previous 24 h ; absence of other trichomonal vaginal infections or bacterial vaginosis ; absence of known systemic disease such as diabetes or other autoimmune disease ; showing positive potassium hydroxide (koh) samples in culture. twelve subjects were excluded because they demonstrated allergic reactions to fluconazole or protexin, conceived during treatment, commenced treatment with antibiotics or any other antifungal drug, began menstruation, used a vaginal douche during the treatment period, or had intercourse without a condom during the treatment period. this questionnaire included information regarding age, marital status, pregnancy and lactation status, history of previous disease, history of previous drug use, and contraception methods.demographics and obstetric history questionnaire. questions regarding the education level, occupation, age, duration of marriage, number of pregnancies, number and type of deliveries, number of abortions and curettages, menstrual status, type of menstrual products used during menstruation, and sex and bathing habits were included.observation checklist for the first visit (before treatment). the first part of this questionnaire was related to complaints at the first visit, including vaginal discharge, itching, dysuria, and pain during intercourse and urination. in the second part, ph score and symptoms during the first examination, including vulvitis and vulvar redness, vaginal discharge, and vulvar edema, were reviewed. in addition, information regarding the existence of branched hyphae and candida buds in the wet slide, culture result, and the type of candida infection is included. this checklist was similar to the first, with the addition of questions about treatment - related complications.daily checklist for patients. a daily checklist for completion by participants was also used in this study. throughout the treatment period, patients took daily notes of their physical symptoms and complaints based on the observation checklist. the date on which symptoms reduced, completely disappeared, or relapsed was also recorded. a microscope this questionnaire included information regarding age, marital status, pregnancy and lactation status, history of previous disease, history of previous drug use, and contraception methods. questions regarding the education level, occupation, age, duration of marriage, number of pregnancies, number and type of deliveries, number of abortions and curettages, menstrual status, type of menstrual products used during menstruation, and sex and bathing habits were included. the first part of this questionnaire was related to complaints at the first visit, including vaginal discharge, itching, dysuria, and pain during intercourse and urination. in the second part, ph score and symptoms during the first examination, including vulvitis and vulvar redness, vaginal discharge, and vulvar edema, were reviewed. in addition, information regarding the existence of branched hyphae and candida buds in the wet slide, culture result, and the type of candida infection is included. this checklist was similar to the first, with the addition of questions about treatment - related complications. a daily checklist for completion by participants was also used in this study. throughout the treatment period, patients took daily notes of their physical symptoms and complaints based on the observation checklist. the date on which symptoms reduced, completely disappeared, or relapsed was also recorded. a ph indicator paper. to determine the validity of the questionnaire and observation checklist, content validity testing was performed. to determine the reliability of the observation checklist, the kappa coefficient was used to ensure agreement among raters. thus, 10 patients referred to the clinic for vulvovaginal candidiasis were examined and questioned about the checklist simultaneously by the primary researcher and a clinic professional of the same rank. the minimum acceptable coefficient was 0.80. to ensure the reliability of the ph paper (merck, darmstadt, germany), 5 samples were taken from the same person and their ph values were assessed. uniformity of the obtained results confirmed the reliability of this tool. to ensure the reliability of the microscope (nikon, tokyo, japan), accurate calibration of the device then, 5 slides were prepared from a single sample and investigated using the microscope. uniformity of results was compared with those from another standard microscope ; the results were the same. codes of some slides were then changed, and the slides were reviewed again by the same person. all slides were reviewed using the same microscope by the same laboratory science specialist. to assess the reliability of the agar medium (darvash ltd., participants who met the inclusion criteria and conformed to the specifications of the research unit were instructed about this paper and its goals. participants were first placed in the lithotomy position. a sterile speculum without lubricant was placed, and the vagina and crevices were evaluated for abnormal inflammation and secretions in terms of color, consistency, and odor. samples were placed on two slides and a plate containing agar medium and checked for trichomonas vaginalis, bacterial vaginosis, and c. albicans. for microscopic investigation, 1 or 2 drops of normal saline were added to the first slide sample, which was investigated for key cells and t. vaginalis. in cases where flagellant t. fungus was identified, one drop of solution (koh 10%) was added to the second slide for investigation in terms of candida hyphal category and amine odor. culture samples were also transferred to taleghani hospital laboratory daily, and the culture results were analyzed within 2448 h of sampling. c. albicans was distinguished from other types of candida using a germ tube test. in addition, vaginal ph was determined using the ph indicator paper. finally, if symptoms of itching, cheesy vaginal discharge, and any one of dysuria, ph 3.9 were observed in the vaginal discharge of all subjects before treatment. claimed that high vaginal ph in healthy women and women with vulvovaginal candidiasis is natural at approximately 4.5. found that lactobacilli administered in the genital pathway as a prophylaxis improved and strengthened the defenses of the genital microflora against bacterial infection. probiotic metabolites reach the entire body, including the vagina, through the bloodstream and cause changes in the normal vaginal flora. asserted the value of probiotic treatment of vulvovaginal symptoms for 13 days after the second menstrual cycle. in that study, women in the intervention group (taking probiotic supplement) complained significantly less discharge than women in the placebo group (p = 0.03 and p = 0.04, resp.). irritation and itching after treatment with probiotic vaginal capsules in the intervention group were slightly higher than in the placebo group (ns). this study found no difference between participants in whom lactobacilli had colonized and those in whom lactobacilli had not colonized in terms of vaginal ph, reported symptoms, or clinical treatment. in a study by martinez., all participants in both treatment groups (fluconazole - protexin and fluconazole placebo) complained of vaginal discharge along with at least one symptom among the following : itching, vaginal irritation, dyspareunia, and dysuria before treatment. after treatment, only 10.3% of subjects in the fluconazole - protexin treatment group and 34.6% of subjects in the fluconazole - placebo treatment group complained of vaginal discharge and at least one of these symptoms (p = 0.03). in the study of tafazzoli harandi, comparing the effects of metronidazole and a metronidazole - probiotics combination in the treatment of bacterial vaginosis, no significant difference was found between the two treatment groups in terms of amount of vaginal discharge, odorous discharge, dysuria, and itching after treatment. however, results for dysuria were at the threshold of significance, which indicates that the effect of metronidazole and probiotics on dysuria was greater than the effect of metronidazole alone (p = 0.06). however, both treatment methods were effective in alleviating the symptoms of patients. reid. found a 12% improvement in vaginal symptoms in patients treated with orally administered l. rhamnosus and l. fermentum (30%) compared with placebo. suggested that lactobacilli secrete lactic acid and other substances that maintain low vaginal ph, thereby preventing excessive growth of pathogens in the vagina. the study of hilton. noted a significant improvement of symptoms in all women with candida who were treated with vaginal suppositories of l. acidophilus. in addition, erythema and vaginal discharge decreased during the study period in treated participants. boris. identified a connection between l. acidophilus, l. casei, and genital lactobacillus in vitro with c. albicans. this connection reduces the adhesion of c. albicans to the vaginal epithelial cells, thereby reducing or preventing development of vulvovaginal candidiasis. the accumulation of lactobacilli in patients with candida can prevent vaginal infections, especially vulvovaginal candidiasis, by preventing binding of the bacteria to the receptors of the vaginal epithelium. reid. confirmed that the biological surfactants produced by l. fermentum rc-14 inhibit adhesion of c. albicans to the vaginal walls. the study of hilton. found negative cultures in 4 out of 5 women with c. albicans - positive culture in the vagina prior to treatment after administration of lactobacilli. identified a positive culture for l. acidophilus before treatment in 20% of participants receiving 150 ml of yogurt containing living bacteria (group i) on a daily basis versus 31% in the group receiving 150 ml daily of pasteurized yogurt (group ii). after 1 month of treatment, positive cultures for l. acidophilus were found in 71% of participants in the first group and 27% in the second group. thus, the number of women with positive cultures in the first group increased after the first and second months of the study. although a progressive decrease was observed in the candida - positive cultures in both groups, no significant difference in the percentage of women with positive cultures was found between the two groups 1 and 2 months after the start of the study. martinez. found positive cultures for c. albicans before treatment in both treatment groups in their study. after the treatment, only 10.3% of subjects in the group treated with fluconazole - protexin and 38.5% of subjects in the group treated with fluconazole - placebo had candida - positive cultures (p = 0.01). strus. suggested that lactobacilli that secrete high levels of h2o2 enhance the growth of c. albicans and inhibit it faster than other species. according to the results of the current study, vulvovaginal candidiasis was successfully treated in 60% of subjects in the fluconazole - placebo treatment group and 84.4% of subjects in the fluconazole - oral protexin group. thus, a significant difference between these treatments in terms of treatment success was observed. the combination of fluconazole and oral protexin performed better in terms of efficiency. reid conducted three hypotheses explaining the activity by which probiotics can strengthen the performance of antibiotics. firstly, probiotics reduce the risk of antibiotic - driven infections in the intestine and vagina. secondly, probiotics secrete antibacterial substances that locally reduce pathogen populations in the mucus, enabling antibiotics to work better. finally, probiotics generally improve the integrity of the mucosal barrier, which helps to eradicate pathogens in the mucus. in their study, murina. claimed that the use of fluconazole plus probiotic in the treatment of candida infections could have a synergistic effect, maintaining homeostasis and balance in the vaginal flora. in their study, ehrstrm. noted a success rate of treatment after the first menstrual period of 78% in the intervention group (probiotic supplement) and 71% in the placebo group. after the second menstrual period and 6 months after the end of treatment no difference in the value of clinical treatment was observed between the intervention and placebo groups. martinez. found a positive response rate of 89.7% in the group treated with fluconazole - protexin. treatment with probiotics was successful because of inhibition of the growth of c. albicans in the vagina and strengthening of the immune system in the vagina, small bowel, and colon and reduction of fungi in the rectum and vagina. in the current study, no complications occurred in most subjects in both treatment groups. probiotics can be especially useful when the use of antifungal drugs is contraindicated or may cause side effects. reported itching in one subject (1.6%) in the group receiving probiotic supplementation (intervention group) and 5 women (13.2%) in the placebo group. one woman (1.6%) in the intervention group experienced slight vaginal bleeding, while vulvar swelling and redness developed in one subject (1.6%) after treatment with placebo. one subject in the placebo group complained of headache. in the study of martinez., no specific complications were expressed in groups treated with fluconazole - protexin and fluconazole - placebo. differences between the results reported here and those of other studies may be attributed to use of lactobacilli alone in some studies, differences in kant lactobacillus colonization, use of vaginal lactobacilli, and administration of drugs other than fluconazole. further studies are essential to confirm the effect of probiotics in vaginitis, especially vulvovaginal candidiasis. this study demonstrated that complementary treatment with probiotic lactobacillus increased the efficacy of fluconazole in treatment of vulvovaginal candidiasis. | background. according to the limited studies reporting new treatments for vulvovaginal candidiasis, this study was designed to compare the combination of fluconazole and oral protexin with fluconazole in the treatment of vulvovaginal candidiasis. methods. a double - blind clinical trial was conducted, involving 90 women who were referred to the gynecology clinic. vulvovaginal candidiasis was diagnosed with itching, cheesy vaginal discharge, and any one of the following : dysuria, ph < 4.5, dyspareunia, vulvar erythema, or vulvar edema and if branched hyphae and candida buds were visible after addition of koh 10% in the culture and the result of cultivation in sabouraud 's dextrose agar medium was positive. patients were randomly classified into two groups absence of discharge, itching, and negative culture results 57 days after completion of treatment indicated treatment success. data in this study were analyzed using the spss version 17.0 software. results. the combinations, fluconazole - oral protexin and fluconazole - placebo, were equally effective in reduction of complaints and symptoms, but fluconazole - oral protexin combination elicited a better therapeutic response (2 = 0.01, p = 6.7). in addition, fluconazole - oral protexin combination treatment demonstrated better recovery time (t = 2.04, p = 0.04). conclusion. this study demonstrated that complementary treatment with probiotic lactobacillus increased the efficacy of fluconazole in treatment of vulvovaginal candidiasis. further research is recommended. |
the global plan towards the elimination of new hiv infections among children by 2015 and keeping their mothers alive (global plan) was transformative. 1) in new hiv infections among children in 21 priority countries (angola, botswana, burundi, cameroon, chad, cte d'ivoire, democratic republic of the congo, ethiopia, ghana, kenya, lesotho, malawi, mozambique, namibia, nigeria, south africa, uganda, united republic of tanzania, swaziland, zambia, and zimbabwe) in sub - saharan africa from 2009 (the global plan used 2009 as a baseline year against which to measure progress) to 2015. under the global plan, 1.2 million new infections among children were averted giving these children a far better chance to survive, thrive, and fulfill their dreams. during the life of the global plan, the number of aids - related deaths among women of reproductive age was halved in these same countries. as a result of these exceptional gains, the first aids - free generation in more than 3 decades is now in sight, and more mothers and other women are staying healthy and alive. number of new hiv infections among children in 21 global plan priority countries, 20002015. the tremendous progress achieved by the global plan is well documented (http://www.unaids.org/sites/default/files/media_asset/globalplan2016_en.pdf), specific elements of which are explained in greater detail across this supplement. what is often less well or widely understood is how the global plan came to be. what unique factors and forces coalesced to form such a diverse coalition of contributing partners, and in what key areas did the global plan catalyze change and action ? perhaps most importantly, what lessons did the global plan leave as a legacy, which can inform and improve ongoing efforts to achieve its ultimate goals ? in short, the global plan mobilized unprecedented political, technical, and community leadership at all levels to accelerate progress toward the elimination of new hiv infections among children and keeping their mothers alive. this is the global plan 's living legacy the final chapters of which are still being written. the global plan began with the simple but powerful premise that children everywhere can be born free of hiv and their mothers remain alive (http://files.unaids.org/en/media/unaids/contentassets/documents/unaidspublication/2011/20110609_jc2137_global-plan-elimination-hiv-children_en.pdf). although this goal may not seem radical today, when the global plan was launched it seemed unimaginable. in 2009, there were 270,000 new hiv infections among children in the 21 global plan priority countries, over 5,000 a week. at that time, in the 21 priority countries, only 36% of pregnant women living with hiv received antiretroviral medicines (excluding the less efficacious single - dose nevirapine) for the prevention of mother - to - child transmission (pmtct) and 15% of children living with hiv received life - saving antiretroviral therapy. in these same countries, new hiv infections among children progress was being made but not nearly fast enough, and with millions of lives at stake. in contrast, in high - income countries, hiv transmission to newborns had been essentially eliminated during the 1990s. this stark disparity created a demand that the goals of the global plan seek similar outcomes and futures for newborns and their mothers. in response, unaids and partners prepared a business case to examine the feasibility of a global campaign to change the trajectory of pediatric aids, and set the planning in motion. in 2010, unaids executive director michel sidib and then united states global aids coordinator ambassador eric goosby jointly launched and co - chaired a high - level global task team to see what could be done to accelerate global efforts. the task team brought together an eminent consortium of stakeholders from 25 countries and 30 partners garnered from civil society, the private sector, the faith - based community, networks of people living with hiv, and international organizations. led by the joint un programme for hiv / aids (unaids) and the united states president 's emergency plan for aids relief (pepfar), the global task team charted a bold course for a country - led movement to create an aids - free generation, which would become the global plan. the global plan towards the elimination of new hiv infections among children by 2015 and keeping their mothers alive was formally launched on june 9, 2011, on the margins of the united nations high - level meeting on aids. pepfar announced an additional $ 75 million to support prevention of mother - to - child transmission of hiv efforts in sub - saharan africa, on top of the $ 300 million that it was already investing annually in pmtct. private sector partners, including the bill & melinda gates foundation ($ 40 million), chevron ($ 20 million), and johnson & johnson ($ 15 million) also stepped forward with substantial pledges of their own. the global plan was exceptional in many ways ; however, several critical aspects, in particular, shaped its structure and determined its impact : commitment to clear, ambitious, and time - bound targets : the global plan embraced the adage that what gets measured gets done in setting bold global targets for 2015, not only to reduce new hiv infections among children by 90% but also to halve the number of aids - related maternal deaths. these overarching targets were supported by sub - targets under each of the 4 prongs of pmtct [the 4 prongs of pmtct are to : (1) help women of reproductive age avoid hiv infection ; (2) help women living with hiv avoid unintended pregnancies ; (3) prevent hiv transmission from mothers to their infants using antiretroviral medicines ; and (4) provide continuous care and treatment for women and mothers, their partners, and their children living with hiv].concentration on the highest - burden countries : the global plan set global targets, but it focused intensively on 21 priority countries, which at the time were home to nearly 90% of pregnant women with hiv in need of services worldwide. without significant progress in this subset of countries, the global goals would remain out of reach.country ownership : from the outset, the global plan was grounded in country ownership at all levels, which ensured the buy - in required to drive and sustain accelerated progress.built-in governance and accountability structures : the global plan was created with clear accountability and governance structures. these included annual accountability meetings at the level of ministers of health from across the 21 priority countries, at which time progress data and key gaps were presented and ultimately published in the form of an annual progress report.dual focus on political leadership and technical assistance : recognizing the critical importance of, and interplay between, political leadership and technical assistance, the global plan used 2 independent but coordinated structures to advance progress in these 2 domains. the global steering group (gsg) convened regularly to drive progress in the areas of political leadership, advocacy, and policy. the global plan worked with and through the interagency task team on the prevention and treatment of hiv infection in pregnancy women, mothers, and children (iatt) to ensure that priority countries received timely and effective technical capacity - building, training, and support. the iatt is cochaired by the world health organization (who) and united nations international children 's emergency fund (unicef) and was a member of the gsg to facilitate regular communication and coordination between these 2 structures.multisectoral engagement and mobilization : the global plan embraced the key concept that progress toward its goals was dependent on multisectoral engagement and mobilization at all levels. no single sector could accelerate action alone ; it would take multiple forces pulling in a coordinated and collaborative fashion to get the job done. therefore, the gsg membership included senior representatives from bilateral donors, multilateral institutions, networks of women living with hiv, the faith - based community, implementing partners, and the private sector all of which had essential roles to play.centrality of mothers, and other women, living with hiv : the global plan strongly affirmed that mothers and other women living with hiv are integral to an effective response to the epidemic. the global plan stood with and for women living with hiv and was committed to ensure that all efforts to support them are informed by and developed with them. commitment to clear, ambitious, and time - bound targets : the global plan embraced the adage that what gets measured gets done in setting bold global targets for 2015, not only to reduce new hiv infections among children by 90% but also to halve the number of aids - related maternal deaths. these overarching targets were supported by sub - targets under each of the 4 prongs of pmtct [the 4 prongs of pmtct are to : (1) help women of reproductive age avoid hiv infection ; (2) help women living with hiv avoid unintended pregnancies ; (3) prevent hiv transmission from mothers to their infants using antiretroviral medicines ; and (4) provide continuous care and treatment for women and mothers, their partners, and their children living with hiv ]. concentration on the highest - burden countries : the global plan set global targets, but it focused intensively on 21 priority countries, which at the time were home to nearly 90% of pregnant women with hiv in need of services worldwide. without significant progress in this subset of countries, the global goals would remain out of reach. country ownership : from the outset, the global plan was grounded in country ownership at all levels, which ensured the buy - in required to drive and sustain accelerated progress. built - in governance and accountability structures : the global plan was created with clear accountability and governance structures. these included annual accountability meetings at the level of ministers of health from across the 21 priority countries, at which time progress data and key gaps were presented and ultimately published in the form of an annual progress report. dual focus on political leadership and technical assistance : recognizing the critical importance of, and interplay between, political leadership and technical assistance, the global plan used 2 independent but coordinated structures to advance progress in these 2 domains. the global steering group (gsg) convened regularly to drive progress in the areas of political leadership, advocacy, and policy. the global plan worked with and through the interagency task team on the prevention and treatment of hiv infection in pregnancy women, mothers, and children (iatt) to ensure that priority countries received timely and effective technical capacity - building, training, and support. the iatt is cochaired by the world health organization (who) and united nations international children 's emergency fund (unicef) and was a member of the gsg to facilitate regular communication and coordination between these 2 structures. multisectoral engagement and mobilization : the global plan embraced the key concept that progress toward its goals was dependent on multisectoral engagement and mobilization at all levels. no single sector could accelerate action alone ; it would take multiple forces pulling in a coordinated and collaborative fashion to get the job done. therefore, the gsg membership included senior representatives from bilateral donors, multilateral institutions, networks of women living with hiv, the faith - based community, implementing partners, and the private sector all of which had essential roles to play. centrality of mothers, and other women, living with hiv : the global plan strongly affirmed that mothers and other women living with hiv are integral to an effective response to the epidemic. the global plan stood with and for women living with hiv and was committed to ensure that all efforts to support them are informed by and developed with them. the global plan was also guided by 4 overarching principles : (1) women living with hiv should be at the center of the response ; (2) countries must own and lead their national response ; (3) much more can be achieved through synergies, linkages, and integration than in any single area alone ; and (4) everyone shares responsibility for the overall goals, but individual entities are specifically accountable for doing their part, with partner countries in the lead. heads of state, first ladies, ministers, and other leaders took up the mantle of the global plan, demanding and driving progress for women, children, and mothers in their own countries. this leadership gave greater visibility to the importance of pregnant women getting tested for hiv, and the opportunity for those who tested hiv - positive to receive treatment for their own health and that of their baby. leadership also drove policy change and, in some countries, increased domestic resource mobilization targeted to achieving the global plan goals. impact of the global plan (2009 vs. 2015) number of new hiv infections among children in 2015 and percentage reduction in new hiv infections since 2009, by country. it rapidly accelerated momentum around country - level adoption of option b and option b+. it encouraged countries to implement task - shifting, more optimally using their existing health personnel in the delivery of hiv prevention and treatment services. it advanced efforts on early infant diagnosis, including the development and distribution of point - of - care assays, so that more children living with hiv could be identified and treated. it motivated the development of better pediatric formulations especially for the youngest babies and supported space for industry and partners to explore solutions. these efforts paid off ; for example, in 2015, a new and more palatable antiretroviral pellet for infants was approved by the u.s. it supported countries to strengthen their translation of data into better policies and, ultimately, more efficient and effective programs. reporting systems were streamlined and combined for improved follow - up to better knit existing systems for maternal / child health care with hiv services. it improved efforts across the pmtct cascade, revealing and filling key gaps and better targeting responses that enhanced the delivery of care. this included leveraging the private sector in the areas of management training such as through embedding talented staff support with national, state, provincial, and district health government officials and in harnessing the private sector 's expertise and experience to improve health outcomes. the global plan was also a catalyst for and an example of purposeful integration, showing what is possible when hiv prevention and treatment is strategically knit into the existing maternal and child health care system. in addition, the global plan helped spur momentum around validation of elimination of new hiv infections among children, as countries both within and outside the 22 global plan priority countries now gain recognition for achieving these key milestones. in 2015, cuba became the first country to receive who certification for having ended mother - to - child transmission of hiv. in a broader sense, the global plan advanced progress toward reaching 3 of the millennium development goals (mdgs 4, 5, and 6) and the united nations secretary - general 's global strategy for women 's and children 's health as well as helping lay the groundwork for the adoption of the sustainable development goals. the global plan supported remarkable progress, but much work remains to be done. although new hiv infections among children declined by 60% in the 21 global plan priority countries, 110,000 new hiv infections occurred in the 21 there 2015and 150,000 globally. an important area for intensified focus is primary prevention of new hiv infections among women of childbearing age. new hiv infections among women of childbearing age in the 21 priority countries decreased by only 5% over the same period. between 2009 and 2015, a total of 4.5 million women of childbearing age in the 21 reporting priority countries were newly infected with hiv. in 2015 alone, 390,000 adolescent girls and young women were newly infected with hiv and 75% of new hiv infections among adolescents in sub - saharan africa occurred among girls. this is particularly alarming, as the population of young women in sub - saharan africa is increasing to more than 200 million by the year 2020, doubling the number in 1990. the global plan aimed to eliminate unmet need for family planning among all women, including women living with hiv, in the priority countries. the most recent population - based surveys, however, show that while some countries (notably malawi, swaziland, and zimbabwe) have made noticeable improvements in their efforts to provide family planning services, 11 of the 21 priority countries do not meet the need for family planning for 20% or more of married women. the proportion of pregnant women living with hiv who received antiretroviral medicines for pmtct more than doubled (from 36% to 80%) in the 21 priority countries, and 93% of them were accessing lifelong antiretroviral therapy (up from 10% in 2009). the percentage of children aged 014 years who received lifelong treatment jumped from 15% in 2009 to 51% in 2015. these improvements greatly contributed to the 46% decline in aids - related deaths among women of reproductive age and the 62% decline in aids - related deaths among children (aged 04 years) over the lifespan of the global plan. yet, there remain critical gaps here to bridge, particularly for children who are still often identified too late in their disease progression. adopt a focused approach : clarity on purpose, goals, and targets facilitates better understanding and generates momentum around concrete objectives.political leadership at all levels matters : ownership and buy - in are essential to mobilize and sustain an agenda for change.the power of setting clear, ambitious targets with built - in accountability structures : continual tracking of progress shows what is working and what is not, allowing for both public accountability and programmatic improvement.communities and people living with hiv (particularly women living with hiv) must be engaged early, often, and meaningfully in service delivery : nothing for them should be done without them, as they are an indispensable voice on what works, what is not working, and how to improve it.increased attention and action is needed on primary prevention, particularly for adolescent girls and young women : in sub - saharan africa, adolescent girls and young women are up to 14 times more likely to contract hiv / aids than young men, highlighting the urgency of addressing the factors related to their hiv risk, including by increasing access to secondary education, reducing gender - based violence, and changing community norms and structures that may make it difficult for young women to thrive.there is need for concerted effort to help pregnant and breastfeeding women who test hiv - negative to remain negative. many programs have clear protocols to help women who test positive, but fall short for those who test negative. women remain at risk for seroconversion during this period, increasing the risk of transmission to their infant ; this hightlights the value of repeat testing.many children living with hiv and adolescents are still being left behind. there is a need for greater focus on active case - finding to reach children in need of treatment and tailored approaches to identify and support adolescents who are not seeking or staying in care systems created for adults or children.pmtct progress has been impressive, but the gains are fragile and many countries are lagging behind : there were 150,000 new infections among children in 2015. this is no time to rest on our laurels.men matter too : male engagement has a critical impact on health outcomes for men, women, and children >, and the context of how care is provided can be as important as the content in achieving optimal outcomes. this is especially important in identifying serodiscordant couples so that treatment can start quickly.optimize all available opportunities for service delivery : this includes offering an hiv test to women of reproductive health age (rather than waiting for them to become pregnant), follow - up care for infants at immunization clinics for early infant diagnosis, and smart integration of services.the job is not yet done : attention and investment must be sustained as long as women of childbearing age are living with hiv. adopt a focused approach : clarity on purpose, goals, and targets facilitates better understanding and generates momentum around concrete objectives. political leadership at all levels matters : ownership and buy - in are essential to mobilize and sustain an agenda for change. the power of setting clear, ambitious targets with built - in accountability structures : continual tracking of progress shows what is working and what is not, allowing for both public accountability and programmatic improvement. communities and people living with hiv (particularly women living with hiv) must be engaged early, often, and meaningfully in service delivery : nothing for them should be done without them, as they are an indispensable voice on what works, what is not working, and how to improve it. increased attention and action is needed on primary prevention, particularly for adolescent girls and young women : in sub - saharan africa, adolescent girls and young women are up to 14 times more likely to contract hiv / aids than young men, highlighting the urgency of addressing the factors related to their hiv risk, including by increasing access to secondary education, reducing gender - based violence, and changing community norms and structures that may make it difficult for young women to thrive. there is need for concerted effort to help pregnant and breastfeeding women who test hiv - negative to remain negative. many programs have clear protocols to help women who test positive, but fall short for those who test negative. women remain at risk for seroconversion during this period, increasing the risk of transmission to their infant ; this hightlights the value of repeat testing. there is a need for greater focus on active case - finding to reach children in need of treatment and tailored approaches to identify and support adolescents who are not seeking or staying in care systems created for adults or children. pmtct progress has been impressive, but the gains are fragile and many countries are lagging behind : there were 150,000 new infections among children in 2015. this is no time to rest on our laurels. men matter too : male engagement has a critical impact on health outcomes for men, women, and children >, and the context of how care is provided can be as important as the content in achieving optimal outcomes. this is especially important in identifying serodiscordant couples so that treatment can start quickly. optimize all available opportunities for service delivery : this includes offering an hiv test to women of reproductive health age (rather than waiting for them to become pregnant), follow - up care for infants at immunization clinics for early infant diagnosis, and smart integration of services. the job is not yet done : attention and investment must be sustained as long as women of childbearing age are living with hiv. launched at the 2016 united nations general assembly high - level meeting on ending aids (and co - chaired by unaids and pepfar), the start free stay free aids free super fast - track framework provides a vehicle to carry forward the important and unfinished business of the global plan. it unites partners across various sectors around accelerating progress toward ending new hiv infections among children, finding and treating children, adolescents, and mothers living with hiv and preventing the cycle of new hiv infections among adolescents and young women, including by setting ambitious targets for 2018 and 2020. | abstract : the global plan towards the elimination of new hiv infections among children by 2015 and keeping their mothers alive (global plan) was transformative, helping drive a 60% reduction in new hiv infections among children in 21 priority countries in sub - saharan africa from 2009 to 2015. it mobilized unprecedented political, technical, and community leadership at all levels to accelerate progress toward its ambitious targets. this progress is well documented, many specific elements of which are explained in greater detail across this jaids supplement. what is often less well or widely understood are the critical aspects of the global plan that shaped its structure and determined its impact ; the factors and forces that coalesced to form a deep and diverse coalition of contributing partners committed to catalyzing change and action ; and the critical lessons that the global plan leaves behind, a living legacy to inform and improve ongoing efforts to achieve its ultimate goals. |
the advent of periodontal plastic surgery has made it possible to address the common esthetic concern of receded gums. however, till date, the most challenging scenario lies in enhancement of lost interdental papillae in the maxillary anterior region. loss of interdental papilla (idp) causes not only an esthetic and phonetic dilemma but also a functional impairment as it predispose to food accumulation. factors which influence the presence or absence of interdental papilla are crestal alveolar bone height, dimensions of the interproximal space, soft tissue appearance (thick or thin biotype), minimal buccal plate thickness, type of contact area (triangular versus square), and the biologic width. an ideal embrasure will house the entire papillae without impinging it with a pointed end extending to the top of the contact point, leaving no space in between the two, thus not favoring food entrapment or being esthetically displeasing. the free gingival margin averaged 2 - 3 mm above underlying facial bone, whereas the tip of the papillae is about 4.5 - 5 mm above the interproximal bone. tarnow., proposed that the interdental papillae filled the space when the distance between the contact point and the crest of interdental bone is 5 mm. when the contact was 6 mm and 7 mm from bone, only 56% and 37% of the papillae could fill the space respectively. the complex anatomy combined with the vascular supply allows for periodontal disease to progress rapidly and is the most common cause for appearance of black triangles. nevertheless, it may also be absent in cases of naturally occurring diastema or can be encountered in teeth with tapered tooth form, where the papillae does not fill the space completely or in case of divergent roots, which places the contact point too coronally. iatrogenically, surgical reflection of interproximal tissues in areas where the distance between the contact and interdental bone is 5 mm, also results in partial loss of interdental papillae. while the former can be corrected by shifting the contact point either restoratively or orthodontically, loss due to periodontal disease can be treated surgically. platelet rich fibrin (prf) is a form of platelet gel ; a matrix of autologous fibrin, which has scored over platelet rich plasma by virtue of its properties, easier preparation, and cost effectiveness. the platelet cytokines, platelet - derived growth factor (pdgf), transforming growth factor beta (tgf-), and insulin - like growth factor-1 (igf-1) are gradually released as the fibrin matrix is resorbed, aiding the process of healing. the presence of leukocytes and cytokines in the fibrin network can play a significant role in the self - regulation of inflammatory and infectious phenomena. it can be used as a membrane or in conjunction with a bone graft, and is shown to promote bone density. it has been extensively used in hard and soft tissue augmentation, but not tried for augmenting interdental papilla. in this case report, we describe a surgical technique using prf combined with advanced papillary flap for total papilla reconstruction in the maxillary anterior region. a 40 year old healthy, nonsmoking female presented to the department of periodontics, thai moogambigai dental college and hospital, mogappair, chennai, in november 2011. her chief complaint was unaesthetic appearance of her gums in the upper front teeth region. clinical examination revealed, esthetically displeasing black triangles between 11, 12 and 11, 21 [figure 1 ]. preoperative examination included papilla contour measurements based on modification of papilla index score (pis) described by jemt. papilla was absent with no curvature of soft tissue contour, which was observed in between 11, 12 and 11, 21, and therefore was assigned a pis score of 0. the distance between the contact point and the crest of alveolar bone was determined under local anesthesia with 2% lignocaine hydrochloride. a william 's periodontal probe was used and a distance of 9 mm between 11 and 21 and 9.5 mm between 11 and 12 was recorded. preoperative view showing loss of interdental papillae in 11, 12 and 11, 21 region the preparation of prf was carried out before the start of the surgery as per the protocol developed by choukron. en milliliter of intravenous blood (antecubital site) was collected in sterile 10 ml tubes without the addition of an anticoagulant and centrifuged at 3000 revolutions (400 g) per minute for 10 minutes. prf settles down between the platelet poor plasma (ppp) at the top and the red blood cells (rbc) at the bottom of the tube [figure 2 ]. platelet rich fibrin at the center with platelet poor plasma at the top and red blood cells at the bottom of the test tube a split thickness semilunar incision was given about 1 mm coronal to the mucogingival junction in the interdental region of 11, 12 and 11, 21. through the semilunar incision toward the interdental papillae, the split thickness flap was continued to create a pouch in the interdental area. a curette was used around the necks of 11, 12 and 21 to free the tissue attachment from the root surface, facilitating the displacement of gingivopapillary unit coronally. the prepared prf was removed using sterile tweezers and trimmed with scissors and transferred on to sterile gauze. a thick fibrin membrane was obtained by squeezing the serum out of the prf clot. this membrane was eased in to the pouch and pushed coronally, enabling to fill the bulk of the interdental papillae [figure 3 ]. analgesics (ibuprofen 400 mg twice daily for 3 days) along with chlorhexidine digluconate (0.12%) rinse twice daily were prescribed for 10 days. review of the patient on 10 day revealed partial fill of the interdental region, with the conversion of pis from 1 to 3 papilla fills the interproximal embrasure to the same level as in the proximal teeth and is in complete harmony with the adjacent papillae. shapiro. advocated use of repeated curettage to stimulate the regrowth of interdental papillae in necrotizing ulcerative gingivitis. the roll technique and the use of pedicle graft with coronal displacement of the gingivopapillary unit and subepithelial connective tissue grafting has been presented. interpositional subepithelial connective tissue grafting and use of buccal and palatal split thickness have been tried out. interdental papilla augmentation along with reconstruction of interdental bone to create appropriate support for gingival papilla has been reported. however, even with these different surgical techniques with different flap designs, results are elusive, not predictable and long - term stability are lacking. a major drawback associated with all these techniques any graft placed in this small anatomic area will have to thrive in an unfavorable environment, walled on both sides by the nonvascularized tooth surfaces. thus many authors have advocated the use of pedicle / advanced flap for better results than free grafts. the case presented here with the use of prf and pedicle flap offers a reliable solution as prf membrane has both mechanical adhesive properties and biologic functions like fibrin glue ; it maintains the flap in stable position, enhances neoangiogenesis, reduces the necrosis and shrinkage of the flap and stabilization of the gingival flap in the highest covering position. the prf is easy to procure, not expensive and can be prepared in few minutes. this fibrin matrix inclusive of its platelets, leucocytes, and cytokines allow remodeling of interdental papilla to occur. it has been found prf organized as a dense fibrin scaffold with a specific release of growth factors (tgf-1, pdgf - ab, and vascular endothelial growth factor (vegf) and glycoproteins (thrombospondin -1) during 7 days, is critical for the take of the grafted prf membrane. no improper root angulation or disproportional crown size was present in our case, but the interdental bone loss was high thus making this not a very ideal, but still optimal fill of the interdental space was noted. additionally, harvesting prf just prior to surgery, advocating an atraumatic procedure, with primary closure is likely to contribute to the overall success. another advantage of this procedure is that a second site for graft harvest is avoided, vastly improving the patient compliance and reducing the post operative morbidity. in conclusion, the case report shows a novel surgical procedure using prf to regenerate a lost interdental papilla. the reconstructed papilla in the new position was stable when reviewed at 3 and 6 months postoperatively [figure 5 ]. however, studies with a longer study period are required to determine the success rate and the predictability of this procedure. moreover, of all methods, genuine and stable papillary reconstruction results only when the regeneration of interdental bone occurs, therefore, prf combined with bone graft may improve the clinical success. | loss of interdental papilla predisposes to phonetic, functional, and esthetic problem. surgical techniques are manifold, but are challenging and very unpredictable. the purpose of this case report is to present the use of platelet rich fibrin (prf) in the reconstruction of papilla in the maxiallry anterior region of a forty year old woman who presented with loss of interdental papillae in 11, 12 and 11, 21 region. prf was tucked in to the pouch created with a semilunar pedicle flap and the entire gingivopapillary unit was displaced coronally. optimal fill was noted at 3 and 6 months postoperatively. use of prf may thus be the panacea for interdental papilla augmentation. |
two human gamma - herpesviruses, kaposi 's sarcoma - associated herpesvirus (kshv or hhv-8), and epstein - barr virus (ebv), are implicated in multiple malignancies. like other herpesviruses, they establish life - long persistent infections, interchanging between lytic replication and latency, while being subjected to the control of the host immune system. an enormous amount of knowledge has been built on the molecular biology of kshv and ebv. however, due to the lack of a small animal model, the studies on the in vivo interplay between the virus and the host during persistent infections have been limited. murine gammaherpesvirus 68 (mhv-68, hv-68, also known as muhv-4), originally isolated from wild rodents, was found to be closely related to kshv / hhv-8 and ebv [14 ]. following intranasal inoculation into laboratory mice, mhv-68 first replicates in lung epithelial cells to produce infectious viruses and then establishes latency in b cells [5, 6 ]. remarkably, massive lymphoproliferation that occurs at about two weeks after infection resembles infectious mononucleosis seen in some individuals experiencing primary ebv infection [7, 8 ]. persistent infections of mhv-68 also lead to b - cell lymphomas in a small fraction of mice and the tumor incidence increases in immuno - deficient mice. the genome of mhv-68 was completely sequenced and the majority of the identified open reading frames (orfs) share homology to those of kshv and ebv. however, unlike human gamma - herpesviruses, mhv-68 readily infects a variety of cell lines and undergoes lytic replication. therefore, mhv-68 represents a valuable model to study not only the virus - host interactions but also viral lytic replication of gamma - herpesviruses. in virology, mutations are introduced into a specific gene on the viral genome and the phenotype of the resultant mutant virus is studied. herpesviruses have rather large dna genomes up to 250 kb and thus the mutant virus is generated by homologous recombination between the viral genome and the dna fragment carrying the desired genetic alterations. this method is time consuming because the mutant virus needs to be separated from the parental virus by multiple rounds of plaque purifications or limiting dilutions. it would be even more cumbersome to generate the mutants that are defective in viral replication. a breakthrough in genetic mutagenesis of herpesviruses came from the method that was established to clone the entire herpesviral genome into a bacterial artificial chromosome (bac) [1016 ]., has the capacity to accommodate a large insert (up to 300 kb) and stably maintain it in bacterial hosts. once the viral genome is cloned and propagated as a bac plasmid in e. coli, it can be efficiently modified using the well - developed bacterial genetic methods. the cloning method exploits the fact that the linear herpesviral dna within an infectious viral particle becomes circularized once entering a cell. for cloning of the herpesviral genome, the first step is to construct a recombinant virus that contains the insertion of the bac sequence at a tolerable site, and then this bac - containing virus is used to infect permissive cells. next, the circularized bac - containing viral dna is harvested from the infected cells and used to transform e. coli to obtain colonies, each of which harbors a viral bac. two major recombination systems have been used for site - specific mutagenesis of viral bacs. one is reca - mediated allelic exchange, relying on the shuttle plasmid to transfer the mutation flanking by at least 350-bp homologous sequences into the viral bac plasmid. the other is carried out by recombinases e and t between linear dna fragment and the bac plasmid, which only requires a 50-bp homologous region on either site of the mutation. however, et - recombination might suffer from a higher risk of illegitimate recombination. in order to efficiently and systematically study the functions of individual viral genes encoded by mhv-68, we decided to clone the sequenced wums isolate as a bac plasmid. after obtaining the mhv-68 bac plasmid, we conducted transposon - mediated random insertional mutagenesis to systematically identify the viral orfs essential for viral replication as well as to functionally profile a genetic locus in great details. due to the extensive use of our mhv-68 bac plasmid in the field the bac sequence flanked by the loxp sites was inserted into upstream of the leftmost open reading frame, m1. the infectious viruses were reconstituted after transfection of the mhv-68 bac plasmid and shown to replicate indistinguishably compared to the wild - type virus. however, we found that the excision of the bac sequence from the reconstituted viruses by cre / loxp recombination is necessary for the in vivo study. after verifying the mhv-68 bac clone we generated, mutagenesis was carried out to explore the role of orf11. orf11 is conserved among gamma - herpesviruses, but it does not have any assigned function. nonsense mutations were inserted near the n - terminus of orf11 on the mhv-68 bac by a reca - mediated mutagenesis system. disruption of orf11 had no effect on viral replication in vitro or on viral infection in vivo following intranasal inoculation into balb / c mice. the working virus stocks were grown by infecting bhk-21 cells (atcc ccl-10) at a multiplicity of infection (moi) of 0.05 pfu / cell. bhk-21 and 293 t cells were cultured in dulbecco's - modified eagle 's medium (dmem) plus 10% fetal bovine serum and nih3t3 cells were cultured in dmem plus 10% bovine calf serum. the pbac(loxp) plasmid was constructed from pbelobac11 by inserting a second copy of loxp sequence. this was achieved by annealing two oligonucleotides (loxp4 and loxp5, listed in table 1) and cloning into the unique bamhi and sfoi sites of pbelobac11. the puromycin expression cassette derived from ptw39 which contains the puromycin coding sequence driven by the cmv promoter was inserted into pbac(loxp) to create pbac(loxp+pur). pbac(loxp+pur) was then linearized at the unique clai site between two loxp sites, blunted and cloned into the unique stui site in the mhv-68 genome region (nt 1064340) to generate the targeting plasmid ptw64 for homologous recombination. the translational stop codons were introduced into the targeted orf by pcr. the pcr reactions were carried out as suggested by the manufacturer using a proof - reading enzyme, vent dna polymerase (biolab) and the cycle number was limited to 25. the sequences upstream of the stop codons (a fragments) were amplified by primers of af and ar while the downstream sequences (b fragments) were by primers of bf and br using wild - type mhv-68 virion dna as the template. the a and b fragments were designed to have a 21 bp overlapping sequence containing restriction enzyme sites bamhi and paci for later screening purposes. in a subsequent pcr reaction, the a and b fragments were used as templates and amplified by primers of af and br. the mhv-68(bac) was generated by cotransfecting ptw64 linearized with avrii and the mhv-68(egfp) virion dna into bhk-21 cells. at 5 days after transfection, the pool of mhv-68(bac) and mhv-68(egfp) the recombinant mhv-68(bac) candidates were selected by the loss of enhanced green fluorescent protein expression. generally four 10-cm plates of bhk-21 cells were infected at moi of 0.05 pfu / cell. at the time when 5080% cells were detached from the plate, the supernatants were harvested and clarified twice by spinning down cell debris for 15 min at 1500 rpm, followed by digestion of dnasei (5 g / ml) and rnasea (5 g / ml) in the presence of 3 mm of mgcl2 and cacl2 at 37c for 30 min. the treated supernatants were subjected to high - speed centrifugation in a sa-600 rotor (sovall) at 12,000 rpm for 2 hr at 4c. the pellets were resuspended in the buffer (200 mm tris [ph 8 ] and 100 mm edta) and digested with 1 mg / ml of proteinase k (sigma) in the presence of 0.5% sds at 60c for overnight. the digested samples were extracted twice with phenol : chloroform (1:1) and the dna was precipitated with ammonium acetate and ethanol. for isolating circular viral dna, briefly, bhk-21 cells were infected at moi of 100 pfu / cell and cells were harvested at 3 hr after infection in pbs. the cell pellet was resuspended in the buffer containing 10 mm tris (ph 8), 10 mm edta, 0.5% sds, and 1 m nacl. the sample was then incubated at 4c for overnight and spun down at 14,000 rpm for 20 min at 4c. the supernatant was digested with proteinase k (60 g / ml) and rnasea (30 g / ml) at 37c for 30 min. the dna was extracted twice with phenol : chloroform (1 : 1) and precipitated with ammonium acetate and ethanol. the pellet was resuspended in te and 1 l was used to electroporate e.coli dh10b. all the bac plasmids were isolated by the midi - prep kit (qiagen) according the modifications suggested by the manufacture. for transfection of bhk-21 cells, lipofectamine plus (invitrogen) was used according to the manufacture 's recommendations. to remove the bac sequence, a cre recombinase expression plasmid was co - transfected with the viral bac plasmid. for electroporation of dh10b (invitrogen), a gene pulser ii system (bio - rad) with 0.1-cm cuvettes (fisher) was used. for reporter assays, 10 ng of a firefly luciferase construct driven by the isre (interferon - stimulated response element) promoter and 1 ng of a renilla luciferase construct driven by the housekeeping pgk (phosphoglycerate kinase) promoter were transfected into 293 t cells seeded in 48-well plates together with 100 ng of a protein expression plasmid of a viral gene. one day later, the transfected cells were treated with interferon (ifn-) and 24 hours (24 hrs) later, the total cell lysates were harvested for dual luciferase assay (promega). the normalized value was obtained by dividing the firefly luciferase reading with the renilla luciferase activity of each sample. to analyze virion dna and bac plasmids, digestion of restriction enzymes was performed and the products were separated on 0.7% agarose gel. the gel was then transferred onto a hybond n membrane (amersham). the membrane was then hybridized with isotope - labeled probes and the signals were developed as previously described. to quantify the copy number of viral dna, quantitative real - time pcr was performed using primers and probes derived from the m9 gene as previously described. female balb / c mice (charles river laboratories, wilmington, mass.), 5 - 6 weeks - old, were first anesthetized by intraperitoneal injection of a mixture of ketamine and xylazine (100 mg / kg and 2 mg / kg) and then inoculated intranasally with 20 pfu of each virus in 20 l of dmem. at the times indicated, lungs and spleens were harvested and weighed. to determine the viral titers in the lungs, serial dilutions of the tissue homogenates were incubated with bhk-21 cells for plaque assays. single - cell suspensions were obtained from the spleens and subjected to reactivation assays. serial numbers of splenocytes were laid onto bhk-21 cells and after 6 days bhk-21 cells were fixed to determine the numbers of plaques. the plaques are referred to as infectious centers and each infectious center arises as a result of a virus reactivating from latency. preformed viruses in splenocytes were examined by freeze - thawing cells once prior to incubating with bhk-21 cells and no plaques were detected. the viral copy numbers present in splenocytes were determined by quantitative real - time pcr described in the previous section. the porf11s(bac) plasmid was generated by reca - mediated allelic exchange in e. coli., as described by. briefly, the donor strain is gs111 carrying the shuttle plasmid, porf11s(gs284), and the recipient strain is gs500(reca) harboring pmhv-68(bac). the shuttle plasmid contains an ampicillin - resistant marker and the negative selection marker sacb, which causes the toxicity to bacteria in the presence of sucrose. cointegrates were selected by growing in the presence of chloramphenicol (34 g / ml) and ampicillin (100 g / ml) and resolved by 8-hr growth in the presence of chloramphenicol only. after resolution, negative selection against the bacteria retaining the shuttle plasmid was done by growing in the presence of 5% sucrose and chloramphenicol on lb plates lacking nacl. the incorporation of the stop codons was determined by pcr and restriction enzyme digestion to look for the insertion of new sites engineered next to the stop codons. to facilitate genetic manipulation of mhv-68, the viral genome was cloned as a bac plasmid and mutagenized in e. coli, based on a strategy used for mutagenesis of mcmv. the site has been used for insertion in our laboratory to construct several recombinant viruses which replicated comparably to wild - type mhv-68 in vitro and in vivo. the plasmid pbelobac11 was modified to contain two tandem loxp sites for the excision of the bac sequence mediated by the cre recombinase. to promote the selection of the bac - inserted recombinant virus, an expression cassette of the puromycin resistance gene the resultant modified plasmid designated as pbac(loxp+puro), was linearized between two loxp sites and inserted into a stui site of a 4.2 kb mhv-68 sequence such that the bac sequence was flanked by regions of 1.8 kb (nt 1061891) and 2.4 kb (nt 18924340). this final construct was co - transfected into bhk-21 cells with purified virion dna from mhv-68(egfp), containing an egfp insertion at nt 1891. after several rounds of purification by limiting dilutions, the recombinant virus, mhv-68(bac), was obtained and its genomic structure was analyzed by restriction enzyme digestion (figure 1(b), lane 2). as a result of the insertion of the bac sequence at nt 1891, the wild - type 12.7-kb ecori fragment (labeled with an asterisk in lane 1) were replaced by the 3.2-kb and 20 kb fragments in the digested mhv-68(bac) dna (labeled with a and b in lane 2). similarly, the wild - type 6.1-kb hindiii fragment (labeled with an asterisk in lane 1) was replaced by the 2.9- and 11.5-kb fragments (labeled with d and e in lane 2) in the digested mhv-68(bac) dna. next, the circular viral genomes of mhv-68(bac) were harvested from infected bhk-21 cells by the hirt extraction method and then electroporated into e. coli dh10b. the plasmids from several colonies were prepared and digested with hindiii to identify the clone that contains the full - length mhv-68 genome. one clone, pmhv-68(bac), was analyzed by ecori and hindiii digestions (figure 1(b), lane 3). compared to mhv-68(bac) virion dna (figure 1(b), lane 2), the only difference is the appearance of a larger fragment (labeled with f in lane 3) derived from the fused terminal fragment due to the circular nature of the bac plasmid. transfection of the pmhv-68(bac) into bhk-21 initiated viral lytic replication and led to the formation of plaques. a similar amount of wild - type mhv-68 virion dna was transfected as a control and the appearance of plaques was about at the same time, 3 days after transfection. the supernatant containing the reconstituted virus, pmhv-68(bac)v, was harvested to infect fresh bhk-21 cells to produce more viruses and obtain virion dna for the analysis of restriction enzyme digestions. as expected, the restriction pattern of virion dna of pmhv-68(bac)v (figure 1(b), lane 4) is identical to mhv-68(bac) (figure 1(b), lane 2). in order to remove the rather large insert of the bac sequence (10 kb), pmhv-68(bac)v was co - transfected with a protein expression plasmid of cre recombinase. the resultant pool of viruses was subjected to limiting dilution and screened by pcr for the absence of the bac sequence. the virus, mhv-68(loxp), lacking the bac sequence but retaining one copy of the loxp site, was then amplified in bhk-21 cells to obtain virion dna for analyses. after cre - mediated recombination, there is 200-nt bac sequence left on the genome of mhv-68(loxp), which causes a shift in the 6.1-kb hindiii wild - type fragment (labeled with an asterisk in lane 1) to a larger fragment (labeled with f in lane 5). next, the growth kinetics of pmhv-68(bac)v and mhv-68(loxp) were examined by determining their multiple - growth curves on bhk-21 cells. these two viruses replicated indistinguishably from each other and comparably to wild - type mhv-68 (figure 2) thus, the 10-kb insertion of the bac sequence did not significantly affect the replication of mhv-68 in cultured cells. one major advantage of studying mhv-68 is the availability of an in vivo infection mouse model. thus, we needed to determine whether the reconstituted virus behaved similarly to the wild - type virus in mice. balb / c mice were intranasally inoculated with 20 pfu of wild - type mhv-68, pmhv-68(bac)v, or mhv-68(loxp). at the peak of acute lytic infection in the lungs, mice infected with mhv-68(loxp) generated comparable viral titers to those infected with wild - type mhv-68 (figure 3). the viral titers in mice infected with pmhv-68(bac)v were slightly lower (2.6-fold) than those infected with wild - type mhv-68 but the difference did not reach the statistical significance (p > 0.1). at day 11 after infection, no infectious viruses were recovered from any group of mice. the results indicate that the virus derived from our bac clone infects and replicates in the lungs as well as wild - type mhv-68 and the presence of the bac insert does not significantly interfere with viral productive infection in the lungs. following acute infection in the lungs, the spleens of mice infected either with wild - type mhv-68 or mhv-68(loxp) enlarged to similar extents compared to uninfected mice (figure 4(a)). the levels of latently - infected cells determined by infectious center assays were also comparable between mice infected with wild - type virus and those with mhv-68(loxp) (figure 4(b)). similar results were obtained from measuring the viral dna copy numbers present in the spleen (figure 4(c)). in contrast, the virus retaining the bac insert failed to establish the wild - type level of latency in the spleen. there were 100-fold fewer infectious centers and 10-fold lower viral dna copies in the spleen compared to those from mice infected with wild - type mhv-68. taken together, the bac insertion in the viral genome severely attenuated viral splenic latency and its removal restored the ability of mhv-68 to establish the wild - type level of latency. the present study indicates that our mhv-68 bac clone is suitable for genetic mutagenesis to investigate the function of individual viral genes. in fact, random mutagenesis by transposon insertions was already conducted on this mhv-68 bac plasmid, and the resultant mutant viruses were used to identify genetic requirements for productive replication in vitro and in vivo. moreover, we also constructed a firefly luciferase - expressing virus using the mhv-68 bac genetic engineering system described here and examined viral infection via the whole body bioluminescence imaging. it was shown that the virus derived from our mhv-68 bac clone mainly replicates in the lung following intranasal inoculation and produces infectious virus that can be recovered from it, which is similar to what has been observed for wild - type mhv-68. although a different mhv-68 bac plasmid was constructed and published previously by adler., we independently carried out the cloning process and inserted the bac sequence at a different location. our bac sequence insertion is at 1.8 kb from the terminal repeats of the genome while adler. we showed that the presence of the 10-kb bac sequence did not significantly reduce the replication ability of the virus in cultured cells or in the lungs of mice, unlike the previous mhv-68 bac clone constructed in the other laboratory. despite that the bac insertion does not interfere with viral lytic replication, it severely attenuates viral ability to establish latency in the spleen. we observed less splenomegaly, 10-fold lower viral dna copy numbers and 100-fold reduction in viral reactivation from splenocytes. this result is similar to the mhv-68 bac clone made by adler., but not surprising, since several studies have shown that the left end of the mhv-68 genome is important for viral latency [2629 ]. in addition, several microrna genes were identified on the left end of the genome. it is possible that the insertion of a large bac sequence alters the expression of the neighboring genes. thus, it is necessary to remove the bac sequence using cre recombinase prior to the study of viral latency. orf11 is one of mhv-68 genes whose functions remain unknown. previously, orf11 was shown to be a virion component but dispensable for viral replication in vitro. a recent study on the ebv orf11 homologue (also known as lf2) indicates that this viral protein play a role in counteracting type i interferon (ifn) responses. here, we used transient transfection assays to examine whether mhv-68 orf11 (m - orf11) affected the ifn - mediated induction of an isre (interferon - stimulated response element) reporter. we also included transfection of a kshv orf11 (k - orf11) expression plasmid as a comparison. the induction by ifn- was 10~12-fold in the cells transfected with an empty vector but reduced to 2-fold in the cells receiving the m - orf11 plasmid (figure 5(a)). interestingly, k - orf11 did not have the same inhibitory effect as m - orf11. neither did expression of other mhv-68 genes, such as orf48 and orf46, inhibited the induction of isre reporter activity. the reporter assays indicate that m - orf11 can reduce the ifn responses but not k - orf11. in order to determine the biological significance of the anti - ifn activity of m - orf11 in the context of viral replication the reca - mediated allelic exchange method was used to introduce translational stop codons after n - terminal 41 amino acids of the predicted 388 amino - acid orf11 gene product. the corresponding shuttle plasmid to transfer the stop codons into the pmhv-68 bac plasmid was constructed and verified by sequencing. coli as described in section 2, the recombinant bac plasmid, porf11s(bac), was isolated and examined by saci and paci digestion. to reconstitute the virus, the porf11s(bac) plasmid was transfected into bhk-21 cells together with a crerecombinase expression plasmid. the pool of viruses containing both orf11s(bac) and orf11s(loxp) was subjected to limiting dilution and screened for the absence of the bac sequence. one isolate, orf11s(loxp), was selected and its genomic structure was examined by restriction analysis. as expected, the virion dna of orf11s(bac) and orf11s(loxp) have the similar restriction patterns of saci and paci altered in the fragment containing the orf11 coding sequence (figure 5(b), lanes 4 and 5) compared to wild - type pmhv68(bac)v and mhv68(loxp). the 7.0-kb saci wild - type fragment (labeled with squares in lanes 13 of figure 5(b)) containing the orf11 coding sequence is replaced by the 4.7- and 2.2-kb fragments (labeled with a and b in lanes 4 - 5) as a result of the new paci site introduced along with the stop codons into the orf11. the removal of the bac sequence led to the appearance of the 2.7-kb saci in orf11s(loxp) (labeled with c in lane 5 of figure 5(b)), which is also detected in mhv68(loxp) (figure 5(b), lane 3). this 2.7-kb fragment is 200 bp larger than the 2.5-kb wild - type fragment (figure 5(b), lane 1) as a result of the remaining loxp and bac vector sequence. restriction digestions by hindiii and ecori displayed similar patterns compared to the wild - type pmhv68(bac) plasmid, indicating no detectable illegitimate dna rearrangements during recombination in e. coli. to determine whether orf11 contributes to the resistance of mhv-68 to type i interferons, we studied the multiple - step growth curves of mhv68(loxp) and orf11s(loxp) with or without the treatment of ifn-. for this experiment, we used nih3t3 cells and mouse ifn-. the orf11s(loxp) virus replicated comparably to mhv68(loxp) in the absence of interferons, indicating that orf11 is not required for viral replication in vitro (figure 5(c)), consistent with the previous results [19, 31 ]. furthermore, the lack of orf11 did not increase the sensitivity of mhv-68 to the treatment of ifn-. there were about 34-fold reductions by ifn- in the peak viral titers of both mhv68(loxp) and orf11s(loxp) (figure 5(c)). one is that the anti - ifn activity of orf11 observed in the transient transfection reporter assay is a nonspecific effect due to overexpression of the protein. this is unlikely since overexpression of other viral proteins, especially k - orf11, does not have the same inhibitory effect. the other interpretation is that there are additional viral proteins with similar anti - ifn functions to complement the loss of orf11. it is not unusual for large dna viruses, such as herpesviruses, to utilize multiple viral proteins to counteract type i interferon responses. as reviewed elsewhere [3335 ], several kshv proteins can inhibit the functions of irf3 and irf7, the two important transcriptional factors that regulate type i interferon responses. therefore, it is likely that interferons play an important role in the control of gamma - herpesvirus infection and the viruses utilize multiple mechanisms to counteract the host responses for their survival. to examine the role of orf11 in mhv-68 infection in vivo, balb / c mice were intranasally inoculated with 20 pfu of wild - type mhv-68, mhv68(loxp), or orf11s(loxp). the peak viral titers in the lungs were similar among groups of mice at day 9 after infection (figure 6(a)). at day 11, no infectious viruses were detected in any mice (data not shown). the viral latency at day 15 after infection in the spleens of mice infected with orf11s(loxp) was comparable to that in the mice infected with wild - type mhv-68 (figure 6(b)). although mhv68(loxp) seemed to establish lower levels of latency \ than the other two groups of infected mice, this difference did not reach statistical significance. similar results were obtained from the analysis of dna copy numbers measured by real - time pcr. in conclusion, orf11 is not required for mhv-68 to establish lytic and latent infections in mice, consistent with the previous studies [19, 31 ]. one notable piece of information about orf11 is that orf11 as well as orf10 were previously postulated to be derived from the viral dutpase gene, orf54, based on sequence similarities and structural predictions. however, orf10 and orf11 do not retain the critical residues at the catalytic site of dutpase and thus they are not expected to have any enzymatic activity. since these three proteins, orf54, orf10, and orf11, have some degrees of homology, it may be that they have the same unknown functions, such as anti - ifn activity, and can complement each other ; thus, elimination of orf11 alone is not sufficient to generate a phenotype. nevertheless, it is also possible that orf11 is only required under specific circumstances. for example, the virus deficient in the m3 gene only exhibited a different phenotype from the wild type when infecting cns. we have not tested other aspects of virus infection besides replication in the lungs and latency in the spleens. the mhv-68 bac plasmid generated in our laboratory has been extensively used to construct various mutant viruses. in this report, we provide the details for the cloning and characterization of our mhv-68 bac. in comparison to the wild - type mhv-68, the virus reconstituted from the bac plasmid replicated comparably in cultured cells and produced similar titers in the lung of infected mice. however, removal of the bac insertion is necessary for the studies of viral splenic latency. in summary, | here we describe the cloning of a sequenced wums isolate of murine gammaherpesvirus-68 (mhv-68, hv-68, also known as muhv-4) as a bacterial artificial chromosome (bac). we engineered the insertion of the bac sequence flanked by loxp sites into the left end of the viral genome before the m1 open reading frame. the infectious viruses were reconstituted following transfection of the mhv-68 bac dna into cells. the mhv-68 bac - derived virus replicated indistinguishably from the wild - type virus in cultured cells. excision of the bac insert was efficiently achieved by coexpressing the cre recombinase. although the bac insertion did not significantly affect acute productive infection in the lung, it severely compromised the ability of mhv-68 to establish splenic latency. removal of the bac sequence restored the wild - type level of latency. site - specific mutagenesis was carried out by reca - mediated recombination to demonstrate that this infectious bac clone can be used for genetic studies of mhv-68. |
the plasma proteome has been extensively investigated with the aim of biomarker development [1, 2 ]. plasma is the most accessible clinical material, and plasma biomarkers for early diagnosis and monitoring the response to therapy and disease recurrence would be beneficial for patients with cancer. because proteins released by tumors, particularly early - stage tumors, are expected to exist in very low concentrations and plasma contains various proteins with considerable heterogeneity between and within patients, the identification of novel plasma biomarkers represents a substantial challenge. global expression studies on intact plasma proteins are of special interest in biomarker studies as the intact proteins reflect the functional features of protein structure. peptide subsets from complex digests have been analyzed for plasma proteomics, resulting in the identification of low - abundance proteins such as tissue leakage proteins and biomarker candidates. however, analysis of peptide digests may not be sensitive to posttranslational protein processing, and may therefore not reveal many relevant protein isoforms associated with disease status. to date, much effort has been devoted to detect trace intact proteins in complex plasma samples. the utility of a combinatorial hexapeptide ligand library immobilized on a solid - phase matrix has been reported, introduced to intact plasma proteomics [59 ], and commercialized as proteominer (bio - rad laboratories, hercules, ca, usa). proteominer contains millions of randomly synthesized hexapeptide ligands that are equally represented with a selected number of targets. when a complex plasma protein extract is exposed, the hexapeptide ligands for high - abundance proteins are saturated, but the majority remains unbound. in contrast, the proteins which do not saturate the corresponding hexapeptide ligands and usually not observed by the conventional methods will appear in the proteome data. the approach of using a combinatorial hexapeptide ligand library is different from that of using depletion and separation ; thus, it reveals a novel aspect of the plasma proteome. a recent report demonstrated that prefractionation using a hexapeptide ligand library for shotgun mass spectrometry studies identified plasma proteins not recorded in the human plasma proteome project. the combined use of a hexapeptide ligand library with depletion and separation methods has also been a challenge in deeper plasma proteomics, and the resulting protein contents are examined by gel electrophoresis and mass spectrometry [12, 13 ]. proteominer has been used for disease biomarker studies in lung cancer and liver cancer. considering that it will potentially visualize the unique plasma proteome aspects, the application and optimization of a solid - phase hexapeptide ligand library for disease biomarker studies should be further investigated. in this study, we examined the utility of a solid - phase hexapeptide ligand library in combination with a depletion column, an anion - exchange column, and 2d - dige that allows an instant visual comparison of the protein patterns. protein spots exhibiting prominent differences between samples treated with and without the library were subjected to mass spectrometry. our study clearly demonstrated that the combined use of the proteominer and the other proteomics modalities can visualize unique plasma proteome. frozen human plasma was purchased from cosmobio koj (tokyo, japan). after the plasma was placed on ice, 40 ml plasma was centrifuged and 30 ml supernatant was recovered for the following experiments. albumin and other proteins were separated using a hitrap blue hp column (5 ml resin, ge, uppsala, sweden) with the akta explorer system (ge) at a flow rate of 1.0 ml / min. the separation was initiated by washing the column with rinse buffer (50 mm kh2po4/na2hpo4, ph 7.0) for 5 min. plasma (30 ml) was diluted with 60 ml 50 mm kh2po4/na2hpo4 (ph 7.0), and 9 ml of the diluted plasma was injected. the column was then washed with binding buffer (50 mm kh2po4/na2hpo4, ph 7.0) for 35 min, and the flow - through fraction was collected. bound proteins were eluted from the column with elution buffer (50 mm khpo4, 1.5 m kcl, ph 7.0) for 45 min, and the bound fraction was collected. this process was repeated 10 times for a total of 90 ml of diluted plasma. one - third of the flow - through and bound fractions, approximately 150 ml of each, was concentrated to 1.2 ml using a viva spin 20 column (10 k mwco, 20 ml capacity, sartorius, gotteingen, germany). then, 1.0 ml and 0.20 ml of the concentrated samples were subjected to treatment with the solid - phase hexapeptide ligand library and 2d - dige, respectively. two - thirds of the flow - through fraction, approximately 300 ml, was subjected to an immunodepletion column. immunoglobulin was depleted using the hitrap protein g hp column (1 ml resin, ge) with the akta explorer system (ge) at a flow rate of 1.0 ml / min. the depletion was initiated by washing the column with rinse buffer (50 mm kh2po4/na2hpo4, ph 7.0) for 4 min. after 15 ml of the flow - through fraction from the hitrap blue hp column was injected, the column was washed with binding buffer (50 mm kh2po4/na2hpo4, ph 7.0) for 5 min, and the flow - through fraction was collected. bound proteins were eluted from the column with elution buffer (0.1 m glycine - hcl, ph 2.2) for 8 min and collected as the bound fraction. the collected bound fraction was immediately neutralized with neutralizing buffer (1.0 m tris - hcl, ph 9.0). this process was repeated 20 times for a total of two - thirds of the flow - through fraction from the hitrap blue hp column (approximately 300 ml). half of the flow - through and bound fractions (approximately 200 ml and 80 ml, resp.) were concentrated to 1.2 ml and 0.25 ml, respectively, using viva spin 20 columns (sartorius). then, 1.0 ml of the concentrated flow - through fraction and 0.20 ml of the concentrated bound fraction were subjected to treatment with the solid - phase ligand library, and the remaining samples were subjected to 2d - dige. another half of the flow - through fraction (approximately 200 ml) was concentrated to 2.0 ml using the viva spin 20 column (sartorius). after diluting with 38 ml of 25 mm tris - hcl (ph 9.0), the sample was subjected to separation on an anion - exchange column. the flow - through fraction from the hitrap protein g hp column was separated using the resource q column (1 ml resin, 6.4 mm i d 30 mm, ge) with the akta explorer system (ge) at a flow rate of 3.0 ml / min. the separation was initiated by washing the column with rinse buffer (25 mm tris - hcl, ph 9.0) for 4 min, and 5 ml of the flow - through fraction from the hitrap protein g hp column was injected. the separations were performed using a stepwise nacl gradient as follows : 0, 100, 150, 200, 250, and 1000 mm for 5 min each. the column was washed with rinse buffer (25 mm tris - hcl, ph 9.0) for 5 min. this process was repeated 8 times for a total of 40 ml of the diluted flow - through fraction from the hitrap protein g hp column. the collected samples were concentrated to 0.25 ml, and the buffer was exchanged gradually with 25 mm tris - hcl (ph 9.0) using the viva spin 20 column (sartorius). then, 0.2 ml and 0.05 ml were subjected to treatment with the solid - phase ligand library and 2d - dige, respectively. a solid - phase combinatorial library of hexapeptides was purchased from bio - rad laboratories (proteominer kit). unprocessed plasma (1 ml) and the flow - through fractions from the hitrap blue hp and hitrap protein g hp columns were treated using the proteominer large - capacity kit, and 0.2 ml of the bound fraction from the hitrap protein g hp column, and all fractions from the resource q column were treated using the proteominer small - capacity kit. after 2 h of incubation at room temperature, the unbound fraction was washed out by centrifugation. after rinsing, the bound sample was eluted with an elution reagent containing 8 m urea, 2% chaps, and 5% acetic acid, according to the manufacturer 's instructions. protein concentration was measured using a protein assay kit (bio - rad), according to the manufacturer 's instructions (table 1). protein samples (1 g) were examined by electrophoresis using 18-well precast 12.5% polyacrylamide gel plates (e - pagel, atto, tokyo, japan). electrophoresis was performed at a constant current of 40 ma for 80 min and using the page run ae6531 system. silver staining was performed using the silver stain kanto iii kit (kanto chemical, tokyo, japan), according to the manufacturer 's instructions. briefly, protein samples (20 g) were labeled with the cy3 or cy5 fluorescent dye (cydye dige fluor saturation dye, ge), and differentially labeled protein samples were mixed. after dividing into 3, the labeled protein samples were separated by 2d - page. the first - dimension separation was performed using a 24 cm length immobiline gel (ipg, pi 47, ge) and multiphor ii (ge) whereas the second - dimension separation was performed using gradient gels prepared in house and ettandalttwelve (ge). the gels were scanned using a laser scanner (typhoon trio, ge) at an appropriate wavelength for cy3 or cy5. the cy3 and cy5 intensities were compared in the same gel using the progenesis samespots software (version 4.0 ; nonlinear dynamics, newcastle, uk). proteominer - treated and untreated samples were labeled with cy3 and cy5, respectively, or with cy5 and cy3, respectively. the average value of the intensity ratio was calculated among the triplicate gels for all protein spots and then averaged between the 2 samples for further study. spot intensity data were exported from the progenesis samespots software as excel files amenable to numerical data analysis. proteins were extracted from the protein spots by in - gel digestion, as reported previously. briefly, protein samples (100 g) were labeled with cy3 and separated by 2d - page. the protein spots were then recovered from the gel pieces using an automated spot recovery machine. the recovered protein spots were extensively washed with a solution containing acetonitrile and ammonium bicarbonate minimum and treated with trypsin (promega, madison, wi, usa) at 37c overnight. the tryptic digests were recovered from the gel pieces, concentrated by vacuum, and resolubilized with 0.1% trifluoroacetic acid. the final tryptic digests were subjected to mass spectrometry, which was performed using the lxq linear ion trap mass spectrometer (thermo electron, san jose, ca, usa). the mascot software (version 2.3.0 ; matrix science, london, uk) was used to search for the mass of the peptide ion peaks against the swiss - prot database (homo sapiens, 471472 sequences in sprot_57.5 fasta file). the search parameters were as follows : trypsin digestion allowing up to 3 missed tryptic cleavages, fixed modifications of carbamidomethyl, variable modifications of oxidation, 1, 2, and 3 peptide charge, peptide mass tolerance of 2.0 da, and use of ms / ms tolerance of 1.0 da for all tryptic - mass searches. we previously reported the utility of combining multidimensional chromatography and 2d - dige for intact plasma proteomics. extensive fractionation by the different separation modes increased the number of protein spots on 2d - dige and allowed a quantitative comparison between the plasma samples from healthy donors and those from patients with lung adenocarcinoma and pancreatic cancer. however, mass spectrometric protein identification revealed that protein spots with a significant difference between the sample groups corresponded to high- and medium - abundance proteins such as acute - phase proteins, but no known plasma tumor markers were detected. thus, we concluded that further investigations are needed to reveal low - abundance proteins for biomarker studies. in this study, we examined whether a novel technology, a solid - phase hexapeptide ligand library could improve the linkage of multidimensional chromatography and 2d - dige. the overall view of sequential protein separation is shown in figure 1. a sample equivalent to 10 ml plasma was separated using 3 different columns and then treated with the solid - phase hexapeptide ligand library proteominer. the proteominer - treated and untreated samples were compared using 2d - dige by labeling them with different fluorescent dyes and separating the labeled proteins on an identical gel. the protein spots with significantly different intensities between the proteominer - treated and untreated samples were subjected to mass spectrometry to identify the proteins. the number of observable low - abundance proteins was affected by the initial amount of plasma sample and the sensitivity of the final quantification method. we used a relatively large volume of plasma sample (10 ml) as the initial material. the immunodepletion columns allow the use of only a small volume of plasma sample for separation. furthermore, a significantly larger number of plasma samples should be examined to obtain conclusive results for biomarker development. a larger volume of samples can be manipulated by repeatedly using the same immunodepletion column. although it is quite feasible, special attention may be required to maintain reproducibility during a long period of use. in this study, we used blue sepharose and protein g - sepharose columns in a sequential manner to deplete albumin and subsequently immunoglobulin and to minimize repeated use of the same column. although these columns may have less sensitivity than an immunodepletion column and deplete nontargeted proteins that may bind to albumin and immunoglobulin, a larger volume of plasma sample can be treated in individual procedures. a previous study indicated that cibacron blue beads remove a major portion of the albumin but with concomitant loss of potentially important peptides and proteins. thus, we examined both the column - bound and flow - through fractions (figure 1). although the specificity of cibacron blue beads was not validated in this study, as the purpose of cibacron blue was to reduce the complexity of plasma sample, it should not be problem. to avoid possible redundant proteins in the neighboring fractions as much as possible when utilizing the anion - exchange column, we used stepwise elution and fractionation ; once all proteins were eluted, the next elution buffer was applied to the column (figure 1). considering the complexity of the samples and resolution of an anion - exchange column, extensive fractionation with a gradient buffer system may result in redundant contents among the fractions. we employed 6 stepwise fractionations by monitoring the fraction contents using sds - page (data not shown). the ultraviolet detection (280 nm) trace for each run demonstrated consistent separation of albumin and immunoglobulin from the depletion and anion - exchange columns. this high reproducibility may suggest the possible utilities of this approach for biomarker studies (supplementary figure 1). high quantitative and qualitative reproducibility of the solid - phase hexapeptide ligand library proteominer has been confirmed in previous reports [21, 22 ]. we examined the effects of sequential plasma protein fractionation using 3 columns and the reduction of dynamic range by proteominer (figure 2). notably, the protein sample bound to the blue sepharose and protein g - sepharose columns included many proteins that should be different from the targeted proteins, according to their molecular weights. treatment of the fractionated samples with proteominer enhanced the proteins that were not observed, except for those bound to the protein g - sepharose column. treatment of the bound fraction from the protein g - sepharose column with proteominer did not result in a greater number of observable proteins. this may have been due to the low complexity and narrow dynamic range of proteins in the bound fraction from the protein g - sepharose column. there was one order of magnitude in concentration difference for the observed protein bands in the proteominer - treated sample. these observations may reflect that the affinity of proteins for the peptide may not be equal and even the number of peptides bound on the beads is equal, the amount of proteins bound to the proteominer may be different depending on their affinity. this fraction contained similar amounts of only 4 major proteins, as revealed by sds - page (figure 2), and they may have been absorbed to proteominer in proportion to their original amount. the concentration and amount of protein samples before and after proteominer treatment are summarized in supplementary table 1. the recovery rate from proteominer was between 0.54 and 6.33%, suggesting that a unique population of protein species selectively bound to proteominer. this assumption was supported by the sds - page data, except the bound fraction from the protein g - sepharose column which included only 4 major proteins that were bound to proteominer (figure 2). although sds - page separated individual proteins with higher resolution than chromatography in this study, using it for a quantitative comparison in a biomarker study may be troublesome because many protein bands obviously overlapped (figure 2). thus, we subjected the fractionated samples to 2d - dige in order to separate the proteins with higher resolution. bandow compared proteominer - treated and untreated plasma samples using conventional 2d - page and demonstrated substantial differences between unprocessed and immunodepleted plasma samples. in 2d - dige, 2 protein samples were labeled with different fluorescent dyes, mixed, and separated by 2d - page. because the 2 samples were separated on an identical 2d - page, gel - to - gel variation was compensated. in addition, the wide dynamic range of the fluorescent dyes enabled a quantitative comparison. 2d - dige has been applied to compare the performance of proteominer with an immunodepletion column. we further extended the evaluation of the utility of proteominer by loading a high amount of protein and examining the proteins separated by an anion - exchange column. the fluorescent 2d - page images of the proteominer - treated and untreated samples were overlaid with different colors, so that the unique protein contents were visualized (figures 3 and 4). the results of experiments in which the fluorescent dyes were swapped are shown in supplementary figure 2. consistent with the sds - page results (figure 2), figure 3 demonstrates that the approach involving depletion of high - abundance proteins and multidimensional separation was an effective prefractionation method to increase the number of protein spots, and the use of proteominer treatment also contributed to reveal more plasma proteins. because these fractionation methods are based on different binding properties of proteins, their combined use revealed additional plasma proteins. the number of observed protein spots on 2d gel electrophoresis is summarized in supplementary table 2. overall, the total number of protein spots increased by treating the samples with proteominer, except for the bound fraction from the protein g - sepharose column. this observation suggests that proteominer may be a useful tool to observe a greater number of protein spots in prefractionated samples. we compared the protein spots of the samples with and without proteominer treatment (supplementary table 3). depending on the criteria, different numbers of protein spots showed significantly different intensities. although the total number of protein spots increased by treating the samples with proteominer (supplementary table 2), many protein spots revealed decreased intensity with treatment, suggesting the selective enrichment by proteominer. to reveal the characteristics of proteins with a particularly high or low affinity to proteominer, among the protein spots with greater than 5-fold differences (supplementary table 3), we selected those with the top 10% different intensities between the proteominer - treated and untreated samples in each fraction and subjected them to mass spectrometric identification. a total of 200 protein spots were subjected to mass spectrometry, and a positive identification was obtained for 128 (supplementary table 4). a list of the identified proteins is provided in supplementary table 5, and data supporting protein identification are shown in supplementary table 6. because the fold difference of the protein spots in the bound fraction from the protein g - sepharose column was less than 4, we did not examine them. of the original plasma samples, vitronectin and albumin were most affected by proteominer treatment and disappeared after depletion and fractionation using the anion - exchange column. proteins bound to proteominer have been reported in previous studies in which the proteins were globally identified by mass spectrometry. demonstrated that albumin, alpha 1-antitrypsin, alpha 2-macroglobulin, apolipoprotein a - i, apolipoprotein a - ii, haptoglobin - related protein, and serotransferrin have high affinity to proteominer. identified apolipoprotein a - iv, apolipoprotein d, apolipoprotein e, ceruloplasmin, complement c3, fibrinogen beta, fibrinogen gamma, ficolin-2, ficolin-3, paroxonase i, prothrombin, transthyretin, and vitronectin. the protein concentrations identified in this study are summarized in supplementary table 6. according to the literatures adiponectin and the carboxypeptidase n catalytic chain are not reported in previous studies, in which proteominer - treated samples were examined by 2d - page and mass spectrometry. adiponectin is an adipocytokine [2427 ] and plays a protective role against obesity - related disorders such as metabolic syndrome, type 2 diabetes, and cardiovascular disease. low levels of plasma adiponectin are associated with obesity and many types of malignancies such as liver cancer, breast cancer, pancreatic cancer, and endometrial cancer. an epidemiological study suggested that adiponectin is involved in early colorectal carcinogenesis, and that a low circulating adiponectin level is correlated with a poor prognosis in patients with colorectal cancer. the molecular backgrounds of these observations may be attributable to the antiproliferative effects of adiponectin on cancer cells. carboxypeptidase n (cpn), which is also known as kininase i, arginine carboxypeptidase, and anaphylatoxin inactivator, is a zinc finger metalloprotease. the association of cpn1 with malignancy and other diseases has not been reported, and the clinical utility of cpn1 has not been suggested. the working hypothesis of this study was that the combined use of different separation methods, including a solid - phase hexapeptide ligand library, would increase the number of observable proteins, and finally visualize the proteome that may not be observed otherwise. by loading a high amount of protein and using extensive prefractionation techniques prior to using proteominer, trace proteins became visible in sds - page, and the number of protein spots on 2d - dige increased significantly. in contrast, the present results of mass spectrometric protein identification did not support the use of a solid - phase hexapeptide ligand library to enrich low - abundance proteins. first, mass spectrometric identification was performed for proteins with a greater prominent difference between the samples with or without proteominer treatment, and only 128 of 200 proteins were successfully identified (supplementary table 4), probably because of the low protein amount. although we optimized the protocols for mass spectrometric protein identification because the sensitivity of the fluorescent dye in the 2d - dige was very high, not all protein spots on 2d - dige could be identified by mass spectrometry. to evaluate enriched proteins, the complementary use of an lc - ms / ms shotgun approach may be worth considering. second, proteins from proteominer were recovered by a single - step elution with 8 m urea, 2% chaps, and 5% acetic acid, according to the manufacturer 's instructions (bio - rad). however, because proteins may have interacted with hexapeptide ligand libraries in all possible modes, the absolute elution process may require sequential steps or more stringent buffer conditions such as boiling 10% sds with 3% dte. furthermore, various binding conditions may also be worth considering to capture whole binding proteins. third, considering the practical use of trace proteins in a biomarker study, we used as much sample as possible for identifying them and examined 10 ml plasma samples as an initial source. however, a larger volume of plasma sample, such as 100 ml, might be needed to collect rare proteins. in practice, such a high volume of plasma is rarely obtained for many cases in biomarker studies, and we may need to optimize the protocols for use of 10 ml plasma. for instance, we identify the biomarker candidates using 100 ml plasma, and using specific antibody against the identified candidate, we will be able to screen a relatively large number of samples with 10 ml volume or less. the combined use of the proteominer and the proteomic modalities in this study may enable the quantitative comparison for biomarker studies. we demonstrated that the liquid chromatography was quantitatively reproducible (supplementary figure 1), and the quantitative reproducibility of the proteominer and 2d - dige was previously reported [10, 17 ]. we may further need to examine how the combined use of such reproducible methods generate the results in a reproducible way, considering the degree of differences that we expect between the samples to be compared. the use of proteominer in combination with conventional proteomic modalities such as depletion and anion - exchange columns significantly enhanced trace proteins on sds - page and increased the number of protein spots on 2d - dige, suggesting that the use of a solid - phase hexapeptide ligand library has great potential for intact plasma proteomics. mass spectrometric protein identification revealed that high- and middle - abundance proteins were enriched by proteominer, and the characteristics of proteins with unique affinity to a solid - phase hexapeptide ligand library remain to be clarified by more extensive mass spectrometric protein identification. although use of proteominer for biomarker studies is quite feasible and attractive, more extensive characterization of binding proteins and optimized protocols are required for large - scale biomarker studies. | the intact plasma proteome is of great interest in biomarker studies because intact proteins reflect posttranslational protein processing such as phosphorylation that may correspond to disease status. we examined the utility of a solid - phase hexapeptide ligand library in combination with conventional plasma proteomics modalities for comprehensive profiling of intact plasma proteins. plasma proteins were sequentially fractionated using depletion columns for albumin and immunoglobulin, and separated using an anion - exchange column. proteins in each fraction were treated with a solid - phase hexapeptide ligand library and compared to those without treatment. two - dimensional difference gel electrophoresis demonstrated an increased number of protein spots in the treated samples. mass spectrometric studies of these protein spots with unique intensity in the treated samples resulted in the identification of high- and medium - abundance proteins. our results demonstrated the possible utility of a solid - phase hexapeptide ligand library to reveal greater number of intact plasma proteins. the characteristics of proteins with unique affinity to the library remain to be clarified by more extensive mass spectrometric protein identification, and optimized protocols should be established for large - scale plasma biomarker studies. |
squamous cell carcinoma of the head and neck (hnscc) is the sixth most common cancer with 500.000 diagnosis per year worldwide. patients with locally advanced disease have a chance of cure with multimodality treatments that involves surgery, radiotherapy, chemotherapy, and, in the last years, molecular targeted therapies. despite the advances in the treatment of locally advanced disease, furthermore, combining surgery, radiotherapy, and chemotherapy often leads to severe and permanent function deficits with a negative impact on patients ' quality of life. on the other hand, patients with relapsed or metastatic disease have a worse prognosis with an overall survival of approximately 710 months. new therapeutic protocols and agents should be developed to improve survival while limiting treatment - related toxicities. angiogenesis, the process that leads to the formation of new vessel, is a hallmark of tumor progression, and its role has been studied in many cancer types including hnscc. antiangiogenic agents are to date available and useful for the treatment of many tumors. in hnscc ; however, few clinical trials have yielded promising results when focusing on these new agents. this paper is aimed at evaluating the angiogenic factors involved in hnscc growth and progression and their therapeutic implications. vascular endothelial growth factor a (vegf - a) is the best known agent that induce angiogenesis. it is a vascular permeability factor that belongs to the platelet - derived growth factor (pdgf) superfamily, which also includes vegf - b, vegf - c, vegf - d, vegf - e, and placental growth factor (plgf). hypoxia induces vegf expression through the mediation of hypoxia - inducible factor (hif-1). there are many other factors involved in angiogenesis, such as epidermal growth factor (egf), pdgf, prostaglandins, cox-2, and il-6. the vegf family of ligands plays its role through cell surface receptor tyrosine kinases, vgfr-1, vgfr-2, and vgfr-3. vegfr-2 is the most important one through which vegf exerts its mitogenic, chemotactic, and vascular permeabilizing effects on endothelial cell. moreover, vegf interacts with a family of coreceptors called neuropilins (nrp-1 and nrp-2) [8, 9 ] that strengthen the link between vegf and its receptors increasing their biological activity. overexpression of vegf in hnscc is associated with more advanced disease, increased resistance to cytotoxic agents, and poor prognosis [1016 ]. in a meta - analysis of 12 studies including 1002 patients affected by cancer of oral cavity (70.8% of patients), pharynx (15.2%), and larynx (14%), vegf expression was evaluated, and its positivity was associated with a twofold higher risk of death at 2 years. demonstrated that there are different molecular mechanisms by which each tumor induce angiogenesis. using sample collected from patients affected by hnscc and sample of normal and dysplastic mucosa they studied the expression of cytokines (ck) such as vegf, il-8/cxcl8, hgf, and fgf-2 in normal, dysplastic, and pathological tissues. the authors observed that normal mucosa generally does not express vegf, il-8/cxcl8, fgf-2, and hgf and that, where present, the levels of these cks are very low compared to dysplastic and pathological mucosa. the same cks are more frequently expressed and at a higher levels in dysplastic oral mucosa. the incidence and the intensity of expression of vegf, il-8/cxcl8, fgf-2, and hgf are highest in hnscc samples. moreover, they validated the presence of two different clusters in relation to angiogenesis in hnscc samples : tumors in cluster a express high levels of vegf and fgf-2 and low levels of il-8/cxcl8 and hgf and are characterized by higher levels of microvessel density than tumors in cluster b, expressing on the contrary low levels of vegf and fgf-2 and higher levels of il-8/cxcl8 and hgf. these data suggest that there are at least two different pathways in inducing angiogenesis in hnscc. in fact we can argue that the inhibition of a specific molecular pathways can block the angiogenesis process, and consequently the tumor growth, only if the target of the therapy is expressed by the tumor cells. in the same study the authors used three different hnscc cell lines with different levels of expression of vegf that were inoculated in nude mice. then they treated the experimental models with anti - vegf antibody, with nonspecific human igg antibody, or with pbs (phosphate - buffered saline, a buffer solution isotonic and nontoxic to cells). the growth of tumor with high levels of vegf was inhibited by anti - vegf treatment while not influenced by nonspecific igg or pbs. on the other hand anti - vegf treatment had limited effects on the growth of tumor with low levels of vegf. in this case no difference in tumor volume was found compared to those treated with nonspecific igg or pbs. these data may have very important implications in clinical practice and support the need of better understanding the molecular alterations in each specific tumor in order to better select patients for targeted therapies. several studies report the activity of different molecules directed against the angiogenic process in head and neck models. for example miyazawa. tested the effect of ptk / zk (vatalanib) on the initial stages of head and neck tumor angiogenesis. ptk / zk is a small molecule inhibitor of vegf receptors [20, 21 ]. the molecule has just been tested by kim. in anaplastic thyroid carcinoma xenografts in nude mice, and in that study it inhibited the phosphorylation of vegfr-2 in the endothelial cells and reduced the microvessel density of the models. miyazawa. tested the effects of ptk / zk on neovascularization in vitro and in vivo. they inoculated experimental mice with different hnscc lines and treated them with the oral administration of ptk / zk or vehicle controls. they showed that animals treated with the small vegf receptor inhibitor developed low microvessel density compared to those treated with vehicle control. moreover, the models treated with ptk / zk had a slower tumor progression than controls, even if the difference was not statistically significant. several preclinical data about the association between anti - egfr and antiangiogenic treatments [2325 ] and between radiotherapy and antiangiogenic drugs [26, 27 ] have been published recently. moreover, in the last few years a study conducted by bonner. demonstrated the efficacy of the association of radiotherapy and a target therapy such as an anti - egfr agent (cetuximab) in locally advanced disease. this association could be very interesting in clinical practice because the production of vegf is inhibited, at least in part, by anti - egfr agents while radiotherapy, through the induction of egfr production in irradiated cells, can lead to neovascularization. so the combination of these three weapons could have synergistic effects. in a study published in 2007, bozec. evaluated the efficacy of azd2171, gefitinib, and radiotherapy. azd2171 is an inhibitor of vegfr-2, vegfr-1, and vegfr-3 in vitro, while gefitinib is an egfr tyrosine kinase inhibitor with antiangiogenic activity. the effects of the combination of the two drugs on tumor growth and of the combination of the drugs with radiotherapy were tested on human head and neck tumor xenografts. the investigators used a cell line, cal33, that had high levels of egfr end vegf. mice inoculated with cal33 tumors were treated with vehicle alone, azd2171 or gefitinib alone or in combination, or with the two drugs combined with radiotherapy. the treatment with azd2171 and gefitinib showed better antitumor effects than either treatment alone, but tumor regrowth after discontinuation was observed. on the other hand, the triple combination (two drugs plus radiotherapy) had the best antitumor effects with a prolonged activity after treatment discontinuation. the same authors conducted a similar study using bevacizumab, monoclonal antibodies directed against vegf, erlotinib, an egfr tyrosine - kinase inhibitor, and radiotherapy on head and neck orthotopic models. they tested the efficacy of the three treatments, given alone or in combination, on mice inoculated with cal33 tumors. treatment with each single agent did not show a significant activity on tumor growth while the combination of the three treatments had the best antitumor activity with supra - additive effects (combined ratios 2.3). an evaluation of vascularization marker was conducted in the same study and showed that the triple combination led to a decrease in cell proliferation and neoangiogenesis (lower ki-67 and vegfr-2 expression). then the same authors tested the in vivo efficacy of the combination of sunitinib, a multitargeted tyrosine kinase inhibitor with great anti - vegf activity, cetuximab, and radiotherapy. cal33 cell lines were injected in mice that were then treated with vehicle or cetuximab and/or sunitinib and/or radiotherapy. in this study the treatments given alone showed a significant antitumor effect compared with controls. the best result on tumor growth in fact at the end of the treatment with cetuximab, sunitinib, and radiotherapy, no tumor cells were detectable in all treated animals (p < 0.001 versus control). conducted a study using the combination of paclitaxel and thalidomide on xenotransplanted oral squamous cell carcinoma. thalidomide is able to inhibit neovascularization and tumor growth [3437 ] while paclitaxel is an antitumor agent with antiangiogenic activity [3841 ]. in this study a human oral squamous cell carcinoma line was inoculated into nude mice subsequently treated with thalidomide, paclitaxel, or control vehicle. paclitaxel showed a significant activity on tumor growth, while thalidomide did not show any effect. it is worthwhile noting that the two drugs had remarkable effects on the immunohistochemical expression of vegf and cd31, which was also reduced by the administration of paclitaxel and thalidomide. a similar reduction in the production of vegf mrna suggested a good activity of these drugs against neovascularization. the study suggests that the inhibition of angiogenesis is not enough to suppress oral squamous cell carcinoma growth and that probably antiangiogenic treatments have to be integrated with other different approaches. sorafenib and sunitinib are two tyrosine kinase inhibitors with activity against vegfr2, vegfr3, and the pdgf receptors that have been tested in different studies in patients with recurrent or metastatic hnscc. three studies were reported with sunitinib. in the first study, 22 patients with recurrent or metastatic hnscc who had received no more than two prior chemotherapy regimens were treated with sunitinib administered in 6-week cycles at 50 mg / day for 4 weeks followed by 2 weeks off. patients were divided into 2 cohorts according to the eastern cooperative oncology group performance status (ecog - ps) : patients with ecog - ps 0 - 1 in cohort a, patients with ecog - ps 2 in cohort b. the primary endpoint was objective tumor response for group a (15 patients) and feasibility for group b (7 patients). in cohort a partial response (pr) was reported in only one patient, while no response was observed in cohort b. stable disease (sd) was observed in 25% of patients. the median overall survival (os) was 21.1 weeks for patients in cohort a and 19.1 weeks for patients in cohort b. the main grade 3 hematologic toxicities reported were lymphopenia (18%), neutropenia (14%), and thrombocytopenia (5%). the only grade 4 hematologic toxicity observed was thrombocytopenia occurring in one patient. the most common nonhematologic grade 3 toxicities were fatigue and anorexia (23% of patients). grade 3 hypertension occurred only in one patient in cohort b. grade 4 hemorrhage was reported in one patient (gastro - intestinal bleeding). nonfatal hemorrhagic events were seen in 8 patients ; in 1 of these patients a superficial tumor bleeding was observed. even if sunitinib was well tolerated, accrual was closed at interim analysis as nonsignificant antitumor activity was demonstrated. another study was conducted by fountzilas. who treated 17 patients affected by metastatic or recurrent hnscc with sunitinib in first - line setting. the primary endpoint of the study was objective response rate (orr) while the secondary endpoints included time to tumor progression (ttp), os, safety, and tolerability of sunitinib as monotherapy. three patients (18%) had stabilization of disease while 11 patients (65%) showed progression. the most common grade 3 toxicity was fatigue that occurred in 7 patients (41%), while grade 3 hemorrhagic events were described only in 1 patient (6%). these 2 studies showed that sunitinib 50 mg / day for 4 weeks followed by 2 weeks rest is well tolerated but has no significant antitumor activity in monotherapy. in the third study, sunitinib 37.5 mg daily, given continuously until disease progression or unacceptable toxicity, was tested on 38 patients with recurrent or metastatic hnscc refractory to platinum - based treatment or unfit for platinum - based regimens. the primary endpoint was the rate of disease control (rdc), defined as complete response (cr) or pr or sd at 6 to 8 weeks after treatment initiation. the most frequent grade 3/4 toxicities were fatigue (32%), anorexia (16%), thrombocytopenia (13%), and diarrhea (8%). serious hemorrhagic events of head and neck vessels (grades 35) were reported in 5 patients (one grade 3, one grade 4, and 3 grade 5) ; four of these patients were previously irradiated in the head and neck area. in conclusion this study showed a limited activity of sunitinib in the treatment of recurrent or metastatic hnscc while reporting a significant risk of severe hemorrhage. it is a multitarget drug with activity against the egfr - ras - raf - mek - erk signaling pathway and against vegf - vegfr. in the first study, published in 2007, elser. conducted a single - arm phase ii study in patients affected by recurrent or metastatic hnscc (including nasopharyngeal carcinoma) that had previously received no more than one systemic treatment. the trial enrolled 28 patients, treated with sorafenib 400 mg twice daily continuously, 27 evaluable for efficacy. the orr was 3.7%, while 37% of patients achieved a stabilization of disease as best response. the most common grade 3 toxicities were lymphopenia (17%) and fatigue (7%). the other published study, with sorafenib in first - line setting, was conducted on patients with persistent, recurrent, or metastatic hnscc. forty - one patients were eligible for response ; one patient had a confirmed pr (2%). the estimated median pfs was 4 months, and the estimated os was 9 months. the most common grade 3 adverse events were hand - foot syndrome (7.3%), stomatitis (4.8%), and nausea (4.8%). the only grade 4 event was a cerebral ischemia caused by asymptomatic pulmonary embolism. no significant activity was demonstrated in terms of response rate, but we must consider that these novel drugs have often a cytostatic effects with limited cytotoxic activity. it is interesting to note that the trials conducted on chemonaive patients showed pfs and os comparable to those achieved with more toxic and aggressive regimens based on platinum and taxanes. a further antiangiogenic agent tested in recurrent and metastatic setting is the monoclonal antibody bevacizumab directed against vegf. it was administered in association with erlotinib, an anti - egfr inhibitor, to patients with recurrent or metastatic hnscc never treated or previously treated with one line of chemotherapy. it was a phase i / ii study in which the authors used the association of an anti - vascular agent and an anti - egfr one ; there are in fact several trials in other cancers demonstrating that the use of these type of drugs together improves efficacy [4853 ]. the phase i study was designed to determine the maximum tolerated dose of bevacizumab when associated to erlotinib : erlotinib was given at dosage of 150 mg / daily, while bevacizumab was administered in escalating dose cohorts. the primary objective of the phase ii study was orr and ttp ; in this phase bevacizumab 15 mg / kg was administered every 3 weeks. an objective response (pr or cr) was reported in 7 patients (15%), while 15 patients (31%) maintained stability of disease. four patients achieved a complete response with a duration of response that lasted up to 17 months in one patient. grade 3 adverse events reported were esophagitis (1 patient), diarrhea (1 patient), and lymphopenia (1 patient). in this study the association was well tolerated with an interesting activity if compared to trials with antiangiogenic agents used alone. the authors also conducted an exploratory study to investigate biomarkers that could predict clinical outcomes and find that high phosphorylated vegfr2/vegfr2 and endothelial cells phosphorylated egfr / egfr ratios in baseline tumor specimen can identify patients with the greatest probability of response to erlotinib and bevacizumab. with regard to locoregionally advanced disease, added bevacizumab to fluorouracil and hydroxyurea - based chemoradiotherapy in patients with relapsed previously irradiated hnscc or with poor prognosis newly diagnosed disease. it was a phase i study to determine the maximum tolerated dose of bevacizumab when added to chemoradiotherapy. forty - three patients were enrolled : 29 patients (67.4%) were previously irradiated, while 14 patients (32.6%) were newly diagnosed. dose - limiting toxicities were reached at level 3 (bevacizumab 5 mg / kg), so at level 4 (bevacizumab 10 mg / kg), the dosage of chemotherapeutic agents alone was reduced. the treatment was well tolerated with grade 3 mucositis occurring in 69.8% of patients and grade 3 radiation dermitis in 11.6%. the adverse events probably related to bevacizumab were grade 3 hypertension in 3 patients, 1 allergic rash reaction, 2 deep vein thrombosis, 1 stroke, and 2 fatal hemorrhages. patients with no prior radiation had a significantly longer os (40.1 months) than those previously irradiated (10.3 months). this study demonstrates that bevacizumab 10 mg / kg every two weeks can be safely integrated to fluorouracil and hydroxyurea - based concomitant chemoradiotherapy : the rate of severe complication was similar to those reported in trials with different agents in cohorts of patients with the same characteristics [5568 ]. two more interesting studies were presented in the form of abstract at the 2009 asco annual meetings as preliminary results. in the first trial the authors treated 60 patients with newly diagnosed locoregionally advanced hnscc with two courses of induction chemotherapy repeated every 21 days consisting of carboplatin auc 6 day 1, paclitaxel 200 mg / mq day 1, 5 fluorouracil 200 mg / mq / day continuous infusion every 3 weeks, and bevacizumab 15 mg / kg day 1 followed by radiotherapy and concomitant paclitaxel 50 mg / mq / weekly, bevacizumab 15 mg / kg weeks 1 and 4, and erlotinib 150 mg daily for 7 weeks. forty - one patients (85%) completed all treatments with an objective response rate of 77%. this study has a short followup but interesting 18 months pfs of 85% and 18 months os of 87%. severe toxicity during induction chemotherapy was neutropenia (46%), neutropenic fever (6%), mucositis (14%), diarrhea (14%), and hand / foot syndrome (11%), while during concomitant treatment severe mucositis was experienced by 76% of patients. in another trial bevacizumab 15 mg / kg days 1, 15, and 43 and cisplatin 50 mg / mq days 1, 2, 22, 23, 43, and 44 were added to definitive imrt in patients with previously untreated, stage iii / iv, hnscc. all patients completed the treatment with a locoregional control rate of 100% (3 patients developed distant metastases). the main severe toxicities were mucositis (76%), nausea (24%), vomiting (17%), neutropenia (41%), hemoglobin (17%), hyponatremia (14%). in many clinical trials anti - angiogenetic drugs have a limited efficacy, especially in terms of overall survival. some authors [70, 71 ] demonstrated in their laboratories that vegf - targeted drugs inhibit the growth of primary tumors but may shorten survival of mice by promoting tumor invasiveness and the metastatic process. they selected sunitinib because of the schedule of administration in clinical practice (4 weeks on/2 weeks off) and the preliminary observations that tumor regrowth can occur during rest period. they showed that sunitinib inoculated in different schedules and doses and with different tumor cell models can lead to opposite results on tumor growth. for example, sustained treatment of pre - established tumors inhibits its growth, while short - term treatment prior to tumor inoculation results in the acceleration of metastasis and reduction in survival. demonstrated in the same issue of cancer cells that two different mouse models of tumors, pancreatic neuroendocrine cancer (pnet) and glioblastoma multiforme, can develop an adaptive and evasive response to an efficacious antiangiogenic treatment. this leads to a more aggressive behavior, increased dissemination, and distant metastasis progression. in pnet models sunitinib had significantly better efficacy than the competitor but surprisingly led to the development of more invasive tumors. first of all these agents act by inducing hypoxia, but tumor cells are often able to survive in hypoxic conditions thanks to the ability of producing energy in the absence of oxygen. so hypoxia selects those cells that are more malignant and less sensitive to treatment with these classes of agents. moreover, tumors can activate more vascular supply mechanisms through upregulation of proangiogenic stromal cells (fibroblasts, pericytes, mesenchimal and hematopoietic cells) that contribute to the vasculature scaffold. antivascular agents cause acute hypoxia that leads to the accumulation of endothelial progenitors cells at the tumor margins. both macrophages and neutrophils in proximity of hypoxic tissues can contribute to angiogenesis, escaping the mechanism of action of the drugs [76, 77 ]. furthermore hypoxia caused by antiangiogenic treatments causes an increase in bone marrow - derived cells consisting in vascular progenitors and pro - angiogenic monocytic cells (monocytes, hemangiocytes vegfr-1 + and cd11b+ myeloid cells) [7882 ], all involved in the activation of angiogenesis - expressing cytokines, growth factors, and proteases [83, 84 ]. cd11b+gr1 + cells are well known for their ability to confer resistance to anti - vegf in mouse models. these cells derive from bone marrow, are present at high level in tumor and peripheral blood of tumor - bearing animals, and produce several angiogenic factors, such as bv8. in addition vegf - inhibitors induce an inflammatory state characterized by the production of several cytokines (plgf, g - csf, il-6, erythropoietin, osteopontin) that stimulate angiogenesis and metastasis in a vegf - independent manner. another possible mechanism is that anti - vegf agents or the cytokines induced by their action could inhibit the action of pericytes on tumor vessels, making them more leaky and immature and facilitating the intravasation of tumor cells and metastatic spread. the results achieved with antiangiogenic treatment are sometimes controversial, but we must take into account the several variables involved, such as vegf levels, vessel number, and function, vegf - dependence of tumor vascularization, pericyte action, recruitment and activation of bone marrow - derived cells, target and duration of treatment, and the combination with different cytotoxic agents. in conclusion it is time to further investigate how to optimally use these agents, with the aim of blocking the tumor growth while suppressing prometastatic effects. the review of the main studies published in the last years confirms the central role of angiogenesis in the growth and progression of head and neck tumor. moreover, most of the published data point to the relationship between vegf overexpression, more advanced disease at diagnosis, and poor prognosis [1017 ]. despite the importance of angiogenesis in head and neck cancer, few antiangiogenic agents have shown relevant activity in this clinical setting and have been approved for the treatment of this disease. the reason depends mainly on the fact that many studies have been conducted on xenograft models. first of all some data suggest the existence of two different pathways in angiogenesis, so it is mostly important to understand as better as possible the pathogenetic process in each patient, in order to select the correct therapeutic target. secondly, the lack of activity can be explained considering that some authors demonstrated that angiogenesis inhibition is probably not enough to completely arrest the growth of tumors ; then we should likely combine this approach with cytotoxic drugs or other treatment such as radiotherapy or anti - egfr agents [29, 31, 32 ]. furthermore, there are many preclinical data that suggest that antiangiogenic treatments could be effective on primary tumors ' growth while promoting the developing of more aggressive disease with a greater prometastatic behavior [7072 ]. as for the trials concluded in patients with relapsed or metastatic disease, the drugs that are more extensively studied are tki inhibitors, sunitinib and sorafenib. sunitinib [4244 ] as monotherapy has shown limited activity in these patients, and so no more studies are warranted. sorafenib [45, 46 ] did not give encouraging results with regard to objective response but interesting data of pfs and os when used as first - line treatment. few studies have just been concluded and published in patients with locoregionally advanced disease [67, 68 ], and the results of these trials have to be confirmed with a longer followup. finally, it should be interesting to investigate whether the expression of angiogenic factors can be used as predictive. to date only one study with a combination of an antiangiogenic agent and an anti - egfr inhibitor reported a possible role of a molecular biomarker that could predict a greater possibility of response to an antiangiogenic treatment. further studies are needed to understand the mechanisms of response and resistance to angiogenesis inhibitors, how to integrate antiangiogenic therapies in the treatments of patients affected by hnscc, and how to identify those most likely to respond, in order to offer the best treatment for each patient while limiting toxicities. | angiogenesis is a necessary process for tumor growth, progression and diffusion. in the last years many efforts have been made to understand the mechanisms necessary to the formation of new vessels in tumor tissue and how to integrate these findings in the treatment of different type of cancer. thanks to these studies there are today many anti - angiogenic drugs with established activity in cancer and approved in clinical practice. head and neck cancer is a common tumor worldwide that often has advanced stage at diagnosis and poor prognosis. angiogenesis has a well recognized role in head and neck cancer progression and resistance to drugs and radiotherapy and many clinical trials has been conducted with antiangiogenic agents in this disease, even if they often showed limited efficacy. in this review we summarize the main trials published about angiogenesis in head and neck cancer with particular attention to factors involved in this process and the available data on the efficacy of treatment with anti - angiogenic agents in this disease. |
biological membranes generally contain a mixture of various types of amphiphilic molecules, such as phospholipids, glycolipids, fatty acids, glycerides and amines. although present at levels of only a few percent, fatty acids and amines are important constituents of biomembranes (kumar. they can affect any physiological function, such as enzyme activity (gennis 2010), particularly the activation of lipid - metabolizing enzymes, and calcium transport (felix 2006). since fatty acids belong to the lipids that form biological membranes and at the same time also possess a quite simple structure, they are frequently used by researchers for modeling. it is clear that there is a certain equilibrium between the lipid - forming bilayer and lipid molecules and substances present in electrolyte solution. the interactions between membrane lipids are studied by several techniques ; however, quantitative descriptions of the systems are lacking. formation of artificial membranes with built - in study components allows us to research in simpler systems than complicated biological membranes. many investigations have been reported on the effect of fatty acids on physical and chemical properties of model membranes, particularly on the phase behavior of hydrated phospholipid bilayers, using various techniques, such as differential thermal analysis (ulkowski. 2005), differential scanning calorimetry (ohta and hatta 2002 ; matricarde falleiro. 2001), fluorescence spectroscopy (borst. 2000), x - ray diffraction (kumar. 2005), magnetic resonance (heimburg. 1990 ; rama krishna and marsh 1990) and fourier transform infrared spectroscopy (inoue. 2001). in this work, the interfacial tension of phosphatidylcholine (pc)decanoic acid (da) and pc decylamine (de) membranes was determined within the entire composition range where bilayer formation was possible. the aim of these investigations was to study the mixed pc da and pc de bilayer, characterize the molecular interaction between phospholipids and fatty acids and between phospholipids and amine and compare the properties of these systems : stability constants of the formed complexes and surface areas occupied by pure membrane components. in cases where the membrane components do not form chemical compounds, their interaction can be described by the following set of equations (petelska and figaszewski 1998 ; petelska. 2006a):1\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \begin{aligned}&\gamma_{1 } m_{1 } a_{1 } + \gamma_{2 } m_{2 } a_{2 } = \gamma\\&\frac{{m_{1 } } } { { m_{1 } + m_{2 } } } = x_{1}\\&x_{1 } + x_{2 } = 1 \hfill \\ \end{aligned } $ $ \end{document}where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ a_{1}^ { - 1 }, \,a_{2}^ { - 1 } $ $ \end{document } (mol m) are the surface concentrations of components 1 and 2 ; m1, m2 (mol m) are the quantities of components 1 and 2 per unit area of the membrane ; 1, 2 (n m) are the interfacial tensions of membranes assembled from pure components 1 and 2 ; (n m) is the measured interfacial tension of the membrane ; and x1, x2 are the solution mole fractions of components 1 and 2. elimination of m1 and m2 yields the following linear equation:2\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \left ({ \gamma - \gamma_{1 } } \right)x_{1 } = \frac{{a_{2 } } } { { a_{1 } } } \left ({ \gamma_{2 } - \gamma } \right)x_{2 } $ $ \end{document } membranes may also be assembled from two components capable of forming a complex. the stoichiometry of the complex may vary, but because the first stability constant in these complexes is usually the largest (inczedy 1976 ; beck and nagypal 1990), we assumed that the complexes are primarily of 1:1 stoichiometry. in cases where the membrane components form a 1:1 complex, interactions in the membrane the equilibrium between the individual components and the complex is represented by\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { \text{a}}\, ({ \text{component}}\, 1) + { \text{b}}\, ({ \text{component}}\, 2) \leftrightarrow { \text{ab}}\, ({ \text{complex) } } $ $ \end{document}and the basic equation describing the interaction between components 1 and 2 can be written as follows (petelska. 2006a, b):3\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \left [{ \left ({ \gamma - \gamma_{1 } } \right)b_{2 } x_{1 } + \left ({ \gamma - \gamma_{2 } } \right)b_{1 } x_{2 } } \right]\left [{ \left ({ \gamma_{3 } - \gamma_{1 } } \right)b_{2 } x_{1 } + \left ({ \gamma_{3 } - \gamma_{2 } } \right)b_{1 } x_{2 } + \left ({ \gamma_{1 } - \gamma_{2 } } \right)\left ({ x_{1 } - x_{2 } } \right) } \right ] = ka_{3}^ { - 1 } b_{1 } b_{2 } \left [{ \left ({ \gamma - \gamma_{1 } } \right)\left ({ x_{2 } - x_{1 } } \right) + \left ({ \gamma_{3 } - \gamma } \right)b_{1 } x_{2 } } \right]\left [{ \left ({ \gamma - \gamma_{2 } } \right)\left ({ x_{1 } - x_{2 } } \right) + \left ({ \gamma_{3 } - \gamma } \right)b_{2 } x_{1 } } \right ] $ $ \end{document}where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ b_{1 } = { { a_{3 } } \mathord{\left/ { \vphantom { { a_{3 } } { a_{1 } } } } \right. \kern-\nulldelimiterspace } { a_{1 } } } $ $ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ b_{2 } = { { a_{3 } } \mathord{\left/ { \vphantom { { a_{3 } } { a_{2 } } } } \right. $ $ \end{document } equation 3 may be simplified by taking into account the high stability constant of the complex. applying this simplification results in linear behavior for small (x2 x1) x2 values. when calculating the stability constant for the complex, eq. the parameters describing the complex may be used to calculate theoretical points using the equation presented below (agreement between the theoretical and experimental values implies that the system is well described by the above equations):4\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ ka_{1}^ { - 1 } a_{2}^ { - 1 } \left ({ a_{1 } + a_{2 } } \right)\left ({ a_{3 } - a_{1 } } \right)\gamma^{2 } + \left [{ ka_{1}^ { - 1 } a_{2}^ { - 1 } \left ({ \gamma_{1 } a_{1 } - \gamma_{3 } a_{3 } } \right)\left ({ a_{1 } + a_{2 } } \right) - \,ka_{1}^ { - 1 } a_{2}^ { - 1 } \left ({ \gamma_{2 } a_{1 } + \gamma_{3 } a_{2 } } \right)\left ({ a_{3 } - a_{1 } } \right) + \, a_{4 } a_{3}^ { - 1 } \left ({ a_{3 } + a_{2 } } \right) } \right]\gamma + ka_{1}^ { - 1 } a_{2}^ { - 1 } a_{3 } \gamma_{3 } \left ({ \gamma_{3 } a_{2 } + \gamma_{2 } a_{1 } } \right) - ka_{1}^ { - 1 } a_{2}^ { - 1 } a_{1 } \gamma_{1 } \left ({ a_{1 } \gamma_{2 } + a_{2 } \gamma_{3 } } \right) - a_{4 } a_{3}^ { - 1 } \left ({ \gamma_{2 } a_{3 } + \gamma_{1 } a_{2 } } \right) = 0 $ $ \end{document}\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \begin{gathered } a_{1 } = a_{3}^ { - 1 } \left ({ x_{2 } - x_{1 } } \right) \hfill \\ a_{2 } = a_{2}^ { - 1 } x_{1 } \hfill \\ a_{3 } = a_{1}^ { - 1 } x_{2 } \hfill \\ a_{4 } = \left [{ a_{3}^ { - 1 } \left ({ \gamma_{1 } - \gamma_{2 } } \right)\left ({ x_{2 } - x_{1 } } \right) + \,\left ({ \gamma_{1 } - \gamma_{3 } } \right)x_{1 } a_{2}^ { - 1 } + \, \left ({ \gamma_{2 } - \gamma_{3 } } \right)x_{2 } a_{1}^ { - 1 } } \right ] \hfill \\ \end{gathered } $ $ \end{document } for systems containing two lipid components, 1:1 complex formation was assumed to be the explanation for deviation from the additivity rule. model curves were constructed using calculated parameters such as equilibrium constants, molecular areas of the complexes and the interfacial tension of molecules and complexes. the tension in a lipid bilayer sample is determined by measuring the radius of curvature of the convex surface formed when a pressure difference is applied across the bilayer (adamson 1960). the apparatus and measurement method were described previously (petelska and figaszewski 1998 ; petelska. the measurement system consists of two glass chambers separated by a mount holding a 1.5-mm - diameter circular teflon element axially pierced by a small orifice. rudin method (tien and ottova - leitmannova 2003) on the flat end of the teflon element. the membrane - forming solution was introduced to the flat wall of the teflon element using a micropipette, and pressure was applied to the left chamber using a manometer. the radius of curvature was determined using this value and the diameter of the teflon element, corresponding to diameter of the lipid cap. the following reagents were used for preparation of the membrane - forming solution:3-sn - phosphatidylcholine (99% ; fluka, buchs, switzerland) isolated from hen egg yolkdecanoic acid (98%, fluka)decylamine (99.5%, fluka) 3-sn - phosphatidylcholine (99% ; fluka, buchs, switzerland) isolated from hen egg yolk decanoic acid (98%, fluka) decylamine (99.5%, fluka) the as - received pc and da were purified by dissolving in chloroform and evaporating the solvent under argon. the stock membrane - forming solutions consisted of 20 mg cm of the desired lipids (pc, da or de) in 20:1 n - decane : butanol. the solution containing the membrane components was not saturated and could therefore contain the components in any proportion. during membrane formation, the solvent was removed, leaving a membrane composed of lipids in the same ratio as the stock solution. the electrolyte solution contained 0.1 m potassium chloride and was prepared using triple - distilled water and kcl, produced by poch (gliwice, poland). the n - decane was purchased from merck (darmstadt, germany), and the chloroform and butanol were obtained from aldrich (milwaukee, wi). the tension in a lipid bilayer sample is determined by measuring the radius of curvature of the convex surface formed when a pressure difference is applied across the bilayer (adamson 1960). the apparatus and measurement method were described previously (petelska and figaszewski 1998 ; petelska. the measurement system consists of two glass chambers separated by a mount holding a 1.5-mm - diameter circular teflon element axially pierced by a small orifice. rudin method (tien and ottova - leitmannova 2003) on the flat end of the teflon element. the membrane - forming solution was introduced to the flat wall of the teflon element using a micropipette, and pressure was applied to the left chamber using a manometer. the radius of curvature was determined using this value and the diameter of the teflon element, corresponding to diameter of the lipid cap. the following reagents were used for preparation of the membrane - forming solution:3-sn - phosphatidylcholine (99% ; fluka, buchs, switzerland) isolated from hen egg yolkdecanoic acid (98%, fluka)decylamine (99.5%, fluka) 3-sn - phosphatidylcholine (99% ; fluka, buchs, switzerland) isolated from hen egg yolk decanoic acid (98%, fluka) decylamine (99.5%, fluka) the as - received pc and da were purified by dissolving in chloroform and evaporating the solvent under argon. the stock membrane - forming solutions consisted of 20 mg cm of the desired lipids (pc, da or de) in 20:1 n - decane : butanol. the solution containing the membrane components was not saturated and could therefore contain the components in any proportion. during membrane formation, the solvent was removed, leaving a membrane composed of lipids in the same ratio as the stock solution. the electrolyte solution contained 0.1 m potassium chloride and was prepared using triple - distilled water and kcl, produced by poch (gliwice, poland). the n - decane was purchased from merck (darmstadt, germany), and the chloroform and butanol were obtained from aldrich (milwaukee, wi). the effect of the presence of da or de on interfacial tension of the membranes formed from pc was studied. the dependence of interfacial tension on the lipid membrane as a function of composition was studied at room temperature (293 2 k) in the entire feasible concentration range. the interfacial tension values reported here refer to the two sides of the bilayer membrane surface area unit. figure 1 contains a graph of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \left ({ \gamma - \gamma_{1 } } \right)x_{1 } $ $ \end{document } vs. \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \left ({ \gamma_{2 } - \gamma } \right)x_{2 } $ $ \end{document } for the four systems pc da (fig. according to eq. 2, when the membrane components do not interact, these functions should yield straight lines. this is clearly not the case, which suggests that a complex or other structure exists in pc da and pc de bilayers. because the use of eq. 3 presupposes the existence of 1:1 complexes, our initial assumption was that the complexes formed were 1:1. the interfacial tension of the lipid membrane was studied over a wide range of lipid compositions.fig.. 2 for pc da (a) and pc de (b), where x2 is the mole fraction of component 2 (da and de, respectively) graph of eq. 2 for pc da (a) and pc de (b), where x2 is the mole fraction of component 2 (da and de, respectively) the dependence of interfacial tension of lipid membrane as a function of membrane composition for pc da and pc de systems was studied over a possible concentration range. the dependence of interfacial tension on the lipid membranes formed from the pc da and pc de systems was executed in the function of the composition to 41% of the da contents (to 40% of the de) because only to such contents of component 2 (da, de) with lecithin was a bilayer membrane formed.fig. 2the interfacial tension,, of the pc da (a) and pc de (b) membranes as a molar fraction of da or de, x2 (experimental values are marked by points and theoretical ones by curves) the interfacial tension,, of the pc da (a) and pc de (b) membranes as a molar fraction of da or de, x2 (experimental values are marked by points and theoretical ones by curves) the interfacial tension value of pure lecithin membrane (component 1), 1, was measured directly and presented earlier (petelska and figaszewski 1998), which is equal to 1.62 10 n m. there are no accurate data on interfacial tension values for the pure component 2 (da or de) because these components do not create a bilayer membrane. however, in order to characterize the course of the experimental curves, the 2 value for the pure components is necessary, which will be used for calculation. in this case, the interfacial tension hypothetical values for membranes built from da and de were determined by adjusting the experimental curve with the polynomial of the other mark extrapolating the x2 = 1 value, which is presented in fig. the interfacial tension values obtained in this way for pure da and de are equal to 2.38 10 and 3.88 10 n m. negative values of interfacial tension for membrane built from pure da and de point to the fact that it is not possible to create bilayer membranes from pure da or de. the thermodynamic potential for this bilayer would have a negative value ; i.e., the bilayer is not forming.fig. 3plot illustrating the hypothetical interfacial tension values for da (a) and de (b) membrane calculation plot illustrating the hypothetical interfacial tension values for da (a) and de (b) membrane calculation the other constants b1, b2, 3were determined by assuming that the values of the stability constant of the pc da and pc de complexes were sufficient to be simplified, i.e., eq. 1 to eqs. 2 and 3. knowing the b1, b2 constants, which were determined from eqs. 2 and 3, it was possible to calculate the interfacial tension values of the pc da and pc de complexes, 3. the mean values are equal to 7.25 10 n m for pc da and 1.52 10 n m for pc de. determining the interfacial tension value as a function of the composition made it possible to determine the surface concentrations of the membranes composed of pure components. at least one of them is necessary for determination of the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ a_{3}^ { - 1 } $ $ \end{document } value. the surface area occupied by a lecithin molecule equal to 85 was determined in previous work (petelska and figaszewski 2000). the surface areas occupied by da and de are equal to 19 and 22, respectively (petelska and figaszewski 2011). as mentioned earlier, the fatty acid forms a dimer (brzozowska and figaszewski 2003 ; zhao and olesik 2001) ; therefore, the surface area occupied by da is equal to 38. knowing the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ a_{1}^ { - 1 } $ $ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ a_{2}^ { - 1 } $ $ \end{document } as well as \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ b_{1 } $ $ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ b_{2 } $ $ \end{document } values, the surface concentration of the membrane composed of the lecithin da and lecithin de complexes could be determined. the resulting surface concentration values, \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ a_{3}^ { - 1 } $ $ \end{document }, for the pc da and pc de complexes were equal to 1.15 10 and 2.03 10 mol m, respectively. this made it possible to determine the area occupied by one lecithin da and one lecithin the value of area occupied by one lecithin da complex molecule is larger than the amount of the surface area occupied by each component of the complex. it is probably connected with the arrangement of lecithin molecules in such a complex and with the structural construction of such a complex. previously (petelska and figaszewski 2003), we suggested the arrangement of the lecithin molecules in a bilayer membrane at ph > 5. in these media, one particle from the lecithin molecule in the bilayer (orientated in this way) has two straightened chains ; however, the next molecule of lecithin has one straightened and another chain fastened to the membrane surface. how these ions were characterized was previously reported (petelska and figaszewski 2003) : these ions are strongly solvated, and they produce a separation of lecithin particles in the bilayer, which increases the surface occupied by the single molecule of lecithin. the difference between surface area values occupied by one molecule of pc - da and pc - de complexes to appear from the fact than as the chain length increases, van der waals interactions between the chain of the adjacent molecule increase, bringing these molecules closer to each other. when this happens, the carboxylic acid groups of the fatty acids are also packed closer, shielding the hydrogen atom between the two oxygen atoms (kanicky. the only values to be determined were the stability constants of the pc fatty acid and pc amine complexes. 4 when \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ x_{1 } = x_{2 } = 0.5 $ $ \end{document } ; these parameters amount to 4.61 10 and 2.38 10 m mol, respectively. during the course of our investigations, we assumed the formation of pc de and pc de complexes. these complexes arise by producing a connection between the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { -}{\mathop { \text{n}}\limits^{\left (+ \right) } } \left ({ { \text{ch}}_{3 } } \right)_{3 } $ $ \end{document } group from the molecule of lecithin and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ - { \text{coo}}^{\left (- \right) } $ $ \end{document } groups from the dimer of da, in the case of the complex pc da, and between the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ - { \text{po}}^{\left (- \right) } $ $ \end{document } group from lecithin and the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { -}{\mathop { \text{n}}\limits^{\left (+ \right) } } { \text{h}}_{3 } $ $ \end{document } group from de. the dissociation constants of the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { -}{\mathop { \text{n}}\limits^{\left (+ \right) } } \left ({ { \text{ch}}_{3 } } \right)_{3 } $ $ \end{document } group from pc and the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ - { \text{coo}}^{\left (- \right) } $ $ \end{document } groups from the dimer of da are equal 10 (petelska and figaszewski 2000) and about 10 (chemistry tables 2004), respectively. it should be noted that the dissociation constants of the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ - { \text{po}}^{\left (- \right) } $ $ \end{document } group from pc and the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { -}{\mathop { \text{n}}\limits^{\left (+ \right) } } { \text{h}}_{3 } $ $ \end{document } group from de equal 10 (petelska and figaszewski 2000) and about 10 (chemistry tables 2004), respectively. therefore, the connection between pc and da will be stronger, and we can expect that the stability constant of pc da will be higher than the stability constant of pc de.. 1 ; i.e., data (solid lines) with the experimental data (points) in fig. 1 using equation 5. the values yielding a better agreement of the experimental points with equations describing complex formation between membrane lipid components were chosen. 1 are marked by points and the theoretical ones obtained from equation 5, by lines. it can be seen from this figure that there is a good agreement between experimental and theoretical points, which verifies the assumption of formation of 1:1 pc da and pc de complexes in the lipid membrane. good agreement of the experimental and theoretical points verifies the assumption of the correct choice of the 2 values for components of the membrane. table 1 lists several physicochemical parameters for membranes containing pc da and pc de complexes.table 1selected physicochemical parameters for two complexes : phosphatidylcholine decanoic acid (pc da) and phosphatidylcholine decylamine (pc de)examined systemsurface area occupied by one molecule of complex (molecule)stability constant of examined complex (m mol)complex formation energy (gibbs free energy) (kj mol)pc de82 0.822.38 1032.45 0.97 selected physicochemical parameters for two complexes : phosphatidylcholine decanoic acid (pc da) and phosphatidylcholine decylamine (pc de) the following conclusions can be drawn from the parameters describing the complexes studied : the stability constant of the pc da complex is 4.61 10 m mol, whereas the stability constant of the pc de complex is 2.38 10 m mol. the values of the stability constants of the lipid da and lipid de complexes are reported for the first time. it can be observed that the stability constants of the fatty acid containing complex are higher. thus, the pc da complex is more stable than the pc de complex.the experimental area occupied by one pc da complex is 144, whereas the area occupied by the pc de complex is 82.good agreement of the experimental and theoretical points verifies the assumption of formation of a 1:1 complex in the lipid membrane. a lack of variance between points indicates that complexes at different stoichiometries are not possible in the pc da or pc de membrane. the stability constant of the pc da complex is 4.61 10 m mol, whereas the stability constant of the pc de complex is 2.38 10 m mol.. the values of the stability constants of the lipid da and lipid de complexes are reported for the first time. it can be observed that the stability constants of the fatty acid containing complex are higher. thus, the pc da complex is more stable than the pc de complex. the experimental area occupied by one pc da complex is 144, whereas the area occupied by the pc de complex is 82. good agreement of the experimental and theoretical points verifies the assumption of formation of a 1:1 complex in the lipid membrane. a lack of variance between points indicates that complexes at different stoichiometries are not possible in the pc da or pc de membrane. | interfacial tension has been determined for phosphatidylcholine (pc)decanoic acid (da) and pc decylamine (de) membranes. pc (lecithin), da and de were used in the experiments ; the interfacial tension values of the pure components are 1.62 103, 2.38 102 and 3.88 102 n / m (hypothetical values for da and de), respectively. the 1:1 complexes were formed during formation of pc da and pc de membranes. the following parameters describing the complexes were determined : the surface concentrations of the lipid membranes formed from these complexes, \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ a_{3}^ { - 1 } $ $ \end{document } ; the interfacial tensions of such membranes, 3 ; and the stability constants of these complexes, k. |
radiation therapy (rt) has been established as the primary treatment option for egc at most institutions due to its long - term benefits, such as voice preservation. traditional rt for egc uses lateral opposed fields (lof) with low - energy photons. however, the carotid arteries (cas) receive the full prescription dose with lof because they are located to the left and right of the target volume (tv). as a result, increased incidences of stroke and other cerebrovascular events have been reported in patients who have survived over 10 years since undergoing the treatment for egc [3 - 5 ]. in particular, the risk of ischemic stroke increases 10-fold in patients undergoing traditional rt for egc if younger than 60 years of age. for these reasons, various treatment techniques have been introduced to decrease the dose administered to ca during rt for egc [6 - 9 ]. intensity - modulated radiation therapy (imrt) can maintain good coverage while significantly reducing the dose administered to the ca, as compared with traditional lof and 3-dimensional conformal rt (3dcrt) [6 - 8 ]. further, chatterjee. have reported that helical tomotherapy - based imrt offers significant improvements to ca sparing. inverse planning based imrt is highly effective in reducing the dose to adjacent organ at risks (oar) and improves target dose conformity by controlling the beam intensity. however, as compared with 3dcrt, imrt involves complicated treatment plans that are closely related to poor treatment efficiency, as well as to long planning and treatment times. the complicated plans also require additional pretreatment quality assurance in busy clinics. furthermore, as compared with 3dcrt, these more complicated plans are associated with higher risks of error. in particular, imrt is associated with higher risk of inaccurate dose delivery to moving targets, which results from the interplay between multi - leaf - collimator (mlc) and organ motions. because the tv is relatively small in cases of egc, it is more likely to be influenced by movement during imrt, and therefore requires careful consideration. tomotherapy options can be classified as either imrt or 3dcrt, as performed using either a helical mode or a direct mode (fixed beams), depending on the dose planning and beam delivery technique. it has the advantage of offering plan and beam delivery times that are generally shorter than those associated with imrt. th-3dcrt presents these time - advantages because it does not include an intensity - modulation process that relies upon inverse planning. thus, th-3dcrt can be an effective rt modality for egc and other targets that have simple shapes and do not require complex beam - intensity modulation (because the internal beam path length is short). recently, researchers have used dosimetric comparison studies to identify the techniques that minimize the ca dose in rt for egc. however, prior studies have not included clear comparisons of the dosimetric characteristics of helical tomotherapy (th - imrt) and linear - accelerator - based imrt. further, prior comparison studies have not investigated th-3dcrt for egc. in the present study, we compared 3dcrt, imrt, th - imrt, and th-3dcrt in terms of their dosimetric characteristics and treatment time efficiencies for egc. by performing this comparison, we aimed to evaluate the performance of various treatment techniques in clinical application. between february 2013 and december 2014, a total of 21 patients with early glottis carcinoma (ct1 - 2n0m0) were treated with definitive rt. we selected 10 of these patients for this study, each of whom had t1n0 glottic squamous cell carcinoma and underwent curative rt with daily image - guidance. all patients underwent computed tomography (ct) (2.5-mm slice thickness ; lightspeed, ge healthcare, milwaukee, wi) after being immobilized in supine position, using thermoplastic masks. each patient s ct image dataset was transferred to the treatment planning system (tps) (pinnacle ver. 9.2, philips medical system, madison, wi), and the clinical target volume (ctv), planning target volume (ptv), spinal cord, and both cas were delineated. the ctv was contoured as follows : superiorly, at the thyroid notch or at the most cranial extent of arytenoid cartilage ; inferiorly, at 1 - 1.5 cm below the level of the true vocal cord ; posteriorly, the ctv included arytenoid cartilage and posterior commissure ; and anterolaterally, the ctv was drawn along the inner portion of the thyroid cartilage and encompassed the anterior commissure. to create the ptv, the ctv was expanded by 3 mm in the lateral and anterior directions and by 1 mm in the posterior direction. a lesser expansion was used in the posterior direction because we sought to reduce the irradiated dose to the posterior pharyngeal wall. with regard to clinical structures, the cas and the spinal cord were delineated. such oar volumes were delineated up to 2-cm superiorly and inferiorly beyond ptv. for each patient, four sets of treatment plans were created to analyze the dosimetric characteristics and treatment time efficiency : (1) 2-field 3dcrt (2f-3dcrt), (2) 3-field imrt (3f - imrt), (3) th - imrt, and (4) th-3dcrt. 2f-3dcrt and 3f - imrt were planned using a pinnacle tps with a clinac 6ex (varian, palo alto, ca). th - imrt and th-3dcrt were planned using a tomotherapy tps with a tomohd (tomotherapy, accuray, sunnyvale, ca). all plans involved 6-mv x - rays. we employed 2-mm (pinnacle) and 1.95-mm (tomotherapy) dose calculation grid sizes. the prescription dose was 67.5 gy in 30 fractions (2.25 gy per fraction) to the ptv. all plans were normalized such that 95% of the ptv received 100% of the prescription dose. traditional lof was not included in this study because it generally results in a high ca dose. instead, two wedged anterior - oblique fields (2f-3dcrt, gantry angles 70 and 290) were used to provide more effective means of reducing the ca dose. for the 3f - imrt, an anterior field was added to the same right and left anterior oblique fields that were employed in 2f-3dcrt. the direct machine parameter optimization module, supplied by the tps manufacturer, was used for dose optimization, which was performed via inverse planning. to provide the ptv dose constraint for inverse planning, the volumes of the ca receiving 35 gy and 10 gy were constrained to be below 20% and 50%, respectively. finally, the spinal cord dose was constrained to be below 45 gy. for each plan, we used the same number of iterations (250) during the dose optimization process. during inverse planning when the ptv dose reached the constraint early, optimization was continued to reduce the oar dose until the iteration limit, while maintaining the ptv dose. for th - imrt, we used a field width of 2.5 cm, a modulation factor of 2.0, and a pitch of 0.287 (to avoid the thread effect). th - imrt inverse planning involved the same number of iterations, and the same dose constraints that were specified above for 3f - imrt. to spare the ca, a directional blocking was applied to the right and left ca, thus disabling the primary beam if the blocked structure was proximal to the target, but not if the beamlets entered the target first. th-3dcrt was performed under the same conditions as th - imrt, with the exception of intensity modulation. to quantitatively evaluate the plan quality under identical conditions, all calculated plans were transferred to the same dose evaluation software (mim maestro, mim software inc., dose - volume histograms (dvhs) for ptv, ca, and spinal cord were calculated for all plans, and the mean dvh was evaluated based on the results. to evaluate the ptv dose coverage, the conformity index (ci) and homogeneity index (hi) were calculated for ptv under each plan. ci is defined as follows :, where ptvpiv is the ptv encompassed within piv, which is the volume covered by the prescription isodose surface. hi is an indication of dose uniformity within ptv ; a value of 1 indicates a uniform ptv dose distribution, an ideal value. hi is defined as follows :, where d2 and d98 are the minimum doses received by 2% and 98% of ptv, respectively. we calculated v35, v50, v63 (vd : the percentage of the organ volume receiving d gy or more), and maximum dose (dmax) for both cas. to evaluate the treatment time efficacies of the four treatment methods, the planning and treatment times of each plan were compared. to provide an objective measurement, planning time only included the beam generation, optimization, and dose - calculation times, as performed by a senior dosimetrist with 10 years of experience in imrt planning. four sets of plan for each patient were generated continuously and without any interruption in the same manner. in other words, after patient setup verification was completed, the time between the first beam - on and the last beam - off was measured. the wilcoxon signe - drank test and the bonferroni correction were used to compare the following differences : 2f-3dcrt versus th-3dcrt, 3f - imrt versus th-3dcrt, and th - imrt versus th-3dcrt. our statistical analysis was performed using sas ver. cary, nc). a 2-tailed p - value 0.05) (table 2). however, the 3f - imrt plan resulted in a slightly higher hi than did the th-3dcrt plan (p 0.05). however, 3f - imrt resulted in a slightly higher v35 than th-3dcrt (p 0.05) (table 2). however, the 3f - imrt plan resulted in a slightly higher hi than did the th-3dcrt plan (p 0.05). however, 3f - imrt resulted in a slightly higher v35 than th-3dcrt (p < 0.05). under the 2f-3dcrt plan, the median of the maximum ca doses (69.82 gy ; range, 69.23 to 70.41) exceeded the prescription dose further, 3f - imrt resulted in a significant increase in this median of maximums compared to th - imrt and th-3dcrt (p < 0.05). under each of the plans, both 3f - imrt and th - imrt required inverse planning, and their median planning times were 45.5 and 35.3 minutes, respectively. in contrast, 2f-3dcrt and th-3dcrt did not require inverse planning, and their median planning times were only 5.8 and 7.1 minutes, respectively (table 2). the th-3dcrt median beam delivery time did not differ significantly from the th - imrt median beam delivery time, but was slightly longer than the 2f-3dcrt and 3f - imrt median beam delivery times (p < 0.05). rt with lof has played an important role in the treatment of egc for a long time. however, studies have reported that the excessive radiation dose received by ca can increase the risk of stroke due to the development of stenosis and thickening of the vessel wall. accordingly, there is growing interest in using the latest rt techniques to reduce the irradiation of the ca. there are several advantages to the complicated new treatment techniques ; however, these techniques also have disadvantages, such as increased workloads and high probability of error. further study is necessary to clarify the balance of these advantages and disadvantages. in particular, performing rt for egc with a very low dose to ca results in both the deterioration of target coverage and rapid increase in workload. however, studies have reported statistically significant thickening of the vessel wall for doses of more than 35 - 50 gy. hence, we did not consider ca doses of less than 35 gy, while generating 4 different plans for this study. our study considered 2f-3dcrt, which provides a more efficient method of lowering the ca dose, as compared with the traditional lof technique. when indirectly comparing our results with previous studies, we found that 2f-3dcrt provides better target dose conformity and ca sparing than traditional lof. in addition, 3-field (right anterior oblique, left anterior oblique, and an anterior field) 3dcrt shows a slightly better ca sparing than 2f-3dcrt. in this study, however, 3dcrt resulted in a lower ci and a higher ca dose than the other three plans. for this reason, various forms of imrt techniques for egc rt have recently been introduced, such as volumetric - modulated arc therapy (vmat). vmat was not included in this study, but has recently been the subject of considerable attention. when comparing previous investigations of various vmat techniques with the results of this study, only full - arc vmat offered a v35 that was similar to our findings for 3f - imrt, th - imrt, and th-3dcrt (a v35 that was close to 0). as compared with 3dcrt, imrt is generally associated with longer treatment planning times and treatment times because of its need for inverse planning and complex beam delivery. in the present study, we found that the median beam delivery time was the shortest for 2f-3dcrt (2.06 minutes) and longest for th - imrt (2.9 minutes) ; however, the difference was less than 1 minute. the beam delivery time of full - arc vmat was generally less than 2 minutes, although the results may vary with the type of equipment and the dose rate used. therefore, fullarc vmat offers slightly shorter beam delivery times than the plans studied here. particularly, the treatment planning time of fullarc vmat (which usually requires inverse planning for the full arc) is much longer than that of 3f - imrt. th-3dcrt is a conformal arc technique that modifies the beam by opening the mlc in accordance to the shape of the tv in a helical mode (without beam intensity modulation). the treatment planning times and treatment times of th-3dcrt are short (total of less than 30 minutes) because th-3dcrt does not include intensity modulation and additional patient - specific pretreatment quality assurance is not required due to the simple treatment method. at our center, we perform dose verification of the absolute point dose using an ionization chamber and the relative dose distributions using gafchromic film (ebt, isp, wayne, nj) with a solid phantom before treatment for all imrt sessions (table 2). when th-3dcrt was initially introduced, the exact same quality assurance procedures were performed as part of the commissioning process. however, th-3dcrt has not been performed as a general 3d - crt procedure after the correct delivery dose was confirmed. therefore, the same - day treatment with a ct plan may also be worth considering. the patient s larynx is reported to move 20 - 25 mm in the caudal - cranial direction and 3 - 8 mm in the anterior - posterior direction during swallowing. however, the incidence and duration of swallowing are reported to be small in most patients. hence, patients at our center receive thorough instructions not to swallow during treatment, and we try to shorten the treatment time as much as possible. several previous studies reported that, when treating egc with daily image - guided repositioning using a ctv - ptv margin of 1 - 2 mm, there is a very small ctv dose reduction due to geometrical uncertainty, including set - up errors, respiratory movements, interfractional volumetric changes, and deformations that occur during treatment. the ctv - ptv margin added in this study was 3 mm in all directions, except posteriorly (1 mm). this was considered to be a safe margin for th-3dcrt and th - imrt, which involve simultaneous megavoltage ct image - guidance and the use of a thermoplastic mask. in this study, we showed that th-3dcrt provides many new benefits, excellent target dose coverage, and ca - sparing similar to that of the other two imrt techniques. th-3dcrt also offers high efficiency, short planning times, and short beam delivery times (similar to 3dcrt). in addition, pretreatment quality assurance is not required due to the simplicity of the treatment method. this study may serve as an effective guide for selecting the best - performing method of treatment for egc that also requires the lowest workload. a suitable balance of performance and workload can be especially advantageous for busy clinics. | purposethe purpose of this study was to investigate the dosimetric benefits and treatment efficiency of carotid - sparing tomohelical 3-dimensional conformal radiotherapy (th-3dcrt) for early glottic cancer. materials and methodsten early - stage (t1n0m0) glottic squamous cell carcinoma patients were simulated, based on computed tomography scans. two - field 3dcrt (2f-3dcrt), 3-field intensity - modulated radiation therapy (3f - imrt), tomohelical - imrt (th - imrt), and th-3dcrt plans were generated with a 67.5-gy total prescription dose to the planning target volume (ptv) for each patient. in order to evaluate the plan quality, dosimetric characteristics were compared in terms of conformity index (ci) and homogeneity index (hi) for ptv, dose to the carotid arteries, and maximum dose to the spinal cord. treatment planning and delivery times were compared to evaluate treatment efficiency. resultsthe median ci was substantially better for the 3f - imrt (0.65), th - imrt (0.64), and th-3dcrt (0.63) plans, compared to the 2f-3dcrt plan (0.32). ptv hi was slightly better for th-3dcrt and th - imrt (1.05) compared to 2f-3dcrt (1.06) and 3f - imrt (1.09). th-3dcrt, 3f - imrt, and th - imrt showed an excellent carotid sparing capability compared to 2f-3dcrt (p < 0.05). for all plans, the maximum dose to the spinal cord was < 45 gy. the median treatment planning times for 2f-3dcrt (5.85 minutes) and th-3dcrt (7.10 minutes) were much lower than those for 3f - imrt (45.48 minutes) and th - imrt (35.30 minutes). the delivery times for 2f-3dcrt (2.06 minutes) and 3f - imrt (2.48 minutes) were slightly lower than those for th - imrt (2.90 minutes) and th-3dcrt (2.86 minutes). conclusionth-3dcrt showed excellent carotid - sparing capability, while offering high efficiency and maintaining good ptv coverage. |
no commercial serologic assays can detect siv infections in humans, and published assays for this purpose are not designed to detect a wide range of divergent siv strains. to determine whether humans are infected with siv, we developed a sensitive and specific siv multiple antigenic peptide based enzyme immunoassay (smap - eia) for detecting env idr (immunodominant region of gp41/gp36) and v3 antibodies to all of the siv lineages for which env sequences were available, specifically sivsm, sivagm, sivsyk, sivcpz, sivlhoest / sivsun, sivcol, sivmnd and sivdrl, sivrcm, and sivdeb (4). the smap - eia also detects other siv strains not represented by specific siv lineage based peptides. this study was carried out under an approved protocol in accordance with guidelines set forth by the centers for disease control and prevention (cdc). we tested plasma samples from cameroon that were seronegative for hiv-1 and hiv-2 by eia. cameroon has extensive hiv-1 genetic diversity, and rural bushmeat hunting is common (2). plasma from 3 different groups in cameroon was examined : 1) persons in remote villages who reported a high level of exposure to siv strains through hunting nhps, butchering nhps, or keeping wild nhp pets (n = 76) (2) ; 2) persons from the same villages who reported a low level of nhp exposure (n = 77) (2) ; and 3) persons from a general population (n = 1,071) from urban and rural areas in cameroon where people may handle nhp meat but are unlikely to have repeated contact with the blood or body fluids of freshly killed animals. we tested the seroreactivity of these small - volume samples by using our smap - eia. of the samples that were reactive (optical density [od ] > 1.000) to > 1 of a panel of 9 siv idr maps (figure 1), 17.1% were seroreactive in the high exposure group, 7.8% in the low exposure group, and 2.3% in the general group. the higher the risk for exposure to fresh nhp blood and body fluids, the greater the frequency of reactivity (p 1, also reacted strongly to the homologous v3 peptide. this sample, which was from our general population, reacted to the sivcol (colobus guereza) maps in both idr (od = 1.250) and v3 (od = 1.798). since frozen viable cells were available from this person, we performed an interferon- enzyme - linked immunospot (elispot) assay to determine whether peripheral blood lymphocytes (pbls) from this person recognized sivcol peptides from c. guereza. since no information is available about t - cell epitopes within the sivcol genome, and the siv strains from c. guereza are highly divergent from all known siv isolates (5), we designed a series of overlapping peptides (16-mers overlapping by 10) across the gag gene, on the basis of the only available colobus sequence (5). low levels of t - cell reactivity to pools 7180 and 8186 of the gag peptides (10 and 5 background, respectively, and > 25 spots/10 pbls) and env v3 and idr peptides (9 and 6 background, respectively) were observed with unfractionated pbls (figure 2). no reactivity was observed in pbls from an hiv-1seronegative african donor used as a negative control pcr amplifications from proviral dna lysates, plasma from this sample, and cells from stimulated elispot wells were performed with pol primers originally used to identify the c. guereza sequence (5) and with other primers specifically designed from the published c. guereza sequence. despite a strong humoral (env idr and v3) response and weak cellular (gag) immune reactivity (in the range of elispot results reported from sex workers who were highly exposed to hiv but seronegative) seroreactivity without pcr amplification has been documented in those with occupational siv exposures (1,2). therefore, seroreactivity to sivcol in this person may reflect exposure to nonviable or defective sivcol, a nonproductive or cleared infection, or sequestering of virus in lymphatic tissues. interferon- enzyme - linked immunospot reactivity stimulated with sivcol peptides from the env and gag regions in peripheral blood lymphocytes (pbls) from a person seropositive for both the sivcol v3 and immunodominant region (idr) peptides and a seronegative person from africa (both men). to include both assays in a single graph, the number of spots per 106 pbls for each pool of gag peptides was divided by the number of spots per 106 pbls in the medium control. this value was expressed as the level of reactivity above background ; i.e., the value 2 on the y - axis stands for 2 the number of spots in the negative (medium) control. our data, taken together with previous reports of high prevalence of siv in nhp bushmeat (6) and high levels of nhp exposure (3), offer new evidence that persons who hunt and butcher wild nhps are subject to ongoing exposure and potential infection with siv. in a study of 16 siv isolates from 5 different primate lineages, 12 were capable of infecting human monocyte - derived macrophages, and 11 were capable of replicating in human peripheral blood mononuclear cells (7), although cell tropism does not necessarily predict virus pathogenicity. productive crossover infections may occur in low numbers in remote areas of africa, but because of low population density and isolation, they do not have the opportunity to become epidemic strains and instead become dead - end infections. ongoing transmission events may also be missed because serologic assays for detecting a broad range of sivs are lacking or because monitoring is insufficient in populations with high levels of exposure to nhp blood and body fluids. we also have reason to believe that the frequency of siv exposure and possible infection has increased during recent decades because of a combination of factors that have increased levels of nhp hunting (3) ; these factors include increased access to firearms, increased access to undisturbed nhp habitat from new logging roads, and increased demand for bushmeat in logging camps and rural and urban markets. new roads increase travel, increasing the probability that productive crossover siv infections will emerge. further surveillance for new, potentially successful, cross - species lentivirus transmission in africa is needed to ensure a safe blood supply and prevent the spread of novel, emerging hiv infections. | hiv - seronegative cameroonians with exposure to nonhuman primates were tested for simian immunodeficiency virus (siv) infection. seroreactivity was correlated with exposure risk (p<0.001). one person had strong humoral and weak cellular immune reactivity to sivcol peptides. humans are exposed to and possibly infected with siv, which has major public health implications. |
laser - assisted subepithelial keratomileusis (lasek) was introduced by massimo camellin (m. cimberle, lasek may offer the advantages of both lasik and prk, ocular surgery news, international edition, march 1999, page 28) as a technique which would eliminate the disadvantages of photorefractive keratectomy (prk) and laser in situ keratomileusis (lasik). the theoretical advantages ascribed to lasek were less postoperative pain, faster visual recovery, and less haze than prk. however, clinical studies comparing prk and lasek have yielded controversial results in terms of postoperative pain, speed of visual recovery, and wound healing [15 ]. transepithelial prk has been also associated with diminished wound healing response, hence, less refractive regression and haze compared to other techniques of epithelial removal in prk [6, 7 ]. the aim of the present study is to evaluate and compare clinical and confocal microscopic findings after transepithelial prk and lasek for correction of myopia as both techniques have beneficial effects on corneal wound healing. twelve consecutive patients (3 men, 9 women) with less than 0.5 diopter (d) differences in myopic spherical equivalent (se) refraction and astigmatism between their eyes were included in this study. the refractive error was treated with transepithelial prk in one eye and lasek in the other eye of each patient. odd numbered patients received transepithelial prk in the right and lasek in the left eye and vice versa in the even numbered patients. written informed consent inclusion criteria were at least 18 years of age, stable refraction of at least 2 year, and normal corneal topography. daily - wear soft contact lenses were removed at least 2 weeks before the preoperative examination. preoperative evaluation included medical history and complete ophthalmologic examination (uncorrected visual acuity (ucva), best spectacle - corrected visual acuity (bscva), manifest and cycloplegic refractions, anterior segment examination, applanation tonometry, ophthalmoscopy, corneal topography, pachymetry, schirmer testing, and confocal microscopy). patients with unstable refraction, dry eye, blepharitis, corneal disease, glaucoma, collagen vascular disease, diabetes, and topographical evidence of keratoconus were excluded. all patients were treated bilaterally, with both eyes treated at the same surgical session. topical proparacaine 0.5% was used to anesthetize the eyes. a drape and a lid speculum were inserted following the treatment of eyelids with 10% povidone - iodine. in transepithelial prk - treated eyes, initially the epithelium was ablated using the phototherapeutic keratectomy (ptk) mode with laser ablation set to 8.0 mm diameter and 40 m depth. this step was performed with all lights in the operation room turned off to observe the disappearance of blue fluorescent light of the epithelium. as soon as the blue fluorescence of the epithelium disappeared, the laser was immediately switched to the refractive correction program and stromal ablation was performed without delay. in lasek - treated eyes, the epithelium was incised with an 8 mm trephine placed centrally, and 18% alcohol was applied for 25 seconds. laser ablation was performed with the esiris excimer laser (schwind, kleinostheim, germany). spherical and cylindrical ablations were performed according to manifest refraction without any reduction using the schwind ork - cam aspheric ablation profile. the ablation diameter was 6.5 mm with a 0.75 mm transition zone in all eyes. following the ablation, the cornea was irrigated with chilled balanced salt solution, and in lasek - treated eyes the epithelium was rolled to its original position and dried in place for 2 minutes. a cooled soft contact lens (focus night & day ; ciba vision, duluth, ga) was placed over the cornea with sterile forceps, and a drop of tobramycin 0.3% and dexamethasone 0.1% were instilled. patients were examined daily until epithelial closure and at 1, 3, 6, and 12 months. diclofenac 50 mg was prescribed to all patients, and they were advised to take it orally once or twice per day if required. dexamethasone was administered four times daily for 1 month followed by fluorometholone 0.1% four times daily for another 1 or 2 months depending on refraction. all patients were given a questionnaire on the day of surgery and asked to rate and compare their pain levels in each eye on days 1 and 2. the pain scale was defined as follows : level 1 : no pain ; level 2 : minimal pain ; level 3 : moderate pain ; level 4 : severe pain ; and level 5 : unbearable pain. pain level was not rated after third day as the epithelium had healed in some prk treated eyes on day 3. postoperative haze was graded as follows : + 0.5 : barely visible corneal opacity ; + 1 : reticular subepithelial opacities not affecting visual acuity ; + 2 : punctuate or coalesced subepithelial opacities affecting visual acuity ; + 3 : confluent subepithelial opacities affecting visual acuity and partially obscuring iris detail ; and + 4 : dense opacities completely obscuring iris detail. greyscale value and keratocyte count of the anterior stroma immediately beneath the epithelium was evaluated with the confoscan 3 confocal microscope (nidek technologies, padova, italy) at 1, 3, and 6 months. coronal section of each image was approximately 340 m vertically and 255 m horizontally. each image was separated from the adjacent image by an average of 6. the lateral resolution was 1 and depth of field was 10 for each image. to determine the keratocyte density (cell / mm), the bright keratocyte nuclei in a predefined area (of about 0.06 mm) were manually marked. the number of the keratocytes was derived from the average of three sections with no motion artifact within the 5% anterior stroma immediately beneath the epithelium. statistical analysis was performed using spss 10.0 software (spss, chicago, il). the comparisons were done with the chi - square test for categorical variables and mann - whitney u test for continuous variables. the mean preoperative myopic se refraction was 2.39 1.26 d (range 1, 13 to 5.25 d) in transepithelial prk - treated eyes and 2.52 1.14 d (range 1.38 to 4.88 d) in lasek - treated eyes (p > 0.05). mean astigmatism was 1.35 1.38 d (range 0.25 to 4.00 d) in 12 transepithelial prk - treated eyes and 1.44 1.23 d (range 0.25 to 3.50 d) in 12 lasek - treated eyes (p > 0.05). mean time to epithelial healing was longer after lasek (4.00 0.43 days) than that after transepithelial prk (3.17 0.6 days) and this difference was statistically significant (p < 0.05). on the other hand, the mean subjective pain score on day 1 was significantly higher in transepithelial prk - treated eyes (3.75 0.87) than that in lasek - treated eyes (1.92 1.83) (p < 0.05). at 1 month, 58% of transepithelial prk and 75% of lasek - treated eyes achieved 20/20 or better ucva (table 2). at 6 months, 100% of eyes achieved 20/25 in both groups. over 90% of eyes were within 0.50 d of emmetropia at 6 months and maintained it at 12 months (table 3). the mean haze grade and the mean greyscale value in confocal microscopy were significantly higher (p < 0.05) in transepithelial prk - treated eyes compared to lasek - treated eyes at 1 month postoperatively. however, the mean grade of haze and the mean greyscale value did not differ between the 2 groups after 1 month (tables 4 and 5 and figures 1 and 2). the keratocyte density significantly decreased postoperatively in both transepithelial prk and lasek - treated eyes (figure 2). more importantly, the keratocyte density was significantly lower (p < 0.05) in transepithelial prk - treated eyes than in lasek - treated eyes at 1 month and 3 months (table 6). more extracellular matrix deposition and activated keratocytes were observed in transepithelial prk - treated eyes than in lasek - treated eyes (figure 2). after a long term experience with prk, ocular discomfort and slow visual recovery still remain the negative factors.. believed that the reduced postoperative pain after lasek is probably because the epithelial flap acts as another biological therapeutic lens that protects the ablated stroma from lid action. in our practice, particularly drying the lasek flap and use of high dk silicone hydrogel, contact lenses have provided low levels of discomfort (unpublished data). probably, the epithelial flap is slowly shed off and then replaced by new cells after lasek because it loses its vitality and does not reattach completely. many authors found a slight difference in refractive results between traditional prk and lasek [15 ]. reported that transepithelial prk is safe and effective as traditional prk for myopic correction with a minimal hyperopic shift. reported the clinical and visual results after prk using three epithelial removal techniques (mechanical, alcohol - assisted, and excimer laser - assisted) and found no marked difference among the three groups, as in our study. compared the refractive outcomes and complications of lasik, transepithelial prk, traditional prk, and lasek. they detected slightly better visual results after transepithelial prk than after lasek and the others, but mitomycin - c application was higher in transepithelial prk - treated eyes. in the present study, we aimed to compare the wound healing response after lasek with that after transepithelial prk, which has been associated with the lowest level of wound healing response compared to other techniques of epithelial removal in prk. at 1 month, higher haze grades and higher greyscale values in confocal microscopy were noted in transepithelial prk - treated eyes compared to lasek - treated eyes in our study. a greater reduction in keratocyte density was also noted after transepithelial prk at 1 and 3 months. these results imply a more intense wound healing response after transepithelial prk compared to lasek. previous studies have also reported higher grades of haze after traditional prk compared to lasek, particularly in the early postoperative months [13, 13 ]. reported a less intense wound healing process after lasek than after traditional prk, documented with confocal microscopy. transepithelial prk limits initial keratocyte apoptosis and thus reduces subsequent repopulation of activated stromal keratocytes and wound healing response [6, 7, 14 ]. compared with traditional prk, transepithelial prk have induced significantly less haze [15, 16 ]. on the other hand, we found significantly less haze after lasek than after transepithelial prk at 1 month. in contrast to our study, lee. did not find any significant difference among the transepithelial prk, traditional prk, and lasek in terms of cornel haze. also reported that the prevalence of haze with visual loss after lasek and transepithelial prk was low and comparable. but, the authors did not evaluate corneal haze within 3 months after surgery in these studies [10, 11 ]. a reduced wound healing process is associated with less keratocyte apoptosis, diminished production of extracellular matrix and collagen, and eventually reduced haze and regression. confocal microscopy showed some morphologic differences in the corneal wound healing process between transepithelial prk and lasek in our study. we noted that the immediate keratocyte density was significantly lower, and then more extracellular matrix deposition and activated keratocytes were observed in transepithelial prk - treated eyes than in lasek - treated eyes. we believe that lasek seems to decrease changes in stromal keratocytes and corneal wound healing up to 3 months after surgery. animal studies have also demonstrated that lasek provides superior results than traditional prk in terms of keratocyte apoptosis, haze, and wound healing [17, 18 ]. the mechanism of how wound healing response remains less intense after lasek is not still defined. the epithelial flap in lasek is accepted to serve as a barrier against influx of cytokines into the stroma and impede keratocyte apoptosis, which is an essential step in wound healing. in addition to effective barrier function, epithelial flap may also minimize the reflex cytokines release originating from the lacrimal gland, regenerating epithelial and stromal cells in ablated surface following laser ablation, as suggested by lee... however, lasek seems to offer a less intense wound healing response, less haze, and less ocular discomfort than transepithelial prk. on the other hand, time to epithelial healing is slightly longer with lasek. | purpose. to compare the clinical and confocal microscopic results of transepithelial prk versus lasek for correction of myopia. materials and methods. twelve patients with myopia received transepithelial prk in one eye and lasek in the other. in transepithelial prk - treated eyes, the corneal epithelium was removed with 40 microns of excimer laser ablation and in lasek - treated eyes with 25-second application of 18% ethanol. time to epithelial healing, ocular discomfort, uncorrected and best corrected visual acuities, manifest refraction, haze, greyscale value, and keratocyte apoptosis in confocal microscopy were recorded. results. the mean time to epithelial healing was significantly longer after lasek (4.00 0.43 versus 3.17 0.6 days). on day 1, ocular discomfort was significantly higher after transepithelial prk. the grade of haze, keratocyte apoptosis, and greyscale value in confocal microscopy were significantly higher in transepithelial prk - treated eyes at 1 month. all transepithelial prk- and lasek - treated eyes achieved 20/25 or better ucva and were within 1.00 d of emmetropia at final visits. conclusions. both transepithelial prk and lasek offer effective correction of myopia at 1 year. however, lasek appeared to induce less discomfort and less intense wound healing in the early postoperative period. |
leptomeningeal carcinomatosis (lc) is a rare but fatal manifestation of metastatic breast cancer seen in approximately 3.5% of all breast cancer patients. there has been recognition of the neurotropism property of human epidermal growth factor receptor 2 (her2) positive subtype of breast cancer in recent years. an increasing incidence of leptomeningeal metastases has been reported in these patients, possibly due to widespread use of adjuvant trastuzumab that has increased systemic relapse - free survival without impacting the propensity for central nervous system (cns) spread. this effect could, at least partly, be attributed to the poor cns penetration of this antibody. currently, there are limited therapeutic options for these patients and the outcome is poor. we report two cases of women with her2 positive breast cancer who were treated with intrathecal (it) trastuzumab as part of their therapeutic regimen for lc. in 2009, a 49-year - old premenopausal woman was diagnosed to have right breast cancer and synchronous bone metastases. pathological evaluation revealed axillary nodal metastases and estrogen receptor (er), progesterone receptor (pr), and her2 receptor (3 +) were all positive by immunohistochemistry (ihc). she received six cycles of docetaxel, carboplatin, and trastuzumab, followed by maintenance adjuvant trastuzumab and tamoxifen. she was started on capecitabine and lapatinib, on which she had a progression - free interval of 6 months. at this time magnetic resonance imaging (mri) of the brain and spinal cord showed patchy leptomeningeal enhancement suggestive of lc. she was treated with a combination of lapatinib, letrozole, and it trastuzumab (50 mg 2 times / week for 4 weeks followed by 50 mg once per week for 4 weeks, followed by 150 mg once every 3 weeks) along with it hydrocortisone (50 mg) on every occasion. the csf cytology was negative for malignant cells after the 16 it injections of trastuzumab. she had symptomatic (increasing headache and vomiting) and radiological progression (new parenchymal brain lesion and diffuse increase in the leptomeningeal enhancement along both cerebral and cerebellar hemispheres) after 7 months of it therapy. at this time, on this occasion, she received whole - brain radiation therapy (wbrt) while it trastuzumab was continued at 3 weekly intervals. the patient again had symptomatic improvement within 4 weeks and radiological response (decrease in parenchymal lesions and leptomeningeal enhancement) at 16 weeks. in 2011, a 62-year - old woman was diagnosed to have left locally advanced breast cancer (t3n1m0) which was er and pr negative and her2 positive (3 + by ihc). she was treated with neoadjuvant chemotherapy (12 cycles of weekly paclitaxel and trastuzumab) followed by mrm. this was followed by four more cycles of chemotherapy (epirubicin and cyclophosphamide) and locoregional radiation therapy. she received wbrt followed by single agent lapatinib at the dose of 500 mg 2 times / day. after 4 weeks, she had good symptomatic improvement with resolution of headache and mri revealed reduction in cerebral lesions. after 8 months of treatment with lapatinib, she developed headache, backache, and ataxia. she was started on it trastuzumab (150 mg every 3 weeks) combined every time with it hydrocortisone (50 mg). she was simultaneously started on intravenous trastuzumab in usual doses, and lapatinib was escalated to 1250 mg / day. after the 2 dose of it trastuzumab, there was a significant clinical improvement, and the csf cytology became negative for malignant cells. at the time of this report, she has completed 7 months of this treatment without evidence of disease progression and continues to be symptomatically well controlled. in 2009, a 49-year - old premenopausal woman was diagnosed to have right breast cancer and synchronous bone metastases. pathological evaluation revealed axillary nodal metastases and estrogen receptor (er), progesterone receptor (pr), and her2 receptor (3 +) were all positive by immunohistochemistry (ihc). she received six cycles of docetaxel, carboplatin, and trastuzumab, followed by maintenance adjuvant trastuzumab and tamoxifen. she was started on capecitabine and lapatinib, on which she had a progression - free interval of 6 months. at this time magnetic resonance imaging (mri) of the brain and spinal cord showed patchy leptomeningeal enhancement suggestive of lc. she was treated with a combination of lapatinib, letrozole, and it trastuzumab (50 mg 2 times / week for 4 weeks followed by 50 mg once per week for 4 weeks, followed by 150 mg once every 3 weeks) along with it hydrocortisone (50 mg) on every occasion. the csf cytology was negative for malignant cells after the 16 it injections of trastuzumab. she had symptomatic (increasing headache and vomiting) and radiological progression (new parenchymal brain lesion and diffuse increase in the leptomeningeal enhancement along both cerebral and cerebellar hemispheres) after 7 months of it therapy. at this time, on this occasion, she received whole - brain radiation therapy (wbrt) while it trastuzumab was continued at 3 weekly intervals. the patient again had symptomatic improvement within 4 weeks and radiological response (decrease in parenchymal lesions and leptomeningeal enhancement) at 16 weeks. in 2011, a 62-year - old woman was diagnosed to have left locally advanced breast cancer (t3n1m0) which was er and pr negative and her2 positive (3 + by ihc). she was treated with neoadjuvant chemotherapy (12 cycles of weekly paclitaxel and trastuzumab) followed by mrm. this was followed by four more cycles of chemotherapy (epirubicin and cyclophosphamide) and locoregional radiation therapy. she received wbrt followed by single agent lapatinib at the dose of 500 mg 2 times / day. after 4 weeks, she had good symptomatic improvement with resolution of headache and mri revealed reduction in cerebral lesions. after 8 months of treatment with lapatinib, she developed headache, backache, and ataxia. she was started on it trastuzumab (150 mg every 3 weeks) combined every time with it hydrocortisone (50 mg). she was simultaneously started on intravenous trastuzumab in usual doses, and lapatinib was escalated to 1250 mg / day. after the 2 dose of it trastuzumab, there was a significant clinical improvement, and the csf cytology became negative for malignant cells. at the time of this report, she has completed 7 months of this treatment without evidence of disease progression and continues to be symptomatically well controlled. the prognosis of breast cancer patients with leptomeningeal metastases remains dismal with a median survival of about 4.5 months. currently, there is no standard treatment because of its rarity and exclusion of patients from prospective trials. little is known about the pharmacokinetics of trastuzumab in the cns and its ability to cross the intact blood pestalozzi and brignoli. reported that csf concentration of trastuzumab was 300 times lower than serum levels in a patient with lc, whereas stemmler. reported that trastuzumab may cross the impaired (due to radiation or carcinomatosis) bbb in view of these facts, direct delivery of trastuzumab into the spinal fluid via it administration seems to be a promising treatment option for her2-positive breast cancer patients with lc. they had rapid relief in their symptoms (headache, vomiting, dizziness, and ataxia) which led to marked improvement in their quality of life. both patients showed clearance of carcinoma from csf early in the course of treatment and objective response on cns imaging. further, both patients showed relatively prolonged periods of cns disease control (7 and 7 + months, respectively). of note, in parallel with evidence in systemic non - cns metastatic disease, we continued it trastuzumab beyond progression in the first patient. this strategy has been reported to be effective in 75% of cases in a recently published systematic review of patients with lc. the dose has varied from 5 to 150 mg and dosing interval from 2 times / week to once every 3 weeks. we chose to use the higher dose (150 mg) at 3 weeks intervals in both patients because of long drug half - life, anticipated safety and patient convenience. to the best of our knowledge, this dose and schedule of it trastuzumab have been reported in only one patient till date. in both of our patients, this dose and schedule proved to be well tolerated, and there was no evidence of anaphylaxis, aseptic meningitis, paraparesis, cauda equina fibrosis, or segmental root demyelination in our patients. although both patients showed good symptomatic, cytological, and radiological response, we can not ascribe these results solely to it trastuzumab because of concomitant use of systemic therapy that included her2 targeted agents. however, the early temporal correlation of symptomatic and cytological response with initiation of it treatment leads us to believe that the latter was at least partly responsible for the outcome. it trastuzumab, in the dose and schedule described in our report, led to significant symptomatic benefit without major toxicity in heavily pretreated her2 positive breast cancer patients with lc. | there has been recent increase in incidence of leptomeningeal carcinomatosis, possibly due to widespread use of adjuvant trastuzumab and its known poor cns penetration. currently there are limited therapeutic options for these patients and outcome is poor. we report two cases of women with her2 positive breast cancer who developed leptomeningeal carcinomatosis for which they were treated with intrathecal trastuzumab in combination with systemic therapy. both patients had rapid symptomatic benefit and radiological response and remained progression free for at least seven months. intrathecal trastuzumab can be considered a reasonable therapeutic option for these difficult to treat patients. |
self - expanding metallic stents are the devices of choice in the treatment of malign or benign strictures of the esophagus. we report a case of intestinal obstruction caused by esophageal stent migration, in which surgical intervention was used. a 65-year - old woman, who had a medical history of gastric cancer operations and esophageal stent applications, was admitted to our emergency department with a 48-hour history of abdominal pain, nausea and vomiting. this case illustrates that esophageal stent migration has to be considered as a potential life - threatening complication. self - expanding metal stent (sems)-placement has been the first choice for palliative therapy of the unresectable esophageal cancer. these stents are also highly effective for the management of benign (peptic, postsurgical, corrosive) strictures refractory to dilation, esophageal leaks, perforations and fistula. in most cases, rapid relief of dysphagia and adequate oral intake of nutrients can be achieved. although complications at the time of insertion are not uncommon, most stents can successfully be managed by experienced endoscopists and only few of them are lethal. rare reports of intestinal obstruction have been confined to the stiff plastic and stainless - steel stents. in this paper, we present a case of small bowel obstruction due to the migration of an esophageal stent. a 65-year - old woman underwent surgery for gastric cancer four years ago and her passage was restored with jejunal interposition. endoscopic examination revealed a stenosis in the anastomosis, in which a recurrent cancer was assumed ; and so a silicon - coated wall stent (25-mm diameter, 10-cm length) was inserted. four weeks after stent application, she was admitted to our emergency department with a 48-hour history of abdominal pain, nausea and vomiting. laboratory findings showed a white blood cell count of 15600/mm3, hemoglobin 12.3 gm / dl, and a platelet count of 200.000/mm3. a computed tomography scan was ordered, and marked dilatation of the small intestine and the displaced stent in the right iliac fossa were observed (fig. after establishment of the diagnosis as mechanical bowel obstruction, the patient was taken to the operating room for emergency laparotomy. the small intestine segment was incised longitudinally 2 - 3 cm and the migrated stent was removed (fig. today, malignant esophageal obstruction is a common pre - terminal complication of advanced gastric, pancreato - biliary and metastatic carcinoma. for these patients with limited life expectancy, a palliative treatment should relieve dysphagia and intractable hyperemesis, and maintain adequate oral nutrition. in this setting, self - expanding metal stents provide a substantial progress in the management of dysphagia in patients with malignant esophageal obstructions or fistula. they can also be used in esophageal cancer patients having perforations diagnosed shortly after endoscopic dilatations. stent placement can treat the perforations, seal off fistula, palliate dysphagia, and extend the life of most patients, and should be considered as an optional treatment, particularly in patients who are poor surgical candidates. the first description of the endoscopic placement of an expanding metallic spiral stent was made by frimberger in 1983. since then, many different types of sems have been used for the treatment of esophageal obstructions, e.g., covered or uncovered, with or without an anti - reflux valve to prevent gastro - esophageal reflux in patients with a malignant tumor around the gastroesophageal junction. of these stents, the ideal one should be cost - effective, technically easy to place and removable with endoscopy and/or fluoroscopy, and designed to bear a small - caliber delivery device with minimal shortening on deployment. furthermore, it should have low migration rate and both its insertion and removal should be associated with minimal complications. in this sense, covered stents are most commonly used in patients with malign esophageal obstructions because the cover avoids tumor ingrowth through the stentmetal mesh. however, the use of covered stents has been plagued by stent migration. with covered stents placed for tumors of the distal esophagus or gastric cardia, stent migration is more likely to occur than when stents are placed for more proximally located tumors because the distal portion of stents projects freely into the gastric fundus without fixation to the esophageal wall. therefore, stent migration has been reported to occur in up to 28% of patients treated with a covered stent. the most important thing to be done is the removal of migrated stents, which is not successful in all cases and is sometimes even dangerous. most migrated stents are removed non - surgically, exiting the body spontaneously, or remaining in the body in an uncomplicated state. although migrated stents generally do not block the passage as a result of their pliability, migration may infrequently lead to impaction in the distal gut. the common denominator of an impacted stent is the extrinsic fixation of the bowel wall, impeding the passage of the stent through the bowel lumendense intra - abdominal adhesions probably contributed to the obstruction in our case. on very rare occasions, a perforation occurs without any obvious associated bowel pathology. in recent years, newly modified stents, especially used in benign conditions, are capable of being fixed with silk thread or longer devices with internal silicon sleeves which might reduce migration rate. briefly, endoscopic insertion of sems is a useful and powerful procedure for esophageal strictures. we agree that an esophageal stent should remain in its place until the stricture heals in benign conditions. in case of long - term therapy, a migrated esophageal stent, symptomatic or not, should be followed closely or removed immediately. | background : self - expanding metallic stents are the devices of choice in the treatment of malign or benign strictures of the esophagus. stent migration is a well - known complication of this procedure.aims:we report a case of intestinal obstruction caused by esophageal stent migration, in which surgical intervention was used.methods:a 65-year - old woman, who had a medical history of gastric cancer operations and esophageal stent applications, was admitted to our emergency department with a 48-hour history of abdominal pain, nausea and vomiting. an emergency laparotomy was performed and the migrated stent causing intestinal obstruction was removed.results:the patient recovered without incident and was discharged on postoperative day 3.conclusion:this case illustrates that esophageal stent migration has to be considered as a potential life - threatening complication. |
recombinant human growth hormones (rhgh) have been in clinical use for three decades.1 during this time, the safety of rhgh in children and adults has received considerable attention.2 a recent appraisal of rhgh in children and adults concluded that rhgh continues to have a good safety record when used for approved indications and at recommended doses, while noting the need for continued surveillance of those exposed to these therapies.2 another recent study assessed expected deaths in swedish patients (n=3,847) treated in childhood with rhgh for idiopathic isolated gh deficiency, idiopathic short stature, or born small for gestational age (sga).3 compared with the general swedish population, the ratio of observed / expected deaths was not increased in the childhood rhgh - treated group when adjusting for birth characteristics. safety concerns for rhgh treatments generally include impact on cancer risk, impact on glucose homeostasis, and the formation of antibodies to endogenous / exogenous gh.4,5 additional concerns that may exist in relation to omnitrope (biosimilar rhgh ; sandoz, kundl, austria) and its biosimilar status include safety in indications granted on the basis of extrapolation and the impact of changing to a biosimilar rhgh from other rhgh treatments. this article reviews the safety experience gained with biosimilar rhgh during 10 years of clinical use. by 2015, 42,300 patients worldwide had been treated with biosimilar rhgh ; as of june 2016, 106,941,419 patient days (292,790 patient - years) experience had been gathered for this product. physicians should be reassured that the safety profile of biosimilar rhgh is in keeping with that of other rhgh products. the phase iii clinical development program for biosimilar rhgh included three pivotal studies and a total of 210 children with growth failure secondary to growth hormone deficiency (ghd ; table 1). the aq study was a multicenter, randomized, controlled, open - label phase iii study consisting of three parts, performed consecutively in the same cohort of children with ghd (n=89).6,7 throughout the 84 months of treatment, the safety profile of biosimilar rhgh was as expected from previous experience with the reference medicine and other rhgh preparations. adverse drug reactions (adrs) with a frequency of at least 0.05 events per patient - year included increased glycosylated hemoglobin (hba1c), headache, and injection - site hematoma. only one serious adverse reaction was reported ; this was a case of worsening of pre - existing scoliosis that required several hospitalizations during the study period. the lyo study was a multicenter, non - comparative phase iii study using biosimilar rhgh 5 mg / ml lyophilized formulation in the treatment of ghd children (n=51).6 children were treated for a period of up to 48 months. the biosimilar rhgh safety profile was as expected from previous experience with the reference medicine and other rhgh preparations. aes occurring in > 5% of patients were eosinophilia (12%), injection - site reactions (10%), hypothyroidism (8%), and scoliosis (6%). the majority of aes were mild in intensity ; three (contusion, increase in blood alkaline phosphatase, and increase in hba1c) were assessed as being of moderate intensity. no patients withdrew from study treatment due to an ae, and there were no drug - related serious aes. the third phase iii study was an open - label study conducted in spain to assess the safety and efficacy of long - term treatment (up to 5 years) with biosimilar rhgh 3.3 mg / ml liquid formulation in children with ghd (n=70).8 the majority of reported aes (401/426 ; 94%) were assessed as mild in intensity ; 22 were assessed as moderate and one (toothache) as severe. drug - related aes (17 events) were reported in 10 patients ; 15/17 were assessed as mild in intensity. drug - related aes included myopia (1), vomiting (2), gastroenteritis (1), viral pharyngitis (1), injection - site pain (2), antibody test abnormal (3), hyperglycemia (1), tendonitis (1), headache (2), migraine (2), and dermatitis (1). no patients withdrew from study treatment due to an ae, and there were no drug - related serious aes.8 at the end of the study, those patients still growing were offered to remain on treatment (as in usual clinical practice) and continued to be monitored for up to a further 5 years.9 no treatment - related aes were reported in any of the patients who participated in the additional treatment and follow - up period. a phase iiib study was also conducted, in france, in 51 patients with ghd (data on file, sandoz, november 2011). no severe aes occurred, no special concomitant treatments were necessary, and no ae resulted in withdrawal from the study. there were no unexpected aes in this study. two serious aes were reported (appendectomy and constipation), neither of which was considered to be related to study treatment. a number of post - approval studies of biosimilar rhgh are ongoing, and these are a useful source of data for this product in indications granted on the basis of extrapolation. the patients treated with omnitrope (patro) children study is an ongoing, long - term, post - marketing surveillance program.10 the main objective of patro children is to assess the long - term safety of biosimilar rhgh, particularly in terms of the diabetogenic potential of rhgh therapy, the risk of malignancies, and potential risks of rhgh in children with prader fasting plasma glucose, 2-hour oral glucose tolerance tests, insulin levels, hba1c, and anti - gh antibodies are requested to be documented according to routine clinical practice. as of july 2016, 5,007 patients had been enrolled in patro children, with a mean treatment duration of 32.4 months with biosimilar rhgh.11 the majority of patients included have ghd ; there are also a good number of patients included with a diagnosis of sga, turner syndrome (ts), and pws. overall, 1,924 patients (38.4%) had experienced aes, most of which were mild to moderate in intensity (table 3). very few patients (3.5%) had withdrawn due to aes (table 4). omnitrope treatment was interrupted in 126 patients (2.5%) and the dose was reduced in 43 patients (0.9%). in total, 284 patients (5.7%) had reported drug - related aes, with headache being the most common (75 patients, 1.5%) (table 3). in total, only one positive anti - hgh antibody titer occurred transiently in a treatment - nave patient at baseline ; all subsequent results for this patient were negative. so far, 12 patients have been tested for anti - hgh antibodies following 2 years of biosimilar rhgh treatment ; no positive anti - hgh antibody titers have been reported in these patients. in addition, there had been no reports of rhgh - related malignancies or any additional safety concerns. also ongoing is a prospective, open - label, non - comparative, multicenter phase iv study to assess the safety and efficacy of omnitrope in short children born sga.12 this is the largest prospective clinical study so far conducted on rhgh in sga patients. in total, 278 children have been enrolled and received study medication ; 249 have completed 2 years of treatment.13 no child has developed diabetes mellitus during the first 2 years ; no fasting glucose or 2-hour oral glucose tolerance test value exceeded the pre - defined limits (> 126 or > 200 mg / dl, respectively). treatment - emergent aes were experienced by 211 (76.2%) children ; most of these were mild - to - moderate in intensity (99.3%) and unrelated to study treatment (97.6%). twenty - four drug - related aes occurred in 17 (6.1%) patients (hypothyroidism, n=7 ; headache, n=3 ; impaired fasting plasma glucose, n=3 ; igf - i / igfbp-3 increased, n=2 ; thyroid - stimulating hormone increased, n=1 ; puncture site hematoma, n=1 ; scoliosis, n=1 ; upper respiratory tract infection, n=1 ; bronchitis, n=1 ; impaired glucose tolerance, n=1 ; pharyngitis, n=1 ; viral infection, n=1 ; scarlet fever, n=1). all were considered mild in severity, except one case of headache, and none required permanent discontinuation of study medication.13 serious aes were reported in 22 patients (7.9%), with only one (severe headache) suspected to be related to study treatment. there have been no reports of malignancies or deaths during the first 2 years of treatment.13 patro adults is an ongoing observational, multicenter, open, longitudinal study of biosimilar rhgh, conducted in hospitals and specialized endocrinology clinics across europe. the primary objective is to assess the safety and efficacy of biosimilar rhgh in adults treated in routine clinical practice.14 as of march 2016, 1,043 patients had been enrolled in the study ; 562 (54%) had received previous gh treatment.15 to date, 2,025 aes had been reported in 597 (54%) patients, with 317 (in 187 patients) regarded as serious. these included 19 nervous system disorders, 19 musculoskeletal / connective tissue disorders, 17 general disorders / administration site conditions, and two investigations (increased igf levels). twenty - two serious aes in 14 patients were recorded as possibly related to study treatment, including one incidence of diabetes mellitus. of the 159 patients who had discontinued treatment, 39 did so due to an ae. physicians are often required to change the rhgh used by their patients due to health plan and/or patients insurance demands,16 or changes in formularies. it has been suggested that changing patients from one type of rhgh to another may adversely affect patient care.17 several studies have evaluated the impact of changing from other rhgh treatments to biosimilar rhgh. an analysis of phase iii clinical data assessed the efficacy and safety of rhgh in children who received continuous biosimilar rhgh therapy either with lyophilized powder for solution or ready - to - use solution, and children who received 9 months of treatment with the reference rhgh followed by biosimilar rhgh solution thereafter.18 across all groups, few children experienced adrs ; more adrs were observed during the first than the second 9-month treatment period, whether the patients were changed between products or stayed continuously on the same treatment.18 immunogenicity was uncommon across the groups analyzed. no relevant increased risk of anti - gh antibodies emerged following the change from the reference rhgh to biosimilar rhgh.18 another study has reported data from sweden following the change (for cost reasons) of children (n=98) from other rhghs to biosimilar rhgh.19 following the change to biosimilar rhgh there were no reports of serious or unexpected adrs. the mechanisms that lead to a break in immune tolerance to recombinant human proteins are not completely understood, but patient- and product - related factors are thought to be involved.20,21 administration of large therapeutic proteins via the subcutaneous route (which results in therapeutic proteins such as rhgh reaching the circulation via the lymphatic system) is more likely to stimulate an immune response than other administration routes. the development of an immune response to a biological therapy may not necessarily have any clinical consequences. occasionally, however, clinical consequences can arise ; if the generated antibodies neutralize the activity of the biopharmaceutical and/or the endogenous protein, loss of efficacy or more serious clinical effects can occur.22 the capacity of antibodies to bind to biosimilar rhgh is low, and there is no effect on response to treatment. testing for antibodies to gh is advised in any patient with an otherwise unexplained lack of response. the incidence of antibody formation to biosimilar rhgh is similar to that reported for the reference medicine.23 in the aq study, some patients who developed anti - rhgh antibodies received a non - commercial lyophilized form of bio - similar rhgh, which included an undetected increased content of host cell proteins.7 once switched to the improved commercial preparation, the proportion of patients with detectable antibodies had decreased after 3 months and continued to do so over the course of the study ; the presence of anti - rhgh antibodies did not have any impact on patient growth (figure 1). similarly, the safety profile was comparable in patients with and without detectable antibodies. one of 45 patients treated with the reference rhgh over 9 months developed anti - rhgh antibodies. forty - four of these patients were switched to bio - similar rhgh liquid formulation, three of whom developed low titers of anti - rhgh antibodies ; at the final visit (84 months) no patient had detectable levels of antibodies.7 the immunogenicity profile of biosimilar rhgh in the other pre - approval studies was also reassuring. none of the participants in the lyo study or the french phase iiib study developed anti - rhgh antibodies during 24 months treatment.7 in the spanish phase iii study, 2 out of 70 patients (2.9%) treated with biosimilar rhgh for up to 60 months developed anti - rhgh antibodies ; in all cases, the occurrence of antibodies was transient in nature.8 in the phase iv sga study, anti - rhgh antibody levels above the cutoff value were measured in 7 patients (2.7%) at year 1 and in 3 patients (1.2%) at year 2.13 positive test results were transient, with only 2 (0.8%) patients having antibodies above the cutoff value on two separate visits. an analysis was performed of pooled antibody test data across the biosimilar rhgh clinical development program. data from 4,645 tests in 492 patients were analyzed ; included patients had participated in the three phase iii studies (including the aq study), the phase iiib study conducted in france, and the phase iv study in sga children. overall, only 6 (1.2%) patients had antibody titers above the cutoff value on two separate visits, confirming the low immunogenic potential of biosimilar rhgh. a substantial data set is available to fully understand the safety profile of biosimilar rhgh, which includes data from its clinical development studies and 10 years of post - approval experience. based on the available data, there is no increased risk of cancer or adverse glucose homeostasis with biosimilar rhgh compared with the reference medicine and other rhgh products. in addition, the immunogenicity of biosimilar rhgh is similar to that of the reference and other rhgh products. extrapolation is an important element of the biosimilar concept and is part of the framework for approval of these agents by the european medicines agency ; it allows for approval of a biosimilar for the same indications as the reference medicine without the need for clinical studies in each individual condition, as long as the mode of action is the same in the different indications. post - approval studies are therefore important to provide safety and efficacy data in extrapolated indications. again, these studies have not uncovered any unexpected or unique safety concerns with biosimilar rhgh, and have not shown any increased risk of aes associated with specific conditions such as ts (scoliosis, diabetes, slipped capital femoral epiphysis), pws (scoliosis, obstructive sleep apnea), and short children born sga (diabetes). physicians can be reassured that the safety profile of biosimilar rhgh is in keeping with that of other rhgh products. | safety concerns for recombinant human growth hormone (rhgh) treatments include impact on cancer risk, impact on glucose homeostasis, and the formation of antibodies to endogenous / exogenous gh. omnitrope (biosimilar rhgh) was approved by the european medicines agency in 2006, with approval granted on the basis of comparable quality, safety, and efficacy to the reference medicine (genotropin). additional concerns that may exist in relation to biosimilar rhgh include safety in indications granted on the basis of extrapolation and the impact of changing to biosimilar rhgh from other rhgh treatments. a substantial data set is available to fully understand the safety profile of biosimilar rhgh, which includes data from its clinical development studies and 10 years of post - approval experience. as of june 2016, 106,941,419 patient days (292,790 patient - years) experience has been gathered for biosimilar rhgh. based on the available data, there have been no unexpected or unique adverse events related to biosimilar rhgh treatment. there is no increased risk of cancer, adverse glucose homeostasis, or immunogenic response with biosimilar rhgh compared with the reference medicine and other rhgh products. the immunogenicity of biosimilar rhgh is also similar to that of the reference and other rhgh products. physicians should be reassured that rhgh products have a good safety record when used for approved indications and at recommended doses, and that the safety profile of biosimilar rhgh is in keeping with that of other rhgh products. |
a 16-year - old girl presenting fever, cough and sore throat for one day was admitted to the emergency room of our institution. she had no history of recent travel abroad, and nobody was positive on novel influenza a (h1n1) among her family or classmates. on examination, the patient had an elevated temperature (39.0) and tachycardia (117/min). the results of initial laboratory evaluation were as follows ; wbc count 6,900/mm, neutrophil 91% and crp 4.85 mg / dl. 1a) showed an ill - defined increased opacity in right lower lung zone. real time reverse - transcriptase - polymerase - chain - reaction (rt - pcr) test revealed positive result for novel influenza a (h1n1). the blood culture or other examinations to detect the coinfected pathogens were all negative. therefore, she was diagnosed to have novel influenza a (h1n1) pneumonia, and treated with oseltamivir phophate, levofloxacin and ceftriaxone. three days later, because the chest radiograph showed aggravation in extent of pneumonia, high - resolution chest ct (hrct) was performed and showed ill - defined ground - glass opacities with interlobular septal thickening and some ill - defined nodules in right middle and lower lobes (fig. these findings of ct scans were consistent with the findings of viral pneumonia. after the continuation of medical treatment, the symptoms and infiltration on chest radiograph (fig. a 42-year - old woman was admitted to our emergency room for dyspnea and hemoptysis. myalgia, cough and sore throat developed 6 days ago, and she was diagnosed to have an upper respiratory infection (uri) in primary clinic, and took medicine. however the symptoms persisted and dyspnea, hemoptysis and foul - ordered sputum developed newly. on admission, the results of laboratory findings were as follows ; wbc 6,800 /mm, neutrophil 84% and crp 0.11 mg / dl. initial chest radiograph showed ill - defined infiltrates in both lower lung zones (fig. ct scans, lobar - distributed ill - defined consolidation and surrounding ground - glass opacities were noted in right middle lobe and left lower lobe (fig. the pneumococcal urine antigen assay was positive and gram - positive cocci were identified on sputum culture. therefore, she was diagnosed to have a novel influenza a (h1n1) pneumonia with secondary pneumococcal pneumonia and treated with oseltamivir phosphate, levofloxacin and ceftriaxone. with five - day medication, symptoms improved and follow - up chest radiograph also showed improvement of infiltration in both lower lung zones. a 16-year - old girl presenting fever, cough and sore throat for one day was admitted to the emergency room of our institution. she had no history of recent travel abroad, and nobody was positive on novel influenza a (h1n1) among her family or classmates. on examination, the patient had an elevated temperature (39.0) and tachycardia (117/min). the results of initial laboratory evaluation were as follows ; wbc count 6,900/mm, neutrophil 91% and crp 4.85 mg / dl. 1a) showed an ill - defined increased opacity in right lower lung zone. real time reverse - transcriptase - polymerase - chain - reaction (rt - pcr) test revealed positive result for novel influenza a (h1n1). the blood culture or other examinations to detect the coinfected pathogens were all negative. therefore, she was diagnosed to have novel influenza a (h1n1) pneumonia, and treated with oseltamivir phophate, levofloxacin and ceftriaxone. three days later, because the chest radiograph showed aggravation in extent of pneumonia, high - resolution chest ct (hrct) was performed and showed ill - defined ground - glass opacities with interlobular septal thickening and some ill - defined nodules in right middle and lower lobes (fig. these findings of ct scans were consistent with the findings of viral pneumonia. after the continuation of medical treatment, the symptoms and infiltration on chest radiograph (fig. a 42-year - old woman was admitted to our emergency room for dyspnea and hemoptysis. myalgia, cough and sore throat developed 6 days ago, and she was diagnosed to have an upper respiratory infection (uri) in primary clinic, and took medicine. however the symptoms persisted and dyspnea, hemoptysis and foul - ordered sputum developed newly. on admission, the results of laboratory findings were as follows ; wbc 6,800 /mm, neutrophil 84% and crp 0.11 mg / dl. initial chest radiograph showed ill - defined infiltrates in both lower lung zones (fig. ct scans, lobar - distributed ill - defined consolidation and surrounding ground - glass opacities were noted in right middle lobe and left lower lobe (fig. the pneumococcal urine antigen assay was positive and gram - positive cocci were identified on sputum culture. therefore, she was diagnosed to have a novel influenza a (h1n1) pneumonia with secondary pneumococcal pneumonia and treated with oseltamivir phosphate, levofloxacin and ceftriaxone. with five - day medication, symptoms improved and follow - up chest radiograph also showed improvement of infiltration in both lower lung zones. a new strain of triple - reassortant influenza a (h1n1) virus containing genes from swine, avian and human influenza viruses were identified in mexico in april 2009, and then rapid spread of this pathogen has been observed over the world. according to the world health organization, pandemic influenza phase 6 was declared on 11 june 2009, and over 296,471 cases were reported and at least 3,486 patients expired as related with this pathogen by 13 september 2009, (www.who.int/csr/don/2009_09_18). in korea, more than 1,400 patients have been diagnosed including nine mortality cases by 21 september 2009 (www.cdc.go.kr). during the early phase of this pandemic, there was a shift in the age distribution when compared with that of seasonal influenza virus. 87% of patients infected novel influenza a (h1n1) were between the ages of five and 50 years, and only 5% of patients were 51 years of age or older (1). this observation suggests that children and young adults may be more susceptible to novel influenza a (h1n1). the reason is proposed as a proportion of elderly people have some level of cross - reactive neutralizing antibodies to the pandemic h1n1 virus (4). it is also possible that there is a case - ascertainment bias because more of the young people are tested as part of outbreaks in schools than elderly people (5). the most common clinical manifestations of the novel influenza a (h1n1) are similar to the symptoms of seasonal influenza ; fever (94%), cough (92%) and sore throat (66%), whereas diarrhea (25%) and vomiting (25%) are more common in the patients infected with the novel influenza a (h1n1) (1). the clinical outcomes are various from subclinical illness to severe outcomes such as respiratory failure and death, and are similar to that observed in cases with seasonal influenza viruses. the influenza virus infections may cause primary influenza viral pneumonia, lead to secondary bacterial pneumonia or exacerbate underlying chronic illness (6). the chest radiographic findings described in a clinical report were bilateral patch alveolar opacities with basal lung predominance or interstitial opacities such as linear, reticular, or nodular shadows (2). however the ct findings have not yet been described, to the best of our knowledge. the common ct findings of viral pneumonia are known as poorly - defined air - space nodules and patchy areas of peribronchial ground - glass opacities and air - space consolidation. the ct findings of first case, showing the ill - defined ground - glass opacity nodules and patch areas of ground - glass opacities, were thought to be typical pattern of viral pneumonia. on the other hand, the findings of second case, showing lobar - distributed consolidation and peripheral ground - glass opacities, were somewhat different from typical pattern of viral pneumonia and were thought to have combined component of bacterial lobar pneumonia. in conclusion, we report two cases of novel influenza a (h1n1) pneumonia, focusing on radiologic findings including chest ct findings. the radiologists should be aware of the radiographic and ct findings of this viral infection so that the diagnosis of novel influenza a (h1n1) pneumonia should be considered promptly. | novel influenza a (h1n1) virus is the pathogen of recent global outbreaks of febrile respiratory infection. we herein report the imaging findings of pulmonary complication in two patients with novel influenza a (h1n1) infection. the first patient without secondary infection showed the ill - defined ground - glass opacity nodules and patch areas of ground - glass opacities. the second patient with secondary pneumococcal pneumonia showed areas of lobar consolidation in the right middle lobe and left lower lobe and ground - glass opacities. |
prader - willi syndrome (pws) is a contiguous gene syndrome that results from the non - expression of paternal alleles at the pws locus ; it is characterized clinically by uncontrollable hyperphagia, results in morbid obesity with the associated somatic and psychological problems (1 - 3). several studies have confirmed that plasma ghrelin levels are markedly elevated in pws adults (4, 5) and children (6, 7). because ghrelin acutely stimulates food intake and gh secretion in rodents and humans, and because its chronic administration to rodents causes obesity (8 - 12), it is possible that the increased appetite in pws might be due to the ghrelin level enhancement. however, a direct anorexigenic effect of ghrelin, in its physiologic range, has not been demonstrated in either rodents or humans to date. the study of anorexigenic hormones is of interest because appetite is also regulated by negative signals (13). moreover, the response patterns of hormones to meals have not been examined in detail in patients with pws. peptide yy (pyy), an anorectic peptide, is secreted postprandially from the distal gastrointestinal tract. moreover, pyy3 - 36, the major form of circulating pyy, binds to the hypothalamic npy y2 receptor (y2-r) with a high affinity, and has been shown to reduce food intake in rodents and humans (14 - 17). it has been reported that endogenous pyy levels are low in obese subjects, suggesting that pyy deficiency may contribute to the pathogenesis of obesity (18). cholecystokinin (cck) is an important feedback signal that controls meal size ; it is released from intestinal endocrine cells both locally and into the plasma in response to the intraluminal presence of nutrient digestion products. cck acts to coordinate the digestive process in both an endocrine and a paracrine / neurocrine manner by stimulating pancreatic and gallbladder secretions, inhibiting gastric emptying, and by modifying intestinal motility. insulin is a physiological and dynamic modulator of plasma ghrelin and glucose levels, and possibly mediates their effect on nutritional status (10). moreover, it has been reported that insulin has an inhibitory effect on ghrelin secretion that is independent of plasma glucose levels, although these molecules may have additional effects (20, 21). in this study, the 24-hr pyy, cck, insulin and ghrelin profiles of children with pws (n=4) were compared with those of age, gender, and bmi matched controls (n=4) ; the responses of these hormones to meals were evaluated. four pws patients (n=4, mean body mass index (bmi)=395.9 kg / m, mean fat % = 58.45.9%) and four age, gender and bmi matched controls (n=4, mean bmi=395.7 kg / m, mean fat % = 51.23.7%) were enrolled in the present study. patients with diabetes mellitus (fasting plasma glucose > 126 mg / dl with a 2-hr post - prandial glucose value of > 200 mg / dl) were excluded. the study design was reviewed and approved by the samsung medical center institutional review board. for controls, we explained the purpose of the study to teachers, and a written study protocol was sent to all parents. of 23 volunteers, four controls were selected on the basis of age, sex, and bmi. we explained the purpose and methods of the study, and informed consent was obtained from all parents. for this 24-hr study, all subjects were admitted to the pediatric ward at the samsung medical center ; they ate a standard hospital diet [meals served at 7:30 am, 12:00 pm, and 18:00 pm, total calories 2100 calories consisting of 60% carbohydrate (310 g), 20% protein (100 g) and 20% fat (50 g) ] and were allowed to sleep (lights - off) between 11:00 pm and 7:00 am. during the remainder of the day, lights were on and sleeping and snacking were not allowed. blood was drawn to measure hormones through an indwelling venous cannula and was collected in edta and sst tubes every hour for 24 hr without the addition of aprotinin. after taking a baseline sample, which was collected at 7:00 am before breakfast, a total of 23 additional samples were collected at hourly intervals from each patient. samples were stored at 4 during the collection period, centrifuged for plasma within two hours of collection, and stored at -70 until assayed. plasma immunoreactive ghrelin was measured in duplicate using a commercial elisa kit (phoenix pharmaceuticals, belmont, ca) ; the inter- and intra - assay coefficients of variance were 126 mg / dl with a 2-hr post - prandial glucose value of > 200 mg / dl) were excluded. the study design was reviewed and approved by the samsung medical center institutional review board. for controls, we explained the purpose of the study to teachers, and a written study protocol was sent to all parents. of 23 volunteers, four controls were selected on the basis of age, sex, and bmi. we explained the purpose and methods of the study, and informed consent was obtained from all parents. for this 24-hr study, all subjects were admitted to the pediatric ward at the samsung medical center ; they ate a standard hospital diet [meals served at 7:30 am, 12:00 pm, and 18:00 pm, total calories 2100 calories consisting of 60% carbohydrate (310 g), 20% protein (100 g) and 20% fat (50 g) ] and were allowed to sleep (lights - off) between 11:00 pm and 7:00 am. during the remainder of the day, lights were on and sleeping and snacking were not allowed. blood was drawn to measure hormones through an indwelling venous cannula and was collected in edta and sst tubes every hour for 24 hr without the addition of aprotinin. after taking a baseline sample, which was collected at 7:00 am before breakfast, a total of 23 additional samples were collected at hourly intervals from each patient. samples were stored at 4 during the collection period, centrifuged for plasma within two hours of collection, and stored at -70 until assayed. plasma immunoreactive ghrelin was measured in duplicate using a commercial elisa kit (phoenix pharmaceuticals, belmont, ca) ; the inter- and intra - assay coefficients of variance were < 10%. the lower and upper detection limits for this assay were 0.75 ng / ml and 100 ng / ml. plasma immunoreactive pyy was measured in duplicate using a commercial elisa kit (peninsula laboratories, inc.) ; inter- and intra - assay coefficients of variance were < 10%, and the assay detection range was 0 - 25 the antibody against human pyy(3 - 36) exhibited 100% cross - reactivity with full - length pyy. cck was measured by radioimmunoassay using synthetic cck8 (sulphated) [bachem ] as a standard, antibody code r7 (3) (final dilution 1:100,000) ; the intra - assay cvs were 8.2 and 6.6% at 5 ng / l and 15 ng / l, respectively, and the inter - assay cvs were 13.3 and 11.5% at 5 ng / l and 15 ng / l, respectively, with a lower detection limit of 1.5 ng / l. serum insulin was measured using a commercially available immunoradiometric assay kit (biosource europe s.a.) with a detection limit of 1 iu / ml and intra- and inter - assay coefficients of variation of < 10%. increments or decrements in areas under the curve (auc) for each hormone profile (from 7:00 am to 10:00 am) were calculated using the trapezoid method after subtracting the basal auc from the calculated auc, and mann - whitney test was used to compare them between the two groups. all statistical analyses were performed using sas version 8.2 (sas corporation, cary, nc). the pws and control groups did not differ significantly with respect to age, % of ideal body weight, bmi, bmi percentile, or in terms of percent body fat as determined by a dual energy absorptiometry (dexa). 1. repeated measures of anova of pyy levels showed no significant difference between the two groups (p=0.06). therefore, the pyy levels were similar in the two groups over 24 hr ; their pyy responses to meals were also similar, and increases in the auc of pyy after breakfast (7 am-10 am) were not significantly different in comparisons between pws (0.140.14 ng / ml3 hr) and controls (0.0080.18 repeated measures of anova of the cck profiles identified a significant difference between the two groups (p=0.0051) but without a significant group x time interaction (p=0.9311). these results indicate that the mean cck levels were elevated over 24 hr, but that the cck response to meals was not different in comparisons between the two groups. in addition, increments in auc of cck after breakfast (7 am-10 am) were not significantly different (table 2). we interpreted these results to mean that although there was an elevation in the mean cck levels over 24 hr, the cck response to meals was not significantly different in comparisons between the two groups. 3. the repeated measures of anova of the insulin levels demonstrated a significant difference between the two groups (p= 0.013), but there was no significant difference between the two in terms of grouptime interaction (p=0.85). these data show that insulin responses to meals were similar in the two groups ; however, the levels of insulin over 24 hr were relatively lower in the pws patients. increments in the auc of insulin after breakfast (7 am-10 am) were similar in the two groups (table 2). in addition, we measured the 24-hr ghrelin levels ; they were higher in pws than in controls (p=0.0007). however, no significant difference was found in terms of the grouptime interaction (p=0.89) or between decrements in the auc of ghrelin after breakfast (7 am-10 am, table 2). our results show that the response pattern of cck, pyy, insulin and ghrelin to meals in pws patients was not different from that of controls. in addition, we demonstrated that only insulin levels decreased (p=0.013), while the other hormone levels either increased or did not change. therefore, reduced mean levels of insulin as well as elevated mean levels of ghrelin were the major results in the pws patients. it has been repeatedly reported that plasma ghrelin is elevated in both adults and children with pws, which is in contrast to the ghrelin levels found in other causes of obesity, where ghrelin levels have been shown to be decreased (4, 22). based on rodent and human studies elevated ghrelin levels might be associated with an increase in appetite, (8 - 11) although the direct orexigenic effects of ghrelin, in its physiologic range, have not been demonstrated in rodents or humans. however, studies showing an increased appetite in pws are insufficient without an understanding of the effects of anorexigenic hormones ; this is because appetite is also negatively influenced by several hormones. thus, if anorexigenic hormones are reduced, the increased appetite associated with pws could be explained by another mechanism. thus, a single determination of hormone levels in a given day is not adequate for understanding appetite - related hormonal changes in pws. one report emphasized a significant increase in serum cck levels during meals in pws patients, indicating that a failure of peripheral cck release in response to food intake does not explain the impaired satiety response in pws (23) ; however, two additional reports did not find cck elevation in pws (24, 25). in our study, hourly cck monitoring data suggested that cck secretion in response to a meal was similar in pws patients and in controls. these results showed that in pws the failure of peripheral cck release, in response to food intake, can not explain the impaired satiety response. our data suggest that anorexigenic hormones may potentially influence the gastrointestinal tract peripherally and appetite centrally. recently, we reported that gastric emptying in pws was not elevated, and that actually it tended to be delayed, despite the presence of higher ghrelin levels, which generally promote gastric emptying (26). cck may potentially delay gastric emptying ; however, further evidence is needed to confirm this. reported that the gut hormone fragment peptide yy3 - 36 reduces appetite, food intake, and plasma ghrelin levels when infused into both normal weight and obese subjects (18, 27). endogenous pyy levels were depressed in obese subjects, and the fasting pyy levels were found to correlate negatively with bmi (26). moreover, plasma pyy levels in pws were reported to be lower than those of similarly aged individuals without pws ; however, other reports did not confirm this (28, 29). in the present study, we observed that these hormones fluctuate widely according to meal times ; however, we found no significant difference between the pws patients and controls in regard to the pyy levels. our data shows that pyy response to meals and basal pyy levels are similar in pws patients and normal controls ; this suggests that a failure to secrete pyy in response to food is not an explanation for the impaired satiety response observed in pws. our data are consistent with the recent observation that there is no deficiency of the anorexigenic intestinal hormone pyy in pws (29). as for insulin, we observed lower insulin levels in pws than in controls over the 24-hr monitoring period. this finding is consistent with previous reports, which found that insulin resistance is lower in pws subjects, and that insulin sensitivity is higher than in obese controls (30 - 33). unfortunately, we did not measure the 24-hr serum glucose profile, which is a limitation of this study. however, because fasting and post - prandial two - hour glucose levels were normal in all subjects and standard hospital diet was served to all of them, this limitation may not have influenced our results. recently, it was reported that deficits in insulin and glucagons, during fetal and postnatal life, are prominent findings in the tgpws deletion mouse model, and that a pancreatic defect may be the primary lesion (34). consistent with these findings is the presence of type 2 diabetes in pws, which may partly result from the lowered insulin levels observed compared to the expected levels for the degree of increased body mass index (35 - 37). in addition, this model showed that increased plasma ghrelin levels occurred in the postnatal tgpws mice and appeared to begin at the onset of severe hypoglycemia ; this suggests that the hyperghrelinemia, observed in pws, might be a physiological adaptive mechanism of increased eating in response to hypoglycemia (32). however, insulin alone is insufficient to lower the ghrelin levels to control levels, i.e., the ghrelin baseline in pws was almost always higher than in controls. therefore, elevated ghrelin levels may be explained by at least two mechanisms, i.e., by insufficient insulin levels and by an adaptive response to hypoglycemia during the postnatal period. however, the precise mechanism of hyperghrelinemia in pws remains to be determined. in conclusion, our results suggest that the response pattern of hormones to meals in pws patients parallels that of normal controls. in addition, a decrease of the insulin level over 24 hr, in spite of obesity and elevated ghrelin levels, suggests that the baseline insulin level, not the insulin response to meals, may be the important abnormality in pws. | prader - willi syndrome (pws) is a contiguous gene syndrome characterized by uncontrollable eating or hyperphagia. several studies have confirmed that plasma ghrelin levels are markedly elevated in pws adults and children. the study of anorexigenic hormones is of interest because of their regulation of appetite by negative signals. to study the pattern and response of the anorexigenic hormones such as cholecystokinin (cck) and peptide yy (pyy) to a meal in pws, we measured the plasma cck, pyy, ghrelin and serum insulin levels in pws patients (n=4) and in controls (n=4) hourly for a day, and analyzed hormone levels and hormonal responses to meals. repeated measures of anova of hormone levels demonstrated that only insulin levels decreased (p=0.013) and cck (p=0.005) and ghrelin (p=0.0007) increased in pws over 24 hr. however, no significant group x time interactions (ghrelin : p=0.89, cck : p=0.93, pyy : p=0.68 and insulin : p=0.85) were observed ; in addition, there were no differences in an assessment of a three - hour area under the curve after breakfast. these results suggest that the response pattern of hormones to meals in pws patients parallels that of normal controls. in addition, the decrease of insulin levels over 24 hr, in spite of obesity and elevated ghrelin levels, suggests that the baseline insulin level, not the insulin response to meals, may be abnormal in patients with pws. |
diabetes is fast becoming the epidemic of the 21 century. over the past 30 years, the status of diabetes has changed from being considered as a mild disorder of the elderly to one of the major causes of morbidity and mortality affecting the youth and middle - aged people. it is estimated that 20% of global burden of diabetes is in south east asian region (sear), which will triple to 228 million by the year 2025 from the current 84 million. world health organization (who) has projected the maximum increase in diabetes would occur in india. the international diabetes federation (idf) estimates the total number of diabetic subjects to be around 40.9 million in india and this is further set to rise to 69.9 million by the year 2025. according to the national urban diabetes survey, the prevalence of diabetes and pre - diabetes were 12.1% and 14%, respectively. the bangalore urban diabetes study revealed that direct and indirect costs of diabetes care for patients undergoing treatment that involved hospitalization were approximately us$ 850 per patient per year. the cost of care is high and comparable to costs in other countries, especially if one keeps in mind the purchasing power parity. the present study was conducted with the objective of determining the prevalence of diabetes and pre - diabetes in the urban slum of bangalore and also to assess the risk factors associated with the two conditions. this was a cross - sectional, community - based study among adults aged 35 years and above in four urban slums located in the central part of bangalore. screening was conducted by trained community health workers who conducted house to house visits for this purpose. written informed consent was taken from the participants in the local language and the study was approved by ethics committee of the art of living foundation. house to house survey of people above 35 years in all the four slums yielded 2075 persons (total population 6127). people were eligible if they had been residing the study area for at least 2 years. three house visits were made in case the eligible participants were not available on the first visit. participants who refused to participate or those who could not be contacted despite three house visits were taken as non - responders. the information collection proforma contained details about the socio demographic factors, morbidity profile and anthropometric measurements. social class was defined using standard of living index score described by parasuraman. participants were considered as tobacco user if they consumed any form of tobacco daily and as alcoholics if they consumed any form of alcoholic drink one or more times per day. psychosocial stress was coded as yes if the study subjects reported that feeling sad, blue, or depressed for 2 weeks or more in a row during the past 12 months. physical activity was categorized as sedentary, moderate and heavy depending on activity at the work place or at home and during leisure time. blood sugar was measured using a free style optium glucometer (glucometer was standardized cross checking laboratory result) and blood pressure measurement was conducted using a omron digital machine in the sitting position. height and weight measurement, hip circumference, waist circumference were measured using standard techniques. the prevalence of diabetes was defined to include all individuals with known diabetes and those in whom grbs (glucometer random blood sugar) was 200 mg / dl and fasting glucose 126 mg / dl. pre - diabetics included those with grbs between 140 and 199 mg / dl and fasting glucose between 100 and 125 mg / dl (ada recommendation). hypertensive subjects were defined as those with known hypertension or with two average systolic bp readings > 140 mmhg and/or diastolic bp > 90 mmhg (two readings measured 15 min duration apart) (jnc). body mass index (bmi) of all the participants was calculated using quetlet 's index (weight in kilograms / height in meters). based on bmi participants were categorized into undernourished (bmi 30 kg / m). a waist circumference of > 80 cm in females and 90 cm for males was considered as abnormal. participants who were diagnosed with diabetes and hypertension were referred to the project clinic which was conducted in the project area once in a month. after the interview participants were educated on symptoms, complications, treatment and prevention of diabetes using the flip chart. the collected data were alphabetically and numerically coded and entered in microsoft excel 2007 and statistical analysis was done in ssps version 19.0. socio - demographic variables, morbidity profile and risk factor data were analyzed using descriptive statistics like frequencies, mean and standard deviation. chi - square test of association or fishers exact probability test was used as applicable to assess the association between diabetes / pre - diabetes and associated variables. variables which exhibited a statistically significant association on univariate analysis were entered into a multiple logistic regression model with the presence of diabetes / pre - diabetes as the dependent variable and the associated variables as the independent variables. a p value of 25 (= 5.971, p<0.05). hypertension was the most common co - morbidity and was seen in 44.9% (155 subjects) of the diabetics. people who consumed < 2 serving of vegetable per day had higher prevalence of diabetes (= 6.541, p<0.05) and its association was statistically significant. people who consumed fish more than once a week had higher prevalence of pre - diabetes (= 7.895, p<0.05) and people who consumed egg more than once a week had higher prevalence of diabetes (= 8.971, p<0.05). consumption of other food items like green leafy vegetable, fruits, salty food, sweets, red meat, chicken, deep fried food, bakery items and carbonated drink was not associated with prevalence of diabetes and pre - diabetes. association of various risk factors pre diabetes and diabetes (n=2013) we did a multivariate analysis to compute the adjusted odd ratios for the different risk factors. our analysis revealed the odds of developing pre - diabetes were 1.4 times more among those who were above the age of 45 years and 1.5 times more in those who were physically inactive. unadjusted and adjusted odd ratios for risk factors of diabetes and pre - diabetes multivariate analysis for the risk factors of diabetes reveled age greater than 45 years [or 3.3 (2.4 - 4.6) ] and the presence of central obesity [or 2.4 (1.8 - 3.3) ] to be the prominent risk factors for diabetes. other risk factors that showed significant odds ratio were female gender [or 1.6 (1.2 - 2.2) ], family history of diabetes [or 1.9 (1.3 - 2.0) ] and physical inactivity [or 1.4 (1.1 - 1.9) ]. our study found the prevalence of diabetes and pre - diabetes among adults aged 35 years and above in the slums of bangalore to be 12.33% and 11.57%, respectively. studies from india have reported a prevalence of diabetes to be 13% to 16% and prevalence of pre - diabetes to be between 2 - 29%, which is similar to the findings in our study. the results of our study show a higher prevalence of diabetes and pre - diabetes among females. this is probably explained by the fact that females were more sedentary in their habits and the prevalence of obesity including central obesity was more in females. earlier reports from chennai had shown a male preponderance in the prevalence of diabetes which in subsequent years had shifted slightly toward a female excess. in the present study, family history was present in 14.06% of diabetes subjects and 12.01% of pre - diabetes subjects and its association with diabetes was significant and not with pre - diabetes. in a study conducted in slums of mumbai, 18.2% subjects had a family history of diabetes. studies have shown that the genetic factor plays an important role in the causation of diabetes. in our study, hypertension was seen as co - morbidity in 155 diabetics (44.9%) and co - prevalence of both diabetes and hypertension was 7.7%. several studies have shown a close association between diabetes and hypertension. in a study conducted in manipur about 13.8% had both diabetes and hypertension which was much high than our study. in a study in france, marre. reported hypertension in almost one third of diabetic cases. among adult afro - americans, elevation of blood pressure is significantly higher in individuals with impaired glucose tolerance and diabetics than in non - diabetics. the occurrence of hypertension in diabetic patients significantly increases the risk of coronary artery disease, mortality and nephropathy. prevalence of tobacco use was 14.7% and alcohol use 13.1% in the present study which is low compared to earlier reports. the reason for this could be that subjects denied tobacco and alcohol use in the presence of other family members. an association between alcohol and diabetes has been documented by many authors with a non - linear relationship between alcohol intake and the risk of type 2 diabetes. levitt., on the other hand, reported that alcohol intake was not a significant risk factor for dm in south africa. vashitha. in a study of rural population of haryana reported that smoking and alcohol use were not found to be a risk predictor of diabetes mellitus. chida. in a study reported association of psychosocial factor with the prognosis of diabetes and as etiological effect was inclusive. another study on working women reported psychosocial work stress as independent predictor of type 2 diabetes among women after a 15-year follow - up. the present study shows no significant association of psychosocial stress with diabetes and pre - diabetes. our study showed a significant association of physical inactivity with diabetes and pre - diabetes which is in line with the several other studies. in our study prevalence of overweight and obesity was 66.81 (overweight 17.23 and obese 49.57%), which was higher than in previous studies with prevalence of diabetes and pre- diabetes among these subjects being 23.34% and 12.49%. subjects with increased bmi showed increase prevalence of diabetes and the association was statistically significant. overall prevalence of central obesity in our study was 73.02% (male 72.42% and female 73.60%). prevalence of pre - diabetes in male and female was 9.48% and 6.37%, respectively. higher prevalence of pre - diabetes was seen in male and diabetes was seen in females. a study conducted in punjab showed prevalence of 14.6% diabetes with central obesity. in our study larger proportion of the subjects had higher waist hip ratio (73.02%) compared to increased bmi (66.8%). ramachandran. had shown susceptibility of urban indians to central obesity in national urban diabetes survey. studies in india had shown that central obesity was more strongly associated with pre - diabetes than general obesity. lean asian indians had whr values similar to the mexicans with higher rates of bmi. this could indicate that asian indians have a predisposition to deposit abdominal fat which could be one of the risk factor s contributing to the high prevalence of diabetes. studies in uk and in the usa have shown that asian indians were insulin resistant despite having bmis in the non - obese range, an observation which could probably be related to a high percentage of visceral fat. the higher prevalence of diabetes in asian indians than in the white population might be partly related to the above feature. in our study consumption of vegetables and egg had a significant association with diabetes and fish with pre - diabetes. many studies have shown and discussed the uses of consuming high water soluble fiber (vegetable and fruits) and polyunsaturated fat (fish) in the control of diabetes and prevention of diabetes. viscous and gel - forming properties of soluble dietary fiber inhibit macronutrient absorption, reduce postprandial glucose response, and beneficially influence certain blood lipids. dietary fibers consumption contributes to a number of unexpected metabolic effects independent of changes in body weight, which include improvement of insulin sensitivity, modulation of the secretion of certain gut hormones, and effects on various metabolic and inflammatory markers that are associated with the metabolic syndrome. people who consumed fried fish more than once a week had higher prevalence of pre - diabetes. polyunsaturated fatty acids (omega-3fats found in fish and flaxseed, pumpkin seed, canola, soy, and walnuts) appear to reduce the risk of diabetes while trans - fatty acids were responsible for the increase in incidence. increased prevalence of diabetes in india has a lot to do with a switch from a traditional to a western diet. eating fiber - rich foods gives a sense of fullness. eating a lot of refined carbohydrates such as soft drinks and candy bars or or even pretzels and crackers leads to feeding a vicious circle in body that never really satisfies hunger because one gets only short - term relief. only few readings were taken in the fasting and all the others were random blood sugar. prevalence of diabetes and pre - diabetes was comparable to data from other part of the country and the association of risk factors was also similar to the previous studies. increasing age, female gender, family history of diabetes, physical inactivity and central obesity emerged as the major risk factors for diabetes in our study. | background : to determine the prevalence of diabetes and pre - diabetes and to assess the risk factors associated with diabetes and pre - diabetes in the urban slums of bangalore.materials and methods : a cross - sectional study was conducted in four slums of bangalore in the age group of 35 years and above comprising of total 2013 subjects. risk factors like age, sex, family history, behavior, physical activity, bmi, waist hip ration, diet habits were assessed to find their association with diabetes.results:prevalence of diabetes was 12.33% and of pre - diabetes was 11.57%. prevalence was more among the females compared to males. increasing age, over weight and obesity, sedentary life style, tobacco consumption, diet habits showed statistically significant association with prevalence of diabetes and pre-diabetes.conclusion:physical activity like regular exercises both at the office and at home, fibers - rich diet, blood sugar estimation after 35 years are some of the recommendations which can control diabetes. |
the liver has an important role in lipid metabolism, which includes the mobilization and synthesis of free fatty acids as well as the storage and export of lipids and lipoproteins. various drugs, nutritional factors, and genetic defects in energy metabolism can result in excess hepatic triacylglycerol accumulation (hepatic steatosis). hepatic steatosis can be a benign condition, or it may evolve with inflammation (steatohepatitis), fibrosis, and cirrhosis, an altered spectrum termed nonalcoholic fatty liver disease (nafld). insulin resistance is a condition wherein higher than normal insulin levels are needed to provoke normal metabolic responses or where normal metabolic responses are not achieved with normal insulin concentrations. depending on the primary site of involvement, the insulin resistance can be central (liver) or peripheral (muscle or fat tissue). in nafld, the initial site appears to be in the periphery, followed by or resulting in hepatic steatosis, which exacerbates hepatic insulin resistance and thus the degree of overall insulin resistance. peripheral insulin resistance increases the serum levels of free fatty acids derived from the lipolysis of triacylglycerol from white adipose tissue ; these fatty acids are taken up by the liver and used in the production of triacylglycerol. in addition, chronic hyperinsulinemia resulting from overall insulin resistance promotes de novo hepatic lipogenesis through the upregulation of lipogenic transcription factors. a transcription factor that participates in the development of fatty liver in rodents is srebp-1c (sterol regulatory element - binding protein-1c). in the nucleus, peroxisome proliferator - activated receptor gamma (ppar) is another transcription factor involved in the development of hepatic steatosis in rodents. in the liver, ppar is usually expressed at very low levels, but its expression is markedly increased in animal models exhibiting insulin resistance and fatty livers. increases in oxidative stress and in factors that promote proinflammatory cytokine expression, such as interleukin (il)-6 and tumor necrosis factor- (tnf), are implicated in the development of nonalcoholic steatohepatitis (nash), with the nuclear factor kappa b (nf-b) playing a critical role in the modulation of proinflammatory transcription. moreover, several studies have documented the association of insulin resistance (liver and adipose tissue) with inflammation. protein restriction is associated with hepatic steatosis. in our laboratory, we have studied an experimental model of protein restriction in early life that demonstrates deficits in insulin secretion and liver insulin resistance in adulthood. we use soybean flour diets as an alternative low - cost and high - quality protein source to feed these animals in an attempt to prevent and/or to treat the long - term consequences of malnutrition. this choice was motivated by scientific evidence showing that the consumption of soy protein and isoflavones may exert beneficial effects on glucoregulation, lipotoxicity in the liver, and lipidemia by acting on a wide spectrum of biochemical and molecular activities [21, 22 ]. interestingly, we observed that serum insulin concentrations were increased in animals reared on a soybean diet, but alterations occurred in the early steps of the hepatic insulin signal transduction pathway, indicating hepatic insulin resistance [23, 24 ]. moreover, the weight and lipid content of the white adipose tissue as well as the lipolysis rate by isoproterenol in white adipocytes were decreased in rats fed the soybean diet. thus, the aim of this study was to investigate the effects of nutritional recovery after weaning with a soybean flour diet on de novo hepatic lipogenesis and inflammation in adult rats exposed to protein restriction during intrauterine life and lactation. the experimental procedures involving rats were performed in accordance with the guidelines of the brazilian college for animal experimentation (cobea) and were approved by the ethics committee at the federal university of mato grosso. male and virgin female wistar rats (8590 days old) were obtained from the university 's own breeding colony. mating was performed by housing males with females overnight (1 male and 4 females), and pregnancy was confirmed by the presence of sperm in vaginal smears. pregnant females were separated at random and maintained from the first day of pregnancy until the end of lactation on isocaloric diets containing 6% (low protein (lp) diet, n = 6) or 17% (control (c) diet, n = 8) protein. spontaneous delivery occurred at day 22 of pregnancy, after which, at 3 days of age, large litters were reduced to eight pups to ensure a standard litter size per mother. after weaning in the 4th week, the males were divided into five groups : cc, consisting of offspring born to and suckled by mothers fed a c diet and subsequently fed the same diet after weaning until 90 days of age ; cs, consisting of offspring born to and suckled by mothers fed a c diet and subsequently fed a soybean flour diet with 17% protein after weaning until 90 days of age ; ll, consisting of offspring born to mothers fed an lp diet and subsequently fed the same diet after weaning until 90 days of age ; lc, consisting of offspring born to mothers fed an lp diet and subsequently fed a c diet after weaning until 90 days of age ; and ls, consisting of offspring born to mothers fed an lp diet and subsequently fed a soybean flour diet containing 17% protein after weaning until 90 days of age. the diets have been previously described [23, 26 ]. throughout the experimental period, the homeostasis model assessment of insulin resistance (homa - ir) index was assessed from the basal glucose and insulin concentrations using the following formula : basal glucose (mmol / l) basal insulin (u / ml)/22.5. fed rats were euthanized, and liver tissue samples were quickly removed, frozen immediately in liquid nitrogen, and stored at 80c to determine malic enzyme (me) and citrate lyase (cly) activities ; hepatic fat content ; and nsrebp-1c (nuclear sterol regulatory element - binding protein-1c), ppar, me, cly, tnf, nf-b, and il-10 expression levels by immunoblotting. the mrna expression levels of tnf, il-6, il-10, and nf-b were determined by real - time pcr. liver samples were obtained for in vivo lipogenesis measurements from another group of rats in the fed state. blood glucose concentrations were determined using a portable glucose meter (accu - chek, roche diagnostics, mannheim, germany). after euthanasia, aliquots of serum obtained by centrifugation were used to measure total serum protein, serum triacylglycerol, and hepatic aminotransferase concentrations (bt-3000 plus, wiener lab, rosario, argentina). me activity was assayed by the method of ochoa in accordance with the modifications proposed by hsu and lardy. h2o (3 mci) dissolved in 0.3 ml saline was administered to anesthetized rats by intraperitoneal injection 1 h before the experiment. h2o was removed from the inferior phase (predominantly chloroform) by washing three times with a superior - phase mixture. after each shaking, the tubes were briefly centrifuged to sharpen the phase boundary, and the superior phase was aspirated and discarded. isolation and counting of h2o - labeled fatty acids from the inferior phase was performed as previously described. for the calculations of lipid synthesis in experiments with h2o, it was assumed that the specific activity of intracellular water was identical to that of plasma water, which was determined directly in aliquots of diluted (20 times) plasma. the rates of tissue lipid synthesis were calculated assuming that each fatty acid incorporated into triacylglycerol contained 13.3 atoms of tritium. all sections were coded and analyzed blindly by the pathologist without knowledge of related characteristics or diet. the degree of fat accumulation was graded on a scale of 0 to 4 as follows : 0 = no evidence of or barely visible microvesicular fat ; 1 + = 75% of the lobule. one frozen liver fragment was homogenized in freshly prepared buffer (1% triton x-100, 100 mmol / l tris - hcl (ph 7.4), 100 mmol / l sodium pyrophosphate, 100 mmol / l sodium fluoride, 10 mmol / l edta, 10 mmol / l sodium orthovanadate, 2.0 mmol / l pmsf, and 0.1 mg aprotinin / ml). insoluble material was removed by centrifugation for 20 min at 12000 g at 4c. samples containing 40 g of protein from each experimental group were incubated with 4x concentrated laemmli sample buffer and 15 mg of dtt and assayed on polyacrylamide gels at 120 v for 90 min (10% gels for me and cly). the electrotransfer of proteins to nitrocellulose membranes (bio - rad) was per formed for 90 min at 120 v in buffer containing methanol and sds. after ascertaining transfer efficiency by ponceau staining, the membranes were blocked with 5% albumin in tween - tris buffered saline (ttbs) (10 mmol / l tris, 150 mmol / l nacl, 0.5% tween 20) overnight at 4c. me, cly, tnf, nf-b, and il-10 were detected in the membranes after a 2 h incubation at room temperature with anti - me1 rabbit monoclonal igg (sigma - aldrich, st. louis, mo, usa), anti - cly polyclonal igg (cell signaling technology inc., usa), anti - tnf rabbit polyclonal igg, anti - nf-b mouse monoclonal igg, or anti - il-10 goat polyclonal igg (santa cruz biotechnology, usa) diluted 1 : 500 in ttbs containing 3% dry albumin. enhanced chemiluminescence was performed (supersignal west pico, pierce) after incubation with the appropriate horseradish peroxidase - conjugated secondary antibody. nuclear extracts (20 g) were separated by sds - page in 10% gels according to milanski.. the membranes were blocked with 5% skim milk in tween - tris - buffered saline (ttbs) (10 mmol / l tris, 150 mmol / l nacl, 0.5% tween 20) overnight at 4c. nsrebp-1c and ppar were detected in the membranes after a 2 h incubation at room temperature with anti - srebp-1c rabbit polyclonal igg and anti - ppar mouse polyclonal igg (santa cruz biotechnology ; diluted 1 : 500 in ttbs containing 3% dry skimmed milk). histone was used as a marker of the subcellular fraction and a protein loading marker. enhanced chemiluminescence was performed (super signal west pico, pierce) after incubation with the appropriate horseradish peroxidase - conjugated secondary antibody. total rna was isolated from frozen liver samples by trizol reagent (invitrogen, usa), according to the supplier 's instructions. three micrograms of total rna were transcribed into cdna with high capacity reverse transcriptase (applied biosystems). primers specific for rat tnf (rn00563005_m1), il-6 (rn99999011_m1), il-10 (rn00563409_m1), nf-b (rn01399583_m1), and glyceraldehyde-3-phosphate dehydrogenase (gapdh) (rn01775763_g1) were obtained from applied biosystems. pcr was carried out in duplicate on a step one system using taqman gene expression master mix (applied biosystems). the cdna was amplified under the following conditions : 95c for 10 min for denaturation and then 40 cycles of 95c for 15 s, 60c for 20 s, and 72c for 15 s, followed by extension at 72c for 10 min. real - time data were analyzed using the step one system (applied biosystems). the results are expressed as the means with their respective standard deviations for the number of rats indicated in parentheses. bartlett 's test for the homogeneity of variances was initially used to determine whether the data complied with the assumptions necessary for a parametric anova. when necessary, the data were log transformed to correct for variance in heterogeneity or nonnormality. a two - way anova (i.e., effects of nutritional status in early life and diet) was used to compare the data from the cc, cs, lc, and ls groups. a one - way anova was used to assess whether the diets were effective at improving the nutritional status of the lc, ls, and ll groups. when necessary, these analyses were complemented by the least significant difference test to determine the significance of the individual differences. all statistical comparisons were conducted using the statistica software package (stat - soft). at the beginning of the recovery phase, lc, ls, and ll rats had similar body weights, and in all cases, these were significantly lower than those of the cc and cs rats. body weight at the end of the experimental period was significantly lower in the lc and ls groups than in the cc and cs groups (p < 0.001). rats maintained on a soybean flour diet after weaning (ls and cs groups) had a lower final body weight than those fed a casein diet (lc and cc groups) (p < 0.001). although ls rats reached a higher final body weight than ll rats (p < 0.001), their weights were still significantly lower than those of lc rats (p < 0.001). total serum protein concentrations did not differ among the cc, cs, lc, and ls groups. the ls and lc rats had higher total serum protein levels than rats from the ll group (p < 0.05). serum triacylglycerol levels were higher in the lc group than in the ls, cs, and cc groups. in the ls group, serum triacylglycerol concentrations were lower relative to those of lc rats but did not differ from those exhibited by the ll rats. serum insulin concentrations were higher in rats fed a soybean diet (cs and ls groups) than in rats fed a casein diet (cc and lc groups) (p < 0.0001). the homa - ir index was higher in rats fed a soybean diet than in those reared on casein (p < 0.0001). similar glycemia levels, but higher insulinemia and homa - ir indices, were recorded in ls rats relative to the ll and lc groups. there was no difference in homa - ir index or serum insulin concentrations between the ll and lc groups. serum levels of alanine aminotransferase (alt) were higher in the ls and lc groups than in the cs and cc groups (p < 0.01) and in rats maintained on a soybean diet (ls and cs rats) relative to those fed a casein diet (lc and cc rats) (p < 0.05). there was no difference in alt levels between the ll, ls, and lc groups. levels of serum gamma - glutamyl - transpeptidase (gt) in the ls group were significantly higher than those of the cs group but similar to those of the cc and lc groups. the ls rats had significantly higher gt levels than the ll rats, but they were similar to those of the lc group. alkaline phosphatase (alp) levels were significantly higher in the ls and lc groups than in the cs and cc groups (p < 0.01). the ls and lc groups showed alp concentrations that were similar to each other and significantly lower than those observed in the ll group (table 1). hepatocellular lipid accumulation (steatosis) was assessed in liver sections using the conventional hematoxylin - eosin staining technique (figure 1(a)). liver histology revealed that rats fed a soybean diet did not show an abnormal accumulation of fat in their livers because 100% of liver specimens from the ls and cs groups were graded as 0. in the lc group, 60% of liver specimens were graded as 0 and 40% as 1 or 2, whereas in the cc group, 80% were graded 1 or 2 and 20% as 3 or 4. in the ll group, 60% were graded 1 or 2 and 40% as 3 or 4 (figure 1(b)). the hepatic fat content (figure 1(c)) was reduced in rats fed a soybean diet (ls and cs groups) compared with rats fed a casein diet (lc and cc groups) (p < 0.001). moreover, rats fed the soybean flour diet (cs and ls groups) exhibited lower fatty acid synthesis rates compared with those fed the casein diet (cc and lc rats) (p < 0.001). the fatty acid synthesis rate in the ls group was lower than that of the ll group and similar to that observed in the lc group (figure 1(d)). nsrebp-1c protein levels were similar across the cs, cc, ls, and lc groups. however, the ls and lc groups showed significantly higher nsrebp-1c than the ll group (figure 2(a)). rats fed the soybean diet (cs and ls groups) had lower nppar levels than those fed the casein diet (cc and lc groups) (p < 0.05). there was no difference in nppar levels among the ll, ls, and lc groups (figure 2(b)). liver me and cly contents were significantly lower in rats fed the soybean diet (cs and ls groups) relative to those fed the casein diet (cc and cs groups) (p < 0.05 and p < 0.01, resp.). livers from the ls group also exhibited lower me and cly contents than livers from the ll and lc groups (figures 3(a) and 3(b)). the cs and ls groups showed lower me and cly activities compared with the cc and lc groups (p < 0.05 and p < 0.01, resp.). moreover, me and cly activities were lower in the ls rats than in the lc rats, and these activities were significantly lower in both groups relative to the ll rats (figures 3(c) and 3(d)). mrna levels of nf-b (figure 4(a)) and il-6 (figure 4(b)) were significantly reduced in the lc and ls groups relative to the cc and cs groups (p < 0.0001 ; p < 0.005). no difference was observed in the nf-b and il-6 mrna expression among the lc, ls, and ll groups. tnf mrna levels (figure 4(c)) were significantly higher in rats fed the soybean diet (ls and cs groups) than in those fed casein (lc and cc groups) (p < 0.01). the tnf mrna levels of the ls group were similar to those of the lc group and higher relative to the ll group (p < 0.05). il-10 mrna expression (figure 4(d)) was not significantly different among the cc, cs, lc, and ls groups. however, the ls group exhibited significantly higher il-10 mrna expression than that observed in the ll and lc groups (p < 0.01). nf-b (figure 5(a)) and il-10 (figure 5(b)) protein levels did not differ among the cc, cs, lc, and ls groups. however, ls and lc rats exhibited higher nf-b protein levels than ll rats. tnf protein levels were higher in the cs and ls groups than in the cc and lc groups (p < 0.05), but no difference in tnf levels was observed among the ll, ls, and lc groups (figure 5(c)). in this study, rats recovered with the soybean diet showed low body weight and normalization of serum triacylglycerol concentrations, corroborating the well - known favorable effect of soy protein containing various levels of isoflavones on somatic parameters [39, 40 ] and serum triacylglycerol levels [41, 42 ]. however, contrary to the observations that soy protein reduces serum insulin levels [42, 43 ], we verify here, as in previous studies [23, 24, 26 ], that the consumption of a soybean flour diet increased serum insulin concentrations. this effect may be attributable to genistein, which increases insulin secretion due to its ability to activate the camp - pka pathway. interestingly, our animals fed with soybean protein showed low liver fat content (assessed by gravimetric and histologic assays) and liver insulin resistance as determined by the homa - ir index and confirmed by high serum alt concentrations (a hepatic enzyme whose appearance reflects hepatic insulin resistance and nafld). it is also noteworthy that abundant lipid droplets (observed histologically) as well as elevated liver fat contents were observed in the rats from the cc group. hepatic steatosis has also been reported by others, who attributed this effect to the elevated amounts of carbohydrates and calories provided by the ain-93 diet. however, the cc rats exhibited homa - ir index values and serum alt concentrations not compatible with metabolic alterations or hepatocellular injury. moreover, although liver fat contents appeared to be comparable between the cc and ll groups, twice as many liver specimens from the ll group were graded as 3 or 4. liver insulin resistance results in the overexpression of srebp-1c, whereas soy protein and genistein suppress the srebp-1c levels. thus, in this and in a previous study, the interplay between liver insulin resistance, which induces srebp-1c overexpression, and other factors (e.g., genistein and soy protein) that suppress its expression resulted in no change in nsrebp-1c contents or srebp-1c mrna expression. an adequate explanation for the paradoxical association of liver insulin resistance with unmodified nsrebp-1c concentrations is the mild hyperinsulinemia and the euglycemia observed in our animals fed with soybean, as noted here and previously. srebp-1c expression has been shown to be stimulated by glucose and insulin and repressed by glucagon [9, 10, 48 ]. interestingly, the repression of srebp-1c expression by soy protein has been attributed to decreased insulin : glucagon ratios. in our animals, we previously observed reduced insulin : glucagon ratios in lc and ll rats compared with ls rats. in that prior study, we observed that both the lc and ll groups exhibited lower serum insulin concentrations, lower liver insulin resistance, and basal glucose concentrations that were similar to those of ls rats. surprisingly, only ll rats exhibited low nsrebp-1c levels, but ll and lc rats had similar liver fat storage levels, and both had higher liver fat content than ls rats. in contrast, we observed that the soybean diet resulted in reduced expression of ppar, which targets the me and cly genes [49, 50 ]. in agreement with this finding and with the observation that soy protein reduces the expression of me, we verified low contents of both me and cly in liver samples from rats fed the soybean diet. interestingly, studies have shown that the genetic deletion of ppar in the livers of lipodystrophic transgenic mice markedly attenuates the development of nafld, independent of the presence of hyperinsulinemia or hyperglycemia [50, 51 ]. liver fat storage is also regulated by the integrated activities of cellular enzymes that catalyze lipid synthesis. insulin acts as a key regulator of triglyceride biosynthesis in the liver by modulating enzymatic activities involved in the synthesis of fatty acids. in this study, both cly and me activities were reduced, and consequently, a decrease in de novo lipogenesis was observed in rats fed with soybean. it is well known that soy protein reduces me activity in the liver ; however, in contrast to our observations, this suppressive effect was accompanied by low serum insulin concentrations and a reduced insulin : glucagon ratio. in contrast to the animals fed soybean, in rats maintained on a low - protein diet, cly and me activity levels were elevated, resulting in an increase in the rate of de novo fatty acid synthesis, despite low levels of serum insulin. two factors may have contributed to the increased activities of these enzymes : an increased sensitivity to insulin and the high carbohydrate levels of the low - protein diet. some lines of evidence suggest that cly and me activity is stimulated by insulin and high carbohydrate intake [52, 53 ]. thus, the high cly and me activity levels appeared to determine the elevated rate of de novo fatty acid synthesis in the livers of rats from the ll group. curiously, the animals that were fed a soybean diet did not exhibit lipid accumulation in hepatocytes but did have high serum alt concentrations, a marker of liver injury. a potential induction factor for the hepatocellular injury and fibrosis observed in nafld is oxidative stress. it has been shown that chronic genistein supplementation at more than 500 mg / kg / day adversely affects liver structure and function. moreover, genistein increases the level and activity of ppar [22, 56 ], which, in the liver, plays a pivotal role in fatty acid catabolism by upregulating the expression of numerous genes involved in mitochondrial and peroxisomal fatty acid oxidation. consequently, activation of ppar can prevent and decrease hepatic fat storage, but the oxidation of fatty acids remains an important source of reactive oxygen species (ros) in fatty livers. this hypothesis is weakened by the fact that the amount of genistein contained in our diet was determined to be lower than 500 mg / kg body weight / day, yet our soybean - fed animals exhibited reduced ppar mrna expression and unchanged ppar protein contents in the liver. however, these animals also exhibited reduced expression of liver acetyl - coenzyme a carboxylase beta (acc), an enzyme localized in the mitochondrial membrane, where it is believed to regulate local malonyl - coenzyme a levels, carnitine palmitoyltransferase i (cpt-1) activity, and fat oxidation. the lack of acc is associated with continuous fatty acid oxidation and reduced fat storage. we also previously observed a reduction in nonprotein thiol levels in the livers of soybean - treated animals, indicating the consumption of nonprotein thiols by enhanced free radical generation (unpublished data). hence, elevated alt may reflect inflammation, which impairs insulin signaling in the liver. however, alt is also a gluconeogenic enzyme, and increased alt levels could therefore indicate impaired insulin signaling instead of liver injury. in our rats that were fed the soybean diet, the increased alt, combined with high tnf mrna and protein levels, is consistent with inflammation. however, the unchanged nf-b expression in livers from these soybean - fed rats is indicative of the absence of fibrosis because nf-b is considered a profibrotic marker. the rats that were rescued from malnutrition in early life showed reduced transcription of nf-b and il-6 and increased transcription of il-10 (an anti - inflammatory cytokine). however, neither nf-b nor il-10 protein levels were altered under these conditions. given the elevated tnf content, it is reasonable to suggest that the soybean diet increased nf-b activity. interestingly, in the livers of rats maintained on the soybean diet, the expression of tnf was correlated with the homa - ir index, confirming the role of this cytokine in the development of hepatic insulin resistance. in conclusion, the present study showed that a soybean diet prevented steatosis at least in part through reduced lipogenesis but resulted in tnf-mediated inflammation. | we evaluated the effects of postweaning nutritional recovery with a soybean flour diet on de novo hepatic lipogenesis and inflammation in adult rats exposed to protein restriction during intrauterine life and lactation. rats from mothers fed with protein (casein) in a percentage of 17% (control, c) or 6% (low, l) during pregnancy and lactation were fed with diet that contained 17% casein (cc and lc groups, resp.) or soybean (cs and ls groups, resp.) after weaning until 90 days of age. ls and cs rats had low body weight, normal basal serum triglyceride levels, increased alt concentrations, and high homa - ir indices compared with lc and cc rats. the soybean diet reduced ppar as well as malic enzyme and citrate lyase contents and activities. the lipogenesis rate and liver fat content were lower in ls and cs rats relative to lc and cc rats. tnf mrna and protein levels were higher in ls and cs rats than in lc and cc rats. nf-b mrna levels were lower in the lc and ls groups compared with the cc and lc groups. thus, the soybean diet prevented hepatic steatosis at least in part through reduced lipogenesis but resulted in tnf-mediated inflammation. |
the binding of igg fc to cell surface and soluble serum ligands triggers a variety of immunological processes including phagocytosis, cytotoxicity, inflammation, and immunosuppression. the structure of the fc domain is stabilized by the n - linked glycan, attached to asn297 of each igg heavy chain. this glycan is critical for fc function : genetic or enzymatic removal leads to an almost complete loss of antibody effector functions. moreover, composition of the glycan is a key parameter in determining the balance between pro - inflammatory or anti - inflammatory effects. for example, removal of the core 1,6-linked fucose residue of the igg1 fc glycan enhances binding for fcriiia, while elevation of the levels of terminal 2,6-sialylation leads to decreased natural killer cell activation and other potent cell - mediated immunosuppressive effects. in addition to natural variations in fc glycosylation, a growing number of enriched and engineered fc glycoforms are finding application in therapeutic monoclonal antibodies when a particular balance of effector functions is desirable. the three - dimensional structure of the fc glycoforms has been investigated as have the independent effects of glycan and protein engineering on receptor binding. by comparison, however, relatively little is known about the interdependence of glycan composition and protein structure on receptor binding. the n - linked glycans in igg1 fc are complex, mostly core - fucosylated, biantennary - type structures with varying amounts of bisecting glcnac, terminal galactose, and sialic acid residues. levels of sialylation are low with < 10% of total fc glycans from serum igg being sialylated. tri- or tetra - antennary glycans are generally not found in serum igg fc. the absence of larger, branched, and/or sialylated structures is notable, especially when compared to the glycosylation of other serum or cell - surface glycoproteins. x - ray crystallographic and nmr studies of the igg fc domain have defined the conformation of the n - linked glycans at asn297. in the complex - type igg fc glycoforms, the conformation of the oligosaccharide is well conserved and contacts over 500 of the surface of each c2 domains. the six arms of the glycan chain makes several stable interactions with hydrophobic amino acid residues of the c2 domain. the terminal gal6 (see legend to figure 1 for terminology) on the six arm has been shown to restrict glycan flexibility through interaction with the fc protein backbone. key amino acid residues that interact with the 6-arm glycans through hydrogen bonds and hydrophobic interactions include : phe241, phe243, val262, val264, asp265, lys246, and arg301. aromatic rings of phe241 and phe243 form ch interactions with the glcnac2 and glcnac5 residues of the fc glycan and contribute to the stability of the fc domain. the three arm on the other hand makes fewer contacts with the protein backbone with hydrophobic interactions between man4 and lys334 being the only observable protein glycan interaction. while the presence of extensive protein glycan interactions suggests a relatively immobile carbohydrate conformation and reduced enzymatic processing, recent nmr spectroscopic studies indicate a more dynamic and mobile role for the fc glycans. nonetheless, the relatively limited processing of the fc glycan indicates a reduced accessibility to glycan reactive enzymes in the golgi apparatus. mass spectrometric analysis of n - glycans released from igg fc - f241a. (b) the data from panel a were processed with the maximum entropy 3 function of masslynx to convert multiply charged ions to singly charged ions. the position of the fucose residue in the triantennary glycans was not determined. the ion at m / z 3169 gave a composition corresponding to the tetrasialylated triantennary glycan, but this was not confirmed by fragmentation. (c) an example of negative ion collision - induced dissociation spectrum of the monosialylated, fucosylated biantennary glycan. (d) spectra showing trigalactosylated structures with three (triply charged) and four (quadruply charged) sialic acids attached, respectively. residue labeling follows that of vliegenhart. with the additional modifications of 7 for sialic acid, 1 for 16-linked core fucose. the symbolic representation of glycans follows that of harvey. with residues in both the schematic diagrams and molecular graphics following the color scheme of the consortium for functional glycomics. the influence of hydrophobic residues in the protein glycan interface of the fc on glycan processing was first observed in mutational studies on mouse human chimeric igg3 antibodies, where replacement of phe241, phe243 or val264 with ala resulted in elevated levels of mono- and disialylated glycans and decreased binding to c1q and fcr activity. in addition, ribosomal display has been used to discover site - specific fc mutants with enhanced fcriiia binding. this approach identified the f243l mutant which, in addition to enhanced fcriiia binding, also exhibited altered glycan processing including decreased fucosylation. two possible explanations have been proposed to explain these observations : either the alteration of the protein carbohydrate interaction directly affected the fc protein conformation or the increased glycan processing affected fcr binding. to discriminate between these possibilities, these glycoform - controlled mutants still exhibited similar reduced fcr binding indicating that the conformation of the c2 domain is modulated by glycan furthermore we show that the effects of these glycan - destabilizing mutations on fcr binding are independent of mutations which directly affect the fc fcr interface. thus, combinatorial mutagenesis can yield antibodies with novel effector properties. for example, we combine fc fcr interface mutations known to selectively enhance fcriib binding, with a glycan protein interface mutation that decreases binding to all fcrs, to provide an igg which more broadly eliminates activatory (but not inhibitory) receptor binding. this study therefore clarifies the role of the fc glycan in maintaining antibody structure and provides routes to the development of antibody therapeutics with bespoke effector functions. glycan interface, we determined the crystal structure of recombinant igg1 fc f241a (table 1). this mutant has been previously reported by lund. to reduce fcr binding and increase glycan processing. prior to crystallization, we performed electrospray ionization (esi) mass spectrometric analysis of the n - linked glycans which confirmed extensive branching and terminal sialylation (figure 1). the igg1 fc f241a crystallized in the primitive orthorhombic spacegroup, p212121, with one molecule of the fc homodimer in the asymmetric unit. data were collected to a resolution of 1.9 (table 1). as observed in many crystal structures of the fc, the protein and glycan moieties of the c2 domain from one chain (chain b) exhibited a high degree of disorder (figure 2d). i(hkl)|/hkl ii(hkl;i), where i(hkl;i) is the intensity of an individual measurement and i(hkl is the average intensity from multiple observations. k|fcalc||/hkl |fobs| rfree is calculated as for rwork but using only 5% of the data, which were sequestered prior to refinement. interpretable electron density was observable for seven monosaccharide residues on chain a (figure 2e, f). in the structure of the wild - type fc, phe241 packs with the glcnac2 and man3 residues (figure 2b, c). in contrast, electron density in our structure of the f241a mutant, revealed the f241a site - directed substitution and a destabilization of the protein carbohydrate interface (figure 2e, f). the n - linked glycan rests in the established position along the c2 domain with defined electron density corresponding to the 6-arm, while only diffuse density corresponding to the 3-arm is observed in the 2fo fc map. packing of n - link glycans in native (a c) and f241a mutant (d f) igg fc. glycans are displayed as blue (glcnac), red (fuc), and green (man) sticks. protein is displayed as a gray cartoon with four hydrophobic residues at the protein. overall structure of (a) native (pdb i d 3ave) and (b) f241a mutant igg1 fc. the c2 domains from chain a (b and e) are shown with close - ups of the protein - glycan interfaces (c and f). electron density corresponding to carbohydrate is depicted as a blue mesh (2fo fc map contoured at 1) around the carbohydrate moiety of the mutant fc reported herein. this weak density indicates that the 3-arm is either conformationally disordered or glycoforms differing in 3-arm composition are adopting different conformations where the x - ray scattering does not sum to yield consensus electron density. previous reports had suggested that the intrinsic flexibility of the 3-arm causes the lack of electron density of the galactose in native galactosylated fc. consistent with a loss of electron density of the 3-arm, detailed negative - ion esi mass spectrometry with fragmentation analysis revealed extensive branching on the 3-arm but not the 6-arm (figure 1). the localized induction of disorder at the 3-arm does not fully account for the apparent increase in accessibility of the glycans to golgi - resident glycosyltransferases (e.g., increase in 6-arm galactosylation) or the reduction in fcr binding affinity (figure 2). protein interface not sufficiently captured by low - temperature x - ray crystallographic methods. for example, the hydrophobic interface mutations may affect the position of equilibrium between the protein bound and free conformations proposed by nmr studies to yield more accessible glycans and potentially more widely spaced c2 domains. interestingly, nmr studies have indicated that 2,6-sialylation has minimal impact on glycan dynamics in the fc domain. this finding is entirely consistent with our observation of an elevation in 6-arm sialylation by electrospray mass spectrometry and the conserved conformation of the 6-arm observed by x - ray crystallography (figure 2c, f). protein interface can induce at least localized glycan disorder, we next sought to determine to what extent the reduction in fcriiia binding can be attributed to disruption of the glycan protein interface or to changes in glycan processing. to this end a series of human igg1 fc mutants was generated containing mutations that modulated the protein carbohydrate interactions within the fc : f241a, f243a, v262e, and v264e. the panel of igg1 b12 mutants was expressed in either human embryonic kidney (hek) 293 t or glcnac transferase (gnt) i - deficient hek 293s cells. the glycans were released from the purified antibody via protein n - glycosidase f (pngase f). the free sugars were fluorescently labeled and resolved via normal - phase high - performance liquid chromatography (hplc) using a tsk - amide column. the hplc spectra from igg1 fc mutants expressed in hek 293 t (black spectra) or gnt i - deficient hek 293s cells (blue spectra) are shown in figure 3. the glycans from igg b12 expressed in hek 293 t cells are composed of a series of fucosylated, biantennary, complex - type carbohydrates, typical of the protein - directed glycosylation observed for igg (figure 3a ; black spectrum). the most abundant species observed were agalactosylated structures with smaller amounts of mono and digalactosylated structures. a small population of sialylated material was also present, showing the typical glycan profile for recombinant igg1 fc as reported previously. consistent with previous analyses of igg3, mutations interrupting the hydrophobic protein glycan interface led to dramatic increases in terminal 1,4 linked galactose levels, with digalactosylated species representing the most abundant glycan populations for all mutants generated from hek 293 t cells (figure 3b e ; black spectra). tri- and tetra - antennary species, not normally observed on fc, were detected, most notably on v262e and v264e. additionally, increased bisecting glcnac and terminal sialylation were also evident for these mutants. an unusual digalactosylated, trisialylated species was also detected in the hplc spectra of all of the mutants. this structural assignment was confirmed by electrospray mass spectrometry of recombinant igg1 fc (figure 1) and b12 mutants (figures s1 and s2). further matrix - assisted laser desorption / ionization time - of - flight mass spectrometry (maldi - tof - ms) (figure s3) and hplc analysis of desialylated mutants (figures s4 and s5) were carried out to validate the hplc assignments. in contrast to the heterogeneous complex - type glycan spectra observed when the igg panel was expressed in hek 293 t cells, expression in gnt i - deficient hek 293s cells led to a purely oligomannose - type glycan profile composed of man5glcnac2 together with a small population of fucosylated man5glcnac2 (figure 3 ; blue spectra). the latter structure has previously been shown to arise via the inefficient gnt i - independent fucosylation pathway. protein interface affected neither oligomannose processing to man5glcnac2 nor the proportion of gnt i - independent fucosylation. in addition to glycan analysis, the n - glycosylation site occupancy at the asn297 was examined, as previous report showed decreased glycan site occupancy for the hydrophobic mutants. a combination of pngase f treatment and trypsin digestion, followed by maldi - tof - ms, showed that the n - glycosylation site on fc asn297 is fully occupied for all the mutants (figures s6 and s7). the discrepancy might be due to the different antibody isotypes used or methods used to examine site occupancy. hplc analysis of 2aa - labeled n - linked glycans from monoclonal igg1 b12 mutants expressed in hek 293 t and hek 293s cells. normal - phase hplc analysis of 2-aa - labeled n - linked glycans released from target antibody glycoforms by in - gel protein pngase f digestion. glycan profile of igg1 b12 expressed in hek 293 t (black) and hek 293s (blue) for the following variants : (a) wild type ; (b) f241a ; (c) f243a ; (d) v262e ; and (e) v264e. the y - axis displays relative fluorescence (rf). to investigate the impact of sialylation on fcr binding, in vitro glycosyltransferase reactions were used to generate hyper-2,6-sialylated igg (figure 4). as there is a potential for 2,3-linked sialic acid to be present in glycoproteins derived from hek 293 t cells, we first performed a sialidase digestion. sialylation was not detected by hplc analysis (figure 4a, b). the sialidase - treated material was then subjected to sequential 1,4-galactosylation and 2,6-sialylation (figure 4c, d, respectively). hplc analysis revealed that a trace population (5%) of monogalctosylated glycans remained after the galactosyltransferase reaction (figure 4c). generation of differentially glycosylated igg1 fc. normal - phase hplc analysis of 2-aa - labeled n - linked glycans, released from target antibody glycoforms by in - gel pngase f digestion. (a) glycan profile of monoclonal igg1 b12. (b) glycan profile of igg1 incubated with 50 u / ml clostridium perfringens neuraminidase for 48 h at 37 c. (c) glycan profile of igg1 incubated with 25 g / ml 1,4-galactosyltransferase (b4galti) and 80 m uridine 5-diphosphogalactose in 50 mm hepes, 10 mm mncl2, ph 7.5 for 48 h at 37 c. (d) glycan profile of igg1 sequentially treated with b4galti and 2,6-sialyltransferase i (st6gali) as described above. fcrs by determining the binding of our panel of igg mutants to the extracellular regions of fcria, fcriia, fcriib, fcriiia, and fcriiib (figure 5). elisa of monoclonal igg variants binding human fcria, fcriia, fcriib, fcriiia, and fcriiib. the fcrs were plated at 5 g / ml overnight at 4 c, igg variants f241a, f243a, v262e, and v264e were incubated for 1.5 h, and binding was detected by hrp - conjugated goat antihuman fab antibody. symbolic representation of igg mutation and glycovariants : solid black square = wild - type native ; solid blue square = wild - type man5glcnac2 ; open black triangle = mutant native ; open blue triangle = mutant man5glcnac2 ; solid red square = wild - type hypergalactosylated and hypersialylated, elisa binding curves of the four igg hydrophobic mutants for (a) fcria, igg variant starting concentration at 10 g / ml. (b) fcriia, igg variant starting concentration at 100 g / ml. (c) fcriib, igg variant starting concentration at 300 g / ml. (d) fcriiia, igg variant starting concentration at 100 g / ml. (e) fcriiib, igg variant starting concentration at 300 g / ml. (f) fcriiia, igg variant starting concentration at 100 g / ml. all data points represent the calculated mean of two independent measurements from a total of at least two experiments. consistent with studies with fcri, our data show that abolition of the fc glycan protein hydrophobic interaction resulted in a decreased fc affinity for the fcria (figure 5d). a similar pattern, albeit to different extents, was observed in the binding analysis with fcriiia, fcriia, fcriib, and fcriiib (figure 5). the high affinity, activatory fcria and low - affinity, inhibitory fcriib were least prone to such modulation. interestingly, the v264e mutant contains the highest level of sialylated structures among mutants tested (figure 3e).. the v264e mutation would be predicted to perturb the overall trajectory of the glycan away from the surface of the c2 domain and may account for the extensive glycan terminal processing due to increased steric accessibility. to investigate the effect of these hydrophobic mutations on fcr binding independent of the differential fc glycoforms, we compared fcr binding to the panel of uniformly glycosylated igg1 fc mutants expressed in the gnt i - deficient hek 293s cells (figure 3 ; blue spectra). consistent with previous reports, wild - type igg1 fc with man5glcnac2 glycosylation exhibits increased affinity for fcriiia (figure 5d) and decreased affinity for the fcriib (figure 5e) compared with fc with native biantennary complex glycans. we also demonstrate that the man5glcnac2 glycoform exhibits decreased fc affinity for fcriia, which is highly homologous to fcriib (figure 5b, c). mutations that disrupt the hydrophobic interface significantly decrease the fc affinity for fcriia, fcriiia, and fcriiib, largely independently of the glycoform. this effect is evident by comparison of the wild - type and mutants expressed in gnti - deficient hek 293s cells (figure 3 ; blue spectra). mutations affecting the hydrophobic interface resulted in significantly decreased fc affinity for fcriia, fcriiia, and fcriiib (figure 5b, d, e), while interestingly, no significant changes were observed for fcriib binding (figure 5c). for the high affinity fcria, together, our results show that the hydrophobic mutations disrupt the fc binding to the activatory fcrs independently of the fc glycan, indicating that the productive engagement of fc fcr requires the protein glycan interaction at the fc c2 domain. unlike f241a, v262e, and v264e, the f243a mutant expressed as the man5glcnac2 glycoform has a minimal effect on fcrs binding (figure 5). this minimal effect can be explained by the different protein glycan interfaces of oligomannose-, hybrid-, and complex - type antibody glycoforms as revealed by x - ray crystallography. in contrast to the other residues, f243 exhibits minimal van der waals contacts with the 6-arm mannose residues in the predicted structure of the man5glcnac2 glycoform. therefore, in contrast to the significant effect of f243a mutation on the mobility of complex - type glycans, f243a would be predicted to have a minimal impact on the mobility of man5glcnac2 structures. the relative affinity of the single mutants for fcrs is summarized in table s2. remarkably, the interaction between fcriib and igg1 fc is relatively unperturbed by the disruption of fc protein we hypothesized that further enhancements to the fcriib selectivity could be achieved by combining our glycan protein interface mutations with previously reported hinge - proximal c2 mutations (s267e / l328f) that exhibit selective fcriib - binding. we generated two novel igg1 fc mutants, v262e / s267e / l328f and v264e / s267e / l328f, which exhibited enhanced affinity for the fcriib and, by comparison to the double mutant alone, significantly decreased affinity for fcria, fcriia, and fcriiib (figure 6 ; table s3). the double mutant s267e / l328f shows significantly increased affinity for the inhibitory fcriib and decreased affinity for the activatory fcriiia, while the binding for the other fcrs remains similar to the wild type (figure 6), consistent with published data. the increased levels of glycan terminal processing and bisection of these triple mutants are comparable to those of the single v262e and v264e mutants (figure s8). elisa of monoclonal igg variants binding human fcria, fcriia, fcriib, fcriiia and fcriiib. the fcrs were plated at 5 g / ml overnight at 4 c, igg variants s267e / l328f, v262e / s267e / l328f, and v264e / s267e / l328f were incubated for 1.5 h and binding was detected by hrp - conjugated goat antihuman fab antibody. symbolic representation of igg mutation and glycovariants : solid black square = wild - type native ; solid blue square = wild - type man5glcnac2 ; open black triangle = mutant native ; open blue triangle = mutant man5glcnac2, elisa binding curves of the four igg hydrophobic mutants for (a) fcria, igg variant starting concentration at 10 g / ml. (b) fcriia, igg variant starting concentration at 100 g / ml. (c) fcriib, igg variant starting concentration at 300 g / ml. (d) fcriiia, igg variant starting concentration at 100 g / ml. (e) fcriiib, igg variant starting concentration at 300 g / ml. all data points represent the calculated mean of two independent measurements from a total of at least two experiments. protein interactions modify the fc structure relevant for fcr binding (figure 5). however, it has previously been shown that hypersialylation of igg1 fc, regardless of the linkage type, decreases fc binding to the fcria, fcriib, and fcriiia, which also reduces antibody - mediated cytotoxicity both in vivo and in vitro. therefore, we generated hypergalactosylated and hypersialylated human igg1 fc (figure 4) and examined their affinity for fcriiia, a critical determinant of natural killer cell - mediated adcc. usually, the fc fcr affinity strongly correlates with effector functions measured by cellular assays. however, our data indicate that the hypersialylated fc binds to the fcriiia with very similar affinity to the wild type, supported by both elisa (figure 5f) and surface plasmon resonance (spr) data (figure 7). one possible explanation for the reduced cytotoxicity is that terminal sialic acid might interact with inhibitory sialic acid binding ig - like lectins (siglec) present on the surface of immune cells including macrophages and natural killer cells. this minimal effect of fc sialylation on fcriiia binding is also supported by the structural analysis presented here, which reveals that the protein glycan interface, rather than glycan terminal processing, modulates c2 domain conformation (figure 5). the igg variants were injected at 5 different concentrations at a flow rate of 30 l / min : igg and igg hypersialylated (0.67, 0.33, 0.17, 0.083, and 0.042 m) ; igg man5glcnac2 (0.33, 0.17, 0.083, 0.042, and 0.021 m). sensorgrams were fitted with a global 1:1 interaction, and the ka, kd, and kd were calculated, all using bia evaluation software 2.0.3. kd values are reported as mean sd, and sensorgrams are representative a total of three independent experiments. modulation of the multiple hydrophobic interactions between the protein surface and the glycan within the igg fc strongly influences fcr binding, presumably by altering the dynamics of the fc and affecting the adoption of receptor binding conformations. while these mutations also modulate glycan processing, expression of fc domains with homogenized glycoforms revealed that the interaction between the glycan and the protein independently influences fcr binding. by combining interface mutations with glycan engineering, new portfolios of effector activities can be generated. the pfuse vector with the human igg1 fc insert was obtained from invivogen, u.k. the vectors encoding igg1 b12 light and heavy chains were kindly provided by prof. protein mutagenesis was performed using the quikchange kit (agilent technology, u.k.) to generate the igg1 fc mutant f241a and the full - length igg1 b12 mutants f241a, f243a, v262e, and v264e. the mutated fc (residues 225447, swiss - prot accession number p01857.1) encompassing hinge, c2 and c3 domains was cloned into the mammalian expression vector, phlsec. the vectors containing full - length fcria, fcriia (his131 variant), fcriib, fcriiia (val158 variant), fcriiib, and mouse -1,4-galactosyltransferase i (b4galti) were all purchased from open biosystems, u.k. the vector containing full - length rat 2,6-sialyltransferase i (st6gali) was a gift from prof. the soluble extracellular regions of each fcr, b4galti and st6gali were cloned into the phlsec vector as described for the fc : fcria (residues 16288 ; swiss - prot accession number bc152383) ; fcriia (residues 34217 ; swiss - prot accession number bc020823) ; fcriib (residues 42225 ; swiss - prot accession number nm_001190828) fcriiia (residues 16288 ; swiss - prot accession number bc033678) ; fcriiib (residues 17200 ; swiss - prot accession number bc128562) ; st6gali (residues 89403 ; swiss - prot accession number np_001106815) ; and b4galti (residues 127399 ; swiss - prot accession number bc053006). for b4galti, the residue cys339 was mutated to thr to minimize the potential for aggregation. the fc, fcrs, b4galti, and st6gali were expressed in hek 293 t cells as previously described. briefly, hek 293 t cells (atcc number crl-1573) were grown to 90% confluence and transiently transfected with polyethyleneimine (pei), using a transfection mix with dna and pei in ratio of 1:1.5. following transfection, cells were grown in dmem/1% fetal bovine serum at 37 c and 5% co2 for 5 days. protein was purified from cell supernatant by immobilized metal affinity chromatography using chelating sepharose fast flow ni - agarose beads (ge healthcare, u.k.) followed by size exclusion chromatography using a superdex s-200 column equilibrated in phosphate buffered saline (pbs) (for fcrs) or 10 mm hepes ph 7.4, 150 mm nacl (for fc). full - length igg1 b12 was transiently expressed in hek 293 t or gnt i - deficient hek 293s cells. prior to transfection, light and heavy chain plasmids were mixed in a mass ratio of 4:1, and the total dna was mixed with pei in a mass ratio of 1:1.5. after incubation for 4 days at 37 c, cell culture supernatant was harvested and igg1 b12 was purified using protein a sepharose (ge healthcare, u.k.) according to the manufacturer s directions. oligosaccharides were released from coomassie blue - stained reducing sds - page gel bands containing 40 g of igg fc as previously reported. gel bands were rehydrated with 30 l of 30 mm nahco3 ph 7.0 containing 100 units / ml pngase f (new england biolabs, u.k.) and incubated for 12 h at 37 c. desialylation was carried out using linkage nonspecific neuraminidase from clostridium perfringens (new england biolabs, u.k.) for 48 h at 37 c. glycans were labeled with anthranilic acid (2-aa) as previously described and separated using tsk amide column (sigma - aldrich, u.k.). the released n - glycans, dissolved in water and 2-aa labeling buffer (3/8, v / v) were mixed with 2-aa and sodium cyanoborohydride and incubated for 1 h at 80 c ; excess 2-aa dye was removed using a spe - ed amide-2 column (systematic systems, u.k.). solvent a was acetonitrile, solvent b was milli - q water, and solvent c was 800 mm ammonium hydroxide adjusted to ph 3.85 using acetic acid. the gradient was a constant 71.6% a for 6 min at a flow rate of 0.8 ml / min, followed by a linear gradient of 71.635% a over 80 min at 0.8 ml / min. afterward, the gradient was a linear 3571.6% a for 1 min at a flow rate of 0.8 ml / min ; then at the same gradient, the flow rate increased from 0.8 ml / min to 1.2 ml / min over 1 min and followed by the same gradient and flow rate for 13 min. the run finished by returning the flow rate to 0.8 ml / min over 1 min. fluorescence was detected at 425 nm, and the excitation wavelength was 360 nm. chromatography data were processed by the empower software (all instruments and software from interlink scientific services limited, u.k.). assignments were consistent with previously reported serum igg n - linked glycan profiles and were confirmed by maldi - tof ms and exoglycosidase analysis. hyper-2,6-sialylated igg was generated by incubating with b4galti in the presence of 80 m uridine 5-diphosphogalactose (sigma - aldrich, u.k.) in 50 mm hepes, 10 mm mncl2, ph 7.5 for 48 h at 37 c. the hyper-1,4-galactosylated igg was treated with st6gali in the presence of 70 m cytidine-5-monophospho - n - acetylneuraminic acid (sigma - aldrich, u.k.) in 50 mm hepes, 10 mm mncl2, ph 6.5 for 48 h at 37 c. the composition of the glycoform was verified by hplc analysis after each enzymatic treatment. recombinantly expressed mutant igg1 fc (f241a) was concentrated to 7.0 mg / ml and crystallized after 10 days using the sitting drop vapor diffusion method using 100 nl protein plus 100 nl precipitant equilibrated against 95 l reservoirs. crystals of f241a igg1 fc grew at room temperature in a precipitant containing 28% polyethylene glycol monomethyl ether 2000 in 0.1 m bis - tris buffer at ph 6.5. crystals were flash frozen by immersion in a cryoprotectant containing the mother liquor diluted in 30% polyethylene glycol and then rapidly transferred to a gaseous nitrogen stream. crystallographic data were collected to 1.9 resolution at beamline i04 at the diamond light source (oxfordshire, u.k.). the structure was solved using molecular replacement with the program phaser using native fc (pdb accession no. model building was performed with coot and iteratively refined using restrained refinement in the ccp4 supported program, refmac5, with the incorporation of translation - libration - screw (tls) parametrization and automatically generated local noncrystallographic symmetry restraints.model quality was validated with molprobity. recombinant fcrs at 5 g / ml in pbs were coated on high - binding microtiter plates (3690, corning, ny, u.s.a.) overnight at 4 c. coated plates were washed with pbs containing 0.05% tween 20 (sigma - aldrich, u.s.a.) and blocked for 1 h at room temperature with 5% bovine serum albumin (bsa) in pbs. recombinant igg1 b12 expressed from hek 293 t cells or from gnt i - deficient hek 293s cells were then added and allowed to bind for 1.5 h at room temperature. plates were washed five times with pbs containing 0.05% tween and binding was detected using a horse radish peroxidase (hrp)-conjugated fab fragment specific for human igg fab (abcam, u.k.). the 3,3,5,5-tetramethylbenzidine substrate (tmb ; thermo scientific, u.s.a.) was used for development according to the manufacturer s directions and was stopped by the addition of 2 m h2so4. absorbance was measured at 450 nm on a spectramax m5 (molecular devices, california, u.s.a.) apparent affinity was calculated as the concentration of igg1 b12 corresponding to half - maximal binding on the elisa binding curve. spr experiments were carried out using the biacore t100 instrument (ge healthcare, u.k.). briefly, the fcriiia (val158 variant) was immobilized onto the surface of cm5 sensor chip (ge healthcare, u.k.) to about 1000 ru during each independent experiment. all experiments were carried out in the hbs - ep running buffer (10 mm hepes, 150 mm nacl, 3 mm edta and 0.005% surfactant p20), at a flow rate of 30 l / min. the monoclonal igg1 b12 protein and the hypersialylated and high - mannose glycol variants were injected at 5 different concentrations, allowing 2 min for association and 3 min for dissociation. after each run, the sensor chip was regenerated using 10 mm glycine - hcl, ph1.7. the sensorgrams were fitted to a global 1:1 interaction, and the ka, kd, and kd were calculated, all using biaevaluation software 2.0.3 (ge healthcare, u.k.). | biologically active conformations of the igg1 fc homodimer are maintained by multiple hydrophobic interactions between the protein surface and the n - glycan. the fc glycan modulates biological effector functions, including antibody - dependent cellular cytotoxicity (adcc) which is mediated in part through the activatory fc receptor, fcriiia. consistent with previous reports, we found that site - directed mutations disrupting the protein carbohydrate interface (f241a, f243a, v262e, and v264e) increased galactosylation and sialylation of the fc and, concomitantly, reduced the affinity for fcriiia. we rationalized this effect by crystallographic analysis of the igg1 fc f241a mutant, determined here to a resolution of 1.9, which revealed localized destabilization of this glycan protein interface. given that sialylation of fc glycans decreases adcc, one explanation for the effect of these mutants on fcriiia binding is their increased sialylation. however, a glycan - engineered igg1 with hypergalactosylated and hypersialylated glycans exhibited unchanged binding affinity to fcriiia. moreover, when we expressed these mutants as a chemically uniform (man5glcnac2) glycoform, the individual effect of each mutation on fcriiia affinity was preserved. this effect was broadly recapitulated for other fc receptors (fcri, fcriia, fcriib, and fcriiib). these data indicate that destabilization of the glycan protein interactions, rather than increased galactosylation and sialylation, modifies the fc conformation(s) relevant for fcr binding. engineering of the protein carbohydrate interface thus provides an independent parameter in the engineering of fc effector functions and a route to the synthesis of new classes of fc domain with novel combinations of affinities for activatory and inhibitory fc receptors. |
astrocytic tumor, the most common type of glioma, is classified into four grades, according to different grades of malignancy (i iv), by the word health organization (who). glioblastoma multiforme (gbm), a who grade iv astrocytic tumor, is the most devastating primary human brain tumor with a high morbidity and mortality among patients. even when treated with a combination of surgery, chemotherapy, and radiotherapy, patients with gbm still have a very poor long - term outcome, with a median survival of 14.6 months. the poor survival is primarily due to the recurrence of tumor, which is resistant to standard therapies. accumulating evidence has demonstrated that a small population of stem - like cells, termed cancer stem cells (csc), in tumors are responsible for tumor initiation and ongoing growth. these cells contribute to therapeutic resistance and are considered to be the most likely cause of cancer relapse. cscs have been identified and validated in various solid tumors such as breast, colon, pancreas, and liver. they have also been shown to exist in gbm, and recent work has shown the possibility for treatment of brain tumors by targeting cscs. the identification of new tumor stem cell markers for gbm is essential for diagnosis and effective treatment of malignant brain tumors. cd133 has been identified and widely used as a marker to characterize csc population in gbms. however, cd133 expression is observed in mature luminal ductal epithelial cells in various organs of adults, indicating that cd133 may not be a suitable organ - specific csc marker. other evidence now suggests that cd133 may serve as a csc marker in only a subgroup of gbm. moreover, cd133 cells also have the capability to generate gbm tumors in immunodeficient nude mice or rats. recently, cd90 was identified as a marker for gbm cscs in primary human high - grade gliomas using tissue microarrays. the expression level of cd90 was highly correlated with who grades and was significantly higher than that in low - grade gliomas. interestingly, cd90 and cd133 markers were coexpressed in gbm, where 100% of the cd133 cells were also positive for cd90, but only part of the cd90 cells were positive for cd133, indicating that the cd133 stem - like cells are a subpopulation of cd90 cells in gbms in vivo. other suggested csc surface markers that have been identified, such as cd15 and ng2, are still under investigation. tenascin - c (tnc) is a large extracellular matrix (ecm) glycoprotein, characterized by a six - armed quaternary structure and a modular construction. it is composed of four subunits : a cysteine - rich amino terminal domain, a sequence of epidermal growth factor (egf)-like repeats, a number of fibronectin type iii repeats, and a carboxy - terminal domain homologous to fibrinogen. its deregulated high expression is causally linked to many diseases, including heart failure, thrombosis, atherosclerosis, and cancer. mesenchymal extracellular matrix antigen that is ubiquitously expressed in glioblastomas but not in normal brains. the distribution pattern of tnc in gbm showed that it plays a role in angiogenesis and tumor cell proliferation. tnc contributes to the generation of a stem cell niche, which is important to the development of neural stem cells. recent work also demonstrated that tnc is a promising target of gbm therapy by interference rna intervention (irnai). thus, tnc may play an important role in gbm. in previous work using mass spectrometry analysis, the expression level of tnc in a gbm - derived stem neurosphere line was shown to be dramatically higher than that in three traditional adherent gbm cell lines, indicating that tnc may be a potential marker for cscs in gbms. tnc has also been identified as a marker in neuroblastoma. in the current work, we showed the potential of tnc as a marker for glioma cscs using tissue microarray analysis, where a significant number of samples from different grades of glioma could be studied. the stem - like cell characterization of tnc positive cells was then further demonstrated using in vitro cell sorting and a limiting dilution assay to monitor sphere formation to understand the role of tnc as a potential csc marker. it is shown that tnc is not only a potential prognostic marker for gbm but also a potential marker for glioma cscs. tissue microarray (tma) samples were obtained from us biomax (rockville, md ; cat. 61 samples were analyzed in these experiments, including 17 gbm samples (age : 35 18 years ; 7 females and 10 males), 18 who grade iii astrocytomas (age : 46 11 years ; 7 females and 11 males), 15 who grade ii astrocytomas (age : 41 12 years ; 6 females and 9 males), 4 who grade i astrocytomas (age : 41 8 years ; 1 female and 3 males), and 7 normal brain tissue samples (age : 38 8 years ; 6 females and 1 male). the brain tissue samples originated from different donors, and each sample had at least two replicates. the glioma tissue sections were from the tumor areas and do not include the adjacent normal tissues. paraformaldehyde - fixed gbm sections were obtained from university hospital at the university of michigan with approval from the internal review board. they were thawed for 2030 s at room temperature and rinsed with pbs before protein extraction. the fasp protein extraction kit was used to extract protein from tissue sections (protein discovery, inc. lysis buffer containing 4% sds, 0.1 m dtt, and protease inhibitors was added onto the tissue section slides (us biomax, inc., the collected tissue cells were boiled using a 100 c water bath for 5 min. the samples were centrifuged at 15 000 g for 10 min, and the supernatant was stored at 80 c for western blotting analysis. the paraffin - embedded tissue arrays with 1.5 mm core diameter and 5 m thickness were dewaxed in xylene for 10 min twice and rehydrated through a series of alcohol solutions (200 proof, sigma - aldrich, st. louis, mo) (100% ethanol twice, 90% ethanol, and 70% ethanol, 5 min each) to water. then, the slides were boiled for 15 min in citrate buffer (teknova, hollister, ca) at ph 6.0 for antigen retrieval. after returning to room temperature, endogenous peroxidase activity was blocked with 3% h2o2 in methanol for 10 min. the tmas were then rinsed with water and pbs and subsequently blocked with 2% bsa and incubated with rabbit anti - human tenascin - c monoclonal antibody (1:100 dilution, abcam, cambridge, ma) overnight at 4 c followed by incubation with a goat anti - rabbit igg conjugated to horseradish peroxidase (1:250 abcam, cambridge, ma). immunodetection was performed using dab solution (vector laboratories, burlingame, ca). the tnc expression level in each tissue section was assessed in non - necrotic areas of three separate microscopic fields of view under a magnification of 200 and was represented by the mean of the percentage of tnc cells. double - immunoflourescence staining was performed using tissue microarrays. according to the different properties of each individual antibody, briefly, the tmas were dewaxed in xylene for 10 min twice and rehydrated through a series of alcohol solutions to water, followed by boiling for 15 min in 100 mm citrate buffer at ph 6.0 for antigen retrieval. after incubation with 1% bsa in pbs for 1 h at room temperature to block nonspecific binding, a mixture of rabbit anti - human tnc (1:80 dilution, abcam, cambridge, ma ; cat. ab108930) monoclonal antibody and mouse anti - human cd133 (1:100 dilution, millipore, temecula, ca ; cat. mab 4399) monoclonal antibody was incubated with the slides overnight at 4 c. dylight 488 anti - rabbit igg (h + l) and dylight 549 anti - mouse igg (h + l) secondary antibodies (1:150 dilution, vector laboratories, burlingame, ca) were used for immunofluorescence detection, and 4,6-diamidino-2-phenylindole (dapi) counterstain was used to visualize nuclei. between each step, finally, tma slides were dehydrated in alcohol and coverslipped using a cc / mount permanent mounting medium (sigma, st. hsr - gbm1 neurosphere cells were derived from a primary gbm patient and have been propagated for hundreds of passages as neurospheres in vitro to enrich the cancer stem - like cell population. hsr - gbm1 neurosphere cells were used for a coupled cell sorting and limiting dilution assay of sphere formation. as described before, neurocult proliferation medium (stem cell technologies, vancouver, canada) was supplemented with 10 ng / ml egf (peprotech, rocky hill, nj), 10 ng / ml fgfb (peprotech), and 2 g / ml heparin (sigma). differentiation of the neurospheres was achieved by plating 0.91 10 cells / cm on a polyornithine (15 g / ml) coated culture plate and maintaining them in the neurocult differentiation medium (stem cell technologies) as described previously. an equal amount of protein from different samples was separated by 415% sds - page and transferred to poly(vinylidene difluoride) membranes (pvdf, bio - rad, hercules, ca). the membranes were blocked for 1 h by 2% milk (bio - rad) in pbst (0.1% tween-20 in pbs) and then incubated with the following antibodies overnight at 4 c : anti - tnc (abcam), anti - cd133 (millipore), and anti--actin (abcam). after being washed three times with pbst, the membranes were incubated with peroxidase - conjugated secondary antibody igg (h + l) for 1 h, washed another three times with pbst, and then detected by supersignal west pico chemiluminescent substrate (thermo scientific). fluorescence - activated cell sorting experiments were performed at the flow cytometry core at the university of michigan in triplicate. to execute the cell sorting experiments, hsr - gbm1 neurospheres were first dissociated into single cells. ab108930) monoclonal antibody, dylight 488 anti - rabbit igg (h + l) (vector laboratories, burlingame, ca), and cd133-pe (miltenyi biotec, auburn, ca ; cat. 130 - 080 - 801) antibody for facs were applied to cell staining according to the manufacturer s instructions. 130 - 092 - 212, for cd133 and rabbit igg monclonal antibody, cat. ab 172730, for tnc) and analyzed for cd133/tnc, cd133/tnc, cd133/tnc, and cd133/tnc cell populations. each population of cd133/tnc, cd133/tnc, cd133/tnc, and cd133/tnc was sorted into 96-wells for 6 days before examination of sphere formation. the percent of wells that did not form spheres (y axis) was plotted against the number of cells plated per well (x axis). the minimum number of cells required to form spheres was calculated from the x intercept of the graph. the student s t - test was used to analyze the difference in pairwise comparison for tnc expression levels among astrocytoma who grade i, grade ii, grade iii, and grade iv and normal brain tissues. the expression level of tnc in a gbm - derived stem neurosphere line was shown to be dramatically higher than that in three traditional adherent gbm cell lines using mass spectrometry analysis. to detect tnc expression in gbm tissues, we extracted protein samples from fresh primary gbm biopsy. the results showed a strong expression of tnc in gbm tissues but not in normal brain tissues, where a dramatically different expression level existed between gbm and normal brain tissues (figure 1). western blot analysis of tnc expression in gbm (glioblastoma multiforme) tissues and normal controls. a strong expression is present in gbm patients, whereas in the normal brain tissue, tnc is not detected. to determine the relevance of aberrant tnc expression in gbm progression, we investigated the expression of tnc using tissue microarrays containing 54 gliomas of different who grades and seven normal subjects by immunohistochemical staining. tnc expression was not detectable in normal brains (figure 2a), who grade i astrocytomas (figure 2b), and part of who grade ii astrocytomas (figure 2c). in contrast, it has a dramatically higher expression in all analyzed who grade iii astrocytomas (figure 2d) and gbms (figure 2e). the results reveal that tnc expression was highly correlated with the grade of astrocytoma, where tumors of higher grades showed higher levels of immunoreactivity. immunohistochemical staining of human tnc in different grades of astrocytomas and normal brains. paraffin - embedded tissue microarrays (tma) of glioma were analyzed using anti - tnc monoclonal antibody. a representative figure of each tma is shown. tnc was not detected in normal brain tissue (a) or astrocytoma who grade i (b). in contrast, low or moderate staining for tnc was detected in astrocytoma who grade grade ii (c), and moderate or strong staining for tnc expression was observed in anaplastic astrocytoma who grade iii (d) and gbm who grade iv (e). hematoxylin counterstain was used to visualize nuclei. the tnc expression level in each tissue section was assessed in non - necrotic areas of three separate microscopic fields of view under a magnification of 200 and is represented by the mean of the percentage of tnc cells. tnc expression was further semiquantitatively analyzed by calculating the percentage of tnc cells in the tissue section. the relative expression level of tnc in normal and different glioma grades are shown in figure 3. the percentage of tnc cells was zero in all of the normal brain and who grade i astrocytoma tissues. in who grade ii astrocytoma tissue samples, tnc was not detectable in part of the samples (5 of 15, 33%) and was expressed at weak levels (16%, 0.05). however, the tnc expression level in high - grade gliomas (grade iii astrocytomas and gbms) was significantly higher than that in low - grade gliomas (p < 0.001, grade i and grade ii astrocytomas). a significant difference of tnc expression level also existed between grade i and grade ii astrocytomas. the results showed that tnc was not expressed in normal and grade i astrocytomas patients but that its expression level is highly correlated with late grades of malignancy. scatter plot of tnc expression levels in 54 patients with different grades of astrocytomas and 7 normal subjects. the percentage of tnc cells of each tissue sample represents tnc expression level on the y axis. tnc expression levels were found to be highly associated with the grade of astrocytoma. tnc has a high expression level in most of the grade iii astrocytomas and gbms analyzed by immunohistochemical staining, a very low expression in most of the grade ii astrocytomas, and undetectable expression in grade i astrocytomas and normal brain tissues. cd133 has been widely used as a marker to characterize csc population in gbms. to determine the relation between the tnc and cd133 cell populations, we performed double - immunofluorescence staining for tnc and cd133 in primary gbm tissue sections. as shown in figure 4, in most of the gbm tissue cells, cd133 was co - expressed with tnc, where most tnc cells were also cd133 cells, but there are still some tnc cells that were not positive for cd133. this indicates that the tnc cell population has a high overlap with the cd133 cell population. double - immunofluorescence staining for tnc and cd133 in a gbm tissue section. tnc expression has a high overlap with cd133 expression, where the coexpression is shown in yellow in the merged image. the expression of tnc and cd133 was further investigated in a gbm cell line. flow cytometry analysis was executed in a gbm - derived stem - like neurosphere line, hsr - gbm1, which has been extensively used in csc studies. cd133/tnc, cd133/tnc, cd133/tnc, and cd133/tnc cell populations were isolated from gbm - derived stem - like neurosphere cells by facs. the results show that tnc was expressed in about 55% of hsr - gbm1 cells, whereas cd133 was expressed in about 56% of hsr - gbm1 cells. the overlap between the tnc and cd133 cell populations reached 43% (figure 5). flow cytometry sorting process to isolate cd133/tnc, cd133/tnc, cd133/tnc, and cd133/tnc cell populations based on the expression of tnc and cd133. the results show that tnc was expressed in about 55% of hsr - gbm1 cells, whereas cd133 was expressed in about 56% of hsr - gbm1 cells. the overlap between the tnc and cd133 cell populations reached 43%. to investigate the tnc expression level changes in the differentiation process of gbm cancer stem cells, undifferentiated hsr - gbm1 stem - like neurospheres were induced to differentiate for 7 to 10 days. after collecting the undifferentiated and differentiated cell samples, we measured the changes in the expression level of tnc during the differentiation process of gbm cancer stem cells using western blotting. we found that most stem - like cells were lost after differentiation of hsr - gbm1 cells. the reduced expression of the known gbm stem cell marker cd133 confirmed this differentiation (figure 6a), which is consistent with previous reports. the results of western blotting analysis showed that the tnc expression level decreased dramatically in the differentiated cells compared with that in undifferentiated stem - like cells, with a similar differential expression pattern to cd133 (figure 6a). the results indicate that the expression levels of both tnc and cd133 were decreased along with the differentiation of stem - like cells, where tnc may represent a new marker for cscs in gbm. (a) tnc has the same expression pattern with cd133 along with the differentiation of the stem - like hsr - gbm1 neurospheres, where expression levels of both tnc and cd133 were dramatically reduced in the differentiated cells compared to that in stem - like hsr - gbm1 neurospheres. stem - like represents the stem - like hsr - gbm1 neurospheres ; diff represents the differentiated hsr - gbm1 cells. (b) the ability of cd133/tnc, cd133/tnc, cd133/tnc, and cd133/tnc cell populations to form spheres was analyzed. y axis, percent of wells that did not form spheres ; x axis, the number of cells plated per well. (c) the minimum number of cells required to form spheres for each population of hsr - gbm1 neurospheres. compared to the tnc cell population, the tnc cell population (including cd133/tnc and cd133/tnc) needs a much lower number of cells to form spheres. to determine whether tnc is a novel marker for gbm cancer stem cells, we performed a limiting dilution assay to evaluate the self - renewal ability of the tnc cells. gbm - derived stem - like neurosphere cells were fractioned into cd133/tnc, cd133/tnc, cd133/tnc, and cd133/tnc cell populations by facs. the ability of each cell population to form spheres was tested, where the tnc cell population has the strongest capacity for sphere formation regardless of cd133 status. on the basis of the data, the percent of wells that do not form spheres (y axis) is plotted against the number of cells plated per well (x axis), where the best line is drawn among the points based on a logarithmic function (figure 6b). the number of cells required to give rise to colonies is calculated from the x intercept of the graph. the minimum number of cells required for sphere formation for cd133/tnc and cd133/tnc was 52 and 54, respectively. compared to the tnc cell population, the tnc cell population (cd133/tnc and cd133/tnc) requires 23-fold more cells to form spheres (figure 6b, c). these results demonstrated that tnc cells had a much higher stemness potential than the tnc cells, which confirmed that tnc is a marker for gbm cscs. also, the cd133/tnc cell population required a similar number of cells to form spheres as that of the cd133/tnc cell population. thus, the tnc population as a csc population contains part of cd133 cscs. the cancer stem cell hypothesis claims that cancer arises from a tumorigenic subpopulation with self - renewing capacity and stem cell - like properties, designated cancer stem cells. the ability to find cell - surface markers that will allow the prospective identification and isolation of these cells is critical to csc research. to date, many studies have relied on the enrichment of cscs based on the cell surface protein cd133. however, recent reports have indicated that cd133 gbm cells can form tumors and that the expression of cd133 may be cell cycle regulated. extracellular matrix (ecm) proteins are key structural components of the perivascular niche and regulate normal stem cell and tumor proliferation and migration. tnc is an ecm protein known to correlate with prognosis in patients with glioblastoma, probably by stimulation of invasion and tumor angiogenesis. tnc also contributes to the regulation of the self - renewal and output of the stem cell population. its functions suggest that tnc plays an important role in gbm tumor initiation. in the current study, it has been shown that tnc is a potential candidate marker for cancer stem cells in glioblastoma. tissue microarrays were used to analyze the expression of tnc in glioma tissues of different grades, and tnc expression was found to be highly correlated with the grade of astrocytoma, where tumors of higher grades showed higher levels of immunoreactivity (figures 2 and 3). tnc was barely detectable in normal and astrocytoma who grade i. western blotting analysis also confirmed these results (figure 1). these observations suggest that the tnc expression level may be an indicator of the aggressiveness of gliomas, and it appears to be a promising new prognostic marker for gliomas. in the process of differentiation of stem - like cells, tnc expression levels were decreased along with the differentiation of stem - like cells (figure 6a). a limiting dilution assay further demonstrated the ability of the tnc cell population to form spheres (figure 6b, c). these findings suggest that tnc is a novel marker for cscs in gbm and overlaps with part of the cd133 cell population. it should be noted that, in contrast to highly differentiated low - grade gliomas, gbms are more undifferentiated and therefore are more likely to contain undifferentiated cscs. our analysis showed that tnc has a high expression level in most of the grade iii astrocytomas and gbms analyzed by immunohistochemical staining and a very low expression in most grade ii astrocytomas, whereas it is undetectable in grade i astrocytomas and normal brain tissues. however, tnc expression level is very heterogeneous in patients, with the expression level varying from only 7% to more than 80%. the average expression level is about 34% in all of the patients of who grade iii astrocytomas and about 45% in gbm patients (figure 3). facs analysis also demonstrated that tnc has a high expression level in the hsr - gbm1 cell line, with a similar percentage of tnc cells (55%) compared to that of cd133 cells (56%) (figure 5). gbm displays significant heterogeneity, so it is unlikely that a single marker will absolutely enrich cscs. recently, a number of groups have suggested that different cscs can coexist in the same tumor. even within a single tumor, different pools of cscs may be present. it is therefore likely that tumors have variability not only in the fraction of tnc cells and other cscs but also in how these populations overlap. in this study, we demonstrated that the tnc cell population has a 43% overlap with the cd133 cell population in the hsr - gbm1 cell line and overlaps with part of the cd133 cell population. previous investigations have indicated that cd133 cells also have the capability to generate gbm tumors in immunodeficient nude mice or rats.. it might be interesting to investigate the relationship between the cd90 and tnc cell populations. tnc is also an extracellular matrix protein, which makes it easier to enter into the bloodstream. tnc already has been shown to be significantly elevated in serum in cancer contexts, such as in liver and ovarian cancers. it would be interesting to investigate the difference in tnc expression in serum associated with gbm. in conclusion, we have shown that tnc expression is significantly elevated with increasing grades of malignancy and decreases with the differentiation of gbm cscs. it can be used to distinguish high - grade gliomas from low - grade gliomas and normal brains. furthermore, it has been shown that tnc is a novel marker for cscs in gbm and overlaps with part of the cd133 cell population, so tnc itself may be an important therapeutic target for gbms. | glioblastoma multiforme (gbm) is a highly aggressive brain tumor, with dismal survival outcomes. recently, cancer stem cells (cscs) have been demonstrated to play a role in therapeutic resistance and are considered to be the most likely cause of cancer relapse. the identification of cscs is an important step toward finding new and effective ways to treat gbm. tenascin - c (tnc) protein has been identified as a potential marker for cscs in gliomas based on previous work. here, we have investigated the expression of tnc in tissue microarrays including 17 gbms, 18 who grade iii astrocytomas, 15 who grade ii astrocytomas, 4 who grade i astrocytomas, and 7 normal brain tissue samples by immunohistochemical staining. tnc expression was found to be highly associated with the grade of astrocytoma. it has a high expression level in most of the grade iii astrocytomas and gbms analyzed and a very low expression in most grade ii astrocytomas, whereas it is undetectable in grade i astrocytomas and normal brain tissues. double - immunofluorescence staining for tnc and cd133 in gbm tissues revealed that there was a high overlap between theses two positive populations. the results were further confirmed by flow cytometry analysis of tnc and cd133 in gbm - derived stem - like neurospheres in vitro. a limiting dilution assay demonstrated that the sphere formation ability of cd133+/tnc+ and cd133/tnc+ cell populations is much higher than that of the cd133+/tnc and cd133/tnc populations. these results suggest that tnc is not only a potential prognostic marker for gbm but also a potential marker for glioma cscs, where the tnc+ population is identified as a csc population overlapping with part of the cd133 cell population. |
breast cancer is the second most common cancer in women and is also the second leading cause of cancer - related death in women. in its most common form, the most frequently used tumor grading system for breast cancer is the modified scarrf - bloom - richardson method where pathologists analyze the rate of cell division, percentage of tumor forming ducts, and the uniformity of cell nuclei to determine the cancer grade in h&e stained biopsies. while precancerous (or lower - grade) tumors tend to grow slowly and are less likely to spread, invasive (or higher - grade) tumors typically gain the ability to proliferate and spread rapidly. subjectivity and variability of the results affect the accuracy of prognosis and subsequent patient treatment. a recent study indicates that the rate of misdiagnosis of breast cancer varies widely between clinicians and is nearly 40% in some cases. thus, there is an unmet need for robust methods that reduce the variability and subjectivity in the grading of breast tumors and lesions. development of quantitative tools for image analysis and classification is rapidly expanding fields that constitute a great potential for improving diagnostic accuracy [4, 5 ]. in this paper, a method for automated grading of breast cancer in three - dimensional (3d) epithelial cell cultures is presented. in vitro epithelial breast cells cultured in laminin rich extracellular matrix form acinar - like structures that both morphologically and structurally resemble in vivo acini of breast glands and lobules. therefore, these culture systems constitute suitable and controllable environments for breast cancer research [79 ]. figure 1 shows a 3d view of a typical nonmalignant breast culture that comprises several acini that are surrounded by extracellular matrix (ecm) proteins. figure 2 shows an enlarged view of a cross section from a typical nonmalignant acinus. (a polarized cell has specialized proteins localized to specific cell membranes such as the basal, lateral, or apical side) and a hollow lumen. the lateral membranes of neighboring cells are in close proximity due to cellular junctions and adhesion proteins. the basal side of cells contacts the surrounding ecm proteins, while the apical sides of cells face the hollow lumen. malignant cancers result in loss of cell polarity that induces changes in the morphology of acinar structures. in this paper, we investigate morphological characteristics of mammary acinar structures in nonmalignant, noninvasive carcinoma, and invasive carcinoma cancer grades in six mcf10 series of cell lines grown in 3d cultures. we propose novel features to characterize these changes along the metastatic cascade and exploit them in a supervised machine learning setting for the automated grading of breast cancer. proposed features capture not only similar factors as the scarff - bloom - richardson grading system but also additional subvisual changes observed in breast cancer progression in a quantitative manner to reduce variability. as shown by the grading accuracies, the proposed features efficiently capture the differences caused by the metastatic progression of the cancer. previous work on this problem includes examining the change in the morphological characteristics of nontumorigenic mcf10a epithelial acini over time and exploiting them to model the growth of culture over time. chang. examined the elongation of the mcf10a acini at 6, 12, and 96 hours after a particular treatment. in a more predictive setting, rejniak. used the number of cells per acini, proliferation, and apoptosis rates to computationally model the mcf10a epithelial acini growth using fluid - dynamics - based elasticity models. in addition to these features, tang. utilized features like acinus volume, density, sphericity, and epithelial thickness to investigate the relationship between acinus morphology and apoptosis, proliferation, and polarization. specifically, they built a computational model that can predict the growth of acini over a 12-day period. in addition, graph theoretical tools [1315 ] were exploited to highlight the structural organization of the cells within the malignant tissues. our method is different than these characterization efforts in that the grading of cancer is achieved over a richer and more discriminative set of small - scale (local) morphological features that are statistically significant. in addition, the features proposed here closely mimic the features that current pathological grading systems utilize. the presented work builds upon and extends our prior work in this area that introduced the underlying framework. in this work, we provide extended details of our methodology and also present analysis that tests the performance of different supervised machine learning methods and investigates the discriminative influence of the proposed features. furthermore, the overall grading accuracy is significantly improved by eliminating the acini that are in the preliminary stages of their formations from our analysis. finally, we perform a preliminary study on the grading of in vivo tissue section using our framework and demonstrate that the proposed features can also be used on in vivo tissue slides albeit with additional constraints on the preparation of the tissue for our analysis. cells were grown on tissue culture - treated plastic t75 flasks and incubated at 37c in a humidified atmosphere containing 95% air and 5% carbon dioxide in the manufacturer suggested media. once 80% confluent, cells were split using 0.25% trypsin with 0.2 g / l edta and seeded into a new flask or under experimental conditions. six mcf10 series cell lines that represent three grades of breast cancer along the metastatic cascade were grown. the cell lines used in this experimentation were mcf10a (10a), mcf10at1 (at), mcf10at1k.cl2 (kcl), mcf10dcis.com (dcis), mcf10ca1h.cl2 (ca1h), and mcf10ca1a.cl1 (ca1a). the dcis, ca1h, and ca1a cell lines were grown in dmem / f12 with 5% horse serum and 1% fungizon / penicillin / streptomycin. 10a, at, and kcl cells were grown in the same base media with additional factors including 20 ng / ml epidermal growth factor, 0.5 mg / ml hydrocortisone, 100 ng / ml cholera toxin, and 10 g / ml of insulin. the 10a cell line was obtained from the american type culture collection (atcc), at, kcl, ca1a, and ca1h cell lines were obtained from the barbara ann karmanos cancer institute at wayne state university, and the dcis cell line was purchased from asterand inc. the advantages of the mcf10 series of cell lines include their derivation from a single biopsy and subsequent mutations forming cell lines of ranging metastatic ability. these cell lines were acquired from a tissue sample diagnosed as noncancerous fibrocystic disease [17, 18 ]. the biopsy cells, mcf-10 m, were cultured and spontaneously gave origin to two immortal sublines. 10a cells were nontumorigenic in mice xenografts ; however, the first derivative cell line was transfected with oncogene t-24 h - ras to promote expression of a constitutively active form of ras resulting in precancerous lesion formations. these cells were then serially passaged for six months and the derived cell line was named mcf10aneot. at cells were derived from a 100-day - old mcf10aneot lesion that formed a squamous carcinoma but failed to produce carcinomas when injected back into mice. kcl cell line was obtained from a 367 day tumor xenograft of the at cell line. kcl cells were injected into a mouse, where a tumor was formed and isolated after 292 days. isolated cells derived from this tumor were cultured and yielded the dcis cell line, which formed ductal carcinoma in situ tumors when injected into mice. additional cells from the tumors which were derived from the kcl cell line were implanted within a mouse and yielded the mcf10ca cell lines ; two of these were included in this study : the ca1h and ca1a. ca1h cells were found to develop invasive carcinoma in mice while the ca1a cells were of higher - grade malignancy and able to metastasize to the lungs. after evaluating the metastatic potentials of these six cell lines, we considered the 10a and at cell lines as nonmalignant, kcl and dcis cell lines as noninvasive carcinoma, and ca1h and ca1a cell lines as invasive carcinoma that constituted the three grades of breast cancer we considered in this study. cells were suspended at a concentration of one million cells per milliliter in matrigel (laminin rich extra cellular matrix) on ice. the gel - cell solution was seeded at 30 ul per glass bottom 96 well for 14 days in their respective media. the matrigel - cell solution was allowed to solidify for 30 minutes at 37c before the media was added and was changed every 2 - 3 days thereafter. following 14 days in culture, samples were washed once with phosphate buffer solution (pbs) and then fixed with 3% paraformaldehyde at room temperature for 30 minutes. next, samples were rinsed with pbs and treated with cell blocking solution (pbs with 1% bovine serum albumin (bsa) and 0.25% tween20) for one hour at 4c., samples were washed with pbs and then treated with the primary antibodies at their determined working dilution in pbs at 4c overnight. next, the samples were washed with pbs three times for 30 minutes at room temperature. the secondary antibodies were added to the samples in pbs at 4c overnight. finally, samples were treated with dapi for thirty minutes followed by three 30-minute pbs washes and stored at 4c in pbs prior to imaging. integrin 3 antibody (mouse monoclonal) (abcam : ab11767) was used at a dilution of 1 : 40 for 3d confocal fluorescent imaging. secondary antibody, alexa fluor 568 goat anti - mouse igg highly cross absorbed (invitrogen a-11031) at a dilution of 1 : 200, was used to visualize the localization of integrin 3. integrin 6 fitc - conjugated antibody (rat monoclonal) (abcam : ab21259) was used at a dilution of 1 : 25 for 3d confocal fluorescent imaging during the secondary antibody step previously described. nuclei were stained with 4,6-diamidino-2-phenylindole (dapi ; molecular probes) for 30 minutes at room temperature. 3d volumes were obtained using a zeiss lsm510 meta confocal microscope with a 40x water immersion objective as z - stacks. proper color filters were used to capture the red, green, and blue fluorescent signals. images were captured using a multitrack setting where fluorescent channels were acquired sequentially to avoid fluorescence crosstalk. thickness of the z - stacks ranged from 10 to 40 m (1 m slices) with an initial depth of at least 10 m. slices had 512 512 pixels (320 m 320 m) cross - section area. in order to include larger volumes of the cultures in our analysis, we captured four tiles (in 2 2 formation) with approximately 20% overlap and stitched these tiles using the 3d image registration technique proposed by preibisch. a total of five stitched images were captured for each of the six cell lines. watershed segmentation exploits the morphological characteristics of the regions of interest and is particularly useful for the segmentation of adjoined objects. the process starts with the identification of the acinar structures. in this study, cell nuclei were marked with blue fluorescent marker dapi, cell - to - cell borders were identified by the red fluorescent marker that shows the localization of integrin 3, and basal sides of the cell membranes were identified by the green fluorescent marker that shows the localization of integrin 6. as these components are observed in the individual color channels of the captured images and, we used the combination of the three color channels to identify the acinar structures. image values were separated into foreground and background classes, where the foreground class represented the stained components and the background class included the combination of the gel medium and extracellular proteins. we employed a local adaptation to otsu 's well - known global thresholding algorithm to binarize the color channels. in each slice along the depth direction, we divided the image into rectangular blocks along the horizontal and vertical directions and binarized them separately. this approach handles the spatial variations in the foreground - background contrast better than global thresholding. the noise produced due to the binarization of local regions that contain hardly any information was eliminated by using the edge - based noise elimination that cleaned the regions that did not contain any edge from the resulting binary image. next, the resulting binary color channels were superposed to obtain a single monochrome binary image by logical or operation. enclosing acinar structures were identified by applying morphological close operation followed by a morphological fill - hole operation to the resulting binary image. finally, 3d watershed segmentation was applied to label the individual acinar structures. for this purpose, we first obtained a topographic interpretation of the resulting binary image by taking its euclidean distance transform where the shortest distance to the nearest background pixel for each pixel was measured. the resulting transformed image was then inverted, while forcing the values for the background class pixels to, to construct the catchment basins and the watershed segmentation method was finally applied to construct to watershed lines to divide these basins and identify the unique acinar structures. acinar structures with less than four nuclei were considered to exhibit reduced ability to form polarized acinar structures and excluded from our analysis. note that this elimination was not carried out in our preliminary work on this problem that resulted in a poorer overall grading accuracy (79.0%) than what we achieve with the elimination (89.0%) as we will present in section 3. from the 30 images we analyzed, 99 10a, 49 10at, 81 kcl, 80 dcis, 29 ca1h, and 62 ca1a acinar structures were identified using this segmentation method yielding a total 400 acinar structures. visual investigation of the acinar structures shown in figure 1 reveals differences in acini morphology and localization of integrin subunits that are highlighted in figure 2. acinar structures in nonmalignant cell lines are comprised of polarized cells that are layered around the hollow lumen that closely approximate the acini formations in mammary glands and lobules. on the other hand, the acinar structures in the tumorigenic cell lines consist of nonpolarized cells that form clusters of cells rather than explicit acini. as shown in figures 3(a) and 3(b), nontumorigenic cell line 10a and precancerous cell line at, respectively, exhibit polarized acinar structures that are characterized by the integrin 6 localization at the basal membrane of the cells, integrin 3 localization along the lateral cell membranes, and clear hollow lumen formations. acinar structures in kcl and dcis cell lines shown in figures 3(c) and 3(d), respectively, exhibit significant changes in the integrin subunit densities and their colocalizations. while the basal and lateral membrane protein densities decrease, relative colocalizations of these proteins increase within the acinus. the acinar structures from the noninvasive carcinoma cell lines and acinar - like structures from the invasive carcinoma cell lines ca1h and ca1a shown in figures 3(e) and 3(f), respectively, are more elongated and exhibit smaller hollow lumens than the acinar structures from the nonmalignant cell lines. the observed variations in the morphology of acinar structures motivated the development of the features that characterize the level of cell polarity within the acinar structures. the features of interest primarily capture (i) the morphology of the acinar structure and hollow lumen, (ii) the basal, and (iii) the lateral protein densities within the acinar structure. these features were computed in each acinar structure for the slice that the acinar structure had the largest cross - section area along the depth direction (z - stack). the first subset of features we propose captured the shape of the acinar structures, number of nuclei that constitute the acinus, and the relative size of the hollow lumen. the segmentation of the cell nuclei was also accomplished by the watershed segmentation technique described previously using the blue (nuclei) channel image only. figure 4(a) shows the number of nuclei per acinar structure across the six cell lines. as expected the invasive carcinoma cell lines exhibit the largest number of nuclei per cell cluster compared to the other cell lines acini due to the unregulated division of cells. malignant cancer grades result in deformations in the acinar structures that cause the shapes to be more elongated. we measured the roundness of the acinar structures by taking the ratio between the minor and major axes of the ellipse fitted as illustrated in figure 4(d). this fitting was achieved by finding the ellipse that has the same normalized second central moments as the region. roundness values close to 1 comes from rounder / more symmetrical acinar structures whereas values close to 0 indicate an elongated shape. as expected, noninvasive and invasive cell lines exhibit statistically significant decrease in acinar structure roundness compared to the nonmalignant cell lines as shown in figure 4(b). the final feature in this subset captured the differences in the relative size of hollow lumen by computing the ratio between the areas of the hollow lumen and the acinar structure. values closer to 1 indicate larger hollow lumens, and those to 0 indicate smaller hollow lumens. in order to compute the hollow lumen area, we assumed that the hollow lumen was circular and computed its radius as the euclidean distance between the centroid of the acinar structure and the nearest nucleus to the centroid as illustrated in figure 4(e). the hollow lumen for the precancerous cell line at is the largest among the six cell lines. noninvasive and invasive cell line acinar structures exhibit statistically significant shrinkage in hollow lumen compared against the nonmalignant cell line acinar structures as shown in figure 4(c). the next subset of features analyzed and quantified the localization and structural relationships of the basal membrane - localized protein integrin 6. the first feature measured the ratio of integrin 6 expression within the acinar structure (excluding the expression along the basal membrane) to the acinar structure area as illustrated in figure 5(e). as nonmalignant cancerous cells exhibit high cellular polarity, integrin 6 is localized to the basal membrane of these cells. reduced cellular polarity in the malignant grades of cancer enables greater internal expressions of integrin 6 within the acinar structure. dcis, ca1h, and ca1a cell lines exhibited statistically significant increase in the internal expression of integrin 6 compared with the less malignant cell lines as shown in figure 5(a). it was computed as the ratio between the amount of the green fluorophores located in concentric circles that were centered at the centroid of the acinar structure and the total amount of green fluorophores in the acinar structure. the radii of the concentric circles were increased by one - tenth of the radius of the circle that circumscribes the acinar structure at each step as illustrated in figure 5(g). cell lines that have expressions of integrin 6 near the centroid of the acinar structure show relatively early rise in the cumulative densities than the others. it is observed that integrin 6 is localized near the basal membrane in the three lower - grade cell lines, and near the centroids of the acini in the three advanced grade cell lines as shown in figure 5(b). since the cumulative densities near the acinus center and the basal membrane are similar for all the cell lines, we decide to include the cumulative densities corresponding to 30 to 70% of the radius of the circle that circumscribes the acinus in our analysis. another feature captured the amount of integrin 6 expressed along the basal cell membrane as illustrated in figure 5(f). first, we took the difference between the acinar structure and its morphologically eroded version to obtain a binary contour mask. this mask was then overlaid with the corresponding slice of the binary green channel image to obtain the integrin 6 localized along the basal membrane of the acinar structure. next, we superposed the resulting image with rays that initiate at the centroid of the acinus oriented at angles that varied from 1 to 360 with 1 steps scanning a complete circle. finally, the total number of times that these rays intersected with the green markers was counted and normalized between 0 and 1 to obtain the continuity of integrin 6 along the acinar basal side. values close to 1 correspond to intact basal sides and, thus, indicate high cellular polarity. as shown in figure 5(c), 10a and at cell lines have the significantly more continuous expression of integrin 6 along the basal side of the cells than the four malignant cell lines. we note that kcl cell line exhibits a statistically significant higher localization of integrin 6 at the basal side than the three more tumorigenic cell lines. the final feature in this category measured the ratio of the amount of integrin 6 colocalized with integrin 3 to the total expression of integrin 6 to determine the amount basal membrane protein overlapped with the lateral membrane protein. this feature gets higher values when there is higher internal expression of integrin 6 or higher basal membrane localization of integrin 3. as plotted in figure 5(d), 10a and dcis exhibit statistically significant less colocalization of integrin 6 with 3 than the other four cell lines. the final subset of features captured the density of lateral membrane protein integrin 3 within the acinar structure. the following features measured the expression and localization of lateral membrane protein and adhesion molecule integrin 3. the first feature determined the amount integrin 3 expressed along the basal cell membrane using the same method described previously. we anticipate observing less amount of integrin 3 expressed along the basal cell membrane in the malignant grades of cancer than the nonmalignant grade. next, we captured the overall expression of integrin 3 within the acinar structure as illustrated in figure 6(e) where the total amount of integrin 3 expressed in the acinar structure was divided by the area of the acinar structure. it is seen in figure 6(b) that this feature monotonically decreases from the nontumorigenic 10a to noninvasive dcis acinar structures. we then measured the ratio between the amount of integrin 3 colocalized with the integrin 6 and the total amount of integrin 3 within the acinar structure. as expected nonmalignant cell lines exhibit significantly less colocalization of integrin 3 with integrin 6 than the malignant cell lines as shown in figure 6(c). final feature in this subset measured the ratio between the amount of integrin 3 localized between the hollow center and basal membrane side of the acinar structure to the total integrin 3 expression. this feature, thus, quantified the density of 3 integrin along the lateral membrane of the cells. since integrin 3 localization is not confined to cell - to - cell lateral membranes in malignant tumors, expressions of this protein are expected within the hollow lumen as well as the cell - to - extracellular matrix border. we used supervised machine learning to grade the acinar structures into nonmalignant, noninvasive carcinoma, and invasive carcinoma forms of breast cancer using the features defined previously. in supervised learning, the data are first divided into training and test sets. the classifier is trained with the labeled training data and the classes of the test data are then predicted using the resulting classifier. linear discriminant analysis fits a multivariate normal density to each of the training class assuming equal covariance matrices for each class. it then separates the classes with a hyperplane that is established by seeking the projection that maximizes the sum of intraclass distances and minimize the sum of interclass distances. quadratic discriminant analysis is similar to the linear discriminant analysis with the distinction that covariance matrix for each class is estimated separately. nave bayes classifier assumes that the classes are arising from independent distributions ; hence, a diagonal covariance matrix is assumed. k - nearest neighbor classifier finds the k closest training data to the test data based on the euclidean distance and classifies the sample using the majority voting of the nearest points. support vector machines classifier maps the training data into a higher dimensional space with a kernel function where the data become linearly separable. a separating maximum - margin hyperplane is established to separate the different class data with minimal misclassification via quadratic optimization. the test data are classified by determining the side of the hyperplane they lie on in the kernel - mapped space. in order to extend svm for three - class classification, we employed the one - against - one approach where three two - class svm classifiers were established for each pair of classes in the training data set. each sample in the test data was assigned to a class by these classifiers and the class with the majority vote was chosen as the final result. if there is equal voting for the three classes, we chose the class that has the largest margin from the separating hyperplane. in order to obtain unbiased performance estimates, 10-fold cross - validation the feature set was first randomly divided into 10 disjoint partitions of equal size. for each partition, a classifier the results for each partition were then combined to find the overall grading accuracy. in order to reduce the scale differences within the features, the data were normalized so that the features had zero mean and unit variance across the samples. we performed a parametric search to determine the number of neighbors in the nearest neighbor identification. we tested between 8 and 15 nearest neighbors and determined that identifying 12 nearest neighbors to a test point achieved the highest grading accuracy. for the svm classifiers, we used radial basis function, also referred to as gaussian kernel, in the form of k(xi, xj) = exp(||xixj||/2) that mapped the data into an infinite dimensional hilbert space. we performed a parameter to search to identify that achieves the highest grading accuracy. we sought in the set of candidate values that varied from 1.0 to 2.5 with 0.1 steps and determined that being equals to 2.0 achieved the best performance in the grading of the acinar structures. it is clear that svm - based classifier achieves the highest overall accuracy in the grading of the acinar structures. this is not unexpected as svm classifiers are known to be highly successful in biological applications. after identifying svm - based classifier as the most accurate grading method for our data set, we performed feature selection to determine the discriminative capabilities of the features to characterize the data. a good feature selection algorithm identifies the features that are consistent within the class and exhibit differences between the classes. fisher score (f - score) is documented to be a powerful feature selection tool. for a dataset xi with two classes, denote the instances in the first class with xi and instances in the other class with xi. the fisher score of the ith feature is then given by f(i)=((x(+)-x)2+(x(-)-x)2)/(x(+)2+x(-)2), where x is the mean value of the ith features, x(+) and x(-) are the mean values over the positive and negative instances, respectively, and x and x are the variances over the positive and negative instances, respectively, for the ith feature. in order to extend this method for a feature set with three classes, we computed the f - score for each feature in each pair of classes and then took the average of the three possible combinations. larger values of f - score indicate stronger discriminative influence ; therefore, after obtaining the f - scores for all the features, we ranked them in descending order. table 2 shows the average f - scores of the features and their corresponding discriminative rank. it is seen that continuity of integrin 6 along the basal membrane is the most discriminative feature to describe the data. discriminative influence of the ratio between the hollow lumen and acinar structure area is also high. these two features are important as they are strong indicators of the level of cell polarity within the acinar structure and can be considered as measures of duct forming tumors as used in the commonly used scarff - bloom - richardson system. some of the other most discriminative features quantify the differences that are difficult to assess by visual inspection such as the colocalization between the integrin 3 and integrin 3 and internal densities of the integrin subunits. we note that these features constitute a subset of the novel features introduced in this paper and, therefore, this analysis particularly highlights the importance of the proposed features and the methodology. we performed cancer grading using subsets of the resulting most discriminative features, where at each stage we increased the number of most discriminative features in the training feature set. figure 7 shows the overall grading accuracy with respect to the number of most discriminative features selected in the grading. it is seen that the highest grading accuracy 89.0% is achieved when all of the features are used to train the classifiers. considering that the most grading systems are typically based on the assessment of a limited number of features, when only the first five most discriminative features are used for grading, we achieve 82.0% overall grading accuracy. though relatively worse than the highest grading accuracy, this constitutes a highly promising setting considering the limited number of features. breast tissue from patients with invasive carcinoma, ductal carcinoma in situ, and from healthy individuals was obtained from proteogenix (culver city, ca) and stored at 80c. compound (sakura finetek usa, torrance, ca) and sections 20 m thick were cut using a microm hm505e cryostat. tissue sections were adhered to superfrost plus gold microscope slides (fisher scientific, morris plains, nj) and vapor fixed using 2 - 3 kimwipes (kimberley - clark worldwide, roswell, ga) soaked in 4% paraformaldehyde in a small chamber at 20c for 30 minutes prior to immunohistochemistry. tissue sections were encircled with an immedge pen (vector labs, burlingame, ca) and immunohistochemistry and confocal microscopy were performed as described for in vitro samples in section 2.2. an alexa488-conjugated goat antifluorescein secondary antibody (invitrogen, carlsbad, ca) was included at a 1 : 300 dilution in the overnight secondary incubation. a workflow diagram involved in the automated grading of breast cancer is shown in figure 8. first, 3d fluorescent confocal images of acinar structures were collected after 14 days within an in vitro culture system as described in sections 2.1 and 2.2. a total of 30 images were captured (5 images for each cell line) and a total of 400 acinar structures were identified using the image segmentation method described in section 2.3 in these images. for each acinar structure, we extracted the morphological features described in section 2.4. these features exhibit high - level of statistical significance across the nonmalignant, noninvasive carcinoma, and invasive carcinoma grades of breast cancer. using the resulting unique feature profiles, we then trained the svm - based classifiers as described in section 2.5 for the automated grading of acini and test on the data. overall grading accuracy of 89.0% is achieved when the whole feature set is used in the grading. as shown in the first half of table 3, the nonmalignant 10a and at cell lines are graded with 97.0% and 73.5% accuracy, respectively. due to the strong resemblance between the at and kcl cell lines, some portions of the at acinar structures acinar structures in kcl cell line are correctly graded as noninvasive carcinoma 72.1% of the time, and as nonmalignant 11.1% of the time which should be considered as high success as kcl falls between the advanced - early stages of cancer and noninvasive carcinoma. noninvasive dcis acinar structures are graded with 95.0% accuracy, and the acinar structures in the invasive cell lines ca1h and ca1a are graded with 93.1% and 93.5% accuracy, respectively. we note that neither the dcis nor invasive cell line acinar structures are graded as nonmalignant. when only the five most discriminative features are used, we achieve 82.0% overall accuracy in the grading. as shown in the second half of table 3, in this case at acinar structures. however, the grading accuracy of noninvasive kcl and invasive ca1h acinar structures significantly decreases. it is not unexpected that some of the features not included after the feature selection capture significant characteristics about the acini morphology. the following discussion on the proposed features helps us understand how they relate to the underlying biological implications. changes in the hollow lumen size and acini shape are visually observed and quantified across multiple cancer stages as described in section 2.4.1. while the average number of cells per acini is a concrete measurement and could be determined manually, it is useful and more practical to utilize automated techniques when analyzing large volumes of image data. with this feature we clearly determine that the two invasive cell lines ca1h and ca1a have more nuclei in the acinar structures than the other less malignant cell lines. alternatively, this could arise from higher density of cells within the acinus due to the loss of the hollow lumen. both of these explanations likely contribute to the resulting feature making it challenging to determine the exact cause. our next feature, the ratio between the areas of the hollow lumen and acinar structure can also help us explain the general trend in the number of nuclei per acinus with the progression along the metastatic cascade. larger hollow lumens in the lower cancer grades possibly limit the space that the cells can proliferate ; thus smaller number of nuclei per acinus is observed at lower - grade cell lines. the hollow lumen to acinar structure area ratio captures a key change in acinar structure which is challenging to assess by visual inspection. while the presence or absence of a hollow lumen is observable by eye, evaluating the relative size of the lumen compared to the overall acinar structure is difficult and poses subjectivity. this feature enabled us to quantitatively characterize this relationship and helps identify the significant changes between cancer grades. the loss of hollow lumens is associated with increasing cell division and cell survival within the acinar structure. in native breast tissue however, despite generally observing a decrease in the hollow lumen to acinar structure area ratio with the progression of cancer, precancerous at cell line exhibits an increase compared to the 10a samples. while it is unclear why this is the case, it could potentially be due to the cells becoming flatter rather than columnar in shape creating a larger hollow lumen. in addition to the changes in the hollow lumen morphology, the acinar structure elongation quantifies the subtle changes in the roundness of acini that are also difficult assess by eye. as shown by our results, we capture statistically significant differences in the acini elongation caused by the increasing metastatic capability, reflecting the progressive loss of structural integrity in acini as breast cancer develops. replacing these qualitative observations on the acini and hollow lumen morphology with these robust quantitative measurements enabled us to characterize the data more objectively. the density of basal membrane protein integrin 6 is quantified through multiple features as described in section 2.4.2 and found to reflect the metastatic potential of acinar structures. the quantitative and statistically significant changes identified in the analysis of integrin 6 distribution strongly correlate with our expectations based on the visual inspection of the acinar structures. it is seen that the 10a and at acini exhibited the highest amount of integrin 6 localization along the basal membrane, reflecting the presence of an intact, extracellular matrix basement membrane on the basal surface of these cells. in addition, it is observed that the acinar structures of more malignant cell lines showed dramatic loss in the localization of integrin 6 along the basal membrane of the cells and an increase in the internal localization of this protein, reflecting loss of the basement membrane. features extracted from ca1a acinar structures are significantly different from some of the features extracted from the ca1h and dcis acinar structures that can be explained by the degree of malignancy of this cell line. ca1a cells exhibit the highest malignancy of all the other cell lines with the advanced ability to metastasize. when cells are able to metastasize, cells may form secondary tumors called macrometastases. at this stage, these cells are able to adapt to their new environment in order to improve their abilities of survival. it is possible that the ca1a cells are behaving as a secondary tumor when placed in a basement membrane protein rich environment causing them to acquire some epithelial like phenotypes, such as increasing the basal membrane localization of integrin 6. thus, these features thoroughly capture the distribution of integrin 6 throughout the acinar structure as visualized and are functionally expected across the different grades of cancer. the features based on the density of integrin 3 as described in section 2.4.3 yield both expected and unexpected results. as reported in a previous study, we expect to observe different levels of total integrin 3 expression across the cell lines of varying metastatic potential. our expectations are confirmed by our results that the total integrin 3 expressions exhibit a decrease between the nonmalignant and noninvasive carcinomas and a higher expression is observed in the invasive carcinoma cell lines (compared to the noninvasive kcl and dcis cell line features). these features support the idea that integrin 3 switches its function from acting in a cell - cell adhesion manner to cell - ecm adhesion manner with increasing metastatic ability. as shown in figure 6(a), the basal continuity of integrin 3 is the lowest for the dcis cell lines as expected due to the low density of integrin 3 in this cell line. the continuity at the basal membrane displayed increased localization in the invasive carcinoma cell lines suggesting a cell - ecm adhesion role. the measurement of integrin 3 density in the exterior of the hollow lumen as shown in figure 6(d) determined that the progression of cancer yields increased localization of this protein within the hollow lumen. it was at similar levels for the 10a, at, and kcl cell lines however that the expression ratio increased in expression between the dcis through ca1a cells. this feature was developed to quantify the functional switch of integrin 3 from cell - cell adhesion to cell - ecm adhesion with progressing metastatic state. the increase in this feature suggests a switch from cell - cell adhesion to cell - ecm adhesions ; however, this change may be influenced by the reduction in the size of the hollow lumen and increased integrin 3 expression between cells throughout the acinar structure, thus hindering the robust characterization of the integrin 3 lateral localization. the amount of an integrin subunit that colocalizes with the other varies across the cell lines. basal membrane integrin 6 colocalizes with integrin 3 more in the tumorigenic cell lines (except the dcis) than the nontumorigenic cell line 10a. this could be due to the increasing internal expression of integrin 6 indicating a loss in cell polarity. another reason could be due to integrin 3 changing localization from the lateral membrane to the basal membrane as it switches functions from cell - cell adhesion to cell - ecm adhesions. it could also be a combination of the two since loss in cell polarity results in irregular localization of the proteins ; thus both integrin subunits are expressed throughout the cell membrane. this could be due to the low expression of integrin 3 in dcis cells as shown in figure 6(b) that yield higher amounts of isolated integrin 6 subunits in the acinar structures. the alternative comparison is the amount of integrin 3 that colocalizes with integrin 6. we observe that the noninvasive and the invasive cell lines exhibit higher colocalization than the nonmalignant cell lines. this confirms our suggestion that low expression of integrin 3 is the cause of the lowest colocalization of integrin 6 with integrin 3 in this cell line. in this case almost all of the integrin 3 is colocalized with integrin 6 due to its low expression levels and loss of cell polarity in the dcis acinar structures. the nonmalignant cell lines exhibit higher levels of colocalization than the noninvasive cell lines. by comparing the two colocalization features, we infer that this is likely due to integrin 3 localization at the basal and lateral membranes while integrin 6 localizes primarily at the basal membrane alone. this is reflected in 80% colocalization of integrin 6 with integrin 3 and 30% colocalization of integrin 3 with integrin 6 as shown in figure 6(c). on the other hand, the invasive carcinoma cell lines exhibit approximately 70% colocalization of the basal membrane integrin with the lateral membrane integrin and approximately 50% colocalization of the lateral membrane integrin with the basal membrane integrin. due to the approximately same values, this suggests that both integrin subunits have lost their specific localization and are expressed throughout. we also can further confirm this with the internal densities of both integrin 6 and integrin 3 having higher values. proposed features display statistical significance across the cell lines with varying metastatic abilities. these features have the potential for studying structure - function relationships in a controlled and quantitative system. this application is useful in identifying underlying mechanisms of cancer and the role of specific protein functions on acinar structures. in addition, this approach could be used to test the effects of potential chemotherapy targets and combinations of drugs on the structures of both nontumorigenic, precancerous, noninvasive carcinoma and invasive carcinoma cells in preliminary studies. also, with increasing medical imaging technology the future holds potential for many quantitative and computerized diagnostic tools and systems to aid doctors in diagnosis, treatment options, and prognosis. finally, these features could be applied to current histology samples when tagged with fluorescent antibodies to quantify complex structural features. in order to demonstrate the relevance of our approach to tissue samples obtained from human patients, we performed immunohistochemistry on frozen sections as described in section 2.6 following the same procedure for cell culture experiments as outlined from section 2.2 to section 2.5. images of nontumorigenic, precancerous, noninvasive, and invasive mammary gland tissue were collected using confocal microscopy. the random orientation of glands in sectioned material presented a challenge as the acinar structures in in vitro cultures are typically spherical in shape. in order to eliminate the longitudinal or oblique planes of sections from the present analysis, single optical sections of glands oriented roughly in crosssection that resemble the acinar formations in the in vitro cultures were cropped manually. although nonspecific alexa568 secondary antibody labeling of luminal contents was observed in some cases, visual inspection of these images indicates that the pattern of both integrin 6 and integrin 3 exhibit similar staining patterns to in vitro acinar structures. in our preliminary study, we identified 12 glands in the 9 images analyzed in this study. for each gland, we extracted the proposed features and performed grading using the svm - based classifier trained with the in vitro feature set. the in vivo test set was graded accurately except one nontumorigenic gland that was graded as noninvasive carcinoma. nevertheless, we note that developing a computer - aided grading system for the grading of in vivo tissue samples is beyond the scope of this paper and left as future work. in this paper, we present a method that enables quantitative characterization of 3d breast culture acini with varying metastatic potentials. specifically, we propose statistically significant features based on acinar structure morphology that capture differences between different grades of cancer that are difficult to assess under microscopic inspection. the experimental results demonstrate the efficacy of the proposed features to differentiate between the nonmalignant, noninvasive carcinoma, and invasive carcinoma grades of breast cancer with 89.0% accuracy. in addition, our preliminary studies indicate that our methodology can also be used for the grading of cancer in in vivo tissues provided that the captured tissue samples include cross - sectional portions of the glands. hence, our method demonstrates great promise to model morphology - function relationships within controlled 3d systems and hold potential as an automatic breast cancer prognostic tool in current histology samples. | prognosis of breast cancer is primarily predicted by the histological grading of the tumor, where pathologists manually evaluate microscopic characteristics of the tissue. this labor intensive process suffers from intra- and inter - observer variations ; thus, computer - aided systems that accomplish this assessment automatically are in high demand. we address this by developing an image analysis framework for the automated grading of breast cancer in in vitro three - dimensional breast epithelial acini through the characterization of acinar structure morphology. a set of statistically significant features for the characterization of acini morphology are exploited for the automated grading of six (mcf10 series) cell line cultures mimicking three grades of breast cancer along the metastatic cascade. in addition to capturing both expected and visually differentiable changes, we quantify subtle differences that pose a challenge to assess through microscopic inspection. our method achieves 89.0% accuracy in grading the acinar structures as nonmalignant, noninvasive carcinoma, and invasive carcinoma grades. we further demonstrate that the proposed methodology can be successfully applied for the grading of in vivo tissue samples albeit with additional constraints. these results indicate that the proposed features can be used to describe the relationship between the acini morphology and cellular function along the metastatic cascade. |
nowadays, total knee arthroplasty (tka) is one of the most common procedures in orthopedic surgery and about half of the patients need blood transfusion [1, 2 ]. however, it can cause some complications such as hemolytic and nonhemolytic transfusion reactions and transmission of infectious diseases and can also increase morbidity and mortality [3, 4 ]. thus, reducing the need for blood transfusion becomes a major concern for orthopedic surgeons. several strategies have been suggested to reduce intraoperative and perioperative blood loss and as a result reduce blood transfusion [58 ]. one of them is the use of pharmacologic agents such as tranexamic acid (ta). previous studies showed that there is a transitional activation of the fibrinolytic system after surgery which can be indices by the use of tourniquets. ta is a synthetic derivative of lysin that competitively blocks the lysine - binding sites in the plasmin and plasminogen activator molecules and its usage has become more popular in recent years. several application methods such as oral, local, and intravenous methods have been described and each one has its own advantages and disadvantages. there are previous studies that have focused on the administration of intravenous ta with different protocols. however, in all of these studies there were deficiencies such as lack of outcome measure, study design, or sample size. there is no consensus on its use protocol and the question still remains about the dosage, timing, and the administration method. the null hypothesis of this study was that ta does not have an impaction on blood loss after tka. this hypothesis was evaluated by measuring the decrease in hb, the drain output volume, and the volume of blood needed to be transfused. this study was a double - blind randomized clinical trial which was performed at kashani teaching hospital, a tertiary referral center in isfahan, iran. during the period of study (january 2012 to march 2013) a total number of 95 patients were enrolled in the study. patients with previous history of cerebrovascular disease, thromboembolism, myocardial infarction, and those who were candidates for bilateral tka were excluded. two grams of intravenous cephazolin (exir, borujerd, iran) was administered thirty minutes before the surgery. all operations were performed in the morning between 8 am and 12 pm by a single skilled surgeon (mm) using posterior cruciate substituting cemented total knee prosthetics (zimmer, warsaw, in). surgeries were performed through an anterior skin incision from 8 centimeters above the patella to 2 centimeters distal to the tibial tubercle. a pneumatic tourniquet was used which inflated before the skin incision and deflated just before the soft tissue repair at the end of surgery. during the surgery sterilized gauzes were used for blood absorption while electrical coater and suction were established to control bleeding. at the end of surgery during soft tissue repair in extension position a low vacuum intra - articular drain was used for postoperative wound drainage which was removed 48 hours after surgery. eligible patients were randomly assigned to one of two groups : in the first group (group t) they received intravenous (iv) tranexamic acid (caspian tamin pharmaceutical co., rasht, iran) 500 mg diluted in 100 ml of 0.9% saline chloride twice ; the first dose was infused in over 10 minutes about 30 minutes before inflation of tourniquet and the second dose after staying in the recovery room for three hours. in the second group (group p), patients received iv slow infusion of 100 ml of 0.9% sodium chloride twice. the timing was the same as that of group t. all patients were mobilized on the first day after surgery. dvt prophylaxis was performed by low molecular weight heparin (clexane, sanofi, uk) 40 mg / day postoperatively which continued for 14 days. postoperative transfusion was done in patients with hemoglobin level less than 8 g / dl and less than 10 g / dl in patients with comorbidities and untolerated anemic symptoms. postoperative complications including hyper coagulable states such as dvt, pte, myocardial infarction, and cerebrovascular events were evaluated by means of clinical signs and symptoms. patients were discharged if they had been mobilized and the wound was dry without any discharge. the primary outcome of this study was the hb level 48 hours after surgery which was evaluated by one of the study investigators (ms). the secondary outcomes were hb levels, 6 and 24 hours after surgery, drain output during the first 48 hours after surgery, and blood product administration after surgery and duration of hospitalization. eligible patients were allocated to one of the two groups using random allocation software, which has been used for this purpose in several previous studies. neither the patient nor the physician who evaluated the study outcomes knew whether a patient was in group t or p. sample size was calculated using a statistical formula considering = 0.05 and = 0.2 expecting at least 0.5 gr / dl difference in hb levels between the two study groups. with these inputs qualitative variables were compared using the chi - square test and presented as number (%). quantitative variables had normal distribution and were compared using the paired t - test and presented as mean standard deviation. the protocol of this study was approved in the review board of isfahan university of medical sciences (number : 392114). four patients did not consent to participate in the research project and one patient was a candidate for bilateral tka and, thus, the mentioned 5 patients were excluded from the study. there was no significant difference in the demographic variables age and sex between the study groups (table 1). hb levels 48 hours after surgery were 10.92 0.97 (gr / dl) and 10.23 0.98 (gr / dl) for groups t and p, respectively, and the difference was statistically significant (p = 0.001). the differences in hb levels between groups, 6 and 24 hours after surgery, were also found to be statistically significant (p = 0.04 and 0.001, resp.). drain outputs were 268.66 116.68 milliliters and 478.11 254.19 milliliters for groups t and p, respectively, and the difference was statistically significant (p = 0.001). in other words, the mean drain output of patients in group t was approximately 43% less than that of patients in group p. patients in group p received 1.28 0.75 units of packed cells while patients in group t received 0.26 0.49 units (p = 0.001) which shows that blood transfusion in group t occurred nearly 79% less than in group p. duration of hospitalization was 6.02 2.97 days in group t and 6.93 2.71 days in group p. the difference was not statistically significant (p = n.s.). there were no instances of dvt or any other adverse reactions for blood transfusion in study patients. our findings reject the null hypothesis of the study and showed that usage of low dose perioperative ta reduces blood loss and the need for blood transfusion in patients undergoing primary unilateral tka. in this study we evaluated the effect of the reception of 500 mg intravenous ta once before and once after surgery on postoperative blood loss by means of measuring the hb levels which was done several times after surgery. it was found that twice receiving 500 mg of ta, once 30 minutes before surgery, and once three hours after surgery significantly reduces the loss of hb, drain volume, and need for blood transfusion.. there are some previous studies that have evaluated the impact of intravenous ta on blood loss after tka with different doses and regimens. the administration dose in this group of studies was 1015 mg / kg (1 gram or lower). administered 15 mg / kg of ta and found a significant decrease in drain volume and transfusion rate but did not find a significant decrease in the drop of hb levels. sarzaeem. conducted a well - designed double - blind randomized clinical trial which showed that administration of a single 500 mg dose of ta significantly reduces the need for blood transfusion and reduces hb drop and drain output after surgery. in another randomized trial, maniar. compared four methods of ta administration and showed that a single dose of intravenous ta did not give effective results. in other studies orpen. and mcconnell. did not find significant reduction in hb drop, transfusion rate, and drain output while lin. administered 10 mg / kg of ta and showed significant reduction in total blood loss and transfusion rate. as can be seen, however, it is the authors ' belief that the reason in some studies no significant changes were seen in the outcome was because of their low sample sizes and that studies with larger sample sizes showed the effectiveness of ta. in the second group there are studies that evaluated the intermediate dose regimens (1 - 2 grams). most of these studies administered 1015 mg / kg for the first dose and another 1015 mg / kg during the first 12 hours after surgery [10, 1927 ]. in the last group there are studies in which high doses of ta (more than 2 grams) were administered [2830 ]. they administered ta with different protocols in doses larger than those of the second group. used 15 mg / kg of ta before the surgery and the same dose every 8 hours for 3 days after surgery and found a significant reduction in hb level drop. in another study dahuja used the same regimen for 2 days and reached results similar to those achieved by jansen el al. most studies in the second and third group revealed that ta is effective in reducing blood loss and hb drop after surgery, a result studies in the first group did not reach. another important variable that was evaluated in this study was the hospitalization period of study patients. few of the previous studies have considered this item and most of them concluded that ta may reduce the duration of hospital stay [31, 32 ]. in this study it was found that although ta reduces hb drop and the need for transfusion, it does not have a significant impact on the period of hospitalization. this issue should be considered in further cost effectiveness studies for the routine use of ta in tka. one of the strengths of this study is that all surgeries were performed by a single expert surgeon and a single prosthetic brand was used which excludes the possible role of technical effects on our results. other downsides are that the diagnosis of ta complications such as dvt or pte was based on clinical signs and symptoms, not the gold standard diagnostic tests, and that other nonthrombotic adverse events of ta were not evaluated. in conclusion it is deduced that perioperative intravenous administration of ta in two 500 mg doses, first dose before and second dose three hours after surgery, reduces hb drop and drain output volume and the need for blood transfusion after tka. the failure of previous studies to show this effect is due to their low sample size and study design. on the other hand this study showed that low dose perioperative intravenous ta does not influence the hospitalization period. | background and objectives. the null hypothesis of this study was that ta has no effect on postsurgical bleeding in patients undergoing tka. methods. this study was a double - blind randomized trial. in the first group (t) patients received 500 mg of intravenous tranexamic acid (ta) twice (once preoperatively and once 3 hours postoperatively) and in the second group (p) they received slow infusion of normal saline as placebo. the primary outcome of the study was the level of hb 48 hours after surgery. results. hb levels 48 hours after surgery as the primary outcome were 10.92 0.97 and 10.23 0.98 (g / dl) in groups t and p, respectively, and the difference was statistically significant (p = 0.001). statistically significant differences were also observed in hb levels 6 and 24 hours after surgery, the drain output 48 hours after surgery, and the number of units of packed cells transfused between study groups (p < 0.05). there was no significant difference in duration of hospitalization between the study groups (p = n.s.). conclusions. the low dose perioperative intravenous ta significantly reduces blood loss, requirement for blood transfusion, and drain output in patients undergoing tka. however, duration of hospitalization did not change significantly. |
the architecture and function of cellular interaction networks underpin the complex behavior of living systems. the network responses to both internal cues and exogenous stimuli and how environmental and/or genetic perturbations affect these responses are critical for understanding the molecular basis of human disease (13). significant efforts have been made to chart the interaction networks of model organisms (47), based on advances in experimental techniques that allow the systematic exploration of biological interactions, both in vivo and in vitro (8,9). the integration of these various experimental datasets has begun to enable computational models of cellular interaction networks and the prediction of individual gene function in the regulation of cellular physiology. the systematic curation of biological data, including protein and genetic interactions, is essential for computational biology and for the interpretation of genetic variation and disease associations revealed by genome - sequencing efforts (10,11). biological interaction databases allow curated experimental datasets that would otherwise be dispersed in the biomedical literature to be accessed and exploited. these databases thus act as central repositories that provide a wealth of interaction data in a unified and common format, and thereby facilitate the exploration, visualization and integrative analysis of biological interaction networks. the biological general repository for interaction datasets (biogrid : http://thebiogrid.org) is an open access database committed to the annotation of genetic and physical interactions between genes or gene products across all major model organism species. biogrid is now a widely used resource that provides interaction datasets directly to the biological and computational communities, as well as to several model organism database (mod) partners. biogrid data records can be used by the biomedical research community to generate and explore specific hypotheses about gene and network function, and as a benchmark for newly generated experimental high - throughput datasets. since our 2011 nar database report (12), the number of interactions curated and amassed in biogrid has increased by > 30%. as of september 2012 (version 3.1.92), biogrid contains 527 569 protein and genetic interactions, of which 360 375 are non - redundant interactions. these interactions correspond to 309 819 (209 354 non - redundant) protein interactions and 217 750 (157 849 non - redundant) genetic interactions (table 1). the data were directly extracted from 33 858 manually annotated peer - reviewed publications, which were identified from the corpus of biomedical literature by keyword searches, text - mining approaches and manual inspection of candidate abstracts. all biogrid interaction records are directly mapped to experimental evidence in the supporting publication, as classified by a structured set of evidence codes (12). table 1.increase in biogrid data content since 2011 nar database updateorganismtypeaugust 2010 (3.0.67)september 2012 (3.1.92)nodesedgespublicationsnodesedgespublicationsarabidopsis thalianapi17354719747591516 4761118gi881745510718862caenorhabditis eleganspi28134663122927501093gi1030211251109232622drosophila melanogasterpi739624 480167799835 843314gi98299941466102399341468homo sapienspi946748 36810 20314 896123 43617 134gi47946317812911609237saccharomyces cerevisiaepi578390 76954446003114 5066601gi5357146 08156065561189 6926686schizosaccharomyces pombepi1441401976917736019968gi134011 527953190714 0151158other organismsall22882985830843515 9782724totalall30 665347 96623 45144 515527 56933 858data drawn from monthly release 3.0.67 and 3.1.92 of biogrid. increase in biogrid data content since 2011 nar database update data drawn from monthly release 3.0.67 and 3.1.92 of biogrid. biogrid curation is focused on the parallel approaches of model organism - oriented curation and themed curation in human biology and disease. in addition to housing curated interaction data for more than 30 organisms, biogrid has achieved exhaustive annotation of the literature for the budding yeast saccharomyces cerevisiae (304 198 interactions), the fission yeast schizosaccharomyces pombe (20 034 interactions) and the model plant arabidopsis thaliana (16 664 interactions) (table 1). these datasets are updated monthly and are directly linked from the respective mods, saccharomyces genome database (sgd) (13), pombase (14) and the arabidopsis information resource (tair) (15). the complete manual annotation of all human interaction data documented in the biomedical literature remains a daunting task due to the sheer number of potentially relevant publications, now well in excess of 12 million papers in pubmed. to enable meaningful insights into human interaction networks, current focused projects include central signaling conduits implicated in development and disease, such as the target of rapamycin (tor), wnt and tgf- networks, disease - centric networks in breast cancer and hiv, and vital global processes such as the chromatin modification (cm) (16) and ubiquitin proteasome systems (ups). for example, the complex network of chromatin modifications that controls gene expression is dictated by at least 470 human genes annotated by the gene ontology (go) process term based on searches and text mining with this gene set, we recently curated more than 15 000 prioritized publications to yield 57 141 protein interactions from 7561 papers. in another example of a global cellular function, conjugation of the small conserved protein ubiquitin to myriad substrates controls the stability, activity and localization of most of the proteome (17). we manually annotated a set of 1140 genes that mediate the core functions of the ups, including e1, e2 and e3 enzymes, deubiquitinating enzymes, ubiquitin - binding domain proteins, and proteasome core and auxiliary subunits. we have currently curated more than 5800 publications that bear evidence for 48 679 interactions (24 400 non - redundant interactions) in the ups. these and other anticipated themed datasets will facilitate the prediction of individual gene function and network behavior within the major cellular regulatory systems. curation for biogrid is performed by a dedicated team of phd - level curators. a web - based interaction management system (ims) is used to build prioritized publication queues for different projects and facilitate the curation process through structured pull - down menus. curators also help guide direct deposition by authors, which is particularly useful for pre - publication annotation of large - scale datasets and allows immediate public release of the data upon publication. within the past 2 years, biogrid curators have begun to use text - mining tools to prioritize the relevant literature for each curation project (18). in turn, biogrid supports the text - mining community by providing a gold - standard collection of manually curated interactions for the biocreative challenge (1922), a community - wide effort for evaluating text mining and information extraction systems applied to the biological domain. we have also established collaborations with wormbase (23) and the development team for the textpresso text - mining tool (24). for example, the curation queue for the wnt - signaling network is prioritized based on text - mining results by textpresso support vector machine (svm) analyses, and textpresso for wnt has also been set up as a text - mining interface to facilitate our curation. the curation workflow consists of three major steps : (i) triage of the literature of interest by text - mining tools and/or interaction - directed pubmed queries ; (ii) curation, annotation and tracking of interaction data through the web - based ims and (iii) monthly public release of interaction data records. the curation workflow consists of three major steps : (i) triage of the literature of interest by text - mining tools and/or interaction - directed pubmed queries ; (ii) curation, annotation and tracking of interaction data through the web - based ims and (iii) monthly public release of interaction data records. for example, in collaboration with sgd, biogrid curators have used the yeast phenotype ontology (ypo) developed at sgd to assign structured phenotypes to over 200 000 budding and fission yeast genetic interactions. collaborations are also underway with wormbase (23), zfin (25), flybase (26), mgi (27) and cgd (28) to coordinate interaction curation, and thereby leverage expertise and in - house mod data that are relevant to biological interactions. for example, go evidence codes generated by the mods are often derived from publications that are likely to contain interaction data. collaborations with the mods have also led to an improved curation approach for higher organisms by implementation of species - specific phenotype ontologies and the broadening of interaction terms to capture more complex genetic interaction data. the different biology of various organisms used in biomedical research presents a formidable challenge in the annotation and interpretation of genetic interactions, and in the reconciliation of structured phenotypes across all species. in order to meet this challenge, in conjunction with wormbase (23), and supported by other mods such as sgd (13), cgd (28), pombase (14), flybase (26), tair (15) and zfin (25), we have developed a universal genetic interaction (gi) ontology that enables the annotation of more complex phenotypic outcomes associated with genetic interactions from higher organisms. the genetic interaction ontology has been submitted to the psi - mi editorial committee (29) and will be made publicly available with the next official psi - mi ontology release. in order to ensure consistent reliability and accessibility of the biogrid web interface, we have migrated the biogrid to a cloud - based server system with a third party provider that provides up - to - date hardware, facile operating system upgrades and improved fault tolerance. biogrid 3.2 supports 28 million systematic names, aliases, official symbols and external identifiers from ensembl (30), uniprotkb (31), ncbi entrez - gene (32), genbank (33), sgd (13), wormbase (23), flybase (26), hgnc (34), mgd (27), tair (15), vectorbase (35), beebase (36), zfin (25) and hprd (37), among other sources. biogrid currently also supports annotation for more than 85 organisms and contains interaction data for more than 30 different species. the biogrid web service (webservice.thebiogrid.org) has been completely redesigned to run off the new decentralized database architecture for better access and maintenance by developers. the new web service will facilitate the incorporation of biogrid data in other databases and applications. the biogrid 3.2 web interface has been upgraded to include an integrated post - translational modification (ptm) viewer. this viewer highlights ptm sites on protein sequences and incorporates much of the functionality available in phosphogrid (figure 2). ptm sites are colored within protein sequences according to the modification type, with clickable functions that display details such as publications, evidence codes and enzymatic relationships. the biogrid currently supports both phosphorylation and ubiquitination sites and will expand to cover other major ptms across all supported species. (c) pop - up with links to publications that document ptm evidence and relationships. (c) pop - up with links to publications that document ptm evidence and relationships. (f) custom gene tags. to facilitate exploration of the biological datasets in biogrid, we have developed a new gene tag feature for specific annotation, including membership in network - specific cohorts, gene functions or detailed attributes such as ptm site information. these gene tags can be used to build customized datasets for downloads and to define criteria for building and maintaining project - specific datasets, as for example defined by themed curation projects. these datasets may be maintained in concert with monthly biogrid updates and are subject to strict version controls that allow reference to specific builds for data analysis. project - specific datasets such as for the cm and ups datasets will be accessed through custom gateways within the biogrid that encompass genes, interactions, publications and biological context for the project. graphical network representation provides an intuitive summary of an interaction query dataset and, when appropriately configured with a dynamic interface, can be used to inspect and further query a network of interest. however, a drawback of current network visualization software is that the graphical output becomes cluttered as network complexity increases. to address this issue, we have developed a new dynamic biogrid interaction viewer that is based on a simple visual layout and which has user - friendly filters (figure 3). in the biogrid viewer, all interaction nodes are distributed in a circular layout with the query gene in the center. the properties of individual interactions are visualized by moving the tooltip over the interactor of interest to highlight gene information, including species type, gene acronym, gene identifier and number of interactions in biogrid. to facilitate retrieval of data types of interest, the viewer provides the user with a check - box filter to reduce the complexity of the graph. the user can thus choose to view only those interactions supported by particular types of experimental evidence, low- versus high - throughput data or species - specific data. the network can also be extended to include all known interactions between interactors for the query. results of the filtered and/or extended query are downloadable in tab2 format with a single click. the biogrid viewer is based on an open source widget, downloadable from github (https://github.com), and is embeddable in any web page. network images in the viewer are rendered from interactions retrieved from the biogrid rest service. the viewer is implemented using the d3js (http://d3js.org/) library and requires a browser that supports javascript and svg, which includes modern browsers such as chrome, firefox and safari. (a) in the example shown the viewer returns all the interactions of the query gene / protein and interactions between the hit genes / protein. (b) network view can be simplified by several available filters. in this example, all genetic interactions have been filtered out. (a) in the example shown the viewer returns all the interactions of the query gene / protein and interactions between the hit genes / protein. (b) network view can be simplified by several available filters. in this example, all genetic interactions have been filtered out. see text for further details. biogrid datasets are updated and archived every month and can be freely accessed through widely used community resources over the internet and a number of dedicated bioinformatic tools. records are now available interactively through the biogrid web search page for download in a variety of xml (psi - mi 1.0, psi - mi 2.5) and tabular (tab, tab2 and mitab) formats and are also available through ncbi entrez - gene (32), droid (38) and germonline (39), through several major mods such as flybase (26), tair (15), sgd (13) and pombase (14), and through meta - databases such as string (40), irefindex (41) and pathway commons (42). biogrid datasets can also be directly interrogated through network visualization and analysis suites, including the original osprey viewer (43), cytoscape (44) and genemania (45). notably, biogrid data have recently been dynamically integrated into the prohits lims system (46) in order to allow real - time comparison of experimental mass spectrometry data to published data housed in biogrid. in 2012, google analytics reported that the biogrid received on average 69 237 page views and 10 110 unique visitors per month, versus 64 298 page views and 9928 unique visitors per month in 2011. biogrid data files were downloaded on average 6900 times per month, compared with 6400 downloads per month in 2011. these statistics do not include the widespread dissemination by the various partner websites listed above that host biogrid interaction data. the biogrid user base is located primarily in the usa (37%), followed by uk (8%), germany (7%), canada (6%), japan (6%), china (5%), france (4%), india (4%), spain (2%) and all other countries (25%). in order to facilitate the access and interoperability of biogrid data with multiple platforms, we recently developed a biogrid representational state transfer (rest) service and a biogrid plug - in for the widely used cytoscape visualization system (47). the biogrid rest service grants full url - based access to the biogrid data and also provides the user with specific parameters to filter the data by various attributes. for example, the rest service drives a related tool called biogrid webgraph that generates network representations from user - provided gene lists. the dedicated cytoscape plug - in acts as a web service client that provides facile import and filtering of the full biogrid dataset for visualization and analysis in cytoscape (44). the biogrid will continue to provide the biomedical and biological research communities with up - to - date, high - quality and extensively annotated protein and genetic interaction data, along with the requisite software tools to search, visualize and analyze interaction datasets. biogrid will also continue to participate in the imex consortium of interaction databases (48). in addition to ongoing curation of interactions for the major model organism species, we will expand species coverage in order to facilitate interolog analyses, in particular to enable comparison of interaction networks across model organism species and humans. we have recently initiated the systematic annotation of protein and genetic interactions for candida albicans, which is an important emerging model system and a prevalent human pathogen. we have also initiated the annotation of the human hiv1 interactome in the context of the linking animal models to human disease initiative (see http://www.lamhdi.org). these and other nascent projects will be facilitated by the development of more efficient text - mining tools through collaborations with textpresso and others. this cross - species and themed approach to curation will enable new insights into human biology and disease by integration of interaction data from multiple model organism systems. the national institutes of health national center for research resources [r01rr024031 and r24rr032659 to m.t. and k.d. ] ; the biotechnology and biological sciences research council [bb / f010486/1 to m.t. ] ; the canadian institutes of health research [frn 82940 to m.t. ] ; the european commission fp7 program [2007 - 223411 to m.t. ] and a genome qubec international recruitment award and a canada research chair in systems and synthetic biology [to m.t. ]. | the biological general repository for interaction datasets (biogrid : http//thebiogrid.org) is an open access archive of genetic and protein interactions that are curated from the primary biomedical literature for all major model organism species. as of september 2012, biogrid houses more than 500 000 manually annotated interactions from more than 30 model organisms. biogrid maintains complete curation coverage of the literature for the budding yeast saccharomyces cerevisiae, the fission yeast schizosaccharomyces pombe and the model plant arabidopsis thaliana. a number of themed curation projects in areas of biomedical importance are also supported. biogrid has established collaborations and/or shares data records for the annotation of interactions and phenotypes with most major model organism databases, including saccharomyces genome database, pombase, wormbase, flybase and the arabidopsis information resource. biogrid also actively engages with the text - mining community to benchmark and deploy automated tools to expedite curation workflows. biogrid data are freely accessible through both a user - defined interactive interface and in batch downloads in a wide variety of formats, including psi - mi2.5 and tab - delimited files. biogrid records can also be interrogated and analyzed with a series of new bioinformatics tools, which include a post - translational modification viewer, a graphical viewer, a rest service and a cytoscape plugin. |
skin diseases are not usually recognized as a major public health problem in developing countries, despite the fact that a recent report by the world health organization (who) estimates that 2187% of the general population in developing countries has skin disease. we review that the current burden of skin disease in africa and how hiv / aids has led to an increase in opportunistic skin infections, ectoparasitic infestations, and other manifestations of systemic infections. we then review the current state of dermatology training in africa, ongoing efforts to address this need, and propose potential solutions to improve dermatologic care for patients with hiv / aids in africa. problems with the skin are among the main reasons for seeking care, accounting for up to 24% of primary care visits, and are one of the most common causes of morbidity. transmissible processes, including infections and infestations, make up the majority of skin disease in many sub - saharan african countries accounting for 85% of skin disease in tanzania, 78% in malawi, 71.5% in ethiopia, and 40.1% in uganda. in addition to the immense burden of skin disease in africa, diseases such as dermatitis, prurigo, scabies, and papular urticaria are commonly either untreated or over treated with strong topical steroids and antibiotics have been found to cause considerable disability. one study conducted in southwestern ethiopia, in a community in which parasitic infestations, bacterial and fungal infections, and endemic nonfilarial elephantiasis are prevalent, found that 67% of households not reporting any skin conditions actually had at least one household member with a skin disease. these data reveal that the health consequences of dermatologic disease extend beyond the individual and, in fact, the public health is at risk since the common skin conditions include parasitic infestations and infections. the epidemic of human immunodeficiency virus (hiv)/acquired immunodeficiency syndrome (aids) in africa further adds to the burden of skin disease. dermatologists have contributed significantly to our knowledge base about hiv / aids and have played an important role in educating about the clinical manifestations historically. additionally, dermatology has a significant role in managing the side effects associated with therapy. through its literature on skin - related quality of life and through experience with managing diseases like leprosy that have a huge stigma, dermatologists are able to contribute to the management of hiv / aids - associated diseases. however dermatology is only just emerging as an expert in epidemiology, and although long twinned with sexually transmitted infections, it remains weak on public health roles such as contact tracing. according to the hiv / aids epidemiological surveillance report for the who african region 2005 update, recent trends in hiv prevalence show that nearly 30% of women aged 15 to 49 attending antenatal clinics in southern africa are infected. more than 60% of all people living with hiv / aids globally live in sub - saharan africa. skin manifestations are frequently the first sign of hiv infection and conversion to aids and 90% of individuals with hiv / aids are diagnosed with skin disease at some point during the course of their illness. furthermore, the number of hospital admissions for dermatologic diseases in hiv / aids individuals, as a proportion of the admissions for dermatologic disease in all individuals, have dramatically increased from nearly 40% to 60% in various regions of south africa. as a continent with a high prevalence of hiv / aids, africa is in need of appropriate and adequate management of dermatologic disease. in many developing countries, health care centers are often run by clinical officers or nurses, rather than physicians, who act as the primary care workers but have very limited training in diagnosing dermatologic conditions. these primary care providers can be taught to diagnose and treat skin diseases commonly seen in the primary care setting, including highly prevalent dermatologic diseases such as pyoderma and scabies. a study conducted in lilongwe, malawi, from january 1988 till june 1989 examined a total of 34,002 patients in which the prevalence of pyoderma was found to be 10.4% in adults and 26% in children, and the prevalence of scabies was 31.6% in adults and 40.4% in children. however, primary care providers may have difficulty diagnosing and treating other important skin diseases, such as dermatitis, infections, genodermatoses, papulosquamous diseases, and pigmentary disorders, which often need referrals to specialized dermatology centers.[1361316 ] moreover, some patients may be dissatisfied with the dermatologic care they receive from their primary care providers. a study by figueroa. ethiopia refused free evaluations by dermatologists, possibly due to the dissatisfaction with previous unsuccessful treatments. this same study also found that these patients, most of whom had access only to the local health facility, were spending 50100% of their cash income on treatments for skin diseases, which were ineffective in 6374% of cases. it can be shown that given appropriate dermatologic management, these patients are not only more satisfied, but also waste less income on ineffective treatments. the current who initiative to relieve poverty is helped by reducing the cost of self - treatment for disfigurement and discomfort of skin disease by such therapies that are both ineffective and, as with depigmenting creams, harmful. the who also recently outlined the need for a greater emphasis in training of health practitioners at both the primary care and specialist levels in the identification and management of dermatologic problems, and a public health focus on prevention. africa suffers from a scarcity of dermatologists, compounded by the fact that most dermatologists are centered near urban areas and are not accessible to 70% of the rural population. for example, it is estimated that nigeria has approximately 30 formally trained dermatologists serving a population of 120 million and a country of 36 states. these dermatologists tend to aggregate toward the southern part of nigeria and around three large towns. dermatologists have not practiced in the northwestern region of nigeria in the recent years and, therefore, patients with skin diseases have relied on health care personnel who are not fully trained in dermatologic care. furthermore, approximately one - third of the dermatologists in nigeria are in private practice, leaving only two - thirds who work in teaching, specialist, or general hospitals, further reducing access for those with limited incomes. with the exception of egypt and south africa, currently there are few dermatology training programs offered in africa. furthermore, for decades those trained in the developed world have emigrated there or, if returning to their country of origin, have set up an urban - based private practice. to address this issue, the international foundation for dermatology (ifd), a non - profit organization that aims to improve dermatologic care in underserved areas of developing countries, established the regional dermatology training center (rdtc) in tanzania in 1992. the rdtc provides a 2 year dermatologic training program for experienced medical assistants and nurses from various sub - saharan african countries, including kenya, malawi, botswana, cameroon, swaziland, uganda, ghana, and sierra leone. the program incorporates two international conferences for community dermatology, two curriculum workshops, and documents prepared by the international committee of dermatology, which are approved by the international league of dermatology societies and the who, entitled healthy skin for all. the graduates serve as dermatologic resources in their countries, since many of the countries from where they come have few or no dermatologists. in addition, a 4 year dermatology residency program was established at the rdtc in 1998. this is only one of two dermatology residency training programs in all of east and central africa and offers one residency position per year. due to the limited number of dermatology training programs in africa, the dermatology residents trained at the rdtc have come from tanzania as well as other countries, including ethiopia and botswana. the faculty and residents play a critical role in the dermatologic care of people living in tanzania and its surrounding countries, as it is one of few tertiary care referral hospitals with a specialized dermatology clinic. the mbarara university of science and technology in uganda also provides a 3 year dermatology residency program, which has matriculated one new dermatologist each year since 2004. these new dermatologists will help improve dermatologic care currently provided by the approximately six dermatologists and eight dermatology officers serving the twenty - five million people living in uganda. more recently in 2006, ethiopia founded a training scheme for dermatologists assisted by others from the united kingdom (uk) and italy. other creative and successful skin disease training programs implemented in the primary care setting include 1 day training programs on the basic management of common skin diseases in the sub - saharan french - speaking african country of mali. this program focused on a group of priority skin diseases and used an algorithm for the standardized management of common skin disorders prevalent in the area. another program implemented in western kenya trained community health workers in identifying and treating common dermatoses. this program used on - the - spot training with a dermatologist as well as one weekend seminar each year. furthermore, training schemes are available in europe, in which the uk, london, and cardiff have provided diplomas in dermatology. in addition, the international journal community dermatology, published by ifd and supported by leading international dermatologists, is being distributed to health care workers in rural areas of africa and other developing countries. this annual journal offers up - to - date information on the diagnosis and treatment of skin diseases, focusing on resources that are available in those rural areas. lastly, the rdtc provides postgraduate continuing medical education by an international faculty each january for returning graduates. however, those graduates living outside central and east africa often can not afford to attend the annual continuing medical education held at the rdtc in moshi, tanzania. a dermatology training experience has been established in gaborone, botswana for us or canadian - based senior dermatology residents which is sponsored by the american academy of dermatology through a partnership with the university of pennsylvania. teledermatology, while promising in many respects, will likely only serve as an adjunct service to sustainable dermatologic education and care in africa. providing remote teledermatology services is extremely helpful for individual difficult cases, but will be insufficient to fill the global need for dermatologic care. the work of organizations such as the ifd and icthes should be commended as they have made significant contributions in the care of individuals with skin diseases in developing regions. however, there still is much room for improvement in dermatology training and in managing skin disease. possible directions include the following : the representation of skin disease of non - caucasians is limited in educational resources. ebede and papier found that only 2% of the educational opportunities available at the american academy of dermatology annual meeting focused on ethnic or dark skin. somewhat more favorably, patients with ethnic or dark skin were represented in 4% to 19% of widely used dermatology textbooks. this limited representation of patients with darker skin may pose challenges in the training of dermatologic disease in africa, since individuals with darker skin may vary in their presentation of common skin diseases and require different management. textbooks written for the developed world emphasize the latest therapies, many of which are too expensive, unavailable, and not cost - effective for the developing world. these texts give insufficient detailed information about low technology and low cost therapies, e.g. the exact use of honey for wound healing or sunflower seed oil for atopic dermatitis. therefore, educational resources including images and discussion of patients with darker skin and tropical diseases, as well as information on the use of low cost therapies, would be of great value for dermatology training in africa and other developing countries. although most training programs in africa concentrate on modern biomedical treatment methods, many individuals prefer and can only afford traditional medicine, which is also sustainable and locally available, as for example honey. forty - three percent of individuals living in rural tanzania would rather consult a traditional healer than go to a modern health facility for their skin problems. the global utilization of traditional medicine (alternative and complementary medicine when transferred from traditional practice) is of public health interest. in asia, in africa, such a tradition is unwritten and is more difficult to collect evidence on the safety and efficacy relating to preparation and dosage schedules. some herbals such as aloe or bee products, including honey and propolis, are now shared with other continents but have untested differences due to soil and climate. it is of special interest in the management of a global epidemic such as aids, if only because of the extent of its utilization and the reports of efficacy especially from asia. the possible value of incorporating traditional medicine into care in developing countries is exemplified by the recent establishment of a siddha hospital in india by the non - governmental organization gandeepam. the medical practices of this hospital include using herbal preparations in the treatment of hiv / aids and hiv / aids - related illnesses. one newly organized group hoping to improve education and point - of - care service regarding dermatologic diseases in africa is the international dermatology educational alliance (idea). the idea group, in collaboration with several academic groups in africa, aims to develop and implement a hiv / aids - focused dermatologic diagnostic decision support software program for use in african countries. this will include images of skin disease in african patients as well as realistic diagnostic and treatment options available in africa. this educational program and point - of - care tool will be used to train general physicians, assistant medical officers, and community health workers in africa in diagnosing and properly managing aids - related skin diseases. technology advances will make information and resource sharing between developed and developing countries with limited resources possible. the application of these advances in developing countries with poor infrastructure can be a challenging venture. however, a combination of technology - based tools where available with traditional (and non - traditional) low - technology educational methods can serve to improve the care of skin disease and hiv in african patients. inclusion of these educational tools in the primary care setting is crucial, especially since there are a limited number of dermatologists and dermatology residency training programs in africa. idea is a new organization formed to help meet the needs of people suffering from skin disease in limited resource settings, with a particular focus on the consequences of hiv / aids or the side effects of its therapy. it aims to provide teaching materials of high quality pertinent for use by medical personnel in africa. this intervention aims to improve diagnostic skills and eliminate the consequent inappropriate prescribing often costly to the recipient. it hopes to educate health care providers, including traditional healers, and will especially focus on the common problems of scabies, fungal infections, and pyodermas that affect the quality of life across all age groups and especially so in the patient population affected by aids. the idea group hopes that through the creation, validation, and wide distribution of these educational tools focused on skin disease diagnosis and management, particularly in those with hiv, a positive impact can be made in improving the burden of skin disease for those living in an area of the world desperately in need of improved health care education, supplies, and sustainable delivery methods. computerized diagnostic decision support systems and computerized dermatology educational tools have been used successfully in medical schools and free clinics in the united states to improve dermatology education to medical students and primary care providers. when used in conjunction with teledermatology for patients in low resource settings, computerized educational systems and diagnostic decision support systems empower the primary care doctors during direct patient care. measuring the impact of educational initiatives always presents a challenge, but usage statistics and surveys of medical providers and patients that take part in the programs is usually the most direct measurement of a program 's success. however, due to the limitations of the medical systems in many african countries, studies designed to measure actual patient outcomes before and after implementation of these programs may be restricted by costs. ebede and papier found that only 2% of the educational opportunities available at the american academy of dermatology annual meeting focused on ethnic or dark skin. somewhat more favorably, patients with ethnic or dark skin were represented in 4% to 19% of widely used dermatology textbooks. this limited representation of patients with darker skin may pose challenges in the training of dermatologic disease in africa, since individuals with darker skin may vary in their presentation of common skin diseases and require different management. textbooks written for the developed world emphasize the latest therapies, many of which are too expensive, unavailable, and not cost - effective for the developing world. these texts give insufficient detailed information about low technology and low cost therapies, e.g. the exact use of honey for wound healing or sunflower seed oil for atopic dermatitis. therefore, educational resources including images and discussion of patients with darker skin and tropical diseases, as well as information on the use of low cost therapies, would be of great value for dermatology training in africa and other developing countries. although most training programs in africa concentrate on modern biomedical treatment methods, many individuals prefer and can only afford traditional medicine, which is also sustainable and locally available, as for example honey. forty - three percent of individuals living in rural tanzania would rather consult a traditional healer than go to a modern health facility for their skin problems. the global utilization of traditional medicine (alternative and complementary medicine when transferred from traditional practice) is of public health interest. in asia, such a tradition is unwritten and is more difficult to collect evidence on the safety and efficacy relating to preparation and dosage schedules. some herbals such as aloe or bee products, including honey and propolis, are now shared with other continents but have untested differences due to soil and climate. it is of special interest in the management of a global epidemic such as aids, if only because of the extent of its utilization and the reports of efficacy especially from asia. the possible value of incorporating traditional medicine into care in developing countries is exemplified by the recent establishment of a siddha hospital in india by the non - governmental organization gandeepam. the medical practices of this hospital include using herbal preparations in the treatment of hiv / aids and hiv / aids - related illnesses. one newly organized group hoping to improve education and point - of - care service regarding dermatologic diseases in africa is the international dermatology educational alliance (idea). the idea group, in collaboration with several academic groups in africa, aims to develop and implement a hiv / aids - focused dermatologic diagnostic decision support software program for use in african countries. this will include images of skin disease in african patients as well as realistic diagnostic and treatment options available in africa. this educational program and point - of - care tool will be used to train general physicians, assistant medical officers, and community health workers in africa in diagnosing and properly managing aids - related skin diseases. technology advances will make information and resource sharing between developed and developing countries with limited resources possible. the application of these advances in developing countries with poor infrastructure can be a challenging venture. however, a combination of technology - based tools where available with traditional (and non - traditional) low - technology educational methods can serve to improve the care of skin disease and hiv in african patients. inclusion of these educational tools in the primary care setting is crucial, especially since there are a limited number of dermatologists and dermatology residency training programs in africa. idea is a new organization formed to help meet the needs of people suffering from skin disease in limited resource settings, with a particular focus on the consequences of hiv / aids or the side effects of its therapy. it aims to provide teaching materials of high quality pertinent for use by medical personnel in africa. this intervention aims to improve diagnostic skills and eliminate the consequent inappropriate prescribing often costly to the recipient. it hopes to educate health care providers, including traditional healers, and will especially focus on the common problems of scabies, fungal infections, and pyodermas that affect the quality of life across all age groups and especially so in the patient population affected by aids. the idea group hopes that through the creation, validation, and wide distribution of these educational tools focused on skin disease diagnosis and management, particularly in those with hiv, a positive impact can be made in improving the burden of skin disease for those living in an area of the world desperately in need of improved health care education, supplies, and sustainable delivery methods. computerized diagnostic decision support systems and computerized dermatology educational tools have been used successfully in medical schools and free clinics in the united states to improve dermatology education to medical students and primary care providers. when used in conjunction with teledermatology for patients in low resource settings, computerized educational systems and diagnostic decision support systems empower the primary care doctors during direct patient care. measuring the impact of educational initiatives always presents a challenge, but usage statistics and surveys of medical providers and patients that take part in the programs is usually the most direct measurement of a program 's success. however, due to the limitations of the medical systems in many african countries, studies designed to measure actual patient outcomes before and after implementation of these programs may be restricted by costs. in africa, the increase of hiv / aids in many areas has complicated the diagnosis and treatment of many of these skin conditions. despite the overwhelming need for specialist dermatology care for these patients, training programs for dermatologists and primary care providers we believe the formation of global networks of educational leaders can help remedy by providing educational resources that are culturally and racially appropriate, by integrating safe and effective traditional medical practices into the teaching, and through the wide distribution of inexpensive, novel types of both high- and low - technology educational resources for dermatology. these resources can be combined with teaching initiatives and telemedicine to provide dermatology education with broader scope and immediate impact. healthy, sustainable, relationships between local educators, health care providers, and international collaborators should be based on a foundation of mutual learning and respect. these relationships are critical to improve the quality of dermatology care for patients with hiv / aids in africa. there is a tremendous burden of skin disease that either is not being treated or is probably being under - treated, largely due to the scarcity of dermatologists and dermatologic training in africa.the hiv / aids epidemic in africa further increases the burden of skin disease.several programs have been developed to help increase dermatologic care in africa, including the regional dermatology training program (rdtc) in tanzania implemented by the international foundation for dermatology (ifd).there is need for the development of additional programs that are as follows. provide educational resources that are culturally, ethnically, and geographically appropriate.integrate traditional medical practices into management options when possible.consider inexpensive, novel types of both high- and low - technology educational resources that can be widely distributed and combined with telemedicine and distance learning where appropriate. the international dermatology educational alliance (idea) group aims to improve the burden of skin disease in africa, particularly in people living with hiv / aids, through the wide distribution of educational tools that aid in the diagnosis and management of skin diseases. there is a tremendous burden of skin disease that either is not being treated or is probably being under - treated, largely due to the scarcity of dermatologists and dermatologic training in africa. several programs have been developed to help increase dermatologic care in africa, including the regional dermatology training program (rdtc) in tanzania implemented by the international foundation for dermatology (ifd). provide educational resources that are culturally, ethnically, and geographically appropriate.integrate traditional medical practices into management options when possible.consider inexpensive, novel types of both high- and low - technology educational resources that can be widely distributed and combined with telemedicine and distance learning where appropriate. consider inexpensive, novel types of both high- and low - technology educational resources that can be widely distributed and combined with telemedicine and distance learning where appropriate. the international dermatology educational alliance (idea) group aims to improve the burden of skin disease in africa, particularly in people living with hiv / aids, through the wide distribution of educational tools that aid in the diagnosis and management of skin diseases. | human immunodeficiency virus and the acquired immunodeficiency syndrome (hiv / aids) have greatly complicated dermatologic disease and the required care in most regions of africa. opportunistic infections, ectoparasites, kaposi sarcoma, and skin manifestations of systemic infections are exceedingly common in patients with hiv / aids. dermatologists have contributed significantly to our knowledge base about hiv / aids and have played an important educational role regarding the clinical manifestations historically. because of the increased burden of skin disease in africa due to the hiv / aids epidemic we must redouble our efforts to provide dermatology education to care providers in africa. we review the burden of skin disease in africa, how it relates to hiv / aids and global infectious disease, current educational strategies in africa to address this need, and suggest potential solutions to move these efforts forward. |
release of large quantities of metals into the environment (especially in natural water) is responsible for a number of environmental problems. metals are major pollutants in marine, ground, industrial, and even treated waste waters. industrial wastes are the major source of various kinds of toxic metals which have nonbiodegradability and persistence properties resulted in a number of public health problems. metals of interest, cobalt (co) and lead (pb), were chosen based on their industrial applications and potential pollution impact on the environment. it is an accumulative toxic metal, which is responsible for a number of health problems. pb reaches humans from natural as well as anthropogenic sources, for example, drinking water, soils, industrial emissions, car exhaust, and contaminated food and beverages. therefore, highly sensitive and selective methods have needed to be developed to determine the trace level of pb in water samples. the maximum contaminant levels of pb in drinking water allowed by environmental protection agency (epa) is 15.0 g l, while the world health organization (who) for drinking water quality containing the guideline value of 10 g l [6, 7 ]. co is known to be an essential micronutrient for metabolic processes in both plants and animals. it is mainly found in rocks, soil, water, plants, and animals. the determination of trace level of co in natural waters is very important because co is important for living species and it is part of vitamin b12. exposures to a high level of co lead to serious public health problems and are responsible for several diseases in human such as in lung, heart, and skin. flame atomic absorption spectrometry (faas) is a widely used technique for quantification of metal species. the determination of metals in water samples is usually associated with a step of preconcentration of the analyte before detection. the determination of trace levels of pb and co in water samples is particularly difficult because of the usually low concentration ; on the bases of these facts a great effort is needed to develop highly sensitive and selective methods to simultaneously determine trace level of these metals in water samples [12, 13 ]. a variety of procedures for preconcentration of metals, such as solid phase extraction (spe), liquid - liquid extraction (lle), and coprecipitation and cloud point extraction (cpe) have been developed. among them, cpe is one of the most reliable and sophisticated separation methods for the enrichment of trace metals from different types of samples. while other methods such as lle are usually time consuming and labor intensive and require relatively large volumes of solvents, which are not only responsible for public health problems but also a major cause of environmental pollution [1722 ]. it was reported in literature that pb and co had been preconcentrated by cpe method after the formation of sparingly water - soluble complexes with different chelating agents such as ammonium pyrrolidine dithiocarbamate (apdc) [23, 24 ] 1-(2-thiazolylazo)-2-naphthol (tan), 1-(2-pyridylazo)-2-naphthol (pan) [26, 27 ], and diethyldithiocarbamate (ddtc) [2830 ]. in the present work, we introduce a simple, sensitive, selective, and low - cost procedure for simultaneous preconcentration of co and pb after the formation of complex with oxine, using triton x-114 as surfactant and later analysis by flame atomic absorption spectrometry. several experimental variables affecting the sensitivity and stability of separation / preconcentration method were investigated in detail. the proposed method was applied for the determination of trace amount of both metals in fresh surface and waste water samples. ultrapure water, obtained from elga lab water system (bucks, uk), was used throughout the work. the nonionic surfactant triton x-114 was obtained from sigma (st. louis, mo, usa) and was used without further purification. stock standard solution of pb and co at a concentration of 1000 g l was obtained from the fluka kamica (bush, switzerland). working standard solutions were obtained by appropriate dilution of the stock standard solutions before analysis. concentrated nitric acid and hydrochloric acid were analytical reagent grade from merck (darmstadt, germany) and were checked for possible trace pb and co contamination by preparing blanks for each procedure. the 8-hydroxyquinoline (oxine) was obtained from merck, prepared by dissolving appropriate amount of reagent in 10 ml ethanol and diluting to 100 ml with 0.01 m acetic acid, and were kept in a refrigerator 4c for one week. the 0.1 m acetate and phosphate buffer the ph of the samples was adjusted to the desired ph by the addition of 0.1 mol l hcl / naoh solution in the buffers. for the accuracy of methodology, a certified reference material of water srm-1643e, national institute of standards and technology the glass and plastic wares were soaked in 10% nitric acid overnight and rinsed many times with deionized water prior to use to avoid contamination. a centrifuge of wirowka laboratoryjna type we-1, nr-6933 (speed range 06000 rpm, timer 060 min, 220/50 hz, mechanika phecyzyjna, poland) was used for centrifugation. global positioning system (ifinder gps, lowrance, mexico) was used for sampling locations. a perkin elmer model 700 (norwalk, ct, usa) atomic absorption spectrometer, equipped with hollow cathode lamps and an air - acetylene burner. the instrumental parameters were as follows : wavelength 240.7 and 283.3 nm and slit widths : 0.2 and 0.7 nm for co and pb. the fresh surface water samples (canals) and waste water were collected on alternate month in 2011 from twenty (20) different sampling sites of jamshoro, sindh (southern part of pakistan) with the help of the global positioning system (gps). n and 67 1268 02 e. the sampling network was designed to cover a wide range of the whole district. all water samples were filtered through a 0.45 micropore size membrane filter to remove suspended particulate matter and were stored at 4c. for co and pb determination, aliquot of 25 ml of the standard or sample solution containing both analytes (20100 g / l), oxine 5 10 mol l and triton x-114 0.5% (v / v), were added. to reach the cloud point temperature, the system was allowed to stand for about 30 min into an ultrasonic bath at 50c for 10 min. separation of the two phases was achieved by centrifuging for 10 min at 3500 rpm. the contents of tubes were cooled down in an ice bath for 10 min. the surfactant - rich phase was treated with 200 l of 0.1 mol l hno3 in ethanol (1 : 1, v / v) in order to reduce its viscosity and facilitate sample handling. blank solution was submitted to the same procedure and measured in parallel to the standards and real samples. the preconcentration of pb and co was based on the formation of a neutral, hydrophobic complex with oxine, which is subsequently trapped in the micellar phase of a nonionic surfactant (triton x-114). utilizing the thermally induced phase extraction separation process known as cpe, the analyte is highly preconcentrated and free of interferences in a very small micellar phase. several parameters play a significant role in the performance of the surfactant system that is used and its ability to aggregate, thus entrapping the analyte species. the ph, complexing reagent and surfactant concentration, temperature, and time were studied for optimum analytical signals. the effect of ph on the cpe of co and pb was investigated because this parameter plays an important role in metal - chelate formation. the effect of ph upon the extraction of co and pb ions from the six replicate standard solutions 20.0 g l was studied within the ph range of 310, while each operational desired ph value was obtained by the addition of 0.1 mol l of hno3/naoh in the presence of acetate / borate buffer. the maximum extraction efficiency of understudy metals was obtained at ph range of 6.57.5 as shown in figure 1, for subsequent work ph 7.0 was chosen as the optimum for subsequent work. separation of metal ions by a cloud point method involves the prior formation of a complex with sufficient hydrophobicity to be extracted in a small volume of surfactant - rich phase. the nonionic surfactant triton x-114 was chosen as surfactant due to its low cloud point temperature and high density of the surfactant - rich phase, which facilitates phase separation by centrifugation. the effect of triton x-114 concentrations on the extraction efficiencies of co and pb were examined at the range of 0.1 to 1.0% (v / v). figure 2 shows that quantitative extraction was observed when surfactant concentration was > 0.5% (v / v). at lower concentrations, the extraction efficiency of complexes was low probably because of the inadequacy of the assemblies to entrap the hydrophobic complex quantitatively. a triton x-114 concentration of 0.5% (v / v) was selected for subsequent studies. the oxine is a relatively very stable and selective hydrophobic complexing reagent which reacts with both selected cations. replicate 10 ml of standard, srm, and real sample solution in 0.5% (w / v) triton x-114 at a buffer of ph 7.0 and complexed with oxine solutions in the range of 1.010.0 10mol l. the results revealed in figure 3 that extraction efficiency of both metals increases up to 5 10mol l. this value was, therefore, selected as the optimal chelating agent concentration. the preconcentration factor (pcf) is defined as the concentration ratio of the analyte in the final diluted surfactant - rich extract ready for its determination and in the initial solution. among the other factors, this depends on the phase relationship, on the distribution constant of the analyte between the phases, and on sample volume. the sample volume is one of the most important parameters in the development of the preconcentration method, since it determines the sensitivity and enhancement of the technique. the phase ratio is an important factor, which has an effect on the extraction recovery of cations. a low phases ratio improves the recovery of analytes, but decreases the preconcentration factor. however, to determine the optimum amount of the phase ratio, different volumes of a water sample 101000 ml and a constant volume of surfactant solution 0.5% were chosen. the obtained results show that with increasing the sample volume > 100 ml, the extracted understudy analytes were decreased as compared to those obtained with 2550 ml. a successful cloud point extraction should maximize the extraction efficiency by minimizing the phase volume ratio, thus improving its concentration factor. in the present work, the initial sample volume was 25 ml and the final volume of surfactant rich phase after diluted with acidic ethanol was 0.5 ml, hence the pcf achieved in this work was 50 for both understudy analytes. the interference is those relating to the preconcentration step, which may react with oxine and decrease the extraction. to perform this study, 25 ml solution containing 20 g / l of both metals at different interference to analyte ratio were subjected to the developed procedure. the tolerance limit of coexisting ions is defined as the largest amount making variation of less than 5% in the recovery of analytes. commonly encountered matrix components such as alkali and alkaline earth elements generally do not form stable complexes under the experimental conditions. a high concentration of oxine reagent was used, for the complete chelation of the selected ions even in the presence of interferent ions. the calibration graph using the preconcentration step for co and pb were linear with a concentration range of 5.020 ug l of standards and subjecting to cpe methods at optimum levels of all understudy variables. the extracted analytes in diluted micellar media were introduced into the flame by conventional aspiration. table 2 gives the calibration parameters for the proposed cpe method including the linear ranges, relative standard deviation rsd, and limit of detection lod. the experimental enhancement factors calculated as the ratio of the slopes of calibration graphs with and without preconcentration. the enhancement factors of co and pb subjected to cpe method were found to be 70 and 50, respectively. the limits of detection lod were calculated as the ratio between three times the standard deviation of ten blank readings and the slope of the calibration curve after preconcentration were calculated as 0.26 and 0.44 g the obtained lod was sufficiently low for detecting trace levels of co and pb in different types of fresh and waste water samples. the accuracy of the proposed method was evaluated by analyzing a standard reference material of water srm-1643e with certified values of co and pb content. it was found that there is no significant difference between results obtained by the proposed method and the certified results of both metals. reliability of the proposed method was also checked by spiking both metals at to three concentration levels (2.010.0 g the perecentage of recoveries (r) of spike standards were calculated as follows : (1)r (%) = (cmco)m100, where cm is a value of metal in a spiked sample, co the value of metal in a sample, and m is the amount of metal spiked. these results demonstrate the applicability of developed procedure for co and pb determination in different water samples. the cpe procedure was applied to determine co and pb in fresh surface and waste water samples. the co and pb concentrations in fresh surface water were found in the range of 2.125.12 g l and 1.498.56 g the levels of both analyte were high, found in the range of 13.616.8 and 15.119.4 g in this study, triton x-114 was chosen for the formation of the surfactant - rich phase due to its excellent physicochemical characteristics, low cloud point temperature, high density of the surfactant - rich phase, which facilitates phase separation easily by centrifugation, and commercial availability and relatively low price and low toxicity. this method is a promising alternative for the determination of co and pb linked with faas. from the results obtained, it can be considered that oxine is an efficient ligand for cloud point extraction of co and pb. the simple accessibility, the formation of stable complexes, and consistency with the cloud point extraction method are the major advantages of the use of oxine in cloud point extraction of co and pb. cpe has been shown to be a practicable and versatile method, being adequate for environmental studies. cloud point extraction is an easy, safe, rapid, inexpensive, and environmentally friendly methodology for preconcentration and separation of trace metals in aqueous solutions. the surfactant - rich phase can be directly introduced into flame atomic absorption spectrometer faas after dilution with acidic ethanol. the proposed cpe method incorporating oxine as chelating agent permits effective separation and preconcentration of co and pb and final determination by faas provides a novel route for trace determination of these metals in water samples of different ecosystem. a low - cost surfactant was used, thus toxic organic solvent extraction generating waste disposal problems was avoided. the comparison of the results found in the presented study and some works in the literature was given in [3144 ]. the proposed cloud point extraction method is superior for having lower detection limits when compared to other methods as shown in table 5. | cloud point extraction (cpe) has been used for the preconcentration and simultaneous determination of cobalt (co) and lead (pb) in fresh and wastewater samples. the extraction of analytes from aqueous samples was performed in the presence of 8-hydroxyquinoline (oxine) as a chelating agent and triton x-114 as a nonionic surfactant. experiments were conducted to assess the effect of different chemical variables such as ph, amounts of reagents (oxine and triton x-114), temperature, incubation time, and sample volume. after phase separation, based on the cloud point, the surfactant - rich phase was diluted with acidic ethanol prior to its analysis by the flame atomic absorption spectrometry (faas). the enhancement factors 70 and 50 with detection limits of 0.26 g l1 and 0.44 g l1 were obtained for co and pb, respectively. in order to validate the developed method, a certified reference material (srm 1643e) was analyzed and the determined values obtained were in a good agreement with the certified values. the proposed method was applied successfully to the determination of co and pb in a fresh surface and waste water sample. |
we applied multiple gene genealogic analyses in studying g. destructans isolates ; this approach yields robust results that are easily reproduced by other laboratories (5). these isolates originated from 7 counties in new york and an adjoining county in vermont, all within a 500-mile radius (table 1). the details of isolation and identification of g. destructans from bat samples have been described (2). one isolate of a closely related fungus g. pannorum m1372 (university of alberta mold herbarium, edmonton, alberta, canada) was included as a reference control. to generate molecular markers, 1 isolate, g. destructans (m1379), was grown in yeast extract peptone dextrose broth at 15c, and high molecular weight genomic dna was prepared according to moller. a cosmid dna library was constructed by using pweb kit (epicenter biotechnologies, madison, wi, usa) by following protocols described elsewhere (7). one hundred cosmid clones, each with 40-kb dna insert, were partially sequenced in both directions by using primers m13 and t7. the nucleotide sequences were assembled with sequencher 4.6 (gene codes corp., ann arbor, mi, usa) and blast (www.ncbi.nlm.nih.gov/blast) homology searches identified 37 putative genes. sequences of 10 genes, including open reading frames, 3 and/or 5 untranslated regions, and introns, were evaluated as potential markers for analyzing g. pannorum and g. destructans. our screening approach indicated that 8 gene targets could be amplified from both g. destructans and g. pannorum by pcr (table 2). all locations in new york state except bridgewater mine, windsor, vermont. genes : alr, -l - rhamnosidase ; bpntase, 3(2),5-bisphosphate nucleotidase ; dhc1, dynein heavy chain ; gphn, gephyrin, molybdenum cofactor biosynthesis protein ; pcs, peroxisomal - coenzyme a synthetase ; pob3, fact complex subunit ; srp72, signal recognition particle protein 72 ; vps13, vacuolar protein sorting - associated protein. f, forward ; r, reverse. to obtain dna sequences from 1 g. pannorum and 16 g. destructans isolates, we prepared genomic dna from mycelia grown in yeast extract peptone dextrose broth through conventional glass bead treatment and phenol - chloroform extraction and then ethanol precipitation (7). louis, mo, usa) was used for pcr : 3 min initial denaturation at 94c, 35 amplification cycles with a 15-sec denaturation at 94c, 30-sec annealing at 55c, and 1-min extension at 68c and a 5-min final extension at 68c. cleveland, oh, usa) before sequencing. both strands of amplicons were sequenced by the same primers used for pcr amplification (table 2). a database was created by using microsoft access (microsoft, redmond, wa, usa) to deposit and analyze the sequences. nucleotide sequences were aligned with clustalw version 1.4 (www.clustal.org) and edited with macvector 7.1.1 software (accelrys, san diego, ca, usa). phylogenetic analyses were done by using paup 4.0 (8) and mega 4 (9). we cloned and sequenced 200 kb of the g. destructans genome and identified genes involved in a variety of cellular processes and metabolic pathways (table 2). dna sequence typing by using 8 gene fragments showed that all 16 g. destructans isolates had identical nucleotide sequences at all 8 sequenced gene fragments but were distinct from g. pannorum sequences. a maximum - parsimony tree generated from the 8 concatenated gene fragments indicated a single, clonal genotype for the 16 g. destructans strains (figure 1). this consensus tree included 4,470 aligned nucleotides from all targeted gene sequences with 545 variable sites that separate the g. destructans clonal genotype from g. pannorum. further analyses of the same concatenated gene fragments with exclusion of 50 insertions and deletions between g. destructans and g. pannorum yielded a tree with a shorter length (495 steps instead of 545 steps) but an identical topology (technical appendix figure 1). this pattern remained unchanged when different phylogenetics models were used for analysis (technical appendix figure 2). the lack of polymorphism among the 16 g. destructans isolates was unlikely because of evolutionary constraint at the sequenced gene fragments. we found many synonymous and nonsynonymous substitutions in target genes among a diversity of fungal species, including between g. destructans and g. pannorum (10) (technical appendix figure 3). consensus maximum - parsimony tree derived from analyzing 8 concatenated gene fragments including a total of 4,470 aligned nucleotides by using paup 4.0 (8). the number 545 on the branch indicates the total number of variable nucleotide positions (out of the 4,470 nt) separating geomyces pannorum m1372 from the clonal genotype of g. destructans identified here. collection sites in new york counties (a) are color - matched with respective geomyces destructans isolates in maximum - parsimony tree based on nucleotide sequence of the vps13 gene (b). the tree was constructed with mega4 (9) by using 450 nt and bootstrap test with 500 replicates. in addition to g. destructans and g. pannorum, fungi analyzed were ajellomyces capsulatus (aaji01000550.1), aspergillus clavatus nrrl 1 (aakd03000035.1), botryotinia fuckeliana b05.10 (aaid01002173.1), coccidioides posadasii c735 delta sowgp (acfw01000049.1), neurospora crassa or74a (aabx02000023.1), paracoccidioides brasiliensis pb01 (abkh01000209.1), and penicillium marneffei atcc 18224 (abar01000009.1). our finding of a single clonal genotype in g. destructans population fits well with the rapid spread of geomycosis in new york (figure 2). our sampling population covered both spatial and temporal dimensions, and the numbers of isolates analyzed were adequate in view of difficulties encountered in obtaining pure isolations of g. destructans (11). although the affected new york sites are separated by sizable distances and include geographic barriers, a role for the natural dissemination of the fungus through air, soil, and water can not be ruled out. indeed, several fungi with geographic distributions similar to that in our study have shown major genetic variation among strains (12,13). it is also possible that humans and/or animals contributed to the rapid clonal dispersal. in such a scenario, the diseased or asymptomatic bats might act as carriers of the fungus by their migration into new hibernation sites where new animals get infected and the dissemination cycle continues (4). similarly, the likely roles played by humans and/or other animals in the transfer of the fungal propagules from an affected site to a clean one can not be ruled out from our data. virulent clones of human and plant pathogenic fungi that spread rapidly among affected populations have been recognized with increasing frequency in recent years (12,14). however, other pathogens, such as the frog - killing fungus batrachochytrium dendrobatidis, have emerged with both clonal and recombining populations (13). our data do not eliminate the possibility that the g. destructans population undergoes recombination in nature. this process to generate genetic variability would require some form of sexual reproduction, which remains unknown in g. destructans. in addition, the fungus might have both asexual and sexual modes in its saprobic life elsewhere in nature, but it exists only in asexual mode on bats (15). in conclusion, our data suggest that a single clonal genotype of g. destructans has spread among affected bats in new york. this finding might be helpful for the professionals involved in devising control measures. many outstanding questions remain about the origin of g. destructans, its migration, and reproduction, all of which will require concerted efforts if we are to save bats from predicted extinction (3). maximum - parsimony trees figures and multiple alignments of 8 target gene fragments figure. | the dispersal mechanism of geomyces destructans, which causes geomycosis (white nose syndrome) in hibernating bats, remains unknown. multiple gene genealogic analyses were conducted on 16 fungal isolates from diverse sites in new york state during 20082010. the results are consistent with the clonal dispersal of a single g. destructans genotype. |
during the last two decades, the successful scale - up of automated high - throughput dna sequencing technologies has made a dramatic change to the biological discoveries in biology and biomedical sciences. an increasing number of complete genome sequences from various organisms have been determined, and the first draft of the full human genome sequence is now available. a major new goal of the human genome project is functional genomics, which uses experimental and computational techniques to elucidate the function and structure of the encoded gene products. computer - aided sequence analysis has become an increasingly important method for identifying the function of uncharacterized proteins translated from genomic or cdna sequences. the primary method for sequence analysis is similarity search, such as blast (1,2), fasta (3) and smith waterman (4) programs. however, in many cases, the sequence of an unknown protein is too distantly related to any protein of known function to detect its resemblance by overall, or even local, sequence alignment. the biological function of such a sequence can often be revealed by detection within its sequence of patterns conserved among a family of proteins. sequence patterns emphasize specific residues that are essential for a biological function ignoring other positions that are not as important for function. the conserved patterns of a protein family usually correspond to important functions such as ligand binding, catalysis, protein interaction, etc. a conserved pattern or motif therefore, compilation of alignments of conserved protein regions is the basis of pattern recognition for protein identification. a number of protein family and superfamily databases have been built to archive the conserved alignments and searching tools that have been developed to link a query sequence to the related family or superfamily through different pattern matching algorithms. widely used protein family and superfamily databases include pfam (5), prosite (6), smart (7), prints (8), prodom (9), domo (10,11), blocks+ (12), interpro (13), systers (14), protomap (15), clustr (16), sbase (17), proclass (18) and protonet (19). structure classes are defined in databases such as scop (20), cath (21) and fssp (22). a biologically important region is most stringently conserved among a smaller family of highly similar proteins. the same region is often found in a larger group of more remotely related proteins with a reduced stringency. the eblocks database has been designed to enumerate a cascade of protein blocks with varied conservation levels for each functional domain. through enumeration, highly specific signatures can be generated from blocks with more columns and fewer family members, while highly sensitive signatures can be derived from blocks with fewer columns and more members as in a superfamily. we have generated the eblocks database to compile ungapped conserved regions, or blocks, directly from an unclassified sequence database in a generic and fully automated way. eblocks builds protein groups from sequences based on psi - blast searches (23). eblocks clusters psi - blast hit sequences into groups of many different conservation levels : subfamilies, families and superfamilies. each group represents one distinct level of conservation, which can then be used to build patterns of a particular specificity. the enumeration of blocks with an array of different specificities determines the basis for generating motifs or position - specific scoring matrices (pssms) over a wide range of sensitivity and specificity. this feature of eblocks allows recognition of a given query sequence by matching with blocks of all family levels, providing a solution to the dilemma of sensitivity and specificity in pattern recognition. eblocks first uses psi - blast to find all the sequences that share various similarities to a seed sequence. sequences that are reported in a psi - blast result usually fall into groups that share distinct regions or domains. group 1 sequences share global similarity to the query sequence (seed sequence) ; group 2 sequences share a domain close to the n - terminus of the seed sequence ; group 3 sequences share the c - terminal region of the seed sequence. group 1 could form a protein family, while groups 2 and 3 could be superfamilies sharing more distant similarities. although the region shared by group 2 is also included in group 1, the same region is less conserved in group 2 than in group 1. therefore, eblocks not only builds high specificity blocks from group 1, but also generates sets of high sensitivity blocks from groups 2 and 3. the eblocks database was built with three major steps : (i) cluster a psi - blast result into individual groups representing distinct similarity modules ; (ii) make gapped multiple sequence alignment for sequences contained in each group ; and (iii) trim each gapped multiple alignment into ungapped subregions, or blocks. using a modified k - means clustering method, the sequences returned from the psi - blast search are classified into k clusters, where k is automatically determined by a heuristic method. the individual cluster thus obtained represents a subgroup that aligns to a distinct region of the query sequence. cluster 2 represents a group of sequences that are almost globally similar but differ in the n - terminus. cluster 9 represents a group of sequences that can only align at a region closer to the c - terminal end. covering clusters to form a group, where the covering clusters are the other clusters sharing a longer region that fully covers the region shared by the cluster. as shown in figure 2, cluster 8 forms group 8, and clusters 2 and 8 form group 2, while all the three clusters form group 9. representing the same region by multiple groups with different levels of conservation allows eblocks to annotate a novel sequence with maximal specificity and sensitivity. models built from these different groups are able to extract patterns that are conserved within a subfamily, a family or a superfamily. the group assembly is done for each cluster, and thus the total number of groups is equal to the number of clusters found by k - means. after the psi - blast result has been divided into groups that represent distinct conservation modules, sequences in each group the block widths directly affect the specificities of the derived patterns, either as regular expressions or probability matrices. to ensure that the blocks provide sufficient specificity, we set a minimum width of 10 positions for eblocks. from each multiple alignment generated for each group, all the subregions with at least 10 consecutive non - gapped positions are trimmed out as raw blocks. both the front and back edges of each raw block are examined to allow refinement and extension of the edges when the conservation level is high. similarity groups representing shared modules at different conservation levels, including subfamilies, families, superfamilies, are formed by the clustering and grouping of all the subject sequences returned by a psi - blast search. sequences in each group are aligned and the ungapped regions are excised to form several blocks. an eblocks accession number is composed of three parts : the swiss - prot accession number of the seed sequence, the group number as assigned by k - means clustering and the block number as the sequential number of trimmed blocks from the multiple sequence alignment for the group. the current eblocks database was built with swiss - prot release 40, resulting in a total of 159 974 blocks. the distribution of the block width in the eblocks database is shown in figure 4b. two kinds of patterns can be computed from blocks : discrete motifs [regular expressions (24) ] and pssms (25,26). discrete motifs were generated for the blocks in eblocks database using the emotif package (27,28). expectation values (e - value) were calculated as described below. for each motif generated by emotif, an e - value is calculated from its specificity (si) by summing up all other equal or better specificities (sj) in the database : for each ematrix hit, the specificity can be converted into an e - value by multiplying by n, the number of tests performed, which is equal to b (l w + 1), where b is the total number of blocks (29) : the eblocks database is available on the web at http://motif.stanford.edu / eblocks/. users can submit query sequences in search a sequence page, and select either emotif or ematrix as the tool to search against emotif or ematrix databases derived from the current eblocks database. in the result page, eblocks hits are ranked by e - values and each hit has a pointer to the eblock record page. the eblock record page displays the accession number of the block, the block alignment, the sequence logo and provides commands to use the corresponding pssm to scan a number of databases to retrieve matching sequences. the eblocks database is also searchable by accession number and by keywords as provided in eblocks represents a similarity region multiple times by enumerating groups with different levels of conservations (figure 2). this important feature of eblocks maximizes its sensitivity and specificity when used to annotate a query sequence. when a region is represented at the superfamily level, more remotely related sequences are included in the block, which is consequently narrower and allows more substitutions for the conserved residues (group 9 in figure 2). conversely, a family or subfamily level block contains more closely related sequences, and therefore is wider and more restricted in residue substitutions (group 8 in figure 2). specificity increases when going up the tree to the subfamily level, and sensitivity increases when going down the tree to the superfamily level. by enumerating all family levels, eblocks forms the basis for highly sensitive and highly specific pattern matching and enables pattern discovery with optimal sensitivity and specificity for a given query sequence. the eblocks building process is generic and can be applied to any set of protein sequences. the characterized proteins in swiss - prot are selected as the building set for this work since these are sources of extensively validated annotation and are therefore useful when applied to identify an unknown sequence. nonetheless, trembl or other protein databases can be used as the building set if we desire to incorporate the most recent information from the large scale sequencing projects. alternatively, a more restricted collection of sequences could be used as the source sequences in order to focus on a particular subset of sequences. in fact, eblocks has been successfully applied to a set of signal transduction proteins and has generated a database called esignal (j. alexander, unpublished data). in this work, the ematrix and emotif algorithms were used to derive pssms and motifs from the eblocks database and the corresponding ematrix search and emotif search tools were used in sequence searches. alternatively, one can use the impala package (30) to derive pssms from the eblocks database and to search sequences. we would like to thank timelogic for their donation of time and equipment that made this research possible. | classifying proteins into families and superfamilies allows identification of functionally important conserved domains. the motifs and scoring matrices derived from such conserved regions provide computational tools that recognize similar patterns in novel sequences, and thus enable the prediction of protein function for genomes. the eblocks database enumerates a cascade of protein blocks with varied conservation levels for each functional domain. a biologically important region is most stringently conserved among a smaller family of highly similar proteins. the same region is often found in a larger group of more remotely related proteins with a reduced stringency. through enumeration, highly specific signatures can be generated from blocks with more columns and fewer family members, while highly sensitive signatures can be derived from blocks with fewer columns and more members as in a superfamily. by applying psi - blast and a modified k - means clustering algorithm, eblocks automatically groups protein sequences according to different levels of similarity. multiple sequence alignments are made and trimmed into a series of ungapped blocks. motifs and position - specific scoring matrices were derived from eblocks and made available for sequence search and annotation. the eblocks database provides a tool for high - throughput genome annotation with maximal specificity and sensitivity. the eblocks database is freely available on the world wide web at http://motif.stanford.edu/eblocks/ to all users for online usage. academic and not - for - profit institutions wishing copies of the program may contact douglas l. brutlag ([email protected]). commercial firms wishing copies of the program for internal installation may contact jacqueline tay at the stanford office of technology licensing ([email protected] ; http://otl.stanford.edu/). |
fused tooth can be defined as a single enlarged or joined tooth in which the tooth count reveals a missing tooth when the anomalous tooth is counted as one. bilateral fusion has an incidence ranging from 0.01% to 0.04% in the primary dentition, and 0.05% in the permanent dentition, out of which, incisors and canines are mostly affected. fusion may be classified as complete or incomplete depending on the developmental stage of the teeth. if it occurs before the beginning of calcification, the union will be complete with the formation of a single large tooth. complete fusion may be characterized by a single pulp chamber and root canal, or a single pulp chamber and two separate root canals, or separate pulp chambers as well as root canals. fusion of teeth is known to result from physical force or pressure causing contact of the developing tooth germs, hypervitaminosis a, viral infection during pregnancy and the use of thalidomide, heredity, aberration of the ectoderm and mesoderm during morphodifferentiation stage of tooth development, and syndromes such as achondrodysplasia, chondroectodermal dysplasia, focal dermal hypoplasia, and osteopetrosis. a 10-year - old boy visited the department of pedodontics and preventive dentistry with the chief complaint of an unaesthetic large bifid anterior right tooth. there was no family history of dental anomalies, and neither was there any history of trauma to the teeth or jaws. intraoral examination revealed unusually large maxillary central incisors, out of which, the maxillary right incisor (mri) was bifurcated with a groove traversing the labial and palatal aspects of the crown [figures 1 and 2 ]. there was the absence of any caries and both incisors responded normally to thermal and electric pulp testing (c pulse pulp tester, foshan coxo medical instrument co. ltd). an orthopantomogram revealed the absence of maxillary lateral incisors (mli) [figure 3 ]. a cone - beam computed tomography (cbct) scan revealed two distinct roots that were connected through the groove, containing two distinct connected root canals, in relation to the mri however, the mli had a single large root and root canal [figures 46 ]. a diagnosis of incomplete fusion of the mri (mesiodistal diameter of 16.5 mm ; crown length of 12 mm) and complete fusion of the mli (mesiodistal diameter of 12.5 mm ; crown length of 12 mm) was made, based on the appearance of the incisors and the fact that the mlis were missing. cone - beam computed tomography with three - dimensional reconstruction cone - beam computed tomography (longitudinal) cone - beam computed tomography (cross - section) after informed consent was obtained for carrying out treatment, upper and lower alginate impressions were made and poured with dental stone. a diagnostic mock - up was done using mockup wax on the mri that matched with the size and shape of the adjacent mli [figure 7 ]. a putty index was made of the mock up wax, following which, bis - acryl composite (kettenbach, germany) was placed into the index and transferred to the mri, intraorally. pretreatment esthetic evaluation was carried out to check for adequate phonetics, lip support and smile line, and for approval from the patient and his parents. an incisal overlap veneer preparation (facial reduction of 0.5 mm) with a shoulder finish line was carried out for the mri [figure 8 ]. a digital mock - up was done using adobe photoshop 7.0 software so that adequate information regarding the size, shape, and extent of the veneer could be sent to the laboratory. in consisted of the following steps : tooth preparation for veneer the free selection tool was used to select and trace the outline of the adjacent central incisor.the outline was converted into a smart object.the inversion tool was used to derive a mirror image of the same.the image was saved as a jpeg file.the jpeg file was imported into the coral draw software and placed over the image of the fused tooth.the cloning tool was used to mimic the gingiva to create an illusion of distinction between the central and the lateral incisors that constituted the mri. the free selection tool was used to select and trace the outline of the adjacent central incisor. the jpeg file was imported into the coral draw software and placed over the image of the fused tooth. the cloning tool was used to mimic the gingiva to create an illusion of distinction between the central and the lateral incisors that constituted the mri. the digital mock - up helped in providing adequate information to the laboratory with regard to the addition of gingival porcelain on the veneer. the fabricated ips e - max press veneer (ivoclar vivadent ag, schaan, liechtenstein), with an incisal lapping preparation, was cemented using a translucent shade of dual cure composite resin luting cement (rely - x arc, 3m - espe, germany) [figures 9 and 10 ]. there has only been one case of bilateral fusion of permanent maxillary incisors without the involvement of supernumerary teeth, reported in literature. moreover, ours is the first case where there has been incomplete and complete fusion, bilaterally. the mri was classified as incomplete fusion since there was a bifurcation of the crown along a groove running labially and lingually till the cervical margin, without the confluence of dentin between the two sections. however, the mli was classified as complete fusion (between the central and lateral incisors) because it consisted of only a single large crown and root structure. intraoral periapical radiographs are insufficient for understanding the morphology of roots and its canal systems in fused teeth. moreover, it was difficult to interpret the same with the help of the orthopantomograph. cbct that can produce three - dimensional images of oral structures are helpful particularly in such cases. since the volume of the scan is smaller, the resolution of the image is higher with little effective radiation dose to the patient. the cbct scans obtained provided us with accurate information with regard to the number of roots, canals and the region of the divide, both occlusally and labially, in the mri. since the cbct scan showed a connection between the canals in the mri, it was decided to place a veneer to avoid endodontic treatment, hemisectioning, and full crown placement on both the separated teeth. endodontic treatment was not preferred for the mri because the tooth was asymptomatic and responded favorably to pulp tests. orthodontic movement was not planned either because there was no shift in the midline, proclination, or spacing. although the mli had a primary canine adjacent to it, the child or his parents had no complaint with regard to its esthetics. however, when the primary canine would get replaced with the succedaneus canine, its reshaping with composite resin or a veneer may be necessary to make it resemble a lateral incisor. in a case reported by sammartino., involving fusion of both upper central incisors, surgical sectioning was carried out, and both teeth were restored with all - ceramic crowns after orthodontic alignment and endodontic treatment. in another case of geminated central incisors, esthetic rehabilitation was carried out using all ceramic crowns for both the incisors. however, in this case report, a conservative approach using ips e - max press veneer (ivoclar vivadent ag, schaan, liechtenstein) was carried out. in a case reported by samimi., a new lateral incisor tooth was fixed between the fused teeth (maxillary central and lateral incisors) and the canine using fiber - reinforced composite resin, after creating space by stripping the fused teeth. the contours of the teeth were designated by lines made with a thin tapered bur and restored with composite veneering. the pink composite was used to mimic gingival papillae between teeth. however, in this case, the mri was made to appear like two teeth by veneering with ips e - max tooth colored and gingival ceramic, instead of pink composite. the contours of the divided teeth that constituted the mri were designated using the adobe photoshop software. the groove that persists lingual to the mri may be susceptible to caries and periodontal disease. however, since the groove was found to be shallow, periodic topical fluoride application and maintenance of oral hygiene should be sufficient to prevent caries or periodontal disease. the patient is on a follow - up schedule every 6 months and has been asymptomatic for over 2 years. | this case report highlights the management of a case of bilateral complete and incomplete fusion of maxillary incisors in a 10-year - old child. a mock - up was done on the diagnostic cast. pretreatment esthetic evaluation was done using bis - acryl composite temporaries which were transferred intraorally from the diagnostic cast using a putty index. an incisal overlap veneer preparation was done, following which, an ips e - max veneer was cemented. a digital mock - up was carried out using the adobe photoshop and corel draw softwares to aid in laboratorial fabrication of the veneer. |
leiomyoma, occurring mostly as a solitary lesion, is the most common benign tumor, accounting for only 0.4% of all esophageal neoplasms. most of the reported cases (10 cm along the distal esophagus), we preferred to convert the procedure to laparotomy. the hiatus was opened using the harmonic knife for proper mobilization of the bulky esophagus. the decision was made to do proximal gastrectomy with distal esophagectomy and reconstruction using either the merendino procedure or gastric pull up with esophagogastrostomy (figure 4). due to the young age of the patient and poor quality of life caused by intractable reflux after the esophagus was resected 2 cm above the proximal tumor edge, the proximal part of the stomach was resected using a linear stapler. the reconstruction was done after preparation of a jejunal limb 15 cm to 20 cm in length, 30 cm to 40 cm away from the treitz ligament. an isoperistaltic esophagojejunostomy was performed using a circular stapler, followed by manual jejunogastrostomy and jejunojejunostomy. an anterior hiatoplasty was performed using nonabsorbable suture material with jejunophrenicopexy and gastropexy to the left crus (figure 4). the final histopathology report confirmed a circumferential leiomyomatosis of muscularis propria of the lower esophagus 10.5 cm in length. the postoperative course was uneventful apart from dyspnea caused by left - sided pleural effusion. the patient was informed about her diagnosis of leiomyomatosis that needs regular follow - up for early detection of possible recurrence. she had no complaints regarding reflux disease, and she is tolerating a normal diet well. the feeding jejunostomy was removed, and the daily dose of ppi was reduced to 20 mg of omeprazole. initially, a laparoscopic approach using a 5-trocar technique was performed. after gas insufflation and inspection of the abdominal cavity, we noticed a 1-cm to 1.5-cm liver lesion (segment 3) that was not described by preoperative ct scan. a large hiatal defect was present with more than 2/3 of the stomach herniated through it. furthermore, we focused on the hiatus where we started with the repositioning of the stomach. the mobilization of the hernial sac was done successfully all around the hiatus apart from the left side. at this point, it was removed and sent for histopathology, which revealed the presence of a mesenchymal tumor. we tried to continue the procedure laparoscopically under gastroscopic control with the aim of tumor excision. due to the large tumor size (macroscopically > 10 cm along the distal esophagus), we preferred to convert the procedure to laparotomy. the hiatus was opened using the harmonic knife for proper mobilization of the bulky esophagus. the decision was made to do proximal gastrectomy with distal esophagectomy and reconstruction using either the merendino procedure or gastric pull up with esophagogastrostomy (figure 4). due to the young age of the patient and poor quality of life caused by intractable reflux after the esophagus was resected 2 cm above the proximal tumor edge, the proximal part of the stomach was resected using a linear stapler. the reconstruction was done after preparation of a jejunal limb 15 cm to 20 cm in length, 30 cm to 40 cm away from the treitz ligament. an isoperistaltic esophagojejunostomy was performed using a circular stapler, followed by manual jejunogastrostomy and jejunojejunostomy. an anterior hiatoplasty was performed using nonabsorbable suture material with jejunophrenicopexy and gastropexy to the left crus (figure 4). the final histopathology report confirmed a circumferential leiomyomatosis of muscularis propria of the lower esophagus 10.5 cm in length. the postoperative course was uneventful apart from dyspnea caused by left - sided pleural effusion. the patient was informed about her diagnosis of leiomyomatosis that needs regular follow - up for early detection of possible recurrence. she had no complaints regarding reflux disease, and she is tolerating a normal diet well. the feeding jejunostomy was removed, and the daily dose of ppi was reduced to 20 mg of omeprazole. esophageal leiomyomatosis is a rare benign neoplastic condition in which proliferation of the smooth muscle layer of the esophagus leads to circumferential thickening. though in 35% of cases, there may be diffuse involvement of the whole esophagus, in 80% of cases it extends to the proximal part of the stomach. histologically, this condition is characterized by circumferential proliferation of smooth muscle layer with minimal cellular atypia, but without mitosis or vascular invasion (figures 5 and 6). he described this condition in a 17-year - old girl who had a history of dysphagia : until now, < 100 cases have been reported. it is twice as common in males as in females. regarding the clinical presentation, most patients present with dysphagia that is usually progressive and longstanding over many years. it is important to differentiate it from that occurring in patients with achalasia in which dysphagia is also longstanding and progressive, but it tends to occur in adolescents. this condition can occur sporadically, or it may be associated with hereditary diseases like alport syndrome, characterized by deafness, cataracts, and hematuria. it may present as isolated esophageal leiomyomatosis or in association with other visceral forms of leiomyomatosis like rectal, tracheobronchial, and others. ct scan, barium study, and endoscopic ultrasound (eus) are the mainstay of diagnosis. the ct scan usually shows circumferential thickening of the esophageal wall that extends to the cardia. it is not easy to differentiate these 2 entities, though the narrowed segment in achalasia is usually shorter than in leiomyomatosis. upper endoscopy also is helpful because it may show irregularity of the wall due to submucosal lesions that are mostly covered by normal mucosa. a total or subtotal esophagectomy including proximal gastrectomy must be performed depending on the extent of the disease. each procedure has its advantages and disadvantages in terms of operative difficulties and postoperative short- and long - term morbidities. regarding our patient, who was already suffering from reflux disease, we preferred to use the merindino procedure after distal esophagectomy with proximal gastrectomy. the merendino technique was introduced in 1955 by merendino and dillard as an option for reconstruction after gastroesophageal junction tumors. a surgeon has to be aware of intraoperative incidental findings, ie, converting laparoscopic procedure and performing conventional resection and reconstruction with minimal morbidity. we are convinced that in this case merendino 's procedure was the best reconstructive option, because our patient was already suffering from reflux symptoms. | case report : a 42-year - old female presented with longstanding symptoms suggestive of gastroesophageal reflux disease improved after proton pump inhibitor treatment. an upper endoscopy revealed an intrathoracic position of the stomach (type 4 hiatal hernia) with no mucosal abnormality. barium swallow demonstrated gastric herniation with gastric volvulus without stenosis. a computed tomographic scan confirmed the intrathoracic location of the stomach associated with thickening and edema of the gastric wall due to gastric volvulus, but no evidence of malignancy. the patient was scheduled for laparoscopic gastric repositioning with anterior hemifundoplication. due to the incidental intraoperative finding of a large distal esophageal tumor (frozen section : esophageal leiomyomatosis), the operation was converted to conventional distal esophagectomy and proximal gastrectomy with reconstruction using a merendino procedure. final histology revealed extensive circumferential leiomyomatosis of the distal esophagus with a diameter of 10 cm. esophageal leiomyomatosis is an extremely rare pathological finding with < 100 cases reported in the literature.conclusion:any surgeon performing laparoscopic fundoplication has to be ready to deal with such unexpected findings, ie, converting the procedure and doing reconstruction with minimal morbidity. the merendino procedure is a well - established reconstructive surgical option in cases of tumor formation at the gastroesophageal region with fewer postoperative morbidities like reflux symptoms. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.