article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
the success of restorative dentistry is determined on the basis of functional results and esthetic outcomes. the constant evolution of restorative materials and techniques has made possible the achievement of optimal esthetics. currently, fluoride - releasing esthetic restorative materials have been extensively used due to their caries preventive effect. however, the color stability of these restorative materials has been a challenge to dentistry, as the oral cavity has a dynamic environment. due to the constant presence of oral microflora, saliva and the frequent intake of food, the color stability of an esthetic material like composite resin previous studies have revealed that composite resins are susceptible to various degrees of discolouration which may be attributed to intrinsic or extrinsic factors. intrinsic factors involve alterations or changes in the chemical structure of the composite resins under physical and chemical conditions, while extrinsic factors are mainly due to surface staining from absorption or adsorption of exogenous substances. it is reported that matrix, filler composition and content, minor pigment addition, initiation components and filler coupling agents also affect color of esthetic materials. the visible color alterations in esthetic materials can also be ascribed to the proprietary differences in chemistry that may affect the polymerization, water sorption, and consequently the color stability of the material. in addition, the obvious effect of colorants in beverages and foods leads to extrinsic discoloration of composites. thus, for suitable performance, longevity and good clinical success of esthetic restorations, the material of choice should present adequate inherent characteristics. however, the property of color stability of esthetic dental materials is often ignored over other physical and mechanical properties while making a choice. the ideal composite resin formulations that may permit an optimal esthetic outcome without compromising the mechanical properties essential for a suitable functional outcome are nevertheless under exploration. it is imperative that an ideal anterior restorative material should exhibit adequate esthetics as a function of color stability in addition to other properties such as strength and biocompatibility and at the same time aid in prevention of secondary caries formation. the conventional glass ionomer cement (gic) is a fluoride - containing restorative material with non - satisfactory esthetics. thus, different hybrid restorative materials such as high - viscosity gic, polyacid - modified resin composite, giomers, and resin - modified glass ionomer cement (rmgic) have been developed to improve some physical properties of the materials, including the esthetics. however, there is limited information regarding the color stability of these hybrid restoratives. thus, the aim of the present study was to evaluate the color stability of two hybrid esthetic restorative materials, when subjected to immersion in various children 's beverages. the test restorative materials used in the study were resin - modified glass ionomer cement (gc fuji ii lc capsules - gc corporation, tokyo, japan) and giomer (beautifil ii - shofu inc, kyoto, japan). for preparation of the test specimens, a custom - made teflon ring mould was used. the capsules of rmgic were activated and mixed in amalgamator (gnatus amalga mix 2) for 10 seconds according to manufacturer 's instructions. the specimens were made by placing the respective materials into the mould over a glass slab sandwiched between two mylar strips using gc applier ; the smoothest surfaces were obtained by curing the materials against the mylar strip. the material was light - cured for 40 seconds on each side (henry schein 's maxima led unit). similarly, giomer specimens were prepared by incremental insertion into the mould with plastic instruments followed by sandwiching between two mylar strips and light - curing for 40 seconds on each side. after preparation, the specimens were kept in distilled water for 24 hours to achieve rehydration. after rehydration, the samples were rinsed and dried with filter paper, and the baseline color measurements were performed using spectrophotometer (gretag macbeth color - eye 7000a). color evaluations were made with color parameters based on average daylight (d65 : 6504 k) and illuminating view geometry d/10. individual specimens were placed on aperture, and readings were recorded according to commission internationale de leclairege lab color space (cielab). after baseline evaluation, the above groups were further divided into 6 experimental subgroups for immersion in 3 children 's beverages, namely, orange juice (pepsico, india), bournvita milk (kraft foods, cadbury india), and coke (the coca - cola company, atlanta, ga). for each subgroup, the bournvita milk was prepared using 15 g of bournvita poured into 500 ml of unsweetened hot milk and filtered after 10 minutes. the specimens were subjected to ph - cycling by daily immersion in demineralizing solution for 7.5 hours and in a remineralizing solution for 16 hours. the demineralizing solution was prepared using 2.2 mm cacl2, 2.2 mm nah2po4, and 50 mm acetic acid adjusted to ph 4.8. the remineralizing solution was prepared using 1.5 mm cacl2, 0.9 mm nah2po4, and 0.15 m kcl adjusted to ph 7. these solutions served as storage medium for the specimens so as to mimic the oral environment. the specimens were removed daily from the ph cycling solutions and immersed in respective beverages for 30 minutes. subsequent to immersion and ph cycling, new color evaluations were carried out after 1 week (t1) and 4 weeks (t4) for all the experimental groups. lab values of each specimen were measured 3 times by placing each specimen on the measuring head. the values of dl da and db after 3 measurements were automatically calculated by spectrophotometer and recorded. resistance to staining effect was expressed in delta e unit and calculated from the mean dlda and db values for each specimens with the following formula, equation : delta e = [(dl)+ (da)+ (db) ] the data generated during the study was processed with the aid of pasw 18.0 software (formerly known as spss). the comparative evaluation of color change (de) as a function of different beverages was obtained using one - way analysis of variance (anova). the statistical analysis indicated that the de of bournvita group was significantly (p < 0.05) lesser than that observed with orange juice and coke groups at both time periods, i.e. t1 and t4 with rmgic. the de of orange juice group was significantly (p < 0.05) lesser than that observed with bournvita and coke groups at both time periods, i.e. t1 and t4 with giomer [tables 1 and 2 ]. mean color change (de) recorded as a function of use of different beverages using rmgic after 1 week (t1) and 4 weeks (t4) mean color change (de) recorded as a function of use of different beverages using giomer after 1 week (t1) and 4 weeks (t4) in rmgic group, it was observed that there was a significant increase in mean color change after 4 weeks when compared to that observed after 1 week of immersion in orange juice. the maximum color change took place after 1 week of immersion in bournvita and coke. the color change gradually decreased over the period of 4 weeks with bournvita and coke [table 1 ]. the results for giomer showed that the maximum color change took place after 1 week of immersion in orange juice and bournvita. the color change gradually decreased over the period of 4 weeks with orange juice and bournvita. there was a significant increase in mean color change after 4 weeks when compared to that observed after 1 week of immersion in coke [table 2 ]. it could be concluded on the basis of statistical analysis of the data that comparatively, giomer indicates a better color stability than that exhibited with material rmgic [graph 1 ]. comparative assessment of the least mean color change (de) obtained with rmgic and giomer according to paired t test the discoloration of tooth - colored, resin - based materials may be caused by intrinsic or extrinsic factors. the use of instrumental methods like spectrophotometers and colorimeters to quantify tooth color could potentially eliminate the subjective aspects of color assessment. the american dental association recommends the use of the cielab color differential system in assessing chromatic differences. in the present study, the color evaluations were made using a reflectance spectrophotometer using the cielab color system. this system is a useful mode that provides information about location of object color in a uniform 3-d color space. it quantifies the color in terms of 3 co - ordinate values l, a, and b. here, l represents brightness or lightness (value), and a and b serve as numeric correlates both for hue and chroma. the a and b values represent position on a red / green and yellow / blue axis, respectively. the magnitude of the color difference (delta e) perceived between two objects is thus calculated. the higher the delta e, the greater the difference between the two samples being compared. a delta e value of 3.3 or less is considered to be clinically acceptable in dentistry. the results of the present study showed that giomer exhibited greater stain resistance as compared to rmgic at both time periods with respect to all of the tested beverages. this difference in the color stability of the two materials tested could be attributed to the differences in various factors as discussed further. the oral environment is exposed to a variety of media on a daily basis, many of which may stain or alter the surfaces of dental restorations, potentially causing esthetic degradation. staining of oral tissues and restorations is known to be affected by dietary factors. while many studies exist on the staining effects of beverages on tooth - colored restorations, the beverages used in most of these studies were coffee, tea, and wine, which are normally associated with adult tooth stains. a few studies have evaluated the effects of common beverages ingested by children and their staining effects on restorative dental materials, but studies on fluoride - releasing restorative materials have not been previously reported. consumption of soft drinks is known to have increased in recent years, and is especially high among younger individuals. the effect of cola on the color stability of restorative materials has been evaluated ; however, the effects of chocolate milk and orange juice have not been reported. therefore, the present study measured the color stability of rmgic and giomer after exposure to various children 's drinks. also, the choice of the beverages in the present study attempted to represent diverse areas of the color spectrum. there are differences in consistency also as juice is a thin, watery solution, bournvita milk is sugary, and coca - cola is carbonated. additionally, the beverages show varying ph like 3.0 (cola), 3.88 (orange juice), and 6.9 (bournvita milk). in the present study, although color change was observed maximum in 1 week, it gradually increased from 1 week to 4 weeks with cola samples. this could be attributed to low ph of cola, which may lead to increased surface roughness. in the present study, a ph cycling process has been used in order to simulate the oral environment. however, it has been previously reported that fluoride - releasing materials have a greater ion release when submitted to ph variations than when stored in artificial saliva or saline. these facts could lead to lower color stability evident in the present study due to the great amount of ionic changes between the materials and the environmental solutions. staining susceptibility of resin - based materials might be attributed to their degree of water sorption and hydrophilicity of matrix resin, that is, if the resin composite can absorb water, it can also absorb other fluids like tea and coffee. the glass filler particles will not absorb water into the bulk of the material ; however, can absorb water onto the surface. in the literature, hydrophobic materials like resin composites are believed to exhibit greater stain resistance and color stability than hydrophilic materials like glass ionomer cements and compomers. it is reported that most of the water sorption with resin - based materials was observed during the first week. chan. investigated the staining potential of coffee, tea, cola, and soy sauce on two different resin composites and reported that staining after 1 week of immersion differed significantly from all succeeding weeks, and the greatest amount of discoloration occurred during the first week, which is in agreement to the results obtained in the present study. the color stability is also related to the resin matrix, dimensions of filler particles, depth of polymerization, and staining agents. among the materials tested, it has been previously reported that glass ionomer cements lack color stability due to the polyacid content of the material and can be explained by the degradation of metal polyacrylate salts. this may be attributed to the amount of resin and filler particles present in the giomer. rmgic is a hybrid material with a mean filler size range of 1.8 m, with filler loading 76 wt.% by volume. giomer is a bridge product ; with filler loading 83.3 wt.% and a particle size of 0.8 m. the composition and size of the filler particles affect the surface smoothness and the susceptibility for extrinsic staining. therefore, it can be expected that giomer, with a smaller particle size, will have a smoother surface and will retain less surface stains than rough surfaces. moreover, it is reported that giomer consists of additional discrete nano - fillers (10 - 20 nm), which makes it possible to incorporate larger filler content of 68.6 vol%. this may lead to a better polishability and surface finish and subsequently, more resistance to staining with giomer. based on the results of the present color stability evaluation, it can be stated that giomer material showed greater resistance to staining as compared to rmgic at all time periods.
|
purpose : the present study was aimed to evaluate and compare the color stability of two hybrid tooth - colored restorative materials, namely, resin - modified glass ionomer cement (gc fuji ii lc capsules - gc corporation, tokyo, japan) and giomer (beautifil ii - shofu inc, kyoto, japan) when subjected to immersion in various children 's beverages.materials and methods : standardized disc specimens were prepared using the test restorative materials. after preparation and rehydration of the specimens, baseline color evaluations were performed using spectrophotometer. the readings were recorded according to cielab color space. the experimental groups were further subdivided for immersion in orange juice, bournvita milk, and coke. subsequent to immersion and ph cycling, new color evaluations were carried out after 1 week and 4 weeks for all the experimental groups. the mean color change values were calculated.results:the obtained data was subjected to statistical analysis. the results indicated that giomer specimens exhibited less color change as compared to rmgic specimens indicating better color stability. the maximum color changes were found with the use of coke for a period of 4 weeks.conclusion:amongst the two materials, giomer showed less color changes as compared to rmgic indicating a better color stability.
|
intramural gallbladder hematoma is one of the rare causes of abdominal pain and commonly occurs in patients with trauma, hemobilia, gallbladder neoplasm, or bleeding diathesis including renal impairment, hepatic cirrhosis, and anticoagulant therapy. the clinical characteristics vary from findings indicating cholecystitis such as right upper quadrant (ruq) pain, fever, and leukocytosis to symptoms indicating gastrointestinal bleeding like hemobilia, melena, and hematemesis. while abdominal ultrasonography is a major imaging method to diagnose gallbladder diseases, it is difficult to distinguish hyperechogenic, immovable mass on the ultrasonography from diseases like gallbladder neoplasm, tumefactive biliary sludge, and gangrenous cholecystitis. we present one case of intramural gallbladder hematoma of which we were unable to make a definitive diagnosis until after cholecystectomy in a patient who had not experienced any previous abdominal trauma and had no history of bleeding disorders. the pain was sudden in onset, dull in character, and did not radiate to the back. on admission, the physical examination exhibited ruq tenderness and a positive murphy 's sign. laboratory examinations revealed that white blood cell, hemoglobin, hematocrit, and platelet counts were 9,450/mm, 16.4 gm / dl, 46.5%, and 289,000/mm, respectively, which were all within the normal limits. the international normalized ratios including prothrombin time and activated partial thromboplastin time were all normal. serum amylase and lipase were 47 u / l and 22 u / l, respectively, which were all within the normal limits. aspartate aminotransferase / alanine aminotransferase was 171/57 u / l and total bilirubin 1.6 mg / dl, which showed slight increase. was suspected, abdominal computed tomography (ct) was performed. on the abdominal ct, thickening of the gallbladder wall and high - density intramural gallbladder mass without contrast enhancement were suspected (fig. therefore, endoscopic ultrasound (eus) and magnetic resonance cholangiopancreatography (mrcp) were conducted. the eus revealed mild diffuse thickening of the gallbladder wall and mass in the gallbladder lumen with the hypoechogenic boundary surrounded by a single layer of membrane along with messy hyperechoic signals (fig. the mrcp showed mild non - specific diffuse biliary dilatation but did not find anything to suspect biliary obstruction. as with the previous tests, the mrcp showed diffuse thickening of the gallbladder wall and a filling defect inside the gallbladder (fig. the patient complained of mild but persistent ruq pain, and a possibility of gallbladder tumor could not be ruled out considering the findings of several imagining studies. bloody fluid was not seen in the peritoneal cavity. upon opening the gallbladder postoperatively, 4). under optical microscope, diffuse hemorrhage and infiltration of non - specific chronic inflammatory cells were observed from the mucosa to serosa (fig. intramural gallbladder hematoma is a very rare disease and its causes are various. since sandblom reported 9 patients with cholemia who showed post - traumatic acute abdominal pain and shock in 1948, intramural gallbladder hematoma has been reported in a number of clinical situations. it is also associated with gallbladder neoplasm, aneurysm rupture, hemophilia, bleeding diathesis including renal impairment and hepatic cirrhosis, and anticoagulant therapy. hemorrhage accompanied with cholecystitis has rarely been reported. as for symptoms, clinical characteristics indicating acute cholecystitis such as ruq pain, fever, and leukocytosis are commonly observed, and gastrointestinal bleeding like hemobilia, melena, and hematemesis rarely happen. intramural gallbladder hematoma caused by hemorrhage can rarely induce obstruction of common bile duct, leading to cholangitis. scrupulous examinations should be conducted including ultrasonography, abdominal ct, and - if gastrointestinal bleeding is suspected - endoscopy. despite several concomitant imaging studies, it can be difficult to diagnose gallbladder hematoma, which occurs without initiating factors including clear trauma and coagulopathy, because it looks similar to gallbladder tumor, tumefactive biliary sludge, etc., gallbladder hematoma shows fluidity changes caused by changes in posture along with hyperechogenic mass in the gallbladder. the diseases that can be identified by ultrasonography, which reveals intramural gallbladder mass, include gallbladder cancer, tumefactive biliary sludge, and gangrenous cholecystitis. early findings of gallbladder tumors on ultrasonography are local gallbladder wall thickening, irregular - bordered polyp - shaped lesion, loss of normal gentle contour of the gallbladder, etc. in the case of tumefactive biliary sludge, diffuse rough shadow in the gallbladder is observed along with thickening gallbladder wall, but acoustic shadow is not. therefore, they must be distinguished from intra - gallbladder hematoma. in this case report, the patient visited us for ruq pain and there were no findings to suspect cholecystitis except for high - density shadow in the gallbladder on the abdominal ct. the subsequent eus revealed immovable polypoidmass in the gallbladder lumen with clear boundary as well as diffuse thickening of the gallbladder wall. these findings allowed us to strongly suspect gallbladder tumor in a situation when obvious evidence could not be found to predict occurrence of intramural gallbladder hematoma. the mrcp showed mild non - specific diffuse biliary dilatation, thickening of the gallbladder wall, and filling defect in the gallbladder. treatment of intramural gallbladder hematoma can be managed by conservative therapy or surgical intervention depending on its cause. for gallbladder hematoma caused by trauma or bleeding diathesis, substantial improvement can be expected mainly through conservative therapy and follow up as long as the patient 's vital signs are stable, the clinical course is good or there are no findings such as persistent bleeding. however, if gangrenous cholecystitis is accompanying, emergency cholecystectomy should be performed because complications including perforation may occur. if gallbladder tumor is suspected as with this case report, surgical treatment is required. as mentioned above, intramural gallbladder hematoma is a very rare disease and most cases can not be definitely diagnosed although findings of imaging studies are different from those indicative of gallbladder tumor. therefore, the possibility of gallbladder tumor should be taken into consideration when a diagnosis is made. it is almost impossible to diagnose, especially when the patient does not have trauma or hemophilia or is not onanticoagulant therapy. therefore, when gallbladder tumor can not be definitely distinguished and diagnosed by applicable test methods and it is difficult to predict the clinical course as with this case report, a definite diagnosis should be made by cholecystectomy. in this case, we could not predict gallbladder bleeding because it is very rare in healthy men without any special medical history including hemorrhagic diseases. under the impression of probable gallbladder tumor, we opened the gallbladder, removed the hematoma, and performed tissue scanning to follow up for mucosa after cholecystectomy. however, macroscopic gallbladder tissues in the pool of blood and hematoma could not be scanned. in conclusion, when hyperechogenic lesion is seen in the gallbladder, gallbladder cancer should be suspected mostly, but hematoma, which can occur without bleeding diathesis or trauma, should be considered in the differential diagnosis, and cholecystectomy should be performed for definite diagnosis.
|
hemorrhage in the gallbladder (gb) is usually associated with cholecystitis, gb neoplasm, trauma, hemobilia, and cystic artery aneurysm. our patient had not experienced any previous abdominal trauma, and gb hemorrhage was unlikely to result from cholecystitis or bleeding diathesis. a 55-year - old male was admitted because of right upper quadrant pain. both prothrombin time and partial thromboplastin time were normal. abdominal computed tomography, endoscopic ultrasound and magnetic resonance cholangiopancreatography were performed. image studies revealed gb wall thickening and an intraluminal mass. laparoscopic cholecystectomy was performed. upon opening the gb postoperatively, a large amount of fresh blood and old blood clot was noted. the incidence of gb hematoma is very rare. gb hematoma should always be considered in the differential diagnosis of gb tumor. in such a situation, surgical intervention is needed for further patient evaluation and management. we present a rare case of intramural gb hematoma, of which we were unable to make a definitive diagnosis preoperatively.
|
pan involves multiple organs, therefore, single organ involvement except for the skin is rare. in particular, most cases only present symptoms of myalgia and a fever without the elevation of creatine kinase, leading to a difficulty in the diagnosis (1,2). recently, some groups have reported the utility of magnetic resonance imaging (mri), which demonstrates diffuse high intensity signals in affected muscles (3,4). we herein report the case of biopsy - proven pan confined to the lower limb muscles with unusual mri findings, which were discordant from previous reports. a 69-year - old man was hospitalized because of a spiking fever and lower limb weakness and pain that persisted for a month. on physical examinations, there was no eruption, ocular abnormal finding, oral ulcer, respiratory manifestation, arthritis, or any abnormal neurological signs except for rapidly progressive lower proximal muscle weakness. manual muscle testing revealed the following (right / left) : deltoid 5/5, biceps 5/5, triceps 5/5, iliopsoas 3/4, quadriceps 3/3, biceps femoris 5/5, gastrocnemius 5/5, and tibialis anterior 5/5. blood testing showed an elevated c - reactive protein (crp) level of 20 mg / dl, low levels of creatine kinase (ck) of less than 20 u / l and normal levels of aldolase of 4.9 iu / l (2.7 - 5.9 antinuclear antibody was negative, and both anti - proteinase 3 antineutrophil cytoplasmic antibodies and myeloperoxidase antineutrophil cytoplasmic antibodies were negative. other laboratory testing showed alanine aminotransferase levels of 11 u / l (5 - 40 u / l), aspartate aminotransferase levels of 14 u / l (10 - 35 u / l), serum creatinine levels of 0.63 mg / dl (0.7 - 1.1 mg / dl), kl-6 levels of 125 u / ml (0 - 500 u / ml), and sp - d levels less than 17 ng / ml (0 - 109 ng / ml). hepatitis b antigen, hepatitis b antibody, and hepatitis c antibody were all negative. a urinalysis showed a red blood cell count of 3 - 5/hpf, a white blood cell count of 3 - 5/hpf, trace protein and no red blood cell casts. although an electromyogram showed a mild positive sharp wave in the gluteus maximus, enhanced mri demonstrated discretely granular hyperintensities on t1 in the gluteus maximus and femoral muscles (fig. a biopsied specimen of the femoral muscle revealed fibrinoid necrosis of small - sized arteries (100 m) with inflammatory cell infiltrate and disruption of the elastic lamina of the vessel wall without findings of myonecrosis (fig. 2). a computed tomography angiogram did not show any other lesions related to pan, including aneurysms. according to these findings, the patient was diagnosed with pan with limited involvement in the muscle and treated with methylprednisolone pulse therapy (1,000 mg / day 3 days) followed by prednisolone of 60 mg / day. his fever subsided and the crp level temporarily decreased, but re - increased within 5 days. we added monthly intravenous cyclophosphamide (ivcy) of 1,000 mg, which resulted in normalization of the crp level (fig. sulfamethoxazole / trimethoprim was switched to pentamidine inhalation for prophylaxis against pneumocystis pneumonia due to drug - induced leukocytopenia. however, after two episodes of bacterial pneumonia requiring intravenous antibiotics, a sustained elevation of the crp level was observed with a decrease in the psl dose and intermission of ivcy. we regarded the crp elevation to be related to pan activity, and switched psl to betamethasone (bmz) and reinitiated ivcy to control pan inflammation. the mri findings of the limb muscles improved after the second course of ivcy. however, 27 days after the third course of ivcy, he developed pneumocystis jiroveci pneumonia that was diagnosed with elevated (13)--d - glucan (31.9 pg / ml) and the presence of pneumocystis jiroveci dna from his sputum, although pentamidine inhalation was periodically performed. despite methylprednisolone pulse therapy (1,000 mg / day3 days) and sulfamethoxazole / trimethoprim, his respiratory condition deteriorated, and he died 14 days after the diagnosis of pneumocystis pneumonia. (a) fibrinoid necrosis of a medium - sized vessel (hematoxylin and eosin staining, 400). (b) disruption of the elastic lamina of the vessel wall (elastica van gieson stain, 400). the x - axis indicates the date and the y - axis indicates the crp levels (mg / dl) and (13) --d - glucan levels (pg / dl). psl : prednisolone, mpsl : methylprednisolone, bmz : betamethasone, ivcy : intravenous cyclophosphamide, mepm : meropenem, st : sulfamethoxazole / trimethoprim, mri : magnetic resonance imaging we present a case of refractory, biopsy - proven pan with only muscle involvement that showed unusual findings of discretely granular hyperintensities on t1-weighted mri with contrast enhancement in the femoral muscles. ten cases of pan confined to the lower limb muscles with mri finding were previously reported with mri images (table). mri in those cases (2 - 10) showed homogenous hyperintensities within the muscles resembling inflammatory myositis without ck elevation (one case showed an elevated ck level). the possibility that these findings reflect functional ischemia inside the muscles is of great interest in considering the pathological differences between pan and inflammatory myositis. ck : creatine kinase, mpsl : methylprednisolone, bmz : betamethasone, ivcy : intravenous cyclophosphamide, tri : triamcinolone, psl : prednisolone, na : not available according to the description in the manuscript. we then classified the mri findings of the ten previous reports and our case as diffuse, patchy and granular hyperintensities. we classified the mri findings into patchy and diffuse according to either the description or the area and homogeneity of t2 high intensity lesions in muscle mri images in the previous reports. although the difference in mri resolution might affect the findings between patchy and speckled hyperintensities, no previous reports described the resolution of mri used. furthermore, we divided the diameters of the affected vessels into small, small to medium or medium - sized according to the descriptions in the articles. we classified the affected vessel diameter of our case as small according to the 2012 revised international chapel hill consensus conference nomenclature of vasculitides (11). there was a trend that cases with affected small - sized vessels showed patchy or granular high intensity lesions on mri, while those with medium - sized vessels showed diffuse lesions. as medium - sized vessels are mainly localized in the epimysium and perfuse large areas of muscle fibers, medium - sized vessels can cause broad ischemia leading to vasogenic edema, which shows diffuse hyperintensities on mri. on the other hand, localized ischemia and inflammatory cell infiltration spreading from the affected small vessels to muscles can project patchy hyperintensities on mri. the discrete and granular hyperintensities on mri in our case with small - sized vasculitis suggested that mri could confirm the vessel size involved in pan. alternatively, those findings can be associated with the severity of vascular inflammation, for our case was refractory whereas other cases responded well to glucocorticoids. antineutrophil cytoplasmic antibody - associated vasculitis (aav) affects mainly small - sized vessels. although aav commonly involves the lungs and kidneys, a few cases with muscle involvement have been reported (12,13), among which only one case presented with a muscle mri image showing a diffuse pattern (12). since aav affects smaller vessels than pan, vasculitis might cause diffuse edema in the muscles resulting in diffuse hyperintensities on mri. although this case was refractory to glucocorticoid requiring intensive immunosuppressive therapy, we should have titrated the initial ivcy dose and continued sulfamethoxazole / trimethoprim in such an immunocompromised case. other treatment choices such as intravenous immunoglobulin can be considered in order to avoid susceptibility to infection such as in our case (14). in summary, we experienced a rare form of pan with a unique mri finding. a greater accumulation of cases is necessary to clarify whether this mri finding accurately reflects the course of pan.
|
polyarteritis nodosa (pan) confined to the muscle is rare and hard to diagnose. recently, the utility of magnetic resonance imaging (mri) for detecting muscle involvement of pan has been introduced. we herein report the case of biopsy - proven, refractory pan confined to the lower limb muscles with enhanced mri demonstrating discretely granular hyperintensities, which was contrary to previous reports. our results, with those of previous reports, suggest that the mri findings of muscles in pan reflect the vessel size involved and disease severity.
|
the study included 6,580 nondiabetic men from the population - based metabolic syndrome in men (metsim) study who were a mean sd age of 57 7 years. glucose tolerance was evaluated according to the world health organization criteria (12), based on glucose levels from a 2-h oral glucose - tolerance test (ogtt) (75 g of glucose). of these, 4,442 (67.5%) had normal glucose tolerance, 1,144 (17.4%) had isolated impaired fasting glucose, 582 (8.8%) had isolated impaired glucose tolerance, and 412 (6.3%) had impaired fasting glucose and impaired glucose tolerance. a total of 1,545 subjects (23.5%) were receiving statin treatment, and 16 (0.2%) were being treated with a fibrate. the study was approved by the ethics committee of the university of kuopio and kuopio university hospital, and was conducted in accordance with the helsinki declaration. height and weight bmi was calculated as weight (kilogram) divided by height (meter) squared. proton nuclear magnetic resonance (nmr) spectroscopy was used to measure lipid, lipoprotein subclass, and particle concentrations in native serum samples (1315). serum concentrations were determined for tg, total cholesterol (c), vldl - tg, intermediate - density lipoprotein (idl), ldl, and hdl cholesterol. the measurements of these subclasses have been validated against high - performance liquid chromatography (18). the subclasses are as follows : chylomicrons (cm) and largest vldl particles (cm / lar - vldl), five different vldl subclasses : very large vldl (vl - vldl), large vldl (l - vldl), medium - size vldl (m - vldl), small vldl (s - vldl), and very small vldl (vs - vldl);idl;three ldl subclasses : large ldl (l - ldl), medium - size ldl (m - ldl), and small ldl (s - ldl) ; andfour hdl subclasses : very large hdl (vl - hdl), large hdl (l - hdl), medium - size hdl (m - hdl), and small hdl (s - hdl).the following components of the lipoprotein particles were measured : phospholipids (pl), tg, cholesterol, free cholesterol (fc), and cholesterol ester (ce). chylomicrons (cm) and largest vldl particles (cm / lar - vldl), five different vldl subclasses : very large vldl (vl - vldl), large vldl (l - vldl), medium - size vldl (m - vldl), small vldl (s - vldl), and very small vldl (vs - vldl) ; three ldl subclasses : large ldl (l - ldl), medium - size ldl (m - ldl), and small ldl (s - ldl) ; and four hdl subclasses : very large hdl (vl - hdl), large hdl (l - hdl), medium - size hdl (m - hdl), and small hdl (s - hdl). descriptive statistics of 60 lipoprotein traits and their correlation with insulin sensitivity (matsuda isi) iqr, interquartile range ; p, particle concentration. genotyping of 34 snps, comprising 20 risk snps for type 2 diabetes and 14 risk snps for fasting and 2-h glucose in an ogtt (810), was performed using the taqman allelic discrimination assay (applied biosystems, carlsbad, ca) at the university of eastern finland (pparg rs1801282, kcnj11 rs5219, tcf7l2 rs7903146, slc30a8 rs13266634, hhex rs1111875, loc387761 rs7480010, cdkn2b rs10811661, igf2bp2 rs4402960, cdkal1 rs7754840, fto rs9939609, hnf1b rs7501939, wfs1 rs10010131, jazf1 rs864745, cdc123 rs12779790, tspan8 rs7961581, thada rs7578597, adamts9 rs4607103, notch2 rs10923931, kcnq1 rs2283228), or the iplex gold sbe assay (sequenom, san diego, ca) at the national human genome research institute, national institutes of health (mtnr1b rs10830963, adra2a rs10885122, fam148a rs11071657, cry2 rs11605924, adcy5 rs11708067, slc2a2 rs11920090, fads1 rs174550, dgkb rs2191349, prox1 rs340874, gck rs4607517, g6pc2 rs560887, glis3 rs7034200, gckr rs780094, madd rs7944584, gipr rs10423928). the taqman genotyping call rate was 100%, and the discordance rate was 0% among 4.5% dna samples genotyped in duplicate. the sequenom iplex call rate was 90.296.9%, and the discordance rate was 0% among 4.2% dna samples genotyped in duplicate. all snps were consistent with hardy - weinberg equilibrium at the significance level corrected for multiple testing by bonferroni method (p = 0.0015). statistical analyses were conducted using spss 17 software (spss, chicago, il). all lipoprotein traits, bmi, and insulin sensitivity index (matsuda isi) were log - transformed to correct for their skewed distribution. unstandardized effect sizes [b (se) ] per copy of the risk allele were estimated by linear regression adjusted for covariates, using untransformed dependent variables. the values of lipid traits equal to 0 were excluded from all analyses due to the need of log - transformation. the model included age, bmi, statin treatment (yes / no), and smoking (yes / no) as covariates. a p value of 2.3 10 was considered to be statistically significant given a total of 2,142 tests performed (63 traits 34 snps). however, the bonferroni correction for multiple testing might be too conservative because of high correlations between the different lipoprotein traits and subclasses. therefore, we additionally used benjamini - hochberg - yekutieli false discovery rate (fdr) method (19) to correct for multiple comparisons under dependency assumptions. in these analyses the fdr - adjusted pfdr < 0.05 was considered statistically significant. pearson correlations were calculated to test the association of lipoprotein traits with matsuda isi, calculated as [10,000/ (fasting insulin fasting glucose the genetic risk score (grs) was calculated as a sum of type 2 diabetes / hyperglycemia risk alleles in all 34 snps (grs34) in 20 type 2 diabetes risk snps (grst2d) or in 17 hyperglycemia risk snps (grsglu ; details in supplementary table 6). statistical power calculations were performed using bioconductor s geneticsdesign package version 1.16 (21). we had 80% power to detect changes in trait mean value from 1 to 28% per copy of the risk allele at the significance level of 0.05, depending on minor allele frequency (supplementary fig. the study included 6,580 nondiabetic men from the population - based metabolic syndrome in men (metsim) study who were a mean sd age of 57 7 years. glucose tolerance was evaluated according to the world health organization criteria (12), based on glucose levels from a 2-h oral glucose - tolerance test (ogtt) (75 g of glucose). of these, 4,442 (67.5%) had normal glucose tolerance, 1,144 (17.4%) had isolated impaired fasting glucose, 582 (8.8%) had isolated impaired glucose tolerance, and 412 (6.3%) had impaired fasting glucose and impaired glucose tolerance. a total of 1,545 subjects (23.5%) were receiving statin treatment, and 16 (0.2%) were being treated with a fibrate. the study was approved by the ethics committee of the university of kuopio and kuopio university hospital, and was conducted in accordance with the helsinki declaration. height and weight were measured to the nearest 0.5 cm and 0.1 kg, respectively. bmi was calculated as weight (kilogram) divided by height (meter) squared. proton nuclear magnetic resonance (nmr) spectroscopy was used to measure lipid, lipoprotein subclass, and particle concentrations in native serum samples (1315). serum concentrations were determined for tg, total cholesterol (c), vldl - tg, intermediate - density lipoprotein (idl), ldl, and hdl cholesterol. the measurements of these subclasses have been validated against high - performance liquid chromatography (18). the subclasses are as follows : chylomicrons (cm) and largest vldl particles (cm / lar - vldl), five different vldl subclasses : very large vldl (vl - vldl), large vldl (l - vldl), medium - size vldl (m - vldl), small vldl (s - vldl), and very small vldl (vs - vldl);idl;three ldl subclasses : large ldl (l - ldl), medium - size ldl (m - ldl), and small ldl (s - ldl) ; andfour hdl subclasses : very large hdl (vl - hdl), large hdl (l - hdl), medium - size hdl (m - hdl), and small hdl (s - hdl).the following components of the lipoprotein particles were measured : phospholipids (pl), tg, cholesterol, free cholesterol (fc), and cholesterol ester (ce). chylomicrons (cm) and largest vldl particles (cm / lar - vldl), five different vldl subclasses : very large vldl (vl - vldl), large vldl (l - vldl), medium - size vldl (m - vldl), small vldl (s - vldl), and very small vldl (vs - vldl) ; three ldl subclasses : large ldl (l - ldl), medium - size ldl (m - ldl), and small ldl (s - ldl) ; and four hdl subclasses : very large hdl (vl - hdl), large hdl (l - hdl), medium - size hdl (m - hdl), and small hdl (s - hdl). descriptive statistics of 60 lipoprotein traits and their correlation with insulin sensitivity (matsuda isi) iqr, interquartile range ; p, particle concentration. genotyping of 34 snps, comprising 20 risk snps for type 2 diabetes and 14 risk snps for fasting and 2-h glucose in an ogtt (810), was performed using the taqman allelic discrimination assay (applied biosystems, carlsbad, ca) at the university of eastern finland (pparg rs1801282, kcnj11 rs5219, tcf7l2 rs7903146, slc30a8 rs13266634, hhex rs1111875, loc387761 rs7480010, cdkn2b rs10811661, igf2bp2 rs4402960, cdkal1 rs7754840, fto rs9939609, hnf1b rs7501939, wfs1 rs10010131, jazf1 rs864745, cdc123 rs12779790, tspan8 rs7961581, thada rs7578597, adamts9 rs4607103, notch2 rs10923931, kcnq1 rs2283228), or the iplex gold sbe assay (sequenom, san diego, ca) at the national human genome research institute, national institutes of health (mtnr1b rs10830963, adra2a rs10885122, fam148a rs11071657, cry2 rs11605924, adcy5 rs11708067, slc2a2 rs11920090, fads1 rs174550, dgkb rs2191349, prox1 rs340874, gck rs4607517, g6pc2 rs560887, glis3 rs7034200, gckr rs780094, madd rs7944584, gipr rs10423928). the taqman genotyping call rate was 100%, and the discordance rate was 0% among 4.5% dna samples genotyped in duplicate. the sequenom iplex call rate was 90.296.9%, and the discordance rate was 0% among 4.2% dna samples genotyped in duplicate. all snps were consistent with hardy - weinberg equilibrium at the significance level corrected for multiple testing by bonferroni method (p = 0.0015). statistical analyses were conducted using spss 17 software (spss, chicago, il). all lipoprotein traits, bmi, and insulin sensitivity index (matsuda isi) were log - transformed to correct for their skewed distribution. unstandardized effect sizes [b (se) ] per copy of the risk allele were estimated by linear regression adjusted for covariates, using untransformed dependent variables. the values of lipid traits equal to 0 were excluded from all analyses due to the need of log - transformation. the model included age, bmi, statin treatment (yes / no), and smoking (yes / no) as covariates. a p value of 2.3 10 was considered to be statistically significant given a total of 2,142 tests performed (63 traits 34 snps). however, the bonferroni correction for multiple testing might be too conservative because of high correlations between the different lipoprotein traits and subclasses. therefore, we additionally used benjamini - hochberg - yekutieli false discovery rate (fdr) method (19) to correct for multiple comparisons under dependency assumptions. in these analyses the fdr - adjusted pfdr < 0.05 was considered statistically significant. pearson correlations were calculated to test the association of lipoprotein traits with matsuda isi, calculated as [10,000/ (fasting insulin fasting glucose mean insulin during ogtt mean glucose during ogtt) ] (20). the genetic risk score (grs) was calculated as a sum of type 2 diabetes / hyperglycemia risk alleles in all 34 snps (grs34) in 20 type 2 diabetes risk snps (grst2d) or in 17 hyperglycemia risk snps (grsglu ; details in supplementary table 6). statistical power calculations were performed using bioconductor s geneticsdesign package version 1.16 (21). we had 80% power to detect changes in trait mean value from 1 to 28% per copy of the risk allele at the significance level of 0.05, depending on minor allele frequency (supplementary fig. the p values and effect sizes for the associations between 34 snps and 60 lipoprotein traits are summarized in fig. 1. two snps (gckr rs780094 and fads1 rs174550) were significantly associated with several lipoprotein traits after adjustment for age, bmi, statin treatment, smoking, and conservative bonferroni correction for multiple testing (p 2.3 10). two more snps (notch2 rs10923931 and hnf1b rs7501939) showed significant associations using a less conservative fdr correction for multiple testing (pfdr < 0.05). significances (a) and effect sizes (b) of associations between 34 snp and 60 lipoprotein traits in nondiabetic men. p values (presented as log10) were calculated by linear regression adjusted for age, bmi, statin treatment, and smoking, using log - transformed variables. unstandardized effect sizes (presented as percentage from the mean) per type 2 diabetes / hyperglycemia risk allele were calculated from the same model, using untransformed variables. the type 2 diabetes risk (major) c allele of the intronic snp rs780094 at the gckr gene was significantly associated with low particle concentrations of vldl subclasses (from vl- to s - vldl, p = 1.9 10 7.3 10), with effect sizes from 4 to 10% per allele (fig. 2a, supplementary table 2). the c allele was also significantly associated with low concentrations of almost all components of (cm) and vldl (pl, tg, c, fc, and ce). furthermore, the c allele was nominally associated with low particle concentrations of cm / lar - vldl (p = 5.4 10), vs - vldl (p = 1.4 10), and the l - ldl (p = 0.008), m - ldl (p = 5.0 10), and s - ldl (p = 3.2 10) subclasses, and with high concentrations of vl - hdl (p = 0.031) and l - hdl (p = 2.8 10) but low concentration of s - hdl particles (p = 8.4 10), as well as with most of the components of these particles. associations for vs - vldl, s - ldl, and s - hdl were statistically significant when using the fdr correction (pfdr = 0.048, 0.015, and 0.030). this snp tended to have larger and more significant effects on the tg components of most of lipoprotein subclasses (cm, vldl, idl, and hdl) than on other components. the c allele was also significantly associated with vldl particle size (p = 4.8 10), and nominally with ldl and hdl particle size (p = 8.2 10 and 2.3 10). almost all associations disappeared after additional adjustment for serum levels of tgs, suggesting that they were most likely secondary to the effects of rs780094 on tg synthesis or metabolism. effects of gckr rs780094 (a), fads1 rs174550 (b), notch2 rs10923931 (c), and hnf1b rs7501939 (d) on lipoprotein subclasses and their components in nondiabetic men. bars represent percentage change to the mean of the trait per copy of a minor allele and were calculated by linear regression adjusted for age, bmi, statin treatment, and smoking. significant association after bonferroni correction (p < 2.3 10) or fdr correction for multiple testing (pfdr < 0.05). nominally significant associations (p < 0.05). the type 2 diabetes risk (major) t allele of the intronic snp rs174550 at the fads1 gene was significantly associated with high concentrations of vl - hdl (p = 2.5 10) and l - hdl (p = 1.6 10) particles, with effect sizes of 6.7 and 4.8% per allele, and all their components (fig. 2b, supplementary table 3). the largest effect size (6.7% per allele) was observed for the pl component of vl - hdl particles (p = 2.6 10). association with low concentration of s - hdl particles was nominally significant (p = 0.002). the t allele was also nominally associated with low concentrations vl- to s - vldl particles, and high concentrations of vs - vldl and idl particles (p = 2.8 10 to 0.032), as well as with components of vldl and idl particles. rs174550 was also significantly associated with particle size of vldl (p = 5.8 10) and hdl (p = 1.1 10), and nominally with ldl particle size (p = 0.001). the associations with hdl subclasses and hdl particle size were not considerably affected by additional adjustment for tgs, suggesting that primary effect of the snp might be on hdl particles. the type 2 diabetes risk (minor) t allele of the intronic snp rs7501939 at the hnf1b gene was nominally associated with high particle concentrations of all vldl subclasses (p = from 8.1 10 to 0.006) and their components and low concentration of vl - hdl (p = 0.038) and l - hdl (p = 0.004) particles and their components (fig. the association with s - vldl was significant when using fdr correction (pfdr = 0.030), as well as associations with components of m - vldl (fc, pfdr = 0.05), s - vldl (pl, pfdr = 0.045 ; tg, pfdr = 0.020), and vs - vldl (tg, pfdr = 0.016). these associations, however, disappeared after additional adjustment for tgs. the intronic snp rs10923931 at the notch2 gene was nominally associated with particle concentrations and components of most of the lipoprotein subclasses (fig. the type 2 diabetes risk (minor) a allele was nominally associated with low concentrations of l- to vs - vldl, idl, and ldl (all subclasses), and with high concentrations of vl - hdl particles (p = 4.1 10 to 0.039). significant associations (using fdr correction) were observed for concentration of s - hdl particles (pfdr = 0.017), the tg component of vs - vldl (pfdr = 0.044), and the pl component of m - ldl (pfdr = 0.030), with effect sizes of a 13% decrease per a allele. the results for gckr rs780094, fads1 rs174550, notch2 rs10923931, and hnf1b rs7501939 remained essentially similar when statin users (n = 1,545) were excluded (data not shown). the quantile - quantile (q - q) plot of the association results between the 34 snps and the 60 lipoprotein traits (observed log10 p values against theoretic expected log10 p values) shows a large deviation from the null hypothesis of no association, strongly suggesting that the deviating results are true significant associations (fig. 3). after the p values of two most significant snps (in gckr and fads1) were excluded from the analyses, the q - q plot still deviated from the null hypothesis. however, after p values of notch2 and hnf1b snps were also excluded, the deviation from the null hypothesis was largely decreased ; therefore, the nominally significant associations in the remaining snps might be false findings, such as associations of cdc123 rs12779790 with vl- and l - hdl particles, dgkb rs2191349 with vl - hdl particles, fto rs9939609 with l- and m - ldl and vl - hdl, jazf1 rs864745 with l- to s - vldl and all ldl particles, kcnj11 rs5219 with m- and s - hdl, and prox1 rs340874 with cm / lar - vldl and vl- to s - vldl particles, and with vl- and l - hdl. quantile - quantile (q - q) plot of the association results between 34 hyperglycemia and type 2 diabetes risk snps and 60 lipoprotein traits (observed log10 p values against theoretical expected log10 p values). the diagonal black line represents theoretical expected values and the gray dashed lines their 95% ci. blue dots, all p values ; red dots, p values for two leading snps (gckr rs780094 and fads1 rs174550) excluded ; green dots, p values for four snps showing significant (pfdr < 0.05) associations (in gckr, fads1, hnf1b, notch2) excluded. the grs calculated using all 34 snps did not show significant associations with concentrations of any of the particles, and the same was observed for grst2d, which included type 2 diabetes risk snps or grsglu, including hyperglycemia snps (supplementary table 6). nominally significant associations of grsglu with vl - hdl (p = 0.047) and l - hdl (p = 0.012) particle concentrations disappeared after gckr and fads1 snps were excluded from the calculations. this suggests that the associations of individual snps with the lipoprotein traits as described are specific for these traits and are not an indication of systematic effects of type 2 diabetes / hyperglycemia risk snps on lipoprotein metabolism. all lipoprotein traits, with the exception of l - ldl particles, were significantly correlated with matsuda isi. the strongest correlations were observed for cm / lar - vldl and the vl- to s - vldl subclasses, particularly with their tg components (r = 0.41 to 0.45), and with l - hdl particles and all their components (r = 0.39 to 0.41 ; table 1). of four snps significantly associated with lipoprotein traits, gckr rs780094 and notch2 rs10923931 showed nominally significant associations with matsuda isi (p = 0.001 and 0.012, respectively, supplementary table 7). this could suggest that the associations between these two snps and lipoproteins are mediated through their effects on insulin sensitivity. additional adjustment for matsuda isi indeed decreased the effects of notch2 rs10923931 on lipoproteins, but no such effect was observed for other snps. however, the effect of snps on lipoproteins was very small : gckr and fads1 snps explained a 1.3% variance in their most associated lipoprotein traits compared with the effect of matsuda isi, which explained a 1219% variance in the same traits. this is the first large population based study where the effects of 34 confirmed risk snps for hyperglycemia or type 2 diabetes on lipoprotein subclasses and their composition have been systematically investigated. we found that 4 of the 34 tested snps, in gckr, fads1, hnf1b, and notch2 genes, were significantly associated with lipoprotein traits after correction for multiple testing. this indicates that there could be some overlap between the genes affecting both glucose and lipoprotein metabolism. the most statistically significant finding was the association of the hyperglycemia / type 2 diabetes risk c allele of the intronic snp rs780094 of gckr with low concentrations of all subclasses of vldl particles (effect sizes 102% per allele for cm / lar - vldl and vl- to s - vldl) as well as with the diameter of vldl particles. only one previous study has examined the effects of gckr on lipoprotein fractions, reporting an association (p < 5 10) of rs1260326 at the gckr locus (in linkage disequilibrium with rs780094, r = 0.89 according to hapmap ceu) with large and medium - size vldl particles and mean particle size (22), which is in agreement with our findings. furthermore, the c allele of rs780094 was significantly associated in our study with a low concentration of s - ldl particles and s - hdl particles, besides nominal associations with idl and other subclasses of ldl and hdl particles. the aforementioned study reported similar associations of rs780094 with s - ldl particles and s - hdl particles (22). in addition, we observed a tendency to a stronger association of the c allele with the tg components of most of the lipoprotein subclasses than with other components. previous studies and gwas, applying only standard measurements of lipoprotein levels, have consistently shown that the c allele of rs780094 was associated with low tg levels (2325). in the first gwas performed by the diabetes genetics initiative consortium, similarly, the missense variant rs1260326 (leu446pro), which could be responsible for the associations of rs780094 (26), has been associated with tg levels in several studies (2630). our study suggests that the association between gckr and tg is attributable to changes in vldl particle concentration, especially in the largest tg - rich subclasses. additional adjustment for serum tg levels abolished all associations of the snp with particles and their components, suggesting that the observed effects of rs780094 on idl, ldl, and hdl particles could be secondary to its effects on tg / vldl metabolism rather than independent effects. a previous study proposed that large tg - rich vldl particles, secreted by the liver preferentially in hypertriglyceridemic conditions, are metabolized into small ldl particles (31), which could explain the stronger association of rs780094 with s - ldl particles in our study. the inverse relationship between tg and hdl levels is well documented (32) and is at least partly explained by increased catabolism of tg - enriched hdl particles (33). the main biologic function of the glucokinase regulatory protein is to inhibit the effects of glucokinase on glycogen synthesis and glycolysis in the liver (34). snps at the gckr locus have been associated with fasting glycemia (9,29), risk of type 2 diabetes (25,29), insulin resistance (25,29,35), and increased hepatic glucose production (26). our study also confirmed the association of the c allele of rs780094 with decreased insulin sensitivity (matsuda isi). however, it did not seem to account for the changes in lipoprotein particle concentrations, because additional adjustment for matsuda isi did not attenuate the associations between rs780094 and lipoproteins. moreover, the effects of rs780094 on insulin resistance and tg levels were in opposite directions. a recent article reporting that leu446pro indirectly increases gk activity proposed that the increased glycolytic flux leads to the elevation of malonyl - coa, a substrate for de novo lipogenesis, which could explain the opposite effects of the snp on glucose and tg levels (36). the glucose - increasing (major) t allele of the intronic snp rs174550 in the fads1 gene was significantly associated with high concentrations of vl- and l - hdl particles and all of their components, as well as with hdl particle diameter. nominally significant associations were found with all vldl subclasses and idl particles. a previous study (22) found an association of two other snps at the fads1 - 2 - 3 gene cluster with medium hdl (rs174537) and large hdl particles (rs102275), and one snp with large ldl particles (rs1535). moreover, four recent gwas (28,30,37,38) reported associations of the fads1 - 2 - 3 snps with hdl cholesterol, total cholesterol, ldl cholesterol, and tg. our findings suggest that rs174550 may primarily affect vl- and l - hdl particles because the associations persisted after additional adjustment for serum tg levels. fads1 encodes the fatty acid desaturase -5 (d5d), which plays a crucial role in desaturation and elongation of polyunsaturated fatty acids (pufa). several snps at the fads1 locus have been previously associated with pufa concentrations in serum and tissue phospholipids (39,40). association of the fads1 locus (rs174537) with serum pufa levels was been confirmed by a gwas in the invecchiare in chianti (inchianti) study (41). the pl component of vl - hdl particles was one of the most strongly influenced traits by rs174550 in our study. fads1, by its effects on pufa metabolism, may influence the composition and properties of phospholipids of hdl particles (forming 20% of a particle), which could further affect the biogenesis, maturation, and catabolism of hdl. in support for this notion, fads1 (rs174548) has also been shown to affect serum levels of phosphatidylcholine (42), which is the major phospholipid in hdl particles and is important in the metabolism of hdl particles (43). furthermore, dietary pufas have been shown to influence lipoprotein levels, mainly hdl and ldl cholesterol (44), and variants affecting biosynthesis of pufas could have similar effects. the t allele of rs174550 has been previously associated with increased fasting glucose levels in a gwas by the meta - analyses of glucose and insulin - related traits consortium (magic) (9). however, similar to our observation for the gckr locus, the glucose - increasing allele was associated with high hdl and nominally with low vldl concentrations. this may suggest that the effects of fads1 variants on lipoproteins and glucose levels are mediated by different mechanisms. pufas have an ability to potentiate insulin secretion (45), which could be one of the mechanisms by which fads1 variants modulate insulin secretion (35) and fasting glucose levels (9). rs7501939 and notch2 10923931 showed mostly nominally significant associations with several lipoprotein traits, some of them being statistically significant using the less conservative fdr correction for multiple testing. the type 2 diabetes risk allele of the intronic snp rs7501939 in hnf1b was associated with high particle concentrations of all vldl subclasses (significantly with s - vldl) and s - ldl particles and low concentrations of vl- and l - hdl particles. although there are no studies on the effect of common snps of hnf1b on lipid levels, patients with maturity - onset diabetes of the young type 5 caused by mutations at the hnf1b locus exhibit dyslipidemia characterized by hypertriglyceridemia and low hdl cholesterol levels (46). the type 2 diabetes risk allele of the intronic snp rs10923931 in notch2 was nominally associated with low particle concentrations of all vldl, idl, and ldl subclasses, high concentrations of vl - hdl particles, and significantly with low concentration of s - hdl particles. the same allele was nominally associated with higher insulin sensitivity (matsuda isi), and an additional adjustment for matsuda isi attenuated the associations between rs10923931 and lipoproteins, indicating that these effects could be at least partly related. associations of notch2 variants with lipid levels or insulin sensitivity have not been previously reported. jazf1, cdc123, prox1, kcnj11, fto, and dgkb loci were nominally associated with several lipoprotein traits in our study. only the fto locus of these loci has been previously found to affect lipid levels (47). grs calculated using all 34 snps, or type 2 diabetes snps and hyperglycemia snps separately, was not significantly associated with any of the lipoprotein subclasses. this suggests that there is no major overlap between the genetic basis of type 2 diabetes / hyperglycemia and lipoprotein metabolism. furthermore, although insulin resistance is a major pathophysiologic link between hyperglycemia and dyslipidemia, our results do not give evidence for a role of the examined snps in this association. pparg, as the main candidate gene for insulin resistance, was not significantly associated with any of the lipoprotein traits. in contrast, the c allele of rs780094 of gckr was associated with decreased insulin sensitivity and low concentrations of vldl particles, suggesting that the effects of the c allele on glucose and lipid metabolism could be independently regulated. associations of notch2 with lipoproteins could be related to its possible effect on insulin sensitivity. a limitation of our study is that only finnish men were included, and therefore, we do not know whether our results are applicable to women and to different ethnic or racial groups. we had only a modest statistical power to demonstrate statistically significant associations with cm, largest to medium vldl, and hdl particles. in conclusion, our large population - based study shows that from the 34 loci associated with hyperglycemia or type 2 diabetes only gckr, fads1, hnf1b, and notch2 were significantly associated with several lipoprotein traits. the effects of gckr were predominantly on concentrations of vldl particles, and fads1 seems to mainly affect concentrations of vl- and l - hdl particles. our findings indicate that only a limited number of risk loci for hyperglycemia or type 2 diabetes affect significantly lipoprotein metabolism. the most statistically significant finding was the association of the hyperglycemia / type 2 diabetes risk c allele of the intronic snp rs780094 of gckr with low concentrations of all subclasses of vldl particles (effect sizes 102% per allele for cm / lar - vldl and vl- to s - vldl) as well as with the diameter of vldl particles. only one previous study has examined the effects of gckr on lipoprotein fractions, reporting an association (p < 5 10) of rs1260326 at the gckr locus (in linkage disequilibrium with rs780094, r = 0.89 according to hapmap ceu) with large and medium - size vldl particles and mean particle size (22), which is in agreement with our findings. furthermore, the c allele of rs780094 was significantly associated in our study with a low concentration of s - ldl particles and s - hdl particles, besides nominal associations with idl and other subclasses of ldl and hdl particles. the aforementioned study reported similar associations of rs780094 with s - ldl particles and s - hdl particles (22). in addition, we observed a tendency to a stronger association of the c allele with the tg components of most of the lipoprotein subclasses than with other components. previous studies and gwas, applying only standard measurements of lipoprotein levels, have consistently shown that the c allele of rs780094 was associated with low tg levels (2325). in the first gwas performed by the diabetes genetics initiative consortium, similarly, the missense variant rs1260326 (leu446pro), which could be responsible for the associations of rs780094 (26), has been associated with tg levels in several studies (2630). our study suggests that the association between gckr and tg is attributable to changes in vldl particle concentration, especially in the largest tg - rich subclasses. additional adjustment for serum tg levels abolished all associations of the snp with particles and their components, suggesting that the observed effects of rs780094 on idl, ldl, and hdl particles could be secondary to its effects on tg / vldl metabolism rather than independent effects. a previous study proposed that large tg - rich vldl particles, secreted by the liver preferentially in hypertriglyceridemic conditions, are metabolized into small ldl particles (31), which could explain the stronger association of rs780094 with s - ldl particles in our study. the inverse relationship between tg and hdl levels is well documented (32) and is at least partly explained by increased catabolism of tg - enriched hdl particles (33). the main biologic function of the glucokinase regulatory protein is to inhibit the effects of glucokinase on glycogen synthesis and glycolysis in the liver (34). snps at the gckr locus have been associated with fasting glycemia (9,29), risk of type 2 diabetes (25,29), insulin resistance (25,29,35), and increased hepatic glucose production (26). our study also confirmed the association of the c allele of rs780094 with decreased insulin sensitivity (matsuda isi). however, it did not seem to account for the changes in lipoprotein particle concentrations, because additional adjustment for matsuda isi did not attenuate the associations between rs780094 and lipoproteins. moreover, the effects of rs780094 on insulin resistance and tg levels were in opposite directions. a recent article reporting that leu446pro indirectly increases gk activity proposed that the increased glycolytic flux leads to the elevation of malonyl - coa, a substrate for de novo lipogenesis, which could explain the opposite effects of the snp on glucose and tg levels (36). the glucose - increasing (major) t allele of the intronic snp rs174550 in the fads1 gene was significantly associated with high concentrations of vl- and l - hdl particles and all of their components, as well as with hdl particle diameter. nominally significant associations were found with all vldl subclasses and idl particles. a previous study (22) found an association of two other snps at the fads1 - 2 - 3 gene cluster with medium hdl (rs174537) and large hdl particles (rs102275), and one snp with large ldl particles (rs1535). moreover, four recent gwas (28,30,37,38) reported associations of the fads1 - 2 - 3 snps with hdl cholesterol, total cholesterol, ldl cholesterol, and tg. our findings suggest that rs174550 may primarily affect vl- and l - hdl particles because the associations persisted after additional adjustment for serum tg levels. fads1 encodes the fatty acid desaturase -5 (d5d), which plays a crucial role in desaturation and elongation of polyunsaturated fatty acids (pufa). several snps at the fads1 locus have been previously associated with pufa concentrations in serum and tissue phospholipids (39,40). association of the fads1 locus (rs174537) with serum pufa levels was been confirmed by a gwas in the invecchiare in chianti (inchianti) study (41). the pl component of vl - hdl particles was one of the most strongly influenced traits by rs174550 in our study. fads1, by its effects on pufa metabolism, may influence the composition and properties of phospholipids of hdl particles (forming 20% of a particle), which could further affect the biogenesis, maturation, and catabolism of hdl. in support for this notion, fads1 (rs174548) has also been shown to affect serum levels of phosphatidylcholine (42), which is the major phospholipid in hdl particles and is important in the metabolism of hdl particles (43). furthermore, dietary pufas have been shown to influence lipoprotein levels, mainly hdl and ldl cholesterol (44), and variants affecting biosynthesis of pufas could have similar effects. the t allele of rs174550 has been previously associated with increased fasting glucose levels in a gwas by the meta - analyses of glucose and insulin - related traits consortium (magic) (9). however, similar to our observation for the gckr locus, the glucose - increasing allele was associated with high hdl and nominally with low vldl concentrations. this may suggest that the effects of fads1 variants on lipoproteins and glucose levels are mediated by different mechanisms. pufas have an ability to potentiate insulin secretion (45), which could be one of the mechanisms by which fads1 variants modulate insulin secretion (35) and fasting glucose levels (9). hnf1b rs7501939 and notch2 10923931 showed mostly nominally significant associations with several lipoprotein traits, some of them being statistically significant using the less conservative fdr correction for multiple testing. the type 2 diabetes risk allele of the intronic snp rs7501939 in hnf1b was associated with high particle concentrations of all vldl subclasses (significantly with s - vldl) and s - ldl particles and low concentrations of vl- and l - hdl particles. although there are no studies on the effect of common snps of hnf1b on lipid levels, patients with maturity - onset diabetes of the young type 5 caused by mutations at the hnf1b locus exhibit dyslipidemia characterized by hypertriglyceridemia and low hdl cholesterol levels (46). the type 2 diabetes risk allele of the intronic snp rs10923931 in notch2 was nominally associated with low particle concentrations of all vldl, idl, and ldl subclasses, high concentrations of vl - hdl particles, and significantly with low concentration of s - hdl particles. the same allele was nominally associated with higher insulin sensitivity (matsuda isi), and an additional adjustment for matsuda isi attenuated the associations between rs10923931 and lipoproteins, indicating that these effects could be at least partly related. associations of notch2 variants with lipid levels or insulin sensitivity have not been previously reported. jazf1, cdc123, prox1, kcnj11, fto, and dgkb loci were nominally associated with several lipoprotein traits in our study. only the fto locus of these loci has been previously found to affect lipid levels (47). grs calculated using all 34 snps, or type 2 diabetes snps and hyperglycemia snps separately, was not significantly associated with any of the lipoprotein subclasses. this suggests that there is no major overlap between the genetic basis of type 2 diabetes / hyperglycemia and lipoprotein metabolism. furthermore, although insulin resistance is a major pathophysiologic link between hyperglycemia and dyslipidemia, our results do not give evidence for a role of the examined snps in this association. pparg, as the main candidate gene for insulin resistance, was not significantly associated with any of the lipoprotein traits. in contrast, the c allele of rs780094 of gckr was associated with decreased insulin sensitivity and low concentrations of vldl particles, suggesting that the effects of the c allele on glucose and lipid metabolism could be independently regulated. associations of notch2 with lipoproteins could be related to its possible effect on insulin sensitivity. a limitation of our study is that only finnish men were included, and therefore, we do not know whether our results are applicable to women and to different ethnic or racial groups. we had only a modest statistical power to demonstrate statistically significant associations with cm, largest to medium vldl, and hdl particles. in conclusion, our large population - based study shows that from the 34 loci associated with hyperglycemia or type 2 diabetes only gckr, fads1, hnf1b, and notch2 were significantly associated with several lipoprotein traits. the effects of gckr were predominantly on concentrations of vldl particles, and fads1 seems to mainly affect concentrations of vl- and l - hdl particles. our findings indicate that only a limited number of risk loci for hyperglycemia or type 2 diabetes affect significantly lipoprotein metabolism.
|
objectivewe investigated the effects of 34 genetic risk variants for hyperglycemia / type 2 diabetes on lipoprotein subclasses and particle composition in a large population - based cohort.research design and methodsthe study included 6,580 nondiabetic finnish men from the population - based metabolic syndrome in men (metsim) study (aged 57 7 years ; bmi 26.8 3.7 kg / m2). genotyping of 34 single nucleotide polymorphism (snps) for hyperglycemia / type 2 diabetes was performed. proton nuclear magnetic resonance spectroscopy was used to measure particle concentrations of 14 lipoprotein subclasses and their composition in native serum samples.resultsthe glucose - increasing allele of rs780094 in gckr was significantly associated with low concentrations of vldl particles (independently of their size) and small ldl and was nominally associated with low concentrations of intermediate - density lipoprotein, all ldl subclasses, and high concentrations of very large and large hdl particles. the glucose - increasing allele of rs174550 in fads1 was significantly associated with high concentrations of very large and large hdl particles and nominally associated with low concentrations of all vldl particles. snps rs10923931 in notch2 and rs757210 in hnf1b genes showed nominal or significant associations with several lipoprotein traits. the genetic risk score of 34 snps was not associated with any of the lipoprotein subclasses.conclusionsfour of the 34 risk loci for type 2 diabetes or hyperglycemia (gckr, fads1, notch2, and hnf1b) were significantly associated with lipoprotein traits. a gckr variant predominantly affected the concentration of vldl, and the fads1 variant affected very large and large hdl particles. only a limited number of risk loci for hyperglycemia / type 2 diabetes significantly affect lipoprotein metabolism.
|
human immunodeficiency virus type 1 (hiv-1) is the causative agent of the worldwide acquired immunodeficiency syndrome (aids) epidemic. approximately 34 million people were estimated to be living with hiv at the end of 2010. the number of people infected is a consequence of continued large numbers of new hiv-1 infections together with a reduction in aids - related deaths due to a significant expansion in access to antiretroviral drug therapy. in the absence of an effective vaccine or cure, therapeutic regimes commonly termed haart (highly active antiretroviral therapy) suppress viral replication but do not eradicate the virus ; therefore, treatment must be administered on a lifelong basis [2, 3 ]. haart consists of the simultaneous use of a combination of three or four different antiretroviral drugs. this combinational approach is required due to the ease with which hiv-1 can acquire drug resistance to a single drug administered as monotherapy [3, 4 ]. drug resistance arises due to the high degree of hiv-1 genetic diversity within the virus population (quasi - species) infecting an individual patient. this genetic diversity is created as a consequence of a rapid rate of viral replication combined with the error prone nature of the viral reverse transcriptase (rt), which copies the viral rna genome into a double - stranded dna copy and the frequent recombination events that occur during genome replication [3, 5, 6 ]. haart is possible due to the successful development and clinical use of more than 20 antiretroviral drugs, which belong to six different mechanistic classes. these drugs primarily target the viral enzymes : rt inhibitors (which fall into two classes based on their mode of action : the nucleoside - analog rt inhibitors (nrtis) and nonnucleoside - analog rt inhibitors (nnrtis)), protease (pr) inhibitors (pis), and an integrase (in) inhibitor [710 ]. most clinical treatment regimens use a combination of either a pi or nnrti with two nrtis, though since its approval for clinical use in 2007 the first in inhibitor (insentress) has increasingly been used in therapy regimens. the remaining two mechanistic drug classes each contain one approved drug and target the viral entry process by either blocking viral fusion by targeting the viral gp41 envelope protein or acting as an antagonist against the host cell coreceptor ccr5. salvage therapy is required upon treatment failure primarily due to the emergence of drug resistance and to be effective should ideally include at least one new drug targeting a novel site of action. until a cure for hiv infection is achieved, the continued threat of drug resistance makes the identification and development of a continuous pipeline of new drugs with a novel mechanism of action an ongoing requirement. in this paper we discuss protease - mediated maturation of hiv-1 particles and the strategies to target this step in hiv-1 replication for therapeutic intervention. proteolytic maturation is essential for the production of infectious hiv-1 virus particles and has been extensively reviewed [1618 ]. particle assembly is driven by the gag (pr55) polyprotein, which is transported to the cellular plasma membrane where it undergoes higher - order gag - gag multimerization. a second polyprotein gag - pol (pr160) gag - pol is expressed via a 1 ribosomal frameshift during approximately 510% of gag translation events. gag - gag multimerization forces membrane curvature and assembly is completed upon budding of the particle from the plasma membrane. the exact mechanism of pr activation is not clearly understood, but it is known to require gag - pol dimerization. once pr is liberated from the polyprotein through autocatalysis, cleavage of the pol domain results in the enzymatic proteins pr, rt, and in. cleavage of gag results in four protein domains : matrix (ma or p17), capsid (ca or p24), nucleocapsid (nc or p7), p6, and two spacer peptides sp1 (p2) and sp2 (p1) (figure 1(a)). gag cleavage follows a sequential cascade that is kinetically controlled by the differential rate of processing at each of the five cleavage sites in gag. the first cleavage creates an n - terminal fragment that contains the ma - ca - sp1 domains and a c - terminal fragment that contains the nc - sp2-p6 domains. subsequent cleavage events occur at the ma - ca and sp1-p6 sites and finally the ca - sp1 and nc - sp2 sites are cleaved. the physical consequence of gag cleavage is a morphological rearrangement of the non - infectious immature particle to a mature infectious particle containing a conical core, which is generated by a second assembly event upon release of the ca domain (figure 1(b)). the conical ca core contains the rt and in enzymes along with the dimeric viral rna genome in complex with nc and is essential for virus replication upon infection of a new cell. therefore, correct core formation is essential for the production of infectious particles and this has been shown to be dependent on accurate proteolytic processing of gag as mutations that disrupt the cleavage of individual sites or alter the order in which sites are cleaved result in aberrant particles that have significantly reduced infectivity. the fundamental role of proteolytic maturation in the generation of infectious particles makes inhibiting this process an attractive target for therapeutic intervention. in this paper we discuss how this has been approached by (i) the successful development and clinical use of pis which target the pr enzyme itself and (ii) research to develop a novel class of antiretroviral drug termed maturation inhibitors which target the gag cleavage sites that act as the substrate for pr. protease inhibitors (pis) target and inhibit the enzymatic activity of the hiv-1 pr. pis inhibit pr activity to the extent that is sufficient to prevent cleavage events in gag and gag - pol that result in the production of non - infectious virus particles. the development of pis in the mid 1990s was a critical step forward in the successful treatment of hiv-1 patients. this is because their development provided a second mechanistic class of antiretroviral drug, which made haart combination therapy possible. pis have remained a key component of hiv-1 patient treatment regimens right up to the current day. to date, nine pis have been approved for clinical use, they are saquinavir, ritonavir, indinavir, nelfinavir, fosamprenavir, lopinavir, atazanavir, tipranavir, and darunavir (table 1). design of pis has been primarily driven by structural knowledge of pr (figure 2), its substrate, and the chemical reaction of peptide bond cleavage. like other retroviruses, hiv-1 pr, is related to the cellular aspartyl pr family, which include pepsin and renin. this family of proteases are typified by an active site that uses two apposed catalytic aspartic acid (asp) residues, each within a conserved asp - thr - gly motif. to function, the cellular prs form a pseudodimer utilizing two asp residues from within the same molecule to create an active site. in contrast, retroviral prs only contain one asp - thr - gly motif and must therefore form a true dimer. indeed x - ray crystallography has shown that the hiv-1 pr exists as a dimer consisting of two identical monomers [1921 ]. the crystal structure of the dimer reveals that four - stranded sheets derived from both ends of each monomer hold the dimer together. a long substrate - binding cleft is created between the monomers and the active site is situated near its centre with the two asp residues located at its base. two -hairpin flaps originating from each monomer cover the active site and are thought to function by stabilizing the substrate within the binding cleft. the substrate - binding cleft interacts with multiple different substrate cleavage site sequences in gag and gag - pol. the sequence of these sites are at least seven amino acids long and termed p4-p3, with p1 and p1 directly flanking the cleavage site. there is no clear consensus amino acid recognition sequence ; however, general patterns have been recognised and most substrate sites have a branched amino acid at the p2 site, a hydrophobic residue at p1, and an aromatic or proline at p1. instead of amino acid sequence, the topology of the cleavage site is primarily important for their recognition and interaction with pr. each of the substrate recognition sites has a super - imposable structure, known as the substrate envelope, which fits within the pr substrate - binding cleft. the divergent amino acid sequences of substrate recognition sites do however result in subtle structural differences, which are caused by different side chain protrusions from the substrate envelope. each subsite is named for the corresponding substrate side chain, for example, the s1 subsite corresponds to the p1 side chain. these differences are thought to alter the rate at which cleavage occurs at individual sites in gag facilitating the regulated proteolytic processing cascade of gag that is essential for correct particle formation. the catalytic mechanism of substrate cleavage requires the asp residues to coordinate a water molecule that is used to hydrolyze the target peptide (scissile) bond. during the reaction, a transition state intermediate is formed which has been mimicked in the design of most pis, which are peptidomimetic transition - state analogues. the principle of this design strategy is that the normal peptide linkage [nh co ] is replaced by a hydroxyethylene group [ch2ch(oh) ], which can not be cleaved by simple hydrolysis. saquinavir was the first pi to be approved for clinical use and its design is based on this principle. the following pis ritonavir, indinavir, nelfinavir, amprenavir, lopinaivr, atazanavir, fosamprenavir, and darunavir also all contain a central core motif of a hydroxyethylene scaffold. the exception is tipranavir, which has a coumarin scaffold and is therefore the only clinically approved pi, which is not a peptidomimetic. knowledge of the catalytic mechanism and a strategy to generate a transition state analogue was coupled with the ability to cocrystallize candidate inhibitors in complex with pr. this facilitated structure - based drug design that enabled consecutive rounds of lead optimization to develop inhibitors, which competitively bind the active site with affinities to purified pr in the low nanomolar to low picomolar range. the rational design strategy was also used to develop inhibitors that aim to combat problems encountered in the clinic, including poor bioavailability, aberrant side effects, and drug resistance. clinical use of pis began in 1995 with the fda approval of saquinavir. saquinavir 's approval was closely followed by ritonavir and indinavir in 1996 and nelfinavir in 1997. in vitro studies demonstrated that all of these first generation pis inhibit hiv-1 replication in the nanomolar range in a selection of cell types relevant to hiv-1 infection [2427 ]. initial clinical trials with these drugs were conducted as monotherapy and encouragingly demonstrated declines in hiv-1 rna levels although the antiviral effect was not sustained for long periods of time due to the rapid acquisition of drug resistance [2833 ]. improved and more sustained reductions in viral rna levels along with increased cd4 cell counts were obtained when a pi was included in triple therapy combinations with two nrtis [3440 ]. importantly, these triple - drug regimens (haart) significantly reduced disease progression and mortality in hiv / aids patients [8, 38 ]. therefore, the development of pis facilitated a pivotal step forward in the clinical management of hiv / aids and dramatically improved the clinical outcome of the disease. despite the successes, antiviral suppression was not always durable and these early clinical trials highlighted a number of key problems associated with pis. as indicated above, drug resistance was problematic from the outset and the complex mechanisms of resistance will be discussed in more detail below. acquisition of drug resistance was compounded by problems with adverse side effects (abnormal lipid and glucose metabolism) and low bioavailability (typical of peptide - like molecules), which led to suboptimal drug concentrations, high pill burdens, and difficulties with patient adherence to treatment regimens. a notable observation to help overcome the pharmacological problems was that ritonavir acts as a potent inhibitor of the cytochrome p450 3a4 metabolic pathway. as a consequence it has been demonstrated that coadministering a low non - therapeutic dose of ritonavir with other pis leads to dramatically improved bioavailability, half - life, and potency of these pis. ritonavir boosting has become a standard procedure when using most pis in the clinic. the first was amprenavir, which was approved for clinical use in 1999, next came lopinavir which was approved in 2000, followed by atazanavir in 2003, tipranavir in 2005, and lastly darunavir in 2006. in 2003 amprenavir was subsequently reformulated as the prodrug fosamprenavir, which improved drug plasma concentrations and afforded a lower pill burden. reduction in pill burden was also achieved by the coformulation of lopinavir with a low dose of ritonavir and further progress in the simplification of drug regimens came with atazanavir, which was the first pi with a once daily dosing regimen. drug potency has also been improved, in vitro studies have shown atazanavir and darunavir to be particularly potent with ic50 values of between 1 and 5 nm however, tipranavir is the least potent because of its novel nonpeptidomimetic chemical structure [4347 ]. clinical trials demonstrated that the next generation pis performed well with superior virological efficacy when tested against a placebo or another comparator pi in a background of two nrtis [8, 4852 ]. finally many of these pis acquire different drug resistance mutation profiles from the earlier pis and/or have a higher genetic barrier to resistance. resistance has been encountered for all nine pis and has been extensively reviewed [8, 5355 ]. a current summary of the key mutations acquired by each of them is provided in a data review of hiv-1 drug resistance by the international aids society - usa. the genetic barrier for acquisition of pi resistance is relatively high, that is, it requires two or more amino acid changes to confer significant resistance. this is because pi drug resistance is a stepwise pathway that results in complex interdependent combinations of multiple mutations. all of these interdependent changes are required to act in synergy to confer drug resistance whilst simultaneously maintaining the fitness of the virus. the mutations that arise first are referred to as primary or major mutations and they are usually located in the pr substrate - binding cleft or its immediate vicinity. examples of primary mutations include d30n, g48v, i50l / v, v82a / f / l / s / t, i84v, and l90 m. these primary mutations are principally responsible for acquisition of drug resistance by causing conformational changes in and around the active site that prevent inhibitor binding. more specifically, pis bound to the substrate - binding cleft occupy a similar space as the substrate envelope, but atoms of the pi protrude from this space and interact with residues in pr. therefore, it has been proposed that drug resistance mutations arise at pr residues involved in these points of contact to inhibit pi binding. in addition to the direct mechanism of resistance described above resistance - conferring mutations may also result in conformational changes to pr beyond the active site and nonactive site mutations can also contribute to drug resistance. recently rare amino acid insertions, particularly between residues 32 and 42 have been observed to occur more frequently and in correlation with the introduction of atazanavir, lopinavir, amprenavir, and tipranavir into the clinic. the insertions have been proposed to be associated with pi resistance by imposing minor structural changes to the pr flap and substrate - binding cleft, although they always appear in combination with other well - described pi resistance mutations. primary mutations are accompanied by secondary or minor mutations, which can be preexisting polymorphisms or acquired after primary mutations. the function of many of these secondary mutations is often not to confer drug resistance per se but instead to compensate for the effect of primary mutations, which reduce protease catalytic efficiency and virus replication capacity or fitness [5862 ]. despite their function being less drug specific in action, they are however critical for development of high - level resistance. the secondary mutations are generally located at residues distal from the active site and occur at more than 20 residues of pr. unlike the primary mutations, which generally occur at highly conserved residues, the secondary mutations, are often polymorphic in pi treatment - nave patient isolates, a well - documented example is the l63p substitution, and thus favour the selection of primary mutations in the presence of drug. despite the presence of multiple secondary mutations almost all clinical strains of hiv-1 with high - level pi drug resistance display some degree of fitness loss [58, 61, 63, 64 ]. the mutations in pr described above primarily have an impact on inhibitor binding while still allowing the enzyme to recognise and cleave its gag and gag - pol substrates to some degree. in addition to the changes in pr itself, amino acid changes in the gag substrate have also been described. these mutations are primarily located at or near to gag cleavage sites and more specifically the sites in the nc - sp2-p6 region of gag. key mutations observed at the nc - sp2 cleavage site are a431v and i437v, which are commonly found in association with the pr primary mutation v82a and key mutations observed at the sp2-p6 cleavage site are l449f and p453l, which are commonly found in association with the pr primary mutations i50v and i84v [6572 ]. in vitro selection experiments have also shown that mutations at the nc - sp2 cleavage site (a431v, k436e, and/or i437v / t) can also be selected in the presence of pis without any accompanying resistance mutations in pr. mutations in gag located at positions distal to cleavage sites have also been documented [7476 ]. the impact of mutations in gag has been attributed to (i) acting as compensatory mutations that improve fitness defects imposed by pi resistance - conferring mutations in pr and (ii) directly contributing to pi resistance [6567, 73, 77 ]. the mechanism by which gag cleavage - site mutations compensate for a loss in viral fitness is by improving the interaction between the substrate and the mutant enzyme and hence increasing the ability of the mutant pr to cleave. noncleavage site mutations are thought to improve fitness by causing more broad conformational changes in gag making cleavage sites more accessible to pr [7476 ]. the mechanism by which gag cleavage - site mutations directly contribute to pi resistance is however not clearly understood. despite the complex interdependent combinations of multiple mutations in both pr and its gag substrate that are required to attain high - level pi drug resistance, many of the pis have a distinctive primary mutation that can be considered a signatory of drug resistance to that particular pi. for example the d30n mutation is a signatory of nelfinavir resistance, i50l is a signatory of atazanavir resistance, the i50v mutation is a signatory of amprenavir and darunavir resistance, and the g48v mutation is a signatory of saquinavir resistance. unfortunately, however, many mutations confer drug resistance to multiple pis leading to broad cross - resistance amongst most pis. for example, the i84v mutation is the most important as it affects all eight pis in clinical use and acts as a key mutation for five of them (atazanavir, darunavir, fosamprenavir, indinavir, and tipranavir). the i54v substitution acts as a key mutation for darunavir but it also affects all the other pis with the exception of nelfinavir and the l90 m mutation affects pis with the exception of darunavir and tipranavir. cross - resistance is likely due to the fact that although chemically different, most of the pis were designed using the same basic principle and have similar structures and interactions with the pr substrate - binding cleft. extensive cross - resistance has serious clinical consequences that threatens the usefulness of pis and drives an ongoing need for new pis with improved resistance profiles. the introduction of pis into the clinic more than 15 years ago heralded the era of haart and resulted in a significant reduction in morbidity and mortality among hiv - infected patients. due to their clinical potency, pis are still commonly used in treatment regimens, although only three (lopinavir, atazanavir and darunavir) of the nine approved pis are in widespread use. despite the clinical benefits, the usefulness of first generation pis was particularly hampered by toxic side effects and low bioavailability, which resulted in high pill burdens and low patient adherence. a significant advance in resolving these issues was the introduction of low - dose ritonavir boosting, which increases plasma pi levels by inhibiting the cytochrome p450 metabolic pathway. ritonavir - boosting is itself ; however, associated with toxicity ; therefore, alternative boosting compounds with improved properties are being developed. pi drug resistance is a major cause of therapy failure despite the relatively high genetic barrier to resistance. unfortunately, pr has proven to be a highly flexible and adaptable drug target due to diverse mutational profiles and the complex interplay between pr and its gag substrate. extensive cross - resistance to pis has also been a key problem that has limited the overall usefulness of the drug class despite the development of new inhibitors such as darunavir with favourable resistance profiles. therefore, there is a need to develop further novel inhibitors with improved resistance profiles to address these ongoing issues. one strategy to develop such new pis is to build on the design of existing inhibitors that target the pr active site by introducing novel modifications to established pi chemical entities. one such example is the novel inhibitor gs-8374, which is a modification of a darunavir - like analogue. gs-8374 has been shown to be highly potent with a resistance profile superior to all clinically approved pis including the parent molecule darunavir. a second strategy is to identify molecules with novel chemical scaffolds, for example ppl-100 is a nonpeptidomimetic inhibitor that incorporates a new lysine - based scaffold and binds the flap region of pr via a novel mechanism. ppl-100 has been shown to have a favourable resistance profile against known pi resistant hiv-1 isolates and its in vitro selection pattern results in two previously undocumented mutations t80i and p81s together with two previously reported compensatory mutations k45r and m46i [81, 82 ]. allosteric inhibitors that bind a site other than the pr active site via a noncompetitive mechanism of action have also been identified and shown to be effective against both wildtype and pi resistant purified pr. a further novel strategy, discussed below, is to design inhibitors that prevent proteolytic maturation by targeting the gag substrate rather than the pr enzyme itself. pis directly target the pr enzyme ; however, an alternative approach to inhibiting hiv-1 proteolytic maturation is to identify small molecules that bind its gag substrate and specifically block individual cleavage events. such a strategy would be successful because accurate proteolytic processing of gag is essential for the production of infectious particles as mutations that disrupt the cleavage of individual sites or alter the order in which sites are cleaved result in aberrant particles that have significantly reduced infectivity. molecules with this mechanism of action have been termed maturation inhibitors and the first - in - class is 3-o-(3,3-dimethylsuccinyl)betulinic acid (dsb), also known as pa-457, mpc-4326, or bevirimat (bvm). bvm specifically inhibits ca - sp1 cleavage, which occurs late in the gag proteolytic cleavage cascade [84, 85 ]. this has been demonstrated by a number of key observations : (i) biochemical studies have demonstrated an accumulation of the uncleaved ca - sp1 intermediate in both cell and virus - associated protein fractions from hiv-1 expressing cells treated with bvm [8486 ] (figure 1(c)) ; (ii) viruses such as hiv-2 and siv which have a divergent sequence at the ca - sp1 junction are not sensitive to bvm ; (iii) the majority of bvm drug - resistance conferring mutations map to the ca - sp1 junction or within sp1 [8486, 8895 ]. interestingly, although pf-46396 has a similar mechanism of action as bvm, it belongs to a distinct chemical class as it is a pyridone - based compound not a betulinic acid derivative like bvm. the consequence of bvm blocking sp1 cleavage from the c - terminus of ca is the formation of noninfectious particles with an aberrant morphology (figure 1(b)). three - dimensional (3d) imaging of bvm - treated particles by cryoelectron tomography showed that they contain an incomplete protein shell, which has a hexagonal honeycomb lattice in the ca layer that is similar in structure to the gag lattice of immature virus particles. this partial shell is consistent with the aberrant electron dense crescent inside the viral membrane observed in bvm - treated particles by conventional thin - sectioning electron microscopy. both imaging techniques also showed most bvm - treated particles to contain an acentric mass, which represents an abnormal core - like structure [13, 84 ]. the general morphological features of bvm - treated particles are shared by particles generated by the ca5 mutant, which has two amino acid substitutions that completely block ca - sp1 cleavage [84, 97 ]. however, these particles have a thinner ca layer with no visible evidence of honeycomb lattice organization. the presence of structural organization in the bvm - treated but not the ca5 ca layer suggests that bvm binding stabilizes the immature lattice as well as blocking ca - sp1 cleavage and that both modes of action may potentially contribute to the generation of non - infectious particles. the assembly state of gag is a determinant of bvms activity. bvm does not inhibit ca - sp1 processing in the context of monomeric gag in solution, but instead requires gag assembly for its activity [84, 98, 99 ]. therefore, it can be hypothesized that bvm binds to a pocket formed during gag - gag multimerization. conversely, gag processing disrupts the putative binding site because bvm has been shown to bind immature but not mature hiv-1 particles. the bvm binding site has been mapped to the ca - sp1 junction within immature virus particles using photoaffinity bvm analogues and mass spectroscopy. this provides the first direct evidence that the bvm binding site spans the ca - sp1 junction and is consistent with previous biochemical and genetic data that have implicated this region of gag in bvm binding. indeed, bvm binding is disrupted in a selection of bvm - drug resistant mutations with amino acid substitutions that map to the ca - sp1 junction [100, 101 ]. positioning of bvm across the ca - sp1 junction supports a mechanism of action whereby binding blocks access of the viral pr to the ca - sp1 cleavage site. a second related hypothesis is that bvm binding alters the conformation, exposure, or flexibility of this region such that pr cleaves it less efficiently. the binding study also identified a second bvm binding site in the major homology region (mhr) of ca, a region of gag known to function in virus assembly. the significance of a potential second bvm binding site has yet to be established but may provide an explanation for the observation that at high concentrations bvm inhibits virus particle assembly. the structure of the bvm binding site remains unknown because this region of gag has been disordered in x - ray crystallographic studies [103, 104 ]. the disorder has been attributed to a structural flexibility, which permits higher - order gag - gag multimerization during virus particle assembly [105110 ]. it is, however, generally accepted that the ca - sp1 region of gag adopts a -helical conformation. the evidence for a helical structure is based on (i) secondary structure computer modelling predictions, (ii) genetic data demonstrating that mutation of key residues predicted to be helix breakers results in a disruption of virus particle assembly [106, 111 ] and (iii) biophysical and nmr techniques that have shown the ca - sp1 region to have a propensity to adopt a helical conformation under certain environmental conditions [110, 112, 113 ]. although the interactions formed by the proposed ca - sp1 junction helices in the gag lattice are not known, a cryoelectron tomography study of immature particles led to the hypothesis that the ca - sp1 region exists as a six - helix bundle that lies directly below the hexagonal honeycomb ca lattice. because bvm activity is known to require higher - order gag - gag multimerization, it has been suggested that the bvm binding pocket might involve more than one helix and hence bound bvm may occupy a cleft formed between helices. the considerable technical challenges of obtaining high - resolution structural information of the ca - sp1 junction in the context of higher - order multimerized gag make the prospect of rational drug design using inhibitor cocomplexes not currently possible. however, further understanding of the interactions involved is important for the development of second - generation maturation inhibitors. such new molecules are now required as clinical development of bvm was suspended in 2010 due to problems with intrinsic bvm drug resistance in hiv-1 infected patients during phase ii clinical trials. bvm was considered an attractive candidate for clinical development because of its potent in vitro activity with a mean ic50 value of 10 nm and its novel mechanism of action, which makes it equally effective against viruses that have acquired resistance to key antiretroviral drugs in clinical use. additional attributes including promising pharmacological and safety studies in animal models and phase i clinical trials led to the testing of bvm in hiv-1 infected patients. initial success in these phase ii clinical trials demonstrated significant bvm dose - dependent viral load reductions. however, further studies quickly showed that approximately 50% of bvm - treated patients did not effectively respond to the drug and exhibited viral load reductions of less than 0.5 log. failure to respond was not due to suboptimal bvm plasma concentrations but has been attributed to virological parameters instead. examination of patient - derived virus revealed amino acid assignment at sp1 residues 6, 7, and 8 (gag positions 369, 370, and 371) is associated with response to bvm [92, 93, 95 ] (figure 1(d)). this trio of residues map to the c - terminal half of sp1, which is relatively nonconserved but commonly encodes a qvt (glutamine - valine - threonine) motif in clade b hiv-1 isolates. patients most likely to respond to bvm are infected with virus encoding the qvt motif, while patients infected with virus encoding polymorphisms at sp1 residues 68 are less likely to respond. studies to investigate the contribution of individual substitutions at sp1 residues 68 have shown that mutations at sp1 residue 7 and 8 (e.g., sp1-v7a, -v7 m, -t8, -t8n) all confer varying degrees of reduced susceptibility to bvm [88, 92, 94, 95 ]. most notably, a critical role for bvm resistance has been attributed to the sp1-v7a polymorphism as it confers full resistance to bvm [88, 92, 94, 95 ]. bvm susceptibility was not however reduced by mutations at sp1 residue 6 (e.g., sp1-q6h, q6a) or the sp1-t8a polymorphism [88, 92, 94, 95 ]. therefore, any contribution of these substitutions to reduced bvm susceptibility maybe dependent on the synergistic effects of a combinations of different polymorphisms, i.e. the context of the wider gag background. indeed, one study identified five patient - derived virus samples with significantly reduced bvm susceptibility in vitro but still encoded the qvt motif. in two of these isolates, bvm resistance has been demonstrated to be conferred by a polymorphism in ca (ca - v230i) situated at the p2 position of the ca - sp1 cleavage site (figure 1(d)). in the other three isolates, the determinants of reduced bvm susceptibility were not resolved, indicating that in some instances the factors conferring bvm susceptibility are likely to be more complex than the parameters that have been established to date. the ca - v230i and sp1-v7a substitutions have also been acquired in in vitro bvm drug - resistance selection experiments [88, 90, 91 ]. in vitro studies have also identified a panel of other bvm - resistance mutations (ca - h226y, ca - l231 m, ca - l231f, sp1-a1v, sp1-a3v, and sp1-a3 t) [8486, 90 ] (figure 1(d)). unlike, the clinically important innate polymorphisms discussed above, these in vitro selected bvm - resistance mutations map to residues in the vicinity of the ca - sp1 cleavage site that are highly conserved throughout hiv-1 isolates. as a likely consequence, these mutations have not been observed in most patient - derived virus samples either with [93, 95 ] or without bvm treatment [92, 95 ]. however, it should be noted that the most frequently acquired mutation sp1-a1v has been shown not to impose a significant defect on virus replication in vitro [86, 89, 90 ] and replicates efficiently in scid - hu thy / liv mice. therefore, it remains a hypothetical possibility that the sp1-a1v mutation could be acquired over time in patients that initially respond well to bvm treatment. initial failure to select the key bvm - resistance conferring polymorphisms in vitro has been attributed to the experimental conditions utilized ; however, later experiments did result in selection of some of the key polymorphic mutations albeit at low frequency [88, 90 ]. nevertheless, a recent study used a more sophisticated in vitro method of serial passage of quasi - species containing recombinant hiv-1 and deep sequencing that more accurately mimicked in vitro the selection of bvm - resistance observed in vivo. in hindsight use of this in vitro selection method or more extensive testing of the spectrum of activity across a diverse panel of clinical isolates may have more accurately predicted the clinical response to bvm and either led to discontinuation of bvm development at an earlier stage thereby avoiding costly clinical studies or alternatively steered bvm 's clinical development to include a genotyping test to screen for preexisting key polymorphisms to enable prior identification of patients most likely to effectively respond to bvm treatment. this intrinsic resistance has caused problems for bvm 's clinical development, which was consequently discontinued in 2010. genotypic analysis has demonstrated a high prevalence of polymorphisms at the qvt motif and their frequency is dependent on the genetic clade of hiv-1 [94, 95, 117 ]. in clade b viruses, which are predominant in the us and europe, polymorphism frequency at the qvt motif has been reported to occur at a rate of ~3060% [91, 95, 117 ]. this genotypic analysis matches bvm susceptibility rates in the in vitro phenotypic and clinical trial studies discussed above [92, 93, 95 ]. in nonclade b viruses, qvt polymorphism rates are much higher with rates of > 90% [95, 117 ]. typically polymorphisms occur most frequently at sp1 residue 7, followed by residue 8, and then residue 6 [91, 94, 95 ]. the critical sp1-v7a polymorphism has been shown to be largely predominant and occurs at a frequency of ~16% in clade b viruses and ~6570% in clade c viruses, which are mostly found in southern africa [94, 95 ]. the high frequency of the sp1-v7a polymorphism combined with its known capacity to confer full resistance to bvm therefore poses the biggest threat to the potential effectiveness and clinical development of bvm. the prevalence of the key polymorphisms in relation to haart and the presence of pi resistance mutations has been investigated due to the complex interplay between pr and its gag substrate. being a new class of antiretroviral drug bvm was most likely in the first instance to be used as salvage therapy for patients harbouring multidrug resistant hiv-1 isolates. studies have shown no association between the prevalence of key qvt polymorphisms and haart treatment experience but in the absence of bvm [91, 92, 117 ]. one study also reported no association between prevalence of qvt polymorphisms and pi resistance - conferring mutations ; however, two other studies with bigger sample sizes demonstrated a higher frequency of bvm resistance mutations in pi resistant patient isolates [117, 118 ]. the effect of pi resistance on acquisition of bvm resistance in vitro has also been investigated [89, 90 ]. these two studies made different conclusions about the impact of the pi mutations on the temporal acquisition of bvm - resistance conferring mutations, with one study reporting a delay in the emergence of bvm - resistance. the reported differences may be dependent on the type of pi mutations or the study systems used. interestingly, the other study demonstrated that the pr background influenced the type and diversity of bvm resistance conferring mutations. viruses with a wildtype pr predominantly acquired the sp1-a1v mutation, whereas viruses with a pi resistance pr acquired a significantly higher prevalence of mutations at the qvt motif (sp1-v7a, v7n, and sp1-t8n), at the polymorphic ca-230 residue (ca - v230i) and also a previously unreported mutation sp1-s5n. the pr genetic background was also found to effect bvm susceptibility and virus replication capacity. while these studies have not fully resolved the complex interplay between pr, the gag substrate and susceptibility to bvm they clearly demonstrate that this parameter should be considered in future development of maturation inhibitors. maturation inhibitors are a novel mechanistic class of antiretroviral drug that target pr cleavage sites in gag. bvm is the first - in - class maturation inhibitor, which specifically inhibits cleavage of sp1 from the c - terminus of ca. pf-46396 is a second maturation inhibitor, which also inhibits ca - sp1 cleavage but is chemically distinct from bvm. there are also a small number of molecules that target ca and inhibit assembly of the immature particle and/or the ca core. bvm is however the only molecule that targets gag, which has been tested in clinical trials. bvm was considered a good candidate for clinical development because of its in vitro potency, novel mechanism of action, and good safety profile in animal models and phase i clinical trials. although initial results of bvm efficacy in hiv-1 infected patients were encouraging, it was quickly established that approximately 50% of patients do not effectively respond to the drug. failure to respond is due to virological parameters, more specifically, intrinsic polymorphisms primarily located at sp1 residues 6, 7, and 8. these polymorphisms have a high prevalence, particularly in non - clade b hiv-1 isolates. the existence of bvm - resistance conferring polymorphisms in bvm - treatment nave patients severely limits the clinical usefulness of bvm and consequently clinical development of bvm was suspended in 2010. halted clinical development of bvm necessitates the need for a second - generation maturation inhibitor to overcome the problem of intrinsic drug resistance encountered by bvm. bvm targets an as yet undefined drug - binding pocket, which is hypothesized to be created upon higher - order multimerization of gag during virus particle assembly. the significant technical challenge of obtaining high - resolution structural information of this hypothetical drug target makes rational structure - based drug design unfeasible at the current time. however, the need to develop improved maturation inhibitors has highlighted a need to further our understanding of the ca - sp1 region of gag and its role in hiv-1 particle assembly. bvm, pf-46396, and their analogues can be utilized as tools to further explore drug - binding requirements to inform future strategies to improve drug resistance profiles. development of bvm has provided evidence that small molecules to inhibit hiv-1 replication can target gag cleavage sites. four other cleavage sites are present in gag and a genetic study predicted that a small molecule that blocks ma - ca cleavage maybe a particularly potent inhibitor of hiv-1 replication. however, the intrinsic flexibility in gag cleavage sites and wide variation in substrate sequence recognition by hiv pr may represent insurmountable problems for the future development of maturation inhibitors.
|
protease - mediated maturation of hiv-1 virus particles is essential for virus infectivity. maturation occurs concomitant with immature virus particle release and is mediated by the viral protease (pr), which sequentially cleaves the gag and gag - pol polyproteins into mature protein domains. maturation triggers a second assembly event that generates a condensed conical capsid core. the capsid core organizes the viral rna genome and viral proteins to facilitate viral replication in the next round of infection. the fundamental role of proteolytic maturation in the generation of mature infectious particles has made it an attractive target for therapeutic intervention. development of small molecules that target the pr active site has been highly successful and nine protease inhibitors (pis) have been approved for clinical use. this paper provides an overview of their development and clinical use together with a discussion of problems associated with drug resistance. the second - half of the paper discusses a novel class of antiretroviral drug termed maturation inhibitors, which target cleavage sites in gag not pr itself. the paper focuses on bevirimat (bvm) the first - in - class maturation inhibitor : its mechanism of action and the implications of naturally occurring polymorphisms that confer reduced susceptibility to bvm in phase ii clinical trials.
|
exclusion criteria were as follows : clinically significant systemic diseases, alcohol consumption (> 20 units / day), neuropathies other than dn, hypoglycemia in the preceding 24 h, and standard magnetic resonance (mr) exclusion criteria. subjects with painful dn (ntss 6 score > 4 and < 16) (3) had symptoms for at least 6 months and were on stable pain medications. six age- and sex - matched nondiabetic healthy volunteers (hv) were also recruited. clinical and neurophysiological assessments were undertaken (456) to provide a neuropathy composite score (ncs) based on the neuropathy impairment score of the lower limbs plus seven tests (nis[ll]+7) as described previously (7). subjects were divided into the following groups : 1) no dn (asymptomatic subjects with normal ncs, 2) painless dn (pain - free subjects with both clinical and at least two abnormalities of neurophysiologic assessment), and 3) painful dn (painful symptoms together with clinical and neurophysiological abnormalities). cerebral perfusion was assessed using a multitime point, single shot t2 weighted echo - planar imaging (epi) sequence (teeff = 60 ms ; tr = 1.4 s ; acquisition matrix = 192 188, zero - filled before fourier transformation to 256 256 ; field of view (fov) = 25 cm). exogenous perfusion contrast was provided by a 20-ml bolus of gadolinium diethylenetriamine pentaacetic acid (gd - dtpa ; magnevist, schering ag, germany), which was followed by a 20-ml saline flush, administered intravenously at a rate of 5 ml / s. the microvascular perfusion characteristics of the thalamus (plays a central role in modulating / processing nociceptive information) (8) and the caudate nucleus were assessed. the caudate nucleus was chosen as a control region since it is not involved in somotosensory perception (9). the following hemodynamic markers of cerebral perfusion were calculated : 1) relative cerebral blood volume (rcbv), the volume of blood per unit time passing through a region of brain tissue relative proximal internal carotid artery flow ; 2) first moment transit time (ttfm, in seconds), the average time for contrast bolus to pass through a region of brain tissue ; and 3) relative cerebral blood flow (rcbf), the average volume of blood per unit time (rcbv : ttfm) (10). subgroup demographics were compared using one - way anova and perfusion markers using nonparametric tests. clinical and neurophysiological assessments were undertaken (456) to provide a neuropathy composite score (ncs) based on the neuropathy impairment score of the lower limbs plus seven tests (nis[ll]+7) as described previously (7). subjects were divided into the following groups : 1) no dn (asymptomatic subjects with normal ncs, 2) painless dn (pain - free subjects with both clinical and at least two abnormalities of neurophysiologic assessment), and 3) painful dn (painful symptoms together with clinical and neurophysiological abnormalities). cerebral perfusion was assessed using a multitime point, single shot t2 weighted echo - planar imaging (epi) sequence (teeff = 60 ms ; tr = 1.4 s ; acquisition matrix = 192 188, zero - filled before fourier transformation to 256 256 ; field of view (fov) = 25 cm). exogenous perfusion contrast was provided by a 20-ml bolus of gadolinium diethylenetriamine pentaacetic acid (gd - dtpa ; magnevist, schering ag, germany), which was followed by a 20-ml saline flush, administered intravenously at a rate of 5 ml / s. the microvascular perfusion characteristics of the thalamus (plays a central role in modulating / processing nociceptive information) (8) and the caudate nucleus were assessed. the caudate nucleus was chosen as a control region since it is not involved in somotosensory perception (9). the following hemodynamic markers of cerebral perfusion were calculated : 1) relative cerebral blood volume (rcbv), the volume of blood per unit time passing through a region of brain tissue relative proximal internal carotid artery flow ; 2) first moment transit time (ttfm, in seconds), the average time for contrast bolus to pass through a region of brain tissue ; and 3) relative cerebral blood flow (rcbf), the average volume of blood per unit time (rcbv : ttfm) (10). subgroup demographics were compared using one - way anova and perfusion markers using nonparametric tests. subjects with painful dn (62.0 [3.9 ]) were significantly older than those with no dn (44.9 [7.1 ]) and hv (45.8 [14.7 ] ; p = 0.03 ; painful dn vs. no dn, p = 0.005, 95% ci 5.728.5 ; painful dn vs. hv, p = 0.01, 95% ci 3.828.5). subjects were matched for bmi (hv 26.7 [5.2 ], no dn 30.2 [3.9 ], painless dn 25.6 [2.3 ], painful dn 31.1 [5.1 ] ; p = 0.08) and hba1c (no dn 8.4 [0.2 ]), painless dn 8.9 [0.9 ], and painful dn 7.7 [0.9 ] ; p = 0.71). subjects with painful dn (ncs 31.0 [9.5 ]) and painless dn (21.8 [15.5 ]) had comparable severity of neuropathy, which were greater than those with no dn (1.0 [1.1 ]). there was no difference in the presence of microvascular complications (diabetic retinopathy data from retinal screening database ; painful dn [n = 3 ], painless dn [n = 2 ], no dn [n = 2 ], and diabetic nephropathy based on albumin : creatinine ratio ; painful dn [n = 3 ], painless dn [n = 3 ], no dn [n = 1 ]) between subjects. the bolus arrival time (in seconds) was delayed in both neuropathy subgroups (painful dn 28.6 [1.6 ] and painless dn 27.3 [2.4 ]) compared with hv 23.6 (6.3) and no dn 24.2 (5.9), p = 0.7, = 1.3. overall group comparison showed that subjects with painful dn (rcbv 228.7 [19.5 ]) have the tallest peak concentration of gd - dtpa and significantly greater mean thalamic rcbv compared with hv (181.9 [51.7 ]), no dn (202.3 [25.8 ]), and painless dn (216.5 [65.5 ]) ; p = 0.04, = 8.3). subjects with painful dn (ttfm 38.4 [3.6 ]) had the longest thalamic ttfm (in seconds) compared with the other study groups (hv 33.7 [14.9 ]), no dn 35.3 [13.2 ], painless dn 35.9 [13.7 ] ; p = 0.07, = 6.9). composite concentration time profiles of the bolus passage of exogenous contrast agent (gd - dtpa) though the thalamus in each subgroup : hv, no dn, painless dn, and painful dn. painful dn is the most distressing complication of diabetes (11), but unfortunately current treatments are often ineffective (12). this may be as a result of our poor understanding of the pathophysiological processes involved (13). using established mr perfusion techniques, we demonstrated increased thalamic vascularity (increased rcbv) with sluggish flow (prolonged ttfm) in painful dn, possibly reflecting underlying vasodilatation. delay in bolus arrival time in both neuropathy subgroups reflects the burden of underlying vascular disease. similar perfusion abnormalities have been described in the sural nerve (14). despite this, there remains clear difference in the perfusion profiles of both painful and painless dn. unlike the caudate, the thalamus plays a central role in modulating / processing somatosensory information that is relayed to the cerebral cortex (8). we have previously reported that preservation of thalamic neuronal function may be a prerequisite for the perception of pain in dn (2). hyperexcitable thalamic neurons have since been reported to contribute to neuropathic pain in experimental diabetes (15).. limitations of the current study include an age spread of several years between cohorts, and age is a factor in cerebral hypoperfusion. paradoxically, however, subjects with painful dn comprised the oldest cohort but possessed the greatest thalamic rcbv. interestingly, the difference in thalamic microvascular perfusion between painful and painless dn is not reflected by microvascular disease burden elsewhere with comparable prevalence of minimal retinopathy and nephropathy in both groups. a larger study with sample sizes of 12 from each of the four groups would achieve 91% power to detect significant differences among the groups. future mr perfusion studies may lead to identification of objective hemodynamic correlates of painful dn enabling the targeting of specific components of the pain matrix pharmacologically, hopefully resulting in the development of more effective and better tolerated drugs.
|
objectivethe pathogenesis of painful diabetic neuropathy (dn) remains undetermined, with both central and peripheral mechanisms implicated. this study investigates whether thalamic perfusion abnormalities occur in painful dn.research design and methodseighteen subjects with type 1 diabetes (no dn = 6, painful dn = 5, painless dn = 7) and six healthy volunteers (hv) were recruited. microvascular perfusion characteristics (relative cerebral blood volume [rcbv ], flow [rcbf ], and transit time [ttfm ]) of the thalamus and caudate nucleus were assessed using magnetic resonance perfusion imaging. the caudate nucleus was chosen to serve as an in vivo control region.resultssubjects with painful dn had significantly greater thalamic rcbv (means [sd ] ; painful dn, 228.7 [19.5 ] ; no dn, 202.3 [25.8 ] ; painless dn, 216.5 [65.5 ] ; hv, 181.9 [51.7 ] ; p = 0.04) and the longest ttfm(s) (painful dn, 38.4 [3.6 ] ; no dn, 35.3 [13.2 ] ; painless dn, 35.9 [13.7 ] ; hv, 33.7 [14.9 ] ; p = 0.07). there was no significant difference in markers of caudate nucleus perfusion.conclusionspainful dn is associated with increased thalamic vascularity. this may provide an important clue to the pathogenesis of pain in dn.
|
nurses, as a part of this system, should move forward along with these changes. for this purpose, nurses need to influence the formulation of health policies rather than just implementation of them. then, they need to be active in the development of health policies to be better able to control their practice. in this process, nurse leaders have a very important role. they need to acquire policy - making skills in order to address professional challenges. because of their values, professional ethics, advocacy skills, and experiences, nurse leaders have unique and valuable views toward health policies. there has been increasing growth toward nurses presence, role, and influence in health policies during recent decades. nurses are expected to identify the issues deliberately and work with other decision makers to advance health care policies. they should understand the levels of power, and know who controls the resources of health services in their organizations. therefore, we can go ahead and say that nurses have to be involved in policies which affect patients, families, themselves, and the whole health care system. nurses influence in health polices protects patient safety, increases quality of care, and facilitates their access to the required resources and promotes quality health care. accordingly, the concept of policy influence in nursing is a new and important concept, but there is lack of conceptual clarity with regard to what this concept really represents. (2002) in their study showed that most primary care groups in primary care centers consulted with local nurses about the key fields in care services and they believed that consultation with nurses had been effective. on the other hand, results of a survey about the health managers and authorities perceptions of the effect of various health professions on revision of health affairs reveal that nurses are in the sixth (the last) grade with a dominant point interval in comparison to other health professionals. (2002) reported as consultation with nurses in local fields really represents nurses policy influence. it seems that the extent of applying this concept is wide and not clearly addressed in literatures. on the other hand, we should state that health systems policies settle within three levels : micro, macro, and meso. in the micro level, policies are just for especial parts, fields, or groups, and have not been made essentially by the government, whereas in the macro level, policies are for the whole country and have been made essentially by the government. the meso level policies settle between micro and macro levels and have usually been made by official organizations. so, clarifying and defining this concept in order to develop it, especially in different levels of nursing management is essential. by clarifying this concept, we can reach a common language and help to increase the credibility of future studies. this study was carried out using concept analysis approach, by which an abstract concept is defined and clarified and differentiated from similar concepts. we used the eight - stage walker and avant approach, which is a clear and systematic method of concept analysis and also the most common one. this method is especially useful for novice concept analysts, and had been successfully applied in previous analysis of the concepts. walker and avants eight stages method for concept analysis one probable concern about using walker and avant approach is insufficient conceptual clarification due to the context - free nature of this approach. while conceptual clarification should be achieved through referring to different existing theoretical contexts, some analysts have commitment that the concepts own theoretical context should be highlighted. thus, they suggest that if there is no theory or theoretical framework for the concept in literatures, this should be stated explicitly by the analysts. in the present concept analysis while there is not any direct theory that represents the concept of nurses policy influence, we have referred to relevant theories with both nursing and management context. in the discussion section, we have addressed the concept 's relevance with existing theories. in the process suggested by walker and avant, the first and second stages are identifying a suitable concept for analysis and then determining its purpose. as mentioned earlier, the extent of using nurses policy influence as a concept has not been determined clearly. this means it is not clear whether we can address consultation with nurses from operational levels of nursing care about health and nursing issues as influencing the policies or this is a concept that just addresses high levels of nursing management and leadership. it is not clear which one of activities carried out in these extended levels can be introduced as policy influence. the principal purpose of this concept analysis is to clarify and develop the concept and to propose a definition for it, through which nurses can better understand the importance of policies in health care system and the necessity for their involvement in policies and to have their influence on them. the third stage is review of literature. according to walker and avant, review of literature should not be limited to nursing literatures to prevent bias in understanding the concept. in the search strategy, we searched various databases including pubmed, science direct, elsevier, cinahl, and also google scholar as an internet search engine, using relevant key terms, nursing and policy involvement, nursing and policy influence, nursing and policy making, and nursing and decisional involvement. only english articles published between 1999 and 2013 were reviewed. finally, 24 articles related to nurses policy influence were selected. we also searched english dictionaries, the textbooks about nursing management, and nurses guide to health policies manually. here is a summary of this review : looking back at the nursing background in the 19 century, we find nurse leaders such as florence nightingale, sojourner truth, lillian wald, and margaret sanger who have had extraordinary roles in the development of policies, especially in women 's, newborns, school children 's, and environmental health. in 1991, the american association of college of nursing (aacn) announced that it is necessary to add health policy education to the field of nursing at master 's level. we also found nursing courses with the content of policies in baccalaureate degree programs after the year 2000. therefore, it seems that nurses should be knowledgeable about all issues related to health system, and not just caring issues. certainly, days of just carrying out the prescribed orders are over for nurses globally. kowalik and yoder point to health care organizations which have identified the importance of nurse leaders participation in decisional affairs. they believe that the outcomes of having strong voice in the fields of decision making will enhance the quality of patients care. however, the managerial roles of nurse leaders, such as decision making, analyzing, control, and budgeting, are still considered as less valuable from the viewpoint of health system managers. nurses should know that the political ideology of health care system and policy - making process will shape nursing leadership, whether it is a political, clinical, academic, or management leadership. there are two words in the lexicon (2006) including policy and politics, which need to be defined. although these two words are different, because of their similar tone, they infer same concepts and are usually used interchangeably. in order to wildly define these two words, both as a general and as a management and health concept, analysts have referred to dictionaries, articles, and books with the approach of nursing policy and nursing management. policies are decisions which are made by people who have power and authority. on the other hand practical ways or principles accepted or suggested by a government, group, profession, or an individual. meanwhile, mason, leavitt, and chaffee are nurses who define policy as, choices of society or a part of society or organization, with consideration of purposes, health priorities, and ways of resource supply in order to reach purposes. in management books, policies are guidelines for procedures and helping people for decision making. what is important for management 's authorities is to understand how policies can support effective leadership. the word politics in fact, this word has been driven from aristotle 's book named citizen affairs which is about government and how to govern. for the first time in 1430, this word with the title of politiqu was imported to english, and in 1520, was changed to politics. as we see, polities is always related to organizational process and government function, while policies sometimes are principles and acts for how to behave. define politics as the art of influence to supply rare resources such as money, time, personnel, and materials. from management point of view, politics is the art of influencing others ; it is a means to get ends. to better clarify the concept of policy influence, we also need to define the concept of influence. in webster 's dictionary (1977), influence is defined as affecting others without any force or pressure. as previously mentioned, some authorities of management define politics as the art of influence. thus, the words influence and politics or influence and policy are very much related to each other. for example, imagine a person who has a lot of important and consistent views and opinions about one of the patient care issues, but the people working with him / her think contrary. here, we should ask the questions of how we can influence others to make them come in our direction and what kind of power we can use. also, the concept of influence has a very near association with the concept of power. we will discuss about it more in this article. the fourth stage is clarifying attributes. according to walker and avant (2005), attributes are characteristics which are with the concept or related to it. review of literature helps us to find these attributes. instead of using many attributes which are less related to the concept, it is better to use less attributes with more relations. policy influence is accompanied with the following attributes : the spectrum of policy influence, power, and advocacy. before explaining these attributes, these are concepts which have some, but not all of the attributes of the concept. these are decisional involvement, policy making, political influence, and policy involvement. policy making is one of the activities which are done during the process of policy influence. most of the times, for individuals to be influential in polices, they require to be politically influenced. policy involvement may have very close meaning to the concept of policy influence. like policy influence which can be considered on a spectrum, policy involvement has three levels. according to boswell., policy or political involvement entails the use of activities and behaviors to have an effect on governmental and legislative strategies. in the first level, the individual goes beyond just voting and will take a hard look at personal values, beliefs, and world views. these stimulators will make them as being an adherent for a group of individuals. in the final level, the individual reaches a level of commitment that involves the development of health policies. policy influence is moving on a spectrum which begins from policy literacy, moves forward to policy acumen, and then continues to policy competence and finally to policy influence. one way is referring to policy documents and asking these questions : what is the problem ? when was the process begun ? how many are affected ? and who are the stakeholders ? policy acumen is the ability to analyze policies, and when nurses acquire policy acumen, they can actively analyze organizational process and health care services. managers who have acquired policy competence can direct their organizations in response to the challenges and opportunities related to political situations and also make policies which have desirable effects on their organizations. finally, we have reached policy influence which refers to the nurses who are able to give especial consultation to governments about nursing issues and have important roles in development, implementation, and evaluation of government policies about health care. power is the ability to achieve goals. on the other hand, power is the inherent ability to influence others. thus, nurses should acquire enough information about the presence and place of power fields. what nurses need and should know about power is power with others instead of power on others indeed nurses need power as one attribute of policy influence to protect the quality of care and to change organizations. an advocate should be active in political process of his / her country (i.e. by voting). without involvement in policies, advocating role of nurses will be ineffective. nurses as advocates should know that when they want to influence decision makers, they need to understand that they are working in an open system, so they are affected by many factors. an advocate should ensure that everything influencing decision makers for developing a plan has been understood and considered. model cases are valuable for better clarification of abstract concepts in nursing and should have all the attributes of a concept. iranian nursing organization (ino) was established in december 2001 after years of work for counseling, mentoring, and lobbying. ino is the most active nursing organization and the largest one in iran which has been established by iranian nurse activists. this is a non - governmental organization (ngo) according to iran 's constitution. the main mission of this organization is to improve nursing profession in iran by protecting and supporting nurses rights, improving their knowledge, skills, and on - the - job education, and introducing nursing to society. if we look at the pathway that iranian nurse activists paved to establish this organization, we can find the attributes of policy influence. first of all, iranian nurse activists searched and investigated for similar constructions in the world, such as american nursing association (ana), and in this way, they increased their policy literacy. then, they started to analyze the findings and reached a consensus on the establishment of this organization as their policy acumen developed. iranian nurse leaders who were well educated, together with other nurse activists facilitated the process as policy competent people. they put the primary plan in writing and sent it as a statement to islamic consultative parliament. finally, when all amendatory acts were accomplished, the establishment of ino was approved and the statement changed to a law. in this way, policy influence occurred. although the legislation system of iran is centralized and all the health policies are made in the ministry of health, ino has the authority and power to act for the improvement of iranian nurses welfare and patients rights. according to the world health organization (who), there are some domains in which ngos like ino are required to advocate and, therefore, be involved in political actions such as influencing on workplace policy procedures, funding allocation decisions, practice models, setting of standards, and also special licensure and credentialing. in the sixth stage, antecedents of the concept should be identified. according to walker and avant, antecedents are events or factors which come before the occurrence of the concept. antecedents of policy influence in nursing which were identified in this analysis are listed and discussed as follows. 1)strengthening political knowledge through especial educational programs in nursing : there are a number of formal programs to increase the political knowledge of nurse leaders in iran. these are leadership for change (lfc) and leadership for development (lfd), which are conducted similar to international council of nursing (icn) and eastern mediterranean region office (emro) nursing advisor. meanwhile, there are a number of such programs in the united states with emphasis on this issue. one wonderful program is new york state nurses association 's lobby day (nysna s lobby day), which is an exciting dynamic course for baccalaureate nursing degree programs. the well - known program in the uk is royal college of nursing political leadership program (2005). this program corresponds to the needs of leaders, students, and other related groups, and is presented as workshops and active learning sessions.2)communications : policy and politics have a very close relationship with communication skills. nurses are well experienced on how to communicate with people and how to attract their interest in order to meet different institutional needs and achieve their goals.3)teamwork : policy making is teamwork and needs support and hard work, which is only possible through effective decision making by groups. teamwork in policy affairs is very creative and active because many people are involved who support each other. there are two important aspects for teamwork in policy influence : one of them is nursing coalitions in the framework of associations and organizations and the second one is inter - disciplinary participation. ino, iranian scientific nursing association (isna), iranian nursing association (ina), and iranian cardiac nursing association (icna) are four nursing coalitions in iran that provide the required framework for policy influence in nursing.4)strengthening public mental image : policy is related to perceptions and images. for policy influence, nurses ability to influence policies depends on others images of nursing and also their own images of themselves. increasing visibility of nurses in media would enhance their participation in public health discussions. strengthening political knowledge through especial educational programs in nursing : there are a number of formal programs to increase the political knowledge of nurse leaders in iran. these are leadership for change (lfc) and leadership for development (lfd), which are conducted similar to international council of nursing (icn) and eastern mediterranean region office (emro) nursing advisor. meanwhile, there are a number of such programs in the united states with emphasis on this issue. one wonderful program is new york state nurses association 's lobby day (nysna s lobby day), which is an exciting dynamic course for baccalaureate nursing degree programs. the well - known program in the uk is royal college of nursing political leadership program (2005). this program corresponds to the needs of leaders, students, and other related groups, and is presented as workshops and active learning sessions. nurses are well experienced on how to communicate with people and how to attract their interest in order to meet different institutional needs and achieve their goals. teamwork : policy making is teamwork and needs support and hard work, which is only possible through effective decision making by groups. teamwork in policy affairs is very creative and active because many people are involved who support each other. there are two important aspects for teamwork in policy influence : one of them is nursing coalitions in the framework of associations and organizations and the second one is inter - disciplinary participation. ino, iranian scientific nursing association (isna), iranian nursing association (ina), and iranian cardiac nursing association (icna) are four nursing coalitions in iran that provide the required framework for policy influence in nursing. strengthening public mental image : policy is related to perceptions and images. for policy influence, nurses ability to influence policies depends on others images of nursing and also their own images of themselves. in this consequences are events or outcomes which occur as a result of the concept. as for antecedents, consequences depend on the social context in which the concept has been used. according to the findings of this analysis, the consequences of nurses policy influence are as follows. 1)adequacy of nurse workforce size : nursing workforce is an important problem in the health care system of iran. maintaining nursing workforce by recruitment of more new nurses will have significant effects on health system outcomes. some of these effects are : increased presence of nurses in the bedside, listening to patients more, and better maintenance of patients munificence. although during recent years, some policies have been applied for compensating nurse workforce shortages in iran, such as training nurse assistants through short - term courses, recruitment of undergraduate nursing students as part - time staff, and receiving agreement to recruit 23,000 nurses in governmental health centers, nursing shortage is still the most important problem which needs policy making.2)modification of nursing duties and organizing nursing care systems : evidence indicates that most part of the nurses time is spent for official works and not for direct care of the patients. in iran, traditional functional system of nursing and weak relationship patterns still are destroying nursing work environments and need to be handled by effective policies.3)improving nursing education congruent with social needs : along with the changes in lifestyle and health care systems, there is a serious need to improve nursing education and expand nurses roles. in iran, constructive changes have been made in nursing education, especially in master 's degrees, during recent years. for example, because of population aging, rise in survival rate of neonates, and also high levels of road accidents, new educational programs such as geriatric nursing, intensive care nursing, and neonate intensive care nursing have been recently developed. but we still need effective policies to expand nurses roles in some fields like cancer and diabetes in the community.4)job satisfaction and job retention : according to mangold., effective participation of nurses in career - related decisions will increase their job satisfaction. meanwhile, in institutions with active participatory management and power distribution, job retention will be enhanced.5)improvement of patient outcome : the final product of nurses policy influence is improvement of patient outcome, and in this way, health systems can claim that they have achieved their mission. table 2 shows antecedences, defining attributes, and consequence of nurses policy influence. table 2antecedents, defining attributes, and consequences of nurses policy influence adequacy of nurse workforce size : nursing workforce is an important problem in the health care system of iran. maintaining nursing workforce by recruitment of more new nurses will have significant effects on health system outcomes. some of these effects are : increased presence of nurses in the bedside, listening to patients more, and better maintenance of patients munificence. although during recent years, some policies have been applied for compensating nurse workforce shortages in iran, such as training nurse assistants through short - term courses, recruitment of undergraduate nursing students as part - time staff, and receiving agreement to recruit 23,000 nurses in governmental health centers, nursing shortage is still the most important problem which needs policy making. modification of nursing duties and organizing nursing care systems : evidence indicates that most part of the nurses time is spent for official works and not for direct care of the patients. in iran, traditional functional system of nursing and weak relationship patterns improving nursing education congruent with social needs : along with the changes in lifestyle and health care systems, there is a serious need to improve nursing education and expand nurses roles. in iran, constructive changes have been made in nursing education, especially in master 's degrees, during recent years. for example, because of population aging, rise in survival rate of neonates, and also high levels of road accidents, new educational programs such as geriatric nursing, intensive care nursing, and neonate intensive care nursing have been recently developed. but we still need effective policies to expand nurses roles in some fields like cancer and diabetes in the community. job satisfaction and job retention : according to mangold., effective participation of nurses in career - related decisions will increase their job satisfaction. meanwhile, in institutions with active participatory management and power distribution, job retention will be enhanced. improvement of patient outcome : the final product of nurses policy influence is improvement of patient outcome, and in this way, health systems can claim that they have achieved their mission. table 2 shows antecedences, defining attributes, and consequence of nurses policy influence. table 2antecedents, defining attributes, and consequences of nurses policy influence antecedents, defining attributes, and consequences of nurses policy influence finally, all of the above consequences can be summarized as making change in health care strategies. in the eighth and the last stage of this kind of concept analysis, because of high abstraction level of concepts, their existence in real situations and also the way they have been measured should be determined. although no instrument has been developed to directly measure nursing policy influence and its attributes, political astuteness inventory pai measures the level of political astuteness and identify conceptual factors contributing to organizations, awareness of health policy issues, knowledge of the officials, and involvement in the political process. it is a 40-item tool, and it takes about 70 min to be completed. based on the total score, four levels of political astuteness are categorized : 0 - 9 points, totally unaware ; 10 - 19 points, slightly aware ; 20 - 29 points, beginning political astuteness ; and 30 - 40 points, politically astute. although pai just measures political astuteness and not direct policy influence of a person, it defines awareness, understanding, and evaluation of policy influence. there are also a number of qualitative studies which have focused on nursing influence and its wide effects on patients and nurses. for example, gebbie. described the ways nurses can be influential in the development of health policy and its barriers. in the united states, byrd. introduced a series of learning experiences which have been designed to make students engage in policy involvement process. finally, fyffe (2009) introduced strategies for nurses to be influential in policies. based on this analysis, the concept of nurses policy influence would be defined as nurses ability to have an effect on decisions and affairs related to health care using power, advocacy, and policy competence, which is acquired by policy awareness, effective communication, teamwork, and strengthening images and will result in improvement of nurses and patients outcomes. accordingly, policy influence is the highest level of involvement in policies which are just carried out by high level of nursing management. therefore, activities such as consultation with nurses about health issues will not adequately address this concept. the fourth stage is clarifying attributes. according to walker and avant (2005), attributes are characteristics which are with the concept or related to it. review of literature helps us to find these attributes. instead of using many attributes which are less related to the concept, it is better to use less attributes with more relations. policy influence is accompanied with the following attributes : the spectrum of policy influence, power, and advocacy. before explaining these attributes, these are concepts which have some, but not all of the attributes of the concept. these are decisional involvement, policy making, political influence, and policy involvement. policy making is one of the activities which are done during the process of policy influence. most of the times, for individuals to be influential in polices, they require to be politically influenced. policy involvement may have very close meaning to the concept of policy influence. like policy influence which can be considered on a spectrum, policy involvement has three levels. according to boswell., policy or political involvement entails the use of activities and behaviors to have an effect on governmental and legislative strategies. in the first level, the individual goes beyond just voting and will take a hard look at personal values, beliefs, and world views. these stimulators will make them as being an adherent for a group of individuals. in the final level, the individual reaches a level of commitment that involves the development of health policies. policy influence is moving on a spectrum which begins from policy literacy, moves forward to policy acumen, and then continues to policy competence and finally to policy influence. one way is referring to policy documents and asking these questions : what is the problem ? when was the process begun ? how many are affected ? and who are the stakeholders ? policy acumen is the ability to analyze policies, and when nurses acquire policy acumen, they can actively analyze organizational process and health care services. managers who have acquired policy competence can direct their organizations in response to the challenges and opportunities related to political situations and also make policies which have desirable effects on their organizations. finally, we have reached policy influence which refers to the nurses who are able to give especial consultation to governments about nursing issues and have important roles in development, implementation, and evaluation of government policies about health care. power is the ability to achieve goals. on the other hand, power is the inherent ability to influence others. thus, nurses should acquire enough information about the presence and place of power fields. what nurses need and should know about power is power with others instead of power on others indeed nurses need power as one attribute of policy influence to protect the quality of care and to change organizations. an advocate should be active in political process of his / her country (i.e. by voting). without involvement in policies, advocating role of nurses will be ineffective. nurses as advocates should know that when they want to influence decision makers, they need to understand that they are working in an open system, so they are affected by many factors. an advocate should ensure that everything influencing decision makers for developing a plan has been understood and considered. model cases are valuable for better clarification of abstract concepts in nursing and should have all the attributes of a concept. iranian nursing organization (ino) was established in december 2001 after years of work for counseling, mentoring, and lobbying. ino is the most active nursing organization and the largest one in iran which has been established by iranian nurse activists. this is a non - governmental organization (ngo) according to iran 's constitution. the main mission of this organization is to improve nursing profession in iran by protecting and supporting nurses rights, improving their knowledge, skills, and on - the - job education, and introducing nursing to society. if we look at the pathway that iranian nurse activists paved to establish this organization, we can find the attributes of policy influence. first of all, iranian nurse activists searched and investigated for similar constructions in the world, such as american nursing association (ana), and in this way, they increased their policy literacy. then, they started to analyze the findings and reached a consensus on the establishment of this organization as their policy acumen developed. iranian nurse leaders who were well educated, together with other nurse activists facilitated the process as policy competent people. they put the primary plan in writing and sent it as a statement to islamic consultative parliament. finally, when all amendatory acts were accomplished, the establishment of ino was approved and the statement changed to a law. in this way, policy influence occurred. although the legislation system of iran is centralized and all the health policies are made in the ministry of health, ino has the authority and power to act for the improvement of iranian nurses welfare and patients rights. according to the world health organization (who), there are some domains in which ngos like ino are required to advocate and, therefore, be involved in political actions such as influencing on workplace policy procedures, funding allocation decisions, practice models, setting of standards, and also special licensure and credentialing. in the sixth stage, antecedents of the concept should be identified. according to walker and avant, antecedents are events or factors which come before the occurrence of the concept. antecedents of policy influence in nursing which were identified in this analysis are listed and discussed as follows. 1)strengthening political knowledge through especial educational programs in nursing : there are a number of formal programs to increase the political knowledge of nurse leaders in iran. these are leadership for change (lfc) and leadership for development (lfd), which are conducted similar to international council of nursing (icn) and eastern mediterranean region office (emro) nursing advisor. meanwhile, there are a number of such programs in the united states with emphasis on this issue. one wonderful program is new york state nurses association 's lobby day (nysna s lobby day), which is an exciting dynamic course for baccalaureate nursing degree programs. the well - known program in the uk is royal college of nursing political leadership program (2005). this program corresponds to the needs of leaders, students, and other related groups, and is presented as workshops and active learning sessions.2)communications : policy and politics have a very close relationship with communication skills. nurses are well experienced on how to communicate with people and how to attract their interest in order to meet different institutional needs and achieve their goals.3)teamwork : policy making is teamwork and needs support and hard work, which is only possible through effective decision making by groups. teamwork in policy affairs is very creative and active because many people are involved who support each other. there are two important aspects for teamwork in policy influence : one of them is nursing coalitions in the framework of associations and organizations and the second one is inter - disciplinary participation. ino, iranian scientific nursing association (isna), iranian nursing association (ina), and iranian cardiac nursing association (icna) are four nursing coalitions in iran that provide the required framework for policy influence in nursing.4)strengthening public mental image : policy is related to perceptions and images. for policy influence, nurses ability to influence policies depends on others images of nursing and also their own images of themselves. in this increasing visibility of nurses in media would enhance their participation in public health discussions. strengthening political knowledge through especial educational programs in nursing : there are a number of formal programs to increase the political knowledge of nurse leaders in iran. these are leadership for change (lfc) and leadership for development (lfd), which are conducted similar to international council of nursing (icn) and eastern mediterranean region office (emro) nursing advisor. meanwhile, there are a number of such programs in the united states with emphasis on this issue. one wonderful program is new york state nurses association 's lobby day (nysna s lobby day), which is an exciting dynamic course for baccalaureate nursing degree programs. the well - known program in the uk is royal college of nursing political leadership program (2005). this program corresponds to the needs of leaders, students, and other related groups, and is presented as workshops and active learning sessions. nurses are well experienced on how to communicate with people and how to attract their interest in order to meet different institutional needs and achieve their goals. teamwork : policy making is teamwork and needs support and hard work, which is only possible through effective decision making by groups. teamwork in policy affairs is very creative and active because many people are involved who support each other. there are two important aspects for teamwork in policy influence : one of them is nursing coalitions in the framework of associations and organizations and the second one is inter - disciplinary participation. ino, iranian scientific nursing association (isna), iranian nursing association (ina), and iranian cardiac nursing association (icna) are four nursing coalitions in iran that provide the required framework for policy influence in nursing. strengthening public mental image : policy is related to perceptions and images. for policy influence, nurses ability to influence policies depends on others images of nursing and also their own images of themselves. in this consequences are events or outcomes which occur as a result of the concept. as for antecedents, consequences depend on the social context in which the concept has been used. according to the findings of this analysis, the consequences of nurses policy influence are as follows. 1)adequacy of nurse workforce size : nursing workforce is an important problem in the health care system of iran. maintaining nursing workforce by recruitment of more new nurses will have significant effects on health system outcomes. some of these effects are : increased presence of nurses in the bedside, listening to patients more, and better maintenance of patients munificence. although during recent years, some policies have been applied for compensating nurse workforce shortages in iran, such as training nurse assistants through short - term courses, recruitment of undergraduate nursing students as part - time staff, and receiving agreement to recruit 23,000 nurses in governmental health centers, nursing shortage is still the most important problem which needs policy making.2)modification of nursing duties and organizing nursing care systems : evidence indicates that most part of the nurses time is spent for official works and not for direct care of the patients. in iran, traditional functional system of nursing and weak relationship patterns still are destroying nursing work environments and need to be handled by effective policies.3)improving nursing education congruent with social needs : along with the changes in lifestyle and health care systems, there is a serious need to improve nursing education and expand nurses roles. in iran, constructive changes have been made in nursing education, especially in master 's degrees, during recent years. for example, because of population aging, rise in survival rate of neonates, and also high levels of road accidents, new educational programs such as geriatric nursing, intensive care nursing, and neonate intensive care nursing have been recently developed. but we still need effective policies to expand nurses roles in some fields like cancer and diabetes in the community.4)job satisfaction and job retention : according to mangold., effective participation of nurses in career - related decisions will increase their job satisfaction. meanwhile, in institutions with active participatory management and power distribution, job retention will be enhanced.5)improvement of patient outcome : the final product of nurses policy influence is improvement of patient outcome, and in this way, health systems can claim that they have achieved their mission. table 2 shows antecedences, defining attributes, and consequence of nurses policy influence. table 2antecedents, defining attributes, and consequences of nurses policy influence adequacy of nurse workforce size : nursing workforce is an important problem in the health care system of iran. maintaining nursing workforce by recruitment of more new nurses will have significant effects on health system outcomes. some of these effects are : increased presence of nurses in the bedside, listening to patients more, and better maintenance of patients munificence. although during recent years, some policies have been applied for compensating nurse workforce shortages in iran, such as training nurse assistants through short - term courses, recruitment of undergraduate nursing students as part - time staff, and receiving agreement to recruit 23,000 nurses in governmental health centers, nursing shortage is still the most important problem which needs policy making. modification of nursing duties and organizing nursing care systems : evidence indicates that most part of the nurses time is spent for official works and not for direct care of the patients. in iran, traditional functional system of nursing and weak relationship patterns still are destroying nursing work environments and need to be handled by effective policies. improving nursing education congruent with social needs : along with the changes in lifestyle and health care systems, there is a serious need to improve nursing education and expand nurses roles. in iran, constructive changes have been made in nursing education, especially in master 's degrees, during recent years. for example, because of population aging, rise in survival rate of neonates, and also high levels of road accidents, new educational programs such as geriatric nursing, intensive care nursing, and neonate intensive care nursing have been recently developed. but we still need effective policies to expand nurses roles in some fields like cancer and diabetes in the community. job satisfaction and job retention : according to mangold., effective participation of nurses in career - related decisions will increase their job satisfaction. meanwhile, in institutions with active participatory management and power distribution, job retention will be enhanced. improvement of patient outcome : the final product of nurses policy influence is improvement of patient outcome, and in this way, health systems can claim that they have achieved their mission. table 2 shows antecedences, defining attributes, and consequence of nurses policy influence. table 2antecedents, defining attributes, and consequences of nurses policy influence antecedents, defining attributes, and consequences of nurses policy influence finally, all of the above consequences can be summarized as making change in health care strategies. in the eighth and the last stage of this kind of concept analysis, the empirical referents of the concept should be presented. because of high abstraction level of concepts, their existence in real situations and also the way they have been measured should be determined. although no instrument has been developed to directly measure nursing policy influence and its attributes, political astuteness inventory (pai) can measure some aspects of this concept indirectly. pai measures the level of political astuteness and identify conceptual factors contributing to organizations, awareness of health policy issues, knowledge of the officials, and involvement in the political process. it is a 40-item tool, and it takes about 70 min to be completed. based on the total score, four levels of political astuteness are categorized : 0 - 9 points, totally unaware ; 10 - 19 points, slightly aware ; 20 - 29 points, beginning political astuteness ; and 30 - 40 points, politically astute. although pai just measures political astuteness and not direct policy influence of a person, it defines awareness, understanding, and evaluation of policy influence. there are also a number of qualitative studies which have focused on nursing influence and its wide effects on patients and nurses. for example, gebbie. described the ways nurses can be influential in the development of health policy and its barriers. in the united states, byrd. introduced a series of learning experiences which have been designed to make students engage in policy involvement process finally, fyffe (2009) introduced strategies for nurses to be influential in policies. based on this analysis, the concept of nurses policy influence would be defined as nurses ability to have an effect on decisions and affairs related to health care using power, advocacy, and policy competence, which is acquired by policy awareness, effective communication, teamwork, and strengthening images and will result in improvement of nurses and patients outcomes. accordingly, policy influence is the highest level of involvement in policies which are just carried out by high level of nursing management. therefore, activities such as consultation with nurses about health issues will not adequately address this concept. explaining precise and specific meaning of a concept through various theoretical contexts with emphasis on the favorite context is sufficient. the concept of policy influence at all and nurses policy influence, in particular, has not been adequately addressed in various theoretical contexts. kingdon 's theory (1995) of policy streams proposes presence of some streams in the process of policy making before agenda setting and policy formulation take place. kingdom believed that in spite of the dominant effect of governmental agents in progression of an agenda setting, some interest groups also may have a key role in acceptance or obstruction of an agenda setting through formation of a coalition. kingdom, according to dohler (1991), states that a united and constant coalition increases the chance for victory in policy streams. the results of current concept analysis of policy influence also forebode the significance of communication and teamwork as two important antecedents for policy influence. as mentioned before, policy activists need to work together as a team and have an acceptable level of communication. margaret newman 's theory of health as expanding consciousness can be seen as related to raising political awareness. her theory emphasizes that all people, of any health status and from any circumstance, are a part of the process of expanding consciousness. her theory defines consciousness as the capacity of the system to interact with the environment. some of the dimensions of this interaction are exchanging, communicating, relating, choosing, moving, perceiving, and knowing. in summary, expanding consciousness is a metaphor for the changing health systems. nurses awareness of policies will assist expanding consciousness and change health systems. in the present study, we have achieved attributes such as policy literacy, policy acumen, policy competence, and also strengthening political knowledge as antecedents, all of which build policy awareness. these are concepts which can be abstracted from some of newman 's dimensions of interaction with environment, i.e. knowing and perceiving. meanwhile, other dimensions of newman, i.e. exchanging, communicating, and relating, can be accommodated to other antecedents of policy influence, i.e. communication and teamwork, in this study. finally, choosing and moving are newman 's dimensions which are related to making change in health care strategies as overall consequence of policy influence in the present study. the other theories which the results of current concept analysis are related to are philosophical theories of nursing advocacy. advocacy as a concept had been considered by nurse theorists, and each of them has a unique definition of nursing advocacy. she has a moral view of advocacy and believes that the ultimate goal of advocacy is to increase patient outcomes. kohnke (1980) propounded a model of functional advocacy, in which nurses are agents who inform patients and support patients decisions. the results of the current concept analysis are pertinent for gadow 's and kohnke 's theories, since we postulated advocacy as an attribute of policy influence and an inseparable part of the role of nurses as health care providers. it is notable that the role of advocacy is not limited to patient advocacy, but rather it is allocated to professional advocacy too. nurses as professional advocators are concerned about nursing workforce, nurse patient ratio, prevention of malpractice, and the expansion role of nurses. in the present study, we have also introduced pertinent activities such as adequacy of nurse workforce size and improving nursing education, congruent with social needs, as the consequences of policy influence, all of which address professional advocacy. the aim of this article was to clarify the concept of policy influence associated with nursing management, leadership, and practice in the context of iran. in this unique analysis, attributes of the concept, such as advocacy, power, and policy competence, were identified. this effect is impossible without the required knowledge of health care system as a whole. nurses need to be aware of policy agendas, policy makers, and political backgrounds. they are advocates for improvement of the quality of care, but many of them do not have adequate organizational and personal power for advocating patients rights. in fact, for nurses to be in a state of empowering patients, it is first essential for them to be empowered. their expertise, judgment, and policy influence, all together help them to achieve their goals and to facilitate the professional process and the efficacy of health care system. we hope this concept analysis addresses a clear definition of nurses policy influence for all nurses and encourage political influence, especially for nurse leaders. in summary, results of this concept analysis indicate that although there are some theories about policy - making process and its facilitators and barriers, there is still lack of nurses theories in which the main concepts are involving them or their influence in health policies. however, these are stepping stones in nursing discipline, as we can see them in newman 's model and advocacy models which have been developed by nurses theorists. considering the state of nurses policy involvement in reports and research papers identified that this involvement has various levels but not all levels indicates influencing in policies. our definition of this concept may represent a broad theoretical understanding of this concept and may discriminate between similar or related concepts. this analysis will potentially inform nurses about how they could be really influence in policies and what they need to achieve for this purpose. the identified antecedents, attributes and consequences of policy influence may also give guidance to nurse administrators and managers to achieve high level of leadership step by step to be influence in policies. finally this paper may offer a theoretical framework to guide future work on this concept.
|
background : nurses influence on health policy protects the quality of care by access to required recourses and opportunities. this is a new and important concept for nursing ; however, research studies on policy influence of nurses in health care sector are lacking a basic conceptual understanding of what this concept represents. the aim of this paper is to clarify the concept of nurses policy influence and to propose the definition of this concept, considering the context of iran.materials and methods : the eight stages of walker and avant approach was used to guide this concept analysis. various databases and internet engines were searched to find all related information about the concept. textbooks were also searched manually. english language literature reports published between 1990 and 2012 were reviewed.results:based on the analysis undertaken, nurses policy influence is nurses ability in influencing decisions and affairs related to health through political knowledge, effective communication, and collaboration with other members of the health team, which results in the improvement of nurses job environment and increases patient outcomes. this is a dynamic process situated on a spectrum and is accompanied with nurses knowledge, competency, power, and advocacy, and also their ability to change.conclusions:nurses have individual views on health care issues and influence health care policies in different ways. with a common understanding of nurses policy influence as a concept, nurses will recognize the importance of policy making in the health sector and their influence on this process and also on patients outcomes.
|
the population aged 65 years and older accounts for more than 80% of cardiovascular disease deaths and 85% of cardiovascular disease hospitalizations, including 62% of hospitalizations for myocardial infarction and 77% of hospitalizations for heart failure., advancing age is more frequently associated with other cardiovascular diseases (e.g., with heart failure, arrhythmia, and/or valvular heart disease), and also more frequently associated with non - cardiac diseases, patterns that tend to complicate management and worsen outcomes. older chd patients are also more likely to be taking multiple medications, to be hampered by physical limitations (cognitive and functional) and to be coping with many additional health dynamics (e.g., chronic pain, poor sleep) that compound cardiovascular risks and pose management challenges. given the high age - related prevalence of chd and age - related compounding factors, the recently updated american heart association / american college of cardiology foundation (accf / aha) chd - related guidelines included increased focus on older patients. these guidelines are predominately evidence - based (using data from quality randomized clinical trials) and are organized to delineate medications and procedures that best treat particular cardiovascular diseases. while such rationale and thought work well in young and middle aged adults, they become problematic in patients who are very old. data pertaining to adults aged 80 are virtually absent from most randomized clinical trials, and even in the instances when very old patients were included, eligibility criteria typically excluded candidates with comorbidities and complexities of customary chd patients. therefore, a medication judged to be effective according to guidelines criteria may produce unanticipated harm in very old age, particularly for patients with multimorbidity, polypharmacy, and other typical age - related health complexities. geriatric cardiology the inclusion of geriatric cardiology perspectives to the guidelines corroborates the growing awareness that aging broadly impacts management decisions and outcomes. cardiovascular disease is both more common and more perilous as a function of advanced age. while medications and interventions yielding benefit in clinical trials should theoretically produce the greatest benefits for patients with high intrinsic risk, age - related cardiovascular complexities also increase iatrogenic risks. navigating between the potential for high benefit and high risk in evidence - based the 2012 guideline for the diagnosis and management of patients with stable ischemic heart disease defines older adults as those > 75 years of age, and includes a small section focused specifically on their care. the text acknowledges that older patients are more likely to have diffuse and severe disease coronary atherosclerosis with a higher prevalence of three - vessel and left main coronary artery disease. the guideline recognizes that common co - existing conditions makes diagnosis more difficult, including the limited capacity of older adults to exercise and their high prevalence of baseline electrocardiographic changes that render exercise test data less reliable. the utility of the duke treadmill score as a prognostic index is similarly limited, both because of physical limitations of most old adults and also due to their higher prevalence of stable ischemic heart disease that diminishes the utility of a function - based test to stratify risk. the guidelines cite a number of studies showing the less frequent use of evidence - based therapies in older adults including early invasive procedures, anti - coagulants, beta blockers, and glycoprotein iib / iiia antagonists, likely related to challenges of pharmacotherapy stemming from polypharmacy (and drug interactions) as well as age - related differences in drug bioavailability and elimination. given these concerns, a conservative approach to coronary angiography is generally advised, especially given higher age - related risks of contrast - induced nephropathy and increased morbidity and mortality risks associated with coronary artery bypass graft surgery. randomized controlled trial data comparing guideline - based medical therapy with myocardial revascularization in older patients are also reviewed. whereas revascularized patients showed greater improvements in symptoms in the early months, improvements were comparable in symptoms and other quality - of - life measures in both groups over the long term, providing additional rationale for non - invasive management. there is considerable evidence that elderly patients have higher mortality rates following percutaneous coronary intervention (pci) and coronary artery bypass graft surgery than do younger patients, but the available data are highly variable. thus, the guideline recommendation for patients with stable ischemic heart disease includes initial management that essentially overlaps with guideline - based medical therapy for older adult patients of any age. however, given the concerns about higher mortality rates associated with revascularization, particularly in patients older than 75 to 80 years, revascularization is recommended only after careful consideration of patient preferences and desired outcomes, functional capacity, quality - of - life and end - of - life issues, as well as therapeutic alternatives. the 2012 accf / aha focused update incorporated into the accf / aha 2007 guidelines for the management of patients with unstable angina / non - st - elevation myocardial infarction includes a section that addresses older adults as a distinct management process. five class i recommendations are provided : (1) older patients with unstable angina / non st - segment elevation myocardial infarction (ua / nstemi) should be evaluated for appropriate acute and long - term therapeutic interventions in a similar manner as younger patients with ua / nstemi, (level of evidence : a) ; (2) decisions on management of older patients with ua / nstemi should not be based solely on chronologic age but should be patient - centered, with consideration given to general health, functional and cognitive status, comorbidities, life expectancy, and patient preferences and goals, (level of evidence : b) ; (3) attention should be given to appropriate dosing (i.e., adjusted by weight and estimated creatinine clearance) of pharmacological agents in older patients with ua / nstemi, because they often have altered pharmacokinetics (due to reduced muscle mass, renal and/or hepatic dysfunction, and reduced volume of distribution) and pharmacodynamics (increased risks of hypotension and bleeding), (level of evidence : b) ; (4) older ua / nstemi patients face increased early procedural risks with revascularization relative to younger patients, yet the overall benefits from invasive strategies are equal to or perhaps greater in older adults and are recommended, (level of evidence : b) ; and (5) consideration should be given to patient and family preferences, quality - of - life issues, end - of - life preferences, and socio - cultural differences in older patients with ua / nstemi, level of evidence : c. overall, the recently updated ua / nstemi guidelines acknowledge the complexity of older chd patients, but assert that evidence - based standards for younger adults are often still effective. however, they also emphasize that management of older chd patients must incorporate age - related issues into cardiovascular management choices : i.e., medical and cognitive status, bleeding risk and other risk of interventions, anticipated life expectancy, and patient or family preferences. the 2013 accf / aha guideline for the management of stemi is a revision of the 2009 focused stemi updates. the older population is noted to present special challenges for diagnosis and management, including delays in or lack of reperfusion, increased risk of antithrombotic therapy, and presence of comorbidity and renal impairment which require dosing adjustment. although the clinical trials frequently have a limited enrollment of older populations, treatments that are effective in younger patients are usually indicated in the older adults, with the caveat that older adults more often have absolute or relative contraindications to their use. the guidelines recommend appropriate boundaries of care within the context of individual co - morbidities, frailty, and advanced - care directives. some medications are specifically mentioned as not recommended due to excessive iatrogenic risks, i.e., prasugrel for pci treated patients, 300 mg loading dose of clopidogrel in fibrinolytic - treated patients. in the crusade quality improvement initiative (20042006) 7% of eligible stemi patients did not receive reperfusion therapy, with the factor most strongly associated with lack of providing reperfusion in these patients being increasing age. nonetheless, even very elderly patients have reasonable post - infarction outcomes when treated aggressively with reperfusion therapy, although individual circumstances vary. both the gwtg quality improvement program and a reperfusion acute myocardial infarction initiative in north carolina demonstrated that programs designed to systematize care across integrated regional centers can lessen disparities and improve the care of elderly patients with stemi. currently, longer delays to emergency medical activation are common among older adults, often due to atypical, symptoms and/or lack of symptom recognition. the 2011 guideline for pci acknowledges that older adults constitute a growing proportion of patients considered for pci. in one series examining trends over 25 years, the proportion of patients undergoing pci who were 7584 years of age doubled and those older than age 85 years increased fivefold. older age is a strong predictor of mortality following pci and older adults present with a substantially higher clinical risk profile. nonetheless, the guidelines stress that angiographic success rates and clinical benefits of pci in older adults are similar to those in younger patients ; thus, the higher absolute benefit associated with older age compensates for the higher absolute risk of adverse outcomes. nonetheless the increased risks of complications such as major bleeding and stroke mandate careful consideration of the benefits and risks of pci for individual elderly patients. the 2011 guideline for coronary artery bypass graft surgery defines the term elderly as 80 years of age. as in prior coronary disease subsets, older adults, compared with younger subjects, are more likely to have severe coronary artery disease (left main or multi - vessel disease), left ventricular systolic dysfunction, concomitant valvular disease, and to previously have had a sternotomy. frequent co - morbid conditions include diabetes mellitus, hypertension, chronic obstructive pulmonary disease, peripheral arterial disease and azotemia. consequently, elderly patients have a higher perioperative risk of morbidity and mortality than younger patients. operative mortality among elderly patients ranges from 2.6% at ages older than 75 to 11% at ages older than 80 years, undergoing urgent surgery. in several retrospective studies, a substantially higher in - hospital mortality rate is reported among octogenarians than among younger patients. in the national cardiovascular network, which included 4,743 octogenarian patients, the in - hospital mortality rate for octogenarians was 8.1% compared with 3% for the remaining population. retrospective studies also showed that octogenarians have a higher incidence of neurological complications, renal failure, respiratory failure and gastrointestinal complications than younger patients.,, consistently, octogenarians have longer lengths of stay, long durations of intensive care, and are less likely to be discharged home. in the new york state registry, the length of stay was 8.5 days for patients younger than age 50 years compared with 14.1 days for those 80, with discharge - to - home rates of 96% and 52% respectively. despite their higher rates of in - hospital morbidity and mortality, the majority of octogenarians achieve functional improvement following coronary artery bypass graft surgery. two studies of patients > 80 years of age demonstrated improvements in quality of life., in one study, angina relief and quality - of - life improvement scores did not differ between patients older and younger than 75 years of age. of 136 octogenarians following coronary artery bypass grafting surgery, 81% felt that they were left with little or no disability in their daily activities and 93% reported substantial symptomatic improvement at an average of 2 years postoperatively. chd guidelines have evolved in their specific inclusion of age - based dimensions of care, many unresolved relevant elements of care remain. even the precise definition of age remains ambiguous, with variance between the different guidelines in the number of years considered as old age and/or components of health correlated to years of life that impact on management decisions. likewise, age is usually mentioned as a set point, rather than as a continuum that can fluctuate in relation to accumulating years as well as in relation to variations in aggregate health and social dynamics. clinical trial endpoints constituting the basis of most guidelines recommendations are also rarely aligned to an aging perspective. whereas most trials underlying chd guidelines assess mortality endpoints, older adults may not view length of life as their greatest concern. health goals for many chd patients with chronic illness include independence in daily living ; improved functional capacity, particularly the ability to ambulate ; decreased hospitalizations and symptoms, i.e., prolongation of symptom - free life. therefore it remains ironic that the concepts of patient - centered care or patient preferences which are appropriately emphasized as a key component of management choices can rarely be informed with relevant data. the guidelines often extrapolate from the standards emphasized for younger adults with some recommendations for precaution (e.g., renal and weight - dose adjustments). however, standard recommendations for younger populations often produce untoward effects that remain relatively poorly demarked. for example, beta blockers may limit chronotropy and exercise performance and potentially increase the need for pacemaker implantation. nitrate drugs, despite symptom relief, may be associated with an increase in fall risk and syncope. other interventions effective in younger patients may adversely affect older adults ; for example, despite the benefits of drug - eluting stents and intensive anti - platelet therapy for younger adults, they substantially increase the bleeding risk at elderly age. this is particularly complicated for older adults prone to atrial fibrillation and thromboembolic disease for which anti - thrombin therapy may be indicated, further exacerbating bleeding risk. perhaps under - emphasized in all guidelines is the necessity for patient education designed to foster adherence to medications, diet, physical activity and other health - promoting behaviors. it remains ironic that trials often do not collect data most pertinent to older patients ' concerns, but it is likely that if patients understood which medications best achieved independence, function, and high quality of life, it would reinforce compliance. cardiac rehabilitation services also merit added emphasis as a component of chd care that is particularly likely to benefit the many older chd patients. paradoxically, cardiac rehabilitation is substantially under - utilized among older adults with chd despite strong evidence that facility and/or home - based cardiac rehabilitation programs lessen morbidity and mortality, improve quality of life and functional capacity, and decrease readmissions and healthcare costs in frail to robust older adults. as the guidelines are serially updated, it is likely the focus and sophistication in relation to age will grow. tiered management, stratified to better account for a continuum of comorbidity, frailty, medications, and other components of health will likely evolve, adapting standards of evidence - based care to older adults. specific medication and procedural strategies to improve chd management in relation to age will also likely evolve, targeting goals to mitigate bleeding and other iatrogenic risks without forgoing therapeutic benefits. diagnostic sensitivity and specificity will also likely improve, potentially linking functional and/or serological indices to imaging to better predict which older chd patients may benefit from therapy despite higher age - related therapeutic risks. the consistent inclusion of age as a relevant dimension of care appears an important first step toward improved management of the burgeoning population of senior adults who are intrinsically prone to cardiovascular disease. a patient - centered approach, i.e., management personalized to each patient 's situation, is pivotal in the diagnostic and therapeutic considerations of coronary heart disease in older adults. a systematic approach is requisite to incorporate age - related complexities into clinical decision - making. cardiovascular risks must be assessed in the context of aggregated age - related risks, determining realistic goals that incorporate each patient 's overall health circumstances to determine the risks and the benefits of specific options of care. these include cardiac and non - cardiac co - morbidities, functional capacity (physical and cognitive), pain, and quality of life factors, all highly relevant in selecting patients most likely to benefit from different therapeutic choices. patient - centered treatment goals must also address quality of life, function, independence, and avoidance of adverse events. more data are needed from a broad range of older adults to better determine specific thresholds for medical and invasive interventions, development of strategies to minimize adverse events, and the incorporation of complex co - morbidities into risk / benefit ratios.
|
biological aging predisposes older adults to increased cardiovascular disease (chd) and greater disease complexity. given the high age - related prevalence of chd and age - related compounding factors, the recently updated american heart association / american college of cardiology foundation chd - related guidelines increased their focus on older patients. these guidelines are predominately evidence - based (using data from quality randomized clinical trials) and are organized to delineate medications and procedures that best treat particular cardiovascular diseases. while such rationale and thought work well in young and middle aged adults, they become problematic in patients who are very old. data pertaining to adults aged 80 are virtually absent from most randomized clinical trials, and even in the instances when very old patients were included, eligibility criteria typically excluded candidates with co - morbidities and complexities of customary chd patients. while medications and interventions yielding benefit in clinical trials should theoretically produce the greatest benefits for patients with high intrinsic risk, age - related cardiovascular complexities also increase iatrogenic risks. navigating between the potential for high benefit and high risk in evidence - based cardiovascular management remains a key geriatric cardiology challenge. in this review we consider the expanded geriatric cardiology content of current guidelines, acknowledging both the progress that has been made, as well as the work that still needs to be accomplished to truly address the patient - centered priorities of older chd patients.
|
atmospheric aerosol particles influence global climate directly by scattering and absorbing solar radiation and indirectly by acting as cloud condensation nuclei. atmospheric aerosols are complex mixtures of organic and inorganic molecules. during atmospheric aging the evolution of size and composition of primary particles, i.e. particles that enter the atmosphere in the condensed phase, is influenced by condensation and evaporation of vapors. for secondary particles, i.e. particles formed in the atmosphere through gas - to - particle transitions, condensational growth is a crucial step on their way to become climatically relevant, and organic vapors play a significant role in this growth. to quantify the climate and air quality effects of aerosols dicarboxylic acids are a group of water - soluble organic compounds often found in atmospheric aerosol particles. they can be classified as semi- to low - volatile, although the values reported for their saturation vapor pressures vary considerably depending on the measurement techniques. while there are uncertainties related to the pure - component saturation vapor pressures of organic compounds, even less experimental data is available about their interactions with inorganic aerosol constituents. the equilibrium vapor pressures of individual compounds over a mixed particle surface are affected by the particle composition. this effect is described by the activity, i.e. the product of the activity coefficient and the molar fraction of the given compound in the particle. for aqueous solutions of single organic compounds directly measurement - based activity models and models based on group contribution methods, like unifac, are available. activity models are often developed based on water equilibrium, rather than the equilibrium of the organic solute largely due to the fact that experimental data on organic activities are extremely scarce. also activity models for mixtures of inorganic and organic solutes have been tested with measured values of water activity yielding information on the mixture effects on equilibrium vapor pressures of water but not directly on the activity and volatility of the organic compounds. to our knowledge, the effect of inorganic salts on the evaporation, specifically the equilibrium vapor pressures, of dicarboxylic acids over aqueous solution droplets has so far been investigated in only two experimental studies. in both of these studies used a tandem differential mobility analyzer (tdma) system for submicrometer aqueous solution droplets containing succinic acid (hooc(ch2)2cooh) and nacl and found that the experimentally determined evaporation rate of the particles was lower than theoretically expected if nacl did not directly affect the equilibrium vapor pressure of succinic acid. they concluded that the presence of nacl in the droplets possibly lowers the activity coefficient of succinic acid but identified several possible uncertainties related to this conclusion and highlighted the need for direct observations of the aerosol composition. studied micrometer - sized aqueous solution droplets containing malonic (hooc(ch2)cooh) or glutaric acid (hooc(ch2)3cooh) and nacl using two techniques, electrodynamic balance and optical tweezers. they did not find a clear effect of nacl on the activity coefficient of the two dicarboxylic acids within experimental uncertainty. as the studies on the effect of inorganic compounds on the equilibrium vapor pressures of organic compounds are scarce and somewhat inconclusive, further investigations on this topic are warranted. in this work we study, for the first time, the effect of ammonium sulfate (as) on the equilibrium vapor pressure of succinic acid (sa) over aqueous solution droplets by investigating the evaporation rate and chemical composition of these droplets. we use a tdma setup similar to zardini. and koponen. but improve the setup by coupling it to direct online measurement of the droplet composition during evaporation with an aerosol mass spectrometer (ams). we complement these studies with offline analysis of aqueous solutions using ultra high performance liquid chromatography coupled to a quadrupole time - of - flight mass spectrometer through an electrospray ionization inlet (uhplc - esi - qtof - ms). by comparing these experimental data to predictions by an evaporation model we study the effect of as on sa volatility in submicrometer aqueous solution droplets. we also discuss potential uncertainties related to the interpretation of the flow tube experiments, along with the influence of gas phase composition and particle phase chemistry on the evaporation. the evaporation of aqueous solution droplets was measured at the university of copenhagen with a modified tandem differential mobility analyzer (tdma) setup including a laminar flow tube. in total 22 evaporation experiments were done, and in six of them the chemical composition of the droplets during evaporation was measured with an aerosol mass spectrometer (ams, table s1). liquid droplets containing water, sa, and as were studied (table 1). experiments with binary droplets containing water and sa were also performed to determine the subcooled liquid saturation vapor pressure of pure sa (psat, sa) under the same conditions as for the ternary droplets. the tdma setup has been described previously, and only a brief summary is presented here. the liquid particles were generated with an atomizer from aqueous solutions (total solute concentrations of approximately 120 mg l in experiments without ams, and 400500 mg l in experiments with the ams). double deionized water purified using a milli - q plus ultrapure water system was used. a nearly monodisperse droplet population (geometric standard deviation of log - normal distribution 1000 cm (> 1 g m) it depends drastically on aerosol loadings, the effect increasing with increasing forg. the limiting concentration for gas - phase saturation decreases with decreasing equilibrium vapor pressure of the evaporating compound (figure s2). the assumption of psa, = 0 gave consistent model results for experiments 1721 compared to experiments 112, which supports the picture of the droplets being concentrated in the center of the tube and part of the sa vapor diffusing toward the walls of the tube, thus diluting the gas phase. predicted particle size evolution for initial forg (forg,0) of 0.5 (blue line, blue area, and red dashed line) and 0.9 (black line, magenta area, and gray dashed line) with different particle number concentrations. colored areas present model prediction with n = 10010000 cm, solid lines with n = 1000 cm and dashed line with assumption of p,sa = 0, in which case the evaporation is insensitive to n. we investigated the role of particle phase impurities or chemistry by introducing 520% nonvolatile material to the modeled particles initially (see figure 3 and figure s3). while already 5% nonvolatile material in the initial particle dry mass affects the evaporation rate, it should have accounted for 20% or more of the initial particle dry mass to fully explain the difference in the final droplet size (figures 3 and s3), if sa molar mass was assumed for the nonvolatile material with lower molar mass the effect increases. nonvolatile material whose concentration depends on the initial forg could thus explain the discrepancy between measured and modeled particle evaporation and potentially the difference between the tdma and ams. in principle a reaction product of sa and as could represent such a material, but no such compounds could be clearly identified from the ams spectra. no evidence of such products, specifically organosulfates or organic oligomers, was visible in the uhplc - esi - qtof - ms analysis run for the bulk solutions either (see the si) although further studies are needed to confirm this conclusion to hold also for our supersaturated droplets. from the modeling perspective the impurity could also refer to the dissociated fraction of sa which was predicted to increase with decreasing forg. however, in all cases less than 5% of sa was predicted to dissociate, and the dissociated sa would be detected as sa with the ams. above the mobility equivalent diameter measured with smps was compared to the volume equivalent diameter from the model. in principle, nonspherical shape could lead to mobility diameter being larger than the volume equivalent diameter. nonsphericity of the particles would, however, be somewhat unexpected as the experiments were conducted above the crhs of both as and sa. as a summary, the dynamic evaporation model coupled with the e - aim thermodynamics captures the evaporation of sa from aqueous solutions containing as well if the relative abundance of sa is larger than or equal to as. the model and the observations start to deviate at lower organic to inorganic ratios : the model predicts larger decrease in particle size than observed with tdma. these results suggest that the presence of as in the particles enhances the partitioning of sa to aqueous particles more than expected based on current knowledge. this enhancement could be through lowering the activity coefficient of sa in the solution or through other interactions between as and sa in the aqueous phase, naturally having implications for predictions of the gas - aerosol partitioning of atmospheric organic compounds. for particles with high organic fraction however, at inorganic dominated regions the partitioning of organic compounds to particulate phase can be enhanced by these interactions with the inorganic constituents. direct composition data collected using the ams confirmed the assumptions about the initial composition of the droplets, but neither ams nor uhplc - esi - qtof - ms results yield a conclusive chemical explanation to the suppressed evaporation observed with the tdma. the results show a strong sensitivity of evaporation rate predictions to accurate description of the particle and gas phase composition particularly at high aerosol loadings (larger than about 1 g m for compounds with psat < 10 pa).
|
condensation and evaporation modify the properties and effects of atmospheric aerosol particles. we studied the evaporation of aqueous succinic acid and succinic acid / ammonium sulfate droplets to obtain insights on the effect of ammonium sulfate on the gas / particle partitioning of atmospheric organic acids. droplet evaporation in a laminar flow tube was measured in a tandem differential mobility analyzer setup. a wide range of droplet compositions was investigated, and for some of the experiments the composition was tracked using an aerosol mass spectrometer. the measured evaporation was compared to model predictions where the ammonium sulfate was assumed not to directly affect succinic acid evaporation. the model captured the evaporation rates for droplets with large organic content but overestimated the droplet size change when the molar concentration of succinic acid was similar to or lower than that of ammonium sulfate, suggesting that ammonium sulfate enhances the partitioning of dicarboxylic acids to aqueous particles more than currently expected from simple mixture thermodynamics. if extrapolated to the real atmosphere, these results imply enhanced partitioning of secondary organic compounds to particulate phase in environments dominated by inorganic aerosol.
|
neurocysticercosis (ncc) is a neurologic infection caused by the larval stage of the tapeworm taenia solium. in the developing world, ncc, infection of the central nervous system (cns) with the t. solium larvae, is the most common cause of acquired epilepsy [13 ]. because of globalization, many clinicians in industrialized countries who are unfamiliar with ncc are now faced with managing this disease. humans are the definitive hosts for this parasite, and swine are the intermediate hosts. the adult tapeworm develops in human hosts after they ingest live cysticercus in undercook pork. this occurs when feces of human carriers contaminates food, although the most important risk factor for the acquisition of cysticercosis is the proximity of a tapeworm carrier [4, 5 ]. once the hexacanth embryo reaches the parenchyma it forms cysticerci which undergo four stages of involution. the first is the vesicular stage characterized by a cyst with a translucent vesicular wall, transparent fluid, and a viable invaginated scolex. during this stage the cyst then develops a thick vesicular wall, the fluid becomes turbid, and the scolex degenerates during the next stage, which is termed the colloidal stage. an intense inflammatory host response is seen and is reflected in the pathology which reveals varying degrees of acute and chronic inflammation [1, 6 ]. the cyst continues to degenerate as it moves into the granular stage which is characterized by a thick vesicular wall, degenerated scolex, gliosis, and little inflammatory host response. ultimately the parasite transforms into coarse calcified nodules ; the calcific stage [1, 2, 6 ]. the clinical manifestations of ncc range from asymptomatic to life threatening. within the cns it can affect the parenchyma, subarachnoid space, or intraventricular system. ocular and spinal disease occurs, but is less common. therefore, the clinical manifestations are pleomorphic and dependant on the location, number, and stage of the cysts at presentation. ncc is the leading cause of adult - onset epilepsy in areas of the world where it is endemic, particularly in latin america, asia, and africa. epilepsy occurs more frequent in patients with parenchymal disease, although it can occur in patients with cysts in the cortical sulci. seizures due to cysticercosis usually occur when the dying cyst incites an inflammatory reaction, but has been reported in the cystic stage. for many patients epilepsy may be the sole presentation of the disease with 50%70% of patients experiencing recurrent seizures [8, 9 ]. as noted, seizures can occur early in the disease in the setting of intense inflammation associated with viable or degenerating cysts. they can also occur secondary to vasculitis and infarction which occurs in the setting of subarachnoid disease. lastly, increasing evidence implicates calcified ncc in the development and maintenance of seizures and epilepsy. patients who present with seizures in regions where infection with t. solium is endemic commonly have calcified brain lesions observed on computerized axial tomography (ct) scan that are typical for ncc. in population - based studies calcified lesions on ct are much more common than viable cysts, and they are more prevalent in patients with epilepsy than they are in asymptomatic patients [1113 ]. strong evidence supports the role of calcified lesions in seizures ; there is a high prevalence of cerebral calcifications in patients with seizures in the absence of other etiologies, and there is a positive correlation between endemic populations with increased proportions of calcification and seizure activity. in addition, individuals with calcified granulomas have increased risk of ongoing seizure [1417 ]. there has been increasing evidence that perilesional edema, which occurs episodically, is associated with seizures [14, 15, 1820 ]. perilesional edema appears as a bright signal using magnetic resonance imaging (mri) flair or t2 imaging (figure 1). previously calcified ncc has been classified as the inactive form of the disease, suggesting that it is less important than other forms of ncc. recently a growing literature is finding that perilesional edema related to calcifications seems to be a relatively frequent phenomenon, with reports ranging from 23%35% in literature [8, 14, 22 ]. the natural history or pathophysiology of perilesional edema is not yet known, but it appears that it recurs, and repeated episodes tend to be associated with the same lesions in a patient. in a recent prospective nested case - control study, 110 patients with seizures or headaches and calcified lesions in an endemic region were followed for recurrent seizures. of those with recurrent seizures, perilesional edema was noted on mri in 50% as opposed to 9% of asymptomatic matched controls. this study suggests that perilesional edema is a common and potentially preventable cause of seizure in endemic regions. although, seizures are the most common clinical manifestation of parenchymal ncc, focal neurologic signs have been reported and are usually related to the number, size, and location of the parasites in individuals with parenchymal disease. intracranial hypertension can occur in patients with parenchymal ncc and is termed cysticercotic encephalitis [1, 24, 25 ]. this manifestation has been best described in children and young woman and is a result of the acute inflammatory response to massive cysticercal infection resulting in brain edema. patients present with a syndrome characterized by clouding of consciousness, seizures, decreased visual acuity, headache, vomiting, and papilledema which can be subacute or acute in onset [1, 22 ]. these patients are treated with mannitol and corticosteroids in an attempt to control the inflammation and intracranial hypertension. those individuals with this form of ncc would not be candidates for antiparasitic agents, since treatment could exacerbate the inflammation and edema. other causes of intracranial hypertension in patients with parenchymal ncc include the development of a large cyst that displaces midline structures or obstructs the flow of cerebrospinal fluid (csf) in the cerebral aqueduct. psychiatric manifestations of ncc, such as depression and psychosis, have been described [26, 27 ]. a recent study found that patients admitted to a chronic inpatient psychiatric unit were more likely to have a positive serology for t. solium then healthy controls in the community. of these inpatients, those with mental retardation were found to carry an increase risk of cysticercosis compared with patients with other psychiatric disorders. these patients were not carrying adult taenia spp. in their stool and did not have cns imaging, but the high prevalence of a positive cysticercosis serology in the inpatient psychiatric group suggests that there is a large proportion of cysticercosis in this group of patients. subarachnoid ncc is a common finding at autopsy, but when cysticerci find their way to the sylvian fissure or the basilar cisterns the result can be devastating for the patient. the cysticercus larva (after embedding itself in the parenchyma) undergoes four stages of evolution : vesicular, vesicular colloid, granular nodular, and nodular calcified. racemose ncc refers to aberrant proliferating cestode larvae that manifest as solitary or multiple unencapsulated bladders that bud exogenously to form a multilocular cyst resembling a bunch of grapes. the multiple cysts of the racemose type occur in nonconfining areas in and around the brain such as the suprasellar, sylvian and quadrigeminal cisterns. these cysts are nonviable, degenerated interconnected bladders of different sizes that often lack scolices, and can reach large sizes producing local mass effect. arachnoiditis can occur with resulting communicating hydrocephalus secondary to either chronic inflammation or fibrosis of the arachnoid villi causing obstruction to the reabsorption of csf or extension of the subarachnoid inflammatory reaction to the meninges at the base of the brain occluding the forminal of luschka and magendie [1, 30 ]. cysticercotic arachnoiditis can lead to entrapment of cranial nerves in the inflammatory exudates that occur on the ventral aspect of the brain. extraocular muscle paralysis, diploplia and papillary abnormalities are the result of entrapment of the ocular motor nerves. the optic nerves and the optic chiasm can also be encased within the exudates with subsequent development of decreased visual acuity and visual field defects [31, 32 ]. acute aseptic meningitis associated with subarachnoid disease has been reported, but is rarely associated with fever and signs of meningeal irritation. cerebrovascular complications of neurocysticercosis include cerebral infarction, transient ischemic attacks and brain hemorrhage [10, 33, 34 ]. the most common mechanisms by which ncc produces cerebrovascular disease are related to cerebral arteritis, mainly in those individuals with subarachnoid cysticercosis. earlier clinical reports of cerebral infarction were secondary to small vessel involvement in ncc. in a recent study that examined 28 patients with subarachnoid disease 53% had angiographic evidence of cerebral arteritis with the middle cerebral and posterior cerebral arteries being the most commonly involved vessels associated with clinical stroke syndrome. the frequency of cerebral arteritis in subarachnoid cysticercosis seems to be higher than previously reported, and middle - size vessel involvement is a common finding. clinical manifestations of ventricular ncc vary according to the size of the parasites, their location inside the ventricular system, and the coexistence of granular ependymitis [1, 36 ]. lateral ventricles usually induce a syndrome of increased intracranial pressure which may be associated with focal neurological signs due to compression of adjacent structures [37, 38 ]. patients with third ventricle cysticerci complain of progressively worsening headaches and vomiting due to developing obstruction or may present with sudden loss of conscious from acute hydrocephalus [39, 40 ]. paroxysmal headache and vomiting secondary to intermittent obstruction at the level of the cerebral aqueduct has been described. cysts in the fourth ventricle can also cause subacute hydrocephalus that may be associated with signs of brainstem dysfunction secondary to compression of the fourth ventricle. a well - described clinical presentation of fourth ventricle cyst is the bruns ' syndrome which is characterized by episodic headache, papilledema, neck stiffness, sudden positional vertigo induced by rotatory movements of the head, nausea and vomiting, drop attacks and loss of consciousness with rapid recovery and long asymptomatic periods. cysts in the third and fourth are a well - described cause of sudden death due acute obstructive hydrocephalus [4143 ]. a degenerating cyst in the ventricles can result in an inflammatory reaction throughout the ventricular system leading to granular ependymitis. when this occurs the cyst capsule can become fixed to the ventricular wall with strong adhesions and fibrosis. increased intracranial pressure due to hydrocephalus can occur if ependymitis occurs at the level of the cerebral aqueduct. these patients tend to have a more chronic course than those with cysts in the fourth ventricle. spinal cord involvement in ncc is rare, accounting for 1%5% of all cases [1, 45 ]. spinal cord involvement can be intramedullary or extramedullary with the latter being more common. intramedullary cysts are most common in the thoracic spine and patients usually present with gradual onset of myelopathy similar to the presentation of intramedullary tumors [4652 ]. extramedullary cysts or leptomeningeal ncc is usually an extension of subarachnoid disease which has migrated from the basilar cisterns. cysts may be single or may form clumps of multiple cysts extending along the entire spinal canal [46, 47 ]. the resulting clinical picture is characterized by a combination of radicular pain and motor deficits of subacute onset and progressive course. intraocular cysticerci may be located in the anterior chamber, the lens, the vitreous and the subretinal space, but the latter is the most common location. vitreous cysts can produce worsening vision with the perception of something moving within the eye. cysts in the anterior chamber may induce a severe iridocyclitis, while retro - ocular intraorbital cysticerci may cause decreased visual acuity due to pressure on the optic nerve [1, 53, 54 ]. neuroimaging of parenchymal ncc depends on the stage of the development of the parasites. in the vesicular stage ct and mri reveal that the cyst wall is thin and well demarcated from the parenchyma. there may be a bright nodule in their interior giving the lesion a hole with dot appearance that represents the scolex (figure 2(a)). as the cysts begin to degenerate they appear as ill - defined lesions surrounded by edema which enhance after contrast medium administration. this is the colloidal stage of the cyst and represents the so - called acute encephalitic phase of ncc which likely represents an intense host reaction to the parasite (figure 2(b)). the perilesional edema is best visualized on mri with the fluid - attenuated inversion recovery (flair) technique. granular cysticerci appear as nodular hyperdense lesions surrounded by edema or a rim of gliosis after contrast medium administration (figure 2(c)). calcified (dead) cysticerci appear on ct as small hyperdense nodules without perilesional edema (figure 2(d)) or abnormal enhancement after contrast administration ; these lesions are usually not visualized by mri. conversely, when calcified lesions are associated with perilesional edema and contrast enhancement, they are better seen by mri [7, 55 ]. cysticerci within the basilar cisterns are usually missed by ct scan and require mri to adequately visualize them. while most subarachnoid cysts over the convexity of the cerebral hemispheres are small, lesions located in the sylvian fissure may reach 50 mm or more in size ; these parasites usually have a mulitlobulated appearance, displace neighboring structures, and behave as mass occupying lesions. fibrous arachnoiditis commonly occurs in subarachnoid disease resulting in hydrocephalus which is the most common ct finding in subarachnoid ncc [7, 46 ]. leptomeningeal enhancement at the base of the brain is observed best by mri. in general, the neuroimaging appearance of cerebrovascular complications is indistinguishable from cerebral infarcts from other causes.. however, their presence can be inferred from distortions of the ventricular system causing asymmetric or obstructive hydrocephalus. in contrast, most ventricular cysts are well visualized by mri because their signal properties differ from those of the csf, particularly using flair techniques. they may also move within the ventricular cavities in response to movements of the patients ' head (ventricular migration sign), a phenomenon that is best observed with mri than with ct. occasionally, this finding facilitates the diagnosis of ventricular cysticercosis. in patients with spinal ncc, ct may reveal symmetrical enlargement of the cord (intramedullary cysts) or pseudoreticular formations within the spinal canal (leptomeningal cysts). mri reveals intramedullary cysticerci to be ring - enhancing lesions that may have an eccentric hyperintense nodule representing the scolex. myelography still has a role in the diagnosis of patients with spinal leptomeningeal cysticercosis because it shows multiple filling defects in the column of contrast material corresponding to each cyst. leptomeningeal cysts may be mobile (changing their position according to the movements of the patient) [7, 59, 60 ]. only tests based on detection of antibodies specific for t. solium antigens are reliable for clinical diagnosis and epidemiologic studies. to date, these are limited to those based on the use of purified glycoprotein antigens derived from t. solium cysticerci. the current assay of choice is the electroimmunotransfer blot (etib) using partially purified antigenic extracts [61, 62 ]. this assay has a specificity approaching 100% and a sensitivity of 94%98% for patients with two or more cystic or enhancing lesions. a major limitation of these tests are frequent false negative results in patients with single intracranial cysticerci, in which fewer than 50% test positive. sensitivity of specific antibody assays is also relatively low in patients with only calcified cysticerci. detection of circulating parasite antigen reflects the presence of live parasites establishes the presence of ongoing viable infection and may permit quantitative verification of successful treatment [6466 ]. garcia and others have used ag - elisa based on the use of a monoclonal antibody (hp10) that reacts with a repetitive carbohydrate epitope found in excretory / secretory and surface antigens of living cysticerci [66, 67 ]. this assay had a sensitivity of 86% when tested on (csf) samples from a series of 50 peruvian patients with ncc. the specificity of the assay is about 96% and it has been used to follow patients after treatment. parasite antigen levels fell significantly by 3 months after treatment in patients with cured this study found that the sensitivity is low in intraparenchymal ncc, especially in patients with only a few intraparenchymal cysts. in a study examining patients with hydrocephalus and ncc the assay was positive in 14 of 29 patients, but negative in patients with calcifications. a drop in antigen levels (serum and csf) after treatment in subarachnoid disease has been reported in a small number of patients. the management of subarachnoid disease is particularly complicated and the appropriate endpoint for treatment has not been established. a monoclonal antibody - based elisa to detect t. solium antigens in urine has been described. the overall sensitivity of urine antigen detection for viable parasites was 92%, which decreased to 62.5% in patients with a single cyst.. this assay could be useful in diagnosis of ncc and evaluating the efficacy of treatment. praziquantel and albendazole are antiparasitic agents that are effective against t. solium cysticerci killing between 60% and 85% of parenchymal brain cysticerci. the majority of studies evaluated praziquantel at a dosage of 50 mg / kg / d for 2 weeks, although studies describing a single day regimen have also been described [8, 7283 ]. higher doses have been used, but there is limited experience in literature [71, 72 ]. a dose of 15 mg / kg of albendazole for four weeks was initially employed, but later reduced to 15 days and then to one week [74, 76, 80, 81, 8388 ]. between the second and fifth day of treatment with an antiparasitic agent there may be an exacerbation of neurologic symptoms which has been attributed to inflammation secondary to killing of the cysticerci. because of this inflammation steroids are generally administered in conjunction with albendazole or praziquantel to control the resulting edema. it should be noted that steroids decrease the plasma level of praziquantel, but not albendazole. randomized studies evaluating the clinical benefit of treatment have yielded conflicting data with some studies indicating a benefit and others failing to show a difference [9094 ]. there has been much controversy whether cysticidal drugs modify the natural course of neurocysticercosis. in 2004 a randomized, placebo - controlled trial of treatment of adults with 20 or less viable parenchymal cysts and a history of seizures using albendazole demonstrated a reduction in seizures and enhanced resolution of cysts after treatment. the number of patients who became free of seizures was similar in the two groups, but the reduction in the number of the seizures among patients who received the treatment was significant in patients with generalized seizures, not in the group with partial seizures. further studies are needed to determine whether longer or repeated courses of therapy will result in a decrease in seizures overall and leave patients with fewer remaining cysticerci. a recent meta - analysis these authors concluded drug therapy results in better resolution of colloidal and vesicular cysticerci, lower risk for recurrence of seizures in patients with colloidal cysticerci, and a reduction in the rate of generalized seizures in patients with vesicular cysticerci. however, there were not sufficient data to determine conclusively the superiority of either albendazole or praziquantel as first - line treatment of ncc in this meta - analysis. despite the numerous studies, an optimal therapeutic regimen for neurocysticercosis has not been established. the evidence favors albendazole over praziquantel, but longer courses and repeated courses might be needed for patients with multiple cysts. future trials should look to define the optimal therapeutic regimen. a recent prospective, randomized placebo, controlled trial examined combination therapy with albendazole and praziquantel versus albendazole alone in 110 children with seizsures and single enhancing lesions larger studies are warranted with combination therapy in both parenchymal disease and extraparenchymal forms of neurocysticercosis. studies examining this group of patients have shown variable clinical results, probably due to the heterogeneity of morphology of single enhancing lesions. the most rigorous double - blinded randomized treatment trial showed an initial increase in seizure occurrence, but in a follow - up evaluation at two years there was a significant benefit of treatment [87, 88 ]. the previously mentioned meta - analysis found that enhancing lesions benefited from treatment with antiparasitics. solid nodular cysts that are degenerating have shown resolution with antiparasitic treatment. calcified cysts need not be treated with antiparasitic agents [4, 71 ]. serum levels of phenytoin and carbamazepine may be lowered when given concomitantly with praziquantel. steroids can control symptoms, but there are no data that treatment with steroids will prevent recurrent edema [4, 14 ]. methotrexate has been used in patients with recurrent perilesional edema to control the host inflammatory response as a steroid sparing agent in patients requiring long - term steroids [99, 100 ]. patients with cysticercotic encephalitis should not be treated with cysticidal drugs because this may exacerbate the intracranial hypertension. treatment should be aimed at relieving edema with corticosteroids (up to 32 mg per day of dexamethasone) and mannitol at doses of 2 mg / kg per day. there are no controlled trials on the management of subarachnoid disease. in a series of patients treated with only csf diversion, 50% died at a median follow - up of 8 years and 11 months. cysticidal drugs with steroids and shunting for hydrocephalus have been used with success in subarachnoid disease [46, 102, 103 ]. the host inflammatory reaction around the cysts may result in occlusion of leptomeningeal vessels resulting in stroke or hydrocephalus [9, 101 ]. therefore, steroids must be used in conjunction with therapy [2, 4, 55 ]. there is no consensus on the dose of antiparasitic agent or length of treatment for this form of ncc. a study of 33 patients with giant cysticerci in the sylvian fissure treated with albendazole (15 mg / kg / d for 4 weeks) found only one single death from aplastic anemia at 59 months, with patients requiring several courses of therapy. therefore, a single course in patients with subarachnoid disease patients is probably inadequate and long - term therapy (months) might be required to treat some patients. methotrexate has been used as a steroid sparing agent in subarachnoid disease in patients requiring long - term steroids and experiencing intolerable side effects. anthelmintic treatment of the fourth, third, and lateral ventricle has been reported [41, 104107 ]. if hydrocephalus is present patients, should have a shunt placed prior to medical therapy. surgery has been the mainstay in this form of ncc [39, 108 ]. there is a growing literature supporting flexible neuroendoscopy to remove approachable subarachnoid cysts and cysts lodged in the lateral, third, and fourth ventricles [109112 ]. it is important to recognize that the management of ncc is complicated and involves antiinflammatory agents, antiparasitic drugs, and in some cases surgery.
|
neurocysticercosis, the infection caused by the larval form of the tapeworm taenia solium, is the most common parasitic disease of the central nervous system and the most common cause of acquired epilepsy worldwide. this has primarily been a disease that remains endemic in low - socioeconomic countries, but because of increased migration neurocysticercosis is being diagnosed more frequently in high - income countries. during the past three decades improved diagnostics, imaging, and treatment have led to more accurate diagnosis and improved prognosis for patients. this article reviews the current literature on neurocysticercosis, including newer diagnostics and treatment developments.
|
drug - eluting stents (des) have become the primary treatment modality for percutaneous coronary intervention owing to the significantly reduced incidence of in - stent restenosis compared to bare metal stents. the early generation des, sirolimus - eluting stent, showed favorable long - term outcomes. however, stent fracture has been an important clinical issue of sirolimus - eluting stent because of its potential association with in - stent restenosis, target lesion revascularization, and stent thrombosis. the everolimus - eluting stent is a new generation drug - eluting stent which is based on a thin - strut, cobalt - chromium alloy platform and releases everolimus, a semisynthetic sirolimus analog, from an acrylic and fluoropolymer mixture. this new des has been designed for improved safety and efficacy compared with sirolimus - eluting stent. based on these enhanced properties, the everolimus - eluting stent has shown promising clinical outcomes in previous clinical trials. however, in this report, we describe a case of 25-year - old male presenting acute myocardial infarction because of multiple stent fractures after everolimus - eluting stents implantation. we obtained written informed consent from the patient for publication of this case report and any accompanying images. a 25-old - year - man with end - stage renal disease secondary to nephrotic syndrome presented with acute chest pain. his initial heart rate was 107 beats / min and blood pressure was 100/60 mm hg. the initial levels of ck - mb and troponin t were 1.50 and 0.08 ng / ml and peaked at 27.30 and 1.47 ng / ml. about 10 months ago, he was admitted for unstable angina and successfully treated by deploying 2 everolimus - eluting stents (xience xpedition 3.5 38 mm and 2.75 38 mm, abbott vascular, santa clara, ca) in the right coronary artery (figure 1a and b). serial coronary angiograms (a) initial coronary angiogram revealed total occlusion at mid to distal right coronary artery. (b) the patient was treated by deploying two overlapping everolimus - eluting stents. (c) about ten months later, the patient presented with inferior st elevation myocardial infarction due to acute thrombotic occlusion at the distal right coronary artery. angiographic result after balloon angioplasty was acceptable. emergency coronary angiography revealed a thrombotic total occlusion at the distal right coronary artery (figure 2a). during the primary percutaneous coronary intervention, a gap was found at the proximal portion of the totally occluded site, which was indicative of a stent fracture (figure 2b and c). we also found multiple stent fractures in other segments in the right coronary artery (figure 2d f). balloon angioplasty for right coronary artery was performed using ikazuchi 1.2 6 mm balloon (kaneka medics, tokyo, japan), maverick 1.5 15 mm balloon (boston scientific, natick, ma), and ryujin 2.0 15 mm and 2.5 15 mm balloons (terumo, tokyo, japan) (figure 1c). (a) the angiogram revealed a thrombotic total occlusion at the distal segment of right coronary artery. (b) fluoroscopic imaging shows multiple fractures (arrows) of the implanted everolimus - eluting stents. (c f) fluoroscopic images obtained using a stent enhancement tool (clearstent, siemens healthcare, forchheim, germany) also demonstrated the multiple stent fractures. the incidence of stent fracture after des implantation has been reported up to 8% in clinical studies. stent fracture after des implantation is an infrequent but potentially serious complication because of its association with higher cardiac event rates. the mechanisms of stent fracture have not yet been completely understood. however, several predisposing risk factors for stent fracture have been suggested. the implantation of longer and overlapping stents at right coronary artery might have contributed to stent fractures. most cases of multiple stent fractures after des implantation were reported in sirolimus - eluting stent implantation. the sirolimus - eluting stent has a relatively thick, rigid, and closed - cell structure with less flexibility and conformability and be more prone to fracture. on the contrary, the everolimus - eluting stent has a thin - strut, open - cell design, and cobalt - chromium platform with high flexibility and conformability, which is expected to have potential advantages over sirolimus - eluting stent. however, in a recent study, stent fracture after everolimus - eluting stent implantation was observed in 2.9% of lesions and was associated with a higher rate of myocardial infarction, target lesion revascularization, and stent thrombosis. furthermore, the present case showed that multiple stent fractures could occur even after new generation everolimus - eluting stent implantation and be associated with unfavorable cardiac events. therefore, physicians should be aware that various contributing factors mentioned above for the occurrence of stent fracture and multiple stent fractures could be possible even after new generation dess implantation. therefore, we should pay special attention to the possibility of multiple stent fractures even after newer generation des implantation.
|
abstractstent fracture is an uncommon complication of drug - eluting stent implantation, but it has a clinical significance because of its potential association with adverse cardiac events such as in - stent restenosis, target lesion revascularization, and stent thrombosis. multiple stent fractures account for a small proportion, but they may lead to more serious complications. newer generation drug - eluting stents are designed for improved safety and efficacy compared with early generation drug - eluting stents. multiple stent fractures after newer generation drug - eluting stent implantation are a rare case.we report a case of 25-year - old male who presented with acute myocardial infarction caused by multiple stent fractures after everolimus - eluting stents implantation and was treated by balloon angioplasty.physicians should be aware of the possibility of multiple stent fractures even after newer generation drug - eluting stent implantation.
|
at least 85% of stroke patients experience hemiplegia and upper - extremity function of at least 69% of patients is damaged1, 2. hemiplegic damage to upper - extremity function has critical effects on the ability to perform independent activities of daily living3. interventions to improve control of the upper extremities and function in stroke patients have been reported to be associated with neural circuit reconstruction4, 5 and subsequent changes in neural networks6. mirror therapy is an intervention aimed at improving the functional movements of the paretic limb7. it uses visual information to encourage patients to concentrate on the movements of their nonparetic limbs8,9,10. visual illusions make the patients feel as if their two hands are moving simultaneously and symmetrically. the visual illusions are activated in the cerebral hemisphere, and this activation functions as the basis of a neurological mechanism for inducing brain plasticity11. studies on the effects of observation or movement association methods have shed light on how perception or recognition is transformed into actual movements through a series of processes12, 13. mirror therapy was first introduced in the treatment of limb - amputated patients with phantom limb pain, and resultant reductions in pain were reported14. mirror therapy conducted on two chronic stroke patients for four weeks led to an increase in upper - extremity function and improvement in movement accuracy and velocity9, 15, 16. mirror therapy applied to subacute stroke patients for four weeks improved their upper - extremity motor recovery and independent activity scores17, as well as their lower - extremity motor recovery and motor function items in the functional independence measure (fim) scale10. in previous studies, the study subjects were patients in stage i through iii according to the brunnstrom recovery scale16. thus, the effects of mirror therapy on each of the various stages of recovery have not yet been analyzed. furthermore, studies on the effects of mirror therapy on programs for upper - extremity function and activities of daily living are scarce9, 17. this study applied mirror therapy to patients with chronic stroke of at least a 6 month duration who were in stage iv according to the brunnstrom recovery scale. furthermore, this study examined the effects of the therapy on upper - extremity function and activities of daily living in these patients. were conducted, the homogeneity of the upper - extremity function of the paretic side and the abilities of the patients in the two groups to perform activities of daily living were assessed. the subject selection criteria were as follows : 1) a diagnosis of hemiplegia due to stroke ; 2) scores of 24 points on the mini - mental state exam - korean (mmse - k), which indicated the patients had no difficulty with cognitive functions ; 3) paretic upper - extremity movements corresponding to brunnstrom s stage iv classification ; 4) no difficulties with perceptual abilities, including hemineglect based on the motor - free visual perception test (mvpt) ; 5) stroke of at least a 6 month duration ; and 6) voluntary consent to participate in the study. fifteen of the patients were assigned to the mirror therapy intervention, while the other 15 were used as the control group. the general subject characteristics of each group are shown in table 1table 1.general characteristics of the subjectsgeneral characteristicsdivisionmirror group (n = 15)control group (n = 15)persons (%) persons (%) sexmales9 (60.0)8 (53.3)females6 (40.0)7 (46.7)age (years)56.2 13.456.4 15.1lesion typehemorrhagic7 (46.7)7 (46.7)ischemic8 (53.3)8 (53.3)paretic sideright5 (33.3)11 (73.3)left10 (66.7)4 (26.7)period after the onset of the condition (months)20.1 6.321.7 12.2mean sd. for assigning the patients to the mirror and control groups, the names were written on cards, and the cards were randomly selected for each group. information regarding gender, age, dates of onset, and lesion sites were obtained through the medical records and the mmse - k. the mirror group participated in the mirror therapy program five times a week for 30 minutes for four weeks, in addition to conventional occupational therapy. the control group was treated with a sham therapy program five times a week for 30 minutes for four weeks, in addition to the conventional occupational therapy. after the interventions, the paretic upper - extremity function, hand coordination abilities, and abilities to perform activities of daily living were re - evaluated with the fma, bbt, and fim. to maintain consistency, these parameters were evaluated by the same occupational therapist before and after the treatment in both groups. the paretic hand of the patient was placed on the back of the mirror, and the nonparetic hand was placed in front of the mirror. when the program began, the patient was instructed to gaze at the nonparetic upper extremity reflected in the mirror. the pronation and supination of the forearm and the flexion and extension movements of the wrist and fingers on the nonparetic side were performed sequentially. five sets of each motion consisting of 30 motions / set were conducted, and a resting time of one minute was given after each set. each motion was explained by the therapist, and the therapist assisted the patient if assistance was necessary. the sham therapy applied to the control group was conducted in the same way as the therapy applied in the mirror group except that the reflected movements of the nonparetic hand could not be observed because of the use of non - reflecting mirrors. independent sample t - tests were performed to compare paretic upper - extremity function and the abilities of the two groups to perform activities of daily living before and after intervention. the paretic upper - extremity function and coordination abilities were significantly different between the two groups (p = 0.000 and p = 0.002, respectively) (table 2table 2.comparison of the fma scores and ability to perform bbt in the mirror and control groupsmirror groupcontrol groupfma score9.60 2.66 4.93 2.81bbt (number of pieces)7.86 1.762.40 5.87fma : fugl - meyer motor function assessment ; bbt : box and block test. comparison of the abilities to perform activities of daily living also revealed statistically significant differences between the two groups (p = 0.008) (table 3table 3.comparison of the differences in the fim scores of the mirror group before and after the intervention with those of the control groupmirror groupcontrol groupfim score8.80 4.12 4.06 4.92fim : functional independence measure. fma : fugl - meyer motor function assessment ; bbt : box and block test. p < 0.05 subitems of the abilities to perform activities of daily living were compared between the two groups. the area of self - care was observed to be significantly different between the two groups (p = 0.001) (table 4table 4.comparison of the scores of the sub - items of the fim of the mirror group with those of the control groupmirror groupcontrol groupself - care5.20 2.21 1.73 2.76sphincter control0.06 0.820.20 0.56transfer1.40 1.451.26 1.86locomotion0.86 1.350.86 1.30communication0.20 0.560.06 0.25social cognition0.46 0.830.13 0.51fim : functional independence measure. the areas of sphincter control, transfer, locomotion, communication, and social cognition did not significantly differ between the two groups (table 4). in this study, mirror therapy showed positive effects on upper - extremity function and activities of daily living in chronic stroke patients. in contrast to previous mirror therapy studies, which were conducted with subacute stroke patients17, this study focused on chronic stroke patients. according to previous work, bilateral motor training is effective in enhancing the activity of the motor cortex and the recovery of motor functions in chronic stroke patients18. consistent with this previous study, the present findings showed the upper - extremity items in fma improved when mirror therapy was applied. differences in upper - extremity function after intervention in the mirror group were compared with those in the control group treated with sham therapy. the mirror group showed significantly greater differences compared to the control group, with improvements in paretic upper - extremity functions (p < 0.05). similar results were reported by yavuzer.,17 indicating that visual illusions that make patients feel as if their two hands are symmetrically moving simultaneously activate both the left and right cerebral hemispheres and increase the excitability of the paretic limb. based on the present result, the mirror group showed a significant improvement in the abilities to perform activities of daily living compared to the control group. the bilateral upper - limb training in mirror therapy using visual feedback improved paretic upper - extremity function, which, in turn, enhanced the performance of activities of daily living. the area of self - care showed statistically significant differences when the subitems of the abilities to perform activities of daily living in the mirror group were compared with those of the control group. improvement in self - care is one of the most important aspects in performing activities of daily living17. that is, if unable to independently perform self - care, the patient can not live independently and must depend on family members or others for assistance. this study confirmed that mirror therapy is effective in improving upper - extremity function and self - care in the performance of activities of daily living. a limitation of this study is that the patients met specific selection criteria ; hence, the findings can not be generalized to all stroke patients. in addition, patients with visual - field defects and hemineglect were excluded from this study. studies with patients with visual - field defects and hemineglect are needed, in addition to long - term follow - up studies to determine whether the interventional effects are sustained. mirror therapy programs tailored to patients with different levels of functioning and brunnstrom s stages should be developed. in addition, studies that use brain images are necessary to examine the effects of mirror therapy on the activation of the brain in stroke patients.
|
the purpose of this study was to examine the effects of mirror therapy on upper - extremity function and activities of daily living in chronic stroke patients. [subjects and methods ] fifteen subjects were each assigned to a mirror therapy group and a sham therapy group. the fugl - meyer motor function assessment and the box and block test were performed to compare paretic upper - extremity function and hand coordination abilities. the functional independence measurement was conducted to compare abilities to perform activities of daily living. [results ] paretic upper - extremity function and hand coordination abilities were significantly different between the mirror therapy and sham therapy groups. intervention in the mirror therapy group was more effective than in the sham therapy group for improving the ability to perform activities of daily living. self - care showed statistically significant differences between the two groups. [conclusion ] mirror therapy is effective in improving paretic upper - extremity function and activities of daily living in chronic stroke patients.
|
episodes of binge eating (be) in humans are characterized by compulsive, nonhomeostatic consumption of an unusually large quantity of highly palatable food (hpf) in a short period of time. even though not hungry, subjects eat more rapidly than normal until feeling uncomfortably full. these episodes are accompanied by subjective sense of loss of control over eating and are associated with feeling of distress, disgust, depression, being guilty about overeating, and eating alone because of embarrassment. be represents a central feature of bulimia nervosa, in which episodes of be are followed by behaviours aimed at avoiding weight gain, such as self - induced vomiting. intense and persistent be episodes represent a typical phenomenon occurring also in subjects suffering from binge eating disorder (bed) that is probably the most prevalent eating disorder. it is characterized by repeated episodes of be in the absence of compensatory behaviours to avoid weight gain. the dms - iv - tr indicates among diagnostic criteria for bed that be episodes should occur at least 2 days per week for six months. it is estimated that be afflicts approximately 5% of the us adult population at some time in their life, and it contributes to aggravate obesity and associated pathologies [3, 810 ]. a large body of evidence suggests that dieting, stress and negative affective states represent possible triggers of be in patients suffering from bed or bulimia nervosa [11, 12 ]. indeed, dieting periods are a common finding in the history of binge eaters, although hunger per se appears to be not enough to induce be in the absence of stress and negative affective states [13, 14 ]. considerable evidence suggests that be may be caused by a unique interaction between dieting and stress ; thus, environmental stress and a history of cyclic food restrictions may be responsible for its precipitation and maintenance [1517 ]. accordingly, recurring food restrictions are consistently the strongest predictor of overeating in response to stress. despite a growing recognition of the consequences of bulimia nervosa and of bed on public health, medications that have been suggested to reduce be in clinical studies, like topiramate [19, 20 ] or sibutramine [21, 22 ] are associated with a variety of adverse side effects, which represent a serious problem during chronic treatment [2325 ] ; in particular, sibutramine has been recently withdrawn from the european market. fluoxetine has been approved by the fda for bulimia nervosa, but evidence for its efficacy is reported inconclusive. apparently, treatment of bed and bulimia nervosa can not simply rely on pharmacological agents aimed at reducing food intake in general, like serotonergic drugs. innovative treatments for bulimia nervosa and bed, devoid of severe side effects, are strongly needed. be episodes appear to be characterized by uncontrollable urge to obtain and consume food, which is similar to that exhibited by addicted individuals towards drug of abuse. evidence is accumulating that excessive intake of certain foods under specified conditions produces behaviours and changes in the brain that resemble an addiction - like state [2731 ]. neural systems that motivate and reinforce drug abuse have been proposed to underlie also behaviours associated with compulsive food seeking and food intake [3236 ]. in this regard, it is interesting to note that several drugs that influence alcohol addiction have been reported to reduce be in experimental models (such as naloxone, naltrexone, and baclofen [38, 39 ] and topiramate) as well as in clinical studies [4143 ]. previous studies have shown that acute administration of hypericum perforatum extract attenuates alcohol intake in genetically selected alcohol - preferring rats by influencing the motivational properties of ethanol [4450 ]. john 's wort, are known to exert antidepressant effects in humans [5155 ] and antidepressant - like actions in laboratory animals in different experimental models [5661 ]. hypericum perforatum contains a variety of biologically active compounds, including the naphthodianthrones hypericin and pseudohypericin, and the phloroglucinol derivatives hyperforin, adhyperforin, and several flavonoids [51, 62, 63 ]. a further reason of interest in the effect of hypericum perforatum on be is raised by the finding that it has been reported to exhibit antistress properties. in this regard, several papers have shown that some of its active principles bind to crf-1 receptors and exhibit antagonist activity at these receptors [6467 ]. moreover, hypericum perforatum extracts have been shown to reduce the hypothalamic - pituitary - adrenal (hpa) axis activation following chronic treatment, to reduce restraint stress - induced increases in plasma acth and corticosterone levels following acute administration, and to counteract the negative effects of corticosterone on hippocampal cell proliferation. since stress is a key determinant of be, a reduction of the response to stress might represent an effective mechanism for suppression of be. therefore, we thought it of interest to evaluate whether hypericum perforatum extracts attenuate be evoked in female rats by combining stress and food restrictions. moreover, the effect of hypericum perforatum on be was also evaluated in combination with salidroside, active principle of the dry extract of rhodiola rosea (family crassulaceae) [71, 72 ]. rhodiola rosea roots contain a variety of biologically active compounds, including organic acids, flavonoids, tannins, and phenolic compounds. phenylpropane and phenylethane phenolic glycosides, such as salidroside, rosavin, syringing, and triandrin are considered the most important active principles. recently our group reported that rhodiola rosea extract and salidroside suppress be, interfering with stress mechanisms. in the present study, it was evaluated whether the combined administration of hypericum perforatum and salidroside might offer advantages over their separate administration. a preclinical model has been recently developed by our group to investigate the neuro- and psychobiology of be and to identify innovative pharmacological treatments. this model is derived with modifications from the original model developed by hagan.. it uses female rats in relation to the higher prevalence of binge - type eating disorders in women than in men [1, 3 ] and combines three 8-day cycles of food restriction / refeeding and acute stress (on the 25th day) to evoke be for hpf in sprague - dawley rats. female sprague - dawley rats (charles river, calco, como, italy) were used. rats were acclimated to individual cages under a 12 h light / dark cycle (lights on at 08:00 a.m.) with ad libitum chow and water for 2 weeks prior to the experiments. they were kept in a room at constant temperature (2022c) and humidity (4555%). rats were kept in individual cages with metallic walls ; the floor and the front wall were made of metallic grid. the dimensions of the cage floor were 30 cm 30 cm ; the cage was 30 cm high. a front door (30 cm 20 cm) made of metallic grid was present in the anterior wall of the cage to get access to the inside of the cage ; the remaining part of the front wall was equipped with a drinking burette. animals were offered standard rat food pellets (4rf18, mucedola, settimo milanese, italy (2.6 kcal / g). the hpf was a paste in texture, prepared by mixing nutella (ferrero, alba, torino, italy) chocolate cream (5.33 kcal / g ; 56%, 31%, and 7% from carbohydrate, fat, and protein, resp.), grounded food pellets (4rf18, mucedola, settimo milanese, italy), and water in the following weight / weight percent ratio : 52% nutella, 33% food pellets, and 15% water. hpf was offered in a coffee cup ; the handle of the cup was inserted into the metallic grid of the anterior wall of the cage and fixed to the wall. standard pellets were offered inside a metallic grid container that was hung on the anterior wall of the cage ; it was removed from the cage to measure its weight in order to determine food pellet intake. for 15 min, the coffee cup containing hpf was placed inside a metallic grid container that was hanged up on the anterior wall of the cage. in these conditions, the animal was able to see the cup in which it received hpf on day 5, 6, 13, and 14 of the first two cycles, was able to see the hpf itself, and to smell its odour. in this 15 min period, the rat engaged in repeated movements of the forepaws, head, and trunk aimed at obtaining the hpf, but it was not able to reach it. this procedure was adopted to generate a mild stressful condition that causes a significant increase in serum corticosterone levels. rats underwent the stressful procedure between 10.00 and 12.00 h. after 15 min, the cup was placed inside the cage of rats of the stress groups, so that hpf became accessible to them. hypericum perforatum dry extract, containing 0.1% hypericin and 3.8% hyperforin, was a generous gift of indena, milano, italy. it was dissolved in 2% ethanol and water and administered by gavage (2 ml / kg) at doses of 125500 mg / kg 1 h before access to hpf. salidroside, an active principle of rhodiola rosea extract, was purchased from chengdu biopurify phytochemicals ltd. it was dissolved in 2% ethanol and water and administered by gavage (2 ml / kg) 1 h before access to hpf at the dose of 312 g / kg. control rats received vehicle administration by gavage (2 ml / kg). in experiment 4, effect of repeated food restrictions and acute stress of hpf intake in female ratsforty female rats were used. they were divided in 4 groups of 10 animals, matched for body weight and daily food intake : (1) the nonrestricted and not exposed to stress group (nr + ns), (2) the restricted and not exposed to stress group (r + ns), (3) the non - restricted and exposed to stress group (nr + s), and (4) the restricted and exposed to stress group (r + s). rats were subjected to 3 consecutive 8-day cycles followed by the final test on day 25. each 8-day cycle was as follows : (a) the control group (nr + ns) had chow ad libitum for 4 days, on days 5 - 6, it received chow ad libitum + hpf for 2 h (from 10:00 a.m., i.e., 2 h after the beginning of the light phase of the cycle) ; on days 7 - 8, it had chow ad libitum ; on day 25, it was not exposed to stress ; (b) the second group (r + ns) had chow restricted to 66% of the usual intake for 4 days, was offered chow ad libitum and hpf for 2 h on days 5 - 6 and only chow on days 7 - 8 ; on day 25, it was not exposed to stress ; (c) the third group had chow and hpf as controls (nr + ns), but on the test day (day 25), it was exposed to stress (nr + s) ; (d) the fourth group (r + s) had food available like group r + ns and on day 25, it was exposed to stress. the 8-day cycle was repeated three times, but in the third cycle, the animals did not have access to hpf on day 21 and 22. it has been recently reported by our group that in the estrous phase of the ovarian cycle, female rats do not exhibit be in the adopted model, while in all the other three phase of the ovarian cycle they exhibit be without significant differences in intensity. therefore, immediately after the test on day 25, vaginal smears were collected and analysed under microscope to assess the ovarian phase, and data from rats in the estrous phase were not included in the statistical analysis. vaginal smears were analysed by an experienced experimenter blind to treatment conditions.food intake was expressed as mean kcal / kg ingested s.e.m. ; it was measured for 2 h, since previous experiments showed no differences among groups after this period. hpf intake was measured at 15, 30, 60, and 120 min after access to it. food pellet intake was measured only at 2 h, in relation to the findings of previous studies showing that the food pellet intake was very small and to avoid disturbance to the animals during the test. they were divided in 4 groups of 10 animals, matched for body weight and daily food intake : (1) the nonrestricted and not exposed to stress group (nr + ns), (2) the restricted and not exposed to stress group (r + ns), (3) the non - restricted and exposed to stress group (nr + s), and (4) the restricted and exposed to stress group (r + s). rats were subjected to 3 consecutive 8-day cycles followed by the final test on day 25. each 8-day cycle was as follows : (a) the control group (nr + ns) had chow ad libitum for 4 days, on days 5 - 6, it received chow ad libitum + hpf for 2 h (from 10:00 a.m., i.e., 2 h after the beginning of the light phase of the cycle) ; on days 7 - 8, it had chow ad libitum ; on day 25, it was not exposed to stress ; (b) the second group (r + ns) had chow restricted to 66% of the usual intake for 4 days, was offered chow ad libitum and hpf for 2 h on days 5 - 6 and only chow on days 7 - 8 ; on day 25, it was not exposed to stress ; (c) the third group had chow and hpf as controls (nr + ns), but on the test day (day 25), it was exposed to stress (nr + s) ; (d) the fourth group (r + s) had food available like group r + ns and on day 25, it was exposed to stress. the 8-day cycle was repeated three times, but in the third cycle, the animals did not have access to hpf on day 21 and 22. it has been recently reported by our group that in the estrous phase of the ovarian cycle, female rats do not exhibit be in the adopted model, while in all the other three phase of the ovarian cycle they exhibit be without significant differences in intensity. therefore, immediately after the test on day 25, vaginal smears were collected and analysed under microscope to assess the ovarian phase, and data from rats in the estrous phase were not included in the statistical analysis. food intake was expressed as mean kcal / kg ingested s.e.m. ; it was measured for 2 h, since previous experiments showed no differences among groups after this period. hpf intake was measured at 15, 30, 60, and 120 min after access to it. food pellet intake was measured only at 2 h, in relation to the findings of previous studies showing that the food pellet intake was very small and to avoid disturbance to the animals during the test. effect of hypericum perforatum extract on be evoked by cycles of food restriction and exposure to acute stresseighty female rats were used. they were divided in 2 groups of 40 animals, matched for body weight and daily food intake : (1) the nonrestricted and not exposed to stress group (nr + ns) and (2) the restricted and exposed to stress group (r + s). only these two groups were used since experiment 1 confirmed that be is not expressed in the r + ns and nr + s groups. rats were subjected to 3 consecutive 8-day cycles followed by the final test on day 25, as reported in experiment 1. each group of 40 rats was divided in 4 subgroups of 10 rats, treated, respectively, with vehicle or with hypericum perforatum dry extract (125, 250, or 500 mg / kg) given by gavage 1 h before access to hpf. hpf intake was measured at 15, 30, 60, and 120 min after access to it. food pellet intake was measured only at 2 h. eighty female rats were used. they were divided in 2 groups of 40 animals, matched for body weight and daily food intake : (1) the nonrestricted and not exposed to stress group (nr + ns) and (2) the restricted and exposed to stress group (r + s). only these two groups were used since experiment 1 confirmed that be is not expressed in the r + ns and nr + s groups. rats were subjected to 3 consecutive 8-day cycles followed by the final test on day 25, as reported in experiment 1. each group of 40 rats was divided in 4 subgroups of 10 rats, treated, respectively, with vehicle or with hypericum perforatum dry extract (125, 250, or 500 mg / kg) given by gavage 1 h before access to hpf. food intake was expressed as mean kcal / kg ingested s.e.m. hpf intake was measured at 15, 30, 60, and 120 min after access to it. be in female ratsadditional eighty female rats received the same procedures of the nr + ns and r + s rats in the experiments 1 and 2. on the test day (day 25), nr + ns and r + s rats were treated by gavage as follows (10 rats per group) : (a) vehicle + vehicle, (b) vehicle + salidroside 312 g / kg, and (c) hypericum perforatum extract 125 mg / kg + vehicle, hypericum perforatum extract 125 mg / kg + salidroside 312 g / kg. food intake was expressed as mean kcal / kg ingested s.e.m. hpf intake was measured at 15, 30, 60, and 120 min after access to it. food pellet intake was measured only at 2 h. additional eighty female rats received the same procedures of the nr + ns and r + s rats in the experiments 1 and 2. on the test day (day 25), nr + ns and r + s rats were treated by gavage as follows (10 rats per group) : (a) vehicle + vehicle, (b) vehicle + salidroside 312 g / kg, and (c) hypericum perforatum extract 125 mg / kg + vehicle, hypericum perforatum extract 125 mg / kg + salidroside 312 g / kg. hpf intake was measured at 15, 30, 60, and 120 min after access to it. effect of hypericum perforatum extract and salidroside on serum corticosterone levels following cycles of food restriction and exposure to acute stress experiment 4ato assess if the doses of hypericum perforatum extract (250 and 500 mg / kg) that reduced be have an effect on the increased corticosterone levels in the r + s group, additional fifty - four sprague - dawley rats were used. they were divided in two groups (nr + ns and r + s) of 27 animals, were subjected to three cycles of 8 days with the same procedure described under experiment 1. at the end of the third cycle (on day 25) in each group, 9 animals received vehicle, 9 animals received hypericum perforatum dry extract, 250 mg / kg, and other 9 rats received hypericum perforatum dry extract, 500 mg / kg. the r + s group received drug administration 45 min before exposure to the stressful procedure and was sacrificed at the end of the 15 min period of stress. the nr + ns group was administered vehicle or hypericum perforatum dry extract, 250 or 500 mg / kg and then sacrificed 60 min later. to assess if the doses of hypericum perforatum extract (250 and 500 mg / kg) that reduced be have an effect on the increased corticosterone levels in the r + s group, additional fifty - four sprague - dawley rats were used. they were divided in two groups (nr + ns and r + s) of 27 animals, were subjected to three cycles of 8 days with the same procedure described under experiment 1. at the end of the third cycle (on day 25) in each group, 9 animals received vehicle, 9 animals received hypericum perforatum dry extract, 250 mg / kg, and other 9 rats received hypericum perforatum dry extract, 500 mg / kg. the r + s group received drug administration 45 min before exposure to the stressful procedure and was sacrificed at the end of the 15 min period of stress. the nr + ns group was administered vehicle or hypericum perforatum dry extract, 250 or 500 mg / kg and then sacrificed 60 min later. experiment 4badditionally forty - five sprague - dawley rats, divided in two groups : nr + ns (n = 9) and r + s (n = 36), were subjected to three cycles of 8 days with the same procedure described under experiment 1. at the end of the third cycle (on day 25), 9 nr + ns rats received vehicle + vehicle, r + s rats were divided in four groups of 9 animals that received : vehicle + vehicle, vehicle + salidroside 312 g / kg, hypericum perforatum dry extract (125 mg / kg) + vehicle, and hypericum perforatum dry extract (125 mg / kg) and salidroside 312 g / kg. the r + s group received drug administration 45 min before exposure to the stressful procedure and was sacrificed at the end of the 15 min period of stress. the nr + ns group was administered vehicle and then sacrificed 60 min later. blood samples were collected from the rat trunk after decapitation. to improve serum separation from whole blood, samples were allowed to clot at room temperature before centrifugation (1000 g for 10 min). taking into account the circadian rhythm of corticosterone, all sacrifices were carried out between 12.00 and 2.00 p.m., that is, during the diurnal period when its concentrations are relatively constant [77, 78 ]. assessment of serum corticosterone level was done by means of enzyme immunoassay (eia) using a commercially available kit (arbor assays, ann arbor, mi, usa), which utilizes microplate reader set at 450 nm. serum samples were diluted 1 : 100 in appropriate assay buffers in order to be within the calibration curve range and assayed in duplicate. the detection limit of the assay was 16.9 pg / ml ; intra- and interassay coefficients of variations were, respectively, 5.1 and 7.9%. additionally forty - five sprague - dawley rats, divided in two groups : nr + ns (n = 9) and r + s (n = 36), were subjected to three cycles of 8 days with the same procedure described under experiment 1. at the end of the third cycle (on day 25), 9 nr + ns rats received vehicle + vehicle, r + s rats were divided in four groups of 9 animals that received : vehicle + vehicle, vehicle + salidroside 312 g / kg, hypericum perforatum dry extract (125 mg / kg) + vehicle, and hypericum perforatum dry extract (125 mg / kg) and salidroside 312 g / kg. the r + s group received drug administration 45 min before exposure to the stressful procedure and was sacrificed at the end of the 15 min period of stress. the nr + ns group was administered vehicle and then sacrificed 60 min later. blood samples were collected from the rat trunk after decapitation. to improve serum separation from whole blood, samples were allowed to clot at room temperature before centrifugation (1000 g for 10 min). taking into account the circadian rhythm of corticosterone, all sacrifices were carried out between 12.00 and 2.00 p.m., that is, during the diurnal period when its concentrations are relatively constant [77, 78 ]. assessment of serum corticosterone level was done by means of enzyme immunoassay (eia) using a commercially available kit (arbor assays, ann arbor, mi, usa), which utilizes microplate reader set at 450 nm. serum samples were diluted 1 : 100 in appropriate assay buffers in order to be within the calibration curve range and assayed in duplicate. the detection limit of the assay was 16.9 pg / ml ; intra- and interassay coefficients of variations were, respectively, 5.1 and 7.9%. data were analyzed by two - ways analysis of variance (anova) with between - subject comparisons for experimental groups or drug treatments and within - subject comparison for time of observation when appropriate (systat 13.0). experiment 1. effect of repeated food restrictions and acute stress of hpf intake in female ratsthirty female rats (of the 40 used in the experiment) proved not to be in the estrous phase at the moment in which the experiment was carried out. only data from these animals (68 per group) were subjected to statistical analysis.as shown in figure 1, body weight of rats was reduced during the 4 days of food restriction, but immediately afterwards the animals increased their food intake and rapidly recovered their body weight to control levels by the end of each cycle. on the test day, body weight of the 4 groups of animals, as well as their food intake in the previous 24 h, was not significantly different. thirty female rats (of the 40 used in the experiment) proved not to be in the estrous phase at the moment in which the experiment was carried out. only data from these animals (68 per group) as shown in figure 1, body weight of rats was reduced during the 4 days of food restriction, but immediately afterwards the animals increased their food intake and rapidly recovered their body weight to control levels by the end of each cycle. on the test day, body weight of the 4 groups of animals, as well as their food intake in the previous 24 h, was not significantly different. the anova revealed a highly significant difference in 2 h hpf intake in the 4 groups of rats (f(3, 26) = 19.32 ; p 0.05), nor a group - drug treatment interaction (f(2, 36) = 0.1, p > 0.05) on serum corticosterone levels. the administration by gavage of hypericum perforatum extract at either dose used (250 or 500 mg / kg) failed to reduce the increase in serum corticosterone levels in the r + s group. post hoc tests showed that serum corticosterone levels in r + s rats, treated with the 2 doses of hypericum perforatum extracts, were comparable to those of r + s rats treated with vehicle (p > 0.05), but were statistically different from those of nr + ns rats, either treated or not treated with hypericum perforatum. forty - two female rats (of the 54 used in the experiment) were not in the estrous phase at the moment in which the experiment was carried out (68 per group). two - way anova showed significant group effect (f(1, 36) = 20.7, p 0.05), nor a group - drug treatment interaction (f(2, 36) = 0.1, p > 0.05) on serum corticosterone levels. the administration by gavage of hypericum perforatum extract at either dose used (250 or 500 mg / kg) failed to reduce the increase in serum corticosterone levels in the r + s group. post hoc tests showed that serum corticosterone levels in r + s rats, treated with the 2 doses of hypericum perforatum extracts, were comparable to those of r + s rats treated with vehicle (p > 0.05), but were statistically different from those of nr + ns rats, either treated or not treated with hypericum perforatum. experiment 4bthirty - six female rats (of the 45 used in the experiment) were not in the estrous phase at the moment in which the experiment was carried out (69 per group).two - way anova showed significant group effect (f(1, 34) = 93.4, p 0.05) on serum corticosterone levels. thirty - six female rats (of the 45 used in the experiment) were not in the estrous phase at the moment in which the experiment was carried out (69 per group). two - way anova showed significant group effect (f(1, 34) = 93.4, p 0.05) on serum corticosterone levels. the present study confirms that stress or repeated food restrictions, given separately, are not enough to induce be, but the combination of both determinants is required. has shown that the experimental model of be adopted in the present study possesses, in addition to face and construct validity, also predictive validity, since both topiramate and sibutramine abolish be. the administration by gavage of a dry extract of hypericum perforatum, 250 mg / kg, significantly reduced the increase in hpf intake in the r + s group (subjected to both stress and repeated food restrictions), and the dose of 500 mg / kg completely reduced it. on the other hand, 125 mg / while suppressing the increase in hpf intake in the r + s group, the three doses tested of hypericum perforatum extract did not significantly reduce hpf in the control group (nr + ns) even if a clear trend of reduction was shown by the highest tested dose (500 mg / kg). the mechanisms accounting for this selective effect on be remain to be elucidated. as mentioned in the introduction several papers have shown that some of its active principles bind to crf-1 receptors and exhibit antagonist activity at these receptors [6467 ]. moreover, hypericum perforatum extracts have been reported to reduce hpa axis activation following chronic treatment and to reduce restraint stress - induced increases in plasma acth and corticosterone levels following acute administration. corticosterone has been proposed to have motivational properties and to influence drug - seeking behaviour in rats [7982 ], suggesting that it may have a role in the control of compulsive behaviour, like that exhibited in episodes of be. however, a recent study of our group has shown that peripheral administration of corticosterone is not able to induce be in rats exposed to repeated cycles of food restrictions ; moreover, metyrapone, a glucocorticoid synthesis inhibitor, does not affect be. on the other hand, the same study has shown that a crf-1 receptor antagonist completely blocks be in the experimental model adopted. taken together, these findings suggest that crf controls be through crf-1 receptors mainly in extrahypothalamic brain areas, rather than in the hypothalamic structures controlling the hpa axis. the results of experiment 3 indicate that in our experimental conditions hypericum perforatum does not influence hpa axis activation ; however, it can not be excluded that it abolishes be by blocking central crf-1 receptors in extrahypothalamic brain area. on the other hand, the inhibition of the be may be achieved also by suppressing addictive - like behaviours, in particular those related to the binge / intoxication stages of addiction. in this regard, it is interesting to note that hypericum perforatum has been reported to suppress voluntary alcohol intake, ethanol self - administration and the alcohol - deprivation effect in genetically selected alcohol - preferring rats [4450, 75 ], including the marchigian sardinian alcohol - preferring rats that represent an interesting experimental model of alcohol abuse. therefore, hypericum perforatum may influence motivation and compulsive behaviours towards hpf in be episodes, as it does towards alcohol. among the active principles identified in hypericum perforatum extracts, apparently pseudohypericin is the most potent crf-1 receptor antagonist, but also hypericin exhibited high binding affinity for human crf-1 receptors. other hypericum perforatum constituents with high affinity for the crf-1 receptor are also bisanthraquinone glycosides and flavonoids. hyperforin and hyperforin derivatives do not bind with high affinity at crf1 receptors and are not involved in the control of hpa axis function. on the other hand, hyperforin has been proposed to be the main active principle responsible for the effect of hypericum perforatum in the control of alcohol abuse. the extract used in the present study had a very low hypericin content (0.1%) and a rather high hyperforin content (3.8%). these data favour the hypothesis that hyperforin may have a major role in the suppressive effect of hypericum perforatum on be ; accordingly, the mechanism of action may be more likely related to suppression of addictive - like behaviours than to interference with stress mechanisms. it is interesting to note that hypericum perforatum was able to increase the effect of salidroside, that in our previous study, showed to be the active principle of rhodiola rosea extracts responsible for the selective effect in reducing be. recently, the effect of salidroside on expression and secretion of neuropeptide y (npy) in neuroglia cells has been demonstrated. since it is well documented that npy reduces consummatory ingestive behaviour by about 40% [88, 89 ], it has been suggested that the effect of salidroside on be is mediated by npy. in conclusion, the present findings suggest that hypericum perforatum extracts and salidroside may be useful for treatment of bingeing - related eating disorders.
|
purpose. the present study evaluated the effect of hypericum perforatum dry extract in an experimental model of binge eating (be). methods. be for highly palatable food (hpf) was evoked in female rats by three 8-day cycles of food restriction / re - feeding and acute stress on the test day (day 25). stress was induced by preventing access to hpf for 15 min, while rats were able to see and smell it. hypericum perforatum dry extract was given by gavage. results. only rats exposed to both food restrictions and stress exhibited be. the doses of 250 and 500 mg / kg of hypericum perforatum extract significantly reduced the be episode, while 125 mg / kg was ineffective. the same doses did not affect hpf intake in the absence of be. the dose of 250 mg / kg did not significantly modify stress - induced increase in serum corticosterone levels, suggesting that the effect on be is not due to suppression of the stress response the combined administration of 125 mg / kg of hypericum perforatum together with salidroside, active principle of rhodiola rosea, produced a synergic effect on be. conclusions. the present results indicate for the first time that hypericum perforatum extracts may have therapeutic properties in bingeing - related eating disorders.
|
this review focuses on current methods to track natural killer (nk) cells used in cancer therapy : how they can be monitored in vivo to assess tumor response, assay treatment efficacy, and elucidate mechanisms of nk cell - based immunotherapy. nk cell therapy includes activation of endogenous nk cells, and adoptive transfer of activated and genetically modified nk cells. adoptive transfer of ex vivo - targeted nk cells has been used more recently. typically, response to adoptive cell therapy is evaluated on the basis of decreases in tumor markers and tumor size and improved survival that are assessed weeks to months after administration of treatment. localization and function of adoptively transferred immune cells at the tumor site are typically determined through biopsy and ex vivo analysis. accumulation in the tumor region is one of the requirements for effective adoptive immunotherapy. with the biology of nk cells continually being elucidated, tumor targeting of nk cells can potentially be enhanced using a variety of new methods. nk cells may be labeled with different markers for in vivo monitoring.1 cells can be labeled directly by harvesting them and labeling them ex vivo with fluorophores, radiotracers, or paramagnetic nanoparticles that allow visualization by optical microscopy, positron emission tomography / single - photon emission computed tomography (pet / spect), and magnetic resonance imaging (mri), respectively. direct labeling procedures may prove to be useful for clinical translation because of the ease of labeling procedures and the potential to use labels that are already approved for clinical use. first, the level of labeling depends on the capacity of the cell to retain the label, as different cell populations may exhibit different levels of phagocytosis or have different membrane properties. second, the direct method can be useful for in vivo imaging of only terminally differentiated cells, such as nk cells, dendritic cells, and macrophages, because the label may be lost or diluted as cells proliferate or die. cells may also be labeled indirectly ex vivo where cells are transduced with a vector carrying a reporter gene. signal can be generated and tracked in vivo when the reporter gene is expressed and when a transgene - specific probe is administered. although genetic manipulation makes it possible to track the long - term fate of a cell population (distribution, proliferation, and survival) in vivo, insertion of reporter genes demands stable genetic modification and is currently restricted to preclinical research. noninvasive imaging technologies are now able to qualitatively and quantitatively detect the presence of labeled nk cells in target tumors. these imaging signals can potentially be used as real - time biomarkers for tumor response and for differentiating patients who are responders or nonresponders to nk cell therapy. noninvasive nk cell imaging has the potential to provide immediate evaluation of nk cell therapy in both preclinical and clinical realms. nk cells are a crucial part of the innate immune system that were originally identified based on their ability to lyse malignant and infected cells without prior sensitization or immunization.2 nk cells mediate the suppression of infected and tumor cells through several effector mechanisms (e.g. the perforin / granzyme - containing granule, death - receptor and interferon- (ifn-) mediated pathways, and antibody - dependent cell - mediated cytotoxicity (adcc)).3 nk cells produce cytokines that have proinflammatory and immunosuppressive effects (e.g. ifn-, tumor necrosis factor- (tnf-), or interleukin il-10) and growth factors, such as granulocyte macrophage colony - stimulating factor (gm - csf) and granulocyte colony - stimulating factor (g - csf)). they also produce many kinds of chemokines that are crucial in nk cell trafficking to lymph nodes and areas of inflammation, as well as their colocalization with dendritic and other hematopoietic cells.4,5 nk cell - mediated cytotoxicity and cytokine production provide regulatory roles of nk cells that impact members of the adaptive immune system, such as dendritic cells, macrophages, neutrophils, and t and b cells.4 human nk cells are broadly defined as cd3 cd56 cells and can be further divided into two subsets based on the level of their expression of cd56.6 cd56 nk cells are predominantly involved in immunoregulation by producing cytokines. cd56 nk cells also express high levels of low - affinity fc receptor for igg (fciiir cd16), which mediates adcc. nk cells are widely distributed throughout lymphoid and nonlymphoid tissues, including bone marrow, lymph nodes, blood, liver, spleen, and lung.5 about 90% of nk cells in the peripheral blood and spleen are cd56 cd16 + nk cells. most nk cells in the lymph nodes are cd56cd16 nk cells are equipped with a variety of receptors that stimulate or inhibit activity. nk cell activation is dependent on the balance between inhibitory and activating receptors. activating receptors human activating receptors include the natural cytotoxicity receptors (ncr nkp46, nkp30, and nkp44), c - type lectin receptors (cd94/nkg2c, nkg2d, nkg2e / h, and nkg2f), and killer cell immunoglobulin - like receptors (kirs) (kir-2ds and kir-3ds). inhibitory receptors include c - type lectin receptors (cd94/nkg2a / b) and kirs (kir-2dl and kir-3dl).8 the nk cell receptor repertoire provides three ways by which nk cells take part in tumor immune surveillance. normal cells express major histocompatibility complex (mhc) class i self molecules that bind to inhibitory receptors and inhibit nk cell killing. under stress conditions, mhc class i is down - regulated in target cells resulting in loss of inhibitory signals and activation of nk cells. nk cells possess activating receptors that recognize molecules that are pathogen - encoded, only expressed by infected cells, and are not expressed by the host. for example, in mice, the cytomegalovirus - encoded m157 ligand is recognized by the activating receptor ly49h in nk cells. human nk cell activating receptor nkp46 can recognize hemagglutinins on virus - infected cells and initiate nk cell - mediated lysis.913 third is the stress - induced self process, wherein nk cells recognize proteins up - regulated only by transformed or infected cells. furthermore, ifns and cytokines (il-2, il-12, il-15, il-18, and il-21) can potentiate these surveillance roles by enhancing activation, increasing cytolytic activity and promoting maturation of nk cells.4,8 nk cells play crucial roles in the innate and adaptive immunities against infections and tumors. their therapeutic use is currently being pursued in cancer immunotherapy.8,14 briefly, there are five methods in which nk cell therapy is being employed pre - clinically and clinically. autologous nk cells can be activated and potentiated through systemic administration of cytokines (il-2, il-12, il-15, il-18, il-21, and type i ifns).4,1518 however, poor clinical outcome has been observed with severe side effect in cancer patients, including vascular leak. ex vivo activation and expansion of autologous nk cell using cytokines and eventual adoptive transfer back to the patients have shown greater success.8 use of allogeneic nk cells in adoptive cell transfer has shown kir mismatch and enhanced tumor - killing ability. kir mismatch contributes to alloreactivity of nk cells through the missing self - recognition process, i.e. the inhibitory kirs on allogeneic nk cells do not detect self mhc class i ligands.19,20 following transfer of haploidentical allogeneic nk cells in acute myeloid leukemia (aml) patients, 26% had complete remission and most patients experienced nk cell expansion following il-2 therapy.19 to take advantage of the alloreactivity of nk cells, they are expanded and activated in vitro prior to adoptive transfer using various cytokines (il-2, il-15, or il-21) and growth factors.21,22 nk cell function can also be enhanced by blocking inhibitory kir with monoclonal antibodies.23 adcc : nk cells expressing the activating receptor type iiia fc receptor (cd16) recognize antibodies on target cells and trigger nk cell - mediated adcc. the use of monoclonal antibodies with or without immunocytokine stimulation of endogenous or adoptive nk cells could potentiate adcc and improve immunotherapy. antibody treatment of non - hodgkin lymphoma (with anti - cd20rituximab) and metastatic breast cancer (with anti - transtuzumab / herceptin) shows strong evidence that adcc is nk cell mediated.2426 nk cell lines : ex vivo - activated nk cells have increased cytolytic activity compared to parental nk cells. this has led to the use of cytotoxic nk cells lines that can be continuously expanded, maintained using good manufacturing practice (gmp), and kept readily available without a donor. there are seven established nk cells lines : nk-92, yt, nkl, hank-1, khyg-1, nk - ys, and nkg.8,27 the human nk-92 cell line originated from a patient with large granular lymphoma and is the only cell line that has been shown safe in adoptive transfer in humans.28,29 nk-92 cells can also be expanded in recombinant il-2. more recently, tonn showed that infusions of ex vivo il-2-activated nk-92 cells were well tolerated in patients with advanced cancer and remain in circulation up to 48 hours.30 genetic modification : in addition to mediating cytotoxicity of nk cells, it is also important to optimize accumulation and retention of the modified nk cells at the tumor site by altering the targeting receptor milieu. small interfering rna (sirna)-based technologies can be used to down - regulate the expression of inhibitory nk cell receptors or overexpress activating receptors.3133 gene transfer of chimeric tumor - antigen - specific receptors in nk cells enhance their tumor targeting and killing abilities. studies in vitro and in vivo have shown that genetic modification of nk cells via transfer of chimeric receptors targeted against her2/neu, carcinoembryonic antigen (cea), cd33 + leukemia, and epithelial cell adhesion molecules (epcam)-positive prostate cancer provided specific cytotoxicity.3439 genetically modifying nk-92 cells with cd20-specific chimeric antigen potentiated nk cell cytotoxicity toward a cd20 expressing lymphoma that was previously resistant to nk cells.40 multimodal immunotherapy promises to optimize nk cell efficacy and tumor targeting.15 nk cell therapy can be combined with cytokines, hematopoietic growth factors, humanized monoclonal antibodies, immunocytokines, and/or immunomodulatory drugs.4,1518,41,42 other types of cancer treatments may provide some tumor priming that could also enhance direct or indirect nk cell - mediated tumor recognition and killing. ionizing radiation and chemotherapy may lead to increased expression of nkg2d ligands on tumor cells and increased nk cell targeting and binding of nkg2d activating nk cell receptors.43 drugs acting on histone deacetylase inhibitors or proteasome inhibitors may up- regulate expression of tnf - related apoptosis - inducing ligands on malignant cells and render them more susceptible for trail - mediated nk cell - induced death.4447 focused ultrasound treatment of human breast cancer increases tumor - infiltrating lymphocytes that include : cd3, cd4, cd8, cd4/cd8 t cells, b cells, and nk cells. levels of fasl+, granzyme+, and perforin+ lymphocytes also significantly increase after focused ultrasound treatment.48 focused ultrasound has also been used to disrupt the blood - brain barrier to deliver targeted nk-92 cells expressing a chimeric her2 antigen receptor to her2-expressing human breast tumor cells.49 quantitation of the distribution and timing of nk cell trafficking is necessary to clinically assess the efficacy of their adoptive transfer. using various imaging techniques, this evaluation can be done quickly and noninvasively in patients receiving adoptive nk cell therapy. there are currently three methods to track nk cells in vivo50 : (1) optical imaging (oi) using fluorescence (fli) or bioluminescent imaging (bli), (2) radionuclide - based imaging using pet or spect, and (3) mri. direct or indirect cell labeling can be used to track nk cells using oi. cells can be directly labeled with exogenous fluorescent tracers for fli or indirectly via transfection of a reporter gene that generates a protein product for fli (e.g. green fluorescent protein, gfp) or bli (e.g. luciferase). fluorescent dyes can be used to permanently label nk cells and other lymphocytes through covalent and noncovalent binding to dna, rna, and protein sites ; cell membrane insertion ; and reactions in the cytosol.51 optical markers exhibit high sensitivity and high specificity, but provide limited resolution (23 mm), poor anatomical discrimination, and limited tissue penetration (1 mm fluorescence ; 3 mm bioluminescence). oi is well suited for small animal models due to small tissue depths as compared to humans. there are also no readily available clinical instruments. using oi, nk-92scfv(moc31)-zeta cells targeted to epcam antigen in human prostate cancer xenografts have been tracked in vivo in athymic rats using a near - infrared dye did (1,1-diotadecyl-3,3,3,3-tetramethylindodicarbocyanine). tumor fluorescence increased significantly after injection of targeted nk-92 cells vs. nontargeted parental nk-92 cells (fig. 1).39 nk-92mi cells have also been labeled with anti - cd56 antibody conjugated with quantum dots (qd705) without affecting viability and ifg- production and cytolytic activity. qd705-labeled nk cells have been tracked up to 12 days post intratumoral injection in human malignant melanoma (mewo) xenografts in mice.52 conjugation of fluorescence organic dye (cy5.5) with magnetic nanoparticles (fe3o4/sio2) has also been used to visualize the migration of nk-92mi cells to the tumor site controlled by an external magnetic field.53 pet and spect provide high sensitivity for detecting labeled nk cells (in the nanomolar concentration range), high specificity (target to background contrast), quantification of labeled cells, and has immediate clinical translation through use of fda - approved labeling agents. however, limitations include poor spatial resolution (~15 mm), limited anatomic information, ionizing radiation, and, depending on the radionuclide, limited duration and number of scanning sessions.50 radionuclide tracer decay limits follow - up studies within hours (fdg 24 hours) to days (in 47 days). integration of computed tomography (ct) can improve the resolution of pet and spect through attenuation correction and allows registration of tracer signals with anatomical structures.54 nk cells have been labeled with positron emitting radionuclides, including fdg (half life = 109 min) and c - methyl iodide (half life = 20 min) for pet,22,35,55 as well as with gamma emitting radioisotope in (half life = 2.8 days) for spect.56,57 pet tracers have been used to experimentally investigate the optimization of nk cell targeting to tumors. melder, using c - methyl iodide and pet, demonstrated that 430% of injected activated nk cells localized (1 hour post injection) to the tumor site of a murine fsaii fibrosarcoma model compared to 34% of nonactivated splenic lymphocytes.22 using an fda - approved pet label, fdg, meier tracked genetically modified nk-92 cells, nk-92-scfv(frp5)-zeta cells. these cells express a chimeric antigen receptor targeting tumor - associated her2/neu antigens, and were shown to accumulate more in the tumor site compared to parental nk-92 cells in mice (fig. 2).35 additionally, spect agents have been used to explore optimal administration routes for adoptively transferred nk cells clinically. matera and colleagues used in - oxide - labeled recombinant il-2-activated nk cells, evaluated by spect, to show that intra - arterial injection vs. intra - venous results in increased accumulation of adoptively transferred nk cells in the liver tumor site (colon carcinoma metastasis).56 for mri, nk cells have been labeled with nanoparticles, such as superparamagnetic iron oxide (spio) and ultra - small superparamagnetic iron oxide (uspio) nanoparticles.34,36,58,59 depending on how long the adoptively transferred nk cells survives ; nk cells are able to retain their iron oxide label up to 4 days.58 iron oxide - based agents produce strong hypointensity in t2 and t2 weighted images. interpretation of the signal loss may be difficult because other factors could contribute to the hypointensity regions in an image, apart from the presence of iron oxide - labeled cells (e.g. presence of blood, susceptibility artifacts due to air tissue interfaces, magnetic field inhomogeneities due to poor shimming, etc.). even with its drawbacks, direct labeling with paramagnetic particles show promise of direct clinical translation since fda - approved iron oxide nanoparticles are already in clinical use (ferumoxide, ferumoxytol, and ferucarbotran) and iron oxide nanoparticle labeling involves simple incubation, electroporation, or use of a transfection agent.34 direct measurement of the relaxation rate, r2 (r2 = 1/t2) provides quantification of the attenuated signal intensity. r2 relaxometry displays the effects of iron oxide as a positive signal and is a quantitative measure that correlates with iron concentration. use of ultra short echo - time (ute) pulse sequence60 is an alternative imaging protocol that can display signal increase in the presence of iron oxide nanoparticles. meier demonstrated significant decreases in t2 -weighted signals in epcam - positive tumors after injection of ferumoxide - labeled epcam - targeted nk-92 cells (nk-92-scfv(moc31)-zeta), but not after injection of ferumoxide - labeled nontargeted parental nk-92 cells (fig. 3).36 for a more quantitative approach, relaxation rate maps can be constructed to provide quantitative metrics of the organ and tumor tissues and possibly labeled nk cell concentrations. for instance, sheu showed that tumor signal changes in t2 relaxation time maps generated from gradient echo sequences after intra - arterial infusion of spio - labeled nk-92 cells.59 figure 4 shows a t2 -weighted image and the corresponding parametric r2 (r2 = 1/t2) map of an nod - scid - gamma (nsg) mouse implanted with daudi burkitt s lymphoma before (pre) and after (6 hour post) tail vein injection of ferumoxtyol - labeled nk cells. the r2 maps show a heterogeneous signal increase in the tumor region 6 hour after administration of ferumoxtyol - labeled nk cells. mri is readily available clinically, has relatively high resolution (better than 0.1 mm), well - defined soft - tissue contrast, and has no ionizing radiation. disadvantages of mri compared to oi or radiotracer - based imaging are limited sensitivity for detecting small cell populations, relatively high cost, long scan times, and low specificity. quantitation of cells in vivo is theoretically possible using relaxation rate maps, but this type of quantification is indirect as the mr signal detected is related to the perturbation in tissue proton magnetization rather than directly to cell concentration. multiplexing adoptive transfer with patient and tumor priming (via adjuvant and/or immunocytokine treatments, genetic modification of nk cells, and/or combinatorial therapies) are being explored to optimize targeting to the tumor and enhance cytotoxicity of nk cells. in vivo assessment of the spatiotemporal distribution and the concentration of transferred nk cells within tumor sites existing imaging techniques with optimized probes can be used noninvasively and results can be visualized in real time. for future clinical applications, multimodal imaging (mri and pet) offers the most desirable characteristics for measuring responses to nk cell adoptive therapy, to qualitatively and quantitatively track cells, and to measure cellular viability through visualization of pet and mri signal colocalization.
|
natural killer (nk) cells are a crucial part of the innate immune system and play critical roles in host anti - viral, anti - microbial, and antitumor responses. the elucidation of nk cell biology and their therapeutic use are actively being pursued with 200 clinical trials currently underway. in this review, we outline the role of nk cells in cancer immunotherapies and summarize current noninvasive imaging technologies used to track nk cells in vivo to investigate mechanisms of action, develop new therapies, and evaluate efficacy of adoptive transfer.
|
mental health nurses frequently encounter such multidimensional stressors as demanding or difficult patients,1 inadequate staffing,2 physically threatening patients, and potential suicides.3,4 mental health nursing has been recognized as a highly stressful occupation, and previous studies have demonstrated the relationship between occupational stressors and psychological health, resulting in depression or burnout.5,6 to provide high - quality, sustainable nursing care, it is necessary to identify and control the factors associated with psychological health among mental health nurses. recently, in addition to the established work stress measures, work family conflict (wfc) has been recognized as an important factor in organizational behavior and occupational health. wfc has been defined as a form of inter - role conflict in which the role pressures from the work and family domains are mutually incompatible in some respects.7 participation in one role makes it difficult to participate in the other. this definition of wfc implies bidirectional relationships between work and family life, and previous factor analysis studies identified two types of wfc : work interference with family (wif) conflict and family interference with work (fiw) conflict.8 theoretically, the definition of wfc implies mediation ; wfc can mediate the way we experience demands over a prolonged period of time.9 several studies have shown that wfc is associated with a wide range of occupational, family, and psychological outcomes.1013 medical staff who devote a large amount of time and energy to their work,14,15 may experience higher wfc.16 more than half of japanese family households consist of the nuclear family, that is, the father, mother, and child.17 compared to extended families, nuclear families might be more sensitive to stressful events.18 however, there has been limited evidence of wfc among medical staff in japan. thus, research is required to evaluate the relationship between wfc, occupational stress, and psychological health among japanese mental health nurses. the objective of the current investigation was to examine the role of wfc in the association between occupational stress and psychological health among mental health nurses who had a coresident child or were married in japan. to our knowledge, this study is the first to examine wfc in japanese mental health nurses. self - report questionnaire packages were mailed to 7 randomly selected hospitals that are affiliated with hirosaki university school of medicine, and the surveys were then distributed to 318 nurses. three of the hospitals were psychiatric hospitals, and 4 of the hospitals were general hospitals. all respondents provided their verbal informed consent to participate in this study, and no incentives were offered for participation. the anonymous questionnaire was the only research instrument, and the following statement was included : completion of the attached questionnaire will be considered your consent to participate. in total, 20 or 30 minutes were needed to answer the questionnaires. before the questionnaires were distributed, nurses were well informed about the study and the potential risks and benefits of their participation by the research team. subsequently, nurses had the right to not submit the questionnaires if they wished to withdraw from the study. to avoid common method variance, the participants were allowed to answer the questionnaire at places of their choosing. of the 318 distributed surveys, responses were received from 240 nurses, and 238 questionnaires (response rate 74.8%) were completed. the characteristics of the study population have been reported previously.5 in this study, we reanalyzed the 180 mental health nurses who had a coresident child or were married from the same study population. the study protocol was approved by the ethics committee of the hirosaki university school of medicine (20122013). family conflict scale in this study.19,20 this scale covers two types and three dimensions of conflicts, namely, time - based, strain - based, and behavior - based wif and time - based, strain - based, and behavior - based fiw. responses were provided on a 5-point likert scale ranging from 1= strongly disagree to 5= strongly agree. the two scales included 18 items, and each of the two subscales included nine items. the wif scale measured the extent to which work demands interfere with family - related obligations, whereas the fiw scale measured the extent to which family demands interfere with work- related obligations. job - related stress was assessed with the generic job stress questionnaire (gjsq),21 which was developed by the national institute for occupational safety and health. the japanese version of the gjsq has demonstrated sufficient reliability and validity.22 the original authors of the gjsq permit the use of their independent subscales for assessing occupational stress,21 and we focused on 3 subscales to assess occupational stress : quantitative workload, variance in workload, and mental demands. burnout was assessed using the japanese version of the maslach burnout inventory - general survey (mbi - gs).23,24 this questionnaire consisted of three subscales : exhaustion (five items), cynicism (five items), and professional efficacy (six items). for each item, respondents used a 7-point likert - type scale ranging from 0 (never) to 6 (every day). higher scores on the emotional exhaustion and cynicism dimensions and lower scores on the professional efficacy dimension indicated higher levels of burnout. the japanese version of the center for epidemiologic studies for depression scale (ces - d) was administered to all of the participants to measure their depressive status.25,26 this questionnaire has been widely used to measure depressive symptoms in community populations and to screen individuals for probable depression. the ces - d is a 20-item self - report instrument that focuses on depressive symptoms during the week prior to the administration of the questionnaire. the maximum score on this scale is 60, and higher scores are associated with depression. a value of p<0.05 was considered to be statistically significant. to compare the characteristics between genders, the unpaired student s t - test was performed to analyze continuous variables, and the chi - square test was performed to analyze categorical variables. pearson s correlation was used to explore the relationships between the psychological and occupational variables. to assess 1) occupational stress once demographic characteristics were controlled and 2) wfc (each the two directions of wif and fiw conflicts) after demographic characteristics and occupational stress were controlled, we performed hierarchical linear regression analysis for psychological variables (depression and each of the three dimensions of burnout). in step 1 of the hierarchical linear regression analysis, the control variables, namely, age and gender were used as predictors. in step 2, occupational factors (quantitative workload, variance in workload, and mental demands) were added. in step 3, wif and fiw were added individually to models 3a and 3b. according to baron and kenny,27 the following conditions should be satisfied to establish mediation : 1) the independent variable (occupational factors) is significantly associated with the dependent variable (depression and each of the three dimensions of burnout) ; 2) the independent variable is significantly associated with the mediator (wif / fiw) ; and 3) the mediator is significantly associated with the dependent variable, and the effect of the independent variable on the dependent variable decreases with the addition of the mediator to the model. if the independent variable does not affect the dependent variable when the mediator is added to the model, full mediation is established. we assessed multi - collinearity using the variance inflation factor (vif), and all independent variables in our linear regression models showed vifs < 5. the data were analyzed using pasw statistics pc software for windows, version 18.0.0 (spss inc. self - report questionnaire packages were mailed to 7 randomly selected hospitals that are affiliated with hirosaki university school of medicine, and the surveys were then distributed to 318 nurses. three of the hospitals were psychiatric hospitals, and 4 of the hospitals were general hospitals. all respondents provided their verbal informed consent to participate in this study, and no incentives were offered for participation. the anonymous questionnaire was the only research instrument, and the following statement was included : completion of the attached questionnaire will be considered your consent to participate. in total, 20 or 30 minutes were needed to answer the questionnaires. before the questionnaires were distributed, nurses were well informed about the study and the potential risks and benefits of their participation by the research team. subsequently, nurses had the right to not submit the questionnaires if they wished to withdraw from the study. to avoid common method variance, the participants were allowed to answer the questionnaire at places of their choosing. of the 318 distributed surveys, responses were received from 240 nurses, and 238 questionnaires (response rate 74.8%) were completed. the characteristics of the study population have been reported previously.5 in this study, we reanalyzed the 180 mental health nurses who had a coresident child or were married from the same study population. the study protocol was approved by the ethics committee of the hirosaki university school of medicine (20122013). we used the 18 items of the japanese version of the work family conflict scale in this study.19,20 this scale covers two types and three dimensions of conflicts, namely, time - based, strain - based, and behavior - based wif and time - based, strain - based, and behavior - based fiw. responses were provided on a 5-point likert scale ranging from 1= strongly disagree to 5= strongly agree. the two scales included 18 items, and each of the two subscales included nine items. the wif scale measured the extent to which work demands interfere with family - related obligations, whereas the fiw scale measured the extent to which family demands interfere with work- related obligations. job - related stress was assessed with the generic job stress questionnaire (gjsq),21 which was developed by the national institute for occupational safety and health. the japanese version of the gjsq has demonstrated sufficient reliability and validity.22 the original authors of the gjsq permit the use of their independent subscales for assessing occupational stress,21 and we focused on 3 subscales to assess occupational stress : quantitative workload, variance in workload, and mental demands. burnout was assessed using the japanese version of the maslach burnout inventory - general survey (mbi - gs).23,24 this questionnaire consisted of three subscales : exhaustion (five items), cynicism (five items), and professional efficacy (six items). for each item, respondents used a 7-point likert - type scale ranging from 0 (never) to 6 (every day). higher scores on the emotional exhaustion and cynicism dimensions and lower scores on the professional efficacy dimension indicated higher levels of burnout. the japanese version of the center for epidemiologic studies for depression scale (ces - d) was administered to all of the participants to measure their depressive status.25,26 this questionnaire has been widely used to measure depressive symptoms in community populations and to screen individuals for probable depression. the ces - d is a 20-item self - report instrument that focuses on depressive symptoms during the week prior to the administration of the questionnaire. the maximum score on this scale is 60, and higher scores are associated with depression. a value of p<0.05 was considered to be statistically significant. to compare the characteristics between genders, the unpaired student s t - test was performed to analyze continuous variables, and the chi - square test was performed to analyze categorical variables. pearson s correlation was used to explore the relationships between the psychological and occupational variables. to assess 1) occupational stress once demographic characteristics were controlled and 2) wfc (each the two directions of wif and fiw conflicts) after demographic characteristics and occupational stress were controlled, we performed hierarchical linear regression analysis for psychological variables (depression and each of the three dimensions of burnout). in step 1 of the hierarchical linear regression analysis, the control variables, namely, age and gender were used as predictors. in step 2, occupational factors (quantitative workload, variance in workload, and mental demands) were added. in step 3, wif and fiw were added individually to models 3a and 3b. according to baron and kenny,27 the following conditions should be satisfied to establish mediation : 1) the independent variable (occupational factors) is significantly associated with the dependent variable (depression and each of the three dimensions of burnout) ; 2) the independent variable is significantly associated with the mediator (wif / fiw) ; and 3) the mediator is significantly associated with the dependent variable, and the effect of the independent variable on the dependent variable decreases with the addition of the mediator to the model. if the independent variable does not affect the dependent variable when the mediator is added to the model, full mediation is established. we assessed multi - collinearity using the variance inflation factor (vif), and all independent variables in our linear regression models showed vifs < 5. the data were analyzed using pasw statistics pc software for windows, version 18.0.0 (spss inc., chicago, il, usa). table 1 contains the sociodemographic and occupational characteristics of the participants. according to the optimal ces - d cutoff point of 19 that was determined by wada to identify possible cases of depression among working individuals,28 table 3 shows the results of the hierarchical linear regression analysis used to assess the effects of occupational factors and wfc on burnout. the relationship between emotional exhaustion and occupational factors, including quantitative workload and the variance in workload disappeared with the addition of wfc (each wif or fiw). the relationship between emotional exhaustion and mental demands disappeared only with the addition of wif. table 4 presents the results of the hierarchical linear regression analysis used to assess the effects of occupational factors and wfc on depressive symptoms. the relationship between depressive symptoms and variance in workload disappeared with the addition of wfc (each wif or fiw). this study identified significant associations between occupational stress and psychological health among japanese mental health nurses in the model, which did not include wfc factors. our results were consistent with those of an earlier investigation in which hours of overtime work and job control, assessed by the brief job stress questionnaire, were correlated with depressive symptoms in a cross - sectional study of 706 female general nurses in japan.29 in a study of 141 taiwanese female mental health nurses, lin identified a significant interaction between social support and job stress using a multiple linear regression model, which suggested that the ascending trend of depression with elevated job stress, as assessed by the taiwanese nurse stress checklist, was accelerated in subjects who had a low level of social support.30 among 877 finnish nurses, there was a linear trend toward increasing workload with increasing absenteeism because of sickness.31 occupational factors and psychological health may affect both job outcomes and quality of care.32 our findings demonstrated the mediating role of wfc in the effect of occupational stress on depression, emotional exhaustion, and cynicism. although several studies have primarily focused on the direct effect of wfc on both burnout9,33 and depression,10,13,34 other studies have investigated the mediating effect of wfc on psychological health. among greek doctors, montgomery showed that work family interference partially mediated the relationship between emotional job demands and depersonalization.35 in a german leben in der albeit (lida) study (n=5,906),36 cross - sectional evidence for the mediating effect of wfc in the association between occupational stress and depression among full- and part - time employed, middle - aged females and males in full - time positions was obtained. furthermore, vignoli observed that job demands affected absenteeism by the subsequent mediation of wfc and emotional exhaustion in 245 italian workers.37 these findings should encourage hospital administrators to maintain awareness of wfc. to promote the psychological health of medical staff to reduce wif, hospital administrators could increase staff to reduce quantitative workload and provide opportunities to enhance skills to keep up with progress in medical technology. in addition, hospitals could provide childcare services for child - rearing female workers or arrange schedules to allow parents to work flexible hours. by reducing fiw in contrast to our expectations, we did not identify a relationship between wfc and professional efficacy. previous studies showed that professional efficacy is positively associated with wif and negatively associated with fiw. wfc among individuals with preschool - aged children may be different from wfc among parents with older children. another explanation is that the nature of professional efficacy, which is different from the other two dimensions of the mbi - gs, may reflect a personal characteristic rather than a genuine burnout component.38 the cross - sectional nature of this study did not allow causal assumptions ; thus, our results should be confirmed by a longitudinal study. second, our data were obtained by self - report questionnaires, which could cause reporting bias. third, some important occupational factors, such as irregular work schedules, overtime work, personal income, shift work, and working position, were not included in this analysis. fourth, selection bias may exist because the characteristics of the excluded subjects may differ from those of the study participants. fifth, our sample was limited to only the hirosaki university school of medicine and its affiliated hospitals, which could limit the generalizability of our results. our study revealed that occupational stress affected psychological health and that wfc was a mediator in this relationship in japanese mental health nurses. in addition, the promotion of an adequate work - life balance among nurses may aid in the prevention of depression. however, the interpretation of our results was hampered by the lack of data on personal income, working hours, and organizational commitment. furthermore, longitudinal investigation of the factors associated with wfc may yield practical information that is useful for administrative and psychological interventions.
|
backgroundoccupational stress among mental health nurses may affect their psychological health, resulting in reduced performance. to provide high - quality, sustainable nursing care, it is necessary to identify and control the factors associated with psychological health among mental health nurses. the purpose of this study was to examine the role of work family conflict (wfc) in the well - known relationship between occupational stress and psychological health among mental health nurses in japan.methodsin this cross - sectional study, data were gathered from 180 mental health nurses who had a coresident child or were married. data from the work family conflict scale, the generic job stress questionnaire, the maslach burnout inventory - general survey, and the center for epidemiologic studies for depression scale were obtained via self - report questionnaires. the effects of occupational stress and wfc on psychological health were explored by hierarchical linear regression analysis.resultsthe relationship between emotional exhaustion and occupational factors, including quantitative workload and the variance in workload, disappeared with the addition of wfc (each work interference with family [wif ] or family interference with work [fiw ]). the relationship between emotional exhaustion and mental demands disappeared only with the addition of wif. the relationship between depressive symptoms and variance in workload disappeared with the addition of wfc (each wif or fiw).conclusionour findings may encourage hospital administrators to consider the risks of medical staff wfc. furthermore, longitudinal investigations into the factors associated with wfc are required for administrative and psychological interventions.
|
even if rarely, breast cancer (bc) affects men. to date, in western countries, male breast cancer (mbc) is 2% in total) in the ashkenazi jewish male population than the general population of the united states,,,. recently were studied specific brca - associated phenotypes otherwise identified in mbc, ; it was discovered that most of the mbc brca1-related are negative her2 (her2), and grade 3 tumors show high proliferative activity. in the study that we propose, we evaluated the clinical pathological characteristics, biological and genetic implications, treatment and prognosis of cases of mbc treated in the breast unit of the hospital it was performed analysis regarding cases of mbc treated in twenty years in a single center. inclusion criteria were male patients > 18 years with localized breast cancer, locally advanced or metastatic. we excluded from the study patients who had no follow - up after initial diagnosis. all the diagnosis of breast cancer had preoperative histological confirmation ; tumoral staging was performed with the 2007 edition of the tnm classification. the tumor histological classification was performed using the scarff - bloom and richardson (sbr) system histology. immuno histochemical analysis to determine the estrogen (er) and progesterone receptor (pr) status was performed using standard procedures on 4 micron paraffin sections of tissue samples stained with the monoclonal antibodies 6f11 and 1a6 for er and pr, respectively. the description of the clinical data was produced in percentage or in terms of mean and median standard deviation. survival was calculated using the kaplan meier method, and for the evaluation of the relationship between the explanatory variables was used the program xlstat the treatment of each patient was determined by the medical staff of the breast unit, while the consent, signed by all the patients, was approved by the multidisciplinary oncology group and by the ethics committee of the hospital. it was performed analysis regarding cases of mbc treated in twenty years in a single center. inclusion criteria were male patients > 18 years with localized breast cancer, locally advanced or metastatic. we excluded from the study patients who had no follow - up after initial diagnosis. all the diagnosis of breast cancer had preoperative histological confirmation ; tumoral staging was performed with the 2007 edition of the tnm classification. the tumor histological classification was performed using the scarff - bloom and richardson (sbr) system histology. immuno histochemical analysis to determine the estrogen (er) and progesterone receptor (pr) status was performed using standard procedures on 4 micron paraffin sections of tissue samples stained with the monoclonal antibodies 6f11 and 1a6 for er and pr, respectively. the description of the clinical data was produced in percentage or in terms of mean and median standard deviation. survival was calculated using the kaplan meier method, and for the evaluation of the relationship between the explanatory variables was used the program xlstat the treatment of each patient was determined by the medical staff of the breast unit, while the consent, signed by all the patients, was approved by the multidisciplinary oncology group and by the ethics committee of the hospital. santa maria in terni, italy, with a diagnosis of breast cancer between january 1995 and december 2014 were retrospectively analyzed and evaluated in terms of general characteristics and survival. the median time for the consultation was 28 months (range : 348 months). according to the tnm classification, tumors were classified as t1 : 4 cases (9%), t2 : 9 (18.5%), t4 and t3, 25 and 9 cases, respectively, 52.5% and 20%. in 27 patients (57.2%), locally advanced disease was classified as n1, while in 25.2% of cases (12 patients) was classified as n2. he was diagnosed with invasive ductal carcinoma (idc) in 45 cases (95%) ; for the two remaining cases this was infiltrating ductal carcinoma with paget 's disease of the breast (2.5%) and infiltrating lobular carcinoma (ilc) (2.5%). according to the classification scarff - bloom richardson grade ii or iii was predominant (82% of cases). axillary lymph nodes containing metastases (n+) in 79.4% of cases (39 patients). both estrogen receptor (er) and progesterone receptor (pr) were positive in 67% (31 patients). santa maria in terni, italy, with a diagnosis of breast cancer between january 1995 and december 2014 were retrospectively analyzed and evaluated in terms of general characteristics and survival. the median time for the consultation was 28 months (range : 348 months). according to the tnm classification, tumors were classified as t1 : 4 cases (9%), t2 : 9 (18.5%), t4 and t3, 25 and 9 cases, respectively, 52.5% and 20%. in 27 patients (57.2%), locally advanced disease was classified as n1, while in 25.2% of cases (12 patients) was classified as n2. he was diagnosed with invasive ductal carcinoma (idc) in 45 cases (95%) ; for the two remaining cases this was infiltrating ductal carcinoma with paget 's disease of the breast (2.5%) and infiltrating lobular carcinoma (ilc) (2.5%). according to the classification scarff - bloom richardson grade ii or iii was predominant (82% of cases). axillary lymph nodes containing metastases (n+) in 79.4% of cases (39 patients). both estrogen receptor (er) and progesterone receptor (pr) were positive in 67% (31 patients). thirty - four patients (71%) were treated with radical mastectomy (rm), while the modified radical mastectomy (mrm) was performed in three cases ; in the other three cases was performed simple mastectomy (sm), without lymph node dissection, and in only one case was performed lumpectomy. in six patients (13%) was determined only palliative treatment. twenty - three patients of thirty - four patients received radiation therapy ; the median dose delivered was 50 gy to the breast, chest wall and regional lymph nodes. chemotherapy (anthracycline - based protocol, ac60 or fec 100) was given in the neoadjuvant situation in two cases, in adjuvant situation in nine cases. hormone therapy was delivered in twenty patients adjuvant situation : tamoxifen alone in 20 cases, tamoxifen with orchiectomy in one case. table 2 summarizes the methods of treatment according to the tnm stage. during the median follow - up of 38 months (3168 months) ; evolution has been characterized by local recurrences in eight cases (17% of all patients). the site of bone metastases was in six cases ; lung in four cases ; liver in two cases ; liver and skin in one case and pleura and skin in one case. the 5 and 10 year overall survival (os) rates were 63% and 55%. male breast cancer has many similarities to breast cancer in women, but there are distinct functions that need to be appreciated. in recent years, there has been an increase in the incidence of this disease. review of surveillance, epidemiology and end result data (seer) indicate an increased incidence of male breast cancer, from 1.0 per 100,000 men in the late 1970s to 1.2 per 100,000 men from 2000 to 2004, ; this value of incidence has increased steadily, so that in some countries have already led to 1.4 per 100,000 men. the average age at diagnosis for men with breast cancer is 67 years, which is about 510 years the average age at diagnosis for women,. the average age of our patients (62 years) is slightly lower than that of other series. the male breast cancer is probably caused by the concomitant effects of various risk factors, including clinical disorders related to hormonal imbalances, some occupational exposures and environmental and genetic risk factors, for example, a family history of breast cancer and mutations in the breast cancer predisposing genes, like the brca genes, and possibly other. similar to breast cancer in women, mbc is likely to be caused by the concurrent effects of different risk factors, including clinical disorders relating to hormonal imbalances, certain occupational and environmental exposures, and genetic risk factors, for instance a positive family history (fh) of breast cancer (bc) and mutations in bc predisposing genes, such as brca genes, and possibly others. as is the case in female bcs, mbcs are highly sensitive to hormonal changes. in particular, hormonal imbalance between an excess of estrogen and a deficiency of testosterone increases the risk of the disease. this imbalance may occur endogenously due to testicular abnormalities, including, undescended testes, congenital inguinal hernia, orchitis, orchiectomy and testicular injury. in general, liver damage and disease, caused by the effects of several drugs or their metabolites, may affect hepatic functions and lead to hyperestrogenism. obesity is one of the most common causes of hyperoestrogenization in men because of increased peripheral aromatization of androgens. klinefelter s syndrome, characterized by 47xxy karyotype, testicular dysgenesis, gynecomastia, low testosterone concentrations and increased gonadotrophins, is strongly associated with mbc risk. individuals with this syndrome have a 2050 times higher risk over the general male population. an upset in estrogen or androgen balance is a causal factor in gynecomastia, which is extremely common in pubescent boys, may occur in men over the age of 50 and is found in 638% of male pts affected by bc. however, the incidence of gynecomastia in mbc pts is no higher than in the general male population ; gynecomastia, therefore, does not in itself seem to represent a risk factor for mbc,. as in women, ionizing radiations have been considered as possible causal cofactors in the etiology of mbc,. occupational exposure to heat and electromagnetic radiation are postulated to be linked to mbc risk. a higher frequency of breast cancer is reported in men who have worked in hot environments, such as blast furnaces, steel works, rolling and finishing mills,, possibly because long - lasting exposure to high ambient temperatures can lead to testicular failure. as for women, alcoholic beverages seem to represent a risk factor for the development of mbc, with an increase of 16% for each increase of 10 g / day of alcohol intake. moreover, strong consumers of alcoholic beverages (more than 90 g / day) present a 6-fold increased or to develop mbc when compared to light consumers (< 15 g / day),. overall, with the exception of alcohol consumption, dietary factors seem to play a marginal role in the etiology of mbc. similar to fbc, a positive fh of bc is associated with increased risk of mbc. data from population - based studies have shown that about 20% of all mbc pts have a history of bc in a first - degree female relative,,,,,,. in general, a positive fh of either female or male breast cancer among first - degree relatives confers a 23-fold increase in mbc risk,,,,,,,,,,,,,. the risk increases with increasing numbers of first - degree relatives affected and with early onset in affected relatives. in addition to bc families, mbc cases have also been reported in families with the hereditary non - polyposis colorectal cancer (hnpcc) syndrome, and cowden syndrome,. a personal history of a second primary tumor is reported in more than 11% of mbc pts,. mbc predisposition can result from germ - line mutations in the high - penetrance brca2 (omim # 6600185) and, with lower frequency, brca1 (omim # 113705) genes. the presence of mbc within high - risk bc families indicates a high likelihood of brca2 mutations with a frequency ranging from 60 to 76%, whereas brca1 mutations frequency ranges from 10 to 16%,,,. brca2 mutations are currently considered as the major genetic risk factor for mbc, however, there is no evidence for a correlation between the location of the mutation within brca2 gene and risk of mbc. the median age at bc diagnosis among brca2 mutation carriers is earlier (median, 58.8 years) than that of negative cases (median, 67.9 years). male carriers of brca2 germ - line mutations have a higher risk of developing bc than men in the general population. male brca2 mutation carriers have been estimated to have a lifetime risk of 6.9% for developing bc, which is approximately 80100 times higher than in the general population. the most common clinical sign of breast cancer onset in men is a painless palpable swelling sub areolar. other symptoms may include involvement nipple, with retraction and/or ulceration and/or bleeding, axillary lymphadenopathy and gynecomastia,. because male breast lobules has not fully formed, the male type of breast cancer is the most common invasive ductal carcinoma (idc) (8595%),. the result of our study was comparable with a ratio of 95% for idc and this was significantly higher than the other histological types. lobular carcinoma in situ, paget 's disease, and inflammatory breast cancer have rarely been described in males. positivity rate receptor is more common in men with breast cancer, compared to women. in several studies, er and pr positivity was reported 7593%,. in our study, both the estrogen receptor (er) and progesterone receptor (pr) were positive in 67%. however, recent studies are in favor of the amendment radical mastectomy or simple combination with radiotherapy. postoperative radiotherapy does get local control, but no effect was observed on survival. in men treated with mastectomy, adjuvant radiation therapy has been shown to decrease local recurrence. tamoxifen has been shown to lead to increased survival rates in women with hormone - sensitive disease and today is generally considered the standard adjuvant treatment for male breast cancer hormone - dependent. the tolerance of the drug has not been sufficiently studied in males, and its main side effects are deep vein thrombosis, reduced libido, impotence, mood swings and hot flashes. the chemotherapy should be used in case of absence or doubt on endocrine - reactivity. the taxanes may be considered when the lymph nodes are involved. regarding the use of adjuvant trastuzumab, since there are no specific data, its use should be considered based on the patient and tumor characteristics. the survival rate at 5 and 10 years overall patient with male breast cancer are about 60 and 40%, respectively,. the number of histologically positive axillary lymph nodes and tumor size were significant prognostic factors. another negative prognostic factor is the advanced age at the time of diagnosis, as the increased presence of comorbidities may limit the possibility of treatment. we believe, while recognizing that much will be clarified by a better knowledge of their genetic engineering and epigenetic, extremely important collection of studies and pilot retrospective series. efforts to develop randomized, prospective studies in cooperative groups and other consortia clinical trials are essential. alessandro sanguinetti, nicola avenia : participated substantially in conception, design, and execution of the study and in the analysis and interpretation of data ; also the drafted and editing of the manuscript. andrea polistena, roberta lucchini, massimo monacelli, sergio galasse, stefano avenia, roberta triola, walter bugiantella, fausto rondelli, roberto cirocchi : participated substantially in conception, design, and execution of the study and in the analysis and interpretation of data.
|
highlightsmale breast cancer (mbc) is a rare disease representing less than 1% of all malignancies in men andonly 1% of all incident breast cancers.management consisted especially of radical mastectomy ; followed by adjuvant radiotherapy and hormonal therapy with or without chemotherapy.future research for better understanding of this disease at national or international level are needed to improve the management and prognosis of male patients.
|
the major causes of ischemic strokes are occlusion of cerebral arteries either by a cardiac embolus or by thrombus formation in atherosclerotic vessel walls. the process of thrombus formation is initiated by two separate but interacting mechanisms : fibrin formation and platelet activation. thrombolytic therapy is the only approved treatment for acute cerebral ischemia in order to recanalize the occluded artery and reestablish the blood flow(1).however, benefit from this treatment rapidly declines over time after symptom onset. the number needed to treat to have one patient with favorable outcome is 4 - 5 treatment started within 90 minutes after symptom onset((2). this number increases to 14 if the treatment has been started between 3 to 4.5 hours after symptom onset(2,3). within this current time window, early recanalisation is strongly associated with improved functional outcomes and reduced mortality (4,5). for this purpose the duration of the ischemia should be considered as an important factor of the viability of neurons in the penumbra. there are several reports of good outcomes and recovery after treatment of acute stroke with thrombolytic therapy within 4.5 hours after the onset (6,8). today only a small proportion of stroke patients in iran have the benefit of thrombolytic therapy. the reasons are delaying in referring patients, local unavailability of thrombolytic therapy, fear of hemorrhagic transformation and limited number of existing stroke units. there is scarce data about r - tpa usage in the middle - east. the aim of this study was to evaluate the feasibility, outcome and safety of intravenous thrombolysis with r - tpa in acute ischemic stroke patients treated in a university hospital with a unit specialized in early stroke treatment. the population studied was patients admitted and treated with intravenous r - tpa during the first two years from implementation of this therapy. we prospectively recorded all patients treated with intravenous (iv) r - tpa for ischemic stroke at our hospital between august 2010 and august 2012 in an ongoing register. all patients with acute ischemic stroke admitted within the first four and half hours of stroke onset were considered for intravenous thrombolytic therapy. inclusion and exclusion criteria for systemic r - tpa treatment were those of the national institute of neurological disorders and stroke (ninds) study. this study was conducted at stroke unit of firoozgar university hospital, affiliated to tehran university of medical sciences. patients who were treated with intravenous thrombolysis between august 2010 and august 2012 were included in the study. patients admitted to our hospital with acute stroke were first examined clinically in the emergency room. brain ct scan was performed as soon as possible and interpreted by an experienced neuro - radiologist. a total of 37 patients were treated with intravenous r - tpa within 4.5 hours from symptom onset. intravenous r - tpa (0.9 mg / kg) was prescribed in eligible patients with acute ischemic stroke within 4.5 hours after the onset. the protocol of r - tpa administration was based on the research supported by the the national institute of neurological disorders and stroke (ninds). patients received 0.9 mg / kg of iv r - tpa (alteplase ; actilyser), 10% as bolus and 90% as continuous infusion over 60 min, up to a maximum of 90 mg. iv r - tpa was administered immediately after screening and admission to the emergency room or stroke unit. most of the exclusion criteria were similar to the guidelines proposed by the american heart association and american stroke association. variables were biographic information of patients, time of arrival to hospital, time of r - tpa administration, dosage of r - tpa, and follow up information. the patients or their family completed a consent form for application of their information in the study. a cerebral ct scan was performed before discharge if the neurological status did not improve or immediately if it deteriorated. intracerebral hemorrhage (ich) was categorized primarily as symptomatic versus asymptomatic, based on the ninds trial. symptomatic ich was defined as a ct - documented hemorrhage related to clinical deterioration as judged by the treating physician. asymptomatic hemorrhagic transformation refers to evidence of post - treatment ich on t2-weighted mri or ct without clinical evidence of neurological deterioration, i.e. national institutes of health stroke scale (nihss) within three points of pre - treatment score. any deterioration of symptoms or signs was a criterion for performing a brain ct - scan without contrast for ruling out of hemorrhagic transformation. if there was no deterioration of symptoms or signs, the brain ct was performed after 24 hours of stroke onset to decide on initiation of anti - platelet therapy. in this cross - sectional study, asymptomatic ich has been considered as ich visible on brain ct after 24 hours without any deterioration of symptoms. statistical analysis : patients were classified into three major groups : symptomatic ich, asymptomatic ich, and no ich. chi - square test and t - test were used for qualitative and quantitative data, respectively. statistical significance for intergroup differences was assessed by student s t - test for continuous variables, mann - whitney u test for nonparametric data, and fisher exact test for categorical comparisons. thirty seven patients with acute ischemic stroke who treated with r - tpa were evaluated. the mean age of participants was 70.2 10.9 years (range 44 to 87 years). the overall mean nihss score before administration of r - tpa was 15.4 4.6 (range 7 to 25). the mean symptom to - needle time was 186 61 minutes (range 50 to 270 minutes). thirteen (35.1%) of them were female and 24 (64.9 %) were male. the mean dose of administered r - tpa was 60.5 12.04 mg (50 - 90 mg). there were hemorrhagic transformations in 9 (24%) patients of which 5 patients were male and 5 were female. seven (18%) cases of hemorrhagic transformations were found incidentally within 24 hours control brain ct without any deterioration of neurologic symptoms (asymptomatic ich), one of them had ich after 48 hours and the other had ich after 72 hours that were associated with decrement of the level of consciousness (symptomatic ich). there were no significant differences in r - tpa dosage and cva (cerebrovascular accident) to r - tpa time between patients with and without hemorrhagic transformation (p=0.51). mean systolic and diastolic blood pressure was higher in patients with symptomatic hemorrhagic transformation, but this difference was not significant (p=0.09). there were no significant differences between non - hemorrhagic post r - tpa and asymptomatic post r - tpa hemorrhagic outcome and prognosis according to nihss, barthel (p=0.3) and mrs (modified rankin scale) (p=0.2) scale in the two groups (table 1). mrs (modified rankin scale) nihss (national institutes of health stroke scale) there were no significant association between occurrence of symptomatic or asymptomatic hemorrhagic transformation with history of diabetes mellitus (p= 0.7), hypertension (p= 0.9), atrial fibrillation (p= 0.3), previous history of cva (p= 0.7), tia (p= 0.6) and hyperlipidemia (p= 0.3). hospitalization was significantly longer in hemorrhagic group in comparison to non - hemorrhagic group (p=0.04). the results of this clinical study suggest that intravenous thrombolytic therapy for ischemic stroke is feasible and safe in a hospital setting in the treatment of acute stroke in iranian patients. overall outcome will only be improved when the majority of these patients can be given the benefit of thrombolytic therapy. however, the treatment s safety must be guaranteed by a defined quality of structure, process and outcome. prior to introduction of intravenous thrombolysis as a treatment option for acute ischemic stroke in our department, most of the patients considered for this therapy could not receive thrombolytic therapy, mainly because of the time limit. broad education of the public and referring physicians regarding the importance of early treatment may help to shorten these time intervals. improvement in pre - hospital and in - hospital fast - track mechanisms may further improve the outcome. chiu (10) prospectively investigated 30 patients in the houston area treated with intravenous r - tpa. they concluded that r - tpa administration is feasible, safe, and efficacious when guidelines are carefully followed in an urban setting. in the assg report (11), 32 (35%) of 93 patients given r - tpa within 8 hours of stroke onset had evidence of blood on a computed tomogram (ct) done at 24 hours. moreover, in the nih trial, three symptomatic intracerebral hematomas (parenchymal hemorrhages) were documented clinically and by ct (within 24 hours) in the 0- to 90-minute group (4%) and two in the 91- to 180-minute group (10%)(12). in our study there were no association between the duration of cva to r - tpa administration and occurrence of ich (neither symptomatic nor asymptomatic ich). ich following r - tpa is due to reperfusion of cerebral vessels which their integrity has been disrupted by severe ischemia (13,14). two publications have been reported on the risk factors of hemorrhagic transformation in patients who were treated with r - tpa after ischemic stroke, including ninds (national institute of neurological disorders and stroke) and ecass (european cooperative acute stroke study)(15)(16). hemorrhagic transformations have been classified according to their appearance on ct in the ecass, including hemorrhagic infarction (hi) and parenchymal hemorrhage (ph)(17,18). also hemorrhagic transformations were classified into symptomatic or asymptomatic intracerebral hemorrhages in the ninds r - tpa stroke trial. in contrast to the ninds and ecass (916), there were no significant association between nihss of patients at admission and the risk of hemorrhagic transformation in our study, this might be due to strict consideration of r - tpa protocol in our stroke center. risk factors for symptomatic intracerebral hemorrhage in the ninds r - tpa stroke trial were the severity of neurological deficit at baseline, the presence of ischemic changes on pretreatment ct scan, and treatment with r - tpa(9). high blood pressure, congestive heart failure and cardio - embolic stroke has been related to intracranial hemorrhage after r - tpa for ischemic stroke in both experimental and clinical settings (17 - 19). larrue and colleagues reported that there were increased risk of hemorrhagic transformation in patients with cardio - embolic stroke, patients with congestive heart failure and patients with higher systolic blood pressure (20). in our study the symptomatic ich was associated with the high systolic blood pressure and atrial fibrillation with risk of hemorrhagic transformation (neither symptomatic nor asymptomatic ich).. there is association between history of diabetes mellitus and serum glucose on admission and risk of symptomatic ich. in long - standing diabetes, chronic micro - vascular damage may predispose vessels to rupture in the setting of ischemia (21). this factor may lead to increased hemorrhagic transformation (22). in our study there was no significant association between history of diabetes mellitus and symptomatic ich occurrence (neither symptomatic nor asymptomatic ich). as chiu described in their study, we also demonstrated that if the protocol is followed carefully, taking r - tpa is feasible and safe in our community. in conclusion, thrombolysis in acute ischemic stroke in iranian patients is safe and feasible provided that hospitals equipped with stroke unit and attached strictly to the guideline.
|
background thrombolytic therapy is the only approved treatment for acute cerebral ischemia. the hemorrhagictransformation is the greatest complication of this treatment, which may occur after recanalization of occludedartery. the aim of this study was to determine factors associated with clinical improvement and worseningin patients with acute ischemic stroke treated with intravenous thrombolysis.methods thirty seven patients who were treated with intravenous thrombolysis between august 2010 andaugust 2012 who had the inclusion criteria were studied. in this prospective study, all of the admitted patients instroke unit, monitored for at least 48 hours. we registered all patients information in a stroke data registry andfollowed them for at least 6 months.results thirty seven patients with acute ischemic stroke who treated with recombinant tissue plasminogenactivator (r - tpa) were studied. there were hemorrhagic transformations in 9 (24%) patients. seven of them(18%) revealed intracerebral hemorrhages (ich) within the control brain ct after 24 hours without any deteriorationof neurologic symptoms (asymptomatic ich). although outcomes of patients with symptomatic post r - tpa hemorrhages were worse than non - hemorrhagic post r - tpa patients, there were no significant differencesbetween asymptomatic post r - tpa hemorrhages and non - hemorrhagic post r - tpa patients, according to thenational institutes of health stroke scale (nihss) at admission (p = 0.2), after 24 hours (p= 0.07) and after 7days (p= 0.06) post treatment.conclusion if the r - tpa protocol is followed carefully, the risk of symptomatic hemorrhage is low (about7%). taking r - tpa was feasible and safe in our study population ; thus, it can be applied for other iranian patients.
|
the avon longitudinal study of parents and children (alspac) is a uk birth cohort study examining the determinants of development, health, and disease during childhood and beyond. 14,541 women were enrolled, provided that they were resident in avon while pregnant and had an expected delivery date between april 1, 1991 and december 31, 1992. a total of 13,978 children (alive at 1 year) formed the original cohort. ethical approval for the study was obtained from the alspac law and ethics committee and the local research ethics committees. informed consent was obtained from the parents of the children. from the first trimester of pregnancy, parents have completed postal questionnaires about the study child 's health and development, while the child has attended annual assessment clinics, including face - to - face interviews and psychological and physical tests. at a mean age of 12.9 years, psychotic - like symptoms were assessed using the semi - structured, face - to - face psychosis - like symptoms interview (pliksi). the pliksi comprises 12 psychotic symptoms, encompassing hallucinations, delusions, and thought interference over the previous 6 months. the items are derived from the diagnostic interview schedule for children version iv (disc - iv) and the schedules for clinical assessment in neuropsychiatry version 2.0 (scan). two pliks variables were considered : probable / definite (1 of the 12 pliks items was suspected or definitely present), and definite (1 of the 12 pliks items were definitely present). in all, 34 mothers (0.6%) reported no school change ; 2,698 (49.5%) reported 1 school change ; 2,267 (41.7%) reported 2 school changes ; and 446 (8.2%) reported 3 school changes. because of the skewed distribution of responses (very few responses for higher frequencies), we constructed a dichotomous variable : no school mobility was coded as 0, 1, or 2 different schools and school mobility as 3 or more different schools. as indicated by the distribution of the data this reflects the progression through the english school system, typically beginning with nursery or preschool at 4 years of age ; reception class at 5 years of age (american equivalent, kindergarten) ; and primary school from 6 to 11 years of age (american equivalent, elementary school). we used a cut - off point of 3 to indicate school mobility as consistent with previously reported definitions of mobile students. residential mobility was mother - reported when the child was approximately 5, 6, 7, and 8 years of age. assessment points were selected to match the period defined for school mobility as closely as possible. a total of 3,748 mothers (61.1%) reported no home moves ; 1,565 (25.5%) reported 1 home move ; 607 (9.9%) reported 2 home moves ; and 218 (3.5%) reported 3 home moves. unlike natural school progression changes (e.g., nursery to reception), home moves are not normative as the child progresses through school ; therefore, we chose a lower threshold of 2 moves to indicate residential mobility. bully victimization was assessed at 10 years by child report with the bullying and friendship interview schedule. bully victimization was coded as present if the child reported being relationally (e.g., other children not wanting to play with him, spreading rumors about him) and/or overtly bullied (e.g., having been hit or beaten up, having been called nasty names), either frequently (more than 4 times in the last 6 months but less than once per week) or very frequently (at least once per week) at 10 years. similarly, bully status was coded as present if the child reported relationally (e.g., would not play with others to upset them, told lies / said nasty things about others) and/or overtly bullying others (e.g., hit / beat up others, threatened/ blackmailed others) frequently or very frequently at 10 years. bully victimization and bully status at 10 years were very highly correlated. to avoid problems with multicollinearity within the path analysis, we collapsed these variables to create involvement in bullying indices : 0 = no involvement ; 1 = involvement as a bully or victim ; and 2 = involvement as a bully and victim. assessment of friendships was based on questions from the cambridge hormones and moods project friendship questionnaire. children were asked five questions during clinic sessions, for example, do your friends understand you, or responses (ranging from 0 to 3) were summed to create a friendship scale from 0 to 15, with 0 denoting the most positive friends score and 15 the least positive. level of urbanicity was ascertained at birth and was coded in line with previous research as 0 = village / hamlet, 1= urban / town. multiple social risk factors during pregnancy and from birth to 2 years were assessed using the family adversity index (fai). the fai consists of 18 items (e.g., financial difficulties, maternal affective disorder). if an adversity item was reported, it was coded as 1 point, and the points were then summed to derive a total fai index score for each time point. the 2 fai scores (pregnancy, 02 years) were summed and incorporated into the analysis as a continuous variable. ethnic background of the child was based on the ethnicity of the mother and her partner. if the mother and/or her partner reported non - white ethnicity, unadjusted and adjusted associations between psychosocial factors, school mobility, peer difficulties, and subsequent psychotic - like symptoms were computed. unadjusted associations between psychosocial factors and subsequent school mobility, and school mobility and subsequent peer difficulties, were also computed. results are reported in odds ratios (ors) and 95% confidence intervals (cis) for dichotomous outcomes and coefficients for continuous outcomes. using mplus version 6, we modeled the pathways via which psychosocial factors and school mobility may be associated with subsequent psychotic - like symptoms. probit estimation is recommended for path analysis with both categorical (e.g., school mobility) and continuous (e.g., friendship score) endogenous variables. probit regression is a log - linear approach analogous to logistic regression, producing similar statistics, p values, and conclusions to logit models. probit regression coefficients indicate the strength of the relationship between the predictor variable and the probability of group membership. they represent the change in the probability of caseness associated with a unit change in the independent variable ; thus, it is important to keep the scale of the predictor in mind when interpreting probit coefficients. for example, a probit coefficient of 0.034 indicates that each 1-point increase in the family adversity index resulted in an increase of 0.034 standard deviations in the predicted z score of psychotic - like symptoms. thus, one would expect probit values to be larger for dichotomous predictors, which represent the change from no caseness (i.e., school mobility) rather than a single value on a continuous scale. the weighted least squares means and variance (wlsmv) estimator (weighted least squares with robust standard errors, mean and variance adjusted) was used, yielding probit coefficients for categorical outcomes and normal linear regression coefficients for continuous outcomes. the avon longitudinal study of parents and children (alspac) is a uk birth cohort study examining the determinants of development, health, and disease during childhood and beyond. 14,541 women were enrolled, provided that they were resident in avon while pregnant and had an expected delivery date between april 1, 1991 and december 31, 1992. a total of 13,978 children (alive at 1 year) formed the original cohort. ethical approval for the study was obtained from the alspac law and ethics committee and the local research ethics committees. informed consent was obtained from the parents of the children. from the first trimester of pregnancy, parents have completed postal questionnaires about the study child 's health and development, while the child has attended annual assessment clinics, including face - to - face interviews and psychological and physical tests. at a mean age of 12.9 years, psychotic - like symptoms were assessed using the semi - structured, face - to - face psychosis - like symptoms interview (pliksi). the pliksi comprises 12 psychotic symptoms, encompassing hallucinations, delusions, and thought interference over the previous 6 months. the items are derived from the diagnostic interview schedule for children version iv (disc - iv) and the schedules for clinical assessment in neuropsychiatry version 2.0 (scan). two pliks variables were considered : probable / definite (1 of the 12 pliks items was suspected or definitely present), and definite (1 of the 12 pliks items were definitely present). at a mean age of 12.9 years, psychotic - like symptoms were assessed using the semi - structured, face - to - face psychosis - like symptoms interview (pliksi). the pliksi comprises 12 psychotic symptoms, encompassing hallucinations, delusions, and thought interference over the previous 6 months. the items are derived from the diagnostic interview schedule for children version iv (disc - iv) and the schedules for clinical assessment in neuropsychiatry version 2.0 (scan). two pliks variables were considered : probable / definite (1 of the 12 pliks items was suspected or definitely present), and definite (1 of the 12 pliks items were definitely present). mothers reported school mobility when children were approximately 9 years of age. in all, 34 mothers (0.6%) reported no school change ; 2,698 (49.5%) reported 1 school change ; 2,267 (41.7%) reported 2 school changes ; and 446 (8.2%) reported 3 school changes. because of the skewed distribution of responses (very few responses for higher frequencies), we constructed a dichotomous variable : no school mobility was coded as 0, 1, or 2 different schools and school mobility as 3 or more different schools. as indicated by the distribution of the data, most children experienced 1 or 2 school changes. this reflects the progression through the english school system, typically beginning with nursery or preschool at 4 years of age ; reception class at 5 years of age (american equivalent, kindergarten) ; and primary school from 6 to 11 years of age (american equivalent, elementary school). we used a cut - off point of 3 to indicate school mobility as consistent with previously reported definitions of mobile students. residential mobility was mother - reported when the child was approximately 5, 6, 7, and 8 years of age. assessment points were selected to match the period defined for school mobility as closely as possible. a total of 3,748 mothers (61.1%) reported no home moves ; 1,565 (25.5%) reported 1 home move ; 607 (9.9%) reported 2 home moves ; and 218 (3.5%) reported 3 home moves. unlike natural school progression changes (e.g., nursery to reception), home moves are not normative as the child progresses through school ; therefore, we chose a lower threshold of 2 moves to indicate residential mobility. bully victimization was assessed at 10 years by child report with the bullying and friendship interview schedule. bully victimization was coded as present if the child reported being relationally (e.g., other children not wanting to play with him, spreading rumors about him) and/or overtly bullied (e.g., having been hit or beaten up, having been called nasty names), either frequently (more than 4 times in the last 6 months but less than once per week) or very frequently (at least once per week) at 10 years. similarly, bully status was coded as present if the child reported relationally (e.g., would not play with others to upset them, told lies / said nasty things about others) and/or overtly bullying others (e.g., hit / beat up others, threatened/ blackmailed others) frequently or very frequently at 10 years. bully victimization and bully status at 10 years were very highly correlated. to avoid problems with multicollinearity within the path analysis, we collapsed these variables to create involvement in bullying indices : 0 = no involvement ; 1 = involvement as a bully or victim ; and 2 = involvement as a bully and victim. assessment of friendships was based on questions from the cambridge hormones and moods project friendship questionnaire. children were asked five questions during clinic sessions, for example, do your friends understand you, or do you talk to your friends about problems ? responses (ranging from 0 to 3) were summed to create a friendship scale from 0 to 15, with 0 denoting the most positive friends score and 15 the least positive. level of urbanicity was ascertained at birth and was coded in line with previous research as 0 = village / hamlet, 1= urban / town. multiple social risk factors during pregnancy and from birth to 2 years were assessed using the family adversity index (fai). the fai consists of 18 items (e.g., financial difficulties, maternal affective disorder). if an adversity item was reported, it was coded as 1 point, and the points were then summed to derive a total fai index score for each time point. the 2 fai scores (pregnancy, 02 years) were summed and incorporated into the analysis as a continuous variable. ethnic background of the child was based on the ethnicity of the mother and her partner. if the mother and/or her partner reported non - white ethnicity, unadjusted and adjusted associations between psychosocial factors, school mobility, peer difficulties, and subsequent psychotic - like symptoms were computed. unadjusted associations between psychosocial factors and subsequent school mobility, and school mobility and subsequent peer difficulties, were also computed. results are reported in odds ratios (ors) and 95% confidence intervals (cis) for dichotomous outcomes and coefficients for continuous outcomes. using mplus version 6, we modeled the pathways via which psychosocial factors and school mobility may be associated with subsequent psychotic - like symptoms. probit estimation is recommended for path analysis with both categorical (e.g., school mobility) and continuous (e.g., friendship score) endogenous variables. probit regression is a log - linear approach analogous to logistic regression, producing similar statistics, p values, and conclusions to logit models. probit regression coefficients indicate the strength of the relationship between the predictor variable and the probability of group membership. they represent the change in the probability of caseness associated with a unit change in the independent variable ; thus, it is important to keep the scale of the predictor in mind when interpreting probit coefficients. for example, a probit coefficient of 0.034 indicates that each 1-point increase in the family adversity index resulted in an increase of 0.034 standard deviations in the predicted z score of psychotic - like symptoms. thus, one would expect probit values to be larger for dichotomous predictors, which represent the change from no caseness (i.e., school mobility) rather than a single value on a continuous scale. the weighted least squares means and variance (wlsmv) estimator (weighted least squares with robust standard errors, mean and variance adjusted) was used, yielding probit coefficients for categorical outcomes and normal linear regression coefficients for continuous outcomes. data were available for 6,448 children who completed the psychosis - like symptoms interview (pliks) at the annual assessment clinic at 12 years. those who were lost to follow - up (54.2%) were more often boys, non white, of low birth weight, born to single mothers of lower educational level, that is, did not obtain o levels (o levels were the standard school - leaving qualification at age 16 in the united kingdom until recently, when they were replaced by the general certificate of secondary education [gcses ]), from families living in rented accommodations, and exposed to family adversity (a more detailed analysis is provided by schreier.). those students lost to attrition were also more likely to have moved school 3 times, to live in an urban area, and to have been exposed to family adversity (table s1, available online). a total of 5.6% of adolescents reported definite pliks and 13.7% suspected / definite pliks. in all, 13.4% had moved home 2 times. school and residential mobility were significantly associated with one another. mobile students were 3.5 (or = 3.66 ; 95% ci = 3.084.35) times more likely to have moved home 2 times (tetrachoric correlation = 0.23). unadjusted and adjusted associations between psychosocial factors, school and residential mobility, peer difficulties, and subsequent psychotic - like symptoms are reported in tables 1 and 2. urban residence, family adversity, residential mobility, school mobility, and peer difficulties were all significantly associated with pliks definite and probable / definite symptoms. combined bully / victim status was strongly associated with pliks definite outcome. in multiple logistic regressions, family adversity, school mobility, bullying, and negative friendship score remained significantly associated with definite pliks outcome, whereas urbanicity, family adversity, bullying, and friendship score remained significantly associated with pliks probable / definite outcome. after adjustment for all other risk factors, school mobility led to an approximately 1.5 times increased risk, and being both a bully and victim of bullying led to an approximately 2.5 times increased risk of definite pliks. associations between psychosocial factors and school mobility were assessed. family adversity (or = 1.05 ; 95% ci = 1.021.09) and ethnicity (or = 1.78 ; 95% ci = 1.16 2.75) school mobility was significantly associated with bully status (or = 1.47 ; 95% ci = 1.022.14), bully victimization (or = 1.26 ; 95% ci = 1.011.59) and negative friendship score (= 0.50 ; 95% ci = 0.290.72). we conducted 2 path models using definite and probable / definite psychotic - like symptom outcomes. based on existing literature, in the first path model we incorporated direct associations between all psychosocial risk factors (i.e., family adversity, urbanicity, and ethnicity), sex, school mobility, residential mobility, bullying involvement and subsequent psychotic - like symptoms, and indirect associations from psychosocial risk factors, sex, and school mobility to psychotic - like symptoms (figure 1 shows direct pathways within the final models). thus, urbanicity, ethnicity, sex, family adversity, and residential mobility were incorporated as exogenous (independent) variables ; school mobility and peer difficulties as independent, mediating and dependent variables ; and psychotic - like symptoms as the main endogenous (outcome) variable. the fit indices indicated that there was room for improvement in model fit (= 66.20 ; p <.001 ; root mean square error of approximation [rmsea ] = 0.026 ; comparative fit index [cfi ] = 0.85). inspection of the modification indices suggested that incorporating a pathway from family adversity to bullying involvement would improve model fit. as this pathway was consistent with the research literature, it was incorporated into the final model leading to a considerably improved model fit : definite pliks outcome (= 16.57 ; p =.17 ; rmsea = 0.008 ; cfi = 0.99) and probable / definite pliks outcome (= 16.43 ; p =.17 ; rmsea = 0.008 ; cfi = 0.99). bullying involvement was incorporated as an ordinal variable (0 = no involvement ; 1= involvement as a bully or victim ; 2 = involvement as a bully and victim) consistent with the observed dose an ordinal variable is treated as a continuous latent variable that exceeds thresholds to give the various outcome categories. direct associations among psychosocial factors, school mobility, and peer difficulties are shown in figure 1 (pathways to psychotic - like symptoms are not shown for clarity). family adversity and ethnicity predicted school mobility, whereas school mobility predicted bullying involvement and negative friendship score. direct and indirect pathways to psychotic - like symptom outcome are shown in table 3 (definite symptoms) and table 4 (probable / definite symptoms). family adversity, urbanicity, and bullying involvement were independently associated with pliks definite and probable / definite symptoms. there was a significant indirect association between school mobility and pliks (definite and probable / definite) via bullying involvement, and a significant indirect association between family adversity and pliks (definite and probable / definite) via bullying involvement. for example, the indirect effect of school mobility on definite psychotic - like symptoms via bullying involvement was 0.018, whereas the direct association between school mobility and psychotic - like symptoms was 0.108. therefore, the ratio of indirect effect to direct effect was 0.17, that is, the indirect effect was approximately one - sixth of the size of the direct effect. data were available for 6,448 children who completed the psychosis - like symptoms interview (pliks) at the annual assessment clinic at 12 years. those who were lost to follow - up (54.2%) were more often boys, non white, of low birth weight, born to single mothers of lower educational level, that is, did not obtain o levels (o levels were the standard school - leaving qualification at age 16 in the united kingdom until recently, when they were replaced by the general certificate of secondary education [gcses ]), from families living in rented accommodations, and exposed to family adversity (a more detailed analysis is provided by schreier.). those students lost to attrition were also more likely to have moved school 3 times, to live in an urban area, and to have been exposed to family adversity (table s1, available online). a total of 5.6% of adolescents reported definite pliks and 13.7% suspected / definite pliks. in all, 13.4% had moved home 2 times. school and residential mobility were significantly associated with one another. mobile students were 3.5 (or = 3.66 ; 95% ci = 3.084.35) times more likely to have moved home 2 times (tetrachoric correlation = 0.23). unadjusted and adjusted associations between psychosocial factors, school and residential mobility, peer difficulties, and subsequent psychotic - like symptoms are reported in tables 1 and 2. urban residence, family adversity, residential mobility, school mobility, and peer difficulties were all significantly associated with pliks definite and probable / definite symptoms. combined bully / victim status was strongly associated with pliks definite outcome. in multiple logistic regressions, family adversity, school mobility, bullying, and negative friendship score remained significantly associated with definite pliks outcome, whereas urbanicity, family adversity, bullying, and friendship score remained significantly associated with pliks probable / definite outcome. after adjustment for all other risk factors, school mobility led to an approximately 1.5 times increased risk, and being both a bully and victim of bullying led to an approximately 2.5 times increased risk of definite pliks. associations between psychosocial factors and school mobility were assessed. family adversity (or = 1.05 ; 95% ci = 1.021.09) and ethnicity (or = 1.78 ; 95% ci = 1.16 2.75) were significantly associated with school mobility. school mobility was significantly associated with bully status (or = 1.47 ; 95% ci = 1.022.14), bully victimization (or = 1.26 ; 95% ci = 1.011.59) and negative friendship score (= 0.50 ; 95% ci = 0.290.72). we conducted 2 path models using definite and probable / definite psychotic - like symptom outcomes. based on existing literature, in the first path model we incorporated direct associations between all psychosocial risk factors (i.e., family adversity, urbanicity, and ethnicity), sex, school mobility, residential mobility, bullying involvement and subsequent psychotic - like symptoms, and indirect associations from psychosocial risk factors, sex, and school mobility to psychotic - like symptoms (figure 1 shows direct pathways within the final models). thus, urbanicity, ethnicity, sex, family adversity, and residential mobility were incorporated as exogenous (independent) variables ; school mobility and peer difficulties as independent, mediating and dependent variables ; and psychotic - like symptoms as the main endogenous (outcome) variable. the fit indices indicated that there was room for improvement in model fit (= 66.20 ; p <.001 ; root mean square error of approximation [rmsea ] = 0.026 ; comparative fit index [cfi ] = 0.85). inspection of the modification indices suggested that incorporating a pathway from family adversity to bullying involvement would improve model fit. as this pathway was consistent with the research literature, it was incorporated into the final model leading to a considerably improved model fit : definite pliks outcome (= 16.57 ; p =.17 ; rmsea = 0.008 ; cfi = 0.99) and probable / definite pliks outcome (= 16.43 ; p =.17 ; rmsea = 0.008 ; cfi = 0.99). bullying involvement was incorporated as an ordinal variable (0 = no involvement ; 1= involvement as a bully or victim ; 2 = involvement as a bully and victim) consistent with the observed dose an ordinal variable is treated as a continuous latent variable that exceeds thresholds to give the various outcome categories. direct associations among psychosocial factors, school mobility, and peer difficulties are shown in figure 1 (pathways to psychotic - like symptoms are not shown for clarity). family adversity and ethnicity predicted school mobility, whereas school mobility predicted bullying involvement and negative friendship score. direct and indirect pathways to psychotic - like symptom outcome are shown in table 3 (definite symptoms) and table 4 (probable / definite symptoms). family adversity, urbanicity, and bullying involvement were independently associated with pliks definite and probable / definite symptoms. there was a significant indirect association between school mobility and pliks (definite and probable / definite) via bullying involvement, and a significant indirect association between family adversity and pliks (definite and probable / definite) via bullying involvement. for example, the indirect effect of school mobility on definite psychotic - like symptoms via bullying involvement was 0.018, whereas the direct association between school mobility and psychotic - like symptoms was 0.108. therefore, the ratio of indirect effect to direct effect was 0.17, that is, the indirect effect was approximately one - sixth of the size of the direct effect. using data from the alspac cohort study, we explored whether, and how, school mobility might be associated with increased risk of psychotic - like symptoms in early adolescence. first, we found that school mobility is independently associated with an increased risk of psychotic - like symptoms, even when controlling for all other psychosocial risk factors. psychologically, it can lead to the formation or exacerbation of negative schemata, such as low self - esteem and external locus of control. as negative schemata have also been associated with the development of psychotic symptoms, such schema may represent 1 mechanism by which school mobility could increase the risk of psychotic - like symptoms. in addition, repeated school change may induce feelings of social defeat (i.e., the negative experience of being excluded from the majority group), which, if chronic, may lead to sensitization of the mesolimbic dopamine system, and hence heighten the risk of psychotic - like symptoms in vulnerable individuals. second, school mobility was also associated with an increased risk of psychotic - like symptoms via bullying involvement, indicating a second indirect pathway through which school mobility may be associated with increased risk. consistent with previous research, we found a significant association between bullying involvement and psychotic - like symptoms ; involvement in bullying was the strongest predictor of psychotic - like symptoms, leading to an approximately 2.5 times increased risk. results here expand on current evidence by highlighting mobile students as an especially at risk consistent with previous research, we found that mobile students were more likely to encounter negative friendships and bullying. indeed, research suggests that mobile students tend to view themselves as insecure and to have fewer friends than their less - mobile peers. these observations are also consistent with the social defeat hypothesis of psychosis, which has been postulated as the mechanism linking social risk factors to psychosis. therefore, peer problems may add to psychosocial adversities in a cumulative way, presenting a further source of marginalization, exclusion, and social defeat. third, we found that urbanicity, ethnic status, and family adversity were independently associated with psychotic - like symptoms. consistent with previous research, we found that mobile students were more likely to have experienced family adversity and to be of ethnic minority status, suggesting that those who experience adversity and marginalization from a young age are more likely to change school more often. however, school mobility was not found to be a mediator of the association between such psychosocial risks and psychotic - like symptoms. instead, the effects of family adversity were partly mediated by involvement in bullying at school. this confirms previous research that family stresses increase the risk of involvement in bullying and adverse mental health outcomes, including psychotic - like symptoms. we used a large, longitudinal data set, and were able to take into account a number of psychosocial factors associated with school mobility and psychotic - like symptoms. using path analyses, several pathways to psychotic - like symptoms were quantified while taking into account the time ordering of exposures, enabling us to assess the potential temporal associations between school mobility, other risk factors, and subsequent psychotic - like symptoms. although we controlled for residential mobility, we were unable to distinguish between school moves with and without concomitant home moves. although many educators believe that school mobility is an inevitable consequence of moving homes, research suggests that approximately 40% of school moves are not associated with residential changes. furthermore, we did not control for any pre - existing peer difficulties or individual traits present before the child 's first entry into school, which may have contributed to subsequent school mobility and bullying experiences. this reduces statistical power and therefore works against our hypotheses, rather than inflating effects. we found that those who were lost to attrition were more likely to have moved school 3 or more times, to live in an urban area, to be of ethnic minority, and to have been exposed to family adversity. previous simulations with this longitudinal data resource indicate that selective dropout may underestimate the prevalence of psychiatric disorders but has only a small impact on associations between predictors and outcomes, even when dropout is correlated with predictor variables. third, the psychosis outcome referred to symptoms occurring over the previous 6 months only, and for some adolescents, these phenomena may have been transient and self - limiting. however, recent long - term follow - up indicates that psychotic experiences in childhood highly increase the risk of psychosis in adulthood. our study demonstrates that school mobility is independently and also indirectly associated with psychotic - like symptoms via bullying involvement. as bullying and school exclusion may significantly contribute to student mobility and are also associated with risk factors for psychosis, including social deprivation, ethnicity, and alienation from mainstream society, the impact of school exclusion on mental health outcomes may be a fruitful route of inquiry. although school moves may be unavoidable, involvement in bullying and isolation from peers are amenable to psychosocial interventions and may be a focus of attention for mobile students. reports suggest that teachers may lack the time and resources to ensure that mobile students are adequately established within new school environments. pilot schemes indicate that the addition of dedicated mobility support workers may help mobile students to successfully establish themselves within new school environments, reducing the risk of bullying involvement and other social difficulties. an awareness of mobile students as a possible high - risk population and routine inquiry regarding school changes and bullying experiences may be advisable in mental health care settings.clinical guidanceschool mobility (i.e., moving schools 3 times) during childhood may increase the risk of psychotic - like symptoms in early adolescence, both directly and indirectly via increased risk of bullying involvement.when assessing young persons with psychotic disorders, clinicians should explore history of school mobility and its psychological / emotional impact, particularly of bullying and marginalization.strategies to help mobile students to establish themselves within new school environments (e.g., through use of mobility support workers) may help to reduce peer difficulties and to diminish the risk of psychotic - like symptoms. school mobility (i.e., moving schools 3 times) during childhood may increase the risk of psychotic - like symptoms in early adolescence, both directly and indirectly via increased risk of bullying involvement.when assessing young persons with psychotic disorders, clinicians should explore history of school mobility and its psychological / emotional impact, particularly of bullying and marginalization.strategies to help mobile students to establish themselves within new school environments (e.g., through use of mobility support workers) may help to reduce peer difficulties and to diminish the risk of psychotic - like symptoms. school mobility (i.e., moving schools 3 times) during childhood may increase the risk of psychotic - like symptoms in early adolescence, both directly and indirectly via increased risk of bullying involvement. when assessing young persons with psychotic disorders, clinicians should explore history of school mobility and its psychological / emotional impact, particularly of bullying and marginalization. strategies to help mobile students to establish themselves within new school environments (e.g., through use of mobility support workers) may help to reduce peer difficulties and to diminish the risk of psychotic - like symptoms. table s1dropout analysis comparing those with and without the psychotic - like symptoms (pliks) interviewcharacteristicpliks interviewnot available, n (%) pliks interviewavailable, n (%) pliks interview not availablevs. available, or (95% ci)aschool mobility no1,989 (88.5)4,990 (91.8)[reference ] yes (3 moves)258 (11.5)446 (8.2)0.69 (0.590.81)residential mobility no3,846 (87.6)5,313 (86.6)[reference ] yes (2 moves)545 (12.4)825(13.4)1.10 (0.981.23)urbanicity rural349 (4.7)415 (6.5)[reference ] urban7,065 (95.3)5,964 (93.5)0.71 (0.610.82)ethnicity white5,592 (93.8)5,882 (96.1)[reference ] nonwhite368 (6.2)241 (3.9)0.62 (0.530.74)bullying involvement no853 (71.8)4,380 (74.9)[reference ] bullied or bully259 (21.8)1,147 (19.6)0.86 (0.741.00) bullied and bully76 (6.4)320 (5.5)0.82 (0.631.06)friendship score mean (sd)2.90 (2.22)2.96 (2.13)p =.38family adversity score3.43 (3.35)2.74 (2.99)p.001note : or = odds ratio.aboldface type indicates that the 95% ci does not include 1.00. dropout analysis comparing those with and without the psychotic - like symptoms (pliks) interview note : or = odds ratio.
|
objectivesocial adversity and urban upbringing increase the risk of psychosis. we tested the hypothesis that these risks may be partly attributable to school mobility and examined the potential pathways linking school mobility to psychotic - like symptoms.methoda community sample of 6,448 mothers and their children born between 1991 and 1992 were assessed for psychosocial adversities (i.e., ethnicity, urbanicity, family adversity) from birth to 2 years, school and residential mobility up to 9 years, and peer difficulties (i.e., bullying involvement and friendship difficulties) at 10 years. psychotic - like symptoms were assessed at age 12 years using the psychosis - like symptoms interview (pliksi).resultsin regression analyses, school mobility was significantly associated with definite psychotic - like symptoms (odds ratio [or ] = 1.60 ; 95% ci = 1.072.38) after controlling for all confounders. within path analyses, school mobility (probit coefficient [] = 0.108 ; p =.039), involvement in bullying (= 0.241 ; p <.001), urbanicity (= 0.342 ; p =.016), and family adversity (= 0.034 ; p <.001) were all independently associated with definite psychotic - like symptoms. school mobility was indirectly associated with definite psychotic - like symptoms via involvement in bullying (= 0.018 ; p =.034).conclusionsschool mobility is associated with increased risk of psychotic - like symptoms, both directly and indirectly. the findings highlight the potential benefit of strategies to help mobile students to establish themselves within new school environments to reduce peer difficulties and to diminish the risk of psychotic - like symptoms. awareness of mobile students as a possible high - risk population, and routine inquiry regarding school changes and bullying experiences, may be advisable in mental health care settings.
|
schizophrenia is still one of the most mysterious and costliest mental disorders in terms of human suffering and societal expenditure.1 as schizophrenia is a chronic psychotic disease, emerging oxidant molecules make toxic effects to neurons over the years.2 in the pathogenesis of schizophrenia, two important processes are inflammation and oxidative stress. inflammation is a complicated response to deleterious stimuli and is mediated by cytokines cascades and oxidative factors.3 there are various parameters showing the inflammation. a new, easy, and cheap option, suitable for routine use to show inflammation, is measurement of the neutrophil / lymphocyte ratio (nlr).4 nlr is associated especially with malignant diseases, cardiovascular diseases, pancreatitis, inflammatory bowel syndrome, and traumas.58 assessing the relationship between schizophrenia and nlr, the studies are limited and there is a contradiction in data.9,10 according to these studies, nlr was found to be significantly higher in patients with schizophrenia than in controls. in schizophrenic patients, there are various studies showing increment or decrement levels of antioxidant enzyme.11 the failure of antioxidant defense mechanisms causes damage on cell membranes, and it might have a negative effect on neurotransmission and the clinical course of schizophrenia.12 inflammation is one of the causes of oxidative stress. myeloperoxidase enzyme released from neutrophils plays an important role in inflammation and causes increased production of reactive oxygen metabolites. free radicals generated as a result of inflammation kill neurons and cause neuronal toxicity.3 there is only one study assessing together the oxidative stress and inflammation in patients with schizophrenia, and in the same study c - reactive protein, fibrinogen, total oxidative status (tos), and oxidative stress index (osi) values were higher in schizophrenic patients than controls.13 in the literature, there are no studies evaluating the relationship between nlr and oxidative stress parameters in patients with schizophrenia. based on these data, the aim of our study was to evaluate the relationship between nlr and total antioxidant status (tas), tos, osi, paraoxonase (pon1), and total thiol (t.thl) in schizophrenic patients compared to a healthy control group and investigate the relationship between these parameters and psychopathological symptoms. the study complies with the declaration of helsinki and was approved by the institutional ethics committee of antalya education and research hospital. in all, 64 schizophrenic patients and 61 healthy controls aged between 18 and 65 years old participated in the study. the schizophrenic patients had been diagnosed according to the diagnostic criteria of diagnostic and statistical manual of mental disorders, fourth edition, text revision and were followed for at least 2 years in the psychiatry clinic of antalya education and research hospital.14 patients were excluded from the study if they met one or more of the following criteria : alcohol and substance abuse or dependence, hypertension, heart disease, diabetes mellitus, hepatic or renal failure, autoimmune diseases, active infection, active or chronic inflammatory diseases, heavy smoking (> 15 cigarettes per day), obesity (body mass index > 30 kg / m), and treatment with antiinflammatory, antioxidant, or immunosuppressive medications. positive and negative syndrome scale (panss) scale which was developed by kay was applied to the patients.15 antecubital vein blood was taken after 12 hours of fasting from the participants for laboratory analysis. for complete blood counts, ethylenediamine tetraacetic acid anticoagulated tubes and for other parameters serum was separated by centrifugation for 10 minutes at 3,000 rpm and serum fractions were stored at 80c and used to analyze pon1, tos, tas, and t.thl concentrations. hemograms were determined by using a fully automated hematology analyzer (beckman coulter lh780 ; beckman coulter, brea, ca, usa). tos, tas, pon1, and t.thl were measured using a novel automated colorimetric measurement method developed by erel.16 in the tos method, oxidants present in the serum oxidize the ferrous ion chelator complex to ferric ion. the ferric ion makes a colored complex, which can be measured spectrophotometrically.17 in the tas method, antioxidants in the serum reduce the dark blue - green colored 2,2-azino - bis (3-ethylbenzthiazoline-6-sulfonic acid) radical to a colorless reduced form. the antioxidative effect of the serum against the potent free radical reactions initiated by the produced hydroxyl radical is measured.16 the ratio of tos level to tas level was accepted as osi. the osi value was calculated according to the following formula : osi (arbitrary unit) = tos (micromolar hydrogen peroxide equivalent per liter)/tas (micromolar trolox equivalent per liter).17 the pon1 activity measurement method consists of two different sequential reagents. hydrolysis of paraoxon was subtracted from the total rate of hydrolysis.18 serum t.thl concentration was measured by the method described by ellman19 and modified by hu.20 continuous variables are presented as mean standard deviation, while categorical variables are given as percentages. statistical analysis of clinical data between two groups consisted of unpaired t - tests for parametric data and mann whitney u - test analysis for nonparametric data. correlations were assessed with the pearson / spearman correlation coefficient and the chi - square / fisher s exact test was used for categorical variables. receiver operating characteristic (roc) curve analysis was used to determine the optimum cut - off levels of pon1, t.thl, tas, tos, and osi. using the roc curve, values for sensitivity and for false - positive rates (1 specificity) are plotted on the y- and the x - axes of the curve and the area under the curve represents the probability a measure correctly classifies patients as improved or unchanged. analyses were performed with pasw 18 (spss inc., chicago, il, usa) software and a p - value < 0.05 was considered statistically significant. continuous variables are presented as mean standard deviation, while categorical variables are given as percentages. the kolmogorov statistical analysis of clinical data between two groups consisted of unpaired t - tests for parametric data and mann whitney u - test analysis for nonparametric data. correlations were assessed with the pearson / spearman correlation coefficient and the chi - square / fisher s exact test was used for categorical variables. receiver operating characteristic (roc) curve analysis was used to determine the optimum cut - off levels of pon1, t.thl, tas, tos, and osi. using the roc curve, values for sensitivity and for false - positive rates (1 specificity) are plotted on the y- and the x - axes of the curve and the area under the curve represents the probability a measure correctly classifies patients as improved or unchanged. analyses were performed with pasw 18 (spss inc., chicago, il, usa) software and a p - value < 0.05 was considered statistically significant. in terms of sociodemographic data, patient and control groups are consistent with each other (table 1). neutrophils, nlr, tas, and tos significantly increased whereas the lymphocytes, t.thl, and t.thl/osi ratio were significantly lower in the schizophrenia patient group compared to the control group. there was no statistical difference in pon1 and osi values between groups (table 2). between panss positive subscale with leukocytes a significant positive relationship, and between panss positive subscale with lymphocytes and t.thl/osi ratio significant negative relationships were found. between panss total subscale (panss - t) with leukocytes and nlr significant positive relationships, and between panss - t with lymphocytes and t.thl/osi ratio significant negative relationships were found (table 3). in the group of patients with schizophrenia, between nlr and there was no significant correlation in the control group (table 4). in the group of patients with schizophrenia, a significant positive correlation was found between nlr with tos and osi (table 5). roc analysis of area under the curve, cut - off levels, and sensitivity and specificity values are given in table 6. inflammation and oxidative stress processes are closely associated with each other.3 chronic inflammation is associated with many diseases. in schizophrenic patients, chronic inflammation is associated with reactive oxygen radicals. as inflammation triggers oxidative stress, oxidative stress there is only one study assessing the oxidative stress and inflammation in the same time in patients with schizophrenia, and in this study c - reactive protein, fibrinogen, tos, and osi levels were significantly higher compared to controls.13 in the literature, there are studies assessing nlr and level of oxidative stress as the parameters of inflammation.911 our study is the first evaluating the relationship between oxidative stress and nlr in schizophrenia at the same time. nlr is an important indicator of inflammation and it is cheap, practical, and suitable for routine use.4 there are very few studies assessing the relationship between schizophrenia and nlr.9,10 in these studies, nlr was found higher in schizophrenic patients than controls. in our study, we have also found that nlr was significantly higher in the group of patients with schizophrenia than controls. in one study, antipsychotic drugs did not change the nlr.9 in another study, nlr was significantly higher in first episode schizophrenic patients who were not taking antipsychotic medication.10 in our study, nlr increase is due to the significant increase in the number of neutrophils and decrease in the number of lymphocyte counts. similar findings are also compatible with the study carried out with 156 schizophrenic patients by semiz.9 in literature, there are studies that found a relative increase in leukocytes or direct decrease in lymphocyte levels in patients with schizophrenia.21,22 according to our results, consistent with these data, nlr increase as an important parameter of inflammation in patients with schizophrenia plays a significant role in the pathogenesis of schizophrenia. panss is commonly used to detect psychopathological symptoms in patients with schizophrenia.15 in our study, a positive meaningful correlation between panss - t and nlr shows us that nlr is associated with not only the pathogenesis but also the clinic activity of schizophrenia. to the best of our knowledge, there is no published study comparing the panss with nlr in the literature until now. in just two studies, the relationship between nlr with bprs score was examined and no relationship was found.9,10 the cut - off value of nlr found in our study was 1.98. especially above the level of 1.98, nlr may be very practical and effective in the assessment of psychopathological status and clinical monitoring of schizophrenia patients. if nlr can be used at follow - up and clinical assessment of the schizophrenic patients, further studies are needed on this subject. according to the meta - analysis results in schizophrenia, while the levels of systemic oxidative mediators, such as malondialdehyde and nitric oxide, increased ; the levels of antioxidants, such as superoxide dismutase, catalase, and glutathione, decreased ; and lipid peroxidation in erythrocytes was found higher.23 in the literature, different data are available about oxidant and antioxidant systems in patients with schizophrenia.2426 we found that tas and tos values were significantly higher in the patient group in our study. in another study which was performed in 50 patients with schizophrenia, there were no significant differences in the mean values of tas, tos, and osi compared to the control group.24 in 30 male schizophrenic patients, tos and osi values were found to be significantly higher and no significant difference in tas and pon1 levels was found compared to the control group.13 in our study, a significant increase in tos values showed us that oxidative stress plays a role in the pathophysiology of schizophrenia. especially measuring tos values over the cut - off value of 5.9 may show a significant increase of oxidative stress in patients with schizophrenia. tas values give information about the antioxidant capacity of the organism and in the studies with schizophrenic patients, tas values have been found lower or normal compared to the control group.13,25 in a study including a total of 64 schizophrenia patients (38 with symptomatic remission and 26 without symptomatic remission), the tos, osi, and 8-hydroxydeoxiguanine levels were significantly higher in nonremission schizophrenic patients than in the controls. tos and osi levels were found to be significantly high compared to 80 healthy control subjects. in the same study, tas values were found to be significantly higher in the nonremission group compared to remission group.27 in another study, tas levels were significantly lower in the first episode schizophrenic patients.28 as shown in some studies, tas values were low at the beginning of the disease and by the activation of compensatory mechanisms, tas values were found higher in the chronic phase.28 this situation can be interpreted as the oxidative stress is more effective in the early stages in patients with schizophrenia. in our study, the patients were using antipsychotic drugs ; this may be a limitation of our study, but it was reported in the studies that antipsychotic medications used in the treatment of schizophrenia did not affect the antioxidant capacity.13,29 cysteine has a role in the defensive protein mechanism of the body, and its functional thiol group plays an important role in preventing oxidative damage. protection of cells against oxidative damage is carried out with low molecular weight of thiol and cysteine.30 there is no study assessing the t.thl in schizophrenic patients. in our study, t.thl levels were found significantly lower compared to the control group. according to our study, especially the levels of t.thl under 496.85 may show the low activity in the antioxidant defense systems of the schizophrenic patients. our study is the first that measures the t.thl value using a different method in patients with schizophrenia. the most striking finding in our study was the significant negative correlation between nlr and t.thl/osi values. the absence of this relationship in the control group makes our findings more meaningful. in our study, t.thl/osi value under 137.46 means that the patients with schizophrenia were more exposed to oxidative stress and especially in this case we believe that panss positive subscale and panss - t results must be evaluated more carefully as they reflect the clinical situation. according to our findings, a decrease in the t.thl/osi value resulted in the increase of psychopathological symptoms in schizophrenia patients. by measuring nlr, which is simple, inexpensive, and suitable for routine use, we can have information about oxidative stress and psychopathological symptoms in patients with schizophrenia. inflammation and oxidative stress are important in the pathogenesis of schizophrenia and closely related with the patients clinical symptoms. with the progress of the studies done in this regard, antioxidant medication effectiveness and its place in the treatment of schizophrenia will be better understood.
|
introductionthe aim of our study was to evaluate the relationship between neutrophil / lymphocyte ratio (nlr) and total antioxidant status (tas), total oxidative status (tos), oxidative stress index (osi), paraoxonase, and total thiol (t.thl) in schizophrenic patients compared to healthy control group and investigate the relationship between these parameters and psychopathological symptoms.methodsthe study population consisted of 61 healthy control subjects and 64 volunteer patients monitored in the outpatient clinics of psychiatry of antalya education and research hospital. hemograms were determined by using a fully automated hematology analyzer (beckman coulter lh780). serum tos, tas, paraoxonase, and t.thl were measured using a novel automated colorimetric measurement method developed by erel. sociodemographic data forms were completed by the participants. the positive and negative syndrome scale (panss) was used to assess the patients.resultsneutrophils, nlr, tas, and tos significantly increased, whereas lymphocytes, t.thl, and t.thl/osi ratio were significantly lower in the schizophrenia patient group compared to the control group. a statistically significant positive relationship was found between panss positive subscale with leukocytes and significantly negative relationships were found between panss positive subscale with lymphocytes and t.thl/osi ratio. significant positive relationships were found between panss total subscale with leukocytes and nlr. statistically significant negative relationships were found between panss total subscale with lymphocytes and t.thl/osi ratio. in the group of patients with schizophrenia, a significant negative correlation was found between nlr with t.thl/osi. in the group of patients with schizophrenia, a significant positive correlation was found between nlr with tos and osi.conclusionby measuring nlr, which is simple, inexpensive, and suitable for routine use, we can obtain information about oxidative stress and psychopathological symptoms in patients with schizophrenia. inflammation and oxidative stress are important in the pathogenesis of schizophrenia and are closely related with the patients clinical symptoms.
|
usually, multiple tumor - like lesions observed in the abdominal cavity in a patient with an ampullary cancer would be indicative of peritoneal dissemination and, consequently, of incurable disease. as illustrated by the following case, a rare benign differential diagnosis to peritoneal metastases should always be considered in the absence of other signs of inoperability. a 35-year - old man had suffered from intermittent upper abdominal pain for approximately 1 month. an ultrasound of the abdomen revealed no pathology, and routine blood tests were normal apart from an elevated p - amylase of 374 u / l (approx. 3 weeks later, the patient reported increasing fatigue and an unintended weight loss of 7 kg. on clinical examination, he was icteric. mol / l), alat was 621 u / l (normal range 1070 u / l) and alkaline phosphatase was 430 mmol / l) and thrombocytosis of 424 10/l (normal range 145350 10/l) were also found. the patient 's medical report included splenectomy following a motocross accident with blunt abdominal trauma and intra - abdominal bleeding 20 years earlier, and surgery for appendicitis the same year. the gastroduodenoscopy showed a macroscopically malignant tumor located between the first and second part of the duodenum, involving almost the entire lumen. biopsies showed an invasive, poorly differentiated adenocarcinoma of the intestinal type. a ct scan with intravenous and peroral contrast (fig. 1) revealed a tumor in the ampulla (arrow) involving the whole circumference of the duodenal lumen, but with no apparent involvement of major blood vessels or surrounding organs. in addition, multiple nodular tumors were seen in several intra - abdominal locations, giving rise to the suspicion of peritoneal metastases (fig. the nodules varied in size from a few millimeters up to 60 mm (a arrows). surgical clips from the patient 's prior splenectomy were also seen (b arrow). after these findings, the patient was referred to the multidisciplinary team conference for discussion of palliative chemotherapy. at the multidisciplinary team conference, the patient 's medical history and signs of previous surgery, including absence of the spleen and presence of multiple surgical clips in the abdominal wall, as well as the uncharacteristic appearance of the intra - abdominal lesions, raised the suspicion of diffuse posttraumatic splenosis. in support of this diagnosis, the ct scan showed slightly hypervascular lesions, with soft tissue attenuation and homogeneous enhancement in the portal venous phase. a core needle biopsy of 1 lesion showed characteristic morphological and immunohistological appearances of benign ectopic splenic tissue. the resected tumor was a poorly differentiated adenocarcinoma, originating from the papilla of vater, with intravascular and perineural growth. adjuvant treatment was offered consisting of gemcitabine 1,000 mg / m, 3 weeks on, 1 week off, for 6 months. he tolerated the treatment well and is without any signs of recurrence at follow - up, 18 months after surgery. splenosis, first named by buchbinder and lipkoff, is a condition observed after splenectomy, especially following traumatic rupture of the spleen. however, hematogenous spread has also been reported, resulting in intrahepatic and intracranial sites of implantation, and thoracic splenosis has been reported in cases having both a rupture of the spleen and the diaphragm [2, 3, 4, 5 ]. splenosis occurs in up to 65% of patients with traumatic or iatrogenic splenic rupture with an average delay of 10 years to presentation (range 5 months to 32 years), but the incidence of splenosis in the general population is unknown. patients with splenosis are mostly asymptomatic and the abnormality is often found incidentally. the diagnosis of splenosis can be established noninvasively by a radionuclide scintigraphic study of the liver and spleen with technetium (tc)-99 m sulfur colloid. a more sensitive and specific diagnosis can be made by tc-99m - radiolabelled heat - damaged erythrocytes or indium 111-labeled platelets [7, 8 ]. spect - ct fusion imaging based on tc-99 m sulfur colloid can be used to give supplemental three - dimensional anatomical information [8, 9 ]. ferumoxides - enhanced mri, in which superparamagnetic iron oxide particles administered intravenously are removed from the circulation by the reticuloendothelial system of the liver and spleen and subsequently visualized by mri, is not a fully established modality since it is expensive and there are few published data. ct can be used to characterize the number, shape, size and location of the nodules, but a more specific imaging modality or a biopsy must be performed subsequently to establish the diagnosis. direct biopsies from the spleen are often avoided due to the risk of bleeding, but a biopsy from a suspected splenic implant is believed to be safe, since the blood supply of implants differs from the spleen proper. who was suspected of having metastatic disease from an unknown primary tumor after the finding of multiple intra - abdominal nodules on a ct scan. a tc-99 m sulfur colloid scintigraphy and spect - ct scan were performed, and a biopsy confirmed the diagnosis of splenosis. in another case report by kang., a 54-year - old man, who previously was splenectomized due to an abdominal trauma, was initially diagnosed with a gastric cancer and a solitary liver metastasis. the workup consisted of a pet / ct scan on which no signs of metastasis were seen ; however, an abdominal ultrasound revealed a tumor in the liver. the tumor had high signal intensity on t2-weighted images and low signal intensity on t1-weighted images, raising the suspicion of intrahepatic splenosis. a radical gastrectomy and a liver resection were performed, and the histopathological examination revealed that the lesion suspected to be a liver metastasis was a splenosis implant. splenosis may be confused with abdominal lymphoma, endometriosis, simple lymphadenopathy, primary tumors (including renal, gastric or hepatic tumors) and secondary metastatic disease including carcinomatosis, peritoneal mesothelioma and liver metastases [6, 11, 12 ]. clearly, the described concurrent diagnosis of splenosis and ampullary adenocarcinoma in our 35-year - old patient is exceptional, and, furthermore, the patient had numerous, widely scattered lesions, which is unusual. however, due to the catastrophic consequences of misdiagnosis, splenosis should always be ruled out in cancer patients with a history of abdominal trauma and/or splenectomy if the malignancy is otherwise resectable.
|
a 35-year - old man with a history of blunt abdominal trauma and splenic rupture was diagnosed with an ampullary adenocarcinoma. at workup, a ct scan showed multiple intra - abdominal lesions similar to peritoneal carcinosis, and the patient was referred for palliative chemotherapy. on clinical suspicion, however, a biopsy was performed on an intra - abdominal lesion, establishing the diagnosis of abdominal splenosis. a radical pancreaticoduodenectomy ad modum whipple was performed, followed by adjuvant chemotherapy with gemcitabine. at the 18-month follow - up, the patient was free from recurrent disease. we conclude that splenosis should be considered as a differential diagnosis of peritoneal metastases in cancer patients with a history of abdominal trauma and/or splenectomy. other reports on splenosis in cancer patients and diagnostic workup are discussed.
|
most cases of multiple sclerosis (ms) are currently thought to be caused by an autoimmune process in which activated lymphocytes and other immune cells infiltrate the central nervous system (cns) and cause inflammatory damage to the myelin sheath of axons.1 in recent years, it has become apparent that damage to the axons and neurons also occurs early in the disease process. in fact, damage to the axons and neuronal cell bodies may be a cause of greater permanent disability than myelin damage.2 the underlying cause of this immune attack is unknown, but recent evidence implicates genetic, infectious and environmental factors in the development of this condition. many genes have been implicated in the disease process, with most being involved in either susceptibility to developing ms or determination of ms severity. many of the genes that have been identified are related, through uncertain biological mechanisms, to immune cell function or inflammatory molecule processes.3 one or more infectious processes may serve as a trigger for the disease. over the years many organisms have been suggested, but recent evidence has implicated the epstein - barr virus as the triggering organism in most, if not all, ms cases.4,5 finally, over many years, epidemiological studies have suggested that environmental factors may influence the development of ms. recent data suggest that higher sunlight exposure and/or vitamin d supplementation in childhood may decrease the risk of ms, suggesting that this is the environmental factor implicated in the development of ms.6,7 other recent data have suggested that vitamin d has effects on immune system function and abnormal genetic loci involved in vitamin d effects have been identified in ms patients.8 no approved treatments were available to control the disease process until 1993 when interferon - beta-1b (betaseron [bayer ], betaferon [bayer ], and recently, extavia [novartis ]) became the first approved drug shown to slow the disease process. this was followed within a few years by interferon - beta-1a (avonex [biogen idec ], and, later, glatiramer acetate (copaxone [teva ]), rebif [merck serono ]). the interferons are large molecules that interact with surface receptors on immunocompetent cells and stimulate certain internal genetic processes. the resultant proteins downregulate immune system function in multiple aspects, perhaps most importantly by reducing trafficking of activated lymphocytes across the blood brain barrier (bbb) into the cns. other proposed effects of interferons on the immune system include inhibition of t - cell activation and proliferation, apoptosis of autoreactive t - cells, induction of autoreactive t - cells, induction of regulatory t - cells, inhibition of leukocyte migration across the bbb, cytokine modulation, and potential antiviral activity. furthermore, there is some evidence of regenerative effects of endogenously produced interferon - beta within the cns.9,10 glatiramer acetate (ga), a synthetic amino acid copolymer, is a small molecule that downregulates activated immune cells in some different fashion, but does not apparently affect migration across the bbb. although the mechanism of action is not completely understood, it is felt that ga acts in the peripheral circulation by inducing ga - specific t cells. there is a subsequent induction of regulatory cd8 + and cd4 + cd25 + t - cells in the periphery. these cells then cross the bbb and re - activate within the cns, resulting in downregulation of myelin - specific immune cell activity. this in turn leads to increased production of anti - inflammatory cytokines and resultant neuroprotection. furthermore, ga induces the production of neurotrophic factors, which might favor remyelination and axonal protection.11,12 in 2000 and 2001, mitoxantrone (novantrone ; emd serono, osi), a long - established chemotherapy drug, and interferon - beta-1a administered subcutaneously (rebif) were approved to treat ms in the united states, as well as in other countries throughout the world. finally, natalizumab (tysabri ; biogen idec), a monoclonal antibody, was initially approved in 2004 in the united states and other countries. natalizumab binds to the surface of all white blood cells except neutrophils and reduces their ability to cross the bbb and therefore there is less damage to cns myelin, axons and neurons. it was removed from the market by the drug company in 2005 due to the discovery of progressive multifocal leuko - encephalopathy in two ms patients and one patient undergoing investigational treatment for crohn s disease. it was re - introduced into the market in 2006 after review of available scientific data. since the re - introduction, a number of progressive multifocal leuko - encephalopathy (pml) cases have occurred (currently about 0.67 per 1000 exposed patients worldwide, 1.1 per 1000 patients treated for 1 or more years, 1.59 for patients treated 2 or more years and 0.94 for patients treated 3 or more years). surviving patients have minimal to severe deficits (biogenidec website data, april 6, 2010). thus, the six drugs currently approved to treat ms fall into four categories : interferon - beta, ga, chemotherapy and monoclonal antibody. as will be discussed later, the drugs with higher efficacy (mitoxantrone and natalizumab) often have more serious potential side effects. now that numerous drugs are available to treat ms and several more are expected to be available in the next few years, the choice of medication for treating ms patients has become increasingly complicated. this article will assist physicians in understanding the selection process, as well as strategies for evaluating the efficacy of the initial drug in individual patients and for changing therapies if necessary. the evolving role of ga in the treatment of ms will be emphasized in this article. the treatment of ms has evolved over the years, as we have begun to increasingly understand the disease process more completely, as well as the effects of the available drugs in both groups of patients and individual patients. this has resulted in improved (although not perfect) selection of disease - modifying therapies (dmts) for individual ms patients. ms has been categorized into four clinical types : relapsing remitting ms (rrms), secondary progressive ms (spms), primary progressive ms (ppms) and relapsing progressive ms (rpms). about 85% of patients initially present as rrms. relapses are characterized by the development of new neurological symptoms and/or signs, usually progressing over hours to days, which subsequently stabilize and then partially or completely resolve over weeks to months. relapses may occur with greater or lesser frequency over time, usually thought to occur on average about once yearly. however, analysis of placebo - treated cases in recent studies has suggested that, at least earlier in the disease process, relapses may occur on average about once every 3 years. when a patient presents with the initial clinical attack, this has been termed clinically isolated syndrome (cis). this diagnosis generally requires an mri scan of the brain and/or spinal cord, as well as blood and electrodiagnostic testing to rule out ms mimics. in the past, cis is now accepted as being equivalent to the diagnosis of rrms for treatment decision purposes. in recent years patients have been identified as having possible ms based on mri scans of the brain or spinal cord alone, with no suggestion of clinical events. these mri scans are generally performed for reasons other than to rule out ms (eg, headache evaluation or cervical radiculopathy evaluation). when an mri is consistent with ms, but the patient has no clinical symptoms related to ms, this is termed radiologically isolated syndrome (ris). natural history studies have shown that up to about 85% of rrms patients will develop spms over time if not treated. in this situation, patients demonstrate a slow progression of physical and/or cognitive disability not associated with clear - cut exacerbations. in some cases of spms, about 10% to 15% of patients have ppms. in this form of the disease, most patients develop progressive lower extremity weakness initially, although other symptoms may occur in the early stages. over time progression unfortunately, the clinical disease process does not always correlate well with mri findings and/or pathological findings. some studies have shown several different pathological types of ms within the clinical rrms type. therefore, clinical ms type may not be scientifically useful to determine which ms medications work better in different pathological types. at this point, we do not have any scientific or clinical markers to predict which medication may work better in individual patients. thus, we are left with the scientifically unsatisfactory process of choosing initial therapies and subsequent therapy changes on poorly defined clinical and mri markers. the diagnosis of ms requires clinical acumen to evaluate the patient history, examination findings and mri / blood / urine / cerebral spinal fluid test results. the detailed process of making the diagnosis of ms will not be described here, but at times the diagnosis can not be reasonably certain. in these cases, the process of watchful waiting with scheduled examinations and periodic mri scans of the brain with ms protocol (consortium of ms centers mri protocol for ms, 2009, mscare.org) are performed over time, often for several years. however, once the diagnosis is made, treatment should be initiated as early as possible. recent studies have documented the benefit of early treatment of cis patients, beginning after the first clinical attack, rather than waiting until a second attack occurs.1315 as a result, interferon beta-1a i m, interferon - beta-1b and ga have been approved for the treatment of cis. unfortunately, some patients are reluctant to start therapy after they are diagnosed with cis and/or ms. they do not want to be treated with expensive therapies requiring injections and having potential significant side effects when they have had a single attack of ms with full recovery. they feel normal again and are hopeful that they will have a mild case of ms and can delay treatment. in these cases it is helpful to discuss the plan of preventing disability, even when they feel normal. for example, they can usually understand such comparisons as treating hypertension to prevent strokes and heart attacks, treating seizures to prevent more seizures or wearing a seatbelt to prevent injury in the case of an accident. they need to be told that it is not a good idea to wait until they have permanent problems before starting preventative treatment. often it is difficult to convince a patient to start treatment at the same visit that the diagnosis of ms is made. they are often emotionally distraught by the diagnosis and can not make reasonable choices about therapy at that time. they should be informed that treatments are available that can reduce disease activity and that they will need to be on therapy to reduce the likelihood of further attacks or progression in the future. patients can be referred to various websites or given the telephone numbers of ms organizations for more information and told to return in the near future for further discussions of therapy options. they should not simply be given packages of information and told to choose what they want to take. it is not reasonable for a patient newly diagnosed with ms to choose a therapy on their own. however, information is important in helping the patient and the physician to make the best choice. it is well known that medication will not help patients unless they take it. therefore, it is important for patients to know what the options are in order to assure adherence to therapy once it is started. when starting therapy, it is important to help them understand that side effects do not occur in every patient and that if they do occur, they often improve over time. furthermore, especially with interferons, dose titration and prophylactic medication for flu - like syndrome is important to reduce side effects during initiation of therapy.16 patients may be assisted in the start - up process by communication with other experienced ms patients, pharmaceutical company support programs and various ms charitable organization support programs. patients mistakenly sometimes think that their initial choice of medication will be the only medication they can take indefinitely into the future. patients should be made aware that each treatment has class and individual potential side effects and benefits, but if the initial therapy choice is not tolerable, other therapy can be selected. the initial choice is not necessarily a lifelong decision. from the healthcare provider position, furthermore, as with many other fields of medicine, the prior experience and training of each provider will often influence the initial choice of medication. it is generally held that most providers will initiate therapy in most patients with an interferon or ga, as the risks of the more powerful drugs are too great to assume for initial therapy. however, some experienced physicians will choose a medication with greater efficacy that has a higher risk for patients who are considered to have a more aggressive form of ms. the efficacy of ga and the various forms of interferons are felt to be similar by most physicians. recent studies have shown nearly identical results on clinical and mri parameters when comparing ga to interferon - beta-1a given subcutaneously (sq)17 and also comparing ga to normal and double dose of interferon - beta-1b.18 there are some mild differences in mri results between treatments, but this is variable. no direct comparisons of ga with interferon - beta-1a given intramuscularly (i m) have been undertaken. the phase iii trials of each drug, while not directly comparable, suggest no overall benefit of either drug, but some smaller studies suggest superiority of ga. there is some evidence that more frequent dosing of interferons is more effective than less frequent dosing, at least in the early stages of treatment,1922 but neutralizing antibodies occur more often with the more frequently administered interferons and may affect efficacy after 18 to 24 months of therapy. a large retrospective study of nearly 4000 ms patients has shown no difference in interferons when switching from one to another.23 other recent evidence has suggested that higher doses of interferons are generally not any more effective than the normally prescribed doses,24,25 but higher doses of ga may or may not provide additional benefit.25,18 mri results generally parallel the clinical markers of disease progression (especially if cognitive function is assessed). however, some recent evidence has shown less brain atrophy with ga, somewhat more atrophy with weekly interferon - beta-1a i m, and even more atrophy with more frequently administered interferon - beta-1a and interferon - beta-1b subcutaneously.26 a considerable amount of literature has demonstrated a potential beneficial effect of ga for tissue repair processes as well.27 another factor of some importance may be the potential of the treatment to be associated with pregnancy issues. ga is felt to have the least risk (package inserts for ga and all interferons) ; since many ms patients are young females of child - bearing age, this should be considered when choosing therapies. in summary, the choice of initial therapy with a dmt involves an analysis of efficacy, safety and patient tolerability issues, as well as prescriber experience and training. there is no general consensus on initial therapy choice, except that it is usually ga or an interferon. currently, ga is the most commonly prescribed dmt for ms both around the world and in the united states.28 the initial choice of dmt is often well tolerated and continues to be effective over time in many ms patients however, at times the initial therapy is not optimal for an individual patient and a change must be made. there are generally two reasons for switching therapy intolerance of the current therapy or ineffectiveness of the current therapy. unfortunately, just as with the choice of initial therapy, there are no clear - cut definitions of therapy intolerance or loss of efficacy. in fact, various adjustments in therapies and treatments for side effects, can improve tolerability of each of the medications. many articles have been written about methodologies for improving patient tolerance and adherence to therapy.16 details will not be discussed here, but a few points will be discussed., patients have great emotional difficulty with self - administration. sometimes another person can be recruited to administer the injection. also, additional nursing instructions and support may be necessary to continue self - injection. of course, the necessity of taking medication to prevent neurological deterioration in the future is of utmost importance, but is often minimized by the patient if they are doing well neurologically. the seat - belt analogy noted earlier is often helpful in encouraging adherence. side effects of injections (see table 1) are usually skin site injection reactions (generally with subcutaneous injections) and flu - like syndrome (interferons). various changes in injection techniques, oral medications or cutaneous medications may be helpful in reducing or eliminating these reactions. therefore, psychological function of ms patients needs to be routinely assessed (while on any medication), but with interferons, there may be more frequent and/or more severe depression. when a particular therapy is deemed intolerable, then an alternate therapy must be chosen. for example, when a patient is taking an interferon, switching to another interferon may or may not be a reasonable strategy. therefore, switching to fewer injections or to i m injections due to injection fatigue or injection site reactions may be reasonable, but switching when patients have hepatic, hematological or psychological adverse events is not. most often when side effects occur on an interferon, ga is considered a reasonable switch. interferons can induce the production of neutralizing antibodies in some patients, most commonly with interferon - beta-1b, less with interferon - beta-1a sq and least with interferon - beta-1a i m. many physicians around the world monitor interferon neutralizing antibodies (nabs) either routinely or when a patient has an exacerbation. most, but not all, physicians feel that neutralizing antibodies reduce or eliminate the effectiveness of interferons. this is felt to be especially true in patients with higher titers (100 to 400 titer or higher). when neutralizing antibodies are present and persist with repeat testing (usually about 3 months after the initial positive test), it is reasonable to switch therapies. however, antibodies from one interferon cross - react with the other interferons, so an interferon nab positive patient who is going to be switched will usually be switched to ga and not a different interferon. it is not unreasonable to routinely measure interferon nabs at 18 months after the start of therapy, when they have appeared in most cases, and consider switching to another non - interferon dmt if nabs are present in higher titers (100 or greater or up to 400 or greater based on expert opinion).29 if a patient on ga is experiencing significant injection site reactions that can not be managed with changes in injection technique or topical medications, then a switch to interferon is reasonable. in occasional instances, if a patient needs to switch due to injection fatigue or inability to administer injections, natalizumab may be considered, even after only one drug failure. although the risk of pml or other cns infections with natalizumab is greater, the lower side effect profile, less frequent treatments and greater efficacy may outweigh the risk for individual patients. the concept of treatment failure based on clinical and/or mri assessment is subject to individual opinions and expert consensus agreements. however, there is no consensus on assessment and measurement of treatment failure.3032 clinical definitions of treatment failure usually involve frequency and/or severity of relapses or determination of overall disease progression. however, even the determination of what constitutes a relapse and how progression should be measured is open to individual interpretation. some patients feel that if their ms symptoms do not resolve or if they do not return to a fully functional status, then this means that the medication is not working. this misunderstanding requires education of the patients, often on more than one occasion, that the benefit of treatment is to prevent or reduce exacerbations in the future, not to repair all the damage that has already occurred. as noted above, numerous publications have attempted to provide a definition of treatment failure and there is no consensus.3032 the following assessment is a reasonable attempt to describe treatment failure. it has been a commonly held belief, based on assessment of placebo cases in early ms trials, that one exacerbation annually is average for an untreated patient. however, in a number of more recent placebo - controlled trials of drug efficacy, the relapse rate for untreated patients was approximately one every 3 years.33 thus, the idea that a patient is doing worse than placebo is difficult to define. furthermore, when looking at most long - term studies (5 to 12 years), it is apparent that many patients drop out for various reasons. however, when looking at the patients who remain on the study, the annualized relapse rate is about 0.2 to 0.25 (one relapse every 4 to 5 years). therefore, a reasonable assumption may be made that more than one relapse in a 4- to 5-year period may be considered a commonly used measure, the extended disability status score (edss), is often used to define disease progression. a worsening by 0.5 to 1.0 points on the 10-point scale, sustained for at least 3 to 6 months, is considered a valid measure of disease progression. however, the scale is relatively insensitive to some functions, especially to fatigue, cognitive and emotional functions. since these are common impairments in patients with ms, other scales have been utilized. a recent article34 has proposed a series of tests that are predominantly self - administered by patients before each physician visit to help assess overall function. finally, worsening of mri scan lesion load has been suggested as a measure of disease progression and treatment failure. suggestions for monitoring parameters have included t2 lesion load, t1 lesion load, gadolinium - enhancing lesion load, mr spectroscopy, total brain atrophy and gray matter atrophy, among others. at this point, the determination of treatment failure remains more of an art than a science. in the opinion of the author, assessment of treatment failure therefore, the author uses the following criteria to determine whether or not to discuss change in dmt with a patient : one or more significant attacks in a 4- to 5-year period. for example, mildly blurred vision in one eye lasting several days or mild tingling of the non - dominant hand lasting several days or a week would be considered a mild exacerbation. on the other hand, ataxia and hemiparesis requiring the new use of an ambulatory aid would be considered a significant attack, regardless of degree of recovery with or without steroids.a new t2 cns lesion on mri, measuring 0.5 cm or greater, or a new gadolinium - enhancing or t1 lesion, even in a clinically silent area, is considered a sign of significant disease activity.progressive disability with persistent clinical alteration of motor, cognitive or sensory dysfunction lasting 6 months or longer, is considered a sign of disease progression. for example, mildly blurred vision in one eye lasting several days or mild tingling of the non - dominant hand lasting several days or a week would be considered a mild exacerbation. on the other hand, ataxia and hemiparesis requiring the new use of an ambulatory aid would be considered a significant attack, regardless of degree of recovery with or without steroids. a new t2 cns lesion on mri, measuring 0.5 cm or greater, or a new gadolinium - enhancing or t1 lesion, even in a clinically silent area, is considered a sign of significant disease activity. progressive disability with persistent clinical alteration of motor, cognitive or sensory dysfunction lasting 6 months or longer, is considered a sign of disease progression. if one or more of these events are detected, then there should be consideration of a change in dmt. when the decision to switch is made, what dmt will be used ? as noted above, it is reasonable to switch from an unsuccessful interferon to ga or vice versa. since the interferons are somewhat similar in efficacy, a switch from one interferon to another due to lack of adequate efficacy does not seem reasonable. however, a switch from subcutaneious to intramuscular may be reasonable if injection site reactions or frequency / discomfort of injections are issues and the patient is doing well clinically otherwise. reasonable strategies are to switch from interferon to ga or vice versa ; however, if a patient has failed both classes of therapy, then a switch to natalizumab or mitoxantrone is reasonable. mitoxantrone is currently not used very frequently due to the risk of cardiac muscle damage, infection or leukemia, and other malignancies. natalizumab is a reasonable choice and a recent publication suggests criteria for switching and following patients on this medication.35 this publication also suggests high - risk cases in which natalizumab may be an appropriate dmt to use for initial therapy. although natalizumab has a small risk of the development of pml, many ms patients and physicians consider the small risk reasonable when other therapies are failing. ms is a recurrent and progressive auto - immune disease in which there is ongoing damage to the myelin, as well as the axons and nerve cell bodies, in the cns. there is currently no known treatment to prevent or cure the disease, so all treatment is directed towards downregulation of the immune system within the cns to slow the resultant tissue damage. a number of studies have shown that starting treatment as soon as possible in the disease process reduces disability over time, so early diagnosis is imperative. diagnosis after the first event is currently labeled cis ; this is considered the optimal time to initiate therapy. currently in the united states, ga, interferon - beta-1a i m and interferon - beta-1b have received approval for treatment of cis. when choosing initial therapy in a newly diagnosed patient, it is most important that the patient actually adhere to the therapeutic regimen.16 although patients should not simply be given information about all dmt drugs and told to choose their own therapy efficacy of the medications is generally considered similar, so decisions are often made based on tolerability, ease of use and safety. ga is dosed daily, so it has the most injections monthly of all the current dmts. on the other hand, it has fewer systemic side effects, no hepatic or hematological effects and low risk to fetal development. the last is of considerable importance in ms, since many ms patients are young females of child - bearing age. injection site reactions are fairly common, but generally are of minor significance. however, at times they are of sufficient severity to require a change in therapy. studies of ga versus interferon - beta-1a sq and interferon - beta-1b show essentially the same clinical efficacy and similar, but not identical, mri efficacy. ga also shows experimental evidence of neuro - protection / neural repair and less brain atrophy than interferons. interferon - beta-1a i m is dosed least frequently of the four platform drugs (once weekly), but is given intramuscularly rather than subcutaneously. this may inhibit some patients who can not self - inject intramuscular medication or obtain the assistance of another person. its efficacy is similar to that of the other therapies, although some studies have suggested a slower onset of action than other interferons. however, it is also considered an excellent choice for initial therapy due to its tolerability and efficacy. frequently administered interferons (interferon - beta-1a sq and interferon - beta-1b sq) are also reasonable choices for initial therapy, especially if patients desire subcutaneous injections that are given less frequently than copaxone. uncommonly, initial therapy with natalizumab should be considered. in summary, the most important factor in treating ms is to start early (cis if possible) and prescribe a medication that the patient is likely to tolerate. finally, if they are not tolerating or responding to a medication, early change to another therapy is recommended to prevent an increase in permanent ms - related disability.
|
the treatment of the underlying disease process causing multiple sclerosis has continued to evolve since the initial approval of interferon - beta-1b in 1993. current emphasis is on early treatment, including treatment after a single clinical attack (clinically isolated syndrome). the assessment of which disease modifying medication to use as initial therapy has continued to remain a combination of science and the art of medicine. equally important are the assessment of treatment failure and the subsequent choice of medication change. this article will present scientific information, as well as information about clinical decision making, about these choices, with emphasis on the changing role of glatiramer acetate in this process.
|
lascar el - usb-2-lcd automatic air temperature and humidity loggers (http://www.lascarelectronics.com) were used to measure air temperature (c) and humidity in these pilot studies. relative humidity (%) and absolute humidity (dew point, c) are recorded by these instruments. the accompanying document assessing a population 's exposure to heat and humidity : a practical guide gives practical details on the use and deployment of these instruments. these loggers cost approximately us$80 each, and are small battery - powered devices that can be preprogrammed via a usb port to record data at specified times that can later be downloaded for analysis. in all of these pilot studies, the loggers were programmed to record every 30 min, on the hour and half hour. these studies were carried out in rural north - eastern south africa (as shown in fig. our first consideration, which was addressed in a pre - pilot study, was how to house the loggers either outdoors or indoors in such a way that they would not be exposed to direct sunshine or rainfall, be in well - ventilated locations, and protected from interference by humans, monkeys, and so on. our aim was to approximate the measurement conditions afforded by a stevenson screen, while preserving the portability, security, and convenience of the loggers. map of the area used for the study, showing the three locations of the loggers, their altitudes, and location within south africa. locations 1 and 2 were compounds in the agincourt subdistrict ; location 3 was at the university of witwatersrand 's rural facility and skukuza is the nearest official weather station at an airport on the edge of the kruger national park. we found that the loggers conveniently fitted into electrical conduit boxes that were easily available, white, with secure lids, and prepunched with holes on all sides for conduit fixings. the pre - pilot study involved strapping an unprotected logger and one in a conduit box to the shaded underside of a tree branch approximately 2 m above the ground (fig. 2), and recording data for a 48-h period on 2526 january 2010 to assess comparability between the results from the protected and unprotected loggers. unprotected and protected loggers during the pre - pilot study. for the pilot study, we located two pairs of loggers inside and outside two houses in the agincourt field study area, plus one logger outside at the university of witwatersrand 's rural facility as a slightly more distant reference point, all approximately 2 m above ground level and all situated in identical conduit boxes. the outside loggers were strapped to the underside of convenient tree branches, and the inside ones were attached to convenient fixing points that were not near windows, nor in kitchens, and so on. both of the houses involved were constructed with cement walls and corrugated metal roofs. these three locations, in south africa 's lowveld, are shown on a map in fig. the straight - line distance from location 1 to location 2 is 13.6 km, from location 1 to location 3 is 33.8 km, and from location 2 to location 3 is 45.3 km. the five loggers all recorded data synchronously every 30 min over a 9-day period from 30 january to 7 february 2010 inclusive. data from the loggers were downloaded into microsoft foxpro and subsequently stata 10 was used for analyses. the complete dataset in excel format (pilot.xls) is available as a supplementary file. routinely recorded weather data from the nearest official weather station at skukuza airport (24.968s, 31.593 e, 305 m above sea level) were obtained for the same time period (http://www.wunderground.com). gridded global temperature data were obtained from the noaa ncep / ncar dataset (6) (http://www.esrl.noaa.gov/psd) for the cell 22.5 to 25.0s, 30.0 to 32.5e for the same period. in the pre - pilot study, both loggers recorded data every 30 min for 48 h (i.e. 96 data points each). the pairs of daily maximum temperatures were 32.5, 33.5c and 27.5, 28.0c ; minima 24.5, 24.5c and 22.0, 22.0c for the protected and unprotected loggers, respectively. similarly the daily maximum relative humidities were 78.5, 81.0% and 92.5, 95.5% ; minima 55.0, 55.0% and 77.0, 71.5%. the mean difference in temperature between the two loggers over the whole period was 0.3c and in relative humidity 0.8%, both of which are within the manufacturer 's stated measurement accuracy for the instrument (0.5c and 3%, respectively). the 48-h period of observation happened to include times of sunshine and rainfall as is typical of the summer season in this subtropical area. air temperature and relative humidity data as recorded by unprotected and protected dataloggers (see fig. 2) over a 2-day period, 2526 january 2010. in the pilot study, five loggers recorded data every 30 min for 9 days (i.e. 432 data points each) during a period that included some cloudy, wet weather and some hot, dry days. 4 shows the outside air temperature and relative humidity for the three locations over the whole period. overall mean outside air temperatures by location were 25.4c at location 1, 26.0c at location 2, and 25.5c at location 3. outside air temperature and relative humidity data recorded every 30 min for three locations (see fig. 1) over a period of 9 days, 30 january to 7 february 2010. the mean inside outside air temperature difference at location 1 was + 4.0c (inside warmer than outside) and location 2 was + 2.9c. the mean humidity differences were 22.4% less humid inside at location 1 and 7.0% at location 2. outside differences in air temperature and relative humidity for locations 1 and 2 over the whole period. differences between inside and outside air temperature and relative humidity data recorded every 30 min for two locations (see fig. 1) over a period of 9 days, 30 january to 7 february 2010. temperature data from the skukuza weather station, recorded at 0800, 1400, and 2000 each day were obtained for the period of the pilot study and are shown in fig. 6. in the same figure, the average temperatures every 30 min from the outside dataloggers at locations 1, 2, and 3 are shown for comparison, together with the 6-h temperature data from the noaa ncep / ncar reanalysis 2.5 gridded temperature data for the cell 22.5 to 25s, 30 to 32.5e. mean outside air temperature as recorded by dataloggers every 30 min at locations 1, 2, and 3 together with 6-h temperature data from the noaa 2.5 global gridded model and records from skukuza airport (0800, 1400, and 2000 daily). although this pilot study did not set out to establish any connections between air temperature and humidity measurements and the population in which the measurements were made, it revealed a number of practical considerations associated with making such measurements at the population level. the pre - pilot study results confirmed the feasibility of using easily sourced boxes to secure the dataloggers, without materially affecting the data collected, both during wet and fine conditions. although minor differences were observed between the two loggers, these were within the stated accuracy of the instruments and too small to substantially affect considerations of human heat exposure. in the pilot study, the relatively close agreement in air temperature and humidity between the three outside dataloggers (fig. 4) suggests that distancing measurements by some tens of kilometres results in rather small differences, and for most purposes it is probably unnecessary to make measurements at closer intervals than 10 km. however, in this example the altitudinal differences between the three datalogger sites were fairly small (115 m). in places with larger differences in altitude or including coastal areas, local topography needs to be considered in locating measurement sites. when it comes to measuring air temperature and humidity inside houses, however, it seems from fig. 5 that there may be appreciable variation between houses (although only two houses were sampled here). the difference between exterior and interior humidities (measured both as dew point and relative humidity) varied substantially, possibly reflecting differences in the ventilation between houses. characterising peoples ' exposure to heat indoors, therefore, may be more challenging than measuring outdoor exposure. the comparisons with the local weather station and gridded climate data (fig. 6) are important and interesting, since these sources represent the main alternatives to actual measurement of air temperature and humidity in the field. both sources have much less frequent data than the 30 min data from the dataloggers. the skukuza airport data were available for 0800, 1400, and 2000, and fig. 6 shows reasonably good agreement between the 0800 and 2000 skukuza data and the average readings of the three outdoor dataloggers. skukuza, although not far away, lies at a substantially lower altitude than the datalogger sites, and this may be the reason for the substantially higher air temperatures recorded at 1400. in other settings, both distance and altitude may need to be taken into account in determining locations for a group of dataloggers. the comparison with the noaa ncep / ncar data for the same time period, also shown in fig. these gridded data are available every 6 h (0200, 0800, 1400, and 2000 local time) with the data points at 1400 roughly coinciding with daily observed maxima in this location. in addition, the relatively large size of the 2.5 grid (in this case the cell 22.5 to 25s, 30 to 32.5e covers an approximate rectangle of 250 km west - to - east and 380 km north - to - south, with an altitudinal range from 1,810 m above sea level at the south - western corner to 115 m in the limpopo river valley to the north - east) can be problematic. as it happens, we are dealing with a relatively heterogeneous grid cell covering the escarpment between the highveld and lowveld areas here, and so inevitably the gridded data reflect some kind of average over this area that needs interpreting with care in terms of local air temperature and humidity. nevertheless, there are obvious relationships between the gridded data and the other sources shown in fig. if one had a longer series of contemporary local records, for example over a 1-year period, then one might start to model the relationship between the gridded and observed data. the potential value in doing so could be huge in populations where demographic and epidemiological archives have been accumulated over many years but without local weather data. if it is possible to assume that modelled relationships between current gridded and locally observed data are fairly consistent, it would then be possible to apply such models to construct post hoc local data from gridded data for past years for analyses against population data archives. overall, we conclude that a relatively small number of automatic air temperature and humidity loggers located within a population represent an effective and cost - effective means of gathering weather data at the local level, on a current and prospective basis. we would recommend population surveillance sites to adopt this strategy as a matter of routine to enable prospective enquiries into associations between heat exposure, changes in climate, and human health, performance, and productivity (7). it may also be the case that a reasonable series of contemporary weather data in a particular location will enable local estimates of past weather to be made in a relatively precise manner. access the supplementary material to this article : a user guide and data file (see supplementary files under reading tools online). the ume centre for global health research is supported by fas, the swedish council for working life and social research (grant no. 2006 - 1512). the mrc / wits agincourt health and sociodemographic surveillance system is funded by the wellcome trust, uk (grant nos. 058893/z/99/a and 069683/z/02/z) and the university of the witwatersrand and medical research council, south africa.
|
backgroundit is widely accepted that assessing the impact of heat on populations is an important aspect of climate change research. however, this raises questions about how best to measure people 's exposure to heat under everyday living conditions in more detail than is possible by relying on nearby sources of meteorological data.objectivethis study aimed to investigate practical and viable approaches to measuring air temperature and humidity within a population, making comparisons with contemporaneous external data sources. this was done in a rural south african population during the subtropical summer season.resultsair temperature and humidity were measured indoors and outdoors at three locations over 10 days and the datalogger technology proved reliable and easy to use. there was little variation in measurements over distances of 10 km.conclusionssmall battery - powered automatic dataloggers proved to be a feasible option for collecting weather data among a rural south african population. these data were consistent with external sources but offered more local detail. detailed local contemporary data may also allow post hoc modelling of previously unmeasured local weather data in conjunction with global gridded climate models.
|
she had been admitted two years ago with jaundice and fever. on a ct scan, the distal cbd, a large gallbladder (gb) and cystic duct stones were revealed. urgent endoscopic retrograde cholangiopancreatography (ercp) to remove the distal cbd stone was performed. after the stones were removed, there was no filling defect on the cbd during balloon cholangiography., the laboratory tests revealed a slightly elevated aspartate aminotransferase level (45 iu / l) and an increased value of c - reactive protein (15.3 mg / i). the total bilirubin level, the alkaline phosphatase level, the gamma - glutamyltransferase level and the wbc count were all within the normal ranges. the presumed diagnosis was recurrent cbd stones, and an ercp for recurrent cbd stones was planned. transabdominal ultrasonography demonstrated a dilated extrahepatic bile duct filled with echogenic lesions that showed posterior acoustic shadowing, which was suggestive of bile duct stones (fig., another mildly dilated extrahepatic bile duct was seen, but no stone was noted (fig. the sonographic findings led us to presume that the stone - filled aberrant right hepatic duct drained into the common hepatic duct. a contrast - enhanced ct scan was performed using a 64-mdct scanner (lightspeed vct, ge healthcare, milwaukee, wi) and it showed two separate extrahepatic bile ducts (fig. multiple stones were noted in a posterolaterally located bile duct and these stones extended to right intrahepatic bile ducts. there was a large stone in the gb and the cystic duct joined to a posterolaterally - located extrahepatic bile duct. the minip images were obtained on a postprocessing workstation (advantage windows workstation [version 4.3 ], ge healthcare, milwaukee, wi). the minip image (coronal oblique with a 5.3 mm thickness slab) revealed double extrahepatic bile ducts that combined to create a cbd in the pancreatic head portion with a communicating channel in the hilar portion (fig. mrcp performed with a 1.5-t intera scanner (philips medical systems, the netherlands) failed to depict the precise anatomy of this anomaly due to the impacted stones (fig. erc was subsequently performed to remove the multiple stones in one of the double extrahepatic bile ducts. an erc image also disclosed duplication of the extrahepatic bile duct with multiple stones in the posterolaterally located duct and the right intrahepatic ducts (fig. however, we failed to gain access to the right cbd and to remove the cbd stones. to remove the remnant stones, duct exploration with insertion of a t - tube and cholecystectomy the developmental failure for the double biliary system to regress, and this double system is present in early normal embryogenesis, is considered to be the mechanism of this anomaly (5). the morphological classification of a double extrahepatic bile duct has been modified because the newly reported cases could not be included in the existing classification system. choi. (5), when reporting on a type va case, added types va and vb to the classification system that was modified by saito. the individual subtypes of the modified classification system are as follows (5) (fig. 1h) : type i, a cbd with a septum in the lumen ; type ii, a cbd that bifurcates and drains separately ; type iii, double biliary drainage without extrahepatic communicating channels (without [a ] or with intrahepatic communicating channels [b ]) ; type iv, double biliary drainage with one or more extrahepatic communicating channels ; type v, single biliary drainage of double extrahepatic bile ducts without (a) or with communicating channels (b). the clinical issues for these anomalies are the combined complications and the concomitant aupbd. in a review of the japanese clinical literature by yamashita. (2), the investigators found cholelithiasis in 28% of the cases, a choledochal cyst in 11% of the cases, aupbd in 30% of the cases and cancer in 26% of the cases. these investigators also emphasized that the opening site of the accessory bile duct was associated with a type of cancer and the concomitant presence of aupbd. our case is a form of single biliary drainage in the second portion of the duodenum ; no evidence of aupbd was found by mrcp. although multiple stones were impacted in one of the double extrahepatic bile ducts, there was no evidence of cholestatic findings based on the laboratory results nor was intrahepatic biliary dilatation found in our case. this may be ascribed to the presence of a communicating channel between the two extrahepatic bile ducts that provided another way for biliary excretion. making a correct diagnosis of these anomalies prior to biliary surgery is clinically important due to the risk of biliary injury during the operation. among the seven cases that were recently reported (2 - 8), mrcp is a safe, noninvasive imaging technique and it provides similar diagnostic information as compared with ercp, which is the standard of reference for biliary imaging (10). although mrcp has also played an important role in the diagnosis of double extrahepatic bile ducts (5, 6), it did not provide detailed anatomical information about the biliary tree due to the multiple impacted stones in the current case. instead, mdct imaging using the minip technique was very helpful for precisely depicting the complex anatomical details of this anomaly. recent advances in mdct technology enable physicians to acquire a large volume of images rapidly and these advances also facilitate postprocessing applications with high spatial resolution due to the thin collimation. minip is one of the postprocessing techniques, and it displays the lowest attenuated voxel within a slab and so it is useful for imaging the biliary tree that has a water - density. the usefulness of minip for making the diagnosis of biliary obstruction has been reported in the radiological literature (11, 12). this technique was more useful than axial ct scanning or mrcp to demonstrate the detailed anatomical information such as communicating channels or a stone - filled duct those in our case. in conclusion, we report here on a type vb case of the duplication of the extrahepatic bile duct that was associated with choledocholithiasis. in this case, obtaining the mdct images using the minip technique played a decisive role in the preoperative diagnosis and therapeutic planning.
|
we report here on an extremely rare case of duplicated extrahepatic bile ducts that was associated with choledocholithiasis, and this malady was visualized by employing the minimum intensity projection images with using multi - detector row ct. the presence of duplicated extrahepatic bile ducts with a proximal communication, and the ducts were joined distally and they subsequently formed a single common bile duct, has not been previously reported.
|
exactly 30 years ago richard morris and colleagues published in an article in nature on a novel behavioral task for place navigation in rats and demonstrated the sensitivity of the task for hippocampal lesions (morris., 1982). since then the task has been known as the morris water maze and originally meant to be a test for rats, which are good swimmers by nature, it also has been successfully applied more and more often to memory testing in mice, which are innately strictly terrestrial animals. to acknowledge the important three decade milestone of this task, this review aims at giving a critical overview of applications of morris water maze in testing mouse models of the most important memory disorder of mankind, alzheimer 's disease (ad). in fact, the name water maze is a misnomer in the strictest meaning of the word, because the task is performed in an open wading pool and not in a labyrinth - like series of pathways. in particular, since one of the earliest modifications of the swim task was to place a walled radial maze inside the wading pool, resulting in a true water maze [usually called a radial - arm water maze ; (buresov., 1985) ], it would be more appropriate to call the original task the morris swim navigation task or simply as the morris swim task, as will be done in this review. the test environment consists of a wading pool with a diameter of 120200 cm and a movable submerged platform, which can vary from 10 to 15 cm in diameter, based on animal size. the submerged platform has to be placed close enough to the surface so that a swimming animal will not be able to swim over it without noticing the platform. several tricks have been used to make sure that the platform really is hidden from the animal. because of the bacterial growth this is not an ideal solution, and has been replaced by inorganic white pigment. another strategy is to avoid any additives in the water by making both the pool and the platform of matt black plastic and provide the room lighting so that light reflects from the water surface. this approach gives a beautiful contrast for video tracking with a white albino rat, but is much less optimal for the most common mouse strain used in place navigation studies, the c57bl/6 mouse. having marked black mice with a piece of white adhesive tape for years, our lab eventually decided to use a pool made of white plastic and a transparent plastic platform, which combination eventually proved to work. even though numerous published studies have only utilized a stop - watch to measure the escape latency as a measure of learning in the morris swim task, this is not acceptable, because of the lack of control for the swimming speed. a good - quality video tracking system is a must for a proper task monitoring. besides providing a measure of the swim path length for speed calculation, it also yields several other parameters that help identify the strategy and nature of memory impairment of the animal, such as the mean distance from the wall or from the platform, and occupancy near the platform location in the probe trial without the presence of the platform itself. the standard swim navigation task consists of 38 acquisition trials for 35 days, with the platform kept in a fixed location. the last trial of the last day is usually a probe trial, without the platform, to see the eventual search bias of the animal. ideally, the animal would swim in small circles tightly around the former platform location to indicate that it has an established memory of the location. the probe trial can be delayed to or replicated on the next day to reveal more long - term retention of the memory for the specific location. some details in the task design are fundamentally important for the desired specificity for hippocampal function. first, the starting positions have to vary to make the task performance dependent on true navigation and not egocentric response learning. if a constant start position is used, the task performance will no longer be impaired by hippocampal lesion (eichenbaum., second, the environment must provide multiple prominent cues for triangulation. on the other hand, a single cue may not be too prominent, because it will easily attract the animal as a beacon. especially for mice, this prominent cue is the experimenter him- or herself ! a not uncommon error for the experimenter is to anticipate picking up the animal and moving toward the platform at the end of the trial, thus providing a strong cue leading to the target. besides the probe trial for search bias, the original task design also included another control trial, a visible platform variant of the task. normal performance in this version, with the platform above the water surface or marked with a pole and flag, should imply that the animal is motivated to climb onto the platform, able to master the motor task requirements, and has normal vision. however, with respect to exclusion of visual impairment, the ability to use the visual platform task as a control has been questioned (lindner., 1997). rats with hippocampal lesions show initial impairment also in the visual platform task (morris., 1982). more importantly, it makes a big difference whether visual platform task is run before or after the hidden platform task. if run before in the usual way with curtains around the pool to eliminate all distal cues, it encourages the animal to ignore the distal landmarks, which in the next phase become fundamentally important. this task protocol may thus discourage the use of true navigation strategy and favor the development of alternate search strategies, which eventually show up as poor performance in the probe task. therefore, it would be recommended to run the visible platform task after the hidden platform version or skip that altogether. initial experiences in applying the morris swim navigation task to mice were so discouraging that it was long speculated that mice, as strictly terrestrial animals, are not capable of learning the task at all. for instance, one hallmark study that directly compared place learning between c57bl/6 mice and long evans rats showed mice to be inferior learners in the morris swim task, even though their performance was equal to rats on a dry radial - arm maze (whishaw and tomie, 1996). the authors attributed the inferior performance of mice in the swim task to the better adaptation of rats to swimming. however, there are a number of less well known factors that may account for the poor performance of mice in the morris swim task even to a greater extent than the simple motor aspect of swimming. the first important difference in cognitive abilities between mice and rats are robust differences between mouse strains in their learning ability (see kennard and woodruff - pak, 2011 for a recent review). this is a general problem in using mice in cognitive tasks, but especially pronounced in the morris swim task, because there are strain differences not only in spatial memory per se, but also in visual acuity and the learning pattern (kennard and woodruff - pak, 2011). in fact, one reason why the c57bl/6, among all laboratory mouse strains, has become the most widely used strain in cognitive testing derives from its good performance in place learning tasks, including the morris swim task (owen., 1997). this mouse strain is also suitable for aging studies, showing impairment in spatial memory between 12 and 24 months of age according to various studies. in contrast, fvb, 129/sv, and dba strains, which are often found in genetically engineered hybrid lines, are clearly inferior in spatial learning as measured in the morris swim task (kennard and woodruff - pak, 2011). one severe problem with mice, as compared to rats, is that many mice actually avoid the escape platform. this may be partly related to the common habit of picking up mice with a net, which they experience as highly aversive. furthermore, as worse swimmers than rats, mice occasionally have difficulties in climbing onto the platform. an established solution in mouse pool testing is to give them an extra day of pretraining in an alley that leads to the platform. a second and still largely unsolved problem is that mice often do not display a clear search bias in the probe task. one obvious problem in early studies was the downscaling of the pool size in order to correspond to the difference in body sizes between the rat and the mouse. the use of a pool with a diameter as small as 8090 cm resulted in mice swimming in large circles, but maintaining the appropriate distance from the pool wall. enlarging the pool to almost the same size as used for rats seemed to solve the problem, but only partially. the fundamental problem seems to be that the mice do not develop the habit of swimming in small circles around the presumed platform location in the probe trials like the rats do. rather, they make a quick search of the presumed location of the platform, and as soon as they fail to find it, they return to the start location or begin to swim toward the experimenter in the hope of getting picked up (figure 1). therefore, the most commonly used occupancy - based parameters for assessing spatial memory, such as time in the target quadrant or time in the vicinity of the platform, do not reveal as clear a search bias as corresponding parameters in rats. a recent systematic study comparing the power of various parameters to assess search bias in mice came to the conclusion that the best parameter to assess spatial memory in the morris swim task is the mean distance to the former platform location (maei., 2009). it is unusual for mice to demonstrate the ideal search pattern in the probe test (a). as soon as they fail to find the platform, they switch to a wider search pattern, but still show some preference to the original target area (b). black trace : first 20 s, gray trace : following 40 s. the white square indicates the original platform location. finally, the small body size and especially the thin layer of subcutaneous fat, as compared to rats, render mice susceptible to hypothermia during prolonged exposure to the pool water, which is kept close to room temperature for practical reasons and to ensure sufficient motivation to escape from the water. in the first systematic study on this topic, we found to our great surprise that the regular five daily swims in 20c water with 30 s between the trials was enough to cause up to 9c drop in the rectal temperature (iivonen., 2003). moreover, the effect was dependent on the sex and genotype of the mice ; females were more susceptible to hypothermia than males and transgenic mice carrying alzheimer - associated app and ps1 mutations were more vulnerable than their non - transgenic littermates, because of a smaller body weight. raising the water temperature from 20 to 24c only partially alleviated the hypothermia. however, increasing the inter - trial interval from 30 s to 13 min removed the net cooling effect of five trials on the core temperature and swimming speed. it is nowadays a common practice to allow mice enough time to warm up between the swims and to assist with external heating devices. for instance, in the context of aging studies, a long line of evidence suggests that training distributed over several days is less sensitive to age - related place learning impairment than massed trials (see foster, 2012 for review). one quite common procedure with aged rats is to give eight trials on one day followed by a probe test 24 h later. this would be very difficult to adapt to mice, which on the one hand would require more trials than rats to attain the same spatial bias and on the other hand would not tolerate the unavoidable hypothermia induced by such massive water exposure. notwithstanding all the above mentioned precautions, the morris swim navigation task has become the gold standard in demonstrating spatial memory impairment in mouse models of ad. in contrast to large differences between various transgenic ad model mice in several common memory tests, such as fear conditioning or object recognition, all established ad model mice show deficits in the morris swim task as they age. we have tested about 3000 app / ps1 transgenic mice in the morris swim task during the past 10 years, and have never failed to see an impairment in a test group of transgenic mice, as compared to their wild - type littermates, provided that the mice were past a critical age. using the terminology for assessing animal models of human disease, one can say that the morris swim navigation task has face validity, because one of the most prominent everyday problems of ad patients is easily getting lost outside their home environment. the test can be considered to have construct validity, since transgenic mouse models of ad, whether carrying single app mutation, combined app+ ps1 mutation, or tau mutation, all display age - related impairment in the task performance (table 1). finally, the task has predictive validity, because all ad drugs in clinical use at present (rivastigmine, galantamine, donepezil, memantine) show a beneficial effect in the morris swim task in various mouse models (sweeney., 1988 ; minkeviciene., 2004 ; van dam., summary of genetic mouse models of alzheimer 's disease with reported impairment in the morris swim navigation task. there are some important differences in the spatial learning deficit in the morris swim task between transgenic ad model mice (at least in app transgenics that have been studied the most) and rodents with hippocampal lesions. first, the learning deficit in transgenic mice is never as severe as in animals with hippocampal lesions, and the transgenic mice are usually able to learn the task if allowed some extra training. in this notably, these statements are largely based on comparison between published studies, since few studies have compared the outcome of an experimental lesion with the pathological changes induced by a genetic manipulation. one demonstrative example is our study from 10 years ago, in which we compared the effects of the app / ps1 transgenic background and fimbria - fornix transection (ffx) on spatial learning in the morris swim task in c57bl/6 mice (liu., 2002). while the ffx mice showed practically no improvement during five days, app / ps1 mice showed a clear learning curve, albeit a slower task acquisition than wild - type littermates. a second difference between transgenic app mice and animals with hippocampal lesions is in the number of cognitive processes affected. when we compared learning within and between daily sessions, a clear dissociation emerged between app / ps1 and ffx mice. whereas ffx mice were impaired in both within and between session learning, app / ps1 mice showed robust learning within a session, but seemed to forget most of what they learned by the next morning (liu., 2002). this saw - tooth learning curve in the morris swim task is also a common finding in aged rats (foster, 2012). a parsimonious explanation of this difference is that the hippocampus is necessary for navigation (triangulation based on external landmarks and self - motion) in real time, as well as for episodic encoding and memory consolidation. in contrast, accumulation of amyloid- in the hippocampus interferes only with the long - term memory formation. the susceptibility of app transgenic mice for faster forgetting of spatial information has been confirmed in at least two other mouse models in later studies (billings. the third difference is that long escape latencies at an early stage of task acquisition in app transgenic mice are largely due to strong thigmotaxis, which is a prominent feature in genetically modified mice in the morris swim task in general (lipp and wolfer, 1998). this is illustrated in figure 2, which shows parallel learning curves for 12-month - old apde9 and wild - type littermate male mice in terms of escape latency (figure 2a), path length (figure 2b), and time spent in the wall zone (figure 2c). on top of strong thigmotaxis, apde9 mice also show poor search bias in the probe test (figure 2d). without any doubt the morris swim task is a complex one and involves many cognitive processes at the same time, such as general adaptation to the stressful situation, abandoning of an ineffective tendency to search for an escape in the pool wall, locating the submerged platform based on distal landmarks, and finally encoding that information to long - term memory. a human analogy may be to give the task of delivering a package by bike to a remotely known address in a city to a person who has never ridden a bike before. the learning process involves the motor aspect of bike riding, learning how to cope with busy traffic, and finally, by trial and error, to remember successful and unsuccessful routes to the destination in a complex city map. in fact, it may be the feature of the morris swim task to draw on several parallel cognitive processes that explains its sensitivity to demonstrating cognitive impairment in ad model mice. it is likely that several cognitive processes are compromised in app transgenic mice due to synaptic pathology involving both the hippocampus and neocortex. (a) escape latency over five days of morris swim task acquisition in 12-month - old male appswe / ps1de9 (tg, n = 13) mice and their wild - type littermates (wt, n = 15). (b) corresponding plot for path length (p = 0.01, anova with repeated measures). (c) thigmotaxis, in terms of % time in the most peripheral 1/3 of the pool area, showed a similar time course as escape latency and path length (p = 0.001, anova with repeated measures). (d) the genotypes also differ in the time spent in the former platform area (diameter 30 cm) during the probe test on the last trial of day 5 (p = 0.03, student 's t - test). what then is the pathological feature in ad model mice which accounts for the impaired task acquisition and development of search bias in the morris swim task ? an important feature of all established app transgenic mouse models is that very young mice (~2 months) are indistinguishable from their wild - type littermates in the task performance. because the app transgene is translated to protein already during a late embryonic stage, normal performance in young transgenic mice implies that the behavioral deficit is not due to a developmental abnormality, but rather to age - related neurodegeneration. the same conclusion can be drawn from conditional mutant tau expressing mice (santacruz., 2005). however, the available literature does not support a direct relationship between amyloid plaque formation and spatial memory deficit. namely, the time course between amyloid plaque formation and the onset of spatial memory deficit varies greatly between different app transgenic mouse lines. as exemplified in figure 3, some mouse lines show memory impairment before the first amyloid plaques can be found in a neuropathological examination, while in some other mouse lines these two events can co - occur, and in some other lines, memory impairment may follow amyloid plaque formation by several months. timeline of amyloid plaque deposition vs. memory impairment in the morris swim task in three different app transgenic mouse lines : app23 (appswe under thy-1 promoter, van dam., 2003), tg2576 (appswe under hamster prp promoter, kawarabayashi., 2001 ; westerman., 2002), and apde9 (appswe and deletion of exon 9 of presenilin-1 under mouse prp, garcia - alloza., 2006 ; minkeviciene., the poor correlation between amyloid plaque load in post - mortem examination and performance in cognitive tests is also a well - established finding in human studies (nagy., 1995). however, it is possible that these different mouse lines exhibit different harmful effects induced by a formation. for instance, memory deficits before plaque formation may model the impact of soluble a oligomeric species, whereas memory deficits after plaque formation may model the impact of inflammatory mediators around the plaques. an issue that has attracted little attention so far is whether the exact nature of impaired performance in such a complex task as morris swim navigation also differs between those mouse lines that show early vs. late memory impairment with regard to the appearance of amyloid plaques. similarly, the correlation between insoluble intracellular tau deposits and impaired morris swim task performance is not straightforward. turning off the inducible p301l tau mutant transgene restores the task performance, but if done at a later time point than tau aggregation begins, tau aggregates continue to accumulate in the brain (santacruz., 2005). this finding implies that also for tau aggregates, the soluble species may be the most harmful ones for memory formation. it is often criticized for being too stressful for the animals (kennard and woodruff - pak, 2011). this is unavoidable, but the stress level can be reduced by proper pretraining and the use of testing schemes that allow sufficient time for mice to recover between trials. the concern about stressfulness, however, is outweighed by the guaranteed motivation for mice to perform a cognitive task for several days in a row without strict food restriction, which by itself may interfere with the disease process. another serious limitation is that the classic version of the task is basically a once - a - lifetime learning experience. we have tried to test the same apde9 mice at a young age before ad pathology and a second time around 12 months of age. despite several intervening months, repeated testing has been successfully applied when mice are trained to criterion using one platform position and then introduced to a new task with a novel platform position repeatedly (chen., 2000). however, this approach is quite tedious and is not well - suited for testing a large number of mice at two different age points. for this purpose, the radial - arm water maze may be a more appropriate solution (alamed. nevertheless, because of its established role as the gold standard memory test and the accumulated reference material over the years, the classic morris swim navigation task is likely to prevail for years as a central tool in the cognitive assessment of ad model mice, both in studies delving into the disease pathogenesis and studies on the efficacy of new therapeutic interventions. therefore, knowledge about its use potential and pitfalls should be available in all laboratories working on cognitive assessment of ad model mice. the author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. the author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
|
the morris swim navigation task (water maze) has been a primary research tool to assess hippocampal - dependent spatial learning and memory in rodents for three decades. originally developed for rats, its application to mouse studies has been a tedious process, but nowadays there are more studies performed with the morris swim task in mice than in rats. the task has proved to be particularly useful in demonstrating age - related memory impairment in transgenic mouse models of alzheimer 's disease (ad). this review focuses on task details that are most relevant for its application to mouse studies in general and characteristic patterns of impaired performance in alzheimer model mice as compared with rodents sustaining hippocampal lesions.
|
postvitrectomy diabetic vitreous hemorrhage (pdvh) occurs frequently in patients who undergo pars plana vitrectomy for complications of proliferative diabetic retinopathy (pdr). these complications include vitreous hemorrhage, macula - involving or threatening tractional retinal detachment, rhegmatogenous retinal detachment, and combined traction and rhegmatogenous retinal detachment with or without hemorrhage [13 ]. it is reported by brown. that the primary cause for reoperation in pdr was pdvh, with 14% of the rebleeding eyes regressing to no - light perception. when pdvh occurs, the level of vascular endothelial growth factor (vegf) becomes higher, which usually leads to neovascularization in the iris and the angle [58 ]. when neovascular fibrous tissues occupy the trabecular meshwork, aqueous outflow is disturbed, and nvg develops eventually. a major reason of severe visual loss in these patients who received vitrectomy for pdr is due to nvg. based on the high failure rate associated with filtering surgery and valve implantation surgery, nvg is very difficult to deal with for glaucoma and retina specialists, especially accompanied by pdvh [8, 9 ]. panretinal photocoagulation (prp) is an effective way because it destroys large areas of retinal tissue and rpe. however, in advanced cases of nvg, prp is difficult to perform because of turbid media due to increased iop and vitreous bleeding. cyclophotocoagulation is another alternative approach to lower iop by reducing aqueous production from the ciliary body, rapidly improving retinal perfusion [10, 11 ]. lowering iop improves retinal perfusion but does not alter the underlying pathological mechanism that leads to neovascularization. lke. demonstrated that intravitreal ranibizumab injection appears to be beneficial as an adjuvant treatment in nvg and rubeosis due to its antiangiogenic properties. delayed diagnosis or poor management can cause complete loss of vision with intractable pain. in managing nvg, it is essential to treat both the elevated iop and the underlying cause of the disease, such as pdvh. in view of the findings of the previous studies, we planned a prospective evaluation of the capacity of ranibizumab to treat the patients with nvg accompanied by pdvh. the study was performed in the department of ophthalmology, ruijin hospital, shanghai jiaotong university school of medicine, between january 2013 and december 2014. the research followed the tenets of the declaration of helsinki, and approval of the study was obtained from the institutional review board of ruijin hospital, shanghai, china. all patients received a detailed explanation of the study and provided a written informed consent. inclusion criteria in this study were (i) age 18 years ; (ii) pdvh obscuring the disc and vessels for more than 14 days and no evidence of retinal detachment after primary vitrectomy for pdr - related complications such as nonclearing vh, macula - involving or macula - threatening tractional retinal detachment, or fibrovascular proliferation with vitreoretinal adhesions ; and (iii) nvg occurrence following pdvh less than 4 weeks (nvg was diagnosed when an iop elevation of 22 mmhg or more was accompanied by neovascularization of the iris and/or the anterior chamber angle). the study exclusion criteria included (i) intraoperative use of long - acting gas or silicone oil in primary vitrectomy, repeat vitrectomy after primary vitrectomy for retinal diseases other than vh, and previous history of vitrectomy ; (ii) previous intravitreal injection of ranibizumab or bevacizumab in either eye ; (iii) previous intravitreal corticosteroids injection in either eye ; (iv) pregnancy or current oral contraceptive intake ; (v) usage of clopidogrel bisulfate or coumadin ; (vi) uncontrolled hypertension and cardiac disease ; and (vii) uncontrolled renal or liver disease. the consecutive 18 patients were enrolled in this study and they were treated with intravitreal ranibizumab (0.5 mg in 0.05 ml) injection. repeated intravitreal injection (0.5 mg in 0.05 ml) was given after 3 weeks in case of no obvious blood reabsorption while iop was 25 mmhg and supplementary prp was administered if needed and available by means of retina fluorescein angiography. ranibizumab may have a considerably shorter half - life in the vitreous cavity in a vitrectomized eye than a nonvitrectomized eye. we chose 3 weeks as the interval between two ranibizumab injections based on the suggestion by yeh.. vitrectomy with ranibizumab injection at the end of surgery was indicated if no clinical improvement in vitreous hemorrhage and iop > 25 mmhg was noted 2 weeks after the initial ranibizumab injection. if recurrent vh occurred again in the revitrectomized eyes, repeated injection of ranibizumab would be undertaken again. for some cases, even though having clear vitreous, if iop could not be controlled (30 mmhg) yet after vitreous surgery and ranibizumab injections as well as with medications, ahmed valve implantation was administered. intraoperative bleeding was controlled by either endodiathermy or increasing the irrigation bottle height. in the surgery, transient hypotony was made to identify any potential bleeding sites when operations were finished. at the end of surgery, for some cases with uncontrolled iop, ahmed tube insertion was administered only or with vitrectomy at the same time. all patients underwent a broad ophthalmologic examination at baseline and postoperative week 2 through month 12. at each visit, patients were assessed for logmar best - corrected visual acuity examination (bcva) (light perception vision was assigned as logmar vision of 2.6, hand motion vision as logmar vision of 2.3, and counting finger vision as logmar vision of 1.85), recurrent vh, number of ranibizumab injections, iop (goldmann applanation tonometry), number of glaucoma medications (topical and oral), and surgical interventions. the criteria for success at 12 months postoperatively were iop 21 mmhg without the necessity for adjunctive medications and iop 18 mmhg with 1 adjunctive medication and at the same time the vitreous cavity is clear. usa) using student 's t - test, with a p value 25 mmhg in another 8 eyes after the initial ranibizumab injection, vitreous surgery with supplementation of retinal photocoagulation was administered and at the end of surgery ranibizumab was reinjected intravitreally. after this kind of treatment, four cases (cases 7, 8, 12, and 15) still received mean 3.5 0.58 ranibizumab injections because of uncontrolled recurrent vh ; case 14 received another 3 ranibizumab injections due to uncontrolled nvg. the five eyes gained clear vitreous and controlled iop at 12-month follow - up with or without antiglaucoma medications. for cases 10, 17, and 18, due to recurrent vh and/or uncontrolled iop, the remaining three of the 8 eyes received repeated injections of ranibizumab and revitrectomy ; two of the 3 eyes (cases 17 and 18) received ahmed valve implantation due to uncontrolled iop. finally, all the 18 eyes got clear vitreous at the follow - up month 12 and the total reabsorption time was 17.83 12.71 weeks (table 2). at the first follow - up, the baseline iop decreased significantly, ranging between 15 and 30 mmhg (23.2 5.3 mmhg) in all the 18 eyes. during the 12-month follow - up, after additional treatments with vitrectomy or / with ahmed valve implantation and medications usage, at the remaining visits (week 2 till month 12), the mean iop value was under 23.2 5.3 mmhg. at follow - up month 12, the mean iop was 16.2 4.9 mmhg (figure 1). at baseline, on average, 3.4 0.70 topical antiglaucomatous medications were applied, and ten patients also received oral acetazolamide. at every follow - up visit, compared to baseline, the number of antiglaucomatous medications applied significantly reduced (p < 0.01). after month 6, the number of antiglaucomatous medications applied was between 0 and 2 at the following visits, and no patients received oral acetazolamide. at 12-month follow - up, only 0.67 0.77 antiglaucomatous medications were applied (figure 2). there were significant differences in iop and antiglaucomatous medications usage between baseline and each visit during 12-month follow - up. at follow - up month 12, success was achieved in 83.3% of the 18 subjects. at baseline, the mean bcva was 1.99 0.40. at earlier visits follow - up (week 2 till month 2), bcva revealed a modest improvement compared to baseline (p < 0.05). at the remaining visits (month 3 till month 12), the improvement of bcva reached the significant level (p < 0.01). at month 12, bcva was 0.81 0.34 (p = 0.000, figure 3). no unmanageable intraoperative or postoperative complications developed in this series, such as endophthalmitis, retinal detachment, suprachoroidal hemorrhage, cellulitis, phthisis bulbi, or persistent hypotony [iop < 5 mmhg ]. as for systemic adverse events such as myocardial infarction or cerebrovascular accidents, there were no occurrences in any of the patients in this study. this prospective, controlled interventional case series reports for the first time on an effective iop control and reabsorption of recurrent hemorrhage after adjuvant intraocular ranibizumab injection in addition to appropriate antiglaucomatous treatment and therapy of the nvg accompanied with pdvh lasting for the complete 12-month follow - up. recurrent vh after successful diabetic vitrectomy is not uncommon, although adequate retinal ablation plus sclerotomy site cryotherapy has been undertaken. previous reports showed that in the early postoperative period, injured vessels, residual fibrovascular tissue, or early regrowth of neovascularization may be the causes of bleeding ; late recurrent hemorrhage is more likely associated with neovascularization from the peripheral retina or instrument entry sites. many methods have been used to treat postvitrectomy persistent or recurrent hemorrhage, including gas - fluid exchange, panretinal cryotherapy, vitreous lavage, and dissection of entry - site fibrovascular proliferation [17, 18 ] ; however further recurrent hemorrhage occurred frequently. when pdvh occurs and persists, nvg usually appears immediately, which may be due to the vegf, diffusing throughout the globe and leading to neovascularization. it was reported that high level of vegf induced pdvh and nvg in patients with pdr who received vitrectomy. nvg after vitrectomy for pdr is the most serious complication and portends very poor prognosis. as long as only nvg with pdvh occurs, the treatments become very difficult to be administered [59 ]. bevacizumab (avastin, roche), a recombinant monoclonal antibody that binds to all subtypes of vascular endothelial growth factor (vegf), has been shown to induce effective regression of retinal neovascularization secondary to proliferative diabetic retinopathy (pdr) [68 ]. recently, numerous reports have focused on the adjunctive use of bevacizumab to reduce postoperative vh in vitrectomy for pdr [1922 ]. however, in china, intravitreal bevacizumab injection is considered as an off - label treatment in dr and pdr. ranibizumab (lucentis, novartis), another anti - vegf drug, a fragment of a recombinant humanized igg1 monoclonal antibody that inhibits all isoforms of the human vegf - a, has been shown to be beneficial as an adjuvant treatment in neovascular glaucoma and rubeosis due to its antiangiogenic properties. a current study by li. reported that ranibizumab plus combined surgery for treatment of nvg with vh was effective. based on the previous findings, we hypothesize that intravitreal injection of ranibizumab in eyes with nvg companied with pdvh may induce regression of new vessels and reduce the possibility of repeated bleeding, thus shortening the reabsorption time, lowering higher iop, and reducing the need for surgery. 10 patients (10 eyes) obtained clear vitreous and controlled iop at the end of complete 12-month follow - up only by ranibizumab injection (2.7 1.8 injections) with or without supplementary prp, although second or third episode recurrent vh was noted in some cases. for the remaining 8 eyes in this study, in order to decrease the impact of uncontrolled vh and higher iop on retina, vitreous surgery was administered. during follow - up, after this kind of treatment, five of the 8 eyes gained clear vitreous and controlled iop finally at 12-month follow - up. the remaining three of the 8 eyes received vitrectomy or / with ahmed valve implantation because of uncontrolled recurrent vh and/or uncontrolled iop during follow - up. yeh. reported that in their study after treatment of intravitreal bevacizumab injection for recurrent vh after diabetic vitrectomy, no surgery was needed. however, in our study, in 8 eyes (44.4%), revitrectomy and/or valve implantation was still needed to be performed. we considered that this result was due to the fact that our patients encountered nvg and pdvh at the same time. although effects of ranibizumab injection are known to be transient, especially in vitrectomized eyes, to some degree, the ranibizumab still can inhibit the effect of vegf, resulting in improving absorption of vh and inducing regression of angle and retinal neovascularization, lowering higher iop consequently. however, due to the difficulty of treatment for nvg and pdvh, further surgical procedures, including vitrectomy or valve implantation, can not be avoided completely. intraocular pressure following comprehensive treatment was one of the major criteria of therapeutic success. nvg usually resulted from anterior chamber angle obstruction due to angle neovascularization and peripheral anterior synechiae. before complete formation of synechiae, iop may be controlled without further need for surgical procedures by treatment with ranibizumab injection.. showed if neovascularizations of the anterior chamber angle were present, ranibizumab alone in combination with adequate prp has been demonstrated to be sufficient to achieve a permanent regression of angle involvement, to prevent synechiae, and to reduce the intraocular pressure rapidly. in our study, the rapid regression of iris rubeosis and absorption of vh was combined with a significant iop reduction in major cases after 14 days. at the first follow - up, the baseline iop (36.7 8.1 mmhg) decreased significantly, ranging between 15 and 30 mmhg (23.2 5.3 mmhg) in all the 18 eyes. after treatment with ranibizumab injection, the regression of neovascularization and inflammation allowed improved drainage via the noninvolved trabecular meshwork. during follow - up, repetatus elevated iop and recurrent vh might cause irreversible synechiae formation, resulting in no or lower response to anti - vegf treatment. therefore, intravitreal anti - vegf treatment alone seems to be insufficient in those pathologically advanced stages which require an additional treatment of the ischemic retina, such as vitrectomy or / with valve implantation. after adjuvant ranibizumab injection, a significant reduction of antiglaucomatous medication was also observed in the study at each visit compared to baseline, especially after 6-month follow - up, the number of antiglaucomatous medications applied was between 0 and 2 at the remaining following visits, and no patients received oral acetazolamide. in addition to the absorption of recurrent vitreous hemorrhage and the iop control, a significant improvement of bcva was evident in our study. due to more episodes of recurrent bleeding in early stage, bcva revealed a modest improvement compared to baseline (p < 0.05) at earlier visits follow - up (week 1 till month 3). at the remaining visits (month 4 till month 12), with the iop control and clearance of vitreous cavity improvement, bcva reached the significant level (p < 0.01). the increase of bcva was due to the well - graduated combined treatment regime, including reinjection of ranibizumab, vitrectomy, and/or valve implantation, which resulted in regression of corneal and macular oedema, clearance of vitreous, and iop control. in summary, our study suggests that repeated intravitreal ranibizumab injection may be effective as adjuvant therapy in the treatment of pdvh accompanied by nvg in facilitating reabsorption of vitreous blood, decreasing higher iop, and reducing additional vitreous surgeries. first, the study was designed without control group, just to compare the characteristics between baseline and posttreatment. although there were no serious side effects found in this study with repeated intravitreal ranibizumab injection, further study with prospective design and a larger case number may be necessary to confirm the efficacy and safety of the treatment.
|
purpose. to determine the efficacy of intravitreal ranibizumab injection as adjuvant therapy in the treatment of neovascular glaucoma (nvg) accompanied by postvitrectomy diabetic vitreous hemorrhage (pdvh). methods. eighteen nvg patients (18 eyes) accompanied by pdvh were enrolled in this prospective, monocenter, 12-month, interventional case series. the consecutive 18 patients with an iop 25 mmhg despite being treated with the maximum medical therapy were treated with intravitreal ranibizumab injections. vitreous surgery or / with ahmed valve implantation were indicated if no clinical improvement in vitreous haemorrhage and uncontrolled iop was shown. results. ten patients got clear vitreous and controlled iop only with 2.7 1.8 injections of ranibizumab without additional surgery. vitrectomy or / with ahmed valve implantation was administered in the other 8 eyes due to uncontrolled vh and iop. at follow - up month 12, all the 18 eyes gained clear vitreous. at month 12 bcva improved significantly compared to baseline. the baseline and follow - up at month 12 iop / medication usage were 36.7 8.1 mmhg on 3.4 0.7 medications and 16.2 4.9 mmhg on 0.67 0.77 medications, respectively. conclusions. the findings suggest that intravitreal ranibizumab injection as adjuvant therapy for treatment of nvg accompanied by pdvh may be safe and potentially effective. this clinical trial is registered with nct02647515.
|
chemotaxis is a pivotal response of many cells to spatial cues (van haastert and devreotes, 2004 ; affolter and weijer, 2005 ; wu, 2005). it plays important roles in diverse functions, such as finding nutrients in prokaryotes, forming multicellular structures in protozoa, and tracking bacterial infections in neutrophils (baggiolini, 1998 ; campbell and butcher, 2000 ; crone and lee, 2002). research on directional movement by external cues in eukaryotes is dominated by chemoattraction, which is the movement toward the chemical compound. repellents play an important role in morphogenesis, especially during embryonic development (yang., 2002 ; schmitt., 2005 cell movement during chick primitive streak formation is controlled by fgf8-mediated chemorepulsion of the cells away from the streak, followed by chemoattraction toward the fgf4 signal produced by the forming notochord (yang., 2002). axon guidance during spinal chord development away from the roof plate is regulated by multiple repellents, such as bmp (butler and dodd, 2003), and by the attractant netrin toward the floor plate (kennedy., 2006). the mechanism by which repellents work is not well known (dormann and weijer, 2006). we envision that a critical step of the signal transduction pathway for cell movement is stimulated by a chemoattractant and inhibited by a repellent. it is essential that this hypothetical step is somehow connected with cell polarity to obtain directional movement. dictyostelium discoideum cells have been instrumental in resolving the mechanism by which cells sense and respond to chemoattractants. it has been shown that phosphatidylinositol-3,4,5-trisphosphate (pip3), which is formed at the side of the cell closest to the source of chemoattractant, is a very strong inducer of pseudopod extensions (parent., 1998 ; hirsch., 2000 ; servant., 2000 ; funamoto., d. discoideum cells are known to be repelled by unidentified compounds that are secreted by starving cells (keating and bonner, 1977 ; kakebeeke., 1979), indicating that d. discoideum cells have a mechanism to process repellents. previously, we have shown that several analogues of the attractant camp behave as a repellent (van haastert., 1984). the analogues mediate their effect through binding to the surface camp receptor car1 (johnson., 1992), and they can be polar (3deoxy, 3amino - camp ; 3nh - camp) or lipophilic (8-para - chlorphenylthio - camp ; 8cpt - camp). the analogues induce many signaling responses that are essentially identical to the responses induced by camp, including activation and adaptation of adenylyl and guanylyl cyclase (peters., 1991 ; bominaar and van haastert, 1993, 1994). we show that these analogues inhibit plc, contrary to activation of plc by camp. as a consequence, they induce dominant pi(3,4,5)p3 signaling in the rear of the cell, by which cells move away from the repellent. d. discoideum cells were stimulated with a micropipette containing either the agonist camp or the commercially available antagonist 8cpt - camp. the cells moved toward the pipette with camp, but did not move effectively toward the pipette with 8cpt - camp, and actually moved away from the pipette (fig. experiments have been repeated with 3nh - camp, yielding the same results as with 8cpt - camp (unpublished data). 1 a shows four frames from a movie in which cells were stimulated with two pipettes containing camp and 8cpt - camp, respectively (video 3). in buffer, cells move in random directions (fig. 1 a, 1 min), and cells move away from the pipette with 8cpt - camp (fig. 1 a, 16 min). upon application of the pipette with camp (camp and 8cpt - camp ; fig. 1 a, 26 min) cells moved in nearly random directions. however, upon withdrawal of the pipette containing 8cpt - camp, cells immediately moved toward the pipette with camp (fig. data are presented as the chemotaxis index, which is the distance moved in the direction of the gradient (upgradient) divided by the total distance moved in 30-s intervals. 1 b, and the means and the sems for six independent experiments are presented in fig. 1 c. wild - type cells show an excellent chemotactic response toward camp, with a chemotaxis index of 0.81 0.05. cells are not attracted to the pipette containing 8cpt - camp, but instead exhibit a significant negative chemotaxis index of 0.52 0.04 (p < 0.005). the chemotaxis index of cells stimulated simultaneously with camp and 8cpt - camp is 0.18 0.11, indicating that 8cpt - camp antagonizes the positive chemotaxis toward camp and camp antagonizes the negative chemotaxis induced by 8cpt - camp. finally, starting with stimulation by the two pipettes, upon withdrawal of the pipette with 8cpt - camp the chemotaxis index toward camp rapidly increases to 0.72 0.06. the results demonstrate that 8cpt - camp is a repellent that can reversibly inhibit the chemotactic response to camp. were spread on a polystyrene surface in a droplet with 0.5 ml of 10 mm phosphate buffer, ph 6.1, at room temperature, and stimulated by micropipettes filled with 10 mm 8cpt - camp (bottom right, open circle) or 0.1 mm camp (top left, asterisk) ; see materials and methods for further details. (a) four frames from a movie (video 3) showing the distribution of cells without stimulus, 8 min after stimulation with 8cpt - camp, 5 min after stimulation with 8cpt - camp and camp, and 12 min after stimulation with camp alone (by removing the pipette with 8cpt - camp). (b) the chemotaxis index was determined for 20 cells that were shown in video 3 ; (top) the filled sections show the simulation with camp and/or 8cpt - camp. (c) the chemotaxis index was calculated for 85 cells from 6 independent experiments ; data shown are the mean the sem. d. discoideum cells move using actin filaments in the front of the cell, which induce the formation of local pseudopodia, and actomyosin filaments in the rear of the cell, which inhibit pseudopod formation and retract the uropod. we coexpressed myosin - rfp and the filamentous actin - binding protein lime - gfp from a single plasmid. a pipette with camp induces the expected movement of the cells upgradient with lime - gfp localized in the front and myosin - rfp in the rear of the cell (fig. 2 a and video 4, available at http://www.jcb.org/cgi/content/full/jcb.200611046/dc1). interestingly, the localization of lime - gfp in the protruding front and myosin - rfp in the retracting back is identical in cells stimulated with 8cpt - camp, except that the front is downgradient and cells move away from the pipette (fig. 2 a and video 5). (a) cells expressing myosin ii - rfp (red) and the f - actin binding protein lime - gfp (green) were stimulated with camp or 8cpt - camp by pipettes that are positioned at the right. the figure shows 3 frames of a movie with 5-min intervals (camp, video 4 ; 8cpt - camp, video 5). (b) cells expressing the pi(3,4,5)p3 detector phcrac - gfp, pi3k - gfp, or pten - gfp were stimulated with camp or 8cpt - camp by pipettes that are positioned at the right. the figure shows a representative cell for each case (a field of cells expressing phcrac - gfp is presented in video 4 for camp and videos 5 and 6 for 8cpt - camp). videos 46 are available at http://www.jcb.org/cgi/content/full/jcb.200611046/dc1. to investigate the mechanism by which 8cpt - camp induces negative chemotaxis, wild - type cells expressing the pi(3,4,5)p3 detector phcracgfp were stimulated with camp and 8cpt - camp., 1998 ; huang., 2003), a pipette with camp induces strong localization of phcracgfp to the plasma membrane at the upgradient side of the cell. pseudopodia are extended from phcracgfp - containing areas and cells move upgradient toward the pipette (fig. 8cpt - camp also induces strong localization of phcracgfp at the plasma membrane, but with opposite polarity compared with camp, which is downgradient (fig. cells extend pseudopodia from these phcracgfp - containing areas, and therefore move away from the pipette with 8cpt - camp. the size of the phcracgfp patches induced by 8cpt - camp (9.0 0.43 m) is only slightly larger than the patches induced by camp (6.6 0.17 m), indicating that 8cpt - camp effectively reverses the pi(3,4,5)p3 polarity. pi(3,4,5)p3 is formed by pi3-kinase (pi3k) and degraded by pten that, in camp gradients, are localized at the leading edge and the rear of the cell, respectively. in 8cpt - camp gradients, the localization of pi3k and pten 2 b). to investigate the role of pi3k activity in polarity and chemotaxis reversal, we investigated the chemotactic activity of pi3k1/2-null cells toward camp and 8cpt - camp. in pi3k1/2-null cells, two pi3ks are deleted that, together, mediate the vast majority of camp - stimulated pi(3,4,5)p3 production (zhou., 1998 ; these experiments are possible because pi3k is not essential for chemotaxis, and directional sensing can be mediated by other pathways (hirsch., 2000 ;, 2002 ; iijima and devreotes, 2002 ; huang., 2003 ; 3 shows that pi3k1/2-null cells exhibit a good chemotactic response toward a pipette with camp (chemotaxis index is 0.80 0.13). in contrast to the negative chemotaxis induced by 8cpt - camp in wild - type cells, pi3k1/2 null cells do not exhibit a significant negative or positive response to 8cpt - camp (chemotaxis index is 0.11 0.12). more importantly, using two pipettes with camp and 8cpt - camp, respectively, pi3k1/2-null cells effectively move toward camp and are not inhibited by 8cpt - camp (fig. 3 and video 8, available at http://www.jcb.org/cgi/content/full/jcb.200611046/dc1), indicating that pi3k is essential for the repellent activity of 8cpt - camp and for the inhibitory effect of 8cpt - camp on camp chemoattraction. (a) frames from movies presenting the distribution of cells at 15 min after stimulation with both 8cpt - camp (open circles) and camp (asterisks) taken from video 3 for wt cells, video 8 for pi3k1/2-null cells, and video 9 for plc - null cells. wild - type cells show random distribution, whereas pi3k1/2-null and plc - null cells are attracted toward the pipette with camp. (b) chemotaxis index of wild - type, pi3k1/2-null, and plc - null cells toward camp, 8cpt - camp, or 8cpt - camp and camp. the results show that wild - type cells move away from 8cpt - camp, whereas pi3k1/2-null and plc - null are not repelled from 8cpt - camp. moreover, chemotaxis toward camp is antagonized by 8cpt - camp in wild - type cells, but not in pi3k1/2-null and plc - null cells. videos 3, 8, and 9 are available at http://www.jcb.org/cgi/content/full/jcb.200611046/dc1. the molecular mechanism by which camp mediates pi(3,4,5)p3 accumulation upgradient in d. discoideum cells has been well described. pi3k is activated and enriched upgradient in the cell, whereas the pi(3,4,5)p3-degrading enzyme pten strongly localizes downgradient in the cell (funamoto., 2002 ; iijima and devreotes, 2002). pten has been demonstrated to bind to phosphatidylinositol-3,4,5-trisphosphate (pip2), suggesting that pi(4,5)p2 is depleted upgradient in the cell (iijima., 2004). this depletion of pi(4,5)p2 could be induced by several nonexclusive methods, such as the observed conversion of pi(4,5)p2 to pi(3,4,5)p3 upgradient by pi3k (funamoto., 2002 ; huang., 2003), but also by the conversion of pi(4,5)p2 to ins(1,4,5)p3 and dag by plc, which is known to be activated by camp (drayer and van haastert, 1992 ; bominaar., 1994) we propose a mechanism by which 8cpt - camp could revert the polarity of chemotactic sensing that is based on the observation that camp stimulates plc, whereas 8cpt - camp inhibits this enzyme (peters., 1991 ; bominaar and van haastert, 1993 ; bominaar and van haastert, 1994 ; supporting biochemical data are presented in fig. upgradient stimulation of plc by camp will lead to local depletion of pi(4,5)p2, and thereby prevent pten binding, by which the upgradient pi(3,4,5)p3 accumulation is stabilized. in contrast, the upgradient inhibition of plc by 8cpt - camp will lead to the local accumulation of pi(4,5)p2, thereby inducing pten binding and upgradient pi(3,4,5)p3 degradation (fig. this relatively simple model for polarity reversal predicts that 8cpt - camp does not induce polarity switching in plc - null cells. d. discoideum cells contain a single plc gene encoding a plc isoform (drayer and van haastert, 1992), which, like pi3k, is instrumental but not essential for chemotaxis (drayer., expression of gfp - tagged reporter proteins in plc - null cells reveal, as predicted, cytosolic localization of ph - cracgfp and enhanced pten - gfp expression at the membrane in camp and 8cpt - camp gradients (fig. 3 b and video 9, plc - null cells show a similar chemotactic response toward 8cpt - camp as pi3k - null cells : they move in random directions in the presence of 8cpt - camp alone and, subsequently, move effectively toward an additional pipette with camp. this indicates that plc is also essential for mediating the inhibitory effect of 8cpt - camp, as is pi3k. finally, pten - null cells were investigated, showing that these cells are attracted toward camp, but are not repelled by 8cpt - camp (unpublished data). model for polarity reversal leading to camp - induced attraction and 8cpt - camp induced repulsion. the model contains three regulatory loops : first, a plc activation / inhibition loop providing primary polarity of the pi(4,5)p2 gradient ; second, a pi(4,5)p2/pten loop providing degradation of pi(3,4,5)p3 ; and third, a pi3k / f - actin loop providing pi(3,4,5)p3-mediated pseudopod extension. because of inhibition of plc by 8cpt - camp compared with stimulation by camp, the pi(4,5)p2 polarity inverses, pi(3,4,5)p3 accumulates downgradient, and cells move away from the pipette. the scheme is based on the observation that the pi(3,4,5)p3-degrading enzyme pten binds to pi(4,5)p2, whereas pi3k binds to actin filaments in the leading edge (iijima., 2004 ; sasaki., 2004), and on the observation that camp activates plc, whereas 8cpt - camp inhibits this enzyme (bominaar and van haastert, 1993, 1994 ; peters., 1991). the mediating g proteins have been identified using knock - out cells (see supporting biochemical data in fig. a scheme for pi(3,4,5)p3-mediated chemotaxis reversal by 8cpt - camp consists of three parts (fig. 4). the basis is a plc / pi(4,5)p2 polarity switch. in d. discoideum, plc is regulated by the activating g2 and inhibitory g1, which, in a gradient of attractant or repellent, will determine the polarity of the pi(4,5)p2 gradient. the attractant camp shows predominant activation of plc, leading to lower pi(4,5)p2 levels upgradient, while the repellent 8cpt - camp inhibits plc, leading to higher pi(4,5)p2 levels upgradient. the resulting gradients of pi(4,5)p2 and colocalized pten mediate opposite gradients of pi(3,4,5)p3, leading to the localized polymerization of actin. the gradients of localized pten and pi3k are stabilized because pten accumulates at the site of its product pi(4,5)p2, whereas pi3k accumulates at sites of its effector, pi(3,4,5)p3-induced f - actin. this mutually spatial exclusion of pi3k and pten will result in symmetry breaking, by which small spatial differences in the underlying polarity gradient can be amplified to the observed strong pi(3,4,5)p3 gradient. although pi3k and plc are not essential for chemotaxis, the results clearly demonstrate that local formation of pi(3,4,5)p3 is a very strong inducer of pseudopod formation, such that the cells can even move downgradient, overruling any upgradient signaling that 8cpt - camp may induce. in our model, a compound is a repellent because it binds to a receptor that is preferentially coupled to plc via an inhibitory g protein, whereas it is an attractant when the receptor is coupled to a stimulatory g protein. the regulation of d. discoideum plc by the stimulatory g2 and inhibitory g1 forms the basis for the polarity switch, and it allows the cell to respond to chemical gradient with repulsion or attraction. cells starved for < 1 h secrete unidentified compounds that induce repulsion of the cells, by which cells may find bacteria in a larger area (keating and bonner, 1977 ; kakebeeke., 1979). cells starved for 5 h secrete camp, to which they are attracted and which allows the cells to form a multicellular structure. interestingly, g1 is expressed throughout development, whereas g2 is nearly absent during early starvation and expressed only after 4 h (pupillo., 1989). pi3k system is pruned for repulsion, whereas it becomes a system for attraction by expression of the stimulatory g2 during late starvation. pi3k signaling could be instrumental in mammalian cells to navigate in complex chemotactic gradients. during development, many cells, such as neurons and gonads, are projected in the body by mixtures of attractants and repellents (yang., 2002 ; schmitt., 2005). in contrast, slit2 does not affect the direction of movement of vascular smooth muscle cells, but strongly inhibits pdgf - stimulated chemotaxis by inhibition of pdgf stimulation of rac1 (wu. it is possible that, in neuronal cells, slit2 induces a polar inhibition of rac1, thereby inducing repulsion, whereas in vascular smooth muscle cells slit2 induces uniform inhibition of rac1 and is therefore not a repellent, but only an inhibitor of chemoattractants. rac1 is known to be regulated by pip3 in mammalian (srinivasan., 2003 ; kunisaki., 2006) and d. discoideum (park., 2004) cells. the observed simplicity by which plc - mediated polarity inversion of pi3k signaling in d. discoideum converts attraction to repulsion may provide a single mechanism to integrate complex positive and negative chemotactic signals during development. the plasmid pwf38 (phcracgfp) expressing the 700-bp n - terminal ph domain of crac fused to gfp (parent., 1998), and plasmids expressing pi3k2-gfp (funamoto., 2002 ; iijima and devreotes, 2002) and pten - gfp (iijima and devreotes, 2002) were provided by p. devreotes (johns hopkins university school of medicine, baltimore, md). plasmid 339 - 3 expressing mrfpmars (fischer., 2004) was provided by a. muller - taubenberger (ludwig maximilians university munich, munich, germany). plasmid pbig - gfp - myo expressing a gfp fusion with myosin heavy chain ii (levi., 2002) was a gift from t. egelhoff (case western reserve university, cleveland, oh). pi3k1/2-null cells were provided by r. firtel (university of california, san diego, la jolla, ca). the neomycin resistance gene of mb74 was exchanged for the hph hygromycin resistance gene that was preceded by an actin 15 promotor and terminated with a caba terminator. the dna coding for the actin - binding domain of lime (aa 1145) was cloned behind an actin 15 promoter and 5 adenosines, which serve as the kozak sequence. it was followed by a spei site (coding for thr and ser) and the complete open reading frame of gfp (s65 t variant), followed by a stop codon and an actin 8 terminator. the gene encoding the monomeric red fluorescent protein mrfpmars (fischer., 2004) was amplified by pcr on plasmid dna. the gene was preceded by a ngomiv site, an actin 15 promotor, and 5 adenosines, and was followed by a bamhi site (encoding gly and ser), the sequence encoding aa 22116 of myosin heavy chain, the myosin terminator from the vector pbig - gfp - myo (levi., 2002), and a ngomiv site. finally, the gene encoding the mrfpmars - myosin fusion was released using the ngomiv site and cloned into the single ngomiv site of mb74hyg - lime - gfp. the d. discoideum strain ax3 was used as wild - type control in all experiments. the mutants strains used are the plc - null strain 1.19 (drayer., 1995), the pi3k - null pi3k1/pi3k2 strain gmp1 (funamoto., 2001), and pten - null cells (iijima and devreotes, 2002). cells were grown in shaking culture in hg5 medium (containing per liter : 14.3 g oxoid peptone, 7.15 g bacto yeast extract, 1.36 g na2hpo4 12h2o, 0.49 g kh2po4, 10.0 g glucose) at a density between 5 10 and 6 10 cells / ml. cells were harvested by centrifugation for 3 min at 300 g, washed in pb (10 mm kh2po4/na2hpo4, ph 6.5), and starved in pb in 6-well plates (nunc) for 5h. cells were then resuspended in pb, centrifuged, and washed once in pb, and resuspended in pb at a density of 6 10 cells / ml. unless otherwise mentioned, digital images of cells in pb at room temperature were captured at 10-s time intervals over 45 min. videos 1, 2, 4, and 57 were captured using a confocal laser scanning microscope (lsm 510 meta - nlo ; carl zeiss microimaging, inc.) equipped with a 63/na 1.4 objective (plan - apochromatic ; carl zeiss microimaging, inc.). for excitation of the fluorochromes, gfp (s65 t variant), and mrfpmars, a 488-nm argon / krypton laser and a 543-nm helium laser were used, respectively. the fluorescence was filtered through a bp500 - 530 ir and a lp560 filter, and was detected by a photomultiplier tube. the field of observation is 206 206 m ; videos 1 and 2 present the phase - contrast channel, whereas the fluorescent channel is shown in videos 47. for videos 3 and 9, an inverted light microscope (type ck40 with a lwd a240 20/na 0.4 objective ; olympus) fitted with a charge - coupled device camera (tk - c1381 ; jvc) was used. digital images were captured on a pc using virtualdub software and indeo video 5.10 compression. video 8 was captured using a 10 numerical aperture 0.25 objective, and presents a selected field of the same size, namely 358 269 m. for all individual videos, specific time periods were selected that start at the moment the pipette was lowered to the plane just above the cells. in the phase - contrast videos, (videos 47), the place of the pipette tip is indicated with an asterisk. the chemotaxis index, which is defined as the ratio of the cell displacement in the direction of the gradient and its total traveled distance, was determined for 25 cells in a video, as follows. first, the position of the centroid of a cell was determined with imagej (national institutes of health ; rsb.info.nih.gov/ij) for frames at 30-s intervals, yielding a series of coordinates for that cell. using these coordinates, the chemotaxis index of each 30-s step was calculated and averaged, yielding the chemotaxis index for that cell in the movie. the data shown are the average and sem of the chemotaxis indices from at least three independent experiments, with 25 cells per experiment. s1 shows cell trajectories of wild - type cells in a gradient of camp and 8cpt - camp, revealing that cells are attracted toward camp, but repelled from 8cpt - camp. s3 shows the localization of phcrac - gfp, pten - gfp, and pi3k - gfp in plc - null cells in a gradient of camp or 8cpt - camp. video 3 shows cell movement in gradients of 8cpt - camp and camp+8cpt - camp, followed by movement in only camp. video 4 shows the localization of f - actin at the leading edge and myosin in the back of cells chemotaxing toward camp. video 5 shows the localization of f - actin at the leading edge and myosin in the back of cells chemotaxing away from 8cpt - camp. video 6 shows the localization of phcracgfp (detecting pip3) at the leading edge of cells chemotaxing toward camp. video 7 shows the localization of phcracgfp (detecting pip3) at the leading edge of cells chemotaxing away from 8cpt - camp. video 8 shows chemotaxis of pi3k1/2-null cells toward camp in the presence of 8cpt - camp. video 9 shows chemotaxis of plc - null cells toward camp in the presence of 8cpt - camp. the plasmid pwf38 (phcracgfp) expressing the 700-bp n - terminal ph domain of crac fused to gfp (parent., 1998), and plasmids expressing pi3k2-gfp (funamoto., 2002 ; iijima and devreotes, 2002) and pten - gfp (iijima and devreotes, 2002) were provided by p. devreotes (johns hopkins university school of medicine, baltimore, md). plasmid 339 - 3 expressing mrfpmars (fischer., 2004) was provided by a. muller - taubenberger (ludwig maximilians university munich, munich, germany). plasmid pbig - gfp - myo expressing a gfp fusion with myosin heavy chain ii (levi., 2002) was a gift from t. egelhoff (case western reserve university, cleveland, oh). pi3k1/2-null cells were provided by r. firtel (university of california, san diego, la jolla, ca). the neomycin resistance gene of mb74 was exchanged for the hph hygromycin resistance gene that was preceded by an actin 15 promotor and terminated with a caba terminator. the dna coding for the actin - binding domain of lime (aa 1145) was cloned behind an actin 15 promoter and 5 adenosines, which serve as the kozak sequence. it was followed by a spei site (coding for thr and ser) and the complete open reading frame of gfp (s65 t variant), followed by a stop codon and an actin 8 terminator. the gene encoding the monomeric red fluorescent protein mrfpmars (fischer., 2004) was amplified by pcr on plasmid dna. the gene was preceded by a ngomiv site, an actin 15 promotor, and 5 adenosines, and was followed by a bamhi site (encoding gly and ser), the sequence encoding aa 22116 of myosin heavy chain, the myosin terminator from the vector pbig - gfp - myo (levi., 2002), and a ngomiv site. finally, the gene encoding the mrfpmars - myosin fusion was released using the ngomiv site and cloned into the single ngomiv site of mb74hyg - lime - gfp. the d. discoideum strain ax3 was used as wild - type control in all experiments. the mutants strains used are the plc - null strain 1.19 (drayer., 1995), the pi3k - null pi3k1/pi3k2 strain gmp1 (funamoto., 2001), and pten - null cells (iijima and devreotes, 2002). cells were grown in shaking culture in hg5 medium (containing per liter : 14.3 g oxoid peptone, 7.15 g bacto yeast extract, 1.36 g na2hpo4 12h2o, 0.49 g kh2po4, 10.0 g glucose) at a density between 5 10 and 6 10 cells / ml. cells were harvested by centrifugation for 3 min at 300 g, washed in pb (10 mm kh2po4/na2hpo4, ph 6.5), and starved in pb in 6-well plates (nunc) for 5h. cells were then resuspended in pb, centrifuged, and washed once in pb, and resuspended in pb at a density of 6 10 cells / ml. unless otherwise mentioned, digital images of cells in pb at room temperature were captured at 10-s time intervals over 45 min. videos 1, 2, 4, and 57 were captured using a confocal laser scanning microscope (lsm 510 meta - nlo ; carl zeiss microimaging, inc.) equipped with a 63/na 1.4 objective (plan - apochromatic ; carl zeiss microimaging, inc.). for excitation of the fluorochromes, gfp (s65 t variant), and mrfpmars, a 488-nm argon / krypton laser and a 543-nm helium laser were used, respectively. the fluorescence was filtered through a bp500 - 530 ir and a lp560 filter, and was detected by a photomultiplier tube. the field of observation is 206 206 m ; videos 1 and 2 present the phase - contrast channel, whereas the fluorescent channel is shown in videos 47. for videos 3 and 9, an inverted light microscope (type ck40 with a lwd a240 20/na 0.4 objective ; olympus) fitted with a charge - coupled device camera (tk - c1381 ; jvc) was used. digital images were captured on a pc using virtualdub software and indeo video 5.10 compression. video 8 was captured using a 10 numerical aperture 0.25 objective, and presents a selected field of the same size, namely 358 269 m. for all individual videos, specific time periods were selected that start at the moment the pipette was lowered to the plane just above the cells. in the phase - contrast videos, the pipette tips are visible as dark triangular shadows. in the fluorescence videos (videos 47), the place of the pipette tip is indicated with an asterisk. the chemotaxis index, which is defined as the ratio of the cell displacement in the direction of the gradient and its total traveled distance, was determined for 25 cells in a video, as follows. first, the position of the centroid of a cell was determined with imagej (national institutes of health ; rsb.info.nih.gov/ij) for frames at 30-s intervals, yielding a series of coordinates for that cell. using these coordinates, the chemotaxis index of each 30-s step was calculated and averaged, yielding the chemotaxis index for that cell in the movie. the data shown are the average and sem of the chemotaxis indices from at least three independent experiments, with 25 cells per experiment. s1 shows cell trajectories of wild - type cells in a gradient of camp and 8cpt - camp, revealing that cells are attracted toward camp, but repelled from 8cpt - camp. s3 shows the localization of phcrac - gfp, pten - gfp, and pi3k - gfp in plc - null cells in a gradient of camp or 8cpt - camp. video 3 shows cell movement in gradients of 8cpt - camp and camp+8cpt - camp, followed by movement in only camp. video 4 shows the localization of f - actin at the leading edge and myosin in the back of cells chemotaxing toward camp. video 5 shows the localization of f - actin at the leading edge and myosin in the back of cells chemotaxing away from 8cpt - camp. video 6 shows the localization of phcracgfp (detecting pip3) at the leading edge of cells chemotaxing toward camp. video 7 shows the localization of phcracgfp (detecting pip3) at the leading edge of cells chemotaxing away from 8cpt - camp. video 8 shows chemotaxis of pi3k1/2-null cells toward camp in the presence of 8cpt - camp. video 9 shows chemotaxis of plc - null cells toward camp in the presence of 8cpt - camp.
|
during embryonic development, cell movement is orchestrated by a multitude of attractants and repellents. chemoattractants applied as a gradient, such as camp with dictyostelium discoideum or fmlp with neutrophils, induce the activation of phospholipase c (plc) and phosphoinositide 3 (pi3)-kinase at the front of the cell, leading to the localized depletion of phosphatidylinositol 4,5-bisphosphate (pi[4,5]p2) and the accumulation of phosphatidylinositol-3,4,5-trisphosphate (pi[3,4,5]p3). using d. discoideum, we show that chemorepellent camp analogues induce localized inhibition of plc, thereby reversing the polarity of pi(4,5)p2. this leads to the accumulation of pi(3,4,5)p3 at the rear of the cell, and chemotaxis occurs away from the source. we conclude that a plc polarity switch controls the response to attractants and repellents.
|
electroencephalography (eeg) can directly measure ongoing brain activity with very high temporal but low spatial resolution. in the past decades the main focus was the analysis of event related potentials, i.e., the average brain response to a given stimulus. more recently, the variability of brain activity and especially its interpretation as signatures from the brain as a dynamical network has attracted many researchers (daglish., 2005 ; womelsdorf and fries, 2006 ; buckner and vincent, 2007 ; damoiseaux and greicius, 2009 ; fries, 2009 ; miller., 2009). studying brain connectivity using noninvasive electrophysiological measurements like eeg or meg faces the challenge that the data are largely unknown mixtures of activities of brain sources. to address this issue, we suggest to construct estimates of brain connectivity from quantities that are unbiased by non - interacting sources. for zero mean data the linear statistical signal properties can be determined by the cross - spectral matrices s(f) defined as where xm(f) are the fourier transforms at frequency f in channel m for a given segment or trial and denotes the expectation value which is typically approximated by an average over the segments or trials. it is straight forward to show that noninteracting sources do not contribute systematically, i.e., apart from random fluctuations around zero to the imaginary part of the cross - spectra, (s(f)), regardless of the number of sources and details of the forward mapping (nolte., 2004). the reason is that the forward mapping is essentially instantaneous and does not induce phase delays to excellent approximation (stinstra and peters, 1998) which would be necessary to yield a nonvanishing imaginary part of s(f). from the cross - spectra s(f) one can construct coherency matrices c(f), which are a normalized version of s(f), as in contrast to the imaginary parts of the cross - spectra, (c(f)) also depends on independent sources through the denominator in eq., independent sources can only lead to a decrease of (c(f)) and hence also (c(f)) reflects true interaction even though the physiological interpretation is not trivial especially when interpreting differences of (c(f)), e.g., between different tasks. based on these observations we suggested a series of methods to identify and localize brain interactions (meinecke., 2005 ; nolte., 2006 ; stam., 2007 ; marzetti., 2008 ; additionally, we proposed a method to identify causal structures of the dynamical system under study (nolte., 2008). we here give a brief review of some of these methods (nolte., 2006 ; marzetti., 2008 ; nolte., 2008) to identify interacting brain sources and to estimate causal relationships. all the methods will be demonstrated using simulated data whose characteristics are defined in the following section. we simulated a seminal case with four dipolar sources as shown in figure 1, in which the dipoles have all a parallel orientation and are spatially well separated. the sources on the right (left) are interacting with each other but not with the sources on the left (right). for both subsystems the source in the back served as driver while the activity of the more frontal sources appeared merely identical to the ones of the drivers but the activity was delayed by 20 ms. the activity of the right driver was given as four dipolar sources overlayed on mri - slices. similarly, the activity of the driver on the left side was simulated via we defined a single time step to equal 10 ms, i.e., we considered a sampling rate of 100 hz, by which the time series u1(t) and u2(t) displayed pronounced spectral peaks at around 8 and 12 hz, respectively, and had roughly identical magnitudes. both time series also have (weak) higher harmonics at 24 and 36 hz, respectively. the frontal sources, v1(t) and v2(t) for right and left side, respectively, are merely delayed versions of the drivers : corresponding to a delay of 20 ms. in total, we modeled 200 s of eeg data. the activities of the four dipolar sources were mapped into 118 eeg channels equally distributed on the scalp. as volume conductor we assumed a three - shell realistic model calculated from the mri data containing brain, skull, and scalp with equal conductivities for brain and scalp and 50:1 conductivity ratio between scalp and skull. the maxwell equations were solved using a semianalytic expansion of the electric lead fields (nolte and dassios, 2005). an accurate forward model is important but difficult. for the sake of simplicity we here assumed that the forward model is correct, i.e., for the inverse methods we used the same forward model as for the forward simulation. to the activities of the sources of interest we superimpose spatially correlated and temporally white noise generated as the activity of a collection of dipoles placed on a 1 cm grid within the entire brain. all components of all dipoles were modeled as iid gaussian noise leading to highly correlated noise in the eeg electrodes. the noise level was chosen such that the average of power over all channels and frequencies was 20 times higher than the respective average of the signal of interest. in good channels and at peak frequencies the power of the signal of interest was still around 10 times higher than the noise. power (imaginary part of coherency) over all channels (pairs of channels) are shown as function of frequency in figure 2. the spatial distribution of the imaginary part of coherency at 10 hz, i.e., between the peaks and with contributions from both interacting subsystems, is shown in figure 3. in general, eeg data are a superposition of many subsystems including (effectively) independent sources but also interacting rhythmic sources of various physiological content. to separate these systems we assumed that (a) all interactions are pairwise and that (b) there are not more interacting sources than channels. these two assumptions are a clear simplification of the true brain dynamics, but they yield a unique decomposition of the data and may capture the most relevant aspects of the interaction observed in eeg data, at least when focussing on the current discussion. these assumptions can be expressed for an even number of n channels as a model for the imaginary part of the cross - spectra : for each k the set of topographies (ak and bk) and the interaction spectrum we note that this model is only unique up to linear mixing of the two topographies for each k. in other words, the model only identifies the 2d - subspace spanned by the two topographies and not the individual components. 2004) of (s(f)) in the complex domain : we find a demixing matrix w such that w(s(f))w is diagonal. it can be shown that real and imaginary parts of the columns of the mixing matrix a = w span the same subspaces as the pairs of topographies ak and bk. for technical details we refer to nolte. results of the pisa decomposition for the simulated data set are shown in figure 4, where we show the largest three components. only the first and the second component revealed a significant interaction spectrum corresponding to the two interacting subsystems in the left and right hemisphere, respectively. panels in the right column show the interaction as a function of frequency. in order to uniquely decompose the 2d - subspaces found by the pisa method into contributions from individual sources to this end we apply a linear inverse operator, e.g., a minimum norm solver g onto the topographies denoted here for any fixed k as x1 = ak and x2 = bk, such that the topographies are mapped into distributions si of the source field where si = si(m, k) is a three dimensional vector field calculated in brain voxels m = 1,..,m and in directions k = 1,..,3. the distributions do not represent the sources of the brain, denoted as qi, but are, within the accuracy of the inverse method, a yet unknown superposition of them : for i = 1,2. the 2 2 mixing matrix h can be calculated uniquely under the following constraints the sources are orthonormal : (9)m, kqi(m, k)qj(m, k)=ij the sources have minimum overlap : (10)l(q1,q2)m(kq1(m, k)q2(m, k))2=min this cost function first squares the scalar product of two dipole moments at each voxel and then sums these squares over all voxels. it vanishes if the two dipole distributions have disjoint support (i.e., disjoint regions of non - vanishing activity), thus measuring overlap. it also vanishes if the orientations at each voxel are orthogonal and therefore corresponds to a weaker form of overlap allowing in principle also activities at the same location as long as the orientations are sufficiently different. if the concept is generalized to more than two topographies the minimization requires a numerical approach, which, however, is surprisingly fast and robust (nolte., 2009). we note that the spatial constraints (eqs 9 and 10) and the methods to solve the minimization are similar to those used in ica in the context of fmri data analysis (mckeown and sejnowski, 1998 ; matsuda and yamaguchi, 2004) with the major difference that we here decompose vector fields rather than scalar ones. 9 corresponds, mutatis mutandis, to sphering as is used in most ica methods also used for eeg / meg data analysis : for simplicity, the data are transformed to be exactly uncorrelated while independence in higher statistical orders is only forced to be as good as possible. for the present data set we further assumed the sources to be located on the cortex but allowed for arbitrary orientation. source estimates of the first two pisa components for the simulated data set are shown in figure 5. we observe that each of the topographies, decomposed from the pisa results using moca, corresponds to one of the simulated dipoles. left and middle panels : estimated sources of the pisa components. positive results indicate that the sources shown in the left panels drive those shown in the middle panels. since the combination of pisa and moca resulted in a complete basis of topographies we can find the source activities by applying the inverse of the respective matrix onto the data. (2008) where cij(f) is the complex coherency between sources i and j, as given in eq. 2, and f is the frequency resolution of the coherency. usually, f contains all frequencies, but it can also be restricted to a specified band for rhythmic activities. to see that the definition of ij corresponds to a meaningful estimate of the average slope it is convenient to rewrite it as with cij(f) = ij(f)exp(i(f)) and ij(f) = |cij(f)| being frequency dependent weights. for smooth phase spectra, sin((f + f) (f)) (f + f) (f) and hence corresponds to a weighted average of the slope. we list the most important qualitative properties of : for an infinite amount of data and for arbitrary instantaneous mixtures of an arbitrary number of independent sources, is exactly zero, because mixtures of independent sources do not induce an imaginary part of coherencies (nolte., 2004) which in turn is necessary to generate a non - vanishing. for finite data, will then fluctuate in this case around zero within error bounds. a special case of this are phase jumps from 0 to which can arise also for mixtures of independent sources. the standard deviation of a coherency is approximately constant and only depends on the number of averages which is equal for all frequencies. thus, large but meaningless phase fluctuations in frequency bands containing essentially independent signals are largely suppressed. if the phase (f) is linear in f and provided that the frequency resolution is sufficient (i.e., f is sufficiently small), the argument in the sum has the same sign across all frequencies and then will have the same sign as the slope of (f). it is convenient to normalize by an estimate of its standard deviation with std() being estimated by the jackknife method, which we validated in own simulations. in the examples below we consider absolute values of each larger than 2 as significant. it is important to point out that the phase of coherency itself is not interpreted in terms of causality. for example, a phase of /2 switches to /2 if the sign of one of the signals is reversed, but the psi measure is invariant with respect to the sign of the signals. rather than on phase, psi is based on the slope of the phase as a function of frequency. note, that a sign change adds a constant to the phase and has no effect on the slope. the method assumes that the studied frequency range properly covers the dynamical range. for purely periodic signals results for the causal structure of the sources estimated from the simulated data are shown in the right panels of figure 5. to calculate psi we chose segments of length 2 s corresponding to a frequency resolution of f = 0.5 hz. we observe that in both cases the source in the back is estimated as the driver. in general, eeg data are a superposition of many subsystems including (effectively) independent sources but also interacting rhythmic sources of various physiological content. to separate these systems we assumed that (a) all interactions are pairwise and that (b) there are not more interacting sources than channels. these two assumptions are a clear simplification of the true brain dynamics, but they yield a unique decomposition of the data and may capture the most relevant aspects of the interaction observed in eeg data, at least when focussing on the current discussion. these assumptions can be expressed for an even number of n channels as a model for the imaginary part of the cross - spectra : for each k the set of topographies (ak and bk) and the interaction spectrum we note that this model is only unique up to linear mixing of the two topographies for each k. in other words, the model only identifies the 2d - subspace spanned by the two topographies and not the individual components. 2004) of (s(f)) in the complex domain : we find a demixing matrix w such that w(s(f))w is diagonal. it can be shown that real and imaginary parts of the columns of the mixing matrix a = w span the same subspaces as the pairs of topographies ak and bk. for technical details we refer to nolte. results of the pisa decomposition for the simulated data set are shown in figure 4, where we show the largest three components. only the first and the second component revealed a significant interaction spectrum corresponding to the two interacting subsystems in the left and right hemisphere, respectively. in order to uniquely decompose the 2d - subspaces found by the pisa method into contributions from individual sources we must introduce further spatial constraints on the nature of the sources. to this end we apply a linear inverse operator, e.g., a minimum norm solver g onto the topographies denoted here for any fixed k as x1 = ak and x2 = bk, such that the topographies are mapped into distributions si of the source field where si = si(m, k) is a three dimensional vector field calculated in brain voxels m = 1,..,m and in directions k = 1,..,3. the distributions do not represent the sources of the brain, denoted as qi, but are, within the accuracy of the inverse method, a yet unknown superposition of them : for i = 1,2. the 2 2 mixing matrix h can be calculated uniquely under the following constraints the sources are orthonormal : (9)m, kqi(m, k)qj(m, k)=ij the sources have minimum overlap : (10)l(q1,q2)m(kq1(m, k)q2(m, k))2=min this cost function first squares the scalar product of two dipole moments at each voxel and then sums these squares over all voxels. it vanishes if the two dipole distributions have disjoint support (i.e., disjoint regions of non - vanishing activity), thus measuring overlap. it also vanishes if the orientations at each voxel are orthogonal and therefore corresponds to a weaker form of overlap allowing in principle also activities at the same location as long as the orientations are sufficiently different. if the concept is generalized to more than two topographies the minimization requires a numerical approach, which, however, is surprisingly fast and robust (nolte., 2009). we note that the spatial constraints (eqs 9 and 10) and the methods to solve the minimization are similar to those used in ica in the context of fmri data analysis (mckeown and sejnowski, 1998 ; matsuda and yamaguchi, 2004) with the major difference that we here decompose vector fields rather than scalar ones. 9 corresponds, mutatis mutandis, to sphering as is used in most ica methods also used for eeg / meg data analysis : for simplicity, the data are transformed to be exactly uncorrelated while independence in higher statistical orders is only forced to be as good as possible. for the present data set we further assumed the sources to be located on the cortex but allowed for arbitrary orientation. source estimates of the first two pisa components for the simulated data set are shown in figure 5. we observe that each of the topographies, decomposed from the pisa results using moca, corresponds to one of the simulated dipoles. left and middle panels : estimated sources of the pisa components. positive results indicate that the sources shown in the left panels drive those shown in the middle panels. since the combination of pisa and moca resulted in a complete basis of topographies we can find the source activities by applying the inverse of the respective matrix onto the data. (2008) where cij(f) is the complex coherency between sources i and j, as given in eq. 2, and f is the frequency resolution of the coherency. usually, f contains all frequencies, but it can also be restricted to a specified band for rhythmic activities. to see that the definition of ij corresponds to a meaningful estimate of the average slope it is convenient to rewrite it as with cij(f) = ij(f)exp(i(f)) and ij(f) = |cij(f)| being frequency dependent weights. for smooth phase spectra, sin((f + f) (f)) (f + f) (f) and hence corresponds to a weighted average of the slope. we list the most important qualitative properties of : for an infinite amount of data and for arbitrary instantaneous mixtures of an arbitrary number of independent sources, is exactly zero, because mixtures of independent sources do not induce an imaginary part of coherencies (nolte., 2004) which in turn is necessary to generate a non - vanishing. for finite data, will then fluctuate in this case around zero within error bounds. a special case of this are phase jumps from 0 to which can arise also for mixtures of independent sources. the standard deviation of a coherency is approximately constant and only depends on the number of averages which is equal for all frequencies. thus, large but meaningless phase fluctuations in frequency bands containing essentially independent signals are largely suppressed. if the phase (f) is linear in f and provided that the frequency resolution is sufficient (i.e., f is sufficiently small), the argument in the sum has the same sign across all frequencies and then will have the same sign as the slope of (f). it is convenient to normalize by an estimate of its standard deviation with std() being estimated by the jackknife method, which we validated in own simulations. in the examples below we consider absolute values of each larger than 2 as significant. it is important to point out that the phase of coherency itself is not interpreted in terms of causality. for example, a phase of /2 switches to /2 if the sign of one of the signals is reversed, but the psi measure is invariant with respect to the sign of the signals. rather than on phase, psi is based on the slope of the phase as a function of frequency. note, that a sign change adds a constant to the phase and has no effect on the slope. the method assumes that the studied frequency range properly covers the dynamical range. for purely periodic signals results for the causal structure of the sources estimated from the simulated data are shown in the right panels of figure 5. to calculate psi we chose segments of length 2 s corresponding to a frequency resolution of f = 0.5 hz. we observe that in both cases the source in the back is estimated as the driver. accurately measuring the interaction of oscillatory brain sources from eeg / meg is a challenge. due to the well - known effects of volume conduction, it is easy and not uncommon to detect spurious interaction and thus reach spurious neuroscientific insight. the present review has assembled three data analytical techniques that avoid such erroneous conclusions as they are based on the imaginary parts of the cross - spectra s(f) that as outlined above to clarify this basic message we have used simulated eeg data from interacting neural systems and took the reader through three essential analysis steps (a) discovering interacting sources by pisa, (b) localizing them under constraints by moca and (c) estimating their causal relationship by psi. future research will extend the studies on causal relations of interacting sources also for high noise situations (cf. von bnau., 2009) and the broad application of the presented computational methods in the neurosciences. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
|
estimating brain connectivity and especially causality between different brain regions from eeg or meg is limited by the fact that the data are a largely unknown superposition of the actual brain activities. any method, which is not robust to mixing artifacts, is prone to yield false positive results. we here review a number of methods that allow for addressing this problem. they are all based on the insight that the imaginary part of the cross - spectra can not be explained as a mixing artifact. first, a joined decomposition of these imaginary parts into pairwise activities separates subsystems containing different rhythmic activities. second, assuming that the respective source estimates are least overlapping, yields a separation of the rhythmic interacting subsystem into the source topographies themselves. finally, a causal relation between these sources can be estimated using the newly proposed measure phase slope index (psi). this work, for the first time, presents the above methods in combination ; all illustrated using a single, simulated data set.
|
approximately 50% of men diagnosed with prostate cancer will be exposed to androgen deprivation therapy (adt) at some stage. adt has a clear role in the management of metastatic prostate cancer, for which there is good evidence for reduction in complications and variable evidence for improved survival. in such a setting, adt reduces the burden of metastatic disease and improves patient quality of life. adt is most commonly administered in the form of gonadotrophin - releasing hormone (gnrh) agonists. the gnrh antagonist, degarelix, is less widely used but avoids the testosterone surge associated with gnrh agonists and has a more rapid onset of action. medical castration is regarded as more acceptable than traditional orchidectomy by patients and clinicians alike, and is much more commonly used. for most of the last 30 years, all forms of adt were assumed to be equivalent in effect and adverse effects ; but more recently, doubt has been cast over this assumption. the role (or indeed lack of it) of adt in the earlier stages of prostate cancer has become clearer in the past decade, particularly for locally advanced and localised prostate cancer. the purpose of the current article is to review the role of adt as part of a strategy of treatment with curative intent, concentrating particularly on key recent developments in the area. there is strong evidence to support the use of adt in combination with radiotherapy (rt) for men with locally advanced prostate cancer (t3/4 n+/- m0). the radiosensitising effect of adt is the generally accepted mechanism for improved outcomes with combination therapy. most of these studies excluded patients with multiple co - morbidities, a poor performance status (> 2) or older age. this leaves a question over whether the results that apply to fitter, younger patients can be extrapolated to the old and infirm, particularly with respect to overall survival. adt : androgen deprivation therapy ; ecog : eastern cooperative oncology group ; gy : gray ; lhrh : luteinizing hormone - releasing hormone ; ncic gtc : national cancer institute of canada clinical trials group ; rt : radiation therapy ; sfuo : scandinavian prostate cancer group ; spcg : scandinavian prostate cancer group ; trog : trans tasman radiation oncology group ; yrs : years. in a 2015 publication, mason. randomised 1205 patients to lifelong adt alone versus rt and lifelong adt. at a median follow - up of 8 years, their overall survival was greater by 6% in the combination group, with deaths from prostate cancer reduced from 52% to 32% with the addition of rt to adt. while the evidence is conclusive as to the benefits of combining rt with adt for locally advanced (t3/4) prostate cancer, the benefit to men with node positive disease is uncertain. most of the studies above (three of four) either specifically excluded men with node positive disease or did not document their nodal status at initiation (pro7), raising the question whether men with nodal involvement stand to benefit from adt. the 2009 study by bolla. which did include patients with node positive disease, did not specifically analyse for benefit in node positive patients ; and although the distribution of these patients between trial arms was equal, their numbers were relatively small. most trials report a combination of a luteinizing hormone - releasing hormone (lhrh) agonist and an antiandrogen, although doses and regimes vary. the early prostate cancer (epc) trial shows improved progression - free survival in men with locally advanced disease when bicalutamide monotherapy was added to the standard care ; however, as a monotherapy, lhrh agonists were shown to be oncologically superior to antiandrogens, although the side effects are notably worse. given the recognised adverse events of adt, particularly on sexual function, a reduction in the duration might improve quality of life. this benefit must be balanced against the known improvement in mortality with a longer course of adt. the dose of rt varied between studies, but was usually in the range of 6070 gy. dose escalation studies suggest that rt doses in excess of 70 gy might improve outcomes. one study shows that patients with high - risk locally advanced prostate cancer (t3/4 and/or gleason 8 and/or psa 20 g / l) treated with 80 gy rt had a biochemical progression free rate of 79% at 5 years. there is no evidence that adjuvant adt with radical prostatectomy for locally advanced prostate cancer improves survival, even in patients with margin - positive disease. indeed the optimal treatment for locally advanced disease is not certain, although multimodality therapy is generally required. whether the best strategy is radical prostatectomy and extended lymphadenectomy, followed by adjuvant rt in those who require it, or adt with rt in all, has yet to be determined localised prostate cancer can be classified according to risk at the time of diagnosis using the damico risk stratification tool, as shown in table 2. high - risk prostate cancer is also included in the definition of locally advanced prostate cancer. there is little evidence to support the use of adt alone in localised prostate cancer. in 2014, lu - yao. looked at 66,717 patients diagnosed with localised prostate cancer in whom no definitive local therapy was commenced within 180 days of diagnosis and who had received varying amounts of adt. the data strongly confirmed that the use of primary adt in localised prostate cancer does not improve long - term overall or disease - specific survival. high - risk localised prostate cancer is most commonly combined with locally advanced prostate cancer in clinical trials ; thus, in interpreting the results of most studies, it is difficult to draw a distinction between high - risk localised disease and early locally advanced disease. with this in mind, it still remains evident that the use of adt is of benefit in the treatment of high - risk localised prostate cancer only when combined with radiotherapy, with demonstrable improved survival when compared with adt alone. in a study published in 2011, jones. treated men with localised prostate cancer with a combination of rt and 4 months of maximal androgen blockade in the form of flutamide and a lhrh agonist. rt consisted of 46.8 gy delivered to the pelvis (prostate and regional lymph nodes) in daily 1.8 gy fractions, followed by 19.8 gy to the prostate, for a total dose of 66.6 gy. treatment of the regional lymph nodes was omitted in patients with negative lymph - node dissections or with a psa level of 50% reduction in the risk of cv events among men with pre - existing cv disease, when treated with a gnrh antagonist, as compared with a gnrh agonist ; however, cv risk was not increased in men without pre - existing cv disease. to date, despite the large body of epidemiological and retrospective data supporting that there is an increased risk of cv events in some men, there is little understanding of which men might be at an increased risk, how these men could be identified and what should be done about attempting to reduce this risk. in 2004, damico. published early results of their trial comparing rt alone with rt and adt in combination for the treatment of localised prostate cancer (table 3). initial results at a median follow - up of 4.5 years suggested higher survival rates in the combination group ; however, the updated results of the same trial published in 2015 show that the initial perceived benefit of combination therapy was not sustained. most interestingly, when the survival data were examined by sub - group, separating men according to their co - morbidity status pre - treatment, there was a suggestion that men with moderate or severe co - morbidity might actually fare worse with combination therapy than with rt alone (94% mortality at median 16.62 years versus 70%). moreover, analysis of the cause of death showed a significant increase in cv mortality, as defined by lethal myocardial infarction, in the same comorbid subgroup. adt : androgen deprivation therapy ; lhrh : luteinizing hormone - releasing hormone ; rt : radiation therapy ; yrs : years. if indeed, the treatment directed towards reducing cancer mortality actually had the effect of increasing cv risk, it remains a plausible hypothesis that there exists a significant sub - group of men at risk of a subsequent cardiac event, for whom adt in combination will reduce overall survival, particularly if their a priori risk of dying of prostate cancer (e.g. low - risk prostate cancer) was not particularly high. most prospective trials comparing rt with and without adt have excluded patients with significant comorbidity or advanced age ; and in any case, have not been designed to show a difference in significant adverse events. clearly, there is a need for subsequent randomised trials examining adt to stratify patients according to cv risk, to prospectively look for an association. if certain men are more vulnerable, and this appears to be the case, then the ability to identify and stratify them at the time of treatment planning is key to minimising their risk. given the potential negative effects of adt, there remains a question as to the role of surgery in the management of these men, particularly in those with pre - existing comorbidity. an observational study of 34,515 men with locally advanced / localised prostate cancer over a 15-year period reported a cancer - specific survival benefit of surgery, when compared with rt (with or without adt) ; however, the greatest benefit was seen in younger men with fewer comorbidities and a higher - risk disease. as an observational study, care should be taken when drawing conclusions ; however, there appears to be sufficient evidence to warrant a direct comparison between rt (+ / adt) and surgery in a future randomised trial. in localised and locally advanced prostate cancer, adt alone confers no survival benefit and in some cases might be detrimental. adt in combination with rt improves overall and cancer - specific survival in locally advanced and high - risk localised prostate cancer. further research is required to clarify which patients are at greatest risk of cv mortality associated with adt. the optimisation of medical therapy, including lifestyle factors, to reduce the cv risk is likely to play a significant role in the future. further research is also required to identify the true role of surgery in the management of prostate cancer, particularly in men with co - morbidities.
|
introduction : approximately 50% of men diagnosed with prostate cancer will be exposed to androgen deprivation therapy (adt) at some stage. the role of adt in the management of metastatic disease has long been recognised, and its place in the management of localised and locally advanced disease has become clearer in the past few years. nevertheless, concerns remain that some men might not benefit from adt in earlier - stage disease. the purpose of the current article is to provide a brief narrative review of the role of adt as part of a strategy of treatment with curative intent, concentrating mainly on key recent developments in the area.methods:narrative literature review of key publications in the english language relating to adt in the management of localised and locally advanced prostate cancer.results:in locally advanced and high - risk localised prostate cancer, the use of adt in combination with radiotherapy improves disease - specific and overall survival. there is no evidence to support the use of adt in the treatment of low - risk localised prostate cancer. there appears to be an increased risk of cardiovascular morbidity and mortality associated with luteinizing hormone - releasing hormone agonists, particularly in men with pre - existing cardiovascular disease, but the relevance of this in the adjuvant / neoadjuvant setting is currently unclear.conclusions:future studies should focus on identification of men who are at risk from cardiovascular complications associated with adt and on the comparison of radiotherapy with adt versus surgery in the management of localised and locally advanced prostate cancer, particularly with regards to men with pre - existing comorbidities.
|
human papillomavirus (hpv) has been recognized as a cause of a subset of head and neck squamous cell carcinomas (hnscc). hpv - associated hnscc (hpv - hnscc) arises most commonly in the oropharynx and the incidence of hpv - related oropharyngeal squamous cell carcinoma (oscc) (hpv - oscc) has been increasing despite a decline in tobacco consumption and contrary to a diminishing incidence of cancers at other head and neck sites. in the united states, approximately 40%-80% of osccs are caused by hpv and the underlying mechanism is believed to be chronic persistent infection leading to carcinogenesis. compared with hnscc associated with smoking and/or alcohol, patients with hpv - oscc tend to be younger, of a higher socioeconomic status, have a favorable natural history, and respond better to treatment. although at least 15 types of hpv are thought to have oncogenic potential, the vast majority of hpv - osccs are associated with hpv type 16, the same type that leads to hpv - associated anogenital cancers. hpv preferentially targets the highly specialized reticulated epithelium in the lymphoid tissue of the tonsils and the tongue base. hpv integrates its dna genome into the host cell nucleus, leading to expression of the oncoproteins e6 and e7. the e6 protein induces substantial loss of p53 activity, whereas e7 binds and inactivates the retinoblastoma proteins, which are highly immunogenic and would be expected to induce an antitumor immune response. in hnscc, various mechanisms have been proposed for immune escape including down regulation of tumor antigen presentation, aberrant regulation of the signal transducer and activator of transcription family, release of immunosuppressive cytokines, and dysregulation of immune checkpoint receptors. tumor infiltrating lymphocytes (tils) show high expression of co - inhibitory receptors such as cytotoxic t lymphocyte associated antigen 4 and programmed cell death 1 (pd-1), so - called immune checkpoints. a persistent high level of pd-1 expression on antigen - presented cd8(+) cytotoxic t lymphocytes leads to t cell exhaustion, characterized by impaired effector function and persistent expression of inhibitory receptors. programmed cell death - ligand 1 (pd - l1), also known as b7-h1, is a surface glycoprotein that induces t - cell anergy or apoptosis by binding to pd-1 on t lymphocytes. clinical trials have reported that inhibition of the pd-1:pd - l1 interaction with antibodies specific for pd-1 or pd - l1 has promising antitumor efficacy in patients with various malignancies including melanoma, non - small cell lung cancer (nsclc), and hnscc [8 - 10 ]. recent studies reported that the pd-1:pd - l1 axis is highly related to hpv - positive rather than hpv - negative hnscc. pd-1 is expressed on effector t cells in both hpv - positive and -negative tumors, however the level of expression appears to be increased in hpv - positive hnscc, suggesting that pd-1 expression on cytotoxic t cells is relevant and may play an important role, particularly in hpv - oscc. we therefore examined pd - l1 expression on tumor cells in hpv - positive and -negative oropharyngeal cancer and analyzed its association with clinicopathologic characteristics and its prognostic relevance. patients who met the following criteria were recruited : oropharyngeal cancer arising from tonsil, soft palate, posterior wall of oropharynx, and base of tongue ; squamous cell carcinoma ; curative intent radiation therapy, concurrent chemoradiation therapy (ccrt), or surgery ; no evidence of distant metastasis ; available medical records and sufficient tumor tissue for immunohistochemical (ihc) staining of pd - l1 and p16. formalin - fixed paraffin - embedded (ffpe) tissues from a diagnostic biopsy or surgical specimen were retrieved from the department of pathology. baseline clinicopathologic characteristics including age, sex, smoking history, tnm stage at diagnosis, curative modality, and clinical follow - up data were collected retrospectively from the database at samsung medical center. the study protocol and all related materials were approved by the institutional review board of the institution. an hpv - positive tumor was defined by specific staining of tumor cells for p16 expression. strong correlation between overexpression of p16 and hpv expression has been reported in several studies. tumor p16 expression was evaluated by ihc analysis using a mouse monoclonal antibody (cintec) and visualized using an immunostainer (ventana xt, ventana, tucson, az) and ultraview universal dab detection kit (ventana). positive p16 expression was defined as diffuse nuclear and cytoplasmic staining in 70% or more of the tumor cells as determined by a pathologist (y.h.k.). pd - l1 expression was evaluated by ihc using the monoclonal anti - human b7-h1 antibody (clone 5h1, a non - commercial mab kindly provided by dr. lieping chen s laboratory) as previously described. briefly, ffpe tumor sections were cut at 4 m and then routinely deparaffinized and rehydrated in xylene and graded ethanol solutions. sections were washed and incubated for 5 minutes in wash buffer (dako # s3006, dako, glostrup, denmark), and then placed on the autostainer plus (dako) and subjected to the following protocol using a csa ii kit (dako # k1497). first, the activity of endogenous peroxidase was blocked with endogenous blocking solution, and then the section was washed with wash buffer and incubated for 60 minutes with monoclonal antihuman b7-h1 (clone 5h1) diluted 1:1,000 with antibody diluent containing background reducing components. after washing, the sections were incubated with biotin - conjugated rat anti - mouse igg1 secondary antibody at a 1:500 dilution. reaction products were visualized by incubation in 3, 3'-diaminobenzidine for 2 minutes and the slides were counterstained with hematoxylin. a pathologist (m.h.) who was blinded to the patients clinicopathologic information assessed the expression of pd - l1. pd - l1 positivity was defined as membrane staining in 20% of tumor cells. pd - l1 expression on tumor cells was evaluated using the intensity score and proportion score. the intensity of staining was evaluated according to the following scale : 0, no staining ; 1, weak staining ; 2, moderate staining ; and 3, strong staining. because most prognostic factors are considered as dichotomized and discontinuous variables, a cutoff point was selected to give the optimal separation between low risk and high risk for overall survival (os). we initially set several cutoff points for selection of the best value, and then selected 20% staining as the appropriate cutoff value regardless of intensity score. the relationship between pd - l1 expression and other patient characteristics, including p16 expression, was evaluated using analysis of variance tests for continuous variables and pearson s chi - square tests for discrete variables. association of pd - l1 expression with survival of patients with oscc was also evaluated. os was defined as the time from the date of diagnosis to death as a result of any cause or the last follow - up if the patient was alive. progression - free survival (pfs) was defined as the time from the initial date of treatment to disease progression or the last follow - up if the patient had not progressed. survival curves were generated using the kaplan - meier method, and the difference between the curves according to pd - l1 status was evaluated using the log - rank test. the cox proportional hazard model was used to assess hazard ratios (hrs) of prognostic factors for os. all factors showing statistical significance in univariate analyses or clinical significance were included in the multivariate analysis. all p - values are two sided, and a level of 5% was considered statistically significant. patients who met the following criteria were recruited : oropharyngeal cancer arising from tonsil, soft palate, posterior wall of oropharynx, and base of tongue ; squamous cell carcinoma ; curative intent radiation therapy, concurrent chemoradiation therapy (ccrt), or surgery ; no evidence of distant metastasis ; available medical records and sufficient tumor tissue for immunohistochemical (ihc) staining of pd - l1 and p16. formalin - fixed paraffin - embedded (ffpe) tissues from a diagnostic biopsy or surgical specimen were retrieved from the department of pathology. baseline clinicopathologic characteristics including age, sex, smoking history, tnm stage at diagnosis, curative modality, and clinical follow - up data were collected retrospectively from the database at samsung medical center. the study protocol and all related materials were approved by the institutional review board of the institution. an hpv - positive tumor was defined by specific staining of tumor cells for p16 expression. strong correlation between overexpression of p16 and hpv expression has been reported in several studies. tumor p16 expression was evaluated by ihc analysis using a mouse monoclonal antibody (cintec) and visualized using an immunostainer (ventana xt, ventana, tucson, az) and ultraview universal dab detection kit (ventana). positive p16 expression was defined as diffuse nuclear and cytoplasmic staining in 70% or more of the tumor cells as determined by a pathologist (y.h.k.). pd - l1 expression was evaluated by ihc using the monoclonal anti - human b7-h1 antibody (clone 5h1, a non - commercial mab kindly provided by dr., ffpe tumor sections were cut at 4 m and then routinely deparaffinized and rehydrated in xylene and graded ethanol solutions. sections were washed and incubated for 5 minutes in wash buffer (dako # s3006, dako, glostrup, denmark), and then placed on the autostainer plus (dako) and subjected to the following protocol using a csa ii kit (dako # k1497). first, the activity of endogenous peroxidase was blocked with endogenous blocking solution, and then the section was washed with wash buffer and incubated for 60 minutes with monoclonal antihuman b7-h1 (clone 5h1) diluted 1:1,000 with antibody diluent containing background reducing components. after washing, the sections were incubated with biotin - conjugated rat anti - mouse igg1 secondary antibody at a 1:500 dilution. reaction products were visualized by incubation in 3, 3'-diaminobenzidine for 2 minutes and the slides were counterstained with hematoxylin. a pathologist (m.h.) who was blinded to the patients clinicopathologic information assessed the expression of pd - l1. pd - l1 positivity was defined as membrane staining in 20% of tumor cells. pd - l1 expression on tumor cells was evaluated using the intensity score and proportion score. the intensity of staining was evaluated according to the following scale : 0, no staining ; 1, weak staining ; 2, moderate staining ; and 3, strong staining. because most prognostic factors are considered as dichotomized and discontinuous variables, a cutoff point was selected to give the optimal separation between low risk and high risk for overall survival (os). we initially set several cutoff points for selection of the best value, and then selected 20% staining as the appropriate cutoff value regardless of intensity score. the relationship between pd - l1 expression and other patient characteristics, including p16 expression, was evaluated using analysis of variance tests for continuous variables and pearson s chi - square tests for discrete variables. association of pd - l1 expression with survival of patients with oscc was also evaluated. os was defined as the time from the date of diagnosis to death as a result of any cause or the last follow - up if the patient was alive. progression - free survival (pfs) was defined as the time from the initial date of treatment to disease progression or the last follow - up if the patient had not progressed. survival curves were generated using the kaplan - meier method, and the difference between the curves according to pd - l1 status was evaluated using the log - rank test. the cox proportional hazard model was used to assess hazard ratios (hrs) of prognostic factors for os. all factors showing statistical significance in univariate analyses or clinical significance were included in the multivariate analysis. all p - values are two sided, and a level of 5% was considered statistically significant. from october 2002 to september 2013, of a total of 198 patients with oscc who underwent screening, 133 patients (67%) were eligible for the current study. the median age of patients was 57.5 years (range, 35 to 80 years), 120 patients (90%) were male, and 51 (38%) were never smokers. seventy - nine patients (59%) had stage iv disease at diagnosis, and the most common site of tumor origin was tonsil (78%), followed by soft palate (7%) and base of tongue (3%). ninety - two patients (69%) underwent curative intent surgery, and 35 (26%) underwent ccrt. overall, pd - l1 expression was positive in 90 patients (68%) and negative in 43 (32%). pd - l1 expression according to proportion was scored using various cutoff values as absent (no staining) in 15 patients (11%), 10% in 116 (87%), 20% in 90 (68%), 50% in 51 (38%), and 80% in 23 (17%). pd - l1 expression according to intensity was scored as absent in 15 patients (11%), weak in 55 (41%), moderate in 43 (32%), and strong in 20 (15%). the proportion score of pd - l1 expression showed correlation with the intensity score (pearson coefficiency r=0.451, p=0.01). no statistically significant association was observed between pd - l1 expression and age, sex, location of tumor origin, or stage (table 1). in addition, smoking history was not associated with pd - l1 expression in the tumor cell membrane (p=0.343). patients with p16 positivity had more advanced nodal (n2 - 3 ; 62% vs. 48%, p=0.002) and tumor stage (iii - iv ; 94% vs. 73%, p=0.001),and were more likely to have tonsillar cancer (89% vs. 57%, p < 0.001) than those negative for p16 (table 2). p16 expression was more frequently observed in tonsillar cancer compared with other oropharyngeal cancers (79/104 [76% ] vs. 10/29 [34% ], p < 0.001). no significant correlation was observed between pd - l1 and p16 expression (63/89 [71% ] for p16-positive and 27/44 [61% ] for p16-negative tumors, respectively, p=0.274). in analysis with several cutoff values of pd - l1 expression including proportion score and intensity score, no correlation was observed between pd - l1 and p16 expression. when the analysis was restricted to patients with tonsillar cancer, no association was found between pd - l1 expression and p16 expression (57/79 [72% ] for p16 positive vs. 18/25 [72% ] for p16 negative, p=0.988). over a median follow - up period of 44 months (range, 2.8 to 119.3 months), 15 pd - l1positive patients (17%) and nine pd - l1negative patients (21%) died. the 3-year os was 85% for pd - l1positive and 87% for pd - l1negative disease. results of kaplan - meier analysis showed no significant difference in pfs and os between pd - l1positive and pd - l1negative patients (p=0.519 and p=0.625, respectively) (fig. 1a and b). in analysis with several cutoff values of pd - l1 expression including proportion score and intensity score, we found no significant difference in pfs and os. the patients were further divided into p16-positive and p16-negative groups. even though p16-positive patients had more advanced stage, they tended to show a more favorable pfs, but without statistical significance (p=0.091) (fig. 2a and b). in the p16-positive subgroup, patients with pd - l1 expression had longer pfs than pd - l1negative patients (p=0.049), but no significant difference in os was observed (p=0.165) (fig. pd - l1 expression was not associated with os or pfs (p=0.356 and p=0.206, respectively) (fig. 1e and f). to determine the prognostic value of pd - l1 expression for os, univariate and multivariate analyses old age (hr, 2.834 ; 95% confidence interval [ci ], 1.206 to 6.660 ; p=0.017) and advanced t stage (t1 - 2 vs. t3 - 4 ; hr, 5.806 ; 95% ci, 2.430 to 13.868 ; p < 0.001) remained independent factors for poor prognosis, but pd - l1 expression did not affect os regardless of hpv status. from october 2002 to september 2013, of a total of 198 patients with oscc who underwent screening, 133 patients (67%) were eligible for the current study. the median age of patients was 57.5 years (range, 35 to 80 years), 120 patients (90%) were male, and 51 (38%) were never smokers. seventy - nine patients (59%) had stage iv disease at diagnosis, and the most common site of tumor origin was tonsil (78%), followed by soft palate (7%) and base of tongue (3%). ninety - two patients (69%) underwent curative intent surgery, and 35 (26%) underwent ccrt. overall, pd - l1 expression was positive in 90 patients (68%) and negative in 43 (32%). pd - l1 expression according to proportion was scored using various cutoff values as absent (no staining) in 15 patients (11%), 10% in 116 (87%), 20% in 90 (68%), 50% in 51 (38%), and 80% in 23 (17%). pd - l1 expression according to intensity was scored as absent in 15 patients (11%), weak in 55 (41%), moderate in 43 (32%), and strong in 20 (15%). the proportion score of pd - l1 expression showed correlation with the intensity score (pearson coefficiency r=0.451, p=0.01). no statistically significant association was observed between pd - l1 expression and age, sex, location of tumor origin, or stage (table 1). in addition, smoking history was not associated with pd - l1 expression in the tumor cell membrane (p=0.343). patients with p16 positivity had more advanced nodal (n2 - 3 ; 62% vs. 48%, p=0.002) and tumor stage (iii - iv ; 94% vs. 73%, p=0.001),and were more likely to have tonsillar cancer (89% vs. 57%, p < 0.001) than those negative for p16 (table 2). p16 expression was more frequently observed in tonsillar cancer compared with other oropharyngeal cancers (79/104 [76% ] vs. 10/29 [34% ], p < 0.001). no significant correlation was observed between pd - l1 and p16 expression (63/89 [71% ] for p16-positive and 27/44 [61% ] for p16-negative tumors, respectively, p=0.274). in analysis with several cutoff values of pd - l1 expression including proportion score and intensity score, no correlation was observed between pd - l1 and p16 expression. when the analysis was restricted to patients with tonsillar cancer, no association was found between pd - l1 expression and p16 expression (57/79 [72% ] for p16 positive vs. 18/25 [72% ] for p16 negative, p=0.988). over a median follow - up period of 44 months (range, 2.8 to 119.3 months), 15 pd - l1positive patients (17%) and nine pd - l1negative patients (21%) died. the 3-year os was 85% for pd - l1positive and 87% for pd - l1negative disease. results of kaplan - meier analysis showed no significant difference in pfs and os between pd - l1positive and pd - l1negative patients (p=0.519 and p=0.625, respectively) (fig. 1a and b). in analysis with several cutoff values of pd - l1 expression including proportion score and intensity score, we found no significant difference in pfs and os. the patients were further divided into p16-positive and p16-negative groups. even though p16-positive patients had more advanced stage, they tended to show a more favorable pfs, but without statistical significance (p=0.091) (fig. patients with pd - l1 expression had longer pfs than pd - l1negative patients (p=0.049), but no significant difference in os was observed (p=0.165) (fig., pd - l1 expression was not associated with os or pfs (p=0.356 and p=0.206, respectively) (fig. 1e and f). to determine the prognostic value of pd - l1 expression for os, univariate and multivariate analyses old age (hr, 2.834 ; 95% confidence interval [ci ], 1.206 to 6.660 ; p=0.017) and advanced t stage (t1 - 2 vs. t3 - 4 ; hr, 5.806 ; 95% ci, 2.430 to 13.868 ; p < 0.001) remained independent factors for poor prognosis, but pd - l1 expression did not affect os regardless of hpv status. immunotherapy targeting the pd-1:pd - l1 axis yielded an objective response in a subset of individuals with hnscc and a recent study suggested correlation of pd - l1 expression in tumors with response to pd-1 targeted therapy. taking these findings together, pd - l1 expression in the tumor has shown correlation with both favorable and unfavorable outcomes in various malignancies. several studies have examined pd - l1 expression in hnscc ; however, the clinicopathologic characteristics associated with pd - l1 expression remain largely unknown. in the study by cho., pd - l1 expression was positive in 39 of 43 osccs (91%) and did not show correlation with clinicopathologic factors or os. reported that pd - l1 was expressed in 84 of 181 patients (46%) with oropharyngeal cancer and no association was observed between pd - l1 expression and gender, smoking history, stage, or other clinical parameters ; however, there was an association between pd - l1 expression and distant metastasis (p=0.03). in the current study, however, expression of pd - l1 in tumor cells did not show correlation with any clinicopathologic features, including pfs and os. other studies in nasopharyngeal cancer have reported conflicting results ; one study reported an association of pd - l1 expression with tnm stage, while the other showed no correlation with any of the clinicopathologic parameters examined. these conflicting results in various tumors may be attributed in part to the lack of uniformity in assays, including intra- or inter - observer variability of ihc, lack of standardized antibodies for determining pd - l1 expression, and various cutoff values for defining positive expression. another possible explanation is that pd - l1 signaling not only down regulates antitumor effector t cell immunity, but also interacts with the innate and adaptive immune response. in a recent study, tumors with pd - l1 positivity at baseline showed a significant decrease in pd - l1 expression at disease progression, whereas tumors with pd - l1 negativity at baseline showed a significant increase in pd - l1 expression at disease progression, irrespective of chemotherapeutic regimens. moreover, differences in pd - l1 expression between tumor cells and tumor infiltrating inflammatory cells may be a possible cause of conflicting results. bhandari and siva reported that higher pd - l1 expression in tumor cells was associated with advanced disease in patients with urothelial carcinoma and also showed correlation with poor survival. another study reported that pd - l1 in urothelial carcinoma cells was not predictive for os, but positive pd - l1 expression in tumor infiltrating mononuclear cells showed significant association with longer survival. hpv - hnscc arises from deep crypts within the lymphoid tissue of the tonsil and base of the tongue and the majority of cases can be distinguished from hpv - negative hnscc by the characteristic infiltration of lymphocytes in the stroma and tumor nests. there is substantial evidence that hnscc is an immunosuppressive disease, particularly hpv - positive hnscc, and recent preclinical and clinical studies suggest that the pd-1:pd - l1 pathway is highly related to the pathogenesis of hpv - hnscc. however, it is unclear whether the pd-1:pd - l1 pathway plays a greater role in hpv - positive hnscc compared to hpv - negative hnscc. in the current study, 67% of patients had p16-positive disease indicating hpv - oscc, consistent with previous reports. we found that hpv - oscc was associated with more advanced n stage, a trend for less advanced t stage, and occurrence at a relatively young age. in addition, there was a trend toward favorable pfs in p16-positive patients compared to p16-negative patients despite the more advanced stage in the p16-positive group. in this study, the small difference in survival benefit in the hpv - positive oscc group may be attributed to the limited sample size and relatively few events in the entire cohort. similarly, badoual. reported that 33 of 64 hnsccs (51.5%) expressed a significant level of pd - l1 in tumor cells, but no correlation was observed between pd - l1 expression and hpv status (hpv positive vs. negative, 62.5% vs. 40%, p=0.08). however, hpv - hnscc was more heavily infiltrated by cd8 + t cells (p=0.01) and pd-1+cd4 + t cells (p=0.045), and the total number of pd-1+cd4 + and pd-1+cd8 + t cells (p=0.045) was higher than that in hpvnegative hnscc. reported the presence of pd - l1 expression in 68 of 138 hpv mrna - positive patients (49%) compared with 14 of 41 hpv mrna - negative patients (34%) (odds ratio, 3.4 ; p=0.08). in contrast, lyford - pike. reported that pd - l1 was expressed at a much higher level in hpv - positive tumors compared with hpv - negative tumors (14/20 [70% ] vs. 2/7 [29% ]). a recent study reported that pd - l1 expression in tumors showed correlation with improved efficacy of the immune checkpoint inhibitor anti pd-1 antibody in nsclc. the predictive role of pd - l1 expression in hnscc patients treated with immune checkpoint inhibitors should be further explored. in addition, given the high expression of pd - l1 regardless of hpv status, clinical studies with anti pd-1 or anti pd - l1 antibody are warranted in both hpv - positive and hpv - negative patients. identification of predictive biomarkers related to efficacy of immune checkpoint inhibitors, in combination with hpv status, might provide further clinical benefit to patients with hnscc. first, 33% of patients diagnosed with oscc were not included in the current analysis because of lack of tumor tissue, indicating a potential selection bias. second, even though a relatively large cohort was analyzed, compared to previous studies, because of the favorable prognosis of oscc only a few events occurred in the entire cohort. this might limit the power of the study to determine the prognostic role of pd - l1 expression. consequently, it is not yet certain that pd - l1 expression truly has no prognostic role or it is just a reflection of lack of statistical power. finally, the inherent nature of a retrospective study makes it impossible to explore any dynamic changes in pd - l1 expression. in conclusion, we showed that pd - l1 was highly expressed in oscc, but there was no correlation between pd - l1 expression and hpv status. further large prospective studies are required to determine the role of pd - l1 expression as a prognostic or predictive biomarker, and clinical studies of immune checkpoint inhibitors in oscc are warranted regardless of hpv status.
|
purposeoropharyngeal squamous cell carcinoma (oscc) has been recognized as an immunosuppressive disease. various mechanisms have been proposed for immune escape, including dysregulation of immune checkpoints such as the pd-1:pd - l1 pathway. we investigated the expression of programmed cell death - ligand 1 (pd - l1) in hpv - negative and hpv - positive oscc to determine its prevalence and prognostic relevance.materials and methodsusing immunohistochemistry, 133 cases of oscc were evaluated for expression of pd - l1. formalin - fixed paraffin - embedded tumor samples were stained with monoclonal antibody (clone 5h1) to pd - l1. pd - l1 positivity was defined as membrane staining in 20% of tumor cells. correlations between pd - l1 expression and hpv status and survival parameters were analyzed.resultsof the 133 patients, 68% showed pd - l1 expression, and 67% of patients were positive for p16 expression by immunohistochemistry. no significant difference in pd - l1 expression was observed between hpv(-) and hpv(+) tumors (61% vs. 71%, p=0.274). no significant difference in age, gender, smoking history, location of tumor origin, or stage was observed according to pd - l1 status. with a median follow - up period of 44 months, older age (65) (p=0.017) and t3 - 4 stage (p<0.001) were associated with poor overall survival (os), whereas pd - l1 expression did not affect os in univariate and multivariate analysis.conclusionpd-l1 expression was observed in the majority of oscc patients regardless of hpv status. further large prospective studies are required to determine the role of pd - l1 expression as a prognostic or predictive biomarker, and clinical studies of immune checkpoint inhibitors in ocss are warranted regardless of hpv status.
|
receptive functions are higher mental processes by which people carry out normal daily life tasks (1). the specificity of these functions is that they stimulate specific physiological functions in the body. they are reflected in the ability to select, classify and integrate received informations (2). at the cellular level receptive functions depend primarily on communication between neurons, or the activity of specific signaling molecules called neurotransmitters. studies show that estrogen directly, through intracellular receptors (genomic) and membrane receptors (non genomic), act on neurotransmitters and receptors and alter the level of neurohormones compensation. estrogens prevent decline in cognitive function by modeling blood flow and activity in key brain areas, including the area responsible for attention as well as verbal and spatial memory (3). as the estrogen level decreases with age, so does the level of neurotransmitters in the key areas of the brain, which can affect the receptive functions. in our study, we measured the visual - perceptual ability in patients of childbearing age, perimenopausal and postmenopausal women, which means the ability of visual perception of space and elements of space, spatial relationships and the ability to perform thought - perceptive organization of the observed elements (4). according to the results of the study, these receptive functions are an important factor that predisposes the quality of life in older age. the goals of this study were to assess the visual - perceptual abilities of female patients of childbearing age, perimenopausal and postmenopausal. the baseline sample was divided into three groups. the first group consisted of patients of childbearing age (25 - 39 years). the second group consisted of patients in perimenopausal age (40 - 54 years). unweighted scores, that respondents achieved on pnt are evaluated according to norms for specific age group used in the pnt standardization (5). the total score is the sum of correct solutions. for every age group of women descriptive statistics friedman s test indicates that the distribution of results significantly differ between groups, suggesting that at the onset of menopause there is a decrease in visual - perceptual abilities of the patients. figure 1 presents the average values of achieved scores at the pnt for all three age groups. results in patients of childbearing age, perimenopausal and postmenopausal age are significantly different, friedman s test was significant with p<0.001. in a seattle midlife women s health study, 62% of women complained of memory and concentration difficulties in menopause, resulting in daily problems in behavior and ability to deal with them (5). yaffe (1998) has found that postmenopausal women with higher concentrations of unbound estrogen are less prone to decline of cognitive functions (6). with the help of mini - mental status examination (mmse) test, also measured are concentrations of bioavailable estradiol and testosterone, unbound to proteins in the blood with comparison of their levels of estrogen. women with higher concentrations of free estradiol had a 70% lower risk for decline in cognitive function than women with a low concentration of free estradiol. since some progestogens facilitate the ability of free estrogen to cross the blood - brain barrier, a combined preparations of hrt may be the most effective in preventing cognitive deterioration (7). leblanc and colleagues in the comprehensive meta - analysis and systematic review gathered data from 29 studies exploring the use of hrt in dementia prevention (8). the researchers concluded that women with menopausal symptoms, which used hrt, had improvements in verbal memory, alertness, judgment, and the motor speed. mcewen and colleagues in their study also suggest that hrt may prevent deterioration of cognitive functions related to aging, while estrogen supplement may protect the hippocampus and other brain areas associated with dementia (9). weight of data from randomized, controlled studies in the region on estrogen and cognition in postmenopausal women speaks how estrogen protects verbal memory, while less consistent observational studies showing a greater diversity of their impact. with the worldwide growth of elderly population, observational studies have suggested that estrogens may delay or prevent the onset of ad if treatment is begun in the early period of menopause. tang and colleagues studied 1124 older women, mean age 74.2 years, searching for cognitive impairment over five years. they concluded that the occurrence of ad was significantly later in women taking estrogen than in those who did not (10). relative risk for ad was six percent lower in women receiving hrt and sixteen percent higher in women who had not use it. in women who used estrogen for more than a year reduction in the risk of disease was greatest. barbara sherwin concludes that, given the evidence collected, there may be a critical window of time to initiate treatment with estrogens, immediately upon the occurrence of perimenopause, which can increase their maximum potential against cognition deterioration (11). early commencement and with the lowest effective dose of women may have a protective effect of estrogen with a very low risk of treatment. according to the distribution of results in our study, and the statistical significance of friedman - test, it can be concluded that in patients who enter menopause exist a tend toward decrease of receptive functions. given the evidence collected, there is a critical window in time for receptive function decrease prevention. immediately upon the occurrence of perimenopause, estrogen use may increase their maximum potential in the fight against the deterioration of these functions. by early application of the minimum effective dose of estrogen, women may have a protective effect, with a very low risk of treatment.
|
introduction : receptive functions represents higher mental processes by which people carry out normal daily living tasks. the specificity of these functions is that they stimulate specific physiological functions in the body. they are reflected in the ability to select, classify and integrate the information received.material and methods : we performed an assessment of visual - perceptual abilities by purdue nonverbal test (pnt - tv) in 135 patients. patients are classified into three age groups of 45 patients. the first group consisted of patients of childbearing age (25 - 39 years), second group of patients in perimenopausal age (40 - 54 years) and a third group of postmenopausal patients (55 years). results : the distribution of the results are statistically different between groups, suggesting that at the onset of menopause there is a decrease of visual - perceptual abilities in patients (friedman test was significant with p<0.001).conclusion : by the distribution of the results of our study, and the statistical significance of friedman s, it can be concluded that patients who enter menopause have tendency to decrease of receptive functions.
|
the concept of stress has been around for centuries, but only recently has it been systematically conceptualized and has become a subject of research, indicating its reciprocal relation with body physiology. the relevance of psychological stress in research leads to the need for valid and reliable instruments to measure it. the perceived stress scale (pss) is one of the most widely used psychological instrument for measuring the perception of stress. it is a measure of the degree to which situations in one 's life are appraised as stressful. items were designed to tap how unpredictable, uncontrollable, and overloaded respondents find their lives. the occurrence of stress and stress - related anxiety and depression in medical students, trainees, and qualified physicians are being increasingly reported in literature. stress is not only a risk factor for several chronic diseases including hypertension, diabetes, and coronary artery disease and precipitates several mental ailments, the impact on stress in the medical work environment affects healthcare delivery as well. the ability to measure stress reliably would be useful to further characterize the link between stress and health. more importantly, it would help evaluate interventions that may decrease stress levels. to the best of our knowledge, no study has been conducted so far using pss in a bengali - speaking population, neither has its validity and reliability been tested in this language. a number of studies in recent years focused on the incidence of stress and stress - related illnesses such as anxiety and depression among students, trainees, and qualified physicians. indeed, some research indicate the unique academic challenges of medical studies, rigor of the educational program, and emotionally tense experiences, such as dealing with illness, disease, and dying that make medical students more vulnerable to stress and anxiety than students of other disciplines. a study conducted in uae among medical students, trainees, and university faculties using a questionnaire based on cohen 's perceived stress scale (english), showed that 65% of the students perceived stress (ps) levels too high. relationship between stress scores and students opinions regarding whether stress perceived was too high or not was significant. similarly, pss-10 was administered in a multinational study for the purpose of identifying the determinants of stress in dental students. a significant inverse relationship between emotional independent significant predictors of ps identified were gender, previous higher education qualification, and satisfaction with the decision to study dentistry. in a study conducted in hong kong the psychometric properties of pss-10 (chinese version) were tested in a large population of chinese male, middle - aged, smokers suffering from heart ailment. the study showed that pss-10 not only provides an adequate measure of ps and similar correlations with smoking and health - related measures as the complete version but also shows a higher reliability among chinese patients. women reported a significantly higher ps and also higher scores on negative subscale than men. another study conducted in greece tested the construct validity, internal consistency, and concurrent validity of the greek version of pss-14 and pss-10 was tested for a population consisting mostly of females of age 55 years, single, and with a full - time job. support of the two components in pss was provided by the opposite correlations of the positive and negative factors. females exhibited significant higher stress scores. in the indian context, students of a medical college in mumbai showed high stress level, more during their 2 and 3 year of their mbbs course. the aim of the current study was to establish a valid and reliable version of pss in bengali as well as to examine stress level in medical students and trainees of a teaching hospital in a bengali - speaking set - up. to prepare a bengali version of pss-10to establish its psychometric properties in a population of medical students and interns of a teaching hospitalcomparison of ps among different subgroups of medical personnel. to prepare a bengali version of pss-10 to establish its psychometric properties in a population of medical students and interns of a teaching hospital comparison of ps among different subgroups of medical personnel. to prepare a bengali version of pss-10to establish its psychometric properties in a population of medical students and interns of a teaching hospitalcomparison of ps among different subgroups of medical personnel. to prepare a bengali version of pss-10 to establish its psychometric properties in a population of medical students and interns of a teaching hospital comparison of ps among different subgroups of medical personnel the ten - item pss by cohen (1983) was translated into bengali, the scale consisted of four positive and six negative items. participants are asked to respond to each question on a 5-point likert scale ranging from 0 (never) to 4 (very often), indicating how often they have felt or thought a certain way within the past month. scores range from 0 to 40, with higher composite scores indicative of greater ps. translation was done by two literary experts independently, after which both were matched and a common agreement was reached. it was translated back into english by two health professionals and, when compared with the original version, translation - retranslation validity was found to be satisfactory. the final bengali version was prepared after reaching a common consensus between all the experts, giving more emphasis on the conceptual and semantic meaning of the questions asked. all the 2 mbbs students and interns who attended psychiatry opd as a part of their clinical posting during the months of may - june and who were able to understand, read, and write both english and bengali were included in the study after obtaining informed written consent. socio - demographic and clinical data sheet used in the study included personal information of the subjects as well as the pss-10 scale. a total of 23 students and 14 interns among them agreed to take part and answered the questionnaire. english and bengali version of the scale was handed over to an individual in a random order. completed data sheet was collected back in 2 days and then the other version was given to the same individual. for statistical analysis, statistical package for social sciences for windows, 16 version (spss 16) was used. for descriptive statistics, frequency distribution of the different groups of population and calculation of mean and internal consistency of pss (english) and pss (bengali) and correlation between the scores of the two versions were tested by cronbach 's alpha coefficient and pearson correlation coefficient, respectively. for assessing the validity of translation, kappa coefficient value for intra - rater reliability was computed. student t - test was used to compare the results between different subgroups in the study. the study involved 37 subjects, mean age of 21.72.06 years, majority of the population (n=26) were male (70.3%) with only 11 (29.7%) female participants. among the 37 subjects, 14 (37.8%) were interns and 23 (62.2%) were students. mean age for interns (23.70.83 years) was found to be significantly different (o=0.00) from the mean age of mbbs students (20.481.56 years) [table 1 ]. comparison of age and pss scores among the subgroups cronbach 's of the ten - item bengali scale (0.80) was found to be satisfactory, showing good internal consistency. while computing internal consistency after individual item deleted, item 9 of bengali scale had value slightly greater than that of the full scale. presence of all other items was justified in the scale indicated by their value [table 2 ]. inter - rater reliability and internal consistency of pss bengali (ten item) intra - rater reliability between pss (e) and pss (b) was compared using kappa statistics. items (1, 2, 4, 5, 9, 10) had satisfactory value (> 0.5), indicating strong agreement, while items (3, 6, 7, 8) showed disagreement between the original and translated version indicated by (1 suggested the presence of two factors [table 4a ]. this was also supported by the scree plot placing factors in decreasing number of eigen value [figure 1 ]. variance attributed to factor i was 41.56%, which held the bulk of total variance. table 4b indicated that, except for item no 5 (which was item 9 in original pss), the factor structure and individual item loading supports that of pss english. item 5 showed higher loading for factor 2, which was contrary to previous study results. internal consistency of pss bengali (six item) factor structure of pss bengali (six item composition of two item pss item) exploratory factor analysis with varimax rotation scree plot indicating the probable two factor structure of the scale item composition of the two factors obtained from pss bengali (six item) using exploratory factor analysis with varimax rotation however, to measure ps of the subjects, the current study focused on the findings of pss-10 original version since it is a pre - validated scale. independent t - test was done to compare scores between different subgroups (gender, occupation). the difference of ps score between two occupation subgroups (internee, student) was not significant as indicated by their value (p=0.83). when compared between two genders, ps of the male did not differ significantly from that of the female (p=0.46) [table 1 ]. this was a pioneer study in a bengali - speaking population, in which reliability of pss-10 scale was being examined, no other study was found from available resources that had used pss-10 in medical students or trainees in this part of india. following methods were adapted during data collection to avoid bias : a) proformas were given individually to the participants to avoid influence by peer groups, b) collecting data sheet within a short period of time limited wide variation in stress level in the subjects affecting study findings, c) english and bengali scales were given separately. previous studies have found difference in stress level between medical professional and people from other professions. even among the medical students, different levels of ps but the current study did not find interns to perceive stress differently from mbbs students by any significant level [table 1 ]. the internal consistency (0.79) was good and comparable with that of pre - validated pss-10 applied in a us population (0.78). the value of cronbach 's alpha of pss-10 bengali is satisfactory (0.80) and comparable with that of pss arab (=0.74), greek (=0.82), spanish (=0.83), thai (=0.85), and chinese (>0.5) versions. it is evident from this study that there is considerable amount of stress among medical students and internees in a medical college set - up. this finding is supported by previous studies reporting significant stress levels in health professionals ; some of these studies used pss and some did not. this study does not reveal any significant difference in the ps level in subjects on the basis of age, gender, and educational status, also supported by several other studies. although this is contrary to several other previous study findings that indicate higher ps level in females, younger age group, and in subjects with lower academic qualification. some of the items in pss bengali (items 3, 6, 7, 8) did not show adequate intra - rater reliability shown by inadequate kappa coefficient value, indicating limitation of culturally valid expression. the sample size of this study being modest, hinders the results to be generalized in wider population. the stress in medical personnel has to be explored in detail through further studies. the newly constructed bengali version of pss scale, consisting of the six items with good kappa value has to be administered in a wider population in order to test its psychometric properties.
|
background : the occurrence of stress and stress related anxiety and depression in medical personnel are being increasingly reported in literature. the perceived stress scale (pss) is the most widely used psychological instrument for measuring the perception of stress. it is needed to assess perceived stress in our population using appropriately translated version of pss. the objectives of study were to prepare a bengali version of pss-10 and to establish its psychometric properties in the study population.materials and methods : the study was conducted in a teaching hospital among medical students and interns (n=37). the translated bengali version and the original english version of pss-10 were separately handed over to the individual subjects. the scores were compared across different subgroups and psychometric properties of the translated version were assessed using spss 16.results:internal consistency of pss english (=0.79) and bengali (=0.80) was satisfactory. intra - rater reliability was adequate (>0.5) for most of the items, but showed an inadequate value (<0.5) for four items on the scale. after deleting these four items from the bengali version, a new six - item pss in bengali was derived that showed good internal consistency (=0.699).conclusion : this new version needs to be validated in a larger study population. perceived stress score using pss-10 was considerably high in our study population, although there was no significant difference between the subgroups (male / female, intern / student).
|
in the 1960s, prasad and his colleagues reported that zinc (zn) plays indispensable roles in such diverse cellular events as cell proliferation, differentiation, and survival in humans. in the past decade, studies in animal models have provided considerable knowledge about the molecular principles of zn 's function in the immune system, including new insights into how a single nutritional deficiency can alter immune - cell homeostasis and functions in both innate and adaptive immunity. zn 's physiological importance is supported by recent in silico studies showing that the proteins encoded by approximately 10% of entire genome in homo sapiens can potentially bind zn through zn - finger motifs, ring finger domains, lim domains, and phd domains, all of which are involved in basic cellular activities. in the present era, approximately two billion people in developing countries suffer from zn deficiency (znd), mainly due to malnutrition and manifest clinical characteristics of growth retardation and compromised immune systems [1, 4 ]. znd induces thymic atrophy and lymphopenia and depresses both innate and adaptive immune responses : it impairs phagocytosis, intracellular killing activity, and cytokine production by macrophages ; host defense by neutrophils and natural killer cells ; and the proliferation, cytokine production, and antibody secretion of t and b cells. these outcomes, which appear to be mostly rooted in the dysregulation of basic cellular functions such as dna replication, rna transcription, and cell activation, proliferation, differentiation, and survival [611 ], result in an increased susceptibility to a wide range of infectious agents and a longer duration of infection [1, 5 ]. zn acts as a cofactor for proteins and affects the structural and catalytic functions of enzymes and transcription factors. in addition to recent mechanistic investigations into zn 's functions, other recent studies using chemical or gene - targeting approaches have revealed zn 's role as a second messenger, similar to that of cyclic adenosine monophosphate (camp) and calcium, in zn signaling axes mediated by specific channels or zn transporters. in this review, we describe recent discoveries about the role of zn signaling in the immune system and along specific zn transporter axes. we will particularly focus on the physiological importance of zn signaling in dendritic cells (dcs), t cells, and b cells, major populations that are required for crosstalk between the innate and adaptive immune systems. ongoing research in this field will improve our understanding of the physiological significance of this vital trace element. zn is the second most abundant metal in the human body, with 24 grams distributed throughout the whole body. zn is generally taken in through food or breast milk, is absorbed via several intestinal zn transporters, and is released into the bloodstream (figure 1). circulating zn is taken up into cells and distributed within the cell (figure 1). at each step, zn transporters and metallothioneins play coordinated roles in the transport, distribution, and homeostatic maintenance of zn (figure 2). based on their predicted membrane topology, zn transporters are divided into two major families, slc39s / zips and slc30s / znts, which mediate the inward and outward transport of zn through cell - surface membranes and intracellular organelles (figure 2). the zip family, which consists of 14 members containing eight putative transmembrane domains, elevates intracellular cytoplasmic zn levels by eliciting the influx of zn from the extracellular space or from intracellular organelles. no zip crystal structure has been determined, but zips are postulated to transport zn by diffusion, symporters, or a secondary active transport system but not via an atp - dependent mechanism. accumulated evidence from genetic approaches has demonstrated specific physiological roles of zn transporters in mice and humans (table 1). a single ablation of the zip1, zip2, or zip3 allele or a double ablation of zip1 and zip2 in mice leads to abnormal embryonic development in the znd environment of the mother [1416 ]. zip4, the most intensively studied zn transporter in human genetics, serves as a first gate for absorbing zn into the body through the apical membrane of enterocytes. loss - of - function mutations in zip4 lead to acrodermatitis enteropathica (ae ; omim 201100), a rare, pseudodominant, lethal genetic disorder characterized by severe znd symptoms such as periorificial and acral dermatitis, alopecia, and diarrhea in infants [1720 ]. supplementing with at least 1 - 2 mg zn per kg of body weight per day dramatically improves the health and saves the lives of these patients, who would otherwise die within 2 years [17, 19 ]. in mice, targeted disruption of the zip4 gene impairs early embryonic development, since zip4 is thought to transport zn into the embryo via the visceral yolk sac and later by the uptake of dietary zn through the intestine. furthermore, mice with conditional zip4 ablation in enterocytes exhibit dramatic wasting and death unless they receive additional dietary zn through nursing or supplementation. these mice have reduced labile zn and abnormal gene expression in paneth cells, leading to an abnormal stem - cell niche in the crypts and subsequent disorganization of the absorptive epithelium. loss - of - function zip5 mutations are associated with autosomal dominant nonsyndromic high myopia. zip8 is also associated with human and murine osteoarthritis, in which an influx of zn into cartilage chondrocytes elevates the expression of matrix - degrading enzymes. most recently, it has been reported that a nonsynonymous variant in zip8 is associated with schizophrenia. a lack of zip10 impairs b - cell development and function in mice [27, 28 ]. targeted zip12 disruption attenuates the development of pulmonary hypertension in rats in a hypoxic atmosphere. zip13-deficient mice have abnormal systemic and bone growth with characteristics reminiscent of human ehlers - danlos syndrome (eds), a group of recessive genetic disorders that affect connective tissue development, and of osteogenesis imperfecta, formally named as spondylocheirodysplastic ehlers - danlos syndrome (scd - eds, omim 612350) [3035 ]. zip14-deficient mice have impairments in systemic growth, bone metabolism, and gluconeogenesis, impaired liver regeneration (after partial hepatectomy), decreased insulin signaling and hypertrophied adipocytes, and increased adipose cytokine production and plasma leptin. in addition, it has been recently reported that the homozygous loss - of - function mutations of zip14 cause progressive parkinsonism - dystonia and neurodegeneration with hypermanganesemia in childhood. the znt family, which consists of 10 members containing six transmembrane domains, reduces intracellular cytoplasmic zn levels by exporting zn from the cytosol to the extracellular space or into intracellular organelles or vesicles. mice with a targeted disruption of znt1 exhibit embryonic lethality. in mice, a targeted disruption or mutation of znt2 results in severe znd in nursing pups due to the extremely low zn content of breast milk ; a genetic mutation is known to cause the same symptoms in humans [4043 ]. znt3 localizes to presynaptic vesicles, which are required for extracellular signal - regulated kinase (erk) activation and hippocampus - dependent memory. a targeted znt3 disruption causes memory deficits with alzheimer 's disease - like abnormalities in mice. similar to znt2-deficient mice, the milk of mice with a loss - of - function mutation in znt4 (lethal milk mutant) is deficient in zn, resulting in postnatal lethality. znt5-deficient mice exhibit severe osteopenia, sudden death from bradyarrhythmia in males in their reproductive period, and impaired delayed - type allergic responses mediated by mast cells. in addition, znt7-deficient males are resistant to insulin and become hyperglycemic and glucose intolerant on a high - fat diet. the znt8 transporter is associated with both type 1 and type 2 diabetes mellitus. znt8-deficient mice have impaired insulin secretion and crystal formation in diabetes mellitus [5355 ] and rapidly clear insulin from the liver. znt10 mutations cause parkinsonism and dystonia with hypermanganesemia, polycythemia, and chronic liver disease [5759 ]. neurons respond to exocytotic stimuli by releasing vesicular zn into the surrounding milieu, where it is probably taken up into adjacent postsynaptic neurons and glial cells via zn - permeable channels [6568 ]. zn also mimics the actions of hormones, growth factors, and cytokines and regulates their functions by changing their structures via direct binding [73, 74 ]. these data suggest that zn not only acts as an accessory factor for the function of various cellular components but also behaves as a signaling molecule, like calcium and camp [75, 76 ]. in fact, zn acts through zn channels and transporters to regulate a variety of signaling cascades mediated by hormone and growth factor receptors, cytokine receptors [28, 78, 79 ], toll - like receptors (tlrs) [61, 80 ], and antigen receptors [27, 48 ], so called zn signaling. zn 's behavior as a second messenger has been clearly observed in some cell types. for example, mast cells, which induce allergic responses, express a surface fc epsilon receptor i (fcri) specific for ige binding. upon sensing an antigen through ige - fcri engagement, mast cells release intracellular granules containing histamine, lipids, and proteases to initiate an allergic response. simultaneously, fcri crosslinking induces a rapid release of intracellular zn from the perinuclear area, including the endoplasmic reticulum (er), in a phenomenon known as the zn wave. the zn wave depends on calcium influx and mitogen - activated protein kinase (mapk)/erk activation and is mediated by the pore - forming (1) subunit of the cav1.3 ((1d)) l - type calcium channel (ltcc) as a gatekeeper. the ltcc - mediated zn wave enhances nf-b 's dna - binding activity, inducing the gene transcription of inflammatory cytokines (figure 3). in fact, ltcc antagonists inhibit the cytokine - mediated, delayed - type allergic reaction in mice without affecting the immediate - type allergic reaction. furthermore, nishida. demonstrated using znt5-deficient mice that znt5 in mast cells plays a crucial role in the delayed - type allergic response represented by contact hypersensitivity (figure 3). znt5 is highly expressed in mast cells and is upregulated by fcri stimulation. znt5-zn signaling regulates the fcri - induced translocation of protein kinase c (pkc) to the plasma membrane, which induces nf-b activation, leading to the production of interleukin- (il-) 6 and tumor necrosis factor alpha (tnf-). thus, zn signaling via specific zn channel and transporter controls fcri - induced nf-b signaling in delayed - type allergic reactions (figure 3) zn transported by zip6 controls embryogenesis by regulating the nuclear translocation of snail (a suppressor of e - cadherin transcription) during the epithelial mesenchymal transition (emt) in zebrafish. zip6-zn signaling also negatively modulates the tlr - induced activation of dcs during immune responses. the zip8-zn axis negatively regulates nf-b activity by downmodulating the ib kinase activity in proinflammatory responses. zip10-mediated zn signaling suppresses caspase activity to promote cell survival in early b - cell development in the bone marrow and regulates the activity of cd45r protein tyrosine phosphatase (ptpase) to control the strength of b - cell antigen receptor (bcr) signaling in antibody responses. most recently, taylor. revealed that zip10 forms a heteromeric complex with zip6 and controls emt through inactivation of gsk-3 and downregulation of e - cadherin in a breast cancer cell line and in zebrafish embryos. zn uptake mediated by zip13 and zip14 controls systemic growth and bone homeostasis ; zip13 positively regulates smad 's nuclear translocation in bone morphogenetic protein / transforming growth factor beta (bmp / tgf-) signaling, and zip14 suppresses phosphodiesterase (pde) activity to maintain camp levels in hormone - g - protein coupled receptor (gpcr) signaling. zip14-induced zn signaling also inhibits the protein tyrosine phosphatase 1b (ptp1b) activity, thereby increasing c - met phosphorylation to promote hepatocyte proliferation during liver regeneration. collectively, these findings indicate that individual zn transporters form specific zn signaling axes to selectively organize distinct intracellular signaling events. znd 's multifaceted effect on the immune system results in a high susceptibility to a variety of infections. zn supplementation effectively improves immunity on the one hand and efficiently ameliorates chronic dysfunctional inflammatory responses on the other. these findings strongly suggest that zn is essential for normal immune - cell homeostasis and function. there is already an excellent body of literature about zn 's roles in specific innate cell types, such as monocytes / macrophages and natural killer cells [84, 85 ], and we here focus on the roles of zn and zn transporters specifically in dcs, t cells, and b cells, which are bridging populations that enable crosstalk between the innate and adaptive immune systems. dcs are professional antigen - presenting cells that are differentiated from a hematopoietic lineage and are important in linking the innate and adaptive immune systems. they circulate as immature cells and differentiate into mature dcs when activated by exposure to pathogens. in this process, dcs take up antigens, degrade them into peptides, load the antigenic peptides onto major histocompatibility complex ii (mhc - ii), and finally present the peptide - mhc - ii complex on their cell surface to antigen - specific cd4 helper t (th) cells to initiate immune responses. when mouse dcs in vivo or in vitro are exposed to a ligand for toll - like receptor 4 (tlr4), lipopolysaccharide (lps), which is a component of bacterial cell walls, the dcs elicit cell maturation with a reduction in intracellular - free zn levels and an increase in surface mhc - ii and costimulatory molecules (figure 4). during the maturation process, zn transporter expression is changed : zip6 and zip10 are downregulated, while znt1, znt4, and znt6 are upregulated for a net decrease in cytosolic zn content. chemical zn chelation by the membrane - permeable zn chelator tpen (n, n, n, n tetrakis (2-pyridylmethyl) ethylenediamine) mimics this phenomenon, while the forced introduction of zn or the ectopic expression of zip6 suppresses lps - induced dc maturation. consistent with these findings, dcs that overexpress zip6 fail to activate antigen - specific cd4 th cells. microscopic analysis revealed that zn facilitates the endocytosis of mhc - ii but inhibits the trafficking of mhc - ii from the lysosome / endosome compartments to the plasma membrane. these results suggest that a reduction in cellular zn is required for proper antigen presentation via mhc - ii to elicit adaptive immune responses (figure 4). although znd causes immunodeficiency, it can also induce abnormal skin inflammations accompanied by erythematous rashes, scaly plaques, and ulcers on the acral and periorificial areas [1720 ]. in fact, these paradoxical symptoms are particularly obvious in patients with hereditary and acquired ae, in which an immunostimulated skin inflammation develops in areas subject to repeated contact. interestingly, dietary znd mice with allergic contact dermatitis (acd) induced by dinitrofluorobenzene (dnfb) show markedly reduced ear swelling, while those with irritant contact dermatitis (icd) induced by croton oil (cro) exhibit augmented ear swelling. histological analysis revealed that the icd lesions in znd mice have features similar to cutaneous manifestations in human ae lesions, such as subcorneal vacuolization and epidermal pallor. in znd mice, damaged epidermal keratinocytes release adenosine 5-triphosphate (atp) that leads to icd, which can be ameliorated by locally injecting soluble nucleoside triphosphate diphosphohydrolase. notably, experiments in ex vivo organ culture showed that zn chelation by tpen enhances the atp release in response to cro whereas tpen alone does not, suggesting that a combination of znd and chemical irritants synergistically increases the release of atp from keratinocytes. these findings raise the question of why a znd environment enhances the irritant - induced atp release from keratinocytes. langerhans cells (lcs) are epidermis - resident dcs that act as sentinels to orchestrate immune responses against foreign antigens, including pathogens, in the skin. lcs exclusively express the ecto - ntpdase cd39, which protects the cells against atp - mediated inflammatory signals by hydrolyzing the extracellular nucleotides released by keratinocytes. a similar phenomenon is observed in the lesions of patients with ae, but not those with atopic dermatitis or psoriasis vulgaris. notably, lc recolonization of the epidermis and marked clinical improvement are observed in ae patients treated with oral zn supplements. these data collectively suggest that inflammatory skin manifestations in ae patients may result from excessive icd responses upon repeated exposure to various irritants in a znd environment, due to the aberrant atp release from epidermal keratinocytes and the depletion of lcs. activated t cells are largely divided into cd4 th cells which provide vital assistance to b cells to induce antibody response and cd8 cytotoxic t cells (ctls) which induce cell death by direct interactions with pathogen - infected cells or tumor cells. during an adaptive immune response, both types of cells establish an immunological memory that is poised to respond rapidly and effectively to a pathogen that has been previously encountered (recall response). th - cell populations are involved in autoimmunity, allergic response, and tumor immunity. upon t - cell receptor (tcr) activation in a particular cytokine milieu, naive cd4 t cells can differentiate into several subsets, including th1, th2, th17, and regulatory t (treg) cells. the resultant cd4 t - cell subsets are characterized by their functions and patterns of cytokine production. th1 cells promote cell - mediated immune responses against intracellular pathogens and produce the cytokines, interferon gamma (ifn-), tnf-/, and il-2. these cytokines promote macrophage activation, nitric oxide production, and ctl proliferation, leading to the phagocytosis and destruction of microbial pathogens. the differentiation and expansion of th1 cells are driven mainly by il-12, which induces the signal transducers and activator of transcription (stat) 4-dependent th1-specific transcription factor t - bet. t - bet promotes the expression of ifn- and il-12rb2, which, together with il-12rb1, form a functional il-12 receptor complex to further stimulate ifn--induced th1 differentiation. exaggerated th1 responses are associated with autoimmune diseases, including rheumatoid arthritis, multiple sclerosis, inflammatory bowel disease, and type 1 diabetes. th2 cells, which are required for humoral immunity against extracellular pathogens, secrete il-4, il-5, il-6, il-10, and il-13. exposing tcr - stimulated cd4 t cells to il-4 induces the stat6-dependent expression of the th2 master transcriptional regulator gata-3 and then produces il-5 and il-13 for cell expansion. il-2, il-7, or thymic stromal lymphopoietin (tslp) is also required during th2 differentiation to activate stat5, which cooperates with gata-3 to promote the t - cell production of il-4. il-4 regulates the clonal expansion of th2 cells and, along with il-13, promotes the b - cell production of ige and alternative macrophage activation. excessive th2-type immune responses have been implicated in the development of chronic allergic inflammation and asthma. th17 cells are involved in immune responses mounted against specific fungi and extracellular bacteria. in mice, th17 cells develop from naive cd4 t cells in the presence of tgf- and il-6, inducing the stat3-dependent expression of il-21, the il-23 receptor, and the transcription factor rort. il-21 and il-23 regulate the establishment and clonal expansion of th17 cells, while rort - induced gene expression leads to the secretion of il-17a, il-17f, and il-22. cytokines produced by th17 cells stimulate resident cells to secrete chemokines to recruit neutrophils and macrophages to inflammation sites. the persistent secretion of th17 cytokines promotes chronic inflammation and may be involved in the pathogenesis of inflammatory and autoimmune diseases such as rheumatoid arthritis, multiple sclerosis, and inflammatory bowel disorders. tregs play an indispensable role in maintaining the immunological unresponsiveness to self - antigens and in suppressing excessive immune responses that would be deleterious to the host. they begin as cd4cd8 double - negative (dn) thymocytes, pass through a double - positive (dp) stage (cd4cd8 thymocytes), become single - positive (sp) t cells (cd4cd8 or cd8cd4 sp thymocytes), and finally leave the thymus as naive t cells. in humans and mammalian model animals, znd causes thymic atrophy with a substantial reduction of dp thymocytes and a subsequent decline in mature t - cell counts [91101 ]. patients with ae due to a zip4 mutation show symptoms of severe znd characterized by immunodeficiency with thymic atrophy and lymphopenia and by recurrent infections in ~30% of patients. one mechanism that contributes to this thymic atrophy is accelerated apoptosis, due in part to chronically elevated levels of glucocorticoids (corticosterone in particular) from the adrenal glands [103108 ], although human thymocytes are relatively resistant to glucocorticoids. in fact, adrenalectomized mice fed a znd diet show little change in thymic weight [105, 106 ], whereas, in adult mice given a corticosteroid implant, the thymus size is substantially reduced. furthermore, antiapoptotic proteins such as b - cell lymphoma- (bcl-) 2 and bcl - x are reduced in znd dp thymocytes, increasing their susceptibility to apoptosis compared to dn thymocytes, th cells, and ctls [110112 ]. in vitro studies showed that more lymphocytes and thymocytes undergo apoptosis when cultured in a zn - free medium or with a zn chelator [114116 ] as opposed to when cultured in a normal medium. another potential mechanism underlying thymic atrophy in a znd environment is the impaired activity of the nonapeptide thymulin (h - pyr - ala - lys - ser - gln - gly - gly - ser - asn - oh) [117119 ]. thymulin, which is secreted by thymic epithelial populations, binds a specific high - affinity receptor on t cells to promote t - cell maturation, cytotoxic function, and il-2 production [117, 118, 120122 ]. serum thymulin is present but less active in znd subjects ; its activity is restored by zn supplementation, suggesting that zn promotes a conformational change in thymulin to confer biological activity. thus, the znd - induced thymic atrophy could result from the combination of increased glucocorticoid levels, an impairment of thymulin 's activity and impaired cell - intrinsic survival function. which zn transporter regulates early t - cell differentiation in the thymus mice with a targeted zip3 deletion have lower dp thymocyte counts and increased counts of cd4 sp or cd8 sp thymocytes under a zn - limiting condition, suggesting that zip3 loss accelerates t - cell maturation. however, deleting zip3 does not change zn homeostasis in terms of the levels of essential metals or the expression of zn - responsive genes. these data suggest that zip3 plays an ancillary role in zn homeostasis to generate naive t - cell populations in the thymus. in contrast to the susceptibility of dp thymocytes to znd, mature cd4 and cd8 t cells are relatively resistant to znd and survive well in the atrophying thymus. however, in adrenalectomized mice fed a znd diet, the th - cell helper functions that promote the differentiation of b cells into antibody - secreting plasma cells are impaired, even though there is little change in the thymic weight [105, 106 ], indicating that zn status is important not only in the early development of t cells but also in their activation and function in periphery. indeed, microarray analysis showed that even a modest zn deficiency in mice changes the expression of 1,200 genes related to the proliferation, survival, and response of t cells. furthermore, il-2 production is decreased in mice with a marginal znd, even though there is no thymic shrinkage or increase in glucocorticoid concentrations [124, 125 ]. several in vitro studies demonstrated that zn is important for t - cell proliferation in response to cytokines and mitogenic agents [9, 126132 ]. zn is required during the mid to late g1 phase, the transition to s phase, and the transition to the g2 and m phases [134, 135 ]. phytohemagglutinin- (pha-) stimulated lymphocytes from mildly znd patients contain a greater proportion of cells at s phase than those from normal human controls ; this increase is reversed by zn supplementation. tcr signaling is indispensable for cell proliferation, differentiation, and survival and for cytokine production. upon antigen recognition, the tcr stimulates lck to activate the pi3k - akt pathway and phosphorylate the immunoreceptor tyrosine - based activation motifs (itams) of the tcr / cd3 complex on the cytosolic side, thereby recruiting and activating zap70, which in turn recruits and activates downstream adaptor or scaffold proteins such as slp-76, vav, and itk. itk activates phospholipase c, gamma 1 (plc1), which leads to the production of the second messengers diacylglycerol (dag) and inositol trisphosphate (ip3). dag further activates the protein kinase c theta (pkc), nf-b, and mapk / erk pathways. on the other hand calcium - bound calmodulin activates the phosphatase calcineurin (cn), which promotes il-2 gene transcription through the nuclear translocation of transcription factor nfat. zn is reported to affect components of the tcr signaling pathway [138, 139 ]. some reports indicate that increased intracellular zn concentrations enhance the activation of lck and pkc but inhibit the activity of the phosphatase cn [141, 142 ] and other ptpases. stimulating t cells by incubation with dcs induces an influx of zn across the plasma membrane via zip6, which rapidly increases the intracellular zn concentration at spatially restricted regions ; the zn is concentrated near the immunological synapse between the t cell and dc. this phenomenon enhances zap70 and inhibits the recruitment of tyrosine phosphatase shp-1 (a negative regulator for tcr signaling) to the tcr, resulting in a prolonged calcium influx that contributes to cell proliferation and cytokine production (figure 5). this mechanism suggests an important potential role for the zn transporter - zn signaling axis in tcr signaling. zip8 is highly expressed in human t cells and is markedly upregulated by in vitro stimulation with tcr. rna interference against zip8 reduces the zip8 expression and attenuates the production of ifn- and perforin in human t cells. zip8 localizes to lysosomes, and labile zn decreases in the lysosomes and increases in the cytoplasm during t - cell activation. further analysis revealed that zip8-zn reduces the cn phosphatase activity, leading to higher ifn- production following prolonged phosphorylation of the transcription factor creb. thus, zip8-zn signaling positively controls tcr - induced cytokine production (figure 5). in fact, several studies indicate that znd suppresses the production of cytokines such as il-1, il-2, il-4, and ifn- [93, 145152 ]. in th0 and th1 cell lines cultured in low zn medium, mitogenic, experiments in humans revealed that zn deprivation decreases the production of th1 cytokines but has less effect on the production of th2 cytokines (il-4, il-6, and il-10), so the th1/th2 balance is disturbed and shifted toward th2 [145, 149 ]. consistent with this observation, cell - mediated immunity and delayed - type hypersensitivity fail in th1 cells with a znd condition, whereas th2-dependent function appears to be less affected [94, 145, 149, 154, 155 ]. in contrast, zn enhances production of the th1 cytokine ifn- and decreases the th2 cytokine il-10 in human pbmcs exposed to allergens. these dysregulations associated with low zn are restored by zn supplementation [145, 149, 157162 ], suggesting that zn controls the th1/th2 balance. several reports indicate that zn treatment prevents t - cell - mediated immune responses in vivo and in vitro [78, 164166 ] and enhances the number and activity of tregs in some cases [156, 167, 168 ]. in vitro, zn attenuates th17 differentiation, which is controlled by il-6-induced stat3 activation during chronic inflammation by suppressing stat3 activation. reflecting this result, in vivo studies show that moderate zn treatment inhibits th17-cell development and disease severity in mice with experimental autoimmune encephalomyelitis (eae) and collagen - induced arthritis (cia) [78, 167 ]. moreover, at higher concentrations, zn suppresses t - cell proliferation in mice and cytokine production in human jurkat and cd4 t cells. although the molecular mechanisms underlying these concentration - dependent effects of zn is largely unknown, they may involve the overcapacity of the intracellular buffering system to absorb large amounts of zn and a breakdown of the system of zn transport. thus, zn immunomodulates cytokine signaling in t cells to control antigen - specific immune reactions. although many reports have revealed the importance of nutritional zn in classical th subsets, zn 's effect in vivo on follicular helper t (tfh) cells, an important component in humoral immunity, has not yet been addressed. tfh cells are a subset of specialized effector th cells that help b cells and are essential for germinal center (gc) formation, which promotes the generation of high - affinity antibody - secreting plasma cells and memory b cells in vivo. although it is still controversial whether tfh cells are differentiated from a lineage that is independent from those of th1, th2, th17, and treg cells, tfh cells differentiate through multistage and multifactorial processes that accommodate significant heterogeneity. tfh - cell differentiation begins with the priming of naive cd4 t cells by dcs. early tfh cells can migrate to the border between the periarterial lymphatic sheath (pals) and b - cell follicles ; this migration depends on the cxcr5 chemokine receptor. finally, the tfh cells mature in b - cell follicles. tfh cells express relatively high levels of bcl6, a critical regulator of tfh differentiation, and secrete il-4 and il-21, which cause b cells to induce class - switch recombination (csr) for immunoglobulin (ig) (e.g., igm to igg1 and ige) and to elicit gc persistence, respectively [170, 171 ]. il-2 antagonizes tfh differentiation in a t - cell - intrinsic manner, and il-2 deficiency augments the generation of tfh cells and enhances gc formation. znd impairs the t - cell - induced il-2 production [145, 149, 154 ] but also compromises gc formation, thereby decreasing the subsequent igg1 production ; thus, it is possible that znd also affects the generation of tfh cells. this idea is supported by the fact that bcl6 bears a c - terminal zn cluster, consisting of six zn - finger domains, that is necessary for its dna binding to target genes. future studies should focus on clarifying zn 's role and identifying the zn transporter involved in tfh - cell generation in a variety of immunological contexts. b cells play crucial roles in the humoral immune response, which is a major weapon in the adaptive immune system [174, 175 ]. pro - b cells commit to pre - b cells followed by immature (imm) b cells, which express bcr on their cell membrane. the imm b cells then migrate to the spleen, where they further differentiate into transitional (tr) b cells and then into mature b - cell populations such as follicular (fo) and marginal zone (mz) b cells. mature b cells, which are classified as professional antigen - presenting cells along with dcs, capture and process antigens taken up by specific bcrs, load antigenic peptide onto mhc - ii, and present it to cd4 th cells. among the mature b cells, fo b cells account for the majority of splenic b cells and are crucial for t - cell - dependent (td) immune responses. during an immune response, activated fo b cells form the gc in the follicle with the help of tfh cells, and they undergo massive expansion, with somatic hypermutation and csr (e.g., igm to igg1) of the ig genes to acquire a high - affinity ig. in contrast, mz b cells, which are noncirculating, mediate rapid t - cell - independent (ti) immune responses against blood - borne pathogens. however, the plaque - forming cell (pfc) assays in this study were interpreted by evaluating the antibody - secreting ability of the surviving residual cells in znd mice on a per - cell basis not on a whole - organ scale. other reports show that znd depresses both td and ti antibody responses [96, 99, 178, 179 ]. in addition, znd reduces the td antibody responses against sheep red blood cells by 90% of control [96, 125 ] and reduces the ti antibody responses against dextran by 50% of control [124, 180 ]. in contrast, both the igm and igg pfc activities are restored when znd mice are fed a normal diet, although the recovery of igg pfc is greatly delayed [96, 178 ]. the zip - family member zip10, which is a cell - membrane - localized transporter, is expressed in splenic b cells. zip10 transports zn from the extracellular fluid to the intracellular space [27, 28 ]. the targeted disruption of zip10 in antigen - presenting cells, including mature b cells, diminishes antigen - specific antibody responses, in particular, the production of igg antibodies, which is correlated with severe gc - formation impairment in a b - cell - intrinsic manner. furthermore, in immunized mice fed a znd diet, the gc b - cell population and the antigen - specific igg1 response are significantly reduced, partly mimicking the phenotypes in zip10-deficient mice. although the number of mature resting fo b cells is significantly decreased in zip10-deficient mice in vivo, their proliferative activity in response to bcr stimulation is also reduced in vitro. moreover, ti responses are also impaired in zip10-deficient mice, which have an intact number of mz b cells. collectively, these results suggest that zn not only quantitatively controls fo b - cell maintenance but also qualitatively regulates the bcr signaling pathway. thus, the abrogated td antibody response in zip10-deficient mice can not be fully explained by the reduced fo b - cell count ; impaired bcr signaling is also appreciably involved. bcr signaling is transmitted through multiple pathways to mediate cell activation, proliferation, and death [181184 ]. bcr signaling is initiated by lyn, an src - family protein tyrosine kinase (src - ptk). lyn activates syk, which activates downstream kinases and transcription factors such as mapk, pi3k, and nf-b. paradoxically, the overall bcr signaling is enhanced in zip10-deficient b cells, with hyperactivated lyn and syk and downstream erk, akt, and nf-b in response to bcr stimulation. this phenomenon is partly attributed to a 20% decrease in the expression and 50% decrease in the overall activity of cd45r ptpase that inhibits lyn activity (figure 6), although its precise role in regulating src - ptks remains controversial [186190 ]. generally, zn has a negative impact on ptpase activity, as reported for the receptor ptpase beta, ptp1b, and shp-1 (a negative regulator for bcr signaling). it has also been proposed that intracellular zn is incorporated into the golgi by znt5/6/7 and then released into the cytosol by zip9, which in turn inhibits ptpase activity to activate bcr signaling in dt40 cells. if these situations are applicable to zip10-deficient b cells, there would be a loss of the suppressive effect of zn normally exerted via zip10, resulting in reduced lyn activity due to enhanced cd45r ptpase activity. however, the opposite result is reported : downregulated cd45r ptpase activity is accompanied by enhanced lyn activation after bcr stimulation. the involvement of csk, which downregulates the lyn activity by increasing phosphorylation at its inhibitory site, is also unlikely, since zn completely suppresses csk 's function. in fact, when an active form of cd45r recombinant protein is coincubated with high concentration of zn in vitro, its ptpase activity is suppressed. however, the forced introduction of zn into zip10-deficient b cells partially recovers the cd45r ptpase activity and suppresses lyn activation ex vivo in the stimulated cells. taken together, these results suggest that zip10-zn signaling regulates the expression of cd45r while simultaneously (and indirectly) enhancing the cd45r ptpase activity through a zn - dependent process rather than by a direct effect on ptpase activity (figure 6). although the detail mechanism underlying how zip10-zn signaling controls the cd45r ptpase activity in vivo is currently unclear, one potential target of zip10-zn signaling may be an oxidant (figure 6). the involvement of reactive oxygen species (ros) in bcr signaling as a second messenger has been reported [198, 199 ]. bcr engagement stimulates ros production, which inhibits ptpase activity (e.g., shp-1) around the bcr, thereby amplifying bcr signaling [198, 199 ]. another possibility is that zn is involved in dimerizing cd45, thereby downregulating its function (figure 6).. it would be interesting to investigate (1) how zip10 regulates the expression of cd45r, (2) how zip10 regulates cd45r activity in a steady state and the bcr signaling process (e.g., whether zip10 forms a complex with bcr clusters), (3) which microdomains zip10 is located in, and (4) whether zip10 can act through other factors to regulate bcr signaling. notably, zip10 protein levels are low in splenic b cells and even in 293 t cells with ectopic zip10 expression. there is no difference in the intracellular zn content of zip10-deficient and control b cells. nevertheless, zip10 deficiency leads to a striking loss of mature b cells and a marked impairment of the antibody response. given that a redundant system involving other zn transporters does not appear to be active in zip10-deficient b cells, since there is no alteration in the expression of any other transporters, these data collectively suggest that zip10 is not a major contributor to the overall intracellular zn homeostasis but rather set the threshold of bcr signal strength, probably by locally transporting small amounts of zn from the extracellular fluid. in this regard this raises the question of why, despite the augmented lyn activity, bcr - induced proliferative activity is attenuated in zip10-deficient b cells. one possibility is that the hyperactive lyn simultaneously initiates bcr signaling and generates strong inhibitory signals mediated by fcriib1, cd22, and pir - b that lead to the recruitment of the ship-1 and shp-1 ptpases. in fact, lyn mice, which express a constitutively active form of lyn, spontaneously and simultaneously activate positive (syk) and negative (cd22, shp-1, and ship-1) regulators, leading to impaired bcr - induced cell proliferation. thus, rapidly generated lyn - induced inhibitory signals may result in a signal that is insufficient for proliferation and that subsequently impairs gc formation. it is interesting to note the similarities in immunological abnormalities in zip10-deficient and znd mice. znd attenuates the th1 response, which promotes ig csr to noncytophilic igg2, such as igg2a (igg2c in c57bl/6), without affecting the th2 response, which promotes cytophilic igg1 and ige. given that zip10 deficiency significantly attenuates the level of igg2c but not of igg1 or ige in the steady state, it is tempting to speculate that the loss of zip10 affects the signal transduction mediated by th1 cytokines such as ifn- while that mediated by th2 cytokines in resting b cells remains intact. immunological memory, which involves memory b cells and long - lived plasma cells (pcs), is primarily generated through gc reactions. hence, it is not surprising that memory - recall responses to previously encountered antigens are attenuated in znd animals [74, 167, 168, 173 ], since a znd or zip10-deficient environment considerably attenuates gc formation. these findings suggest that the impaired signaling through bcr in the mature b cells from these mice may be not sufficient to support their differentiation during gc reaction. early b - cell development is adversely affected by znd [109, 204 ]. mice fed a diet marginally deficient in zn show a 50% decline in pre - b and 25% decline in immature b - cell populations. given that steroid - implanted mice have markedly reduced numbers of pre - b and immature b cells in the bone marrow [109, 205 ], the effects of znd on early b - cell development might be partly explained by the effect of glucocorticoids, as is also the case with t cells. znd primarily affects b - cell precursors ; resting mature b cells are relatively resistant to znd. indeed, a detailed study revealed that the number of fo b cells and their levels of intracellular - free zn were unchanged in mice fed a znd diet for 2 weeks, even though these mice clearly showed growth retardation and reduced serum zn [27, 60 ]. such an environment changes the expression levels of some zn transporters and metallothioneins, suggesting that an unknown mechanism of resistance involving the altered expression of zn mediators somehow maintains zn homeostasis and avoids cell death due to insufficient zn. however, specifically ablating zip10 in antigen - presenting cells causes a significant reduction in mature fo b cells. furthermore, the forced chelation of intracellular zn by tpen induces apoptotic cell death of mature b cells. since the loss of zip10 affects neither the expression of other plasma membrane - localized zn transporters nor the intracellular zn content under normal conditions, these data suggest that zip10 plays a definitive role in mature b - cell maintenance by locally targeting the responsible molecules. in light of the enhanced overall bcr signaling already discussed, it appears that the zip10-deficient phenotype is a partial phenocopy of the lyn phenotype, since lyn mice also have significantly fewer resting mature b cells, probably due to enhanced signaling above a certain threshold. however, lyn activation does not appear to be upregulated in zip10-deficient b cells in the steady state, indicating that zip10 maintains mature b cells through a lyn - independent mechanism. zip10 is expressed on the surface of pro - b cells at a relatively high level compared to other bone marrow - resident b - cell subsets. specifically deleting zip10 in pan - b cells leads to splenic atrophy with a marked reduction of peripheral b cells due to a decreased number of pro - b cells in the bone marrow. zip10 ablation enhances the activities of the cystein - aspartic acid proteases (caspases) 3, 8, 9, and 12 in pro - b cells, resulting in increased apoptotic cell death that can be mimicked by chemically chelating intracellular zn using tpen and can be restored by zn supplementation. this finding indicates that zip10-zn signaling inhibits the apoptosis induced by activated caspases and promotes pro - b - cell survival in a cell - autonomous manner (figure 6). jak - stat signaling induced by cytokine stimulation controls pro - b - cell survival and development but also has oncogenic effects. il-3 or il-7 stimulation induces zip10 expression through the jak - stat pathway. in human follicular lymphoma, thus, cytokine stimulation (the first signal) activates the jak - stat pathway (the second signal), which further induces zip10 expression and eventually generates zip10-zn signals (the third signal). in this way, zip10-zn signaling may control fate decisions in lymphocyte progenitors under physiological conditions and exacerbate malignancy under pathological conditions, according to the highly regulated pattern of zip10 expression. given that a rigorous selection process in early b - cell development ensures functionality and avoids autoreactivity by eliminating the majority of newly formed b cells through apoptosis, suppressing or augmenting the zip10-zn signaling axis may lead to lymphopenia on one hand or autoimmunity and malignancy on the other. znd influences the gene expression of the bcl / bax family, which is downregulated to eliminate nonreactive or autoreactive b cells during the developmental process but is also overexpressed in follicular lymphoma cells. since zip10-deficient pro - b cells show lower intracellular zn level, zip10 function may be coordinated with these antiapoptotic factors. taken together, these findings underscore the definitive role of zip10-zn signaling not only in antibody responses but also in early b - cell development and the maintenance of mature b cells (figure 6). collectively, these studies provide deep insights into how zn controls lymphocyte homeostasis and function. the importance of nutritional zn for the immune systems is evident from the immunodeficiency seen in znd mice. although zn 's function as a key structural or catalytic component in more than 300 enzymes and transcription factors are well known, there is a growing body of evidence that supports zn 's role as a second messenger in a variety of cellular activities. the intracellular zn concentration can be changed by immune - related extracellular stimulation, and the subsequent crosstalk between zn and signaling components facilitates the transduction of signaling pathways for immune homeostasis and functions. however, contradictory results have been reported regarding the effects of zn on the immune system. although the molecular mechanisms underlying the concentration - dependent effects of zn are poorly understood, they probably involve the capacity of the intracellular buffering system to absorb large amounts of zn and a breakdown of the system of zn transport. collectively, these findings strongly suggest that cellular zn levels can determine the threshold for zn functions in physiology and pathophysiology. in this regard, it is reasonable that zn signaling by zn transporters and channels would be tightly controlled in physiology. in this review, we focused mainly on the physiological effects of zn signaling mediated by specific zn transporter families in the adaptive immune system. each zn - signal axis targets a specific molecule, allowing zn to influence a wide range of cellular activities such as proliferation, differentiation, survival, migration, and function by selectively regulating distinct signaling pathways in immune systems (figure 7). the disruption of a zn - signal axis by znd can cause immunodeficiency if there is no redundant machinery. however, there are still few studies of the involvement of the individual zn transporters in immune homeostasis and functions ; thus, research into zn signaling in humoral immunity has barely scratched the surface. since znd depresses both primary and secondary immune responses, it will be important to use both nutritional and genetic approaches to investigate zn signaling in the prominent cell types involved in each immunological process (e.g., tfh cells, gc b cells, and memory b and memory t cells). these analyses may provide a deeper understanding of the relevance of zn signals in adaptive immunity and lead to novel therapeutic drugs and vaccines for immune - related disorders and infections.
|
zinc (zn) is an essential micronutrient for basic cell activities such as cell growth, differentiation, and survival. zn deficiency depresses both innate and adaptive immune responses. however, the precise physiological mechanisms of the zn - mediated regulation of the immune system have been largely unclear. zn homeostasis is tightly controlled by the coordinated activity of zn transporters and metallothioneins, which regulate the transport, distribution, and storage of zn. there is growing evidence that zn behaves like a signaling molecule, facilitating the transduction of a variety of signaling cascades in response to extracellular stimuli. in this review, we highlight the emerging functional roles of zn and zn transporters in immunity, focusing on how crosstalk between zn and immune - related signaling guides the normal development and function of immune cells.
|
this enzyme deficiency leads to defective metabolism of dietary proteins especially conversion of phenylalanine to tyrosine. increasing phenylalanine is toxic for growing brain and causes disconnection of brain white matter pathways. early diagnosis and ongoing and timely treatment (by restriction of phenylalanine diet) helps normalization of iq (1 - 4). it is observed that children with pku who have high levels of phenylalanine (more than 6.6 milligrams per deciliter) and poor diet control have worse intellectual and functional status compared to those who have suitable diet (5, 6). following the diagnosis, metabolic center staffs program setting should be coordinated by a physician and nutrition expert, and periodic testing of phenylalanine level and evaluation of nutritional status should be done during the life. it is better to evaluate these children weekly within the first year, and then monthly from one to five years old (7). during the first six years it is observed that pkus under diets are lower than normal in terms of cognitive function and iq (8). that is, early and continuous treatment does not necessarily cause normal iq (9 - 11). screening helps provide early diagnosis and timely intervention (7) and it is emphasized that good metabolic control, especially during the first six years of life, is essential for prevention of defects in cognitive function and intelligence (8 - 15). pku screening program in iran was initiated in 2006 and blood samples were taken from all newborns in third to fifth day of birth for the colorimetric screening. and those with phenylalanine as 4 mg / dl or above levels were referred to confirm the diagnosis by hplc testing. then, regular follow - ups are done for those who have phenylalanine levels of equal or more than 4 mg / dl and if the level of phenylalanine levels is 7 mg / dl and more, phenylalanine restriction diet starts (16), dietary supplements of iron, zinc, selenium, carnitine, vitamins and essential fatty acids are prescribed for all children with hpa and pku up to 2 years of age, as the beneficial role of these materials in improvement of intellectual and functional status of these children has been proven (3, 17 - 25). this study compared intelligence and developmental status of children with pku and hpa within the national screening program with normal population in children s medical center in tehran. the study was conducted at children s medical center, a governmental university referral center in tehran, iran during 2014 - 2015. patients with pku detected in national screening program were referred to children s medical center and were recruited in the study if they inclusion and exclusion criteria and their parental informed consent was obtained. control group sampling method was done randomly among children referred to children s medical center for vaccinations or dental procedures as well as the hospital s kindergarten. children of this group were selected similar to case group in terms of age and gender. in this group, inclusion criteria included : - lack of any acute or chronic disease - lack of use of any drug for any disease - lack of special diet exclusion criteria included : - those patients with no diagnosed hpa and pku during neonatal screening - non - classical pku patients - pku and hpa diagnosis was based on screening test in the third to fifth day after birth and its confirmation by hplc. the diet included phenylalanine restriction and early diet started upon diagnosis (i.e. during neonatal period). the developmental status of children 5 years of age and younger in both groups was measured by asq questionnaire. the questions assess five scopes : communication, gross motor, fine motor, personal - social, and problem solving (26). intelligence in children at age 4 and older was measured by wechsler preschool and primary scale of intelligence-3rd edition (wppi-3), a standard and valid iq test. this test consists of 11 subtests, which measure the child s verbal skills and performance. each sub - test assesses the following (27) : - child s knowledge and awareness of the environment (information) - understanding, learning, memory (vocabulary) - cognitive ability (similarities) - the ability to calculate the real, personal and social problems (arithmetic) - child s understanding of events and knowledge of the social environment (comprehension) - familiarity with the term and its application (sentences) - concentration, reasoning, visual attention, visual memory and visual - perceptual organization (picture completion) - spatial orientation (mazes) - the ability of conceptual and visual - motor organization (geometric design) - accuracy and attention (block design) - speed, memory, target attention and concentration (animal house). wechsler intelligence test was conducted for each person (in case or control group) during two 1.5 hour sessions by trained clinical psychology expert. the parents were asked to carefully answer and complete the asq questionnaire. if any questions were not clear enough, they were explained. data analysis was performed by spss software. for quantitative variables, the mean and standard deviation, and for t - test, chi - square and anova were used for testing hypotheses according to the type of data. p - value was considered as significant at < 0.05 in the tests and as significant at < 0.01 in sub - tests. the study was approved by the ethics committee of tehran university of medical sciences (code number : ir.tums.rec.1394.529). overall 46 patients were investigated in case group, 5 of whom were excluded due to the non - classical pku. in control group 50 children were investigated, 10 of whom were excluded due to the acute disease and use of drug. finally, data from 41 patients in case and 41 children in control group was analyzed. in the patient group, 21 (51.2%) were female and 20 (48.8%) were male, and in control group, 25 (61%) were female and 16 (39%) were male (p = 0.3). mean age in patient group was 37.5 20 months and 37.3 19 months in control group (p = 0.9). the differences between two groups in terms of age and gender were not statistically significant. mean level of phenylalanine in the patient group was 4.7 3.1 mg / dl. results of wechsler test for comparison of intelligence for two groups are shown in table 1. significant difference was observed between the two groups in the sub - tests of animal house (p = 0.002), and picture completion (p = 0.004), as well as in total iq score (p = 0.05) and performance iq score (p = 0.005). comparison results of asq to assess the developmental status for two groups are shown in table 2. the purpose of this study was to compare in framework of national screening program the intellectual and developmental status in hpa and pku children with normal population. current study is important because it investigated subtest of intelligence and developmental indexes in a group of pku patients. our hypothesis was that pku and hpa group is lower in terms of intelligence and development compared to the normal population. current study showed that while significant differences were not found between the two groups in developmental indexes based on asq, the total iq score was lower than normal in pku group, and there were significant differences between them (p = 0.05). the performance iq score in pku group showed significant difference with the control group (p = 0.005). in relation with the sub - tests of performance iq, animal house (p = 0.002) and picture completion (p = 0.004) tests showed significant difference between the 2 groups. the total score of verbal iq and its sub - tests showed no significant difference between the two groups. similar studies by other researchers showed a problem in the executive functions in this group of children. sherman and rachael in a cohort study on 13 children with pku, observed some mild defects in executive function. half of these children showed defects in visuospatial skill and they had also a clear cut of the language understanding skills from age 6 to adolescence (4). in the study by leuzzi. all of them were normal in terms of iq score. in order to evaluate executive functions (ef), all pku patients showed lower scores than control group, which included sorting category, problem solving, planning, set shifting, attention and concentration (5). observed that pku patients had significantly lower levels of spatial vision, visual memory, motor function and executive function compared to the control group (8). in a study, 57 children with pku were compared to normal population using wechsler. significant difference was observed in wechsler sub - tests comparison between pku group and normal group in terms of information, picture completion, object assembly, picture arrangement and coding. in other cases, i.e. the similarities, arithmetic, in short, the two groups showed significant differences in performance sub - tests, but they showed no difference in verbal test except for information (9). sajedi. compared problem - solving skills (related to asq) in the early treated pku children with the control group, and showed a significant difference between the two groups regarding developmental indexes (17). in another study by nazi. (18), development of motor skills in 1 - 4 years old iranian children with early treated pku were studied. this study showed that in the area of fine and gross motor, there was a significant difference between the two groups ; the difference was more obvious in the fine motor area. there are some differences in the results of our study on the developmental skills with other studies which may be due to low sample size in our study or possible weaknesses in the related test. small number of subjects is one of the limitations of this study, since it was conducted on children in national screening program referred to children s medical center. it is suggested that future studies will be done on a larger level, for example in the metropolis of tehran to obtain more generalized results. even with early diagnosis and proper diet, some defects are observed in intellectual status such as performance iq score in children with pku and hpa. thus, it is recommended that with implementing screening programs for development and intelligence, timely detection of weaknesses in children with pku is possible and useful medical and educational measures will be provided.
|
background : hyperphenylalaninemia (hpa) and phenylkeonuria (pku) are metabolic errors caused by deficiency of phenylalanine hydroxylase enzyme, which results in increased level of phenylalanine. this increase is toxic to the growing brain. objectives : the purpose of this study was to compare the intellectual and developmental status in hpa and pku children with normal population in national screening program.patients and methods : in a historical cohort study, 41 pku patients who had the inclusion criteria and 41 healthy children were evaluated. wechsler preschool and primary scale of intelligence-3rd edition (wppi-3) was used in order to assess the intellectual status of children 4 years and older and ages and stages questionnaire (asq) was used to assess the developmental status of children 5 years and younger.results:in intellectual test comparison, the two groups showed significant difference in wechsler s performance intelligence score and some performance subscales (p - value 0.05).conclusions : even with early diagnosis and treatment of pku patients, these children show some deficiencies intellectually compared to normal children. this study emphasizes on necessity for screening intellectual and developmental status of pku patients so that effective medical or educational measures can taken in case of deficiencies.
|
germ cell tumors secreting human chorionic gonadotropin (hcg) may lead to incomplete isosexual precocity in boys. germinomas account for approximately two - thirds of germ cell tumors and usually develop in the midline at the pineal and suprasellar regions. ectopic sites most notably the basal ganglia and thalamus when they usually present with gradually progressive hemiparesis and are almost always unilateral. a 9.5-year - old boy presented with enlargement of penis and appearance of pubic hair for 1 year and breaking of voice for 6 months. there was no history suggestive of raised intracranial tension and no history of head trauma, radiation exposure, cranial surgery or seizure. he was the first born child of a non - consanguineous union and had a younger brother who was healthy. he had a normal perinatal and developmental history had no history of any central nervous system infection or androgen exposure and his family history was non - contributory. on examination, his height was 124.4 cm (standard deviation score [sds ] 1.7), weight was 24.8 kg (sds 1.3) and his target height was 156.4 cm (sds 2.9). testes were 5 ml in volume each and were firm, symmetric and without any irregularity. spl was 8 cm and pubic hair was tanner stage 4 [figure 1 ]. examination of other systems including a detailed examination of the nervous system (with fundoscopic examination) revealed no abnormality. external genitalia and pubic hair suggestive of puberty biochemical tests showed an elevated testosterone (637 ng / dl) with prepubertal basal luteinizing hormone (lh) (0.128 miu / ml) and post decapeptyl lh levels (30 min = 0.325 miu / ml and 60 min = 0.334 miu / ml) and a bone age of 12 years. serum -hcg was elevated (22.47 miu / ml ; normal = non - detectable to 5.3 miu / ml) while 17-hydroxyprogesterone was normal (1.96 ng / ml) gadolinium contrast enhanced magnetic resonance imaging (mri) revealed an ill - defined, heterogenous patchy enhancing lesion in bilateral basal ganglia with minimal compression and contralateral diaplacement of the third ventricle [figures 2 and 3 ]. cerebrospinal fluid (csf) -hcg was elevated (47.9 miu / ml ; normal = non - detectable to 5.3 miu / ml) but -fetoprotein was normal (0.02 iu / ml ; normal = 0 - 5.5). the next investigative step entailed a biopsy of the lesion, which could not be done in our institution for logistic reasons. t1w coronal and t2w axial magnetic resonance imaging showing ill - defined, heterogeneous hyperintense lesion in bilateral basal ganglia gd - contrast sagittal magnetic resonance imaging showing heterogeneous patchy uptake in lesion in basal ganglia he was diagnosed to have isosexual precocity due to germ cell tumor involving bilateral basal ganglia, which in all likelihood was a germinoma and was referred to a specialty oncology institute. he received conformal radiotherapy following which serum testosterone dropped down to 137 ng / dl and mri showed a slight decrease in the size of the lesion [figure 4 ]. post - radiotherapy t2w axial magnetic resonance imaging showing slight reduction in lesion the germ cell tumor was most likely a germinoma considering the age group, location, absence of elevated csf -fetoprotein and response to radiotherapy. incomplete isosexual precocity in males may occur due to hcg secretion from intracranial germ cell tumors, which constitutes 2% of primary intracranial neoplasms below 20 years of age. of the non - midline germ cell tumors, those arising within the basal ganglia are most often germinomas. the usual sites of intracranial germinoma are the pineal and suprasellar region and location in the basal ganglia is very rare occurring in only 5 - 10% of cases. a higher incidence of basal ganglia germinoma is seen in asian populations occurring in patients aged 7 - 20 years with a striking male predominance (20:1). the major signs and symptoms include progressive hemiparesis, cognitive decline and psychosis with precocious puberty being a rare, atypical manifestation. signs of raised intracranial pressure are usually not present as these tumors are non - invasive and do not obstruct the ventricular system. the clinical course is usually slow, with the duration of clinical symptoms ranging from 1 month to 4.5 years and diagnosis at an early stage is extremely difficult. in this regard, our patient could be considered lucky as his atypical presentation led to the diagnosis of his condition before more sinister neurologic manifestations could creep in. an early diagnosis in this condition is of prime importance on account of its excellent response to radiotherapy and chemotherapy. there are only a handful of case reports of bilateral basal ganglia germinoma and only a single report of it presenting with precocious puberty in published medical literature. this is only the 2 report of bilateral basal ganglia germinoma presenting with precocious puberty and as providence would have it, his sexual precocity proved to be a blessing in disguise!.
|
germ cell tumors may lead to incomplete isosexual male precocity and are commonly located in the pineal gland. germinomas of the basal ganglia are almost always unilateral and precocious puberty is a rare manifestation in them. we report a 9.5-year - old boy who presented with incomplete isosexual precocity due to bilateral basal ganglia germinoma.
|
super - refractory status epilepticus (srse) is defined as status epilepticus (se) that persists for 24 h or more after the onset of anesthetic therapy. it also includes those scenarios wherein se recurs on the reduction or withdrawal of anesthesia. se has an annual incidence of 1040 per 100,000 populations. as shown by retrospective data, srse occurs in 23%43% of patients with se resulting in high morbidity and mortality rates of up to 30%50%. critical care physicians are frequently exposed to the multiple challenges that present with this emerging clinical problem, and dealing with these patients proves to be a demanding task. since there is a paucity of data attributed to the lack of controlled or randomized studies, management has to be based on a few clinical reports and expert opinions. practical clinical management involves a variety of scenarios which include antiepileptic drug (aed) therapy, application of hypothermia, induction and maintenance of anesthesia, and immunological and physical therapies as well. srse is consistently attributed to a major insult to the brain most commonly in the form of a stroke, central nervous system (cns) infection, or trauma. the genesis can be identified with ease usually from an excellent clinical history, detailed examination, and imaging of the cns. the pathophysiology responsible for the persistence of seizures is attributed to the receptors on the axon surface which are in a dynamic state. during se, there is an intensified receptor trafficking and a reduction in the functional gamma - aminobutyric acid (gaba) receptors in the aberrant neurons. this loss of gaba receptors makes therapy more challenging as gabaergic drugs such as benzodiazepines and barbiturates fail to achieve a good control of the seizures, thereby further prolonging the seizure duration. in addition, mitochondrial failure or insufficiency has also been postulated to be one of the causes for failure of seizure termination. brain barrier in inflammatory cns diseases has also been implicated in the persistence of seizures in srse. no genetic mechanism has yet been identified to explain the failure of seizure termination which is a characteristic of srse. treating clinicians and intensivists must be aware of the fact that recovery of patients with srse even with a duration of up to a few weeks is not uncommon. premature withdrawal of care (supportive or therapeutic) should not be done merely because of the protracted treatment duration. studies by cooper. concluded that although the mortality rate in srse is high, survival with significant functional and cognitive recovery is feasible. the protracted course of this illness alone is not an indication to consider discontinuing treatment. similarly, drislane. commented that unless srse follows anoxia, it should not be considered a hopeless condition. the primary objective of treatment is to control seizures with the intent of preventing occurrence of the initial excitotoxicity. after 24 h of continuous or recurring seizures, excitotoxic processes attributing to cerebral damage would have been initiated. the secondary objective being neuroprotection is an endeavor to impede the progression of the secondary processes which are triggered by the initial excitotoxicity. the third and final objective is the need to avoid or treat the systemic complications caused by the prolonged unconsciousness and anesthesia. it is usual to continue anesthesia for the initial 24 h and then slowly attempts are made to reverse the same if seizures prove to be under control. recurrence of seizures during the weaning phase warrants anesthesia to be reestablished. initiating and weaning of anesthesia the role of anesthesia is largely to obtain a period of burst suppression which will help in receptor remodulation, thus enabling conventional antiepileptic therapy to be effective. anesthesia is usually administered to the level of burst suppression. a physiological target for the titration of anesthetic treatment drug dosing is typically set at a level which intends to produce burst suppression with interburst intervals of 230 s. as mentioned afore, slow weaning from anesthesia is strongly recommended, with a goal to reduce the infusion rate by 25% during the first 12 h of the weaning phase. the most commonly used anesthetic agents are injection midazolam, injection propofol, and injection thiopental. the choice of anesthetic agent is based on the patients hemodynamic profile and the known side effects of the drug. in our center, anesthetic therapy is initiated with injection midazolam (bolus dose of 0.2 mg / kg followed by an infusion of up to 0.4 mg / kg / h) as it achieves good seizure control without significant hemodynamic fluctuations. however, the major drawback of this drug is its tachyphylaxis which commonly develops within 2448 h. this requires the dose to be constantly adjusted to maintain its pharmacotherapeutics action. injection midazolam is most commonly used as a sole agent initially but can be used in combination with injection propofol as well. the availability of an appropriate antidote (injection flumazenil) provides a definite advantage over the other anesthetic drugs. injection propofol (bolus dose : 35 mg / kg ; infusion : 510 mg / kg / h) is the other option as an initial sole agent, or as mentioned earlier, it may be used in combination with injection midazolam as well. it has the added benefit of being easy to use, due to its versatile pharmacokinetic and pharmacodynamic properties. it has a fast onset and offset making it particularly attractive in being easily titratable, thus facilitating a rapid weaning process. the risk of propofol infusion syndrome should be kept in mind, especially in the pediatric population and when used in combination with a ketogenic diet, steroids, or catecholamine infusions which is common in this scenario. it offers a better hemodynamic profile when compared to the conventional pentothal / thiopental infusions. injection thiopental (bolus : 23 mg / kg ; infusion : 35 mg / kg / h) apart from having a strong antiepileptic action also has the added advantage of being neuroprotective. the drawback of this drug is attributed to the zero - order kinetics which results in a long half - life and thus a prolonged recovery time. its strong propensity to cause hypotension and cardiorespiratory depression, frequently requires the use of additional pressor agents. injection ketamine (bolus : 0.54.5 mg / kg ; infusion : up to 5 mg / kg / h) may be a useful adjuvant in the treatment of srse, especially in late stages when medications that rely on gaba enhancement are ineffective. injection ketamine has a 2-fold advantage over other conventional anesthetics : primarily, it is potentially neuroprotective through its n - methyl - d - aspartate (nmda) antagonist action, and secondarily, it does not cause systemic hypotension attributable to the fact that it is not a cardiac depressant. inhalational anesthetics such as isoflurane (0.8%2% end - tidal concentration) and declarant (8%10% end - tidal concentration) have also been experimented with, resulting in moderate success rates as reported in a few case reports and small case series. impediments to their usage include hypotension, atelectasis, infections, paralytic ileus, and deep venous thrombosis. the major limiting factor for the use of inhalational agents remains the need of an anesthesia workstation and vaporizer. a vaporizer that can be integrated into the respiratory circuit, between the y - piece and the patient, known as the anesthetic conserving device (anaconda), has been effectively used to administer inhalational agents in the intensive care unit. a wide range of aeds have been used along with the anesthetic agents to achieve seizure control in patients with srse. a combination therapy with two or three aeds at their maximum doses is initiated and continued through the protracted course of this illness and their therapeutic levels must be adhered to. the allergic potential of each drug and the drug interactions of the aeds should be envisaged and clinically correlated. other troublesome side effects encountered are acute pancreatitis, hepatic or renal failure, especially with intravenous aeds. high - dose intravenous valproate can induce platelet dysfunction, clotting disorders, and severe hyperammonemia in predisposed patients. intravenous magnesium has its distinctive role in the management of srse and is commonly administered even in the absence of evidence of deficiency. the rare and successful use of drugs such as intravenous lidocaine and intravenous paraldehyde have a role to play and have been reported in literature. there has been a single case report where verapamil has been reported to be responsible to have terminated srse in one patient, and this was attributed to it causing an inhibition of p - glycoprotein or other drug transporter processes.. the most effective drug should be chosen, and as the duration of srse increases, it is best to avoid drugs with the gabaergic mechanism. it is rational to use drugs that have a low interaction potential with predictable pharmacokinetics. it is logical to circumvent the use of drugs with probable renal or hepatic toxicity or with allergic potential. the introduction of immunotherapy has been an interesting development in the recent years in the therapy of srse. the rationale is that there was the possibility of an overt immunologic disease in these subjects. the discovery that anti - nmda - receptor antibodies can lead to srse is a proof that antibodies may play a part in the pathogenesis of srse. the other alternative therapy in such scenarios is high - dose methylprednisolone (1 g / day), followed by one or two courses of intravenous immunoglobulins (ivig). in the presence of a positive response, long - term therapy with steroids, ivig, cyclophosphamide, or rituximab is continued. it acts by reducing cerebral metabolism, glutaminergic drive, intracellular calcium overload, and oxidative stress. mild to moderate hypothermia (3235c) is recommended for 2448 h and only as a trial of therapy. if a positive response is found, therapeutic hypothermia is continued for the next 72 h. varied complications associated with therapeutic hypothermia such as acid base and electrolyte disturbances, disseminated intravascular coagulation, thrombosis, infection, cardiac arrhythmia, and paralytic ileus must be prevented and if at all they occur should be promptly recognized and managed. thus, some centers now routinely apply hypothermia to patients with srse the cardiovascular system, coagulation parameters, blood gases, and lactate levels must be monitored diligently. various contrasting nonpharmacological physical therapies such as electroconvulsive therapy, transcranial magnetic stimulation, vagus nerve stimulation, and drainage of the cerebrospinal fluid have been reported with different rates of success. for which is based on the fact that its enhanced fatty acid and restricted carbohydrate contents produce a switch in metabolism from the preferred atp - generating pathway of glycolysis to an intermediary metabolism that results in increased production of ketone bodies, decreased glucose, and increased levels of circulating fatty acids including polyunsaturated fatty acids. these have membrane - stabilizing property through a marked reduction in neuronal excitability by the opening of atp - sensitive potassium channels to cause membrane hyperpolarization and through the acetoacetate - mediated presynaptic release of excitatory neurotransmitters. it is a demanding task for the intensivist to tackle the associated systemic derangements which ensue. risk factors for these systemic complications include : (1) prolonged immobility and risk for pulmonary emboli ; (2) immunosuppression and risk for nosocomial infections ; (3) adverse effects and interactions related to polypharmacy ; (4) prolonged anesthetic coma causing skin breakdown, muscle atrophy, and critical illness polyneuropathy. cardiac complications are common ; most prominent are hypotension, arrhythmias, and systolic dysfunction. sympathetic storm resulting in a neuroendocrine response which alters the homeostatic environment as well the hemodynamic status. examination of vitals commonly reveals tachycardia and initially an increase in the systemic blood pressure attributed to the increase in peripheral vascular resistance. during the protracted course of this illness, the blood pressure will normalize, and after a while, there usually results in a systemic hypotension often requiring the use of vasopressors. hypotension may result from the cardiovascular depressant effects of the anesthetic agent and is particularly problematic with the inhaled anesthetics, barbiturates, and propanol. it may also occur from hypovolemia, sepsis, or less commonly result from adrenergically driven systolic dysfunction. rarely, these patients can present with low ejection states due to the neurogenic stunned myocardium or takotsubo cardiomyopathy, both being reversible, but requiring meticulous supportive management. the most notorious is neurogenic pulmonary edema which results due to the sympathetic surge of catecholamines. the picture is that similar to adult respiratory distress syndrome (ards) with reduced lung compliance and difficulty in maintaining oxygenation and ventilation. all these result in reduced oxygenation which contributes to further deterioration of an already at risk brain. other frequently encountered complications are ards, atelectasis, and mucus plugging resulting in respiratory acidosis and hypoxemia. a coexisting metabolic acidosis is also found associated with the rhabdomyolysis seen in srse. 85%100% incidence of tracheostomy is reported in srse due to the need for prolonged mechanical ventilation. hematological complications noted in this population include deep venous thrombosis, pulmonary embolism, drug - induced thrombocytopenia, and anemia secondary to malnutrition as well as drug - induced bone marrow suppression. ileus may be severe, and in some cases, it is refractory to medical measures, necessitating a colostomy. there have also been reports of drug - induced hepatitis and pseudomembranous colitis as well. malabsorption and the ensuing malnutrition lead to hypoalbuminemia and anasarca. in spite of the best preventive efforts, such as a good glycemic control and appropriate management of hypoalbuminemia, it is reported that 10%20% of patients may develop critical illness polyneuropathy and critical illness myopathy. furthermore, as a result of continued seizure activity, the musculoskeletal system is affected resulting in conversion to anaerobic metabolism contributing to lactic acidosis and in rare scenarios, rhabdomyolysis. the immune system is also compromised due to multiple factors such as malnutrition, bone marrow suppression, drug - induced leukopenia, and hypothermia. this presents commonly as urinary tract infections (most commonly candiduria), pneumonia, sepsis, and septic shock. last but not the least of our concerns are the skin changes which range from decubitus ulcers to drug - induced rashes and even more serious complications such as steven as the seizure progresses, the body 's core temperature also increases contributing to the ongoing neurological insult. routine screening of patients for precursors of injury such as serum lactate, creatine kinase, and cardiac troponin is warranted. routine arterial blood gas and chest x - ray will also help the intensivist in early detection and management of complications. meticulous attention to the medical complications of se is indispensable and may lead to improved outcomes. thus, even though this complex condition starts as a neurological disorder, because of the associated systemic complications, it can be considered as a multisystem disorder requiring scrupulous attention and deliberate efforts to prevent, detect, and treat these systemic effects. a good recovery can occur even after prolonged and severe srse, and the intensivist has to ensure that premature withdrawal of care is not deliberated. therapy should simultaneously also focus on the appropriate management of the underlying cause of the srse as well. we emphasize that a good outcome is highly dependent on the accurate and prompt treatment of the srse as well as the associated aforementioned systemic complications. treating clinicians and intensivists must be aware of the fact that recovery of patients with srse even with a duration of up to a few weeks is not uncommon. premature withdrawal of care (supportive or therapeutic) should not be done merely because of the protracted treatment duration. studies by cooper. concluded that although the mortality rate in srse is high, survival with significant functional and cognitive recovery is feasible. the protracted course of this illness alone is not an indication to consider discontinuing treatment. similarly, drislane. commented that unless srse follows anoxia, it should not be considered a hopeless condition. the primary objective of treatment is to control seizures with the intent of preventing occurrence of the initial excitotoxicity. after 24 h of continuous or recurring seizures, excitotoxic processes attributing to cerebral damage would have been initiated. the secondary objective being neuroprotection is an endeavor to impede the progression of the secondary processes which are triggered by the initial excitotoxicity. the third and final objective is the need to avoid or treat the systemic complications caused by the prolonged unconsciousness and anesthesia. it is usual to continue anesthesia for the initial 24 h and then slowly attempts are made to reverse the same if seizures prove to be under control. recurrence of seizures during the weaning phase warrants anesthesia to be reestablished. initiating and weaning of anesthesia the role of anesthesia is largely to obtain a period of burst suppression which will help in receptor remodulation, thus enabling conventional antiepileptic therapy to be effective. anesthesia is usually administered to the level of burst suppression. a physiological target for the titration of anesthetic treatment drug dosing is typically set at a level which intends to produce burst suppression with interburst intervals of 230 s. as mentioned afore, slow weaning from anesthesia is strongly recommended, with a goal to reduce the infusion rate by 25% during the first 12 h of the weaning phase. the most commonly used anesthetic agents are injection midazolam, injection propofol, and injection thiopental. the choice of anesthetic agent is based on the patients hemodynamic profile and the known side effects of the drug. in our center, anesthetic therapy is initiated with injection midazolam (bolus dose of 0.2 mg / kg followed by an infusion of up to 0.4 mg / kg / h) as it achieves good seizure control without significant hemodynamic fluctuations. however, the major drawback of this drug is its tachyphylaxis which commonly develops within 2448 h. this requires the dose to be constantly adjusted to maintain its pharmacotherapeutics action. injection midazolam is most commonly used as a sole agent initially but can be used in combination with injection propofol as well. the availability of an appropriate antidote (injection flumazenil) provides a definite advantage over the other anesthetic drugs. injection propofol (bolus dose : 35 mg / kg ; infusion : 510 mg / kg / h) is the other option as an initial sole agent, or as mentioned earlier, it may be used in combination with injection midazolam as well. it has the added benefit of being easy to use, due to its versatile pharmacokinetic and pharmacodynamic properties. it has a fast onset and offset making it particularly attractive in being easily titratable, thus facilitating a rapid weaning process. the risk of propofol infusion syndrome should be kept in mind, especially in the pediatric population and when used in combination with a ketogenic diet, steroids, or catecholamine infusions which is common in this scenario. it offers a better hemodynamic profile when compared to the conventional pentothal / thiopental infusions. injection thiopental (bolus : 23 mg / kg ; infusion : 35 mg / kg / h) apart from having a strong antiepileptic action also has the added advantage of being neuroprotective. the drawback of this drug is attributed to the zero - order kinetics which results in a long half - life and thus a prolonged recovery time. its strong propensity to cause hypotension and cardiorespiratory depression, frequently requires the use of additional pressor agents. injection ketamine (bolus : 0.54.5 mg / kg ; infusion : up to 5 mg / kg / h) may be a useful adjuvant in the treatment of srse, especially in late stages when medications that rely on gaba enhancement are ineffective. injection ketamine has a 2-fold advantage over other conventional anesthetics : primarily, it is potentially neuroprotective through its n - methyl - d - aspartate (nmda) antagonist action, and secondarily, it does not cause systemic hypotension attributable to the fact that it is not a cardiac depressant. inhalational anesthetics such as isoflurane (0.8%2% end - tidal concentration) and declarant (8%10% end - tidal concentration) have also been experimented with, resulting in moderate success rates as reported in a few case reports and small case series. impediments to their usage include hypotension, atelectasis, infections, paralytic ileus, and deep venous thrombosis. the major limiting factor for the use of inhalational agents remains the need of an anesthesia workstation and vaporizer. a vaporizer that can be integrated into the respiratory circuit, between the y - piece and the patient, known as the anesthetic conserving device (anaconda), has been effectively used to administer inhalational agents in the intensive care unit. a wide range of aeds have been used along with the anesthetic agents to achieve seizure control in patients with srse. a combination therapy with two or three aeds at their maximum doses is initiated and continued through the protracted course of this illness and their therapeutic levels must be adhered to. the allergic potential of each drug and the drug interactions of the aeds should be envisaged and clinically correlated. other troublesome side effects encountered are acute pancreatitis, hepatic or renal failure, especially with intravenous aeds. high - dose intravenous valproate can induce platelet dysfunction, clotting disorders, and severe hyperammonemia in predisposed patients. intravenous magnesium has its distinctive role in the management of srse and is commonly administered even in the absence of evidence of deficiency. the rare and successful use of drugs such as intravenous lidocaine and intravenous paraldehyde have a role to play and have been reported in literature. there has been a single case report where verapamil has been reported to be responsible to have terminated srse in one patient, and this was attributed to it causing an inhibition of p - glycoprotein or other drug transporter processes. the most effective drug should be chosen, and as the duration of srse increases, it is best to avoid drugs with the gabaergic mechanism. it is rational to use drugs that have a low interaction potential with predictable pharmacokinetics. it is logical to circumvent the use of drugs with probable renal or hepatic toxicity or with allergic potential. the introduction of immunotherapy has been an interesting development in the recent years in the therapy of srse. the rationale is that there was the possibility of an overt immunologic disease in these subjects. the discovery that anti - nmda - receptor antibodies can lead to srse is a proof that antibodies may play a part in the pathogenesis of srse. the other alternative therapy in such scenarios is high - dose methylprednisolone (1 g / day), followed by one or two courses of intravenous immunoglobulins (ivig). in the presence of a positive response, long - term therapy with steroids, ivig, cyclophosphamide, or rituximab is continued. it acts by reducing cerebral metabolism, glutaminergic drive, intracellular calcium overload, and oxidative stress. mild to moderate hypothermia (3235c) is recommended for 2448 h and only as a trial of therapy. if a positive response is found, therapeutic hypothermia is continued for the next 72 h. varied complications associated with therapeutic hypothermia such as acid base and electrolyte disturbances, disseminated intravascular coagulation, thrombosis, infection, cardiac arrhythmia, and paralytic ileus must be prevented and if at all they occur should be promptly recognized and managed. thus, some centers now routinely apply hypothermia to patients with srse the cardiovascular system, coagulation parameters, blood gases, and lactate levels must be monitored diligently. various contrasting nonpharmacological physical therapies such as electroconvulsive therapy, transcranial magnetic stimulation, vagus nerve stimulation, and drainage of the cerebrospinal fluid have been reported with different rates of success. for which is based on the fact that its enhanced fatty acid and restricted carbohydrate contents produce a switch in metabolism from the preferred atp - generating pathway of glycolysis to an intermediary metabolism that results in increased production of ketone bodies, decreased glucose, and increased levels of circulating fatty acids including polyunsaturated fatty acids. these have membrane - stabilizing property through a marked reduction in neuronal excitability by the opening of atp - sensitive potassium channels to cause membrane hyperpolarization and through the acetoacetate - mediated presynaptic release of excitatory neurotransmitters. it is a demanding task for the intensivist to tackle the associated systemic derangements which ensue. risk factors for these systemic complications include : (1) prolonged immobility and risk for pulmonary emboli ; (2) immunosuppression and risk for nosocomial infections ; (3) adverse effects and interactions related to polypharmacy ; (4) prolonged anesthetic coma causing skin breakdown, muscle atrophy, and critical illness polyneuropathy. cardiac complications are common ; most prominent are hypotension, arrhythmias, and systolic dysfunction. sympathetic storm resulting in a neuroendocrine response which alters the homeostatic environment as well the hemodynamic status. examination of vitals commonly reveals tachycardia and initially an increase in the systemic blood pressure attributed to the increase in peripheral vascular resistance. during the protracted course of this illness, the blood pressure will normalize, and after a while, there usually results in a systemic hypotension often requiring the use of vasopressors. hypotension may result from the cardiovascular depressant effects of the anesthetic agent and is particularly problematic with the inhaled anesthetics, barbiturates, and propanol. it may also occur from hypovolemia, sepsis, or less commonly result from adrenergically driven systolic dysfunction. rarely, these patients can present with low ejection states due to the neurogenic stunned myocardium or takotsubo cardiomyopathy, both being reversible, but requiring meticulous supportive management. the most notorious is neurogenic pulmonary edema which results due to the sympathetic surge of catecholamines. the picture is that similar to adult respiratory distress syndrome (ards) with reduced lung compliance and difficulty in maintaining oxygenation and ventilation. all these result in reduced oxygenation which contributes to further deterioration of an already at risk brain. other frequently encountered complications are ards, atelectasis, and mucus plugging resulting in respiratory acidosis and hypoxemia. 85%100% incidence of tracheostomy is reported in srse due to the need for prolonged mechanical ventilation. hematological complications noted in this population include deep venous thrombosis, pulmonary embolism, drug - induced thrombocytopenia, and anemia secondary to malnutrition as well as drug - induced bone marrow suppression. ileus may be severe, and in some cases, it is refractory to medical measures, necessitating a colostomy. there have also been reports of drug - induced hepatitis and pseudomembranous colitis as well. malabsorption and the ensuing malnutrition lead to hypoalbuminemia and anasarca. in spite of the best preventive efforts, such as a good glycemic control and appropriate management of hypoalbuminemia, it is reported that 10%20% of patients may develop critical illness polyneuropathy and critical illness myopathy. furthermore, as a result of continued seizure activity, the musculoskeletal system is affected resulting in conversion to anaerobic metabolism contributing to lactic acidosis and in rare scenarios, rhabdomyolysis. the immune system is also compromised due to multiple factors such as malnutrition, bone marrow suppression, drug - induced leukopenia, and hypothermia. this presents commonly as urinary tract infections (most commonly candiduria), pneumonia, sepsis, and septic shock. last but not the least of our concerns are the skin changes which range from decubitus ulcers to drug - induced rashes and even more serious complications such as steven as the seizure progresses, the body 's core temperature also increases contributing to the ongoing neurological insult. routine screening of patients for precursors of injury such as serum lactate, creatine kinase, and cardiac troponin is warranted. routine arterial blood gas and chest x - ray will also help the intensivist in early detection and management of complications. meticulous attention to the medical complications of se is indispensable and may lead to improved outcomes. thus, even though this complex condition starts as a neurological disorder, because of the associated systemic complications, it can be considered as a multisystem disorder requiring scrupulous attention and deliberate efforts to prevent, detect, and treat these systemic effects. a good recovery can occur even after prolonged and severe srse, and the intensivist has to ensure that premature withdrawal of care is not deliberated. therapy should simultaneously also focus on the appropriate management of the underlying cause of the srse as well. we emphasize that a good outcome is highly dependent on the accurate and prompt treatment of the srse as well as the associated aforementioned systemic complications. treating clinicians and intensivists must be aware of the fact that recovery of patients with srse even with a duration of up to a few weeks is not uncommon. premature withdrawal of care (supportive or therapeutic) should not be done merely because of the protracted treatment duration. studies by cooper. concluded that although the mortality rate in srse is high, survival with significant functional and cognitive recovery is feasible. the protracted course of this illness alone is not an indication to consider discontinuing treatment. similarly, drislane. commented that unless srse follows anoxia, it should not be considered a hopeless condition. the primary objective of treatment is to control seizures with the intent of preventing occurrence of the initial excitotoxicity. after 24 h of continuous or recurring seizures, excitotoxic processes attributing to cerebral damage would have been initiated. the secondary objective being neuroprotection is an endeavor to impede the progression of the secondary processes which are triggered by the initial excitotoxicity. the third and final objective is the need to avoid or treat the systemic complications caused by the prolonged unconsciousness and anesthesia. it is usual to continue anesthesia for the initial 24 h and then slowly attempts are made to reverse the same if seizures prove to be under control. recurrence of seizures during the weaning phase warrants anesthesia to be reestablished. initiating and weaning of anesthesia the role of anesthesia is largely to obtain a period of burst suppression which will help in receptor remodulation, thus enabling conventional antiepileptic therapy to be effective. anesthesia is usually administered to the level of burst suppression. a physiological target for the titration of anesthetic treatment drug dosing is typically set at a level which intends to produce burst suppression with interburst intervals of 230 s. as mentioned afore, slow weaning from anesthesia is strongly recommended, with a goal to reduce the infusion rate by 25% during the first 12 h of the weaning phase. the most commonly used anesthetic agents are injection midazolam, injection propofol, and injection thiopental. the choice of anesthetic agent is based on the patients hemodynamic profile and the known side effects of the drug. in our center, anesthetic therapy is initiated with injection midazolam (bolus dose of 0.2 mg / kg followed by an infusion of up to 0.4 mg / kg / h) as it achieves good seizure control without significant hemodynamic fluctuations. however, the major drawback of this drug is its tachyphylaxis which commonly develops within 2448 h. this requires the dose to be constantly adjusted to maintain its pharmacotherapeutics action. injection midazolam is most commonly used as a sole agent initially but can be used in combination with injection propofol as well. the availability of an appropriate antidote (injection flumazenil) provides a definite advantage over the other anesthetic drugs. injection propofol (bolus dose : 35 mg / kg ; infusion : 510 mg / kg / h) is the other option as an initial sole agent, or as mentioned earlier, it may be used in combination with injection midazolam as well. it has the added benefit of being easy to use, due to its versatile pharmacokinetic and pharmacodynamic properties. it has a fast onset and offset making it particularly attractive in being easily titratable, thus facilitating a rapid weaning process. the risk of propofol infusion syndrome should be kept in mind, especially in the pediatric population and when used in combination with a ketogenic diet, steroids, or catecholamine infusions which is common in this scenario. it offers a better hemodynamic profile when compared to the conventional pentothal / thiopental infusions. injection thiopental (bolus : 23 mg / kg ; infusion : 35 mg / kg / h) apart from having a strong antiepileptic action also has the added advantage of being neuroprotective. the drawback of this drug is attributed to the zero - order kinetics which results in a long half - life and thus a prolonged recovery time. its strong propensity to cause hypotension and cardiorespiratory depression, frequently requires the use of additional pressor agents. injection ketamine (bolus : 0.54.5 mg / kg ; infusion : up to 5 mg / kg / h) may be a useful adjuvant in the treatment of srse, especially in late stages when medications that rely on gaba enhancement are ineffective. injection ketamine has a 2-fold advantage over other conventional anesthetics : primarily, it is potentially neuroprotective through its n - methyl - d - aspartate (nmda) antagonist action, and secondarily, it does not cause systemic hypotension attributable to the fact that it is not a cardiac depressant. inhalational anesthetics such as isoflurane (0.8%2% end - tidal concentration) and declarant (8%10% end - tidal concentration) have also been experimented with, resulting in moderate success rates as reported in a few case reports and small case series. impediments to their usage include hypotension, atelectasis, infections, paralytic ileus, and deep venous thrombosis. the major limiting factor for the use of inhalational agents remains the need of an anesthesia workstation and vaporizer. a vaporizer that can be integrated into the respiratory circuit, between the y - piece and the patient, known as the anesthetic conserving device (anaconda), has been effectively used to administer inhalational agents in the intensive care unit. a wide range of aeds have been used along with the anesthetic agents to achieve seizure control in patients with srse. a combination therapy with two or three aeds at their maximum doses is initiated and continued through the protracted course of this illness and their therapeutic levels must be adhered to. the allergic potential of each drug and the drug interactions of the aeds should be envisaged and clinically correlated. other troublesome side effects encountered are acute pancreatitis, hepatic or renal failure, especially with intravenous aeds. high - dose intravenous valproate can induce platelet dysfunction, clotting disorders, and severe hyperammonemia in predisposed patients. intravenous magnesium has its distinctive role in the management of srse and is commonly administered even in the absence of evidence of deficiency. the rare and successful use of drugs such as intravenous lidocaine and intravenous paraldehyde have a role to play and have been reported in literature. there has been a single case report where verapamil has been reported to be responsible to have terminated srse in one patient, and this was attributed to it causing an inhibition of p - glycoprotein or other drug transporter processes. the most effective drug should be chosen, and as the duration of srse increases, it is best to avoid drugs with the gabaergic mechanism. it is rational to use drugs that have a low interaction potential with predictable pharmacokinetics. it is logical to circumvent the use of drugs with probable renal or hepatic toxicity or with allergic potential. the introduction of immunotherapy has been an interesting development in the recent years in the therapy of srse. the rationale is that there was the possibility of an overt immunologic disease in these subjects. the discovery that anti - nmda - receptor antibodies can lead to srse is a proof that antibodies may play a part in the pathogenesis of srse. the other alternative therapy in such scenarios is high - dose methylprednisolone (1 g / day), followed by one or two courses of intravenous immunoglobulins (ivig). in the presence of a positive response, long - term therapy with steroids, ivig, cyclophosphamide, or rituximab is continued. it acts by reducing cerebral metabolism, glutaminergic drive, intracellular calcium overload, and oxidative stress. mild to moderate hypothermia (3235c) is recommended for 2448 h and only as a trial of therapy. if a positive response is found, therapeutic hypothermia is continued for the next 72 h. varied complications associated with therapeutic hypothermia such as acid base and electrolyte disturbances, disseminated intravascular coagulation, thrombosis, infection, cardiac arrhythmia, and paralytic ileus must be prevented and if at all they occur should be promptly recognized and managed. thus, some centers now routinely apply hypothermia to patients with srse the cardiovascular system, coagulation parameters, blood gases, and lactate levels must be monitored diligently. various contrasting nonpharmacological physical therapies such as electroconvulsive therapy, transcranial magnetic stimulation, vagus nerve stimulation, and drainage of the cerebrospinal fluid have been reported with different rates of success. for which is based on the fact that its enhanced fatty acid and restricted carbohydrate contents produce a switch in metabolism from the preferred atp - generating pathway of glycolysis to an intermediary metabolism that results in increased production of ketone bodies, decreased glucose, and increased levels of circulating fatty acids including polyunsaturated fatty acids. these have membrane - stabilizing property through a marked reduction in neuronal excitability by the opening of atp - sensitive potassium channels to cause membrane hyperpolarization and through the acetoacetate - mediated presynaptic release of excitatory neurotransmitters. it is a demanding task for the intensivist to tackle the associated systemic derangements which ensue. risk factors for these systemic complications include : (1) prolonged immobility and risk for pulmonary emboli ; (2) immunosuppression and risk for nosocomial infections ; (3) adverse effects and interactions related to polypharmacy ; (4) prolonged anesthetic coma causing skin breakdown, muscle atrophy, and critical illness polyneuropathy. cardiac complications are common ; most prominent are hypotension, arrhythmias, and systolic dysfunction. sympathetic storm resulting in a neuroendocrine response which alters the homeostatic environment as well the hemodynamic status. examination of vitals commonly reveals tachycardia and initially an increase in the systemic blood pressure attributed to the increase in peripheral vascular resistance. during the protracted course of this illness, the blood pressure will normalize, and after a while, there usually results in a systemic hypotension often requiring the use of vasopressors. hypotension may result from the cardiovascular depressant effects of the anesthetic agent and is particularly problematic with the inhaled anesthetics, barbiturates, and propanol. it may also occur from hypovolemia, sepsis, or less commonly result from adrenergically driven systolic dysfunction. rarely, these patients can present with low ejection states due to the neurogenic stunned myocardium or takotsubo cardiomyopathy, both being reversible, but requiring meticulous supportive management. the most notorious is neurogenic pulmonary edema which results due to the sympathetic surge of catecholamines. the picture is that similar to adult respiratory distress syndrome (ards) with reduced lung compliance and difficulty in maintaining oxygenation and ventilation. all these result in reduced oxygenation which contributes to further deterioration of an already at risk brain. other frequently encountered complications are ards, atelectasis, and mucus plugging resulting in respiratory acidosis and hypoxemia. a coexisting metabolic acidosis is also found associated with the rhabdomyolysis seen in srse. 85%100% incidence of tracheostomy is reported in srse due to the need for prolonged mechanical ventilation. hematological complications noted in this population include deep venous thrombosis, pulmonary embolism, drug - induced thrombocytopenia, and anemia secondary to malnutrition as well as drug - induced bone marrow suppression. ileus may be severe, and in some cases, it is refractory to medical measures, necessitating a colostomy. there have also been reports of drug - induced hepatitis and pseudomembranous colitis as well. malabsorption and the ensuing malnutrition lead to hypoalbuminemia and anasarca. in spite of the best preventive efforts, such as a good glycemic control and appropriate management of hypoalbuminemia, it is reported that 10%20% of patients may develop critical illness polyneuropathy and critical illness myopathy. furthermore, as a result of continued seizure activity, the musculoskeletal system is affected resulting in conversion to anaerobic metabolism contributing to lactic acidosis and in rare scenarios, rhabdomyolysis. the immune system is also compromised due to multiple factors such as malnutrition, bone marrow suppression, drug - induced leukopenia, and hypothermia. this presents commonly as urinary tract infections (most commonly candiduria), pneumonia, sepsis, and septic shock. last but not the least of our concerns are the skin changes which range from decubitus ulcers to drug - induced rashes and even more serious complications such as steven as the seizure progresses, the body 's core temperature also increases contributing to the ongoing neurological insult. routine screening of patients for precursors of injury such as serum lactate, creatine kinase, and cardiac troponin is warranted. routine arterial blood gas and chest x - ray will also help the intensivist in early detection and management of complications. meticulous attention to the medical complications of se is indispensable and may lead to improved outcomes. thus, even though this complex condition starts as a neurological disorder, because of the associated systemic complications, it can be considered as a multisystem disorder requiring scrupulous attention and deliberate efforts to prevent, detect, and treat these systemic effects. a good recovery can occur even after prolonged and severe srse, and the intensivist has to ensure that premature withdrawal of care is not deliberated. therapy should simultaneously also focus on the appropriate management of the underlying cause of the srse as well. we emphasize that a good outcome is highly dependent on the accurate and prompt treatment of the srse as well as the associated aforementioned systemic complications.
|
super - refractory status epilepticus (srse) is defined as status epilepticus (se) that continues or recurs 24 h or more after the onset of anesthetic therapy, including those cases where se recurs on the reduction or withdrawal of anesthesia. although srse is a rare clinical problem, it is associated with high mortality and morbidity rates. this article reviews the treatment approaches and the systemic complications commonly encountered in patients with srse. as evident in our search of literature, therapy for srse and its complications have been based on clinical reports and expert opinions since there is a lack of controlled and randomized trials. even though this complex condition starts as a neurological disorder, because of the associated systemic complications, it can be considered as a multisystem disorder requiring scrupulous attention and deliberate efforts to prevent, detect, and treat these systemic effects. we have critically reviewed the intensive care management for srse per se as well as its associated systemic complications. we believe that a good recovery can occur even after prolonged and severe srse as long as the systemic complications are detected early and managed appropriately.
|
nursing homes represent the largest institutional level in norway, with about 40,000 beds, comprising about 14% of norwegian citizens aged 80 years and over.1 nursing home patients commonly suffer from complex health problems leading to polypharmacy. the complexity of drug therapy for these patients and age - related changes in pharmacokinetics and pharmacodynamics increase the risk of drug - related problems (drps) and make appropriate drug prescribing challenging. although qualified nursing staff is available at all hours, medical care in nursing homes is most commonly provided by part - time engaged general practitioners. research suggests a need for improved medication management in nursing homes.2,3 inappropriate prescribing is associated with increased morbidity, hospitalization, and mortality4,5 and has important economical implications. in the united states and australia, quality of care for the elderly has been studied extensively, and managed care programs involving clinical pharmacists have been implemented in primary care. in europe, medication reviews in nursing homes by pharmacists are promising but not conclusive, and only few studies have had a multidisciplinary approach.610 multidisciplinary team interventions including clinical pharmacists are effective to resolve drps in hospital settings,11 and a similar approach is expected to improve the quality of drug therapy in nursing homes. the objective of this study was to examine the effect of systematic medication reviews conducted by multidisciplinary nursing home teams on prescribing quality and to evaluate if drug therapy changes were maintained over time. a clinical pharmacist (author md) prospectively recruited patients from one nursing home in oslo, norway, during a 1.5-year period from 2005 to 2007. in total, the nursing home comprised 127 beds on five different wards. patients were enrolled ward by ward, but due to shortage of nursing staff, we were unable to include 34 patients from one of the wards. based on drug charts and medical records, the clinical pharmacist retrieved the following information for each patient : age, gender, all regular medications (brand name, formulation, strength, and dose), active medical conditions, and relevant laboratory tests (eg, glomerular filtration rate). the drugs were classified according to the anatomical therapeutic chemical (atc) classification system.12 the study was reported to the regional committee for medical and health research ethics, who presented no objection regarding the study design but concluded that committee clearance was not required. they regarded the project as quality improvement of medical care, implying that it was not necessary to obtain informed consent from the study participants. however, an information letter was sent to all patients and to patients next of kin if the patients were diagnosed with dementia. the clinical pharmacist reviewed patients drug list to identify drps, taking into account individual clinical characteristics. norwegian drug therapy guidelines and a drug drug interaction database were used as tools.13,14 a drp was defined according to the pharmaceutical care network europe : an event or circumstance involving drug therapy that actually or potentially interferes with desired health outcomes.15 the identified drps were classified according to a slightly modified norwegian classification system.16 nine drp categories were applied : 1) treatment without clear indication, 2) inappropriate drug, 3) need for additional drug, 4) too high dose, 5) too low dose, 6) suboptimal dosing time or formulation, 7) adverse drug reactions (only those that are unavoidable and show symptoms are included), 8) lack of monitoring, and 9) drug drug interaction. these drps are all potential causes of unfavorable clinical outcomes. although classified as drps in many studies, in this study, preventable adverse events (ades) or therapeutic failure were regarded to be symptoms of the underlying causes ; therefore, ade is not included as a separate category in the drp registration. the identified drps were discussed with the physician and nurses in charge at regular multidisciplinary case conferences, and drug therapy changes were suggested. the nursing home physician held the final decision whether drug therapy changes should be performed or not. after 3 months, the patients drug charts were reviewed again by the clinical pharmacist to evaluate if drug therapy changes were maintained. the change in number of drps was used as a measure of improvement in prescribing quality. changes in numbers of drugs used and numbers of drps before and 3 months after the multidisciplinary case conferences were analyzed by wilcoxon signed rank test. a clinical pharmacist (author md) prospectively recruited patients from one nursing home in oslo, norway, during a 1.5-year period from 2005 to 2007. in total, the nursing home comprised 127 beds on five different wards. patients were enrolled ward by ward, but due to shortage of nursing staff, we were unable to include 34 patients from one of the wards. based on drug charts and medical records, the clinical pharmacist retrieved the following information for each patient : age, gender, all regular medications (brand name, formulation, strength, and dose), active medical conditions, and relevant laboratory tests (eg, glomerular filtration rate). the drugs were classified according to the anatomical therapeutic chemical (atc) classification system.12 the study was reported to the regional committee for medical and health research ethics, who presented no objection regarding the study design but concluded that committee clearance was not required. they regarded the project as quality improvement of medical care, implying that it was not necessary to obtain informed consent from the study participants. however, an information letter was sent to all patients and to patients next of kin if the patients were diagnosed with dementia. the clinical pharmacist reviewed patients drug list to identify drps, taking into account individual clinical characteristics. norwegian drug therapy guidelines and a drug drug interaction database were used as tools.13,14 a drp was defined according to the pharmaceutical care network europe : an event or circumstance involving drug therapy that actually or potentially interferes with desired health outcomes.15 the identified drps were classified according to a slightly modified norwegian classification system.16 nine drp categories were applied : 1) treatment without clear indication, 2) inappropriate drug, 3) need for additional drug, 4) too high dose, 5) too low dose, 6) suboptimal dosing time or formulation, 7) adverse drug reactions (only those that are unavoidable and show symptoms are included), 8) lack of monitoring, and 9) drug drug interaction. although classified as drps in many studies, in this study, preventable adverse events (ades) or therapeutic failure were regarded to be symptoms of the underlying causes ; therefore, ade is not included as a separate category in the drp registration. the identified drps were discussed with the physician and nurses in charge at regular multidisciplinary case conferences, and drug therapy changes were suggested. the nursing home physician held the final decision whether drug therapy changes should be performed or not. after 3 months, the patients drug charts were reviewed again by the clinical pharmacist to evaluate if drug therapy changes were maintained. the change in number of drps was used as a measure of improvement in prescribing quality. changes in numbers of drugs used and numbers of drps before and 3 months after the multidisciplinary case conferences were analyzed by wilcoxon signed rank test. women comprised 89% of the population and mean age was 87 years (sd, 8.3 ; range, 52102). the most commonly used drugs were analgesics (atc groups n02 and m01), which were used by 70% of the patients, laxatives (atc group a06a) (67%), antidepressants (atc group n06a) (46%), loop diuretics (atc group c03c) (42%), and antithrombotic drugs (atc group b01) (46%). the number of drps per patient ranged from 0 to 7 (average, 2.5 drps / patient). after discussion with the multidisciplinary teams, 151 drug therapy changes were performed in 73 patients. table 1 shows that the most commonly acknowledged drps were drug treatment without a clear indication, inappropriate drug choice, and drug drug interaction. eighty - five (91%) patients were eligible for follow - up after 3 months. seven patients had died and one was hospitalized, and, therefore, nine drug therapy changes performed in these patients were not available for follow - up. altogether, 133 (88%) of the changes performed after multidisciplinary case conferences were maintained after 3 months. of the 234 drps discussed, 151 (65%) were acted upon. for the remaining drps, suboptimal dosing time or formulation, too high dose, and need for additional drug were the drps that most frequently led to drug therapy changes (table 2). on the other hand, drug discontinuation (44% of all drug therapy changes) and dose adjustment (32%) were the most common changes. three months after intervention, the average number of drugs used per patient had decreased from 7.4 (sd = 3.3) to 6.8 (sd = 3.5), p < 0.01, while the number of drps per patient had decreased from 2.52 (sd = 1.7) to 1.05 (sd = 1.4), p < 0.01. in the present study, drps were identified in nearly 90% of the patients. following multidisciplinary case conferences, the average numbers of drps were significantly reduced by 60% from 2.6 to 1.3. moreover, almost 90% of the changes were maintained after 3 months. these results indicate that medication reviews conducted by multidisciplinary teams are effective to improve the quality of drug treatment in nursing home patients. to our knowledge, only a few studies using a comparable multidisciplinary model in nursing homes have previously been conducted (ie, two dutch studies,17,18 one swedish study,19 one australian study,8 and two norwegian studies).9,10 all these studies have shown a positive effect of this model on drug prescribing quality. two studies used the medication appropriateness index (mai) to measure quality.8,18 stuijt demonstrated an improvement in mean summed mai from 23.7 before intervention to 16.0 after the intervention period (p = 0.013), while crotty showed a change in the mai with 4.1 in the intervention group compared to 0.4 in the control group (p < 0.001). in one of the other studies, a reduction of 1.7 problems per patient was shown,17 which is comparable to our study. in line with our findings, this latter study also demonstrated a reduction in the overall drug use.17 reduced drug use is probably an indicator of medication quality in this aging population, and it also implies substantially reduced costs for the nursing homes over time. in our study, systematic medication reviews by a clinical pharmacist followed by face - to - face multidisciplinary case conferences were used to identify and resolve drps in a nursing home. verrue performed a systematic review on pharmacists interventions for the optimization of drug use and found mixed evidence for the effectiveness in the nursing home setting.20 one reason could be that in most studies, the pharmacist interventions have been in written form, that is, do not imply a direct communication with prescribers.7,2123 in the united states, legislation demands monthly medication reviews (written comments) in nursing homes,24,25 and although clinical pharmacy services in the united states nursing homes have proven to reduce morbidity and mortality, drps are often reported in nursing homes.26 this is the reason why a new model implementing direct communication between professions has been suggested in the united states : the fleetwood model of pharmaceutical care.25 our f indings support that direct communication between pharmacists and physicians is useful to obtain attention for drps and also accept for drug therapy changes in nursing homes. our study revealed drps in a large majority of nursing home patients (88%), which is in accordance with previous studies.2,5 moreover, in line with previous studies, we found lack of indication to be the most common drp.1719 the high prevalence of this type of problem could be due to administrative system errors, for example lack of transmission of information when a patient moves into the nursing home, incomplete medical records, or suboptimal systems for monitoring of drug therapy. these are changes that also have the potential to provide negative clinical outcomes for the patients. however, the fact that almost 90% of the changes were maintained after 3 months suggests the opposite. three months is probably sufficient time to discover adverse effects of the changes such as the medical condition worsens after discontinuation of a drug. thus, it could be interpreted that the interventions actually improved the quality of drug prescribing in the nursing home. some of the identified drps discussed by the multidisciplinary team were decided not to act upon, and drug interactions were the type of drp that were least intervened on. one of the reasons may be difficulty in communicating the potential outcome of the drp to the physician or difficulty in finding more appropriate drug substitutes. the strength of our study is the prospective approach and that the multidisciplinary case conferences were included in the regular clinical setting. furthermore, the clinical pharmacist added to the team had vast experience in clinical work. the limitations are, of course, that the study was conducted in only one nursing home with one pharmacist. however, the present study provides evidence to postulate that joining intellectual forces in multidisciplinary teams can reduce both the number of drugs and the number of drps in nursing homes and, furthermore, that the vast majority of drug regimen changes maintains over time. despite the limited sample size, the results indicate that medication reviews conducted by multidisciplinary teams are effective in improving quality of drug treatment in nursing home patients.
|
management of drug therapy in nursing home patients is challenging due to complex health problems, use of multiple medications, and age - related changes in pharmacokinetics and pharmacodynamics. the objective of this study was, first, to examine the effect of systematic medication reviews conducted by multidisciplinary nursing home teams on prescribing quality and, second, to evaluate if drug therapy changes were maintained over time. patients in a large nursing home in oslo, norway, were prospectively followed during a 1.5-year period. systematic comprehensive medication reviews were carried out and the identified drug - related problems (drps) were discussed at multidisciplinary team meetings. after 3 months, the patients drug regimens were reviewed again to evaluate if drug therapy changes were maintained. altogether, 93 patients were included (89% women, mean age 87 years). in total, 234 drps were identified in 82 patients, and 151 drug therapy changes were performed in 73 patients. the most common drps were drug treatment without a clear indication (37% of all drps) and treatment with an inappropriate drug (20%). after 3 months, 85 patients (91%) were available for follow - up. in these patients, 133 (88%) of the drug therapy changes were maintained, and the mean number of drps had decreased from 2.6 to 1.0 per patient (p < 0.01). we were able to demonstrate that medication reviews conducted by multidisciplinary teams were effective to improve the quality of drug treatment in nursing home patients by significantly reducing both number of drugs and number of drps. the large majority of drug therapy changes were maintained after 3 months.
|
bronchopulmonary dysplasia (bpd) that develops after surfactant and non - invasive ventilation therapy is characterized by alveolar developmental arrest. in recent times, most preterm infants with bpd have been born between the late canalicular and early saccular stages, during which active acini and alveolar sac formation occurs. preterm infants born in this period have to breathe with structurally and functionally immature lungs. in a majority of such cases, lung development involves the temporal and spatial coordination of a number of transcription and growth factors and cell - cell interactions. this precise developmental process is disrupted in prematurely born infants by various means, including hyperoxia, mechanical stretch, and inflammation1 - 3). until the saccular stage, further extension of the gas exchange surface from the alveolar sacs occurs through a different mechanism termed alveolar septation. saccular walls are subdivided by the protrusion of secondary septa that grow perpendicularly into the air space6). lung interstitial cells play crucial roles in secondary septa formation, and their number markedly increases during alveolarization and decreases thereafter7). axial elastic fibers originate from the bronchiolar wall and form an outline of alveolar ducts. peripheral elastic fibers are connected to the pleura and penetrate the area beneath alveolar acini. septal elastic fibers appear as saccules and alveoli forms and are anchored to both axial and peripheral elastic fiber systems9, 10). elastin is a very stable molecule and once interconnection of these elastic fiber systems is completed, the components retain their configuration11). two subsets of interstitial cells exist during lung development, including myofibroblasts or nonlipid lung interstitial cells and lipofibroblasts or lipid interstitial cells12), and appear to be derived from the same mesenchymal cells. however, the cells show varying growth rates at any age and are hypothesized to be separate populations13, 14). lipofibroblasts contain lipid droplets containing triglycerides, cholesterol esters, and retinyl esters, and are present at the base of elongating septa during alveolar septation15, 16). more importantly, these cells are a source of retinoic acid, which has a major role in alveolarization. myofibroblasts are located in developing secondary crests and at septal tips during the alveolar stage of lung development and are thus called alveolar myofibroblasts18). they are dual positive for elastin and smooth muscle actin in immunostaining assays, suggesting a role in elastin formation19). alveolar myofibroblasts have morphologic and biochemical characteristics intermediate to fibroblasts and smooth muscle cells. during the pseudogladular stage of lung development, progenitors of alveolar myofibroblasts exist as a population of lung mesenchymal cells expressing platelet derived growth factor receptor (pdgfr)- around the distal lung epithelial tubules and buds20). during the canalicular and saccular stages, these pdgfr--positive cells spread from their location around the distal epithelial buds to the walls of prospective terminal saccules to eventually become alveolar myofibroblasts (fig. their absence is associated with a lack of secondary septation and the alveolarization failure21). because an excess of myofibroblasts is implicated in fibrotic diseases, alveolar myofibroblast disappearance following alveolarization completion may be critical. however, the regulatory mechanism of survival during alveolarization and subsequent disappearance of alveolar myofibroblasts is poorly understood. although these 2 subsets of lung interstitial cells have different characteristics, they can reciprocally transdifferentiate into the other subset under specific in vitro conditions24, 25). the force necessary for lifting the alveolar crest from the primary septa wall is thought to be produced by septal elastic fibers. first, elastic fibers accumulate in the thickened area of primary septa (septal crest). secondary, this thickened area grows into secondary crest that protrudes perpendicularly from the saccular wall into air space., elastic fiber deposits are always located at the fore - end of developing secondary septa (fig.. mechanical stress to elastic fibers located along saccular wall bends is believed to cause the fibers to protrude from the saccular walls, leading to new septum formation6). however, another theory involves a repulsive signal to epithelial cells in the primary septum may push the secondary septum into air space. in this theory elastin expression in cultured fibroblasts isolated from rat lung at various postnatal ages is consistent with the degree of septation28). demonstrate that postnatal lysyl oxidase (lox) inhibition or inactivation of the lox gene, which interferes with elastin and collagen synthesis, leads to alveolar septation impairment30, 31). in various pathological conditions leading to impaired alveolarization, such as in a premature lamb bpd model32), a transgenic arrested alveolarization model in mice33), mechanically ventilated newborn mice34), and congenital diaphragmatic hernia35), elastin synthesis was consistently disrupted. thick and tortuous elastic fibers formed disorganized meshwork along alveolar walls instead of their normal location at septal tips. transforming growth factor 1 (tgf-1) plays a crucial role in lung myofibroblast differentiation36). in vitro tgf-1 stimulates smooth muscle actin and tropoelastin expression in lung fibroblasts37). in rats, active tgf-1 and tgf- mice devoid of smad3, a major intracellular downstream signal transducer in the tgf-1 pathway, show inhibited alveolarization with concomitant decreased expression of tropoelastin38, 39). as alveolar septation begins, expression and localization of tgf- family members and bone morphogenetic proteins (bmps) concurrently are changed40). tgf- is also increased in preterm infants with bpd and excessive tgf- expression is associated with alveolarization inhibition in neonatal animals42, 43). hyperoxia increases tgf- expression and induces excessive myofibroblast differentiation, but impairs bmp signaling44, 45). these findings suggest that precise balance of control between tgf- and bmp signaling is essential to alveolar septation. platelet - derived growth factor a (pdgf - a) also plays a crucial role in alveolar septation. disruption of the pdgf - a gene results in failure of elastic fiber deposition in saccular walls and secondary septation. pdgf - a is produced by epithelial cells and acts as a chemoattractant, allowing myofibroblast precursors expressing pdgfr to migrate to peripheral locations46). thus, pdgfr expression by alveolar myofibroblasts is not only a marker, but also has functional consequences. insulin - like growth factor i (igf - i) released by epithelial cells is involved in myofibroblast proliferation, differentiation, and migration. exogenous igf - i enhanced migration and proliferation of fibroblasts in vitro and the extent of alveolar development was well correlated with igf - i levels in animal models47, 48). fibroblast growth factors (fgfs) play crucial roles in various steps of lung development50) and are mediated by tyrosine kinase receptors (fgfr1 - 4)51). alveolar septation coincides with increased fgfr3 and fgfr4 expression52). in mice devoid of both receptors, alveolar septation did not occur, but myofibroblasts were present and elastin formation occurred. however, elastin deposition occurred at atypical locations other than tip of growing septa and elastin formation failed to cease and contined to accumulate into adulthood53). fgf2 down - regulates elastin synthesis and lox activity and is thus considered involved in septal elastogenesis arrest54, 55). unlike fgf2, fgf18 appears to be involved in elastogenesis. an increased fgf18 level coincident with the beginning of alveolar septation has been observed in human fetal lung and postnatal rat lung56). fgf18 coordinately up - regulates tropoelastin and lox expression in isolated rat lung fibroblasts56). fgf18 expression is also reduced in the hypoplastic lung of human fetuses with congenital diaphragmatic hernia58). enhancement of lung growth coincides with the restoration of fgf18 expression, elastic fiber density and location, and alveolar septation58). fgf7 (keratinocyte growth factor) is expressed exclusively in interstitial cells, but its specific receptor, fgfr2iiib, is found only in epithelial cells59, 60). recently, fgf7 was reported to affect alveolar septation by enhancing vascular bed growth61). fgf9 controls mesenchymal cell proliferation in the prenatal lung and fgf9 signaling is necessary for distal lung capillary development62, 63). it can be assumed that genes predominantly expressed in newly forming septa are involved in alveolarization. galectin 1, a -galactosidase - binding protein involved in regulation of cell proliferation, differentiation, and apoptosis, was concentrated in myofibroblasts located at the septal tip with peak level at the time of active alveolar septation64). this suggests an important role of galectin-1 in alveolarization. in fibroblasts isolated from developing rat lungs, 2 groups of genes showed markedly opposite expression patterns before, during, and after alveolar septation65). genes up - regulated during septation and down - regulated afterward are the transcription factors hoxa2, 4, 5, and retinoid x receptor (rxr), and 3 genes involved in wnt signaling, wnt5a, norrie disease protein (ndp), and the receptor frizzled 1 (fzd1). genes down - regulated during septation and up - regulated thereafter include cartilage oligomeric protein, osteopontin, osteoactivin, tnx, and schlafen 4. notably, expression of genes up- and down - regulated during septation decreased or was enhanced, respectively, in arrested alveolarization models65). this observation suggests that alveolarization not only involves up - regulation of specific genes but also requires down - regulation of other sets of genes. lung interstitial cells, especially alveolar myofibroblasts, are essential for secondary septation, a critical process in alveolarization. the locations of myofibroblasts during lung development and their disappearance after the completion of alveolarization imply their crucial role in the formation of new gas exchange units. thus, any disruption in control pathways may lead to abnormal alveolarization. to increase the understanding of bpd, a representative disorder of disrupted alveolarization, fine mechanisms involved in survival, cell - cell interactions, and disappearance of lung myofibroblasts should be searched.
|
recent progress in neonatal medicine has enabled survival of many extremely low - birth - weight infants. prenatal steroids, surfactants, and non - invasive ventilation have helped reduce the incidence of the classical form of bronchopulmonary dysplasia characterized by marked fibrosis and emphysema. however, a new form of bronchopulmonary dysplasia marked by arrest of alveolarization remains a complication in the postnatal course of extremely low - birth - weight infants. to better understand this challenging complication, detailed alveolarization mechanisms should be delineated. proper alveolarization involves the temporal and spatial coordination of a number of cells, mediators, and genes. cross - talk between the mesenchyme and the epithelium through soluble and diffusible factors are key processes of alveolarization. lung interstitial cells derived from the mesenchyme play a crucial role in alveolarization. peak alveolar formation coincides with intense lung interstitial cell proliferation. myofibroblasts are essential for secondary septation, a critical process of alveolarization, and localize to the front lines of alveologenesis. the differentiation and migration of myofibroblasts are strictly controlled by various mediators and genes. disruption of this finely controlled mechanism leads to abnormal alveolarization. since arrest in alveolarization is a hallmark of a new form of bronchopulmonary dysplasia, knowledge regarding the role of lung interstitial cells during alveolarization and their control mechanism will enable us to find more specific therapeutic strategies for bronchopulmonary dysplasia. in this review, the role of lung interstitial cells during alveolarization and control mechanisms of their differentiation and migration will be discussed.
|
more than 170 million people are currently affected by chronic hepatitis c virus (hcv) infection worldwide with the highest prevalence in africa and asia [13 ]. since the adoption of the all volunteer blood donor system to screen blood donations in 1990s, however, some populations remain highly susceptible including drug users sharing the same devices and patients that have received unsafe therapeutic injection or unsafe blood transfer. among all hcv infected individuals, 80% of them remain chronically infected [4, 5 ], 10%20% of them develop cirrhosis, and 1%5% of them acquire liver cancer over years. therefore, previous incidence as well as new incidence all account for future disease burdens. in developed countries, hcv - infected patients could receive anti - viral therapy by giving pegylated interferon- (peg - ifn) with ribavirin. however, this therapy is long, expensive, toxic, and only effective in around 50% of patients for the most common genotype. a regimen of 48-week therapy with peg - ifn and ribavirin costing $ 25,000 usd is recommended for hcv genotype 1 and 24-week therapy for hcv genotype 2/3. there are many side effects associated with peg - ifn, which have lead to early withdrawals or dose modification, including neutropenia, flu - like symptoms, neuropsychiatric disorders like depression, and autoimmune syndromes like autoimmune thyroiditis. a sustained virological response (svr) representing long lasting disappearance of viral rna in the serum can be achieved in 80%90% of genotype 2/3 but only around 40%50% of genotype 1 [10, 11 ], which accounts for more than 70% of hcv infection in us [12, 13 ]. therefore, the development of effective vaccines for hcv, especially therapeutic, is crucial in controlling chronic hcv infection. it contains a positive - sense single - stranded rna genome that is 9,600 nucleotides in length. hcv genomic rna is composed of one open - reading frame flanked by 5 and 3 noncoding region. the hcv polyprotein encoded by the only open - reading frame is approximately 3,000 amino acids in length and is cleaved into three structure proteins (core, e1, and e2), and seven nonstructural proteins (p7, ns2, ns3, ns4a, ns4b, ns5a, and ns5b). according to international standardization and coordination of the nomenclature of variants of hepatitis c virus, hcv is classified into 6 clades or genotypes with 31%33% diversity in nucleotide based on partial sequences of core / e1 and ns5b, or complete sequences. each genotype is further divided into different subtypes with 20%25% differences (table 1). the importance of hcv genotype lies in its geographical distribution and treatment response to peg - ifn and ribavirin. due to the low - fidelity of rna - dependent rna polymerase, ns5a, in viral replication, there are many quasispecies within one infected individual. various molecules including cd81, scavenger receptor class b type i, claudin-1, low density lipoprotein receptor, and glycosaminoglycan have been shown to be the receptors for hcv. the recent discovered receptor, occludin, however, is the crucial factor allowing hcv replication in mice. the studies on hcv evasion from host immunity and host immunity in hcv patients that have spontaneously recovered have allowed us to address important immunological parameters related to protective immunity. spontaneous recovery has been linked to multifunctional cd4 t cells, cross - genotype cytotoxic cd8 t cells, as well as cross - genotype neutralizing antibodies. these studies have advanced our understanding on protective immunity against hcv and provide a blueprint for hcv vaccine developments. there were many vaccines developed and tested in preclinical setting in the past. among them, several vaccines have now advanced to clinical trials. herein, we would examine the immune evasion strategies used by hcv, discuss correlates of successful host immunity against hcv infection, and review some prospective therapeutic vaccines to chronic hcv infection. hcv can target many different effectors of the immune system, which enables its escape from host immune surveillance and ultimately leads to chronic infection. hcv can inhibit ifn- production, inhibit nk activity, and produce escape mutants from antibody and cd8 t cell recognition. double - stranded rna expressed by many rna viruses during replication could be recognized by host pathogen - recognition receptors, such as tlr3 and rna helicases (rig - i and mda-5), which lead to anti - viral responses. in addition to the myd88-dependent pathway, the myd88-independent pathway leads to phosphorylation and nuclear translocation of ifn regulatory factor 3 (irf-3) through adaptor protein trif [2325 ]. the activation of transcription factor irf-3 subsequently induces type 1 ifn production and other genes involved in host defence. by comparison, rig - i activates irf-3 for type i ifn production through another pathway required a card - containing adaptor protein, cardif. during replication, hcv ns3 - 4a protease recognizes and cleaves both trif and cardif, which blocks the signalling pathways of tlr3 and rig - i and ultimately inhibits the production of type i ifn [2729 ]. the lack of type i ifn production in patients chronically infected with hcv may indirectly lead to a decrease in nk cell activity. activated nk cells are important effectors in innate immunity against viral infection through the secretion of inflammatory cytokines like ifn- or the cytolytic ability like antibody - dependent cell - mediated cytotoxicity (adcc). type i ifn activates dcs which subsequently prime nk cells via the production and transpresentation of il-15 [31, 32 ]. thus, the lack of type i ifn production might have led to the lack of il-15 production present in the serum, which eventually causes the decrease in total number of nk cells, especially cytotoxic cd16cd56 nk cells, in chronic hcv - infected patients [33, 34 ]. antibody responses may not be sufficient to protect individuals from hcv infection since neutralizing antibodies are rarely found in acute hcv patients but are found in the majority of chronically infected patients at relatively high titers (> 320) [35, 36 ]. the failure of neutralizing antibodies in controlling hcv infection could be caused by several different factors. hcv can bind to very low - density lipoprotein (vldl), which facilitates the uptake of hcv by hepatocytes via the interaction between apob and scavenger receptor class b type i, helping hcv avoid recognition by neutralizing antibodies. e2 is highly glycosylated with 11 n - linked glycans located at the conserved region outside hypervariable region 1 (hvr1), which is targeted by most antibodies. three glycans located at the cd81-binding site of e2 decrease its immunogenicity and eventually protect viruses from antibody neutralization. hcv can also infect surrounding cells through a direct cell - cell contact mediated by cd81 and claudin-1, which can also avoid itself from the clearance of neutralizing antibodies. moreover, hcv can evolve into many quasispecies representing closely related but heterogenous rna sequences within one individual during the course of infection. the number of quasispecies identified within a single sample ranges between 310 variants and the sequence variation occurs mainly in the hvr1 [4042 ]. studies following the evolution of hcv in one single patient well illustrated the development of quasispecies in chronic patients. neutralizing antibodies to broad genotypes of hcv caused by continuous mounting immune response to evolving hcv could be detected in this patient. however, these antibodies could not neutralize the dominant hcv isolate from this patient at the time of sample collection. furthermore, the presence of interference antibodies could diminish the function of true neutralizing antibodies. two important epitopes located at e2 envelope glycoprotein have been identified (table 2). whereas epitope i located at residue 412426 is an important neutralizing site and conserved between different genotypes, epitope ii at 434446 varies among different genotypes and generates antibodies interfering with the antibody to epitope i. when analysing the appearance of antibodies specific to these two epitopes, chronic hcv patients developed antibodies to nonprotective epitope ii first. the appearance of antibodies to protective epitope i only appeared at very late time point together with equal abundant interference antibodies. indeed, when antibodies specific to epitope ii were depleted from patient plasma, this plasma, which contained antibodies to epitope i, could now provide better neutralizing capacity to a variety of genotypes. in addition to the constant mutation occurred in hcv, the induction of interfering antibodies is yet another strategy of hcv to escape from immune response. since these interference antibodies appear earlier than the protective antibodies, a vaccine effective in generating antibodies to epitope i would be critical against hcv infection. the emergence of escape mutations in cd8 t cell epitopes requires a balance between virus infectivity and host immune response. the low - fidelity of rna - dependent rna polymerase, ns5a, is generally known to be the reason for the emerging of many quasispecies within hcv - infected individuals. the rapid accumulation of mutated variants could be tracked back to the slow immune response generated against hcv, which has allowed many mutations to accumulate in vivo [40, 44 ]. the emerging of mutational variants in cd8 t cell epitopes has been carefully described both in chimpanzees [44, 45 ] and in humans [4648 ]. firstly, when the mutation rate was analysed, amino acid substitutions within cd8 t cell epitopes occurred more frequently compared to other regions. secondly, the lack of cd4 t cell help in chronic phase has prevented the effectiveness of cd8 t cells to clear the virus. when chimpanzees with resolving hcv infection were rechallenged after cd4 t cell depletion, they developed chronic hcv infection. the inability of hcv - specific cd8 t cells to control hcv viremia correlated with the emerging of mutations in cd8 t cell epitopes. therefore, these ineffective cd8 t cells have provided the selective pressure on shaping mutational variants of hcv. recently, studies analysing different hcv variants within one chronically infected individual have shown that some hcv variants were actually emerging early during acute infection. despite poor viral production while infecting hepatocytes, these variants survived due to poor recognition by host cd8 t cells. therefore, a fine balance between virus infectivity and host immune response could shape hcv mutants present in chronically infected individuals. despite the ineffectiveness of the host immune system to eradicate hcv, studies on patients that have spontaneously recovered from hcv infection and vaccinated chimpanzees that have recovered from hcv challenge have allowed us to address the important immunological correlates related to hcv clearance. some reports have shown that the clearance of hcv could be associated with certain host genetic background including host hla types, cytokine and chemokine expression (e.g., il-10, il-28b, and ccr5) [5156 ]. for example, hcv clearance is often linked to patients with hla - b27 allele in their mhc class i locus [55, 57 ]. since mhc class i is directly associated with antigen presentation to cd8 t cells, cd8 t cells are the most important effectors in controlling hcv infection. it was first recognized in earlier studies analysing acute hcv infection in chimpanzees. few chimpanzees have resolved hcv spontaneously while most of them became chronically infected. when comparing these two groups of chimpanzees for the development of neutralizing antibodies and cytotoxic cd8 t cells, spontaneously recovered chimpanzees exhibited a strong cd8 t cell response toward multiple viral epitopes and across multiple mhc class i restrictions (table 2). when these spontaneously recovered chimpanzees were challenged with hcv for the second time, they recovered more rapidly, within 14 days compared to 40 days in primary infection. specific cd8 t cell number inversely correlated with hcv viral load in the blood. additionally when cd8 t cells were depleted before the third challenge, a prolonged hcv infection was observed. when patients with chronic hcv infection were investigated, a general lack of broad specificity and cytotoxicity in cd8 t cells toward hcv epitopes was observed (table 2). a more detailed study on hla - matched individuals with chronic infection or spontaneously resolving infection was set to investigate the breadth, magnitude, phenotype, and function of hcv - specific cd8 t cells. individuals with resolved hcv infection contained stronger cd8 t cell responses (17/20 versus 9/20 ; p =.019) and specific cd8 t cells to broader range of epitopes (table 2 ; mean 2.3 versus 1 ; p =.039) with higher frequency in circulation (mean 584 versus 95 per 1 million pbmc ; p =.027) measured by ifn- secretion in response to hcv peptides. these specific cd8 t cells proliferated vigorously in response to antigens and expressed memory ccr7cd45racd27cd28 phenotype [60, 61 ]. notably a predominant expression of il-7 receptor (cd127) on hcv - specific cd8 t cells additionally cross - genotype cd8 t cells could limit the escape of hcv and help the clearance of viruses. thus, a robust multispecific and cross - genotype cd8 t cell response to different epitopes implies a successful response against hcv infection. robust cd4 t cells with broad specificity and function predict a spontaneous recovery in individuals with acute hcv infection. cd4 t helper cells are important in shaping adaptive immune effectors like b cells and cd8 t cells. even with the critical role of cd8 t cells in controlling hcv infection, a broad specificity of cd8 t cells to hcv could be found in some patients with chronic hcv infection. the difference between spontaneous resolving and chronic persistence seems to lie on the quality of the cd4 t cell response [6265 ]. when studying the specificity of cd4 t cells in acute hcv infected individuals, individuals with spontaneously resolving hcv infection have cd4 t cells specific to many different hcv epitopes compared to chronically infected individuals (table 2) [62, 66, 67 ]. a similar study was reported in patients responding to ifn- treatment (table 2). when the function of cd4 t cells was analysed, multifunctional cd4 t cells with the capacity to secrete il-2 and ifn- seemed to correlate better with hcv clearance during acute hcv infection. in contrast, acute hcv - infected individuals became chronically infected when their specific cd4 t cells secreted no il-2 [62, 65 ]. therefore, multi - specific cd4 t cells capable of secreting il-2 and ifn- are critical in the generation of quality cd8 t cell responses necessary for hcv eradication. in spite of the general lack of protection with neutralizing antibodies to hcv hcv - infected patients can develop anti - hcv antibodies to hcv core, ns3, ns4, and ns5 proteins as measured by a third generation of anti - hcv assays. neutralizing antibodies to hcv, however, are detected using e1 and e2 expressing hcv pseudotype particles (hcvpp). since e1 and e2 proteins are present on the surface of hcv virions and are critical for viral entry into hepatocytes, specific antibodies to certain e1 and e2 regions, mostly igg isotype, have neutralizing capacity [35, 36, 70 ]. new findings using human monoclonal antibodies derived from hcv infected patients demonstrated that specific antibodies against certain e1 and e2 epitopes have in vitro cross - genotype neutralizing capacity to hcvpp (table 2) [7072 ]. in addition, when these cross - genotype neutralizing antibodies were given to humanized mice following intravenous hcv challenge, these antibodies could offer passive protection and prevent hcv replication in vivo. furthermore, a study on intravenous drug users with resolved hcv infection demonstrated the contribution of broad neutralizing antibodies in hcv clearance. when these individuals with resolving infection experienced a secondary hcv infection, the majority of them (83%) would clear the virus spontaneously compared to 25% of them in primary infection. when the specificity of neutralizing antibodies was analysed, neutralizing antibodies reacting to a broad range of genotypes were found in patients spontaneously recovered instead of those who became chronically infected. studies on patients responding to ifn--based therapy have revealed the importance of innate immunity in hcv clearance. several genome - wide association studies on chronic hcv - infected patients have identified a strong genetic association of il28b gene, which encoded for ifn-3, on the responsiveness to standard ifn- and ribavirin therapy. three different studies analysing patient populations at australian, japan, and united states [56, 76 ] have demonstrated that the polymorphism at the upstream of il28b is associated strongly with sustained virological response. this genetic variation of il28b has also been shown to be associated with individuals who were infected by hcv and experienced spontaneously viral clearance. when different geographic populations are compared, c allele (rs 12979860) occurs most often in individuals from asia, then europe, and least common from africa origin. since 36.4% of non - africa individuals and only 9.3% of africa individuals spontaneously clear hcv, it further confirms the association of c allele to hcv clearance. ifn-3 together with ifn-1 (il-29) and ifn-2 (il-28b), which act through the receptor complex consisting of il-28r and il-10r and then signal through jak / stat pathway, has very similar anti - viral effects as type i interferon (ifn- and ifn-). although the importance of ifn-3 on the immune system to combat hcv infection remains mostly unknown, ifn- can inhibit hcv replication in hepatoma cells (huh-7.5). in addition, ifn- can enhance antiviral activities of ifn- and vice versa, which suggest the possible mechanism of il-28b polymorphism in the responsiveness of peg - ifn and ribavirin therapy [77, 78 ]. a pilot study on chronic hcv patients received pegylated ifn- alone or with ribavirin has showed some promising results in hcv rna reduction after 4 weekly subcutaneous injections. the development of vaccines against hcv has been hampered greatly by the availability of research tools. due to the limited tissue tropism and host selection, hcv could be generated in vitro in tissue culture system only very recently. without tissue culture techniques, the development of hcv pseudotype particles by genetically expressing e1&e2 in retrovirus vector has successfully filled the gap before the discovery of cell culture hcv (hcvcc). currently, various vaccines are primarily tested in chimpanzees and humans. through the identification of different receptors for hcv entry, it allows the construction of a humanized mouse model, which expresses hcv entry receptors like occludin. although it is still early in the development, the availability of small animal models could accelerate the preclinical screening for potential vaccine candidates. after the diagnostic kits for hcv became available, the implementation of hcv screening during blood transfusions and organ transplants has dramatically decreased the numbers of new cases of hcv infection. thus, the goals of therapeutic vaccines are to generate broad and multi - specific cd4 t cells, to activate cytotoxic cd8 t cells and finally to generate cross - genotype neutralizing antibodies. due to the variability of hcv, a combination approach including vaccination, anti - viral therapy or immune modulation might be necessary. most of them are still at preclinical stage with some advanced into phase i or ii trials to determine safety and efficacy of the candidate vaccines in a small group of patients. earlier vaccine approaches aiming to generate neutralizing antibodies against e1 failed to show efficacy in chronic hcv patients in spite of its effect on antibody production. consequently, the recombinant e1 with alum adjuvanted vaccine has been discontinued after an unsatisfactory outcome in its phase ii trial. therefore, most of hcv vaccines are focused on generating cytotoxic cd8 t cells in addition to antibody responses. different vaccines have been developed over years including epitope vaccines, vector vaccines, recombinant protein vaccines, and dna vaccines. a review on the progress and efficacy of vaccines currently in clinical trials is summarized in table 3. hcv peptide - based vaccines with different adjuvants are among the earliest vaccines aiming to induce th1 and cytotoxic t cell response in chronic hcv patients. one of these, ic41, contains 5 conservative peptides from core, ns3 and ns4 proteins, which are conserved within hcv genotype 1 and 2, and include 4 known hla - a2 epitopes and 3 promiscuous cd4 epitopes. in a randomized, dose escalating phase i trial, 128 hla - a2 healthy volunteers received 4 subcutaneous vaccinations every 4 weeks. ic41 adjuvanted with poly - l - arginine was well tolerated by these healthy volunteers. when this vaccine was given to 60 chronic hcv nonresponders, there were 67% of patients with specific t cell proliferation, 33% with specific ifn--secreting cd4 t cells, and 25% with specific ifn--secreting cd8 t cells. three responders with the strongest ifn--secreting t cells had a transient decline in serum hcv rna (> 1 log). since the response was not efficient in controlling hcv viral load, ic41 would require further modifications by using more intense regimens and stronger adjuvants or could be incorporated into the combination therapy with peg - ifn and ribavirin. other two peptide vaccines composed of peptides derived from conservative region of hcv with isa51, an emulsified incomplete freud adjuvant, were shown to be safe in hcv - infected patients [82, 91 ]. preliminarily, 26 patients received subcutaneous injection of a conserved peptide derived from hcv core (c35 - 44, yllprrgprl) biweekly. 15 of 25 patients showed an increase in peptide - specific cd8 t cell response measured by ifn- production and 2 patients demonstrated 1 log decrease in hcv viral load after 12 vaccinations. in addition, another phase i trial with virosome - based vaccine containing ns3 peptides derived from hcv is ongoing. it is a single - blinded placebo - controlled randomised trial with 30 healthy volunteers to evaluate dose - dependent safety and vaccine - induced immune response (clinicaltrials.gov identifier : nct00445419). overall, the response with peptide - based vaccines shows good tolerability but their efficacy remains to be optimised. hcv vaccines delivered by attenuated virus vectors could induce effective cd4 and cd8 t cell responses. modified virus of ankara (mva), a highly attenuated poxvirus strain, is immunogenic and safe compared to other strains of poxvirus due to the lack of several genes coding for immunomodulatory proteins, such as the soluble receptors for ifn-, type i ifn, tnf-, and cc - chemokines. it has been used in several different vaccine designs, such as hiv, tuberculosis, colorectal cancer, and melanoma [9396 ]. owing to its high immunogenicity and cross - reactivity, individuals immunized with vaccinia virus or mva - based vaccines have a strong antivector response. however, this preexisting immunity would not affect the induction of immunity against vectored antigens despite lower amount of specific t cells and antibodies to vectored antigens were observed. vaccines based on mva vector expressing hcv antigens including ns3, ns4, and ns5b have been shown to induce ifn--secreting cd4 t cells and specific cd8 t cells capable of secreting ifn- and killing in vitro and in vivo when tested in hla - a2.1 and hla - b7.2 transgenic mice. the phase i trial in 15 chronic hcv patients who received 3 weekly injections demonstrated that mva - hcv (tg4040) was well tolerated, and 6 of 15 patients showed a decline in hcv viral load (0.51.4 log) associated with significant increase in ifn--secreting t cells. currently, a phase ii trial has been proposed to treat chronic hcv patients in combinational therapy with peg - ifn and ribavirin. recombinant hcv proteins require a strong th1 adjuvant in order to generate specific t cell response to hcv. hcv e1/e2 glycoproteins emulsified with mf59, a proprietary oil - in - water emulsion adjuvant, have shown to induce a strong cd4 t cell response with significant production of neutralizing antibodies to e1 and e2 in nonhuman primates. no information has been released from one double - blinded placebo - controlled randomized trial with 60 healthy volunteers to evaluate dose - dependent safety and vaccine - induced immune response (clinicaltrials.gov identifier : nct00500747). the vaccine, gi-5005, designed to treat chronic hcv infection is containing heat - killed yeast cells expressing conserved ns3-core fusion protein. because of its yeast components, this vaccine can induce robust cd4 and cytotoxic cd8 t cell responses. in preclinical studies, vaccinated mice exhibited strong th1 with il-2 and ifn- production and cytotoxic activity to ns3 and core proteins measured by in vitro killing assay and in vivo tumor challenge experiment. biweekly repeated administration could effectively improve their specific immune response. with this successful pre - clinical result, phase i trial has also demonstrated its safety and shown to induce immune response in chronic hcv patients. phase ii trial was designed to compare a combined therapy with gi-5005 and peg - ifn / ribavirin to peg - ifn / ribavirin alone in chronic hcv patients. at the end of 48-week treatment, patients received gi-5005 and peg - ifn / ribavirin had 74% of response rate determined by hcv rna less than 25 in addition, clinical tests have suggested a better liver function by alt normalization after the combined therapy. another vaccine based on conserved hcv core protein is adjuvanted with iscomatrix, an adjuvant composed of saponin, cholesterol, and phospholipid to form sphere particles with 40 m in diameter. the first phase i trial in 30 healthy volunteers provided the evidence for its safety and tolerability. as to the efficacy measured by immune response, 8 volunteers who received the highest antigen dose, 50 g, all showed antibody response to core protein, 7 with cytokine - producing t cells, and 2 with cd8 t cell responses measurable by intracellular ifn- staining. a phase ib trial is prepared to evaluate its safety and immune response in chronic hcv - infected patients. dna vaccines using naked dna delivered by electroporation have been designed to treat chronic hcv patients. due to the heterogeneity of hcv subtypes in most chronically infected patients, a dna vaccine was designed to include the most conserved region including ns3 and ns4a. through extensive codon modification, the dna can be effectively expressed in vivo and elicit a th1 response and cytotoxic response. these primed cd8 t cells could effectively eliminate ns3/4a expressing hepatocytes and tumor cells in mouse model [102, 103 ]. this dna vaccine (chronvac - c) has been given to 12 patients with chronic hcv infection through intramuscular electroporation. two out of three patients received the highest dose of 1500 g showed a decrease in serum hcv rna (1.2 & 2.4 log). moreover, after completing the vaccination, three patients who received standard ifn--based therapy had an accelerated clearance in hcv viral load. therefore, chronvac - c has been proposed to treat chronic hcv patients in combination with standard ifn--based therapy. another dna vaccine currently in phase i clinical trial is cigb-230, a mixture of recombinant hcv core protein and core / e1/e2-expressing plasmid dna. vaccination in 15 chronic hcv patients showed that this vaccine is safe, partially immunogenic, and able to stabilize liver histology despite persistent detection of hcv rna. the lessons from studying protective immunity against acute hcv infection have taught us the importance of multi - functional cd4 t cells toward a broad spectrum of viral epitopes. with the help of these cd4 t cells, the body can then generate functional cytotoxic t cells to eliminate virus - infected hepatocytes and produce neutralizing antibodies to prevent hcv from entering into uninfected cells [6264 ]. hcv e1/e2 glycoprotein emulsified with mf59 can induce a strong cd4 t cell response and neutralizing antibody to e1 and e2. vaccination with defective alphaviral particles with rna encoding for hiv gag has shown to generate a strong gag - specific cd8 t cell response. through different adjuvant and antigen combinations, lin. mice were first primed with e1/e2 glycoprotein, cpg, and mf59 to induce robust th1 response, and followed by the boost vaccination with defective alphaviral particles with rna encoding for hcv e1/e2/ns3 - 5 to generate a strong cytotoxic cd8 t cell response. with this protocol although this vaccine approach remains to be evaluated in other pre - clinical trials, this would set a prototype for the next generation of hcv vaccines. various immunological parameters favoring hcv clearance have gradually been identified. together with the knowledge on the strategies deployed by hcv, we now have a good picture on the war against chronic hcv infection. the issue would lie on how to use the information in various vaccine platforms the scientists worldwide have built for years. in addition to vaccine development, efforts on developing anti - viral drugs are underway. several targets for drug development have been proposed including ns3 - 4a serine protease, ns5b rdrp, hcv 5-ncr, hcv viral entry and fusion, and p7 ion channel. among them, ns3 - 4a serine protease inhibitor has gone into clinical trial with edges on blocking viral replication and enhancing viral recognition by innate immunity. since the nature of hcv in chronic infected patients is changeable, we would have to modify our strategy accordingly. a combination therapy including vaccination, anti - viral therapy like ns3 - 4a protease inhibitor, and immune modulation like ifn- or ifn- would need to be tailored to meet individual requirements. with the help of ns3 - 4a protease inhibitor, antigen - presenting cells, especially dcs and kupffer cells, and infected hepatocytes can now sense hcv infection by tlr3 and rig - i pathways, which consequently activates innate and adaptive immune responses. since the immune response to hcv is skewed in chronic hcv patients, it can be redirected toward th1 and cytotoxic t cell responses through the work of vaccines and immune modulators. hence, the availability of multiple vaccines and treatment options is critical in treating chronic hcv patients.
|
chronic hepatitis c virus (hcv) infection remains a serious burden to public health worldwide. currently, hcv - infected patients could undergo antiviral therapy by giving pegylated ifn- with ribavirin. however, this therapy is only effective in around 50% of patients with hcv genotype 1, which accounts for more than 70% of all hcv infection, and it is not well tolerated for most patients. moreover, there is no vaccine available. the efforts on identifying protective immunity against hcv have progressed recently. neutralizing antibodies and robust t cell responses including both cd4 + and cd8 + have been shown to be related to the clearance of hcv, which have shed lights on the potential success of hcv vaccines. there are many vaccines developed and tested before entering clinical trials. here, we would first discuss strategies of viral immune evasion and correlates of protective host immunity and finally review some prospective vaccine approaches against chronic hcv infection.
|
she was suffering from dilated cardiomyopathy, asymptomatic and untreated b - cell chronic lymphocytic leukaemia and cognitive disorders. on admission, she presented clinical signs of heart failure with pleural effusion on her chest x - ray. a thoracic computed tomography scan showed several enlarged lymph nodes in the mediastinum and signs of congestive heart failure without any parenchymal lesion. adenosine deaminase was within the normal range, and both culture and polymerase chain reaction (pcr) of pleural fluid were negative for mycobacterium tuberculosis (mtb). flow cytometry showed pleural b - cell chronic lymphocytic leukaemia infiltration, leading to the diagnosis of malignant pleural effusion. chemotherapy with chlorambucil 0.3 mg / kg / day (5 days / month) and prednisone (1 mg / kg / day) was started, leading to stabilization of the pleural effusion. one month later, the patient presented with superficial erythematous plaques on the anterior side of the left leg (fig. after 3 weeks, erythematous painless deep nodules appeared on the left popliteal fossa and on the left thigh (fig. ziehl - neelsen stain was negative for acid - fast bacilli and skin tissue culture negative for mtb. the result of the t-spot.tb interferon - gamma release assay (igra) was twice indeterminate. palliative care was initiated, with the family 's agreement, and further pulmonary investigations and blood cultures were not performed. urinary culture performed a few days before death because of the appearance of isolated leukocyturia showed the presence of mtb. as pcr for mtb was not initially performed on a fresh cutaneous sample in the absence of acid - fast bacilli, it was done on paraffin - embedded skin samples and shown to be positive post mortem. the final diagnosis was reactivation of latent tuberculosis (tb) with cutaneous and genitourinary localisations. tb remains a major global health problem. as reported by world health organization (who) in 2012, an estimated 8.6 million people developed tb and 1.3 million died from the disease. cutaneous tb lesions show a wide spectrum of morphology, which depends on the endemic zone as well as the patient 's age and cellular immune status. cutaneous tb is classified by bacterial load into multibacillary and paucibacillary forms or according to the mechanism of propagation (direct inoculation, contiguous infection and haematogenous dissemination). this presentation is rare and may be part of the heterogeneous histopathologic spectrum of erythema induratum of bazin (nodular vasculitis). controversy persists in the literature about whether or not the presence of vasculitis is a histopathologic requirement to establish the diagnosis of erythema induratum of bazin. in some cases with all the stereotypical clinicopathologic features of erythema induratum of bazin, serial sections of the sample therefore vasculitis is not considered as a sine qua non criterion for the diagnosis of erythema induratum of bazin when other characteristic findings are present [2, 3 ]. this diagnosis was eliminated in our patient as the nodules were completely painless with atypical localization. miliary tb was also suspected because of cellular immunosuppression, but skin biopsy and culture of pleural effusion were not consistent with this diagnosis. the diagnosis of cutaneous tb requires the correlation of clinical findings with histopathology and microbiological tests. presence of epithelioid granulomas on biopsy samples is not specific for tb and may also be seen in other conditions such as deep fungal infection, leprosy, sarcoidosis or nontuberculous mycobacteria. igra should not be used for the diagnosis of tb in elderly patients as the pre - test probability for tb is high and as the prevalence of indeterminate results increases in individuals aged > 75 years. failure to cultivate mycobacteria does not exclude the diagnosis of cutaneous tb, especially in paucibacillary forms [1, 7 ]. xpert mtb / rif is an automated pcr that can detect both mtb complex and rifampicin resistance within 2 h after starting the test. it is a diagnostic tool for pulmonary tb recommended by the who with an overall pooled sensitivity and specificity of 90.4 and 98.4%percnt ;, respectively. however, for extrapulmonary tb, its sensitivity varies widely between different studies, depending on the localization of the tb. in one and the same meta - analysis, the sensitivity of this assay for extrapulmonary tb was 80.4%percnt ; and its specificity was 86.1%percnt ;. for cutaneous tb no study has yet been carried out. in our case, pcr analysis of the is6110 fragment of mtb an insertion element that exists exclusively within the members of the mtb complex [7, 11 ] finally led to the diagnosis. different studies highlighted the contribution of pcr for the diagnosis of tb in granulomatous panniculitis [4, 7, 12 ]. chen. showed that in a chinese population pcr was positive in 38.9 and 30.4%percnt ; of cases of nodular vasculitis and erythema nodosum, respectively, suggesting that these lesions are associated with active tb. another study in taiwan demonstrated that pcr was positive in 56.2%percnt ; of cutaneous specimens of cases showing granulomatous inflammation without acid - fast bacilli. obieta. showed on filipino patients that pcr was a suitable technique for the diagnosis of tb in formalin - fixed, paraffin - embedded skin tissue specimens : 1 out of 4 specimens of erythema induratum had positive pcr for the 123-bp segment of the is6110 gene. it should be systematically considered in the presence of granulomatous panniculitis, even in the absence of vasculitis. in such cases, physicians must not hesitate to perform and repeat cutaneous biopsies and use both histopathology and pcr to confirm the diagnosis. the patient 's family gave their written informed consent for the publication of this case report.
|
we report a case of tuberculous granulomatous panniculitis without vasculitis in an 87-year - old female patient with b - cell chronic lymphocytic leukaemia. one month after starting chemotherapy with chlorambucil and prednisone she presented superficial erythematous plaques on the anterior side of the left leg. three weeks later erythematous painless deep nodules appeared on the left popliteal fossa and on the left thigh. cutaneous biopsy revealed granulomatous panniculitis without caseation necrosis or vasculitis. polymerase chain reaction for mycobacterium tuberculosis revealed positivity in the skin. the final diagnosis was reactivation of latent tuberculosis (tb) induced by deep immunosuppression associated with chemotherapy and haematological disease. tuberculous granulomatous panniculitis without vasculitis is a rare presentation of cutaneous tb and may be part of the heterogeneous histopathologic spectrum of erythema induratum of bazin (nodular vasculitis). our case shows that the diagnosis of cutaneous tb requires the correlation of clinical findings with histopathology and microbiological tests.
|
a benzodiazepine is a psychoactive drug whose core chemical structure is the fusion of a benzene ring and a diazepine ring. the first benzodiazepine, chlordiazepoxide (librium), discovered accidentally by leo sternbach in 1955 and made available in 1960 by hoffmann la roche, which has also marketed diazepam (valium) since 1963. 1,5-benzodiazepines constitute an important class of psychopharmaca, in particular as tranquilizers and also as potent virucides and nonnucleoside inhibitors of hiv-1 reverse transcriptase. first, in the acute treatment of seizures as drugs of choice in status epilepticus and also in some cases of febrile seizures. second, the bzds are utilized in long - term therapy of certain seizures types primarily in the pediatrics ' population. a greater therapeutic potential and lower incidence of side effects were described for 1,5-bzds when compared to 1,4-bzds. they are particularly effective against seizures induced by electroshock, and various chemoconvulsants, in kindled seizures and in absence seizures. beside this, 1,5-benzodiazepines show antifungal, antibacterial, antifeedant, anti - inflammatory analgesic, and anticonvulsant activities. the benzodiazepines nucleus is a well - studied traditional pharmacophoric scaffold that has emerged as a core structure unit of various biological activities. although, the first benzodiazepine was introduced as a drug nearly 35 years ago, the research in this area is still very active and is directed towards the synthesis of compounds with enhanced pharmacological activity. the chemical structure of the benzodiazepines seems at first sight to be unique among the various types of central depressant drugs. 1,5-benzodiazepines derivatives show a large number of pharmacological properties such as they acted as sedatives, cerebrovasodialators, neuroleptics, antispasmodic, anticonvulsant, tranquilizing agents, antibacterial, and psoriasis and used for the treatment of small pox. ir spectra (kbr, cm) were recorded on perkin elmer spectrometer, 1h nmr-(, ppm) spectra were recorded on a brucker 300 mhz nmr spectrometer using tms as an internal standard. the purity of compounds and progress of the reaction were checked by tlc using silica gel - g as adsorbent. synthesis of fused ring benzodiazepines in presence of sulfated zirconia involves 2 steps which are as follows. preparation of catalyst25 gm of zirconium oxychloride was dissolved in doubly distilled water (ph-2). precipitate was washed with distilled water several times and dried for 24 h. sample was ground to fine powder and immersed in an 0.5 m h2so4 solution (30 ml) for 30 min. excess water was evaporated on water bath, and the resulting sample was oven dried. 25 gm of zirconium oxychloride was dissolved in doubly distilled water (ph-2). precipitate was washed with distilled water several times and dried for 24 h. sample was ground to fine powder and immersed in an 0.5 m h2so4 solution (30 ml) for 30 min. excess water was evaporated on water bath, and the resulting sample was oven dried. synthesis of benzodiazepines1 : 2.5 mole ratio mixture of o - phenylenediamine and ketone (cyclohexanone (scheme 1)) with catalytic amount of sulfated zirconia was taken in round bottom flask (rbf) with stirring at ambient condition for 2 - 3 h. 10 ml of ch2cl2 was added to reaction mixture, and catalyst was recovered by filtration. 1 : 2.5 mole ratio mixture of o - phenylenediamine and ketone (cyclohexanone (scheme 1)) with catalytic amount of sulfated zirconia was taken in round bottom flask (rbf) with stirring at ambient condition for 2 - 3 h. 10 ml of ch2cl2 was added to reaction mixture, and catalyst was recovered by filtration. equimolar quantity of fused ring benzodiazepine (nbzd-1, 0.01 m), formaldehyde, and various acetophenones (i.e., acetophenone, p - nitroacetophenone, and p - chloroacetophenone) were taken in rbf, and mixture was refluxed for 2.30 h. completion of reaction was monitored by tlc analysis for several times. then equimolar quantities of mannich base derivatives (0.01 m, nbzd-3, nbzd-4, and nbzd-5), in individual reactions, were dissolved in glacial acetic acid and added with p - chloroaniline (scheme 3) or p - chlorophenylsemicarbazide (scheme 4) and taken in rbf and mixture was refluxed for 3 h, respectively. completion of reaction was monitored by tlc analysis for several times in chloroform : ethanol (1 : 1). then melting point, rf value, and % yield were noted. synthesis of 1,5-benzodiazepines in presence of sulphated zirconia involves 2 steps which are as follows. synthesis of benzodiazepines1 : 2.5 mole ratio mixture of o - phenylenediamine and acetone (scheme 5) with catalytic amount of sulfated zirconia was taken in round bottom flask (rbf) with stirring at ambient condition for 2 - 3 h. 10 ml of ch2cl2 was added to reaction mixture, and catalyst was recovered by filtration. 1 : 2.5 mole ratio mixture of o - phenylenediamine and acetone (scheme 5) with catalytic amount of sulfated zirconia was taken in round bottom flask (rbf) with stirring at ambient condition for 2 - 3 h. 10 ml of ch2cl2 was added to reaction mixture, and catalyst was recovered by filtration. equimolar quantities of fused ring benzodiazepine (nbzd-12, 0.01 m), formaldehyde, and various acetophenones (i.e., acetophenone, p - nitroacetophenone, and p - chloroacetophenone) were taken in rbf, and mixture was refluxed for 2.30 h. completion of reaction was monitored by tlc analysis for several times. then equimolar quantities of mannich base derivatives (0.01 m, nbzd-13, nbzd-14, and nbzd-15),in individual reactions, were dissolved in glacial acetic acid and added with p - chloroaniline (scheme 7) or p - chlorophenylsemicarbazide (scheme 8), and were taken in rbf, and mixture was refluxed for 3 h, respectively. completion of reaction was monitored by tlc analysis for several times in chloroform : ethanol (1 : 1). then ten mice of either sex with a weight of 2225 g were treated with the test compounds (30 mg / kg b.w) or the standard (e.g., diazepam 10 mg / kg b.w) by i.p. administration. treatment, the animals were injected with a subcutaneous dose of (300 mg / kg, s.c) isoniazid, thiosemicarbazide (20 mg / kg, s.c). the occurrence of clonic seizures, tonic seizures, and death or recovery were recorded after 0.5 hr, 1 hr, 2 hr, and 4 hr, respectively, for isoniazid induced convulsion (table 3) and also thiosemicarbazide induced convulsion (table 4). the mice were trained to stay on an accelerating rotarod that rotates at 20 revolutions per minute. neurotoxicity was indicated by the inability of the animal to maintain equilibrium on the rod for at least 1 min in each of the three trials. the dose at which the animals were unable to grasp the rotarod was determined (tables 3 and 4). this test was performed with the test substances in a dose of 30 mg / kg by phenobarbitone induced narcosis in rats. the compounds in peg (polyethylene glycol) were administered i.p to a group of six rats. after 30 min, rats were then placed on their back and loss of righting reflex was taken as onset of sleep. the time taken by the rats to awake a control was also performed after pretreatment with test substances vehicle (peg) and injected phenobarbitone (table 5). 10-spirocyclohexane-1,2,3,9,10,10a - hexahydrobenzo[b]cyclohexane [e ] diazepine (nbzd-1) : h nmr (300 mhz,) : ch(m, 6.47.0, 4h, phenyl), nh(s, 4.1, 1h), ch2(m, 1.21.6, 18h, cyclohexane), ch(s, 2.7, 1h, diazepine ring). ir (kbr) : nh(ar, 3030 cm, str), ch(ar, 3180 cm, str), ch(ar, 800 cm, bend), c = n(1618 cm, str) ch2(1490 cm, str), c c(ar, 1600 cm), c = c(ar, 1410, 1500, 1580 cm). 1-phenyl-3-(10-spirocyclohexane-1,2,3,9,10,10a - hexahydrobenzo[b]cyclohexane [e]diazepine-1-yl) propan-1-one (nbzd-3) : h nmr (300 mhz,) : ch(m, 7.37.9, 5h, acetophenone), ch2(s, 2.8, 2h, coch2), ch2(s, 3.5, 2h, nhch2), ch(m, 6.47.0, 4h, phenyl), ch2(m, 1.21.5, 18h, cyclohexane), ch(s, 2.5, 1h, diazepine ring).ir (kbr) : c = o(1700 cm, str), ch(ar, 3180 cm, str), ch(ar, 810 cm, bend), c = n(1618 cm, str), ch2(1490 cm, str), c c(ar, 1600 cm), c = c(ar, 1410, 1500, 1580 cm). h nmr (300 mhz,) : ch(m, 8.1 - 8.2, 4h, p - nitroacetophenone), ch2(s, 2.7, 2h, coch2), ch2(s, 3.5, 2h, nhch2), ch(m, 6.47.0, 4h, phenyl), nh(s, 4.0, 1h,), ch2(m, 1.221.59, 18h, cyclohexane), ch(s, 2.7, 1h, diazepine ring).ir (kbr) : c = o(1710 cm, str), ch(ar, 3150 cm, str), ch(ar, 800 cm, bend), c = n(1658 cm, str), ch2 (1490 cm, str), c c(ar, 1610 cm), c = c(ar, 1410, 1560, 1580 cm), n h nmr (300 mhz,) : ch(m, 7.307.5, 4h, p - chloroacetophenone), ch(m, 7.2 - 7.3, 4h, p - chloroaniline), ch2(s, 1.6, 2h, coch2), ch2(s, 3.4, 2h, nhch2), ch(m, 6.67.1, 4h, phenyl), ch2(m, 1.31.5, 18h, cyclohexane), ch(s, 2.7, 1h, diazepine ring). ir (kbr) : c = n(1569 cm, str), c cl(727 cm, str), c cl(760 cm), c h(2975 cm, str assym), ch(1383.9 cm, def sym.), c h(ar, 3072 cm, str), ch(ar, 3150 cm, str), ch(ar, 860 cm, bend), c = n(1678 cm, str) ch2(1490 cm, str), c c(ar, 1600 cm), c = c(ar, 1410, 1500, 1580 cm). h nmr (300 mhz,) : ch(m,7.98.2, 4h, p - nitroacetophenone), nh(s, 7.0, 1h, = nnh, p - chlorophenylsemicarbazide), nh(s, 6.0, 1h, nhc6h4cl, p - chlorophenylsemicarbazide), ch(m, 7.27.6, 4h, p - chlorophenylsemicarbazide), ch(m, 6.67.1, 4h, phenyl), ch2(m, 1.31.5, 18h, cyclohexane), ch(s, 2.3, 1h, diazepine ring), ch2(s, 1.6, 2h, coch2), ch2(s, 3.4, 2h, nhch2).ir (kbr) : c = n(1569 cm, str), c cl(728 cm, str), c h(2970 cm, str assym), ch(1353.9 cm, def sym.), c h(ar, 3062 cm, str), ch(ar, 3180 cm, str), ch(ar, 810 cm, bend), c = n(1638 cm, str) ch2(1490 cm, str), c c(ar, 1680 cm), c = c(ar, 1410, 1500, 1580 cm), no(1380 cm, str). (4-chlorophenylhyrazinecarboxamide)[1-nitrophenyl-3-(10-spirocyclohexane-1,2,3,9,10,10a - hexahydrobenzo[b]cyclohexane [e ] diazepine-1-yl)-propylidene]-amine (nbzd-11) : h nmr (300 mhz,) : ch(m,7.6 - 7.7, 4h, p - chloroacetophenone), nh(s, 9.0, 1h, = nnh, p - chlorophenylsemicarbazide), nh(s, 6.0, 1h, nhc6h4cl, p - chlorophenylsemicarbazide), ch(m, 7.27.6,4h, p - chlorophenylsemicarbazide), ch(m, 6.67.1, 4h, phenyl), ch2(m, 1.31.6, 18h, cyclohexane), ch(s, 2.7, 1h, diazepine ring), ch2(s, 1.6, 2h, coch2), ch2(s, 3.4, 2h, nhch2). ir (kbr) : c = n(1559 cm, str), c h(2975 cm, str assym), ch(1353.9 cm, def sym.), c h(ar, 3062 cm, str), ch(ar, 3180 cm, str), ch(ar, 880 cm, bend), c = n(1638 cm, str) ch2(1490 cm, str), c c(ar, 1600 cm), c = c(ar, 1410, 1500, 1580 cm). h nmr (300 mhz,) : ch(m, 7.37.8, 5h, acetophenone), ch2(s, 2.7, 2h, coch2), ch2(s, 3.5, 2h, nhch2), ch(m, 6.67.1, 4h, phenyl), 2xch3(s, 1.28, 6h), ch3(s, 0.9, 3h), ch2(s, 2.5, 2h, diazepine ring).ir (kbr) : c = o(1700 cm, str), nh(ar, 3230 cm, str), ch(ar, 3180 cm, str), ch(ar, 800 cm, bend), c = n(1618 cm, str), ch3(2980 cm, str), c c(ar, 1610 cm), c = c(ar, 1410, 1500, 1580 cm). h nmr (300 mhz,) : ch(m, 7.37.8, 4h, p - chloroacetophenone), ch2(s, 2.78, 2h, coch2), ch2(s, 3.5, 2h, nhch2), ch(m, 6.67.1, 4h, phenyl), 2xch3(s, 1.2, 6h), ch3(s,0.9, 3h), ch2(s, 2.4, 2h, diazepine ring).ir (kbr) : c = o(1710 cm, str), nh(ar, 3030 cm, str), ch(ar, 3280 cm, str), ch(ar, 800 cm, bend), c = n(1618 cm, str), ch3(2990 cm, str), c c(ar, 1600 cm), c = c(ar, 1410, 1500, 1580 cm), c cl(760 cm). h nmr (300 mhz,) : ch(m, 7.88.2, 4h, p - nitroacetophenone), ch(m, 7.2 - 7.3, 4h, p - chloroaniline), ch2(s, 1.6, 2h, n = c ch2), ch2(s, 3.4, 2h, nhch2), ch(m, 6.67.1, 4h, phenyl), 2xch3(s, 1.2, 6h), ch3(s,0.9, 3h), ch2(s, 2.5, 2h, diazepine ring).ir (kbr) : c = n(1599 cm, str), c cl(728 cm, str), c h(2985 cm, str assym), ch(1353.9 cm, def sym.), c h(ar, 3062 cm, str), ch(ar, 3180 cm, str), ch(ar, 800 cm, bend), c = n(1618 cm, str), ch3(2990 cm, str), c c(ar, 1600 cm), c = c(ar, 1410, 1500, 1580 cm), no(1350 cm, str) 4-chlorophenylhyrazinecarboxamide) [1-nitrophenyl-3-(2,2,4-trimethyl-2,3-dihydrobenzo[b]diazepine-1-yl)-propylidene]-amine (nbzd-20). h nmr (300 mhz,) : ch(m, 7.98.2, 4h, p - nitroacetophenone), nh(s, 9.0, 1h, = nnh, p - chlorophenylsemicarbazide), nh(s, 6.0, 1h, nhc6h4cl, p - chlorophenylsemicarbazide), ch(m, 7.27.5,4h, p - chlorophenylsemicarbazide), ch2(s, 1.6, 2h, n = c ch2), ch2(s, 3.4, 2h, nhch2), ch(m, 6.67.1, 4h, phenyl), 2xch3(s, 1.28, 6h), ch3(s,0.9, 3h), ch2(s, 2.5, 2h, diazepine ring).ir (kbr) : c = n(1570 cm, str), c h(2975 cm, str assym), ch(1353.9 cm, def sym.), c h(ar, 3062 cm, str), ch(ar, 3180 cm, str), ch(ar, 800 cm, bend), c = n(1618 cm, str), ch3(2990 cm, str), c c(ar, 1600 cm), c = c(ar, 1410, 1500, 1580 cm), no(1350 cm, str). 10-spirocyclohexane-1,2,3,9,10,10a - hexahydrobenzo[b]cyclohexane [e ] diazepine (nbzd-1) : h nmr (300 mhz,) : ch(m, 6.47.0, 4h, phenyl), nh(s, 4.1, 1h), ch2(m, 1.21.6, 18h, cyclohexane), ch(s, 2.7, 1h, diazepine ring). ir (kbr) : nh(ar, 3030 cm, str), ch(ar, 3180 cm, str), ch(ar, 800 cm, bend), c = n(1618 cm, str) ch2(1490 cm, str), c c(ar, 1600 cm), c = c(ar, 1410, 1500, 1580 cm). 1-phenyl-3-(10-spirocyclohexane-1,2,3,9,10,10a - hexahydrobenzo[b]cyclohexane [e]diazepine-1-yl) propan-1-one (nbzd-3) : h nmr (300 mhz,) : ch(m, 7.37.9, 5h, acetophenone), ch2(s, 2.8, 2h, coch2), ch2(s, 3.5, 2h, nhch2), ch(m, 6.47.0, 4h, phenyl), ch2(m, 1.21.5, 18h, cyclohexane), ch(s, 2.5, 1h, diazepine ring). ir (kbr) : c = o(1700 cm, str), ch(ar, 3180 cm, str), ch(ar, 810 cm, bend), c = n(1618 cm, str), ch2(1490 cm, str), c c(ar, 1600 cm), c = c(ar, 1410, 1500, 1580 cm). h nmr (300 mhz,) : ch(m, 8.1 - 8.2, 4h, p - nitroacetophenone), ch2(s, 2.7, 2h, coch2), ch2(s, 3.5, 2h, nhch2), ch(m, 6.47.0, 4h, phenyl), nh(s, 4.0, 1h,), ch2(m, 1.221.59, 18h, cyclohexane), ch(s, 2.7, 1h, diazepine ring). ir (kbr) : c = o(1710 cm, str), ch(ar, 3150 cm, str), ch(ar, 800 cm, bend), c = n(1658 cm, str), ch2 (1490 cm, str), c c(ar, 1610 cm), c = c(ar, 1410, 1560, 1580 cm), n o(1350 cm, str). h nmr (300 mhz,) : ch(m, 7.307.5, 4h, p - chloroacetophenone), ch(m, 7.2 - 7.3, 4h, p - chloroaniline), ch2(s, 1.6, 2h, coch2), ch2(s, 3.4, 2h, nhch2), ch(m, 6.67.1, 4h, phenyl), ch2(m, 1.31.5, 18h, cyclohexane), ch(s, 2.7, 1h, diazepine ring). ir (kbr) : c = n(1569 cm, str), c cl(727 cm, str), c h(2975 cm, str assym), ch(1383.9 cm, def sym.), c h(ar, 3072 cm, str), ch(ar, 3150 cm, str), ch(ar, 860 cm, bend), c = n(1678 cm, str) ch2(1490 cm, str), c c(ar, 1600 cm), c = c(ar, 1410, 1500, 1580 cm). h nmr (300 mhz,) : ch(m,7.98.2, 4h, p - nitroacetophenone), nh(s, 7.0, 1h, = nnh, p - chlorophenylsemicarbazide), nh(s, 6.0, 1h, nhc6h4cl, p - chlorophenylsemicarbazide), ch(m, 7.27.6, 4h, p - chlorophenylsemicarbazide), ch(m, 6.67.1, 4h, phenyl), ch2(m, 1.31.5, 18h, cyclohexane), ch(s, 2.3, 1h, diazepine ring), ch2(s, 1.6, 2h, coch2), ch2(s, 3.4, 2h, nhch2). ir (kbr) : c = n(1569 cm, str), c cl(728 cm, str), c cm, str assym), ch(1353.9 cm, def sym.), c h(ar, 3062 cm, str), ch(ar, 3180 cm, str), ch(ar, 810 cm, bend), c = n(1638 cm, str) ch2(1490 cm, str), c c(ar, 1680 cm), c = c(ar, 1410, 1500, 1580 cm), no(1380 cm, str). (4-chlorophenylhyrazinecarboxamide)[1-nitrophenyl-3-(10-spirocyclohexane-1,2,3,9,10,10a - hexahydrobenzo[b]cyclohexane [e ] diazepine-1-yl)-propylidene]-amine (nbzd-11) : h nmr (300 mhz,) : ch(m,7.6 - 7.7, 4h, p - chloroacetophenone), nh(s, 9.0, 1h, = nnh, p - chlorophenylsemicarbazide), nh(s, 6.0, 1h, nhc6h4cl, p - chlorophenylsemicarbazide), ch(m, 7.27.6,4h, p - chlorophenylsemicarbazide), ch(m, 6.67.1, 4h, phenyl), ch2(m, 1.31.6, 18h, cyclohexane), ch(s, 2.7, 1h, diazepine ring), ch2(s, 1.6, 2h, coch2), ch2(s, 3.4, 2h, nhch2). ir (kbr) : c = n(1559 cm, str), c cl(787 cm, str), c cl(769 cm), c h(2975 cm, str assym), ch(1353.9 cm, def sym.), c h(ar, 3062 cm, str), ch(ar, 3180 cm, str), ch(ar, 880 cm, bend), c = n(1638 cm, str) ch2(1490 cm, str), c c(ar, 1600 cm), c = c(ar, 1410, 1500, 1580 cm). h nmr (300 mhz,) : ch(m, 7.37.8, 5h, acetophenone), ch2(s, 2.7, 2h, coch2), ch2(s, 3.5, 2h, nhch2), ch(m, 6.67.1, 4h, phenyl), 2xch3(s, 1.28, 6h), ch3(s, 0.9, 3h), ch2(s, 2.5, 2h, diazepine ring). ir (kbr) : c = o(1700 cm, str), nh(ar, 3230 cm, str), ch(ar, 3180 cm, str), ch(ar, 800 cm, bend), c = n(1618 cm, str), ch3(2980 cm, str), c c(ar, 1610 cm), c = c(ar, 1410, 1500, 1580 cm). h nmr (300 mhz,) : ch(m, 7.37.8, 4h, p - chloroacetophenone), ch2(s, 2.78, 2h, coch2), ch2(s, 3.5, 2h, nhch2), ch(m, 6.67.1, 4h, phenyl), 2xch3(s, 1.2, 6h), ch3(s,0.9, 3h), ch2(s, 2.4, 2h, diazepine ring). ir (kbr) : c = o(1710 cm, str), nh(ar, 3030 cm, str), ch(ar, 3280 cm, str), ch(ar, 800 cm, bend), c = n(1618 cm, str), ch3(2990 cm, str), c c(ar, 1600 cm), c = c(ar, 1410, 1500, 1580 cm), c cl(760 cm). h nmr (300 mhz,) : ch(m, 7.88.2, 4h, p - nitroacetophenone), ch(m, 7.2 - 7.3, 4h, p - chloroaniline), ch2(s, 1.6, 2h, n = c ch2), ch2(s, 3.4, 2h, nhch2), ch(m, 6.67.1, 4h, phenyl), 2xch3(s, 1.2, 6h), ch3(s,0.9, 3h), ch2(s, 2.5, 2h, diazepine ring). ir (kbr) : c = n(1599 cm, str), c cm, str assym), ch(1353.9 cm, def sym.), c h(ar, 3062 cm, str), ch(ar, 3180 cm, str), ch(ar, 800 cm, bend), c = n(1618 cm, str), ch3(2990 cm, str), c c(ar, 1600 cm), c = c(ar, 1410, 1500, 1580 cm), no(1350 cm, str) 4-chlorophenylhyrazinecarboxamide) [1-nitrophenyl-3-(2,2,4-trimethyl-2,3-dihydrobenzo[b]diazepine-1-yl)-propylidene]-amine (nbzd-20). h nmr (300 mhz,) : ch(m, 7.98.2, 4h, p - nitroacetophenone), nh(s, 9.0, 1h, = nnh, p - chlorophenylsemicarbazide), nh(s, 6.0, 1h, nhc6h4cl, p - chlorophenylsemicarbazide), ch(m, 7.27.5,4h, p - chlorophenylsemicarbazide), ch2(s, 1.6, 2h, n = c ch2), ch2(s, 3.4, 2h, nhch2), ch(m, 6.67.1, 4h, phenyl), 2xch3(s, 1.28, 6h), ch3(s,0.9, 3h), ch2(s, 2.5, 2h, diazepine ring). ir (kbr) : c = n(1570 cm, str), c cl(730 cm, str), c h(2975 cm, str assym), ch(1353.9 cm, def sym.), c h(ar, 3062 cm, str), ch(ar, 3180 cm, str), ch(ar, 800 cm, bend), c = n(1618 cm, str), ch3(2990 cm, str), c c(ar, 1600 cm), c = c(ar, 1410, 1500, 1580 cm), no(1350 cm, str). all the synthesized derivatives were evaluated at the dose of 30 mg / kg b.w for anticonvulsant activity by isoniazid induced convulsion model and the compounds nbzd-3 and nbzd-8 were found to be most active among all compounds. among all the synthesized derivatives, compounds nbzd-13, and nbzd-17 were found to be most active among all compounds using thiosemicarbazide induced model. none of the synthesized compounds were found to be neurotoxic at a dose of 30 mg / kg b.w among all the tested compounds. the compounds nbzd-1, nbzd-3, nbzd-4, nbzd-7, nbzd-11, nbzd-12, nbzd-14, nbzd-15, nbzd-17, nbzd-20, nbzd-21 were found to cause sedation. although nbzd-8, nbzd-10, and nbzd-18 are the compounds which had shown good anticonvulsant activity and have an advantage over that, they were not sedative. sulfated zirconia is one of the important agent that has attracted much attention recently because of its superacidity, nontoxicity, and low cost. sulfated zirconia catalyzes many reactions under very mild condition in vapor as well as liquid phase. highly active : nbzd-3, nbzd-8, nbzd-13, and nbzd-18.moderately active : nbzd-1, nbzd-6, nbzd-10, nbzd-11, nbzd-12, and nbzd-16, nbzd-21.less active : nbzd-4, nbzd-7, nbzd-9, nbzd-14, nbzd-15, nbzd-17, nbzd-19, and nbzd- 20. highly active : nbzd-3, nbzd-8, nbzd-13, and nbzd-18. moderately active : nbzd-1, nbzd-6, nbzd-10 less active : nbzd-4, nbzd-7, nbzd-9, nbzd-14, nbzd-15, nbzd-17, nbzd-19, and nbzd- 20. most functional subtypes of the gabaa receptor contain,, subunits, with the different benzodiazepine binding site ligands. bz - binding site ligands act through mechanisms which modulate the inhibiting effects of gaba.in the basic structure of benzodiazepine, early sar studies indicated that the seven - membered imino ring b was essential for its affinity towards the bz- binding site.4 - 5 carbimino double bond has also been shown to substantially contribute to the binding affinity of compound. it acts as a two - electron donor site.the primary chemical moieties of the compounds which contribute to high receptor binding affinity are restricted to positions 7, 2, 1.position 2 is the most effective place. presence of an electrophilic and bulky substituent at position 2 results in strong increase in receptor binding affinity of the corresponding compounds.compounds nbzd-3 and nbzd-8 had shown good anticonvulsant activity as they have cyclohexane ring at position 2.molar refractivity is the most important parameter at position 1, suggesting that the molecular size of the substituent needs to be restricted at position 1 for effective ligand binding. compounds nbzd-1 and nbzd-8 have less substituent as compared to other and hence more active.compounds nbzd-6, nbzd-10, and nbzd-11 were found to be moderately active anticonvulsant action, hence this shows that chloro - substituted derivatives are rather good anticonvulsant agent as compared to nitro - substituted derivatives.among these synthesized compounds which have methyl groups at the 2nd and 4th position, nbzd-13, and nbzd-18 were found to be most active. hence it shows that good activity compounds are preferred with less substitution the at 1st position. in the basic structure of benzodiazepine, early sar studies indicated that the seven - membered imino ring b was essential for its affinity towards the bz- binding site. 4 - 5 carbimino double bond has also been shown to substantially contribute to the binding affinity of compound. the primary chemical moieties of the compounds which contribute to high receptor binding affinity are restricted to positions 7, 2, 1. presence of an electrophilic and bulky substituent at position 2 results in strong increase in receptor binding affinity of the corresponding compounds.compounds nbzd-3 and nbzd-8 had shown good anticonvulsant activity as they have cyclohexane ring at position 2. presence of an electrophilic and bulky substituent at position 2 results in strong increase in receptor binding affinity of the corresponding compounds. molar refractivity is the most important parameter at position 1, suggesting that the molecular size of the substituent needs to be restricted at position 1 for effective ligand binding. compounds nbzd-1 and nbzd-8 have less substituent as compared to other and hence more active. compounds nbzd-6, nbzd-10, and nbzd-11 were found to be moderately active anticonvulsant action, hence this shows that chloro - substituted derivatives are rather good anticonvulsant agent as compared to nitro - substituted derivatives. among these synthesized compounds which have methyl groups at the 2nd and 4th position, nbzd-13, and nbzd-18 hence it shows that good activity compounds are preferred with less substitution the at 1st position.
|
benzodiazepines have a various behavioral effects in addition to their anxiolytic action. there is every reason to believe that the bz / gaba receptor complex is involved in these effects, since gabamimetic manipulations modify the effect of bz in tests of convulsive activity, motor function, and appetitive behavior. 1,5-benzodiazepines are biologically important molecules and are extensively used clinically as analgesic, hypnotic, sedative, and antidepressive agents. hence, 1,5-benzodiazepines were synthesized by condensation of o - phenylenediamine and ketones, for example, cyclohexanone and acetone in presence of sulfated zirconia (catalyst). mannich bases were synthesized with acetophenone, p - nitroacetophenone, p - chloroacetophenone, and formaldehyde. schiff bases were synthesized using mannich base of 1,5-benzodiazepines with p - chloroaniline and p - chlorophenylsemicarbazide in the presence of glacial acetic acid. all the synthesized compounds were characterized by 1h nmr and ir spectral analyses. all the synthesized derivatives were evaluated at the dose of 30 mg / kg b.w for anticonvulsant activity by isoniazid induced convulsion model, and the compounds nbzd-3 and nbzd-8 were found to be the most active among all compounds. among all the synthesized derivatives, compounds nbzd-13 and nbzd-17 were found to be the most active among all compounds using thiosemicarbazide induced model. although nbzd-8, nbzd-10, and nbzd-18 are the compounds which had shown good anticonvulsant activity and have an advantage over that, they were not sedative.
|
indicated numbers of nave gbt - i transgenic cd8 t cells from the spleens of cd45.1gbt - i or cd45.1cxcr3 gbt - i mice were adoptively transferred into recipient mice. in some experiments, the donor cells were labeled with 0.05 m cfse (invitrogen) before transfer. cd4 t cells from recipient mice were depleted by injection of 200 g of gk1.5 antibody (> 99.5 % depletion). depo - proveratreated 68 weeks - old female recipient mice were infected intravaginally (ivag) with 10 pfu of 186tkkpn (tk hsv-2)9 or with uninfected vero lysate (mock infection) control as described previously10. effector ctls were isolated from the spleen at 6 days post infection, and transferred into day 4 hsv-2-infected recipients. the numbers of cd45.1 gbt - i cells in the primary or secondary hosts were analyzed by flow cytometry. single suspensions were prepared from each experimental group using modified protocol as described21. to analyze chemokine receptor expression, the h-2k - gb498 - 505 tetramer used here was prepared by nih tetramer core facility. samples were acquired on a facscaliber (bd bioscience) and analyzed with flowjo software (treestar). the amount of cytokine / chemokine in the vaginal wash was measured using a multiplex luminex beads assay (millipore) or elisa according to manufacturers instructions. indicated numbers of nave gbt - i transgenic cd8 t cells from the spleens of cd45.1gbt - i or cd45.1cxcr3 gbt - i mice were adoptively transferred into recipient mice. in some experiments, the donor cells were labeled with 0.05 m cfse (invitrogen) before transfer. cd4 t cells from recipient mice were depleted by injection of 200 g of gk1.5 antibody (> 99.5 % depletion). depo - proveratreated 68 weeks - old female recipient mice were infected intravaginally (ivag) with 10 pfu of 186tkkpn (tk hsv-2)9 or with uninfected vero lysate (mock infection) control as described previously10. effector ctls were isolated from the spleen at 6 days post infection, and transferred into day 4 hsv-2-infected recipients. the numbers of cd45.1 gbt - i cells in the primary or secondary hosts were analyzed by flow cytometry. single suspensions were prepared from each experimental group using modified protocol as described21. to analyze chemokine receptor expression, the h-2k - gb498 - 505 tetramer used here was prepared by nih tetramer core facility. samples were acquired on a facscaliber (bd bioscience) and analyzed with flowjo software (treestar). the amount of cytokine / chemokine in the vaginal wash was measured using a multiplex luminex beads assay (millipore) or elisa according to manufacturers instructions.
|
cd4 + t helper cells are well known for their role in providing critical signals during priming of cytotoxic cd8 + t lymphocyte (ctl) responses in vivo. t help is required for the generation of primary ctl responses as well as in promoting protective cd8 + memory t cell development1. however, the role of cd4 help in the control of ctl responses at the effector stage is unknown. here, we show that fully helped effector ctls are not themselves self - sufficient for entry into the infected tissue, but rely on the cd4 + t cells to provide the necessary cue. cd4 + t helper cells control the migration of ctl indirectly through the secretion of ifn- and induction of local chemokine secretion in the infected tissue. our results reveal a previously unappreciated role of cd4 help in mobilizing effector ctl to the peripheral sites of infection where they help to eliminate infected cells.
|
many studies have documented increased atherogenic risk in adults with growth hormone (gh) deficiency, as reflected by visceral obesity, hyperlipidemia, increased intima - media thickness, increased frequency of atherogenic plaques in the carotid arteries and vascular endothelial dysfunction (1,2,3,4,5,6). these changes may start to develop in childhood and progress with age in gh - deficient patients, resulting in increased morbidity and mortality from cardiovascular disease in adults with gh deficiency (7, 8). the high mortality rate in gh - deficient patients becomes similar to the level of the normal population after gh replacement therapy (8). recently, analysis of a nationwide autopsy database in japan also revealed that cerebrovascular disease rates were higher in patients with hypopituitarism than in age- and gender - matched control populations (9). there are, however, few reports on lipid profiles in japanese children with gh deficiency (10,11,12,13). in this study, we investigated changes in lipid profiles and atherogenic risk in gh - deficient children during gh treatment to evaluate whether gh replacement therapy has beneficial effects on risk factors for cardiovascular disease. in total, 158 japanese children with gh deficiency (103 boys 3.4 to 16.4 yr of age ; 55 girls 4.7 to 12.5 yr of age) who had been enrolled in the pfizer international growth database (kigs) japan were studied during 3 yr of gh treatment, with a weekly dose of 0.175 mg / kg of body weight. gh deficiency had been diagnosed in all patients based on a peak gh level of less than 10 ng / ml, as determined with a conventional kit (recombinant gh was not the standard) in at least two provocative tests. all patients were euthyroid and prepubertal, and none had any signs of puberty during the entire study period. patients were excluded from the study if they had reported receiving gh treatment and/or gonadal steroid replacement within the past years. total cholesterol (tc), high - density lipoprotein cholesterol (hdlc), low - density lipoprotein cholesterol (ldlc) and atherogenic index (tc / hdlc ratio) (10) were evaluated before treatment and then annually during the 3 yr of gh treatment. responses to gh treatment were assessed using anova for repeated measures. when the f value was significant (p<0.05), pairs of treatment time periods were compared using dunnett s t test. at the start of gh treatment, the mean tc levels were within the normal ranges, 172.7 32.6 in boys and 182.2 33.2 in girls (table 1). seventeen of the 103 boys (16.5%) and 18 of the 55 girls (32.7%), however, had tc levels greater than 200 mg / dl (fig. 1fig. 1 change in total cholesterol (tc) compared by baseline tc and sex. and : p<0.05 and p<0.01 vs. baseline by analysis of covariance, respectively.). this rate was higher than that in a study of hisayama school - aged children in whom no more than 510% had tc above 200 mg / dl (14). table 1 change in lipid profile and atherogenic indexitemsexpatient no.baselineyr 1yr 2yr 3tc (mg / dl)male103172.7 32.6169.9 30.0168.6 26.0167.3 27.0female55182.2 33.2178.8 32.8171.2 35.0170.5 29.2 200 mg / dlmale17228.3 24.4206.6 24.0199.3 27.8200.8 25.8female18220.7 17.6213.0 26.2205.1 31.5 198.6 25.2 < 200 mg / dlmale86161.7 20.6162.6 25.4162.5 20.9160.7 22.0female37163.5 20.0162.1 20.6154.8 22.7 156.8 19.7ldlc (mg / dl)male1388.5 29.989.1 27.887.5 23.379.8 16.1female5106.6 31.896.2 30.999.4 24.185.8 28.2hdlc (mg / dl)male1357.7 10.362.8 13.962.8 16.156.8 11.8female565.0 20.565.0 23.868.6 18.365.4 21.7atherogenic indexmale113.15 0.653.14 0.752.92 0.742.97 0.64female53.21 1.272.99 1.052.91 0.872.89 0.80 and : p<0.05 and p<0.01 (anova), respectively. tc : total cholesterol, ldlc : low - density lipoprotein cholesterol, hdlc : high - density lipoprotein cholesterol. change in total cholesterol (tc) compared by baseline tc and sex. and : p<0.05 and p<0.01 vs. baseline by analysis of covariance, respectively. and : p<0.05 and p<0.01 (anova), respectively. tc : total cholesterol, ldlc : low - density lipoprotein cholesterol, hdlc : high - density lipoprotein cholesterol. during treatment, the mean tc levels tended to decrease in both sexes, though to a statistically significant extent only in girls (p<0.01) (table 1). in a separate analysis, both boys and girls with tc levels over 200 mg / dl showed significantly decreased tc after the initiation of gh therapy (p<0.01) (fig. 1). on the other hand, those with tc levels under 200 mg / dl showed no changes in tc during the study period. ldlc decreased significantly only in girls (p<0.05), while hdlc showed no change in either sex. the atherogenic index decreased significantly only in girls with tc levels over 200 mg / dl (table 1). risk factors for cardiovascular disease, or a predisposition to the development of such factors, may be present in adolescence and even early childhood, and dyslipidemia is one of the major risk factors in gh - deficient patients (15). many studies have documented increased atherogenic risk, as reflected by visceral obesity and hyperlipidemia, in adults with gh deficiency (7, 8). criteria for normal cholesterol levels differ among populations (16). according to the new criteria for normal serum lipid levels in japanese children reported in a nationwide study, acceptable tc levels were less than 190 mg / dl, borderline levels were 190219 mg / dl and high levels exceeded 220 mg / dl (17). on the other hand, the cut - off points for tc levels in children and adolescents suggested by the american academy of pediatrics are as follows : acceptable levels are below 170 mg / dl, borderline levels are 170199 and elevated levels exceed 200 mg / dl (15). according to these criteria, we employed a tc level of at least 200 mg / dl as an indicator of hypercholesterolemia in children with gh deficiency. at the start of gh treatment, the mean tc levels were within the normal ranges in both boys and girls. this study, however, clearly demonstrated the rate of hypercholesterolemia, i.e., a tc level over 200 mg / dl, before gh treatment in children with gh deficiency to be much higher than that in the normal population : 16.5% in boys and 32.7% in girls with gh deficiency vs. 510% in hisayama school - aged controls (14). the rate of hypercholesterolemia (a tc level over 200 mg / dl) at the start of gh treatment was also reportedly as high as 18% in a long - term study of gh treatment effects on lipid metabolism in japanese children with gh deficiency (11). japanese adults with gh deficiency also reportedly had increased risks of cardio- and cerebrovascular morbidity and mortality as compared with the normal population (18, 19). severe hyperlipidemia may develop in gh - deficient adults, following a milder state during childhood, as a consequence of continuous gh deficiency. these metabolic abnormalities may result in increased morbidity and mortality from arteriosclerotic diseases (7, 8, 20,21,22). during gh treatment in our study, the mean tc levels tended to decrease in both boys and girls, though to a statistically significant extent only in girls. ldlc decreased significantly only in girls, while hdlc showed no changes in either sex. in an additional analysis, however, both boys and girls with tc levels over 200 mg / dl showed significantly decreased tc, while those with a tc level under 200 mg / dl showed no changes during gh therapy. the atherogenic index decreased significantly only in girls with tc levels over 200 mg / dl. these results indicate that gh replacement therapy has beneficial effects on atherogenic risks with a considerable gender difference, i.e., more beneficial effects on atherogenic risk were seen in girls than in boys. these results are in contrast to those of a previous report on japanese children with gh deficiency indicating that atherogenic risk factors improved during gh treatment and worsened after discontinuation of gh especially in boys, whereas the changes were somewhat equivocal in girls (11, 23). in addition, previous studies of adults with gh deficiency indicated that men are more responsive to gh treatment than women (24, 25). in our study, large baseline differences in tc levels between boys and girls, as reflected by the prevalence of hypercholesterolemia, i.e., a tc level over 200 mg / dl, being twice as common in girls, may be one of the reasons for gh being more effective in reducing atherogenic risks in girls. in fact, those with a tc level over 200 mg / dl showed no gender difference in tc reduction during gh therapy. it will be necessary to evaluate the severity of gh deficiency in future studies. gh functions as a major metabolic hormone by optimizing body composition and lipid metabolism. gh suppresses the accumulation of triglyceride in fat tissue by inhibiting lipoprotein lipase activity (26) and stimulates lipolysis by activating hormone sensitive lipase in fat cells (27). gh also regulates lipoprotein metabolism by enhancing clearance of low - density lipoprotein (ldl) through the expression of hepatic ldl receptors (28). cardiovascular mortality is increased in adults with hypopituitarism, and women are disproportionately affected, with etiologies of gh deficiency (8, 20,21,22) and untreated gonadotropin deficiency (22). the impact of gender on mortality rate is clear, but the underlying reasons remain obscure. the higher mortality rate in women may simply reflect that gh deficiency removed the natural survival advantage of women, who live longer than men in the general population. further studies concerning gender and pubertal factors are needed to elucidate the influences of gh on atherogenic risk factors in boys and girls with similar severities of gh deficiency. in conclusion, this study clearly demonstrated that risks of premature arteriosclerosis are already developing even in childhood in those with gh deficiency. gh replacement therapy has beneficial effects on lipid metabolism and atherogenic risk in these patients. early gh treatment, in addition to promoting growth, would thus produce lipid metabolism benefits in these patients.
|
growth hormone (gh) affects body composition and atherogenic risk factors. severe hyperlipidemia may develop in gh - deficient adults as a consequence of continuous gh deficiency. we investigated changes in lipid profiles in 158 japanese children (103 boys and 55 girls) with gh deficiency who had been enrolled in the pfizer international growth database japan during 3 yr of gh replacement therapy to evaluate whether gh treatment has beneficial effects on atherogenic risk factors. total cholesterol (tc), high - density lipoprotein cholesterol (hdlc), low - density lipoprotein cholesterol (ldlc) and atherogenic index were evaluated before treatment and then once a year during treatment. the mean baseline tc was within the normal range in both boys and girls. seventeen (16.5%) of the 103 boys and 18 (32.7%) of the 55 girls, however, had a tc level over 200 mg / dl before treatment. the mean tc level showed a significant decrease in girls. in a separate analysis, patients of both sexes with a tc level > 200 mg / dl showed significantly decreased tc. ldlc decreased significantly only in girls, while hdlc showed no change in either sex. the atherogenic index decreased significantly in girls. gh replacement therapy in children with gh deficiency had beneficial effects on lipid metabolism and atherogenic risk in both sexes. early gh treatment would produce lipid metabolism benefits in these patients.
|
saliva is known to play an important part in the maintenance of oral and systemic health and its absence affects the quality of life. individuals who suffer from salivary gland dysfunction are at risk for development of dental caries, periodontal diseases and fungal infection. a variety of medical conditions and medications can contribute to the development of salivary gland dysfunction. one such medical condition associated with xerostomia (subjective complaint of dry mouth) and salivary gland hypofunction (objective evidence of reduced salivary output) is the human immunodeficiency virus (hiv) infection. the prevalence of xerostomia and salivary gland hypofunction has been reported to be 210% in hiv - infected patients. numerous studies have reported an alteration of salivary gland function and composition in hiv patients in both early and advanced stages of infection. however, the evolution of antiretroviral therapy has altered the management of patients with hiv infection to the extent that hiv infection is now treated as a chronic disease. as of 2008, there are more than 20 approved antiretroviral drugs against hiv infection across five mechanistic classes. these include the nucleoside / nucleotide reverse transcriptase inhibitors, nonnucleoside reverse transcriptase inhibitors (nnrtis), protease inhibitors (pis), fusion inhibitors and integrase inhibitors. in contrast, there have been no reports on the oral effects of the latter two. when several antiretroviral drugs, typically three, are taken in combination to treat hiv infection, the approach is known as highly active antiretroviral therapy (haart). principally, haart increases cd4 + t - cell counts, decreases hiv ribonucleic acid (rna) viral load, improves immune status and decreases incidence of opportunistic infections. significant drop in incidence of oral lesions are noted after the introduction of antiretroviral therapy. on the negative side, orofacial adverse effects of haart are more common, especially with the use of nucleoside reverse transcriptase inhibitors (nrti), particularly, azidothymidine (azt). contemporary studies have disclosed an increased manifestation of oral warts, salivary gland enlargement and dry mouth in association with haart as a part of new phenomenon called immune restoration or reconstruction disease (ird). like some other groups of medicines (e. g. antibiotics, antidepressants and antihistamines), xerostomia and lipodystrophic change of the salivary glands however there is no conclusive evidence in the literature as to how these drugs can alter salivary secretion and composition. recent studies reveal that haart has adverse effects on salivary flow rate and yet there is no concrete evidence on salivary flow rate on long - term usage of haart therapy. hence, this study was undertaken to mainly emphasize on the long - term effect of haart therapy on saliva flow rate and its relation to cd4 count with unstimulated whole saliva and stimulated whole saliva. a cross - sectional study was performed at an ngo, recognized by department of science and industrial research (dsir), government of india. the study group comprised of 150 individuals divided into three groups with 50 subjects in each group. group i (50 hiv - seropositive patients, but not on haart therapy), group ii (50 hiv - infected subjects and on haart for a period of less than 3 years called short - term haart), group iii (50 hiv - infected subjects and on haart for a period of more than or equal to 3 years called long - term haart). cd4 + cell count and medications taken by the patient were obtained from the medical records. cd4 + cell count values recorded on the day of saliva collection or 1 week prior to the saliva collection were considered. unstimulated whole saliva and stimulated whole saliva was collected from each patient in all the three groups. inclusion criteria for study group included seropositive for hiv [as tested by the government, integrated counseling and testing center by three consecutive hiv rapid tests as per guidelines of national aids control organisation (naco) ], currently on haart and consented to participate in the study. exclusion criteria included hiv - infected subjects with a history of local radiation therapy of head and neck and severely - ill hiv - infected subjects who could not cooperate with the study procedure. the study protocol was approved by research committee at panineeya mahavidyalaya institute of dental sciences and research center, hyderabad. measurement of salivary flow rate was conducted only in the morning between 9 and 12 am. spitting method proposed by navazesh and kumar was used for the collection of unstimulated saliva into a sterile preweighted container for 10 min. stimulated saliva was collected by applying 2% citric acid on the dorsolateral surface and tip of the tongue every 30 seconds and the patient were asked to passively drain the saliva into a sterile preweighted container. this was done for 5 min and the total volume of saliva was recorded and expressed in ml / min. clinical diagnosis of hiv - related oral lesions (presence of orofacial pain, feeling of oral dryness and oral burning sensation) was made according to the criteria proposed by the ec - clearinghouse. analysis was done using statistical package for social sciences (spss) version 15 (spss inc, chicago, il, usa) windows software program. chi - square test was used for comparing the frequency and analysis of variance (anova) was used for comparing the means of both groups. the study protocol was approved by research committee at panineeya mahavidyalaya institute of dental sciences and research center, hyderabad. measurement of salivary flow rate was conducted only in the morning between 9 and 12 am. spitting method proposed by navazesh and kumar was used for the collection of unstimulated saliva into a sterile preweighted container for 10 min. stimulated saliva was collected by applying 2% citric acid on the dorsolateral surface and tip of the tongue every 30 seconds and the patient were asked to passively drain the saliva into a sterile preweighted container. this was done for 5 min and the total volume of saliva was recorded and expressed in ml / min. clinical diagnosis of hiv - related oral lesions (presence of orofacial pain, feeling of oral dryness and oral burning sensation) was made according to the criteria proposed by the ec - clearinghouse. analysis was done using statistical package for social sciences (spss) version 15 (spss inc, chicago, il, usa) windows software program. chi - square test was used for comparing the frequency and analysis of variance (anova) was used for comparing the means of both groups. the study population comprised of 150 hiv - seropositive patients aged between 20 and 50 years. group i (hiv - seropositive patients and not on haart therapy) included 21 (42%) males and 29 (58%) females (mean age - 34.22 7.88), group ii (hiv - infected subjects and on haart for a period of less than 3 years called short - term haart) had 15 (30%) males and 35 (70%) females (mean age - 34.92 7.01) and in group iii (hiv - infected subjects and on haart for a period of more than or equal to 3 years called long - term haart) comprised of 18 (36%) males and 32 (64%) females (mean age - 36.28 6.72). majority of the patients were females (64%), which was statistically significant between the groups (p 0.05). mean cd4 count vs unstimulated and stimulated whole saliva anova was performed between cd4 count and uws and sws in each group. in group i, both uws and sws (p > 0.05) was found to be not so significant with cd4 count. in group ii, uws (p 0.05). various studies have concluded that haart has adverse effect on salivary gland function and salivary flow rates, yet it is not quantified based on duration of haart therapy. in our present study, uws and sws flow rates were compared among short and long duration usage of haart therapy with hiv infected individuals. it was found that both uws and sws flow rates of hiv - infected subjects without haart (group i) were found to be significantly higher than in those with short - term use of haart (group ii) (p < 0.05), whereas, uws flow rate between subjects with short - term haart (group ii) and long - term haart (group iii) were also found to be statistically significant (p < 0.05). results in the present study were not conforming with an earlier study conducted by lin., (2006) where there was no significant difference in the salivary flow rates between subjects on haart and those who are not on haart therapy. the present study demonstrate duration of haart as a factor affecting salivary flow which was not considered in previous studies. evidence of reduction in salivary flow rate (both stimulated and unstimulated salivary flow rates) were found in hiv - infected subjects in early stages of the disease process by schiodt. one recent longitudinal report indicated that haart was a risk factor for lower flow rates of unstimulated and chewing - stimulated whole saliva in an interagency population of women with hiv. 2003 have suggested that these types of individuals are at a significantly higher risk for salivary gland enlargement and salivary gland hypofunction which may alter the composition of saliva. this may also be attributed to hiv infection itself and/or due to consequent immunosuppression or the effect of drugs in haart. in contrast to our observation, a study in developing countries reported no changes in the prevalence of salivary gland enlargement. a diffuse infiltration of lymphocytes within the salivary gland [also called diffuse infiltrative lymphocytosis syndrome (dils) ] have been reported in patients with human immunovirus - associated salivary gland disease (hiv - sgd) process which is responsible for salivary gland dysfunction. our study demonstrated that long - term use of haart had adverse effects on oral health status of the subjects., who have also reported that oral symptoms were frequently observed among hiv - infected individuals. however, a study by nittayananta., showed greater risks of having orofacial pain, oral dryness and oral lesions in hiv - infected subjects who were not on haart than those with haart. similarly, greenspan., 2004 have reported the effectiveness of haart in the reduction of incidence of oral damage. this may be attributed to an increase in cd4 cell count, lower viral loads and direct inhibition by pis. among haart regime, pis are group of drugs which causes lipodystrophic changes in parotid salivary gland which is ultimately responsible for xerostomia - like symptoms and reduced salivary flow rates. in a study on effect of haart on salivary gland function in hiv - infected women done by navazesh., found that haart with pis cause significant reduction in salivary flow rates (both stimulated and unstimulated) when compared to hiv - infected subjects who are not on haart therapy., in which most of the subjects on haart did not have pi in their regime. but in indian scenario, pi - based therapy is only used in second regime when first regimen of drugs fails according to guidelines of naco. so subjects in the present study were on first - line haart therapy according to naco guidelines which mostly uses 2 nrti + 1 nnrtis. the most common drugs being used in first - line regime are zidovudine, lamivudine, nevirapine and stavudine. the present study reports for the first time the effect of salivary flow rate in hiv patients on haart, in relation to duration of usage of the antiretroviral drugs in indian scenario. however, further studies of patients in the advanced stages of hiv disease and/or a longitudinal evaluation of salivary gland function in hiv patients is necessary to delineate the beneficial / deleterious effects of haart on salivary gland function and oral health. patients living with the hiv and on haart had a reduced rate of salivary flow than the group not on haart. the reduction in cd4 cell counts were significantly associated with reduced salivary flow rates in hiv - infected individuals who are on haart for duration longer than 3 years.
|
objectives : to determine if long - term highly active antiretroviral therapy (haart) therapy alters salivary flow rate and also to compare its relation of cd4 count with unstimulated and stimulated whole saliva.materials and methods : a cross - sectional study was performed on 150 individuals divided into three groups. group i (50 human immunodeficiency virus (hiv) seropositive patients, but not on haart therapy), group ii (50 hiv - infected subjects and on haart for less than 3 years called short - term haart), group iii (50 hiv - infected subjects and on haart for more than or equal to 3 years called long - term haart). spitting method proposed by navazesh and kumar was used for the measurement of unstimulated and stimulated salivary flow rate. chi - square test and analysis of variance (anova) were used for statistical analysis.results:the mean cd4 count was 424.78 187.03, 497.82 206.11 and 537.6 264.00 in the respective groups. majority of the patients in all the groups had a cd4 count between 401 and 600. both unstimulated and stimulated whole salivary (uws and sws) flow rates in group i was found to be significantly higher than in group ii (p < 0.05). unstimulated salivary flow rate between group ii and iii subjects were also found to be statistically significant (p < 0.05). anova performed between cd4 count and unstimulated and stimulated whole saliva in each group demonstrated a statistically significant relationship in group ii (p < 0.05). there were no significant results found between cd4 count and stimulated whole saliva in each groups.conclusion:the reduction in cd4 cell counts were significantly associated with salivary flow rates of hiv - infected individuals who are on long - term haart.
|
the management of condylar fractures has long been and still continues to be a matter of much debate and controversy. open reduction and internal fixation is the most widely advocated and currently practised treatment option in majority of the centres throughout the world, as it helps in accurate anatomical reduction of condyle and faster rehabilitation of the patient to normal lifestyle with minimum occlusal and temporomandibular joint problems. but in certain patients with severe anteromedial displacement of the condylar segment, the mandibular ramus gets telescoped into the glenoid fossa due to the pull of the pterygomasseteric muscular component in an upward direction. in these situations, it is difficult to locate, reduce and fix condylar segments in their accurate relationship with the ramus. free grafting or extracorporeal fixation of traumatically displaced mandibular condyles has been described as a surgical option to overcome these problems. this involves stripping lateral pterygoid and capsular attachments to the condylar stump, retrieving it out of the body, fixing and adapting a plate outside the body, followed by retransplantation in to glenoid fossa and fixation to the ramus of the mandible. a vertical ramus osteotomy has also been used to locate, retrieve and fix the proximal stump. majority of the published studies on extracorporeal fixation of condyle fractures have used a submandibular approach. but the problems with this approach are the depth of dissection to reach condylar neck / head, difficulty in visibility and access leading to oblique angulation of drilling and screw fixation and the possible need of a ramus osteotomy. preauricular approaches with exposure of the facial nerve have been studied with reported complications such as facial nerve palsy affecting the buccal branches in 20% of the cases with salivary fistula, sialoceles and frey 's syndrome as with all procedures based on incision of the parotid gland. the transmasseteric anteroparotid (tmap) approach overcomes the above problems with dissection along subdermal fat plane till the anterior edge of the parotid gland. the gland is then retracted posteriorly followed by stripping of masseter fibres to reach the fracture site. to our knowledge, this is the first study to evaluate the use of preauricular tmap (p - tmap) for extracorporeal fixation of mandibular condylar fractures. patients who were treated for mandibular condyle fractures between january 2009 and december 2011, who satisfied the following inclusion criteria, were included in the study. patients above 15 years of age, with displaced / dislocated unilateral or bilateral condyle fractures treated by open reduction and extracorporeal fixation only, with co - existing fractures of the mandible and other facial bones, who had follow - up data available (minimum 6 months, maximum 36 months and average 15 months). a clinical case record search of patients operated during that period revealed seven patients (six males and one female), ages ranging from 16 years to 52 years (average 31.7 years) who underwent extracorporeal fixation of condyle fractures through p - tmap incision were included in the study. all the fractures were classified according to lindahl 's comprehensive classification system as condylar head or neck fractures with displacement and dislocation [table 1 ]. computed tomography (ct) scans of facial skeleton were taken for all the patients to aid in the diagnosis and treatment planning, in addition to thorough clinical examination [figure 1a c ]. patient characteristics (a) displaced and dislocated condylar fracture on a reconstructed ct scan (b) coronal section ct showing antero - medially displaced and dislocated condylar neck fracture and telescoping of the ramus superiorly due to pterygomasseteric pull (c) preoperative clinical picture showing severely deranged occlusion due to grossly displaced fractures of mandibular condyle, symphysis and anterior dentoalvoelar region the following patient treatment and follow - up data were analysed. the type of condylar fracture, other fractures of the mandible and facial bones, adequacy of anatomical reduction, postoperative facial nerve function, occurrence of sialocele, frey 's syndrome, infection at operated site. visibility and ease of access were rated as good, fair and poor by the operating surgeon. all the coexisting fractures of the mandible were fixed first, to establish the continuity of the mandibular arch, followed by fixation of condyle fractures. a preauricular incision with a curvilinear extension in the retromandibular or cervicomastoid skin crease was made [figure 2a ]. dissection was done in the subdermal fat plane just above the superficial musculo - aponeurotic (smas) layer till the anterior margin of the parotid gland [figure 2b ]. along the anterior border of the gland, just below the parotid duct, the gland is gently retracted posteriorly to expose the masseter muscle fibres [figure 2c ], which were then divided in the direction parallel to the course of facial nerve branches to expose the periosteum overlying the ramus and condyle. (a) preauricular incision with retromandibular extension. the inferior limb of incision can be modified to include either a cervicomastoid or rhytidectomy extension as per individual needs. (b) subcutaneous is dissection along subdermal fat plane, just superficial to the smas layer till the anterior border of parotid gland. (c) anterior border of parotid gland () is gently retracted posteriorly to expose the masseter muscle (), which is divided in fashion parallel to facial nerve branches leading to exposure of periosteum overlying ramus of mandible (d) subperiosteal dissection exposes the ramus and fracture of condyle of mandible intentional dissection to identify facial nerve branches was not done. buccal branch was the only terminal branch of the facial nerve that was encountered (in two patients only), it was gently retracted either superiorly or inferiorly. after exposure of the fracture, attempts were made to reduce the anteromedially displaced and dislocated condylar stump into its anatomical position and fix it by conventional intracorporeal fixation. the methods employed in trying to achieve this included : a) wedging periosteal elevators between condyle and ramus, simultaneously displacing ramus inferiorly and relocating the condyle. b) the assistant surgeon disimpacts the upwardly displaced ramus in an inferior direction by bi - manual inferior traction (with thumbs of both hands placed intraorally on molar teeth while the other fingers hold the lower border of the mandible extra - orally). c) through the inferior limit of the incision lower part of the mandibular angle is exposed and a trans - osseous wire is placed on angle to give inferior traction on ramus, thereby providing better access and visibility to reduce displaced condylar head. after all attempts at reduction of the condyle fracture by conventional methods have failed, the decision to do extracorporeal fixation was taken intraoperatively, as a last resort. the condyle was stripped free of its attachments from the lateral pterygoid muscle and capsular attachments, and it was retrieved from the body. it was placed on the sterile surgical trolley and a four - hole miniplate was adapted and fixed to its posterior border using 2 mm 8 mm length monocortical screws under copious saline irrigation [figure 3a ]. the condylar segment was replaced into the glenoid fossa, ensuring continuity of anterior and posterior borders of the mandible that was fixed to the ramus [figure 3b ]. (a) extracorporeal fixation of retrieved mandibular condyle (b) reimplantation and fixation of condyle to ramus all the coexisting fractures of the mandible were fixed first, to establish the continuity of the mandibular arch, followed by fixation of condyle fractures. a preauricular incision with a curvilinear extension in the retromandibular or cervicomastoid skin crease was made [figure 2a ]. dissection was done in the subdermal fat plane just above the superficial musculo - aponeurotic (smas) layer till the anterior margin of the parotid gland [figure 2b ]. along the anterior border of the gland, just below the parotid duct, the gland is gently retracted posteriorly to expose the masseter muscle fibres [figure 2c ], which were then divided in the direction parallel to the course of facial nerve branches to expose the periosteum overlying the ramus and condyle. (a) preauricular incision with retromandibular extension. the inferior limb of incision can be modified to include either a cervicomastoid or rhytidectomy extension as per individual needs. (b) subcutaneous is dissection along subdermal fat plane, just superficial to the smas layer till the anterior border of parotid gland. (c) anterior border of parotid gland () is gently retracted posteriorly to expose the masseter muscle (), which is divided in fashion parallel to facial nerve branches leading to exposure of periosteum overlying ramus of mandible (d) subperiosteal dissection exposes the ramus and fracture of condyle of mandible intentional dissection to identify facial nerve branches was not done. buccal branch was the only terminal branch of the facial nerve that was encountered (in two patients only), it was gently retracted either superiorly or inferiorly. after exposure of the fracture, attempts were made to reduce the anteromedially displaced and dislocated condylar stump into its anatomical position and fix it by conventional intracorporeal fixation. the methods employed in trying to achieve this included : a) wedging periosteal elevators between condyle and ramus, simultaneously displacing ramus inferiorly and relocating the condyle. b) the assistant surgeon disimpacts the upwardly displaced ramus in an inferior direction by bi - manual inferior traction (with thumbs of both hands placed intraorally on molar teeth while the other fingers hold the lower border of the mandible extra - orally). c) through the inferior limit of the incision lower part of the mandibular angle is exposed and a trans - osseous wire is placed on angle to give inferior traction on ramus, thereby providing better access and visibility to reduce displaced condylar head. after all attempts at reduction of the condyle fracture by conventional methods have failed, the decision to do extracorporeal fixation was taken intraoperatively, as a last resort. the condyle was stripped free of its attachments from the lateral pterygoid muscle and capsular attachments, and it was retrieved from the body. it was placed on the sterile surgical trolley and a four - hole miniplate was adapted and fixed to its posterior border using 2 mm 8 mm length monocortical screws under copious saline irrigation [figure 3a ]. the condylar segment was replaced into the glenoid fossa, ensuring continuity of anterior and posterior borders of the mandible that was fixed to the ramus [figure 3b ]. (a) extracorporeal fixation of retrieved mandibular condyle (b) reimplantation and fixation of condyle to ramus of the seven patients involved in the study, six patients were males and one was female. five patients had condylar neck fractures and two patients had fractures of condylar head [table 1 ]. their age ranged from 16 years to 52 years with a mean age of 31.7 years. all the seven patients in the study had unilateral severely displaced or dislocated high condylar neck or head fractures associated with deranged occlusion, facial asymmetry, restricted mouth opening and radiographic evidence of shortening of the ramus. the follow - up period ranged from 7 months to 2 years, 4 months with an average follow - up of 15 months. visibility and access to carry out extracorporeal fixation was good through p - tmap approach in all the patients. buccal branch was the only branch of facial nerve encountered and was seen in only two patients. only one patient had transient weakness of the buccal branch that had improved spontaneously by 3 months. anatomical reduction and stability of fixation were good in all the patients [figure 4a and b ]. normal occlusion and mouth opening were restored in all the patients [figure 5a and b ]. healing of the incision was satisfactory in all the patients [figure 6a ]. at the last follow - up visit, all the patients had normal facial nerve function [figure 6b and c ]. no other gland related complications, such as sialocele or frey 's syndrome, were encountered. (b) eight months postoperative orthopantomogram showing stable position of condylar head (a and b) eight months postoperative restoration of normal occlusion and good mouth opening (a) good postoperative healing of incision eight months postoperative. despite the lack of a general consensus on the ideal method of condylar fracture management, there is a growing tendency towards open method of treatment as it permits accurate anatomical reconstruction of the condyle and faster rehabilitation of the patient to normal life style. potential complications and risks associated with the surgical procedure are still a matter of concern for maxillofacial surgeons. visibility and access to the fracture line is sometimes very limited in some of the most commonly followed incisions such as risdon 's submandibular, retromandibular incisions, as they are placed far off from the fracture site, demanding strong soft tissue retraction that can also increase the risk of facial nerve damage ranging from 30% to 48%. improper access is the cause for oblique angulation of screw placement that can jeopardize the plate adaptability and stability of fixation. studies on the branching pattern of extracranial course of facial nerve have shown that the cross anastomosis between the branches of the upper division is considerably high than that between those of lower divisions. the incidence of cross anastomosis between the zygomatic and buccal branches is 87100%, whereas the marginal mandibular nerve receives anastomotic branches in only 016% of cases. the transmasseteric anteroparotid approach introduced by wilson minimized these potential complications and improved surgical exposure. a preauricular incision with an inferior cervo mastoid / retromandibular or rhytidectomy extension was made as per the preference of the surgeon or patient 's needs. wilson reported no case of postoperative facial palsy, but on a series only based on a total of three patients each of them had bilateral fracture condyle. the same p - tmap approach was used in our case series of seven patients, of whom only one had transient buccal branch palsy that improved spontaneously within 3 months. in this approach, buccal and the zygomatic branches are the only branches normally encountered (if any at all), their retraction, given their excellent cross anastamoses, is inherently less risky. the same concept of tmap approach was described using high cervical approach by trost. and lutz. who used it for condylar fracture reduction and fixation. both the studies reported good access and very low complication rate with the approach when used for subcondylar fractures. reduction of high condylar neck or head fracture with severe displacement and dislocation is a challenging task, as the lateral pterygoid muscle pulls the fractured fragment of the condylar head anteromedially. in these situations, detachment of the condylar head and free grafting or extracorporeal fixation is used a last resort. this is used for satisfactory repositioning of the condyle, because the lateral fragment can obstruct the surgeon 's view and manipulation of the displaced medial fragment. majority of the published studies in the literature have used submandibular or retromandibular incision for extracorporeal fixation. retrieval of the condyle and refixing it through submandibular or retromandibular incisions is a daunting task because of the depth of dissection required to reach the condyle and abnormal angulation of screws. to overcome these problems, fixation reported the use of vertical subsigmoid osteotomy in three patients to retrieve the medially displaced condyle. nam 's method, which includes vertical ramus osteotomy, extraoral reduction and fixation of the fractured condyle to the osteotomy fragment, and re - fixation of the ramus. however, this extracorporeal fixation procedure requires detachment of all soft tissue from the medial fragment, thereby leading to potential complications such as avascular necrosis of condyle stump and the osteotomized ramus segment. reported a similar study involving 21 patients with displaced and dislocated condylar fractures that were treated with free grafting of the mandibular condyle with vertical ramus osteotomy, through a submandibular approach. they observed a complication rate of 12% (8%resorption of the condyle, 4%fracture of plate). conventional or intra - corporeal fixation beyond doubt is the ideal method that gives optimal healing of condylar fractures. but, in clinical situations where this is not feasible, extracorporeal fixation is considered as the last resort. though free grafting or extracorporeal fixation permits near accurate anatomical reduction and fixation, it is not free of problems. complications, such as avascular necrosis, resorption of condyle, temporomandibular joint (tmj) pain, dysfunction, screw loosening, re - displacement of fracture, have been reported. the performance of a ramus osteotomy increases the chances of avascular necrosis, because in addition to condylar head, ramus segment also acts as a free graft and its revascularisation and survival is risky. the factors that affect the vascularisation and survival of free grafted condyle are as follows : a) time taken for extracorporeal fixation, b) the number of free grafted segments of bone segments, c) damage to the condylar head that contains cancellous marrow. however, in our case series, the need for osteotomy of the ramus did not arise as the p - tmap incision provided a good straight - line access for the retrieval, repositioning and refixing of the condyle. the p - tmap approach provides good access to medially displaced condylar fractures, and if the need arises for extracorporeal fixation, it facilitates retrieval, transplantation, repositioning and fixing the condyle can also reduce the chances of requirement of a vertical ramus osteotomy. it gives straight - line access to the proximal stump and ramus thereby permitting perpendicular placement of the screws. the risk of permanent facial nerve injury is very low compared with retromandibular and submandibular approaches owing to the excellent cross anastomosis in the upper branches of the facial nerve. other salivary complications as salivary fistula and frey 's syndrome are rare as intraglandular dissection is avoided. as the incision merges with preauricular and cervicomastoid skin creases, it is cosmetically acceptable. the authors certify that they have obtained all appropriate patient consent forms. in the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal. the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity can not be guaranteed. the authors certify that they have obtained all appropriate patient consent forms. in the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal. the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity can not be guaranteed.
|
introduction : free grafting or extracorporeal fixation of traumatically displaced mandibular condyles is sometimes required in patients with severe anteromedial displacement of condylar head. majority of the published studies report the use of a submandibular, retromandibular or preauricular incisions for the access which have demerits of limited visibility, access and potential to cause damage to facial nerve and other parotid gland related complications.purpose:this retrospective clinical case record study was done to evaluate the preauricular transmasseteric anteroparotid (p - tmap) approach for open reduction and extracorporeal fixation of displaced and dislocated high condylar fractures of the mandible.patients and methods : this retrospective study involved search of clinical case records of seven patients with displaced and dislocated high condylar fractures treated by open reduction and extracorporeal fixation over a 3-year period. the parameters assessed were as follows : a) the ease of access for retrieval, reimplantation and fixation of the proximal segment ; b) the postoperative approach related complications ; c) the adequacy of anatomical reduction and stability of fixation ; d) the occlusal changes ; and the e) tmj function and radiological changes.results:accessibility and visibility were good. accurate anatomical reduction and fixation were achieved in all the patients. the recorded complications were minimal and transient. facial nerve (buccal branch) palsy was noted in one patient with spontaneous resolution within 3 months. no cases of sialocele or frey 's syndrome were seen.conclusion:the p - tmap approach provides good access for open reduction and extracorporeal fixation of severely displaced condylar fractures. it facilitates retrieval, transplantation, repositioning, fixing the condyle and also reduces the chances of requirement of a vertical ramus osteotomy. it gives straight - line access to condylar head and ramus thereby permitting perpendicular placement of screws with minimal risk of damage to the facial nerve.
|
type 2 diabetes mellitus (t2d) afflicts 387 million people worldwide and costs 1 out of every 9 dollars spent on healthcare in the united states. t2d is characterized by hyperglycemia in the context of insulin resistance (ir), the inability of normal concentrations of insulin to produce its usual biological actions. in terms of glucose metabolism, the liver, muscles, and adipose tissue are resistant to consuming glucose and/or suppressing hepatic gluconeogenesis. while multiple factors contribute to ir, chronic, low - grade inflammation in adipose tissue is widely viewed as one of the major contributors. a recurring theme in obesity - associated ir concerns a shift in the balance between proinflammatory and anti - inflammatory signals such that proinflammatory cells and mediators are present in excess. multiple studies have identified elevated production of proinflammatory cytokines, such as tnf-, il-1, and ifn-, which can impede insulin signaling in obesity and diabetes [47 ]. conversely, protection of insulin sensitivity has been shown to be mediated by anti - inflammatory cytokines, such as il-10 and il-4 [8, 9 ]. as adipocytes enlarge in obese individuals, they become hypoxic and eventually undergo cell death [10, 11 ]. this process also triggers the production of proinflammatory cytokines which attract immune cells to clear necrotic debris. much of the research in the field has focused on macrophages, which have the ability to phagocytose lipids and debris and polarize into proinflammatory specifically, m2 macrophages help maintain insulin sensitivity in lean adipose tissue while m1 macrophages worsen inflammation [3, 1416 ]. other innate immune cells that have been implicated are mast cells, neutrophils, and dendritic cells which exacerbate ir, eosinophils, and innate lymphoid cells, which appear to be protective. recent evidence has also revealed important roles for cells of the adaptive immune system, b and t lymphocytes, in ir. like macrophages, lymphocytes can be divided into populations with primarily proinflammatory functions (including cd8 + cytotoxic t cells, th1, th17, and b-2) or primarily regulatory functions (including treg, b-1a), and the skewing of the adaptive immune milieu towards a proinflammatory phenotype exacerbates ir [2224 ]. b and t cells also recognize specific antigens via their recombined receptors and form immune memory for long lasting antigen - specific responses. antigen specificity and memory of b and t cells protect against repeated infections but can also lead to disease if the recognized antigen is derived from an autoantigen or commensal organism. as such, the importance of the adaptive immune response in the pathogenesis of ir, as well as the known autoimmune etiology of type 1 diabetes (t1d), has generated interest in the possibility that ir might be caused by antigen - driven responses. in this review, we first discuss how t cells, b cells, and their respective subsets are involved in the development of obesity - associated ir and then examine the available data suggesting that antigen - driven mechanisms may drive lymphocyte activation in ir. accumulation of visceral adipose tissue (vat), such as omental, perirenal, or epididymal fat, is associated with worse ir whereas increased subcutaneous adipose tissue (sat) either decreases the risk for ir or has no effect on it [27, 28 ]. this could be due to the differences in the extent of inflammation in these tissues. human omental adipose tissue released 2 - 3 times more il-6 than sat in vitro and vat showed greater expression of the genes for monocyte chemotactic protein-1 (mcp-1), macrophage cd68, il-6, and il-17 than sat [30, 31 ]. proinflammatory th1, th17, and cd8 + t cells were also found to be significantly more frequent in human vat than in sat [31, 32 ]. most of the studies available have focused on vat so less is known about the sat. lymphoid cells comprise about 10% of the adipocyte - free cells of the stromal vascular fraction (svc) of the vat in young and aged standard chow diet- (scd-) fed wild type (wt) c57bl/6 mice [33, 34 ]. t and b lymphocytes can be found together with macrophages in crown - like structures surrounding dying adipocytes [10, 35 ]. vat t cell numbers have been shown to increase by about 3x in high fat diet- (hfd-) fed diet - induced obese (dio) mice compared to scd - fed lean mice with a tendency towards higher cd8 to cd4 ratios [22, 23 ]. in loss of function studies, obese rag1/ mice, which are deficient of mature lymphocytes, exhibited enhanced glucose tolerance compared to wt mice. however, similar models that lacked mature lymphocytes, rag2/ mice and scid mice, did not show these beneficial effects [37, 38 ]. both of these reports described increased innate immune cell infiltration into the vat which might have compensated for the loss of lymphocyte - induced inflammation [37, 38 ]. unfortunately, no data were provided for the contribution of innate immune cells to metabolic inflammation in the rag1/ mice. besides these models, dio mice that lacked t cells (tcr/) exhibited improved glucose tolerance, enhanced insulin sensitivity, and a parallel reduction of inflammation in the vat and skeletal muscle compared to wt controls. finally, immunotherapy of dio mice with either an anti - t cell (cd3) or anti - b cell (cd20) depleting antibody suppressed metabolic inflammation in vat and reversed ir for months [22, 40 ]. taken together, these data make a strong case for the contribution of lymphocytes to the pathogenesis of ir. cd8 + t cells are the main t cells responsible for eradication of altered or foreign cells, which they kill via secretion of perforin and granzyme [41, 42 ]. in mice, more importantly, 75% of these cd8 + t cells in vat of dio mice bore the markers of effector memory t cells (cd44 + cd62l-) in comparison to 60% in lean mice, suggesting that antigen - driven acquisition of memory phenotype might have occurred during the development of dio [23, 43 ]. in addition, cd8 + t cells in obese vat showed higher expression of the activation marker cd69 and the trafficking marker cd11a and increased proliferation in vivo. treatment of dio mice with an antibody that specifically depleted cd8 t cells significantly reduced adipose tissue inflammation, glucose intolerance, and ir. similar results were observed in cd8 + t cell - deficient cd8a/ mice. reconstituting cd8a/ mice with cd8 + t cells increased m1 macrophage infiltration into the vat, proinflammatory gene expression, glucose intolerance, and ir. cd8 + t cells from dio mice were more efficient at stimulating tnf- production by vat macrophages than cd8 + t cells from lean mice, suggesting that dio induces activation of these cells, which is consistent with reports of their increased production of ifn-, granzyme b, or perforin [4345 ]. on the other hand, results from human studies imply that cd8 + t cells might play a smaller role in human ir. in human peripheral blood, most studies indicate that high body mass index (bmi) and metabolic dysfunction are associated with a reduction of cd8 + t cell numbers or frequency [46, 47 ]. in human vat and sat, obesity is associated with either no increase [32, 48 ] or a significant but small increase in cd8 + t cell frequency. transferred cd8 + t cells into dio rag1/ mice and reported no effect on glucose tolerance. human studies are often difficult to interpret due to subject variability, difficulties in obtaining sufficient samples, and the inherent limitations of correlative evidence provided in most such studies, but hopefully future studies will be able to resolve these discrepancies. circulating cd4 + t cell frequency consistently correlates positively with increased bmi or adiposity in human subjects, making them likely players in obesity - associated metabolic dysfunction. the best studied cd4 + t cell subsets are the th1, th2, th17, and treg subsets. in general, th1 and th17 cells are considered to be proinflammatory while treg cells are regarded as tolerogenic. th2 cells straddle these categories as they produce il-4, which strongly antagonizes th1 cell function, but they also activate b cell and antibody - mediated humoral responses. ifn- is a signature cytokine used by th1 cells and cd8 + t cells to clear intracellular pathogens. ifn- has been implicated in many autoimmune diseases, including t1d and multiple sclerosis, due to its capacity to elicit antibody class switching, increase antigen presentation, and upregulate the expression of tlrs on innate immune cells. interestingly, ifn- stimulation of adipocyte cell lines suppressed glucose clearance by markedly reducing the expression of insulin signaling proteins, including the insulin receptor, insulin receptor substrate 1, and glucose transporter 4 (glut4) and by stimulating production of chemokines such as ip-10, mcp-1, and cxcl10, which could potentially attract proinflammatory immune cells to adipose tissue. ifn- mrna expression is also positively correlated with markers of obesity and glucose tolerance in t2d patients and dio mice [6, 52, 53 ]. as such, it is not surprising that ifn- deficiency protected obese mice from glucose intolerance and ir [6, 54, 55 ]. with some exceptions, most clinical studies have shown a positive correlation between peripheral blood th1 cell frequency and obesity and metabolic dysfunction [49, 5760 ]. in human vat and sat, no correlation was found between th1 cell frequency and insulin resistance. in mice, however, hfd increased the number / frequency of cd4 + ifn-+ th1 cells in the vat and sat [22, 39 ]. antigen presentation to nave t cells by adipose tissue macrophages or adipocytes activated in the obese setting favored th1 cell differentiation, suggesting a potential mechanism [61, 62 ]. adoptive transfer of in vitro differentiated th1 cells into dio tcr/ mice directly demonstrated that these cells could exacerbate ir. th1 recipients showed increased expression of proinflammatory genes in the vat and the skeletal muscle, including ifn-, mcp-1, and mhc - ii. these results were consistent with in vitro data showing that 3t3-l1 adipocytes treated with th1-conditioned medium upregulated expression of proinflammatory genes mcp-1, rantes, and il-6 or ifn--dependent ip-10 secretion. all these lines of evidence strongly suggest that th1 cells are pathogenic in the development of glucose intolerance and ir. it has been well established that il-17-producing th17 cells can exacerbate autoimmune and inflammatory diseases. in line with the hypothesis that th17 cells are pathogenic in t2d, diabetic patients displayed increased frequency of peripheral blood th17 cells compared to nondiabetic controls. insulin resistant obese patients had higher frequencies of th17 cells in the sat than insulin sensitive obese individuals. additionally, levels of il-17 and il-6, which are known to induce th17 differentiation, positively correlated with severity of diabetes [59, 64, 65 ]. in dio mice, splenic th17 cell frequencies were increased, in an il-6-dependent manner, and vat dendritic cells promoted th17 differentiation in vitro [67, 68 ]. il-17 inhibited insulin - stimulated glucose uptake by skeletal muscle and hepatocyte insulin signaling as well as adipocyte differentiation [69, 70 ]. interestingly, the major source of il-17 in the adipose tissue was cd4 t cells, not t cells [45, 69 ]. additionally, hfd - fed wt and il-17/ mice showed no difference in glucose tolerance and insulin tolerance tests. given these contradictory findings, further research is needed to determine if th17 cells and/or il-17 have a role in this disease. cd4 + foxp3 + tregs comprise about 2040% of cd4 + t cells in the vat of lean scd - fed mice [22, 71 ]. they have been observed within the crown - like structures in close contact with macrophages and other lymphoid cells [22, 34 ]. their frequencies initially increase with age, peak at 25 weeks of age, and then drop back down. in characterizing fat resident treg cells, feuerer. discovered that they expressed a unique genetic signature that differed from that of treg cells infiltrating the lymph nodes and the spleen [34, 71 ]. the differences included marked overexpression of genes encoding molecules involved in leukocyte migration and extravasation and extremely high il-10 transcript levels (136-fold higher than the levels in lymph node tregs). when wt mice were fed hfd, their vat treg frequencies decreased [22, 23, 34, 71 ]. this phenomenon could be due to the ability of hfd vat to suppress treg induction in a t cell - specific stat3-dependent manner. in humans, + cd127 treg frequency is reduced in metabolically unhealthy obese individuals compared to metabolically healthy obese subjects and human diabetic patients had lower frequencies of peripheral blood tregs than nondiabetic controls. however, foxp3 mrna expression in the vat is increased [73, 74 ] or decreased in obese patients, depending on the study. to examine the role of tregs in ir, feuerer. used mice in which expression of the diphtheria toxin receptor was regulated by foxp3 transcriptional regulatory elements. administration of diphtheria toxin to these mice led to apoptotic, non - pro - inflammatory death of the tregs. mice that had 30% of their normal vat tregs and 70% of their normal spleen and lymph node tregs showed increased fasting insulin levels, which is indicative of ir, as well as upregulation in gene expression of proinflammatory mediators in the vat. similarly, in a gain of function experiment, tregs were expanded by about 1/3 in dio mice via injection of il-2/anti - il-2 antibody complexes, which resulted in improved glucose tolerance. oftentimes, these are via their secretion of il-10, which can block production of inflammatory cytokines or counteract tnf- inhibition of insulin signaling in adipocytes [15, 34 ]. as such, therapies which specifically increase treg cells may be of utility in treating ir. a proof of principle study in which tgf--dependent latency - associated peptide- (lap-) positive treg cells were induced by oral anti - cd3 antibody and -glucosylceramide combination therapy helped to reduce ir in leptin - deficient ob / ob mice. one of the current drugs for diabetes, pioglitazone, is able to improve insulin sensitivity by stimulating ppar signaling in tregs, leading to increased vat treg cell frequency. th2 differentiation and gata3 expression are induced by il-4, leading to the production of il-4, il-5, and il-13 by th2 cells. administration of il-4 to dio mice protects them from weight gain and glucose intolerance in a pathway that involves stat6 activation and ppar suppression. il-4 and il-13 are also well known for their ability to induce m2 macrophages, which are protective against glucose intolerance. while the il-4/stat6 pathway has been consistently shown to be protective against glucose intolerance, the role of th2 cells in this disease has been much less well defined. for instance, in il-4 gfp reporter mice, eosinophils are the dominant source of il-4 in the vat of lean mice, not the th2 cells, which make up a very small percentage. ricardo - gonzalez. used a model of allergic inflammation to induce a th2 bias in the immune response and found a striking improvement in glucose tolerance and insulin action. however, the readout that they used to measure th2 bias was ige concentration and recall responses of splenocytes to antigen, rather than th2-specific cell markers. an argument favoring a beneficial effect for th2 cells in glucose metabolism is that cd4 + gata3 + t cells are present at high levels in vat from lean mice and are reduced in frequency in hfd - fed mice. unfortunately, up to about 60% of vat foxp3 + tregs also express gata3, making it a less specific marker for th2 cells. however, adoptive transfer of cd4 + foxp3 and cd4 + il-10 t cells into dio rag1/ mice improved glucose tolerance to the same extent as transfer of total cd4 + t cells, suggesting at the very least that a cd4 + non - treg population plays a protective effect. this improvement was partially lost when stat6/ cd4 + t cells were transferred. also, vat t cells recovered from mice that received cd4 + foxp3 t cells showed much greater production of il-4 and il-13 than vat t cells from either pbs recipients or wt dio mice. future studies will have to elucidate the role of th2 cells using better positive markers. a recent study of overweight / obese human subjects supported the view that th1 and th2 cells play opposing roles in ir. in this study, t cell subsets were quantitated by flow cytometry in vat, sat, and peripheral blood on the basis of ifn- and il-13 production, respectively. th1 frequency in sat and vat correlated directly, whereas th2 frequency in vat correlated inversely, with concentration of plasma c - reactive protein, a marker of systemic inflammation. th2 frequencies in both adipose tissue depots and peripheral blood were inversely associated with systemic ir. finally, the relative gene expression of associated cytokines generally reflected the flow cytometry results. while the principal function of b cells is antibody secretion in response to specific antigens, they also present antigen to t cells, produce cytokines, and develop into memory b cells or plasma cells following antigenic stimulation. b cells can be divided into 2 broad classes : b-2 cells and b-1 cells. within the b-2 lineage are the follicular b cells, which comprise the largest population of mature b cells. follicular b cells are also the main b cell subset responsible for producing antibodies to t - dependent protein antigens. conversely, b-1 cells are innate - like b cells with a restricted, but polyreactive bcr repertoire that are enriched in the mucosal tissues, peritoneal and pleural cavities. b-1 cells are further segmented into cd5 + b-1a cells, the major producers of natural igm antibody in the body, and cd5 b-1b cells which respond to t cell - independent antigens. b-1a cells also constitutively produce il-10 and make up the bulk of il-10-expressing leukocytes in the peritoneal cavity. obesity affects b cells by increasing their infiltration to the vat, including the class switched igg+ b cells. peripheral blood b cells from diabetic patients and splenic b cells from obese mice demonstrate a proinflammatory cytokine profile (increased il-6, tnf-, or il-8 and reduced il-10 secretion) [64, 86 ]. follicular b cells contributed the bulk of the il-6 and il-10 secreted by total b cells with marginal zone b cells contributing very little of either cytokine. circulating follicular t helper cells (cd4 + cxcr5 +), which provide assistance to b cells, were also found to be increased in diabetic patients versus healthy controls. to investigate the impact of b cells in ir, 2 groups studied dio mt b cell knockout mice and found that these mice had improved glucose tolerance and insulin sensitivity [40, 86 ]. b cell deficiency was associated with a reduction of tnf--producing m1 macrophages and activated cd8 + t cells in the vat. similarly, mice treated with a cd20-specific b cell depleting antibody had fewer tnf-+ macrophages in the vat. defuria. confirmed that mt mice had lower proinflammatory cytokine levels in the serum and increased treg cells in the spleen and the vat. adoptive transfer of b cells from obese mice, but not lean mice, into dio mt mice worsened glucose intolerance, suggesting that aberrant activation of b cells in obesity might cause their pathogenic effects. a recent report by nishimura. described a subset of il-10 producing b cells (cd19 + cd45r+ cd22 + cd5 igm+ igd+) in the adipose tissue of mainly lean mice that were distinct from cd5 + b-1a cells and splenic cd1dhi cd5 + b-10 cells in terms of surface phenotype and tissue distribution. however, the mechanistic studies in this report address the role of total b cells, rather than just the breg subset. using bone marrow chimeras in which total b cells specifically develop from il-10/ bone marrow, the authors showed that b cell - specific il-10 deletion led to worsened ir and increased infiltration of cd8 + t cells and m1 macrophages in the adipose tissue. adoptive transfer of total b cells (cd19 + cd45r+) from the sat or vat of lean mice, but not obese mice, into obese mt mice improved insulin sensitivity in an il-10-dependent manner and lowered tnf- production by macrophages and ifn- production by t cells. hence, b cell - produced il-10 is important for regulation of glucose homeostasis. delving further into the role of b cell subsets in glucose metabolism, shen. found that b-2 cell frequencies were increased in the peritoneal cavity, vat, and spleen of dio mice, whereas b-1a frequencies were decreased in the peritoneal cavity and the vat. adoptive transfer of b-2 cells into b cell - deficient mice worsened glucose intolerance in the recipient mice, whereas adoptive transfer of b-1a cells improved glucose tolerance. given that b-2 cells comprise more than 90% of the cd19 + b cell population in the spleen, most of the splenic b cells transferred in the experiments by winer. the protective effect of the b-1a cells was mediated via il-10 production and polyclonal igm. b-1a - derived il-10 induced increased il-10 production and reduced il-6 and tnf- production in b-1a : macrophage cocultures [24, 89 ], consistent with a previous report that b-1a cells induce m2 polarization in macrophages. a separate study confirmed the protective effect of b-1a cells and the il-10 mechanism but found no beneficial effect from polyclonal igm injection. this discrepancy may be due to the difference in frequency and duration of igm administration in these experiments. b cell activating factor (baff) is necessary for the maintenance of mature b-2 cells, but not b-1a cells. genetic depletion of baff in baff/ mice and treatment with anti - baff antibody both resulted in depletion of b-2 cells and igg, as well as amelioration of glucose intolerance. it should be noted that because baff - r is expressed on adipocytes in addition to b cells and monocytes express baff - binding taci receptor, the effects of baff loss of function and gain of function studies can not be attributed solely to the loss of b-2 cells. for example, baff can directly reduce insulin - stimulated glucose uptake in 3t3-l1 adipocytes and promote monocyte activation and differentiation. while there is extensive evidence that adaptive immune cells can both exacerbate and protect against t2d (as described above), it is unclear if the involvement of b and t cells is based on their antigen - specific activation or if the cells serve nonspecific bystander immune functions as a result of general inflammation. if the development of t2d indeed has an antigen - specific component, it would potentially enable novel avenues to specifically target and attenuate the immune responses in disease.. any potential antigen - specific t cell response would require involvement of mhc molecules, antigen presentation pathways, costimulation, and professional antigen presenting cells (apcs). therefore, if perturbations in antigen presentation or costimulation affect ir or t2d, this could indicate that an antigen - specific response may be involved in disease pathology, albeit without providing insight into the identity of that antigen. changes in the immune repertoire or use of model antigens may be more direct in probing what antigens may be involved. in this section, we examine both indirect and direct evidence of an antigen - specific response. nave t cells are activated when peptide antigens bound to mhc molecules are recognized by their t cell receptors (tcrs). most cells present endogenous antigens on mhc class i to cytotoxic cd8 + t cells. in addition, professional apcs, such as dendritic cells, macrophages, and b cells, present both endogenous and exogenous antigen on mhc class ii to cd4 + t cells. during antigen presentation, the t cell receives 3 signals : (1) recognition of the peptide - mhc combination via the tcr, (2) costimulation via binding of cd80/cd86 from the apc with cd28 on the t cell, and (3) cytokines which dictate the differentiation program of the t cell. the combination of cytokine signals received by a cd4 + t cell will cause it to differentiate into the different t effector and memory subsets. two key apcs in adipose tissues are cd11c+ dendritic cells and f4/80 + macrophages. in this review, the cells are identified by the nomenclature chosen by the authors but we caution readers that analyses of macrophages or dendritic cells using these surface markers will likely include both populations. for example, adipose tissue m1 macrophages are often defined as cd11b+ cd11c+ f4/80 + cells [45, 61 ] but some papers distinguish cd11c f4/80 dendritic cells from cd11c+ f4/80 macrophages [67, 68 ]. it is no surprise that changes in dendritic cell frequencies are paralleled by changes in cd4 + t cell frequencies in metabolically important tissues. flt3l/ mice, which lack dendritic cells, had much lower frequencies of t cells in the adipose tissue and spleen. injecting wt mice with bone marrow - derived dendritic cells led to an increase of cd4 + t cells in the adipose tissue and the liver but not the spleen. in obese mice, these same tissues were the site of enrichment for mature cd86 + cd11c+ dendritic cells. dendritic cells isolated from hfd vat secreted chemokines for th17 cells and induced th17 differentiation more effectively than splenic dendritic cells [67, 68 ]. dio flt3l/ mice showed improved glucose tolerance and insulin sensitivity than wt controls but because they also gained weight more slowly, these metabolic perturbations can not be fully dissociated from differences in weight. taken together, the data suggest that obesity - associated inflammation attracts dendritic cells, which then present antigen to cd4 + t cells. adipose tissue macrophages are activated in obesity as demonstrated by their higher gene expression of mhc - ii and the costimulatory receptor cd40. mhc - ii expression on adipose tissue macrophages was concentrated in the crown - like structures where dead adipocyte clearance would be expected. dio mhc - ii/ mice showed enhanced insulin sensitivity and reduced adipose tissue inflammation [62, 98 ]. consistent with this result, dio macrophage / dendritic cell - specific mhc - ii knockout (mmko) mice exhibited significant improvements in glucose tolerance and insulin sensitivity. these beneficial effects were associated with increased vat expression of adiponectin and glut4 genes as well as decreased infiltration of macrophages, foxp3 + treg, and cd4 + foxp3 conventional t cells to the vat. when analyzed further, the cd4 + t cells in dio mmko mice had shifted away from memory to nave t cell phenotypes, in line with diminished antigen presentation. adipose tissue macrophages from obese mice were more potent stimulators of proliferation of ova - specific cd4 + t cells than adipose tissue macrophages from lean mice, thereby demonstrating that obesity - related inflammation promotes antigen - specific activation of t cells by apcs. lastly, antigen - specific t cell proliferation could be prevented by mhc - ii neutralizing antibodies. since most non - apcs do not present antigens on mhc - ii to cd4 + t cells, it is notable that adipocytes can do so. in an elegant study by deng., microarray analysis of primary adipocytes from obese women demonstrated upregulation of multiple genes involved in the mhc - ii antigen processing and presentation pathways. in their data set, 11 of 15 genes involved in mhc - ii antigen presentation, 3 of 5 involved in mhc - ii antigen processing, and the costimulatory molecule cd86 increased with obesity. these changes were paralleled in mouse adipocytes 2 weeks after hfd administration before changes in macrophage abundance or polarization. in cocultures of primary adipocytes with ova - specific cd4 + t cells, the authors found that obese adipocytes were far more efficient than lean adipocytes at stimulating il-2 and ifn- production, but not il-4, in t cells and that this was both ova antigen dependent and contact dependent. interestingly, ifn- also upregulates mhc - ii expression in adipocytes, suggesting a possible positive feedback loop that would enhance inflammation in the adipose tissue. the role of mhc - ii was further confirmed by cocultures of mhc - ii - knockdown adipocytes with ova - specific t cells, which resulted in significantly less il-2 and ifn- production than cocultures with mhc - ii competent adipocytes. winer. transferred b cells from wt-, mhc - i-, or mhc - ii - deficient obese mice into b cell - deficient obese mice. they found that wt b cells worsened glucose intolerance in recipient mice whereas mhc - i - deficient and mhc - ii - deficient b cells did not. this effect was associated with reduced total vat svc production of ifn- from vat cd4 + and cd8 + t cells. signal 2, costimulation of cd28 by cd80/cd86, provides a built - in failsafe that prevents t cells from being activated by self - antigen. t cells that recognize peptide - mhc in the absence of signal 2 become anergic. cd28 interaction in stimulating proliferation, survival, and memory programming of t cells has been extensively studied. in obesity, cd80 and cd86 gene expression have been shown to be increased in obese human and mouse adipocytes [62, 105 ]. cd86 + dendritic cells were enriched in the liver and vat of obese mice. however, scd - fed lean cd80/cd86 double knockout mice have fewer tregs than wt mice, suggesting an essential role for cd80/cd86 in inducing tregs [102, 105 ]. in line with this, zhong. reported an inverse correlation between cd80/cd86 + macrophage infiltration of vat and ir status. dio cd80/cd86/ mice had exaggerated adipose tissue macrophage inflammation and worsened ir, accompanied by reduced treg development and proliferation. coculture assays of apcs with foxp3 nave t cells indicated that cd80/cd86 was necessary for stimulating treg differentiation. ctla-4 ig fusion protein binds to cd80/cd86, thereby blocking the engagement of cd28 on t cells and preventing t cell activation. in apparent conflict with a protective role for cd80/cd86 in obesity - associated ir, however, another group, using ctla-4-igg2a, found no difference between treated and control mice. to summarize, cd80/cd86 stimulation of cd28 on t cells appears to be protective in ir via induction of treg differentiation but more studies are required to resolve these conflicting findings. cd40 is constitutively expressed on apcs and a wide range of nonimmune cells, such as endothelial cells and smooth muscle cells. cd40l mutations in humans cause hyper - igm syndrome (inability to produce class switched antibodies, failure to develop germinal centers, and lack of b cell memory response following antigen challenge), and this phenotype is mimicked in mice with cd40 or cd40l deficiencies. four different groups reported that dio cd40/ mice exhibited impaired glucose tolerance and insulin sensitivity as well as higher expression of markers of inflammation in vat compared to wt mice [103, 104, 110, 111 ]. activation of cd40 with an agonistic antibody fgk45 improved glucose tolerance but also reduced weight gain. using bone marrow transplants, yi. demonstrated that wt mice with cd40/ immune cells had impaired glucose tolerance while cd40/ mice with wt immune cells were rescued. to isolate the function of cd40 on lymphocytes, wolf. and yi. generated chimeric mice deficient for cd40 on b and t cells by reconstituting lethally irradiated wt mice with mixed bone marrow - derived cells from cd40/ and rag1/ mice [103, 104 ]. these mice showed impaired glucose tolerance and ir, indicating that the lymphoid cells were the major immune cells contributing to the disorder. one paper reported that cd40 deficiency caused a decrease in total b cell and b-2 cell frequency while two papers noticed a significant increase of cd4 + foxp3 + tregs [103, 110 ]. more importantly, in all four studies, dio cd40/ mice showed increased frequencies of cd8 + t cells and f4/80 + macrophages in the vat [103, 104, 110, 111 ]. subsequently, yi. showed that cd8 depleting antibody wiped out differences between wt and cd40/ mice. lastly, adoptive transfers of cd40/ cd8 + t cells into dio rag1/ mice are more effective at worsening glucose tolerance than adoptive transfers of wt cd8 + t cells. the role of cd40l is more controversial. the first study to investigate cd40l described improved inflammation and glucose tolerance in dio cd40l/ mice and anti - cd40l inhibiting antibody treated mice. later studies replicated the reduced inflammation but found no significant changes to glucose tolerance in cd40l/ mice or mice on a high cholesterol diet and treated with the same anti - cd40l inhibiting antibody. cd40l/ mice showed significant decreases in vat macrophages and b cells but increases in tregs [112, 113 ]. given the conflicting results, more studies are needed to elucidate the role of cd40l in glucose metabolism. nevertheless, the consensus that can be drawn from these studies is that the two major costimulatory receptor - ligand families required for strong and persistent adaptive immune responses are beneficial in the regulation of glucose homeostasis and t cells seem to be the main cell type involved in this context. t cells that have received and integrated the appropriate signals 1, 2, and 3 undergo a pattern of clonal expansion, together with acquisition of effector functions, followed by contraction and formation of memory t cells. these memory t cells persist in greater numbers than their nave counterparts and are significantly more rapid and efficient in responding to a second encounter with their cognate antigens. the pool of memory t cells comprises 3 phenotypes : cd44 + cd62l+ central memory (c / m) t cells which mainly reside within the lymphoid organs, cd44 + cd62l effector memory (e / m) t cells which circulate to afflicted organs, and the newly described tissue - resident memory t cells which provide local protection [114, 115 ]. in lean unimmunized mice, nave t cells account for 1020% of cd4 + t cells in the vat [75, 98 ]. e / m t cells comprise about 60% of both cd4 + and cd8 + t cell populations in the vat of lean mice and consistently increase to about 7580% in obese mice [23, 43, 98 ]. reciprocal decreases in nave t cells and c / m t cells were also observed [75, 116 ]. hfd exposure increased vat e / m t proliferation but did not alter c / m or nave t cell proliferation. increased proliferation is also specific for e / m t cells in adipose tissue but not the blood. obese mice deficient for the nlrp3 inflammasome and stat3 had fewer e / m t cells or more nave t cells due to reduced inflammation [7, 72 ], whereas cd40/ mice had increased frequencies of e / m t cells. while scd - fed mmko and wt mice had similar frequencies of nave, e / m, and c / m cd4 + t cells, hfd caused the nave population to decrease and the e / m t cells to increase in a macrophage - specific mhc - ii dependent manner. this result was specific for adipose tissue as the splenic t cell populations remained unchanged. while thymic aging caused by obesity may lead to a reduction of nave t cell emigration from the thymus and a compensatory expansion of memory cells, the expansion of adipose memory t cells but not systemic memory t cells suggests that this may not be the case. obesity also had no impact on the capacity of nave cd8 + t cells to develop effector and memory cd8 + t cell responses to new infections. thus, a restricted nave t cell output does not preclude an effective memory t cell response to new antigens. it may be tempting to interpret the presence and increased frequencies of memory t cells in obese animals as an indication of historical responses to adipose tissue antigens and continued reactivity to those same antigens. however, memory t cells can also develop due to cross reactivity with homologous antigens. therefore, the presence of memory t cells does not prove the existence of immune response initiated by an autoantigen. clonal expansion of t cells in response to antigen can be tracked via changes to the repertoire of tcr sequences. tcr repertoire sequencing has become one of the most heavily used methods to assess the potential of an antigen - specific immune response in the absence of a model or candidate antigen. vat tcrs in dio mice were observed to have a restricted tcr - v repertoire compared to tcrs from lean vat, suggesting potential clonal expansion of t cells expressing specific tcrs. similarly, sat- and vat - resident cd8 + t cells in wt dio mice had restricted tcr - v repertoires. vat - associated t cells in dio ova - specific ot-2 tcr transgenic mice developed a highly biased tcr - v repertoire to non - ova antigen(s), suggesting a non - ova antigen - driven t cell response. adoptive transfer of total cd4 + t cells into dio rag1/ mice improved glucose tolerance and insulin sensitivity, but adoptive transfer of cd4 + t cells from ot-2 mice had no protective effect, which also raises the intriguing prospect of antigen - driven tolerance mechanisms. in lean mice, vat - resident treg cells have a restricted distribution of tcr complementarity determining region (cdr) sequences compared to their lymph node counterparts, suggesting that these cells might be infiltrating or expanding in the vat in response to a local vat antigen [34, 120 ]. importantly, vat treg cell sequences had very little overlap with those from conventional vat t cells indicating that it was very unlikely that the vat tregs had arisen from conversion of local conventional t cells [34, 120 ]. given that treg cell frequencies are diminished in obese vat [22, 23, 34, 71 ], it would be interesting to learn how the tcr repertoires of these cells change in the context of obesity. in contrast to the mouse studies above, no significant changes to the tcr repertoire were observed in a study that compared lean versus nondiabetic, morbidly obese human subjects (n = 4 and 5, resp.). using genescan analysis of v-j rearrangements, the authors observed minor alterations in the tcr repertoire of peripheral blood cd4 + memory t cells and cd8 + nave and memory t cells from morbidly obese subjects. in addition, the total t cell repertoire from adipose tissue samples from 5 morbidly obese subjects (no samples from lean subjects were studied) showed a largely polyclonal tcr repertoire. future studies with a larger number of samples, bmi - matched metabolically healthy and unhealthy subjects, and the use of high throughput sequencing methods would provide more insights into the role of antigen - specific t cell clones in obese humans. when nave follicular b cells encounter cognate antigen, they migrate to the t cell zones of the secondary lymphoid tissues. here they present antigen to t cells, receive t cell help, and differentiate into either low - affinity antibody - producing short - lived plasma cells or b cells that undergo the germinal center reaction [122, 123 ]. a combination of cd40l, cd28, icos, and il-21 signaling from follicular t helper cells and cognate antigen presentation by follicular dendritic cells to the b cells allows them to undergo rapid expansion, class switching, and generate affinity maturation of antibodies via somatic hypermutation of the immunoglobulin variable regions. they can then differentiate into high affinity antibody - secreting long - lived plasma cells and memory b cells that require less stimulation for activation. thus far, there have been no studies of memory b cells or plasma cells in the context of obesity or glucose intolerance. however, evidence that memory b cells and long - lived plasma cells are resistant to baff depletion, and, in the case of the latter, cd20 depletion as well, would suggest that these cells do not play an important role in the improvement of glucose tolerance in baff - deficient and cd20-depleted mice [24, 40, 124, 125 ]. in terms of class switched antibodies, igg2c is the only immunoglobulin subclass that is significantly increased in the serum and vat lysate of dio mice. transfer of total plasma igg from dio mice but not scd - fed lean mice worsened ir in recipient dio mt b cell - deficient mice. transfer of igg from either source had no effect on glucose metabolism in lean b cell - deficient mice. these results are intriguing in that they suggest that certain igg antibodies that develop in obese mice may recognize antigens that are specific to obese mice. the effect was dependent on antibodies having their fc portions intact, raising the possibility that these antibodies interact with fc receptors on macrophages in vat and promote clearance of apoptotic / necrotic debris and inflammation. the magnitude of the effect was greater if the igg came from mice with late - stage disease compared to igg from mice with early - stage disease, suggesting affinity maturation of antibody or late unmasking of the relevant obesity - related antigen(s). lastly, ir status in a cohort of otherwise healthy overweight human subjects was linked to a specific autoantibody signature. one of the antigens highlighted by the human antigen array was glial fibrillary acidic protein (gfap), which had been identified as an antigen in t1d patients. whether these autoantibodies represent a cause or consequence of disease in humans remains to be explored in future studies. diabetes has traditionally been divided into t1d (onset in children, clear evidence of autoimmune destruction of the insulin - secreting cells) and t2d, (onset at 3540 years, cells still competent, and no obvious signs of autoimmunity). the recent findings detailed in this review, especially the report that autoantigens are potential targets for igg antibodies associated with ir [40, 126 ], have led to speculation that the two diseases may be more alike than previously thought. this is not a new idea. over the past decade, a subgroup of adult patients diagnosed with noninsulin dependent diabetes classified as latent autoimmune diabetes in adults (lada), several studies have shown that autoantibody positive patients tend to be diagnosed at a younger age, progress to insulin dependency more often, and show less evidence of metabolic syndrome than autoantibody negative patients. for these reasons and others, lada has been proposed to be an intermediate form of diabetes, sharing traits from t1d and t2d. in addition, t cell autoimmunity to islet antigens has been identified in phenotypic t2d patients that lack autoantibodies to these antigens. in other aspects, t2d is unlike t1d and other autoimmune diseases. for example, half of the genetic risk of t1d is conferred by hla susceptibility, yet t2d appears to have no hla linkage. despite the relatively high genetic heritability of t2d (3070% based on family studies), it is a very variable polygenic disease such that even the most strongly associated variants at individual loci were estimated to explain only approximately 10% of familial aggregation of t2d. of the key gene associations that have been identified, we could find published associations with the immune system for only pparg and slc30a8. macrophage - specific pparg controls alternative activation of macrophages and consequently ir and likewise treg - specific pparg controls accumulation of tregs in the vat. one meta - analysis of gwas studies found no evidence that genes associated with inflammatory cytokines (like il-18) or genes associated with other inflammatory / autoimmune diseases had a significant relationship to diabetes. another gene expression - based gwas performed on 130 independent microarray experiments highlighted cd44, a receptor that is expressed on many different immune cells. the authors found that cd44 genetic deficiency or use of cd44 blocking antibody protected mice from ir and reduced macrophage infiltration to adipose tissue without significant changes to the t or b cell populations [101, 132 ]. taken together, these studies indicate that there is no strong evidence for a genetic link between the adaptive immune system and t2d. although there is no known infectious disease association with t2d, in an extensive personal - omics profile performed on one insulin sensitive individual (bmi = 23.9 and normal glucose levels), the subject suddenly became insulin resistant after a respiratory syncytial virus infection, but not a human rhinovirus infection. glucose and hba1c levels remained elevated for a few months and only gradually decreased after a dramatic change in diet, exercise, and ingestion of low doses of acetylsalicylic acid. the patient did not develop traditional t1d antibodies such as anti - glutamic acid decarboxylase or anti - islet antibodies. the high fat content in hfd both favors the growth of gram - negative bacterial species, which produce lipopolysaccharide (lps), and enhances intestinal absorption of lps, by increasing intestinal permeability. the resulting increased lps concentrations in the circulation have been shown to increase macrophage infiltration in adipose tissues and liver ir. high permeability index of the intestinal surface may also allow other antigens to enter the adipose tissue, although no studies have actually demonstrated this. thus far, the largest molecule used to demonstrate gut permeability in obesity has been 4000 da fitc - dextran, so we can speculate that peptides up to 4000 da in size can enter the circulation. another mechanism for transport of dietary antigens to adipose tissues is the hitchhiking of dietary fat - induced chylomicrons. one study demonstrated that long - chain triglycerides increased intestinal absorption and mesenteric adipose tissue localization of ova and that this could be abolished with a chylomicron secretion inhibitor. when fed hfd modified such that 1% of the dietary protein was ova by weight, mice that had been previously sensitized to ova showed increased cd4 + t cell accumulation in the mesenteric adipose tissue while mice nave to ova did not. after 14 weeks on this diet, ova - sensitized mice tended to have worse glucose intolerance than ova - nave mice. this study raises the interesting possibility of high fat diet worsening an already existing adaptive immune response to a specific dietary antigen but provides no mechanism for how an individual would get inoculated against that antigen in the first place. table 1 summarizes the evidence in support of antigen - driven pathology in t2d and figure 1 depicts a model for how this might come about. the data are lacking in one critical aspect : there is no obvious candidate antigen. unlike t1d in which the pancreas is a major source of autoantigens, pancreatic cell death is much less extensive in t2d and obesity - associated ir. multiple studies and reviews have postulated that the inflamed adipose tissues, possibly the crown - like structures, are the source of antigen due to the colocalization of necrotic cells and activated immune cells there, but the existence of a pathogenic antigen - antigen receptor pair has yet to be proven. of the data available, a particularly strong piece of evidence supporting an antigen - driven process in ir is the finding that transfer of igg from obese mice, but not lean mice, can aggravate glucose intolerance in obese recipients, but not lean recipients., a b cell must first recognize antigen via its bcr, enter the germinal center reaction, present antigen to follicular helper t cells, and receive stimulation via cd40-cd40l signaling and myriad other signals. all these barriers to class switching heavily imply that the presence of igg is due to antigen - specific activation of b cells. furthermore, the finding that only igg from obese mice could worsen glucose control in obese recipients only strongly argues that the igg was generated specifically in response to the obese setting. consequently, this piece of evidence argues that obesity - related antigens triggered the activation of cognate b cells and that the resulting igg is pathogenic in ir. at present, once t2d is established, our treatments are insufficient. gastric bypass is highly effective but at present is only indicated for morbidly obese patients and, in addition, is associated with potentially serious side effects. furthermore, inflammatory markers such as c - reactive protein and il-6 are predictive of diabetes even in nonobese subjects, suggesting that inflammation, not obesity per se, may be the major culprit in disease pathogenesis. it is reasonable then to propose methods of modulating the immune response to improve insulin sensitivity and indeed several clinical trials have begun to study these approaches. nonspecific anti - inflammatory therapies have their own side effects. if it can be established that t2d pathogenesis is driven by antigen - specific activation, then identification of these antigens could lead to the development of novel vaccines or diagnostic tools. recent advances in t and b cell repertoire analysis, on both bulk and individual cells [119, 142, 143 ], as well as new techniques to identify antigens for t and b cell receptors [144, 145 ], may for the first time enable a successful search for antigens in ir in a systematic way.
|
type 2 diabetes mellitus (t2d) is a metabolic disease that is strongly tied to obesity and often preceded by insulin resistance (ir). it has been established that chronic inflammation of hypertrophic adipose tissue depots in obese individuals leads to obesity - associated ir and is mediated by cells of the innate immune system, particularly macrophages. more recently, cells of the adaptive immune system, b and t lymphocytes, have also emerged as important regulators of glucose homeostasis, raising the intriguing possibility that antigen - driven immune responses play a role in disease. in this review, we critically evaluate the roles that various b and t cell subsets play in ir, and then we examine the data suggesting that antigen - driven mechanisms, such as antigen presentation and costimulation, may drive the activity of these lymphocytes.
|
despite the fact that women s health issues is coming to the forefront of health priorities in many countries, yet, it was observed that women in developing world remain susceptible to poor health because of lack of services and lack of education and information about health issues (1). in developing countries, complications of pregnancy and childbirth are the leading causes of death among women of reproductive age. women risk death and disability each time they become pregnant ; and face these risks much more often since they bear many more children than women in the developed world. who report that women s risk of dying from pregnancy related complications stood at 1 in 48 for all developing countries as compared to 1 in 1,800 for developed countries meaning the risk of dying from pregnancy related complications are highest in africa (2). delivery in health facility by skilled birth attendant is recommended for all pregnant women as a strategy to reduce maternal and neonatal mortality (3, 4). delivery in health facility allow for proper management of labor, early detection of problem in both the mother and the fetus in the event of complications which are usually unpredictable it allows for prompt and effective response. we report findings from zamfara state in northwest nigeria, where an on - going health system strengthening project with technical and financial support from department for international development (dfid) /norwegian government in collaboration with the state government aimed at addressing challenges related to maternal and child health in all its ramification, this provide a unique opportunity to understand why women are averse to facility delivery even when facility based delivery is available at minimal cost. the study was conducted in sub - urban and rural settings in (zamfara state) northwest nigeria between may 2012 and mar 2013. its population as at the 2006 national population and housing census was 3,259,846 (1,630,344 males and 1,629,502 females) (5). the public healthcare system is made up of primary, secondary and tertiary health facilities. there are more than 600 primary health centers, 18 general hospitals with 1 federal medical centre, in addition, 23 health facilities are privately owned. the local government areas (lgas) are responsible for the construction and running of village dispensaries, basic health clinics and primary health centers. the state ministry of health and health services management board are responsible for the secondary healthcare system. key informant interview (kii) and focus group discussion participants were selected purposively and saturation of information was used to decide on adequacy of the samples. ethical approval for this study was obtained from state operational research committee (orac) and informed verbal consent was obtained from all participants. the discussions involved five separate groups of women (those who attended antenatal care (anc), but delivered at home, those who delivered once in facility but fail to return on subsequent deliveries and those who neither had anc nor deliver in facility, mother - in - laws and men (husbands) who s wives opted for home / facility delivery for the most recent births. in addition, in - depth interviews were held with six health care providers (nurses / chews) and six traditional birth attendants (tba). fgd categories in the communities characteristics of participants in focus group discussion and in depth - interview five different interview guide were used for the different sub - groups, trying to explore entrenched socio - cultural / religious barriers to facility delivery within and between categories of women, tba and health workers (table 3). the questions included issues affecting who decide when and why a woman should be taken to facility for delivery, what are the motivations for patronizing tba, and what are the experiences of those that used the facility for delivery. in addition we explored the health workers perspectives on why women are averse to facility delivery. main themes and sub - themes from fgds and kii data on barriers to delivery in health facilities the study teams consisted of the principal researcher, five female secondary school teachers with past experience in fgd one male undergraduate student of sociology of usmanu danfodio university, sokoto. the research teams participated in a two - days training ; the session included : study overview, ethical conduct of research, role play and pre - testing the study instruments. basic demographic data such as age parity and location of participants were collected from each study participant before the start of each focus group. all focus groups were held in hausa, the local language familiar to all research participants. the focus groups lasted about an hour each ; interviewers took extensive notes, in addition to tape recording and transcribing the interviews. the demographic data were processed using spss version 16 (chicago, il, usa), and information obtained were transcribed verbatim. this textual data was compared and combined with information notes taken during the interview sessions. in addition, the content of the textual data was double checked with summaries and conclusions made at the end of the interview sessions in order to ensure that those notes were similar to what they answered during the interviews. basic description of data was done through open coding where textual data was decomposed into parts, marked and coded with the aid of nvivo software. then, the parts were compared based on the similarities and differences that combined to form a new category and subcategories. this was followed by linking the various categories, this is often referred to as axial coding, and the information of each category and it is subcategories was refined and determined in relation to its conditions, context, strategies and consequences. the study used a qualitative method (phenomenology). key informant interview (kii) and focus group discussion participants were selected purposively and saturation of information was used to decide on adequacy of the samples. ethical approval for this study was obtained from state operational research committee (orac) and informed verbal consent was obtained from all participants. the discussions involved five separate groups of women (those who attended antenatal care (anc), but delivered at home, those who delivered once in facility but fail to return on subsequent deliveries and those who neither had anc nor deliver in facility, mother - in - laws and men (husbands) who s wives opted for home / facility delivery for the most recent births. in addition, in - depth interviews were held with six health care providers (nurses / chews) and six traditional birth attendants (tba). fgd categories in the communities characteristics of participants in focus group discussion and in depth - interview five different interview guide were used for the different sub - groups, trying to explore entrenched socio - cultural / religious barriers to facility delivery within and between categories of women, tba and health workers (table 3). the questions included issues affecting who decide when and why a woman should be taken to facility for delivery, what are the motivations for patronizing tba, and what are the experiences of those that used the facility for delivery. in addition we explored the health workers perspectives on why women are averse to facility delivery. main themes and sub - themes from fgds and kii data on barriers to delivery in health facilities the study teams consisted of the principal researcher, five female secondary school teachers with past experience in fgd one male undergraduate student of sociology of usmanu danfodio university, sokoto. the research teams participated in a two - days training ; the session included : study overview, ethical conduct of research, role play and pre - testing the study instruments. basic demographic data such as age parity and location of participants were collected from each study participant before the start of each focus group. all focus groups were held in hausa, the local language familiar to all research participants. the focus groups lasted about an hour each ; interviewers took extensive notes, in addition to tape recording and transcribing the interviews. the demographic data were processed using spss version 16 (chicago, il, usa), and information obtained were transcribed verbatim. this textual data was compared and combined with information notes taken during the interview sessions. in addition, the content of the textual data was double checked with summaries and conclusions made at the end of the interview sessions in order to ensure that those notes were similar to what they answered during the interviews. basic description of data was done through open coding where textual data was decomposed into parts, marked and coded with the aid of nvivo software. then, the parts were compared based on the similarities and differences that combined to form a new category and subcategories. this was followed by linking the various categories, this is often referred to as axial coding, and the information of each category and it is subcategories was refined and determined in relation to its conditions, context, strategies and consequences. the concept and idea of antenatal care (anc) enjoyed universal acceptability among the participants in all the communities studied, with low utilization of facilities for delivery. women who delivered outside health facilities relate their circumstances to the following factors, getting permission from husband / family, distance to a health facility or lack of transportation, cost of service fee for treatment, trust in service quality, belief that it may not be necessary or customary (fig. reasons for not delivering in facilities in addition, cultural sensitivity, social support, availability and affordability of services, previous negative experiences with health facilities delivery, cultural perception of the role of tbas, attitude of health workers to clients, clients assessment of quality of care, ignorance/ low awareness of facility services, economic constraints, and relative autonomy of women / empowerment were among other findings. analyses of the data revealed two patterns in terms of the responses, the general and the specific. the general related to responses common to all the groups and the second related to themes gleaned from the specific responses of the different groups of participants as outlined above. the general related to issues that were found to commonly emerge from the narratives of all the participants in all categories, male and female relating to perceptions and practices on traditional and modern management of pregnancies and births within the local culture. the specific, on the other hand, related to analyses of narratives of participants in fgds with specific groups of women on their different experiences, supported by data from the kii interviews. most of the respondents were stoic about the possibility of other interventions which, at any rate, were in the realm of divine providence pertaining to their occurrence and resolution. a key indicator of such a perception was the very frequent use of the (hausa (local language) word matsala to mean complications / problems, etc.). labor is now short, quick and uncomplicated and if you go to the hospital for delivery, people will think problems have emerged and you need assistance. allah is helping us it is a known fact that most facilities are located in the urban areas and less, in the rural areas. according to a young mother, hospital delivery was.very important ; that is why in the town when it is time you just pick your kit and go there to deliver but in the village we do nt do that unless there is a problem. in short, across all categories, male and female, the participants did not see facility delivery as a necessity, or even a priority, as obvious in such opinions expressed in fgds by anc - regular women during the fgd sessions : yes, attending for anc is important but you only go there to deliver if you become weak or can not deliver on your own without assistance one goes there only if a problem develops or when the labour takes much time typical indications about this possibility include the following statements attended from two women who regularly accessed anc services :.. i went for anc but no one told me to return for delivery.they only said that if you have any problem you go to the hospital but nobody will tell you that when it is time for delivery we should go to the hospital in contrast facility delivery clearly did not enjoy popularity. several misgivings or disincentives were expressed by almost all the participants, males and females, irrespective of age, location, specific previous experience with facilities, etc. the misgivings related to discomfort or dislike with specific procedures or bureaucracy at facilities, including : restricted or limited availability or accessibility to social support network, (family members, relations, friends, and other significant others) ; cumbersome procedures, such as requirements to pay for certain services (such as tests). a female participant stated that sometimes they collect money, but it was not clear if such payment(s) were official or as gratifications offered / demanded. however, a young female regular anc attendee added that if drugs are available, they give us and if not they ask us to go and buy. fixation / obsession with hospital cards (kati, understood to include registration cards and files), found or viewed as modern irritants ; rigid working hours observed by facility staff, especially in the rural areas such that the staff were available only at specified times (business hours) and days (no service on weekends) ; rejection of or delays in attending to women showing up for delivery (often due to complications) but who had not been attending anc. such people were often berated and spoken to in harsh tones. a contributor narrated the experience of an acquaintance who took his (acquaintance s) wife, in a critical condition to a health facility. the wife needed immediate attention (rai a hannun allah or who looked like she could die at any moment) only for the health worker to berate the husband as a villager who only now is bringing a corpse to the facility, even as the patient could not indeed be helped at the location : as if the insult was not bad enough, they were.. referred us to the hospital at gusau. ultimately, the wife died for lack of attention. words used to describe such experiences or perceptions and attitudes translated into arrogance, impatience, lack of empathy, partiality (tending to pay greater attention to elite women) ; poor public relations, etc. rendered in hausa words and phrases conveying such negative attributions, such as cin zarafi, tozartarwa and wulakanchi (an elderly husband related his wife s experience of reaching a facility apparently with a complication (probably an obstructed labour) only to be called.. a lazy villager. ironically, my wife delivered safely on her own even before the midwife got round to attend to her. my wife then asked the midwife who the villager was in that situation. since then my wife had vowed never to return to the hospital. she had even instructed me never to be taken to the facility for delivery if it ever became obvious that a delivery would end her life, she would rather die than accept that the medical treatment given with humiliation. another recounted a discouraging experience thus we rushed my friend s wife to the hospital only to be told that the doctor was at home. the condition of my friend s wife was visibly deteriorating and the nurses appeared helpless. my friend lost it, went wild, grabbed the doctor by the collar and threatened to kill him (doctor) should the wife in labour die ! it was only then that the doctor attended to the woman and she eventually delivered. that story travelled far these kinds of stories are unpleasant and do not inspire or encourage positive attitudes to hospitals and the doctors a woman who had indeed even given up on anc visits claimed to have so decided because a facility staff used to shout on people such that now i do nt go there. specific findings unique to groups for women who neither went for anc nor go to facilities to deliver, there was deep - seated preference for the home, and apprehension about, the facilities, virtually all, the major attractions of home delivery were, foremost, low costs and the privacy that the home environment offered. in particular, the home environment resonated with a desire not to be publicly exposed to non - relations during the birth process, in line with cultural practices in this predominantly muslim hausa and fulani majority environment, where reticence and stoicism were expected of persons undergoing physical and psychological pains / challenges. sensitivity of the home environment to entrenched cultural practices (and, in particular, clear separation between males and females) was thus a critical deciding factor. further, the home environment allowed the woman in labor to be attended to by tbas, as were the availability of extensive network of social support including husbands, mothers, relations, co - wives, etc., who readily rendered assistance, relieve women in labor of responsibility for household chores, etc. such social support also allowed pregnant women to do things that were not allowed or permitted in hospitals (e.g. access to foods and drinks). in short, the home environment was such an entrenched and very supportive comfort zone incomparable to the open (public) nature of facilities. for such women, modern health facilities offered no guarantees (for safe deliveries) anyway, as shown in the following narratives : after all, these were what we grew up to know and had been used for generations ! and : even health facilities can not prevent divine ordination in case of the outcome of complications. it needs be stated here that generational differences were found among women in this category : older women expressed greater confidence in traditional remedies, while younger women expressed doubts about the efficacy of traditional remedies calling them hade - hade (or concoctions of unknown efficacy, given on trial - and - error basis). thus, for the younger women, except for other factors, facility deliveries would be preferable to home delivery. still, and not surprisingly, both the older and younger generation of the women were aware of the shortcomings of the home environment, including the lack of facilities and expertise to handle complications that may arise (obstructed labor, excessive bleeding, retained placentas, etc.). while the older women hesitated to admit the inadequacy of the home environment to deal with such eventualities (complications), the younger ones were more open to admitting the doubtful / unreliable efficacies and effectiveness of herbal concoctions, and other home remedies (i.e. the hade - hade alluded to above). this category of women were clear about the fact of modern health facilities having advantages relating, especially, to monitoring the pregnancy process and offering effective management of birth complications, as well as the availability of modern reliable and effective drugs. additionally, as revealed by a participant at a rural location during an fgd session, an additional attraction going for facility delivery was the incentives given to patrons such as baby kits and mosquito nets. the gifts had become symbols of conformity to modern care that women now compete to acquire and show off, as indeed confirmed by a facility worker at a kii session. another woman given up on anc visit explained that she was put off because of a facility staff : she used to shout on people but now i do nt know because i do nt go there again. this category of women expressed a lot of the sentiments as well as re - echoed perceptions of facilities as expressed by participants of the other categories treated above. however, their most frequently mentioned disincentives for going to facilities to deliver were : (a) costs associated with transportation fare, especially for those who could only attend facility outside their villages / localities. a male household head and participant at an fgd session in a rural location, was emphatic that the problem revolved around talauchii, (translated to condition material poverty) make no mistake about the bush on this facility delivery thing : our problem is poverty ; our daily struggles relate to feeding our families. you are thinking of how to feed the family, buy a ram to slaughter to celebrate births, you hardly boast of n5.00 and you struggle with transportation to reach the hospital with a woman in labor only to be confronted with a list of things to purchase. god save you if you the wife now needs surgery which can costs thousands of naira the simple truth is government has to help us (a) costs associated with transportation fare, especially for those who could only attend facility outside their villages / localities. a male household head and participant at an fgd session in a rural location, was emphatic that the problem revolved around talauchii, (translated to condition material poverty) make no mistake about the bush on this facility delivery thing : our problem is poverty ; our daily struggles relate to feeding our families. you are thinking of how to feed the family, buy a ram to slaughter to celebrate births, you hardly boast of n5.00 and you struggle with transportation to reach the hospital with a woman in labor only to be confronted with a list of things to purchase. god save you if you the wife now needs surgery which can costs thousands of naira the simple truth is government has to help us reflecting such resignation to fate / stoic philosophy a tba expressed during a kii that :.. a pregnant should indeed be taken care of and people do try within the limits of allah s provision for them, but you know we are villagers ; some people try but some just ca nt afford to. similarly a woman participant of this category complained that they also collect money for blood tests and you must pay for that or they will not attend to you (b) shyness and reticence, and deep dislike / distaste for being touched by males other than their husbands ; there are others disallowed by their husbands, from going to the clinic because such husbands could not contemplate their wives being attended to by strange males. (c) distaste for blood transfusion and being forced to accept vaccination ; fear of surgical interventions (including any procedure that involved cutting and stitching parts of the body, episiotomy, etc.). there was a wide belief that all too often facility workers were quick in deciding to go for surgical interventions, even when the need for same was not obvious to husbands / relations accompanying pregnant women to the hospital. several participants recalled situations where pregnant women delivered babies on their own as preparations were being made to admit them into labor rooms or theatres for caesarian operations (cs) at facilities. another recounted a discouraging experience thus we rushed my friend s wife to the hospital only to be told that the doctor was at home. the condition of my friend s wife was visibly deteriorating and the nurses appeared helpless. my friend lost it, went wild, grabbed the doctor by the collar and threatened to kill him (doctor) should the wife in labor die ! it was only then that the doctor attended to the woman and she eventually delivered. that story travelled far these kinds of stories are unpleasant and do not inspire or encourage positive attitudes to hospitals and the doctors a woman who had indeed even given up on anc visits claimed to have so decided because a facility staff used to shout on people such that now i do nt go there. the traditional birth attendants (tba) that participated in this study were mostly elderly women, and often conduct delivery alone. most tbas inherit the role from their mothers, they are normally called only after delivery or when a complication has set in, and may not be around at critical times when danger signs need to be identified. tbas cut the cord and bury the placenta, bath the baby for seven days and assist women to take a hot bath for forty days after delivery. a tba expressed during a kii that : a pregnant should indeed be taken care of and people do try within the limits of god s provision for them, but you know we are villagers ; some people try but some just ca nt afford to similarly a woman participant of this category complained that they also collect money for blood tests and you must pay for that or they will not attend to you shyness and reticence, and deep dislike / distaste for being touched by males other than their husbands ; there are others disallowed by their husbands, from going to the clinic because such husbands could not contemplate their wives being attended to by strange males. there was a wide spread belief that all too often facility workers were quick in deciding to go for surgical interventions, even when the need for same was not obvious to husbands / relations accompanying pregnant women to the hospital. several participants recalled situations where pregnant women delivered babies on their own as preparations were being made to admit them into labor rooms or theatres for caesarian operations (cs) at facilities. most of the respondents were stoic about the possibility of other interventions which, at any rate, were in the realm of divine providence pertaining to their occurrence and resolution. a key indicator of such a perception was the very frequent use of the (hausa (local language) word matsala to mean complications / problems, etc.). labor is now short, quick and uncomplicated and if you go to the hospital for delivery, people will think problems have emerged and you need assistance. allah is helping us it is a known fact that most facilities are located in the urban areas and less, in the rural areas. according to a young mother, hospital delivery was.very important ; that is why in the town when it is time you just pick your kit and go there to deliver but in the village we do nt do that unless there is a problem. in short, across all categories, male and female, the participants did not see facility delivery as a necessity, or even a priority, as obvious in such opinions expressed in fgds by anc - regular women during the fgd sessions : yes, attending for anc is important but you only go there to deliver if you become weak or can not deliver on your own without assistance one goes there only if a problem develops or when the labour takes much time typical indications about this possibility include the following statements attended from two women who regularly accessed anc services :.. i went for anc but no one told me to return for delivery.they only said that if you have any problem you go to the hospital but nobody will tell you that when it is time for delivery we should go to the hospital in contrast facility delivery clearly did not enjoy popularity. several misgivings or disincentives were expressed by almost all the participants, males and females, irrespective of age, location, specific previous experience with facilities, etc. the misgivings related to discomfort or dislike with specific procedures or bureaucracy at facilities, including : restricted or limited availability or accessibility to social support network, (family members, relations, friends, and other significant others) ; cumbersome procedures, such as requirements to pay for certain services (such as tests). a female participant stated that sometimes they collect money, but it was not clear if such payment(s) were official or as gratifications offered / demanded. however, a young female regular anc attendee added that if drugs are available, they give us and if not they ask us to go and buy. fixation / obsession with hospital cards (kati, understood to include registration cards and files), found or viewed as modern irritants ; rigid working hours observed by facility staff, especially in the rural areas such that the staff were available only at specified times (business hours) and days (no service on weekends) ; rejection of or delays in attending to women showing up for delivery (often due to complications) but who had not been attending anc. a contributor narrated the experience of an acquaintance who took his (acquaintance s) wife, in a critical condition to a health facility. the wife needed immediate attention (rai a hannun allah or who looked like she could die at any moment) only for the health worker to berate the husband as a villager who only now is bringing a corpse to the facility, even as the patient could not indeed be helped at the location : as if the insult was not bad enough, they were.. referred us to the hospital at gusau. ultimately, the wife died for lack of attention. do you think we would ever take our wives to the hospital ? negative attitudes of facility workers, a rampant complaint. words used to describe such experiences or perceptions and attitudes translated into arrogance, impatience, lack of empathy, partiality (tending to pay greater attention to elite women) ; poor public relations, etc. rendered in hausa words and phrases conveying such negative attributions, such as cin zarafi, tozartarwa and wulakanchi (an elderly husband related his wife s experience of reaching a facility apparently with a complication (probably an obstructed labour) only to be called.. a lazy villager. ironically, my wife delivered safely on her own even before the midwife got round to attend to her. my wife then asked the midwife who the villager was in that situation. since then my wife had vowed never to return to the hospital. she had even instructed me never to be taken to the facility for delivery if it ever became obvious that a delivery would end her life, she would rather die than accept that the medical treatment given with humiliation. another recounted a discouraging experience thus we rushed my friend s wife to the hospital only to be told that the doctor was at home. the condition of my friend s wife was visibly deteriorating and the nurses appeared helpless. my friend lost it, went wild, grabbed the doctor by the collar and threatened to kill him (doctor) should the wife in labour die ! it was only then that the doctor attended to the woman and she eventually delivered. that story travelled far these kinds of stories are unpleasant and do not inspire or encourage positive attitudes to hospitals and the doctors a woman who had indeed even given up on anc visits claimed to have so decided because a facility staff used to shout on people such that now i do nt go there. for women who neither went for anc nor go to facilities to deliver, there was deep - seated preference for the home, and apprehension about, the facilities, virtually all, the major attractions of home delivery were, foremost, low costs and the privacy that the home environment offered. in particular, the home environment resonated with a desire not to be publicly exposed to non - relations during the birth process, in line with cultural practices in this predominantly muslim hausa and fulani majority environment, where reticence and stoicism were expected of persons undergoing physical and psychological pains / challenges. sensitivity of the home environment to entrenched cultural practices (and, in particular, clear separation between males and females) was thus a critical deciding factor. further, the home environment allowed the woman in labor to be attended to by tbas, as were the availability of extensive network of social support including husbands, mothers, relations, co - wives, etc., who readily rendered assistance, relieve women in labor of responsibility for household chores, etc. such social support also allowed pregnant women to do things that were not allowed or permitted in hospitals (e.g. access to foods and drinks). in short, the home environment was such an entrenched and very supportive comfort zone incomparable to the open (public) nature of facilities. for such women, modern health facilities offered no guarantees (for safe deliveries) anyway, as shown in the following narratives : after all, these were what we grew up to know and had been used for generations ! and : even health facilities can not prevent divine ordination in case of the outcome of complications. it needs be stated here that generational differences were found among women in this category : older women expressed greater confidence in traditional remedies, while younger women expressed doubts about the efficacy of traditional remedies calling them hade - hade (or concoctions of unknown efficacy, given on trial - and - error basis). thus, for the younger women, except for other factors, facility deliveries would be preferable to home delivery. still, and not surprisingly, both the older and younger generation of the women were aware of the shortcomings of the home environment, including the lack of facilities and expertise to handle complications that may arise (obstructed labor, excessive bleeding, retained placentas, etc.). while the older women hesitated to admit the inadequacy of the home environment to deal with such eventualities (complications), the younger ones were more open to admitting the doubtful / unreliable efficacies and effectiveness of herbal concoctions, and other home remedies (i.e. the hade - hade alluded to above). this category of women were clear about the fact of modern health facilities having advantages relating, especially, to monitoring the pregnancy process and offering effective management of birth complications, as well as the availability of modern reliable and effective drugs. additionally, as revealed by a participant at a rural location during an fgd session, an additional attraction going for facility delivery was the incentives given to patrons such as baby kits and mosquito nets. the gifts had become symbols of conformity to modern care that women now compete to acquire and show off, as indeed confirmed by a facility worker at a kii session. another woman given up on anc visit explained that she was put off because of a facility staff : she used to shout on people but this category of women expressed a lot of the sentiments as well as re - echoed perceptions of facilities as expressed by participants of the other categories treated above. however, their most frequently mentioned disincentives for going to facilities to deliver were : (a) costs associated with transportation fare, especially for those who could only attend facility outside their villages / localities. a male household head and participant at an fgd session in a rural location, was emphatic that the problem revolved around talauchii, (translated to condition material poverty) make no mistake about the bush on this facility delivery thing : our problem is poverty ; our daily struggles relate to feeding our families. you are thinking of how to feed the family, buy a ram to slaughter to celebrate births, you hardly boast of n5.00 and you struggle with transportation to reach the hospital with a woman in labor only to be confronted with a list of things to purchase. god save you if you the wife now needs surgery which can costs thousands of naira the simple truth is government has to help us (a) costs associated with transportation fare, especially for those who could only attend facility outside their villages / localities. a male household head and participant at an fgd session in a rural location, was emphatic that the problem revolved around talauchii, (translated to condition material poverty) make no mistake about the bush on this facility delivery thing : our problem is poverty ; our daily struggles relate to feeding our families. you are thinking of how to feed the family, buy a ram to slaughter to celebrate births, you hardly boast of n5.00 and you struggle with transportation to reach the hospital with a woman in labor only to be confronted with a list of things to purchase. god save you if you the wife now needs surgery which can costs thousands of naira the simple truth is government has to help us reflecting such resignation to fate / stoic philosophy a tba expressed during a kii that :.. a pregnant should indeed be taken care of and people do try within the limits of allah s provision for them, but you know we are villagers ; some people try but some just ca nt afford to. similarly a woman participant of this category complained that they also collect money for blood tests and you must pay for that or they will not attend to you (b) shyness and reticence, and deep dislike / distaste for being touched by males other than their husbands ; there are others disallowed by their husbands, from going to the clinic because such husbands could not contemplate their wives being attended to by strange males. (c) distaste for blood transfusion and being forced to accept vaccination ; fear of surgical interventions (including any procedure that involved cutting and stitching parts of the body, episiotomy, etc.). there was a wide belief that all too often facility workers were quick in deciding to go for surgical interventions, even when the need for same was not obvious to husbands / relations accompanying pregnant women to the hospital. several participants recalled situations where pregnant women delivered babies on their own as preparations were being made to admit them into labor rooms or theatres for caesarian operations (cs) at facilities. another recounted a discouraging experience thus we rushed my friend s wife to the hospital only to be told that the doctor was at home. the condition of my friend s wife was visibly deteriorating and the nurses appeared helpless. my friend lost it, went wild, grabbed the doctor by the collar and threatened to kill him (doctor) should the wife in labor die ! it was only then that the doctor attended to the woman and she eventually delivered. that story travelled far these kinds of stories are unpleasant and do not inspire or encourage positive attitudes to hospitals and the doctors a woman who had indeed even given up on anc visits claimed to have so decided because a facility staff used to shout on people such that now i do nt go there. the traditional birth attendants (tba) that participated in this study were mostly elderly women, and often conduct delivery alone. most tbas inherit the role from their mothers, they are normally called only after delivery or when a complication has set in, and may not be around at critical times when danger signs need to be identified. tbas cut the cord and bury the placenta, bath the baby for seven days and assist women to take a hot bath for forty days after delivery. a tba expressed during a kii that : a pregnant should indeed be taken care of and people do try within the limits of god s provision for them, but you know we are villagers ; some people try but some just ca nt afford to similarly a woman participant of this category complained that they also collect money for blood tests and you must pay for that or they will not attend to you shyness and reticence, and deep dislike / distaste for being touched by males other than their husbands ; there are others disallowed by their husbands, from going to the clinic because such husbands could not contemplate their wives being attended to by strange males. there was a wide spread belief that all too often facility workers were quick in deciding to go for surgical interventions, even when the need for same was not obvious to husbands / relations accompanying pregnant women to the hospital. several participants recalled situations where pregnant women delivered babies on their own as preparations were being made to admit them into labor rooms or theatres for caesarian operations (cs) at facilities. this study shows that there is good acceptance of antenatal care and it will result in safe delivery. the major and common reasons across board for preference for home delivery include poverty, affordability, facility delivery is alien, and unattractive to them and inadequate / lack of empathy from facility staff when compare with empathy and support from relation at home. the home preference is largely related to cost, with hospital deliveries known to be very expensive. one man mentioned the sum of naira 2,000 (equivalent to twelve dollars) for a routine hospital delivery. tbas are usually paid in kind, with anything within your reach, even farm produce. a narrative by one male regard to tbas was : we were born through their services, and we are around today. similar phenomena are highlighted by kruk finding in rural tanzania study (9).but in contrast to orisaremi s finding among tarok women in north - central nigeria, where bravery and audacity are the main factors that discourage most women from facility delivery (10). apart from user fee being unaffordable to many, the payment procedure is cumbersome and no credit facility, instalment payment or exchange of goods for service as practiced by traditional birth attendants, which provide succour to many families. in shah s study in karachi, india, the two most common reasons for home deliveries are family tradition and lack of affordability / poor socio - economic condition of the family (11). lack of privacy and exposure to non - relatives and men and dislike / distaste for being touched by male other than their husband which is borne out of cultural and / or religious belief are another major factors that drive women away from facility delivery in this study. since there is no guarantee that they will meet a female staff at time of labour. some attitudes of the hospital staff and hospital practices such as shouting on patients, arrogance, impatience, humiliation, lack of empathy and abuse, tapping patients in labour, all these discourage women from facility delivery. many women can not bear it and that is one of the reasons why they use facility as last resort when they have no other option. this study also reveal perception about facility delivery which is seen to be as necessary if complications emerged, a last resort, an aide in the management of difficult births or those that come with complications. most of the respondents are stoic about the possibility of other interventions which, at any rate, are in the realm of divine providence pertaining to their occurrence and resolution. among the less common reasons for aversion to facility delivery in this study is fear of surgical intervention. this is the most common reason among guatemala women for not going to facility for delivery even in the case of life threatening complications (12). the caesarean section is often thought to be unnecessary and may have effect on future fertility. there is a generational difference in perception and attitude towards facility delivery between younger and older generation of women. most of the women are aware of the possible drawbacks of home delivery such as lack of facilities (equipment), expertise to recognize early complication signs and management of complication. based on these findings it is recommended that facility services should be subsidized if not free, girls / women should be educated and empowered, health care providers should have seminars on attitudinal change so as to cultivate positive attitudes, traditional birth attendants should be officially engaged in encouraging women to embrace facility delivery and provision of incentives such as mosquito nets and baby kits to encourage facility delivery. the home preference is largely related to cost, with hospital deliveries known to be very expensive. one man mentioned the sum of naira 2,000 (equivalent to twelve dollars) for a routine hospital delivery. tbas are usually paid in kind, with anything within your reach, even farm produce. a narrative by one male regard to tbas was : we were born through their services, and we are around today. similar phenomena are highlighted by kruk finding in rural tanzania study (9).but in contrast to orisaremi s finding among tarok women in north - central nigeria, where bravery and audacity are the main factors that discourage most women from facility delivery (10). apart from user fee being unaffordable to many, the payment procedure is cumbersome and no credit facility, instalment payment or exchange of goods for service as practiced by traditional birth attendants, which provide succour to many families. in shah s study in karachi, india, the two most common reasons for home deliveries are family tradition and lack of affordability / poor socio - economic condition of the family (11). lack of privacy and exposure to non - relatives and men and dislike / distaste for being touched by male other than their husband which is borne out of cultural and / or religious belief are another major factors that drive women away from facility delivery in this study. since there is no guarantee that they will meet a female staff at time of labour. some attitudes of the hospital staff and hospital practices such as shouting on patients, arrogance, impatience, humiliation, lack of empathy and abuse, tapping patients in labour, all these discourage women from facility delivery. many women can not bear it and that is one of the reasons why they use facility as last resort when they have no other option. this study also reveal perception about facility delivery which is seen to be as necessary if complications emerged, a last resort, an aide in the management of difficult births or those that come with complications. most of the respondents are stoic about the possibility of other interventions which, at any rate, are in the realm of divine providence pertaining to their occurrence and resolution. among the less common reasons for aversion to facility delivery in this study this is the most common reason among guatemala women for not going to facility for delivery even in the case of life threatening complications (12). the caesarean section is often thought to be unnecessary and may have effect on future fertility. there is a generational difference in perception and attitude towards facility delivery between younger and older generation of women. most of the women are aware of the possible drawbacks of home delivery such as lack of facilities (equipment), expertise to recognize early complication signs and management of complication. based on these findings it is recommended that facility services should be subsidized if not free, girls / women should be educated and empowered, health care providers should have seminars on attitudinal change so as to cultivate positive attitudes, traditional birth attendants should be officially engaged in encouraging women to embrace facility delivery and provision of incentives such as mosquito nets and baby kits to encourage facility delivery. the common reasons for aversion to facility delivery include poverty, cost of service, non - permission from husband, alien and negative attitude of staff. other reasons include its unnecessary, lack of privacy and exposure to non - relatives and men and dislike / distaste for being touched by male other than their husband and lack of empathy. ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors.
|
background : in many sub - saharan african countries the rate of antenatal care (anc) has been increased but skilled birth attendance rate is still low. the objective of this study was to evaluate the reasons why women prefer home delivery when facility based delivery is available at minimal cost.methods:this study was conducted in northwest nigeria using a qualitative method (phenomenology) among five categories of women in april may 2013. this study investigated different categories of women (those that never attend anc nor deliver in the facility, those that attend anc but delivered at home and those that delivered once in the facility but fail to return in subsequent deliveries, the in - laws and facilities staff).results : through focus group discussions and in - depth interviews several reasons why women are averse to hospital deliveries were identified. women reported ignorance, abuse, illiteracy, and poverty, and low esteem, poor attitude of health workers, few working hours and some integrated health services like preventing mother to child transmission of hiv testing as deterrents, while cheap and accessible services were reasons for preference to traditional birth attendants.conclusions:the findings highlighted important entrenched barriers to facility deliveries among women, which is basically socio - cultural and economic. therefore emphasis must be given to health education program to ensure comprehensive and target specific messages that will address individual needs of the groups.
|
central neurocytomas are slow - growing neuronal primary intracranial tumors, found mostly in young adults, usually located in the lateral ventricles. pediatric presentation of central neurocytoma is very rare, and no significant data have been published regarding their incidence. rades. in their series of neurocytoma in children reviewed 59 patients, which is so far considered the largest case series of this rare neoplasm of children under 18 years, reported only 13 (22%) patients who were in the first decade. we are reporting this case because of its rarity, especially in this age and its location. our case is of a 9year - old girl who was diagnosed with central neurocytoma of the third ventricle. a 9-year - old previously healthy girl presented with headache of 1-month duration, which was continuous and holocranial in nature. there was also associated nausea and several episodes of vomiting for the past 1 month. on detailed clinical examination, the only positive the vital signs were within normal limits, and there were no focal neurological deficits. her blood reports were unremarkable. on magnetic resonance imaging of the brain, a well - defined globular mass with mixed intensity the tumor measured 47 mm 59 mm 55 mm in craniosacral and craniocaudal dimensions. bilateral thalamic compression was noted along with upstream hydrocephalus. on t2 imaging [figure 1b ], the mass appeared heterogeneously hyperintense, and on t1-weighted [figure 1a ], a hyperintense area with multiple cystic areas was noted. magnetic resonance spectroscopy revealed high choline and glycine peaks with low n - acetylaspartate peaks. (a) t1 axial section of brain showing a hyperintense lesion with multiple cystic areas within the third ventricle. (b) t2 axial section of the brain showing a heterogeneously hyperintense lesion in the third ventricle. (c) sagittal section of brain on contrast study showing intense enhancement of the solid part of the lesion the patient was operated with right frontoparietal craniotomy using the anterior interhemispheric transcallosal approach. corpus callosotomy of around 2 cm was done the choroid plexus was seen and followed to reach the foramen of monro, and the tumor was approached transforaminally. total removal of the tumor was achieved by piecemeal excision through the foramen of monro. bone flap was replaced, and wound was closed in layers after achieving absolute hemostasis. intraoperatively, the tumor was found to be globular, pale, grayish - white, soft, suckable, and moderately vascular. the tumor sample was sent for histopathologic examination and immunohistochemistry (synaptophysin and neuron - specific enolase [nse ]). on histopathology [figure 2a ], small sheets of atypical round-/oval-/epithelial - like cells with enlarged round / oval / hyperchromatic nuclei with occasional nucleoli with definite cellular - nuclear pleomorphism were seen, and rare mitotic activity was noted. on immunohistochemistry [figure 2b and c ], both synaptophysin and nse were positive helping us to arrive at the diagnosis of central neurocytoma. (a) histopathologic examination suggesting degenerated cellular neoplasm with definite cytologic atypia corresponding to the who grade ii tumor. (b) synaptophysin (c) neuron - specific enolase positive the patient was discharged without any neurological deficits and with relief of headache on the 10 postoperative day. till date initially, it was termed as a who grade i tumor and was updated to grade ii in 1993. fifty percent are located in the lateral ventricles, 13% in both lateral and third ventricles, and solitary third ventricle central neurocytomas amount to only 3%. classically, central neurocytomas present with features of increased intracranial pressure associated with obstructive hydrocephalus. in a study, schild. reviewed 27 patients of which 93% had headache, 37% had visual problems, and 30% had nausea and vomiting as their chief complaints, which was similar to the complaints of our patient. the most commonly used approaches are anterior transcallosal approach and anterior transcortical approach. in our case, the previous approach, i.e. central neurocytoma is confirmed diagnostically by immunohistochemistry for neuronal antigens such as synaptophysin and nse. among the two, synaptophysin is most remarkable and nse is considered nonspecific. both these tests were positive in our study. radiotherapy might prove beneficial in adult cases, in which there is incomplete tumor removal although it is still a matter of concern in children.
|
central neurocytomas are slow - growing primary brain tumors of neuronal origin having a predilection to arise mostly in the lateral ventricles. we report a case of a 9-year - old girl who presented with headache and vomiting of 1-month duration. her magnetic resonance imaging was suggestive of central neurocytoma of the third ventricle and was surgically managed, and tumor tissue was sent for histopathology and immunohistochemistry which confirmed the diagnosis.
|
cisplatin (cddp) is a chemotherapeutic agent of proven value in the treatment of a number of solid tumors. nephrotoxicity and electrolyte depletion are dose - limiting toxicity of cddp and discouraged attempts at dose escalation. initial reports of azotemia and acute renal failure were followed by reports of other renal disorders, including renal magnesium wasting, as a consequence of cisplation treatment. renal magnesium wasting is present in virtually all patients treated with cisplatin, resulting in hypomagnesemia with associated hypokalemia and hypocalcemia. we have observed the development of hypomagnesemia, hyponatremia and hypopotassemia in patients receiving cisplatin as part of a combination chemotherapy protocol for nsclc. the use of cisplatin is likely to increase, and the nephrotoxic effects are iatrogenic and thus some what preventable. we have had the opportunity to follow a number of patients with nsclc who were treated with cisplatin - containing regimen. this report describes the occurrence of nephrotoxicity and some electrolyte depletion in such a patient population. fourty seven patients with advanced nsclc were entered into the study from october 1987 to december 1988. one patient was not eligible because he had inadequately controlled brain metastasis. among the 46 eligible patients, females were 17 (37%) and males 29 (63%). the distribution of patients by histologic diagnosis was ; 39 adenocarcinoma, 3 squamous cell carcinoma, one large cell carcinoma, one adeno - and squamous cell carcinoma respectively, and 2 were unclassified carcinoma. before starting the chemotherapy mitomycin was given intravenously in distilled water at 0.5 mg / ml by intravenous push on day 1 after methylprednisone and antiemetics. cisplatin was then given in 250 ml of 3% sodium chloride with 37.5 g mannitol and 20 meq kcl intravenously for 3 hours on days 1 and 7. etoposide was administered orally in two equally divided doses on days 3, 4 and 5. during & after completion of each courses of chemotherapy, we measured the serum level of na, k and mg until these began to normalize. also, we checked creatinine clearance, bun and creatinine in three to four days interval. the dose schedule of chemotherapy was revealed in table 1. among the total 93 courses, hyponatremia developed in 40 courses (43%), only one course showed severe hyponatremia (na<125 meq / l) on dose level 0. nineteen courses were moderate (125na130 meq / l) and 20 courses were mild (131na135) hyponatremia. nine courses were moderate hypokalemia (2.6k3.0 meq / l) and mild hypokalemia (3.1k3.5 meq / l) was 13 courses. hypomagnesemia was 11 courses ; 5 were mild (1.4<mg<1.8 mg / dl) and 6 were moderate (0.9<mg<1.3 mg / dl). no cumulative toxicity can be estimated, because all the electrolyte levls were normalized before the next administration of chemotherapeutics. some patients showed severe diarrhea, nausea and vomiting but, specific electrolyte depletion was not observed. bun / creatinine increased in 16 courses but almost recovered before the next course of chemotherapy. and the effect of combination chemotherapy containing cddp has been well established in a number of solid tumors, including testicular cancer, ovarian cancer, lung cancer and head and neck cancer. as a coordinate metal complex there are many reports of electrolyte depletion using an usual dose of cisplatin containing regimen and some cases showed fatal results. some reports describe the relationship between renal insufficiency and hypomagnesemia, hyponatremia and potassium depletion as a serial event. to disclose the dynamics of electrolyte depletion, they investigated renal function abnormalities. to overcome the renal and nonrenal toxicities, someone used high dose cisplatin in hypertonic saline and got a measurable effect. and they suggested several measures to prevent impairment of renal function and electrolyte imbalance. when some studies used the dose of cisplatin less than 100200 mg / m body surface area with moderate hydration (3 l / d), mannitol and furosemide diuresis, an acceptible degree of nephrotoxicity has been reduced. to overcome the dose limiting toxicity of cisplatin, robert et they reported that there was no statistically significant decrease in creatinine clearance or elevation of serum creatinine after three to four cycles of a combination chemotherapy regimen. their studies show that high dose cisplatin (40 mg / m body surface area d for 5 days) can be administered without any increase in nephrotoxicity in previously untreated patients, using vigorous saline hydration and 3% saline as a vehicle for drug delivery. baum and associates reported a 44% incidence of renal toxicity with cisplatin doses of 130 mg / m body surface area in childhood cancer. schilsky and anderson noted hypomagnesemia during cisplatin therapy and demonstrated inappropriate urinary magnesium loss in the presence of low serum levels. monique studied the influence of hydration on cisplatin kinetics and kidney function in patients treated with cisplatin. groups of ten patients received 100 mg / m cispatin in isotonic or hypertonic saline by a 20-min infusion. according to their results, they suggest that the infusion of cisplatin in hypertonic saline with salt hydration could exert a protective effect on the kidney. although the mechanism remains unclear, the movement of magnesium and potassium appears tightly coupled in the intracellular compartment and, to some extent, in the extracellular compartment. the rate of cisplatin infusion has been manipulated in an attempt to minimize renal toxicity. hill and associates reported that azotemia occured significantly less often when infusion rate did not exceed 1 mg / kg body weight. cvitkovic and colleagues found that vigorous intravenous hydration before, during and immediately after the administration of cisplatin to dogs reduced the incidence of azotemia and acute renal failure. at this time, there is no complete measure on the avoidance of cisplatin - induced nephrotoxicity and magnesium wasting. careful evaluation of renal function before each course of cisplatin and frequent serum measurements and replacement, of magnesium, sodium and potassium are recommended. in our experience, the incidence and severity of cisplatin nephrotoxicity and consequent electrolyte depletions are reduced by liberal intravenous hydration during and for 46 hours after cisplatin administration. but some others point out that avoidance of othe nephrotoxic drugs, such as aminoglycosides, and keeping off rapid cisplatin infusion are also important.
|
cisplatin has many toxic effects ; emesis, impairment of renal function, myelosuppression, peripheral neuropathy, ototoxicity and renal tubular wasting.we used mvp regimen (mitomycin c, vp-16, and cisplatin) in advanced non - small cell lung cancer (nsclc).using hydration and prophylactic supplementation of sodium and potassium before and during chemotherapy, we have observed the development of hyponatremia in 48 courses (43%), hypokalemia in 23 courses and hypomagnesemia in 11 courses.some patients showed abnormalities of renal function in 16 courses.all the electrolyte depletion and renal problem was corrected before next courses by hydration and replacement of the wasting.frequent measurement of serum cation and appropriate replacement are recommended when high dose cisplatin containing regimen is used in chemotherapy of neoplasms.
|
although effective therapies and evidencebased processes that can improve stroke diagnosis and treatment have been identified, gaps remain in their use. to address these gaps, the american heart association / american stroke association recommends establishing coordinated care systems that integrate best practices in prevention, diagnosis, treatment, and access. in 2004, the joint commission (jc) launched the primary stroke center (psc) hospital certification program that includes assessments of compliance with consensusbased national standards, adherence to clinical practice guidelines, and collection of standardized performance measure (pm) data. although there is considerable support for the psc concept as of january 1, 2011, there were > 800 pscs in 49 states limited data exist comparing the quality of acute stroke care at pscs versus nonpscs over time. the statebased registry of the north carolina stroke care collaborative (ncscc) collects data on pms identical to those required of psc hospitals in a variety of hospitals, including those that are neither capable of nor interested in becoming a psc. we compared compliance with the jc 's 10 pms based on data collected between january 2005 and february 2010 in psc and nonpsc hospitals, as well as in those preparing for certification. the ncscc is part of the centers for disease control and prevention funded paul coverdell national acute stroke registry program. the prospective registry includes patients 18 years of age or older who present to north carolina (nc) hospital emergency departments (eds) with signs or symptoms of stroke or transient ischemic attack. hospitals eligible for participation include all non veterans affairs, nc acute care hospitals with a dedicated ed, including criticalaccess hospitals. all 110 eligible hospitals were invited to participate. a detailed description of hospital characteristics has been published. as previously described, trained hospital staff collect data on demographics, initial presentation, qualityofcare indicators, inhospital outcomes, and discharge disposition using a standardized, internetbased data collection tool. whenever possible, data are collected concurrent with care. a random sample of cases was reabstracted to assess data quality (agreement 95.7%, statistic.94). patients directly admitted to the hospital with a stroke are included ; those with a stroke during hospitalization are excluded. hospitals were grouped into 3 categories : hospitals certified before registry enrollment (psc), hospitals certified after enrollment (preparing for certification), or hospitals that remained uncertified by january 2011 (nonpsc). quality measures include the 10 items in the jc stroke measure set, used as part of the psc certification process. we also measured 2 additional, related measures of quality of care : (1) received tissue plasminogen activator (tpa) within 3 hours of symptom onset and (2) received statin therapy as indicated defectfree care, a summary variable reflecting whether a patient received all of the pms for which he or she was eligible. the tests were used to compare baseline categorical variables, and anova was used for age in years. the overall, unadjusted association between psc group and each pm and defectfree care was evaluated using pearson statistics and 23 contingency tables. odds ratios (ors) and 95% cis for unadjusted models were calculated using logistic regression, with nonpscs as the referent. models adjusted for patientlevel variables included age in years, sex, race (black, white, and/or other), and stroke type (hemorrhagic, ischemic, transient ischemic attack, or stroke not otherwise specified) and used logistic regression. to investigate the effect of psc status while controlling for both patientlevel factors and the hospital size (< 100, 100 to 349, or 350 beds), as well as accounting for clustering of patients within hospitals, a generalized estimating equations (gee) approach was used. change in the percentage of cases in compliance with each pm was averaged for each year between 2005 and 2010, and absolute annual percent change was calculated and compared using 2sided f tests, with nonpsc hospitals as the reference group. trend lines in the plots of compliance with pms over time were created using simple linear regression and 3month time intervals. this study was approved by the university of north carolina at chapel hill institutional review board and individual hospitals ' institutional review boards as required. the tests were used to compare baseline categorical variables, and anova was used for age in years. the overall, unadjusted association between psc group and each pm and defectfree care was evaluated using pearson statistics and 23 contingency tables. odds ratios (ors) and 95% cis for unadjusted models were calculated using logistic regression, with nonpscs as the referent. models adjusted for patientlevel variables included age in years, sex, race (black, white, and/or other), and stroke type (hemorrhagic, ischemic, transient ischemic attack, or stroke not otherwise specified) and used logistic regression. to investigate the effect of psc status while controlling for both patientlevel factors and the hospital size (< 100, 100 to 349, or 350 beds), as well as accounting for clustering of patients within hospitals, a generalized estimating equations (gee) approach was used. change in the percentage of cases in compliance with each pm was averaged for each year between 2005 and 2010, and absolute annual percent change was calculated and compared using 2sided f tests, with nonpsc hospitals as the reference group. trend lines in the plots of compliance with pms over time were created using simple linear regression and 3month time intervals. this study was approved by the university of north carolina at chapel hill institutional review board and individual hospitals ' institutional review boards as required. between january 1, 2005, and february 15, 2010, we enrolled 38 983 patients from 53 hospitals in ncscc for whom we had complete data (figure 1). cases at the 6 hospitals that collected < 6 months of data were excluded (n=291) as were cases discharged as no stroke (n=2389). cases entered during the first 2 months of data collection were excluded (n=1346) to minimize the learning curve effect, leaving 47 hospitals and 29 654 cases for analysis. during the study period, there were 10 pscs (n=14 885), 8 hospitals preparing for certification (n=6974), and 29 nonpscs (n=7795) in the ncscc. one third (n=17) of hospitals included in analyses were located in nonmetropolitan counties, whereas nearly half (n=23) were located in metropolitan areas with a population of 250 000. the median number of beds for hospitals in the study population was 162 (interquartile range 113 to 457) in 2012. north carolina counties with a north carolina stroke care collaborative (ncscc) hospital, 20052012. compared with nonpscs, pscs and hospitals preparing for certification tended to be larger (p<0.01), teaching hospitals (p<0.01), and urban hospitals (p=0.03) (table 1). they were also more likely to have an intravenous (iv) tpa protocol (p=0.04), an ed stroke protocol (p=0.02), a stroke unit (p<0.01), and a neurosurgeon on staff (p<0.01). cases at pscs tended to be younger (p<0.01), male (p<0.01), and nonwhite (p<0.01) (table 2). characteristics of hospitals participating in the north carolina stroke care collaborative, 20052010, by psc certification status psc indicates primary stroke center ; tpa, tissue plasminogen activator ; ems, emergency medical services. characteristics of cases enrolled in the north carolina stroke care collaborative, 20052010, by psc certification status psc indicates primary stroke center. pscs and hospitals preparing for certification had higher compliance with all but 2 pms (smoking cessation counseling and treatment of cases with atrial fibrillation with anticoagulant therapy) compared with nonpscs (p<0.01) (table 3). pscs were the most likely to provide deep vein thrombosis prophylaxis, antithrombotic agents, and iv tpa. hospitals preparing for certification were the most likely to measure lipids during hospitalization, screen for dysphagia, provide stroke education, and provide smoking cessation counseling. defectfree care was most common at hospitals preparing for psc certification (52.8%), followed by pscs (45.0%) and nonpscs (21.9%). percentage of cases in compliance with joint commission performance measures, north carolina stroke care collaborative, 20052010, by psc certification status denominators vary based on exclusion / inclusion criteria. psc indicates primary stroke center ; iv tpa, intravenous tissue plasminogen activator. as shown in table 4, psc hospitals and those preparing for certification had higher odds of complying with all measured stroke performance indicators (including defectfree care) with the exception of providing anticoagulants to patients with atrial fibrillation (no statistical difference) and providing smoking cessation counseling (pscs had lower compliance than nonpscs). adjustment for age, sex, race, and stroke type altered ors only modestly. further adjustment for hospital bed size and accounting for clustering of patients within hospitals modestly attenuated some, but not all, ors but did widen cis. with regard to hospitals preparing for certification, cis were widened to the point of nonsignificance for discharge on antithrombotic, receipt of iv tpa, measurement of lipids, and consideration for a rehabilitation plan. odds ratio and 95% cis of compliance with joint commission performance measures among cases enrolled in the north carolina stroke care collaborative, 20052010, by psc certification status (referent = nonpsc) psc indicates primary stroke center ; iv tpa, intravenous tissue plasminogen activator. adjusted for age, sex, race, and stroke type. adjusted for age, sex, race, stroke type, and hospital bed size and accounting for clustering of patients within hospitals. there were substantial improvements in the quality of acute stroke care from 2005 to 2010 (table 5). overall, pm compliance increased for all measures and for all 3 hospital groups (figure 2), with the exception of discharge on antithrombotic medication, which remained high throughout the study period in all 3 groups. pscs and hospitals in the process of certification had consistently higher pm compliance. compared with nonpscs, pscs had a higher average annual percent increase in smoking cessation counseling (p<0.01), and those preparing for certification had the greatest increases in the percent of patients for whom iv tpa was considered (p<0.01) and in the percentage of eligible cases who received iv tpa (p=0.04), those who had a lipid profile measured during hospitalization (p<0.01), and those who were discharged on a statin (p=0.04). pscs and those preparing for certification had a higher average annual percent increase in the provision of defectfree care (p=0.01 and 0.04, respectively) than nonpscs. compared with hospitals preparing for certification, nonpscs had a higher average annual percent increase in the provision of dvt prophylaxis (p=0.04), and compared with pscs, nonpscs had a higher average annual percent increase in cases administered iv tpa (p=0.01) and in cases discharged on a statin (p=0.01). average annual absolute percentage change in compliance with joint commission performance measures among cases enrolled in the north carolina stroke care collaborative, 20052010, by psc status (referent = nonpsc) denominators vary based on exclusion / inclusion criteria. percentage of cases enrolled in the north carolina stroke care collaborative meeting joint commission performance measures, 20052010, by primary stroke center certification status over time (months). we found that the quality of strokerelated care improved in hospitals participating in the ncscc registry 2005 through 2010, but pscs and hospitals preparing for certification had higher compliance with most pms. moreover, pscs and hospitals preparing for certification had greater improvements over time on a number of measures. in unadjusted analyses, hospitals preparing for certification had higher compliance than established pscs for lipids measured during hospitalization, dysphagia screening, stroke education, smoking cessation counseling, consideration for a rehabilitation plan, and overall defectfree care. these differences initially suggested support for the theory that when preparing for certification, hospital personnel must devote a great deal of time effort and commitment to improving stroke care ; however, thereafter, there may be a tendency toward complacency with past improvements and a diminishment in the urgency for continued quality improvement or a ceiling effect with further improvements having relatively less impact. however, after adjustment for patientlevel factors and hospital bed size and after accounting for the clustering of patients within hospitals, these differences were removed, suggesting pscs continue to improve quality of stroke care, even after certification. our finding that nonpscs had a higher average annual percent increase in cases administered iv tpa and in cases discharged on a statin is likely due to the fact that baseline iv tpa rates were much lower at baseline at nonpscs (table 3), allowing for greater improvements in response to secular trends. rate of discharge on a statin was high for all 3 groups (table 3) but lowest for nonpscs, again allowing for greater improvement over time. certification requires hospitals to have stroke teams and stroke units and to use standardized stroke care pathways to guide evaluation and treatment of stroke. the quality of stroke care has improved in recent years, both nationally and in nc. these trends are reflected in our data, as even nonpscs, which include primarily small, rural, nonteaching hospitals, showed improvements. a 2010 statewide survey of hospitalbased stroke services in nc reported that the introduction of the jc 's psc certification process occurred concurrent with significant improvements in a number of important organizational features in nc hospitals, including the use of stroke care maps, iv tpa protocols, stroke teams, prewritten stroke orders, and diagnostic tests that were not seen in the period preceding the psc certification program. organizational and procedural changes such as these are likely important drivers of improved compliance with stroke treatment recommendations. for example, one study found that patients admitted to pscs were more likely to receive iv tpa. another reported that in new york state, patients cared for at pscs had shorter median doortophysician times, a higher probability of appropriate iv tpa administration, and a higher probability of stroke unit admission. shorter time to computed tomography scan at pscs compared with nonpscs has been reported in a previous ncscc study. psclike programs in other countries have reported similar improvements in acute stroke care. in japan, investigators reported an increase from 1.2% to 2.8% in iv tpa administration among eligible patients and a significant decrease in response time following psc establishment. studies of the effect of psc certification on mortality and discharge destination suggest a survival benefit. stroke mortality rates at pscs were lower than nonpscs in new york state (ie, 30day mortality, 10.1% versus 12.5% ; p<0.001). studies based on us national data also found lower riskadjusted mortality rates for psc patients with both ischemic and hemorrhagic stroke. similarly, a finnish study reported lower 1year stroke case fatality at certified stroke centers. in contrast, an aha get with the guidelines stroke study reported that while the hospitals ' geographical region and academic status were independently associated with riskadjusted mortality and morbidity, psc designation was not. all of the hospitals, however, were participating in a performance improvement program including all psc pms, which may have reduced the potential effect of psc designation. a study evaluating the impact of the get with the guidelines stroke program reported that, independent of secular trends, time of participation in the program was associated with increased adherence to all stroke pms. still, the greatest improvements were noted among hospitals that received psc certification. the similarity in percent change in compliance with pms among pscs and those preparing for certification suggests a continuum of quality improvement and a benefit in the process of attaining certification certain hospital characteristics such as bed size and academic status have been associated with stroke care quality, and hospitals with greater resources may have provided highquality care before the certification process began. although many key acute stroke care processes (eg, stroke teams, stroke units, neurosurgery on staff, and treatment protocols) may have been developed or improved during certification, precertification differences in hospital characteristics including more physicians, specialists, equipment, and other resources may have facilitated their implementation. though pscs tend to have different characteristics than nonpscs, pscs do not have uniform access, resources, capacity, and quality. further, although certain characteristics (eg, larger size, teaching status, and urban setting) are associated with higherquality care, highquality care can still be provided in a dedicated center that provides a coordinated system of care. strategies such as telemedicine to access stroke teams, ambulance rerouting, and transfer agreements make process measures attainable even by small rural hospitals. multilevel modeling to include the effect of hospital bed size was conducted to address this concern. stroke patients treated at pscs were generally younger, male, and nonwhite and more likely to have hemorrhagic strokes. pscs treated a more severe patient population, as suggested by the higher proportion of hemorrhagic stroke cases. hemorrhagic stroke cases are less likely to receive smoking cessation education and stroke education than were patients with ischemic stroke or transient ischemic attack but are more likely to receive care compliant with other pms. although few age differences have been reported, women were less likely to receive iv tpa treatment and lipid testing, and black patients were more likely to have longer ed waiting times and receive fewer evidencebased care processes than were white or hispanic patients. participation in the ncscc is voluntary, and participating hospitals are more likely to have an interest in stroke quality improvement. our study included hospitals from all regions of nc and included a mix of academic and nonacademic, rural and urban, and small and large hospitals. because the ncscc requires no fee for participation in fact, it assists hospitals with the costs associated with participation barriers to participation are low, and the ncscc is more likely to include a diverse population of hospitals. approximately 62% of the nearly 27 000 stroke hospitalizations in nc each year are at hospitals participating in the ncscc. hospitals were encouraged to include all acute stroke admissions ; however, bias may occur if hospitals do not follow instructions consistently. periodic quality control studies found that 83.7% of all acute strokes discharged from participating hospitals were enrolled. this high case ascertainment rate may be attributed to the use of both prospective and retrospective case capture methods and no requirements to obtain written consent. because the ncscc is a quality improvement registry and patient consent is not required, the lack of consent precludes obtaining postdischarge outcomes data. psc certification is associated with an overall improvement in the quality of stroke care in nc. still, considerable room for improvement remains, even among certified hospitals. additional organizational and policy changes and provider and community education are needed for continued progress. improved public knowledge about stroke symptoms and the proper response is particularly critical if patients are to be eligible for the most effective acute stroke care options. nearly onefifth of nc 's population resides in a county without a psc or a facility with telemedicine or a standing transfer plan, underscoring the importance of identifying facilities appropriate for psc certification or, where unable, using alternative quality improvement strategies. assessment of compliance with pms allows for the monitoring of changes and improvements in systems, operations, and organization within hospitals. continuous monitoring of care measures in both pscs and nonpscs particularly in a realtime, prospective manner as done in the ncscc is critical if quality improvement is to continue. linking compliance levels with outcomes will also be an important measure of the true value of these systemlevel changes and must be addressed in future studies.
|
backgroundorganized stroke care is associated with improved outcomes. data are limited on differences in changes in the quality of acute stroke care at the joint commission certified primary stroke centers (pscs) versus nonpscs over time.methods and resultswe compared compliance with the joint commission 's 10 acute stroke care performance measures and defectfree care in pscs and nonpscs participating in the registry of the north carolina stroke care collaborative from january 2005 through february 2010. we included 29 654 cases presenting at 47 hospitals10 pscs, 8 preparing for certification, and 29 nonpscs representing 43% of north carolina 's non veterans affairs, acute care hospitals. using a nonpsc referent, odds ratios and 95% cis were calculated using logistic regression and generalized estimating equations accounting for clustering of cases within hospitals. time trends were presented graphically using simple linear regression. performance measure compliance increased for all measures for all 3 groups in 20052010, with the exception of discharge on antithrombotics, which remained consistently high. pscs and hospitals preparing for certification had better compliance with all but 2 performance measures compared with nonpscs (each p<0.01). defectfree care was delivered most consistently at hospitals preparing for certification (52.8%), followed by pscs (45.0%) and nonpscs (21.9%). between 2005 and 2010, pscs and hospitals preparing for certification had a higher average annual percent increase in the provision of defectfree care (p=0.01 and 0.04, respectively) compared with nonpscs.conclusionspsc certification is associated with an overall improvement in the quality of stroke care in north carolina ; however, room for improvement remains.
|
a 16yearold male with no significant past or family medical history presented to the pediatric emergency department with a 1month history of a macular rash in both palms that in the following weeks spread to the face, trunk, and all four extremities 1, 2. clinical examination revealed a diffuse symmetric macular rash involving the face, the entire trunk, and the extremities, including the palms (fig. 1) and soles. upon questioning, the patient mentioned a history of unprotected sexual intercourse and further examination revealed a midshaft one centimeter ulcer (fig. laboratory investigations confirmed the diagnosis of secondary syphilis with positive venereal disease research laboratory (vdrl) and treponema pallidum hemagglutination assay (tpha) tests. he was treated with penicillin 2.4 million units intramuscular and referred to the outpatient clinic. six months after diagnosis, he presented a complete clinical resolution and a fourfold decline in vdrl titer.
|
key clinical messagedespite being an uncommon disease in pediatrics, the incidence of syphilis has increased in the last years both in europe and in the united states. upon a suggestive clinical presentation, especially if including genital lesions and palmar rash, secondary syphilis must be included in the differential diagnosis.
|
our study examined 68 isolates collected in russia during 19732014, including 17 outbreak and 24 sporadic isolates from humans and 15 rodent and 11 vegetable isolates (technical appendix table 1, figure 2). all but 3 isolates belonged to the o1b serotype ; these 3 isolates belonged to the o3 serotype. the most recent feslf isolates (from 2014) came from a patient who showed typical signs of feslf, including a cyclic course, fever, and raspberry tongue. a comparison of clinical signs and symptoms in historical versus recent patients suggested that the disease had not evolved since its first description. graphic representation of the evolutionary analysis that tested the hypothesis of equality of evolutionary rates between multivirulence locus sequence type (mvlst) genotypes for study of far east scarlet - like fever caused by a clonal group of yersinia pseudotuberculosis, russia. the test statistic was applied for the pairwise comparison of concatenated sequences of mvlst markers, with the y. pestis sequence being used as an outgroup. circles indicate values of the test statistic of the pairwise comparison calculated in mega6 (10) ; diameters correspond to values of rejection of the null hypothesis that states the equality of evolutionary rates between pairs of concatenated sequences. the isolates were kept frozen until the experiment started. to characterize clonal relationships of the strains, we applied the multilocus sequence typing (mlst) scheme developed by laukkanen - ninios. pcr products were obtained with primers and conditions listed at the yersinia pseudotuberculosis mlst database (university of warwick, coventry, uk ; http://mlst.ucc.ie/mlst/dbs/ypseudotuberculosis). we found 3 mlsts among feslf isolates : mlst2 (n = 33), mlst26 (n = 5), and mlst32 (n = 3) ; this mlst was specific for serotype o3 (table 1). all but 1 vegetable isolate belonged to mlst2, which was also found in 9 (60%) of 15 rodent isolates. multivirulence locus sequence typing (mvlst) types found in far east scarlet like fever (feslf) isolates are in bold. mlst, multilocus sequence typing ; vst, virulence sequence types ; +, positive ;, negative. vsts are determined on the basis of alleles of the virulence genes inv, cnf, yada, and yope. plasmid designated pyv was evidenced by pcr with primers specific to yada and yope (technical appendix table 2, http://wwwnc.cdc.gov/eid/article/22/3/15-0552-techapp1.pdf) and confirmed by agarose gel electrophoresis. plasmid designated pypsip31758.1, which is also called pvm82 (3), was confirmed by pcr with primers specific to dota (technical appendix table 2) and was confirmed by agarose gel electrophoresis. # plasmid designated pvm4.4 was confirmed with agarose gel electrophoresis. the subtypes had different plasmid profiles. mlst analysis was complemented with sequencing of 4 virulence genes involved in critical steps of generalized infection : intestine barrier crossing (inv and yada) (6,7) and macrophage activity regulation (yope and cnf) (8,9) (tables 1, 2). the genes inv and cnf are chromosomal, whereas yope and yada are encoded on the virulence plasmid of yersinia (pyv). kr028003kr028011). a total of 4 distinct virulence sequence types (vsts) were found (table 1). dn, number of nonsynonymous substitutions per site ; ds, number of synonymous substitutions per site ; mlst, multilocus sequence typing ; mvlst, multivirulence locus sequence typing ; na, not applicable. length of fragments included in the sequence analysis. the probability of rejecting the null hypothesis of strict neutrality (dn = ds) in favor of the alternative hypothesis (dn is > ds) and the test statistics (dn ds) are shown. the sequences were cut off to start and finish an analysis with the first and third codon positions, respectively. vst gave rise to 6 multivirulence locus sequence types (mvlsts) (table 1). the sequences of 10 mvlst genes (excluding cnf) were used to build a maximum - likelihood tree with mega6 (10). we excluded the cnf gene from the analysis because the dominant allele carries a nonsense mutation that interrupts the polypeptide after asn181. one subclade united mvlsts found in feslf isolates and mvlst6, which was found only in rodent isolates. maximum - likelihood tree generated with concatenated multivirulence locus sequence type (mvlst) sequences for study of far east scarlet - like fever caused by a clonal group of yersinia pseudotuberculosis, russia. branch lengths and scale bar indicate distances measured in terms of the proportion of nucleotide substitutions between sequences. the diversity of virulence genes was analyzed with dnasp software version 5.10 (11 ; table 2). a noticeable feature of virulence genes was the predominance of nonsynonymous substitutions, whereas basic parameters of nucleotide diversity were similar in virulence and housekeeping genes (table 2). plasmids, particularly the pyv plasmid, are central to the virulence of yersiniae (12). the presence of the additional plasmid pvm82/pypsip31758.1 was screened with pcr specific to the dota gene (3), which was found in all but 4 mvlst1 strains but not in other genotypes. plasmid purification (13) confirmed results obtained from pcr - based screening (data not shown). an additional small plasmid was found in mvlst1 strains that lacked pvm82/pypsip31758.1. consequently, plasmid profiling divided mvlst1 into 2 subtypes, mvlst1a and mvlst1b, without changing other mvlsts (table 1). our findings show that feslf clinical manifestations are caused by strains belonging to at least 4 distinct genotypes, with predominance of mvlst1a (mlst2/vst1/pvm82). we consider the mvlst1a genotype to be generally dominant among strains responsible for feslf in russia, a suggestion supported by the finding that mvlst1a appears to be the only genotype that carries the pvm82/pypsip31758.1 plasmid. a body of epidemiologic data has shown that most epidemic and many sporadic feslf strains carry this plasmid (3,13). the fact that full feslf symptomatology is caused by several distinct genotypes supports the view that specific virulence traits are characteristic of feslf - associated strains (2,3) and suggests that the dominance of the mvlst1a genotype could be caused by its epidemiologic advantages rather than its pathogenic traits. the prevalence of mvlst1a among all isolate sources suggests the genotype s wider dissemination in the region we studied, which supports the possibility that this clone has epidemiologic advantages. to further address this question, we used an evolutionary analysis implemented in mega6 (10) to test the hypothesis of equality of evolutionary rates by using the test for pairwise comparison of concatenated sequences of mvlst markers, with the y. pestis sequence used as an outgroup. the hypothesis of equal rates between mvlst1 and other genotypes was rejected (p<0.05 ; figure 2). the molecular clock test performed with mega6 by comparing the maximum - likelihood values with and without molecular clock constraints under the tamura - nei model supported this conclusion. the inequality of evolutionary rates favors the idea of more effective reproduction and growth of mvlst1 strains in the environment, possibly because of better adaptation to environmental niches. another clone with divergent evolutionary rates was the rare mvlst6 (mlst64/vst2) genotype, which has been isolated from small rodents in the far east of russia (i.e., in this study and according to data on the isolation of mlst64, listed in the y. pseudotuberculosis mlst database). feslf, a relatively new disease, is caused by the bacterium that evolved into the causative agent of plague (14). the evolution of y. pestis is linked to loss of functionality of some factors that are active in y. pseudotuberculosis and to the acquisition of additional factors of both plasmid and chromosomal origin ; these alterations enable the organism to adapt and occupy new environmental niches (14). the feslf causative agent lost at least 2 chromosomally encoded virulence loci, cnf and hpi ; its most successful clone, mvlst1a, acquired an additional plasmid. the geographic region where the first outbreaks of feslf were registered seems close, if not identical, to the region where y. pestis emerged. overall, our data support the view of y. pseudotuberculosis as a rapidly developing pathogenic species, whereas its wide dissemination in the environment promotes selection of clones that are potentially hazardous for humans (24,15). additional details of study of far east scarlet - like fever caused by a few related genotypes of yersinia pseudotuberculosis, russia.
|
we used multivirulence locus sequence typing to analyze 68 yersinia pseudotuberculosis isolated in russia during 19732014, including 41 isolates from patients with far east scarlet - like fever. four genotypes were found responsible, with 1 being especially prevalent. evolutionary analysis suggests that epidemiologic advantages could cause this genotype s dominance.
|
some evidence now links a prolonged exed trunk posture to increased muscle loading and a subsequently increased risk for adverse symptoms in the upper body1. abnormal alignment or posture, such as forward head, kyphosis, and forward shoulder postures, are potential risk factors associated with chronic shoulder diorders2, 3. deviation from normal alignment suggests the presence of imbalance and abnormal strain on the musculoskeletal system3. poor when the head or shoulder is held forward in relation to the trunk, and the characteristics referred to as poor include forward head, poked chin, and forward shoulders1,2,3. among these posture changes, the forward shoulder posture is associated with changes in scapular position and alignment in the sagittal and frontal planes3, 4. the scapula is an important link between the trunk and the upper extremity, and it also provides proximal stability for functional activity of the upper extremity4. an abnormal scapular position changes the muscle length attached to the scapula and eventually results in shoulder pathology such as impingement5, 6. we investigated the differences in shoulder muscle activities during shoulder abduction between a forward shoulder posture group and an asymptomatic group. seven males with forward shoulder posture (fhs) and seven asymptomatic males were recruited. subjects were excluded if they reported a history of shoulder surgery, 6 week or more of shoulder pain, or musculoskeletal, neurological, or cardiopulmonary diseases that could interfere with shoulder elevation. for this evaluation, each subject lay in a supine position with knees bent and arms relaxed at the sides. the linear distance from the treatment table to the posterior aspect of the acromion we decided that a positive sign in this test was 3 cm or more. all emg signals were amplified, band - pass filtered (20 to 500 hz), and then sampled at 1,000 hz using the acqknowledge 3.9.1 software. we measured the upper and middle trapezius (ut and mt), serratus anterior (sa), and the clavicle portion of the pectoralis major (cpm) on the right side during shoulder abduction. we used a horizontal bar for the scapular plane and had the subjects perform a 120-degree shoulder abduction with a 2 kg wrist cuff weight in the scapular plane. the statistical package for the social sciences (spss, chicago, il, usa) was used to perform the independent t - test to analyze the differences in shoulder muscle activities between groups. the alpha level for statistical significance the activity of the ut in the fhs group (45.0 10.2%) was significantly more increased when compared with the asymptomatic group (36.3 7.0%) (p<0.05). the activity of the cpm in the fhs group (32.0 13.6%) was significantly more increased when compared with that of the asymptomatic group (12.3 8.9%) (p<0.05). the activity of the mt in the fhs group (16.0 9.3%) was significantly more decreased when compared with that in the asymptomatic group (25.3 7.9%) (p<0.05). the activity of the sa in the fhs group (21.0 10.6%) was significantly more decreased when compared with that in the asymptomatic group (29.3 12.5%) (p<0.05). this study investigated the differences in shoulder muscles activities during shoulder abduction between a forward shoulder group and asymptomatic group. the results showed that the ut and cpm in the fhs group were significantly more increased when compared with those in the asymptomatic group. the activities of the mt and sa in the fhs group were significantly more decreased when compared with those in the asymptomatic group. a previous study reported that increased upper trapezius muscle activity creates scapular elevation and inferior angle tipping7. ludewig.8 described that middle and lower trapezius weakness cause the forward shoulder posture with scapular anterior tilt. moore9 reported that a slumped posture produced weakness of the neck flexor, middle and lower trapezius, and rhomboid and shortness of the upper trapezius, levator scapular, pectoralis major, and pectoralis minor. however, in the clinic, the forward shoulder posture is regarded as simply an abnormal posture associated with pectoralis major or minor muscle shortness. we suggest that forward head posture causes imbalance of shoulder muscles and scapular instability. this posture could produce the weakness of the mt and sa muscles associated with scapular stability10. also, the muscles must be activated strongly during shoulder abduction based on the scapulohumeral rhythm. the weakness of the mt and sa muscles causes the excessive activation of the ut11. also, activation of the cpm disturbs arm elevation and causes the shoulder head to rotate medially during shoulder abduction10. therefore, the changes in the shoulder muscles due to forward shoulder posture may become potential risk factors for evoking many shoulder disorders, such as impingement syndrome, winging or tipping scapulas, shoulder joint arthritis and tendonitis, and myofascial pain syndrome.
|
[purpose ] this study investigated the differences in shoulder muscles activities during shoulder abduction between a forward shoulder posture group and asymptomatic group. [subjects ] seven males with forward shoulder posture (fhs) and seven asymptomatic males were recruited. [methods ] we measured the upper and middle trapezius (ut and mt), serratus anterior (sa), and clavicle portion of the pectoralis major (cpm) in the right side during shoulder abduction. [results ] the activities of the ut and cpm in the fhs group were significantly more increased when compared with the asymptomatic group. the activities of the mt and sa in the fhs group were significantly more decreased when compared with the asymptomatic group. [conclusion ] we suggest that forward shoulder posture may become a potential risk factor evoking the various shoulder disorders.
|
pseudoaneurysms of the extracranial carotid artery (ecca) are uncommon, and many of these vascular lesions can be managed with medical therapy alone. however, large or symptomatic ecca pseudoaneurysms require intervention. although ecca lesions have traditionally been treated with surgery, the evolution and dissemination of endovascular techniques and technologies have shifted the management of ecca pseudoaneurysms toward minimally invasive approaches. giant pseudoaneurysms resulting in compression and luminal narrowing of the parent vessel are difficult to treat with endovascular intervention since mass effect from the pseudoaneurysm can cause in - stent stenosis. the aim of this case report is to describe the use of a telescoping dual covered stent graft construct for the endovascular treatment of a giant ecca pseudoaneurysm which was imposing a significant local mass effect on the common carotid artery (cca) bifurcation. a 56-year - old male presented with an enlarging left - sided neck mass over a period of 2 months. on initial examination, the patient had left cranial nerve x and xii palsies, as well as local oropharyngeal medialization and edema, which resulted in rightward displacement of the glottis and airway compromise. neck computed tomography (ct) showed a very large left - sided neck mass extending from the level of the c2 transverse process superiorly to the supraclavicular fossa inferiorly, and measuring 8.5 and 13 cm in maximum transverse and craniocaudal dimensions, respectively [figure 1a - c ]. the mass resulted in considerable displacements of the larynx toward the right side, with mild airway narrowing. neck computed tomography, (a) axial, (b) coronal, and (c) sagittal views, shows an 8.5 cm 13 cm mass filling the majority of the left side of the neck. after a failed surgical biopsy of the mass resulted in significant intraoperative bleeding, neck computed tomography angiography, (d) axial, (e) coronal, and (f) sagittal views, shows an enlarging mass arising from the left common carotid artery bifurcation with a central, uniformly enhancing component measuring 5.2 cm 5 cm 5 cm, consistent with a partially thrombosed, giant extracranial carotid artery pseudoaneurysm the initial diagnosis was suspected to be a necrotic, metastatic squamous cell cancer. the patient underwent an open biopsy, which revealed a large amount of organized hematoma. on further dissection, a large quantity of active hemorrhage was encountered, and therefore, establishing the diagnosis of a pseudoaneurysm. the intraoperative bleeding was controlled with pressure, the wound was closed, and the patient was transported to radiology, where neck ct angiography (cta) demonstrated a giant, partially thrombosed ecca pseudoaneurysm arising from the left cca bifurcation [figure 1d - f ]. mass effect from the pseudoaneurysm resulted in narrowing of the cca just proximal to the carotid bulb as well as stenosis of the proximal internal carotid artery (ica). after reviewing the findings of the neck cta, arterial access was established with a 7-french right femoral cook shuttle sheath (cook medical, bloomington, indiana, usa). angiography showed a giant ecca pseudoaneurysm, with a neck spanning the distal cca, external carotid artery (eca), and carotid sinus [figure 2a and b ]. a headway 21 microcatheter (microvention, tustin, california, usa) was navigated over a synchro-14 microguidewire (stryker neurovascular, fremont, california, usa) across the neck of the pseudoaneurysm into the left ica. a rosen exchange guidewire (cook medical) was then positioned high in the left ica. a 7 mm 50 mm viabahn endoprosthesis heparin - bonded covered stent graft (w. l. gore and associates, flagstaff, arizona, usa) was deployed from the lower cervical ica to the distal cca. next, an 8 mm 38 mm atrium advanta v12 balloon - expandable covered stent graft (maquet, rastatt, germany) was deployed, within the first covered stent, from the carotid sinus to the cca. cerebral angiography, (a) anteroposterior and (b) lateral views of a left common carotid artery injection, shows a giant extracranial carotid artery pseudoaneurysm, with a neck spanning the distal common carotid artery, external carotid artery, and carotid sinus. mass effect from the pseudoaneurysm is resulting in compression and luminal narrowing of the proximal internal carotid artery. the extracranial carotid artery pseudoaneurysm was treated with an 8 mm 38 mm atrium advanta v12 covered stent telescoped within a 7 mm 50 mm viabahn endoprosthesis covered stent. poststenting control angiography, (c) anteroposterior and (d) lateral views of a left common carotid artery injection, shows occlusion of the pseudoaneurysm and improved caliber of the internal carotid artery final control angiography demonstrated obliteration of the pseudoaneurysm and improved caliber of the previously stenotic proximal ica, without any evidence of intracranial complications [figure 2c and d ]. the patient was prescribed dual antiplatelet therapy (aspirin 100 mg and clopidogrel 75 mg daily) for 6 weeks postoperatively, followed by monotherapy with aspirin indefinitely. carotid doppler ultrasonography on postoperative day 2 showed patency of the dual stent graft construct spanning the left distal cca and proximal ica as well as occlusion of the pseudoaneurysm. due to the patient 's multiple medical comorbidities, he remained hospitalized for a month after the stenting procedure but was eventually discharged home without postoperative neurological complications. the goal of endovascular therapy for ecca pseudoaneurysms is occlusion of the pseudoaneurysm while preserving flow through the affect portions of the cca and ica. although unilateral eca occlusion is universally well tolerated due to extensive collateral supply, ica occlusion can result in devastating thromboembolic and ischemic cerebral infarctions. therefore, reconstructive approaches (i.e., stenting) are generally preferred over destructive approaches (e.g., ica occlusion or ligation). in a cohort of 116 ecca pseudoaneurysms, fankhauser. reported that the mean diameter of symptomatic pseudoaneurysms was 1.7 cm. the pseudoaneurysm in our case was substantially larger, with a maximum diameter of 13 cm. these giant lesions present unique challenges to both surgical and endovascular treatment, particularly when mass effect from the pseudoaneurysm is compressing the parent artery. the use of covered stents has been previously reported for the treatment of ecca pseudoaneurysms. however, due to the size and extensive mass effect from pseudoaneurysm in our patient, we did not believe a single stent would provide sufficient radial force to maintain the patency of the compressed ica. therefore, we used a telescoping dual covered stent graft construct, in which a balloon - mounted covered stent was deployed within another heparin - bonded covered stent, to simultaneously achieve twin goals : (1) exclusion of the ecca pseudoaneurysm and (2) luminal restoration of the ica. a technique utilizing telescoping covered stents can be employed for the endovascular treatment of appropriately selected patients with large or giant ecca pseudoaneurysms. however, further studies assessing the long - term patency of telescoping dual covered stent constructs are necessary.
|
large pseudoaneurysms which compress the parent vessel are challenging lesions to successfully treat with endovascular therapy. we describe the endovascular treatment of a giant extracranial carotid artery (ecca) pseudoaneurysm resulting in substantial mass effect on the common carotid artery (cca) bifurcation using a telescoping dual covered stent graft construct. a 56-year - old male was diagnosed with an 8.5 cm 13 cm pseudoaneurysm arising from the left cca bifurcation, which was causing luminal narrowing of the cca and proximal internal carotid artery (ica). the patient underwent endovascular intervention, during which a balloon - expandable covered stent was deployed within a heparin - bonded covered stent, such that the overall construct spanned from the cca to the lower cervical ica. the employment of a telescoping dual covered stent technique can successfully treat appropriately selected patients with large or giant ecca pseudoaneurysms, with the concomitant goals of excluding the pseudoaneurysm and restoring the luminal caliber of the parent artery.
|
its pathophysiology has been well identified and progresses from otitis externa to a skull base osteomyelitis secondary to pathogens spreading through anatomical planes within and surroudning the temporal bone (2). the most common pathogen identified is pseudomonas aeruginosa and it is treated with anti - pseudomonal antimicrobial agents unless cultures indicate otherwise. a 70 year old gentleman with a background of type two diabetes mellitus first presented to his family doctor in februrary of 2011 with left sided, throbbing otalgia that had been present for a week. a swab was taken and clioquinol / flumetasone pivalate ear drops were prescribed for a working diagnosis of otitis externa. imaging demonstrating extent of disease the patient presented one month later with continuing ear pain and a new headache. framycetin sulphate / gramicidin / dexamethasone drops were prescribed for a diagnosis of ongoing otitis externa and analgesia was prescribed for the headache. over the next three weeks the patient presented on multiple occasions with worsening headache, impaired balance and trismus. again imaging demonstrating extent of disease two months after his initial presentation, he presented to his family doctor with ongoing otalgia, headache, unsteadiness and had now developed anoxeria. an urgent otorhinolaryngology review found a polyp in the left ear canal with ongoing signs of otitis externa associated with a retained cotton bud. imaging demonstrating extent of disease now three months after his initial presentation, the patient still had ongoing symptoms including headaches, vomiting and 10 kg of weight loss over this time. the headache was atrributed to cervical osteoarthritis, previously diagnosed on ct scanning the year prior. his family doctor admitted him to a small peripheral hospital for management of his pain. at this time a repeat ct scan showed extensive abnormality of the left temporal bone and opacification of the left middle ear, external auditory canal and mastoid air cells. he had a t - tube inserted and was continued on oral and topical ciprofloxacin for a working diagnosis of mastoiditis secondary to otitis externa and media. imaging demonstrating extent of disease despite the intensification of antimicrobial therapy, over the next few weeks his condition worsened with weakness, headaches, dizziness, falls and otorrhea. he was admitted to a large tertiary hospital for nuclear medicine imaging for suspected moe. imaging demonstrating extent of disease at the tertiary hospital the patient was found to be clinically wasted and weak. he also had rightward uvular deviation, absent gag reflex, weakness of the left sternocleidomastoid and trapezius, house brackman grade 2 left facial nerve weakness and an immobile left vocal cord. mri and spect / ct with gallium tracer was performed, the images acquired from which illustrate the severe extent of disease (figures 1 to 5). he was diagnosed with moe with extensive skull base osteomyelitis producing multiple lower cranial neuropathies. biopsy performed by orl / ent surgeons grew scedosporium apiospermum and given the extent of the infection a palliative approach was agreed upon with the patient and family. advanced age and immunocompromised states including diabetes mellitus are the primary pre - disposing factors to developing moe (3). diabetes is an integral aetiological factor for moe in the elderly and this has been attributed to small vessel disease and impairment of phagocytic function (3). the vast majority of otitis externa is due to bacterial pathogens and so is the case for moe. the most common pathogen identified is pseudomonas aeruginosa and up until a decade ago fungal moe was considered extremely rare (4,5). there are however a number of cases in the literature reporting fungal organisms causing moe, including asperigillus species (6 - 8), candida parapsilosis (9), candida ciferri, pseudoallescheria boydii, malassezia sympodialis and scedosporium apiospermum (5,10). this case adds to the growing evidence that fungal moe is becoming more prevalent in our community. a possible cause for this is that there is ready access to ciprofloxacin and other anti - pseudomonal agents in the modern era, therefore reducing the disease burden of otitis externa due to pseudomonas in the community while not addressing the relatively unidentified burden of fungal species. careful clinical judgement is therefore needed when laboratory culture results reveal unusual non - bacterial species. this is particularly important in patients who have a poor response to anti - pseudomonal agents. this case also highlights the dangers of attributing headaches in the context of other symptoms to simple causes such as cervical osteoarthritis and it is a reminder to always consider an alternative diagnosis to the working diagnosis. care should always be taken when a patient presents with headaches and systemic upset in the context of otalgia and ear discharge, as the consequences of failing to treat moe are dire. the mortality rate is currently around 10% with early detection and modern anti - microbials, but if it is identified late moe can be very difficult to treat due to its propensity to spread.
|
a recent case report in this journal highlighted the pathophysiology and management of bacterial malignant otitis externa (moe) (1). we describe the case of an elderly gentleman who had a delayed diagnosis of fungal moe with advanced diseased at time of diagnosis. this case highlights the changing microbiology of this serious disease and the difficulty in diagnosis given the rarity of this form of otitis externa relative to its uncomplicated form.
|
stroke is identified as a sudden neurological deficit of cerebrovascular origin and has been considered as an important leading cause of death and disability all over the world (bath and lees, 2000). the high morbidity and mortality as well as disability rate of this catastrophic illness create a huge burden for human society and families, making it a public health issue. in addition, as the aging of population in many industrialized nations (toole, 2011), the severity of stroke will increase year by year. as a result, the number of neurologists, neuroscientists and neurosurgeons focusing on stroke research as well as the amount of the funding for stroke study has grown substantially in the past few decades (zhu.,, stroke can be divided into ischemic and hemorrhagic stroke, the former accounting for approximate 80% of them (grysiewicz., current studies have shown that both hemorrhage within the brain and primary ischemia can cause a lack of oxygenation and nutritional supply and a series of neurochemical events that lead to spreading brain damage. at present, anti - stroke therapies mainly concentrate on stenting and angioplasty, thrombolytic agents, surgical treatment, neuroprotective drugs, stabilization of intracranial pressure and rehabilitation training (zhao., 2014 ; kuan and sun, 2015). as a result of such limited available therapeutic options, new treatment strategies need to be developed to improve the long - term neurological outcome following stroke. hyperbaric oxygen therapy (hbot), as a nondrug and noninvasive treatment, has long been commonly applied in the treatment of stroke since 1960s and has been proved to be a safe and beneficial treatment strategy, although some controversies still exist (ding., 2014). it is well acknowledged that brain cells rely exclusively on aerobic metabolism and need a high consumption of oxygen as well as glucose to produce adequate tri - phosphate for neuronal signal transduction (wang., 2014) 2009) have demonstrated that hbot can enhance the cerebral oxygenation and have many other neuroprotective effects through various physiologic, biochemical and metabolic mechanisms. in this article, we will discuss the hbot influence for stroke injury and the potential mechanisms on the basis of experimental research and clinical studies. at the pressure of sea level which represents 1 atmosphere absolute (1 ata=101.3 kpa), we breathe the air with only about 21% oxygen. the amount of blood oxygen includes hemoglobin - bounded oxygen and dissolved oxygen in the blood plasm. the arterial oxygen saturation in the blood is nearly 100% in physiologic conditions, which means almost all the hemoglobin is bounded with oxygen and only little can be increased (calvert., 2007 ; michalski., 2011a). however, the approximate proportion of oxygen dissolved in plasma is merely 0.29 ml every 100 ml blood (0.3% (v / v)). while inspiring 100% oxygen in high pressures (more than 1 ata) under the hyperbaric oxygen condition, the amount of oxygen dissolved in blood plasma can increase to 3.26% (v / v) at 1.5 ata and to 5.6% (v / v) at 2.5 ata thereby, hbot is mainly used to improve this part of dissolved oxygen in plasma then increase tissue oxygen concentration in the ischemic area. according to common knowledge, oxygen spread along the pressure gradient, so hyperbaric condition can make oxygen diffuse to hypoxic tissue more easily and for a longer effective diffusion distance than normabaric oxygen (gjedde, 2005). frequently animal studies use pressures ranging from 1.5 to 3.0 ata, and duration of treatment ranging 13 hours (michalski., 2011a). clinical studies may apply single or multiple therapeutic sessions with each duration lasting 30 - 90 minutes and pressures varying from 1.3 to 2.5 ata (helms., 2011 ; michalski., 2011a ; efrati., 2013 ; efrati and ben - jacob, 2014), but a study by efrati and ben - jacob (2014) indicated hbot above 2.0 ata may have undesirable neurofunctional inhibition and even focal toxicity. besides, gradual compression and decompression (5 - 15 minutes) before and after treatment is usually used for the safety and comfort of patients with stroke insult. tissue hypoxia has been considered as the key contributor to cellular injury after stroke, so most of early studies were based on the higher dissolved oxygen concentration in plasma achieved with hbot. in recent years, studies (singhal, 2007) have illustrated that hbot may also accomplish neuroprotective effects in stroke via a variety of complex molecular, biochemical and hemodynamic mechanisms : (1) hbot is capable of enhancing the arterial partial pressure of oxygen, improving oxygen delivery and increasing oxygen supply for brain tissue ; (2) hbot can stabilize the blood - brain barrier (bbb) and reduce cerebral edema (chen., 2011b) ; (3) ameliorate cerebral microcirculation and improve brain metabolism to create sufficient energy, preserve cellular ion homeostasis (zhang., 2005) ; (4) decrease the intracranial pressure via modulating cerebral blood flow and brain edema reduction ; (5) hbot alleviates post - stroke neuroinflammation ; (6) inhibit post - stroke cell apoptosis and necrosis ; (7) improve the microcirculation of anoxic area and reduce cerebral hypoxia - ischemia (siesjo, 1988) ; (8) appropriate and timely application of hbot will alleviate oxidative stress and suppress the ischemia - reperfusion injury which is generally recognized as one of the core pathophysiology in stroke injury (sanchez, 2013) ; (9) furthermore, it has been demonstrated that when hbot is used to treat patients with aneurysmal subarachnoid hemorrhage (sah), it may attenuate cerebral vascular spasm induced by sah (ostrowski and zhang, 2011) ; (10) finally, hbot is also confirmed favorable to neurogenesis and angiogenesis. in animal experimental studies, animal models of hemorrhagic or ischemic stroke were successfully made firstly, then hyperbaric oxygen was applied to treat the subject after stroke insult, and finally the investigators detected the effects on stroke of hbot and explored the potential mechanisms of the effects. in general, animal studies belong to basic medical research or preclinical research and quite a number of them were aimed to investigate the possible rationale of hyperbaric oxygen in neurological influence following stroke (figure 1). the conclusion of these studies may be different or even contrary owing to different experimental conditions and methods. we analyze several recent experimental studies related to hbot for stroke treatment in this paper, and most relevant studies have been reported in ischemic stroke animal model. note : bmsc : bone marrow stem cell ; ppar : peroxisome proliferator activated receptor- ; vegf : vascular endothelial growth factor ; pkc- : phospho - protein kinase c - alpha ; tnf- : tumor necrosis factor - alpha ; mmp : matrix metalloproteinases ; hif-1 : hypoxia - inducible factor-1 ; cox-2 : cyclooxygenase-2 ; bbb : blood - brain barrier ; sah : subarachnoid hemorrhage. subsequently, we summarize some valuable and representative experimental results involving hbot and stroke : (1) hbot can decrease infarction size and reperfusion injury. early hbot in rats with permanent middle cerebral artery occlusion (mcao) has neuroprotective effects, possibly via the inhibition of phospho - protein kinase c - alpha (pkc-) and tumor necrosis factor - alpha (tnf-). it was observed that the brain infarction area and edema decreased with the expression of tnf- and pkc- in the ischemic penumbra tissue down - regulated in the hbot group which was immediately given hbot after mcao model successfully made (yu., 2015). (2) in a mouse mcao model, a single session of hbot immediately applied in mcao followed by 24 hours reperfusion may significantly reduce cerebral edema and brain damage via improvement of the ischemic area perfusion. in addition, the protection effect provided by hbot was more robust than that provided by toll - like receptor 4 knockout (dharmasaroja, 2016 ; pushkov., 2016). (2010) surprisingly showed hbot may increase mcao damage in rats model, different with most investigators that hold hbot as a safe and effective option on the whole, even though controversial. (3) hyperbaric oxygen preconditioning (hbo - pc) that means pretreating with hyperbaric oxygen has been shown to be neuroprotective via stabilizing blood - brain barrier permeability and decreasing oxidative stress in animal stroke models. recently, hbo - pc has been widely investigated in preclinical research, for instance, li. (2009) divided the experimental rats into three groups : control group with no treatment, transient mcao group with clipping unilateral internal carotid artery for 90 minutes, hbo - pc group with four treatment sessions of hbot at 2.5 ata per day, once for 1 hour, for 2 days. finally, they found the rats post hbo - pc showed infarct size reduction by triphenyltetrazolium chloride staining, decreased expression of caspase 9 and 3 as well as increased expression of bax / bcl-2 by western - blot assay. besides, soejima. (2013) concluded that hbo - pc can attenuate hyperglycemia - enhanced hemorrhagic transformation after ischemic stroke and reduce hemorrhagic volume and other beneficial effects : decrease infarction size and bbb disruption, improve neurological deficits, down - regulate the expression of hypoxia - inducible factor-1 (hif-1), and reduce the activity of matrix metalloproteinases (mmp)-2 and mmp-9. they also found hbot might decrease post - stroke hemorrhagic transformation through increasing peroxisome proliferator activated receptor- (ppar) in hyperglycemia rats (soejima. additionally, hbo - pc and hbot during ischemia was manifested to have neuroprotective effect by the suppression of the increased glutamate and hydroxyl radical level besides modulating energy metabolism in the penumbral area (yang., 2010 ; gao - yu. (4) in our review (ploughman., 2015), several studies indicated the post - stroke dendritic branching and synaptogenesis probably represent neuroplasticity implicated in neurological recovery. it has been illustrated that delayed hbot which begins at 7 days after mcao and lasts for 42 days can provide certain benefits for neurogenesis and neuroprotection including motor sensory recovery, but the promotion may be reversed by inhibition of reactive oxygen species (ros) and hif-1. that is to say, if ros and hif-1 are inhibited experimentally prior to the treatment of hbot, the beneficial effects of delayed hbot will finally decrease. thereby, it is deduced that delayed hbot as an alternative treatment could enhance endogenous neurogenesis and improve the long - term prognosis of stroke survivors (hu., 2014). (5) in an experimental study in rats related to pre - ischemic hbot and post - ischemic aminoguanidine (ag), all the rats were equally divided into four groups (n = 7) : control group, hbot group, hbo + ag group, and ag group. the infarction rate was measured at 3 days after mcao, the investigators found : 22.2 3.1% in control group, 16.1 2.7% in hbot group, 14.4 3.3% in ag group, and 15.2 1.9% in hbo + ag group. as a result, they came to the conclusion that in permanent mcao model of rats, ag and hbot have a protective effect on the infarct rate, but no additive effect (harman., (6) however, the results of an in vitro study showed that an increase of oxygen partial pressure and exposure time resulted in elevated free radical, enhanced viscosity of the whole blood and lipid peroxidation in erythrocyte, but attenuated erythrocyte deformability (chen., 2011a). another finding in ischemia / reperfusion rat models showed that hbot enlarged the infarct ratio via blocking autophagy by ros generation and activation of extracellular signal - regulated kinase 1/2 (lu., 2014). the results shown above indicate that not all the effects of hbot are directly beneficial and some effects are still under debate. (7) in the present study, cyclooxygenase-2 (cox-2) in cerebral tissues is indicated as a critical component of post - stoke neuroinflammation, and hbo - pc has the capability of protecting brain from global ischemia injury. in the transient global cerebral ischemic rat model, cheng. (2011) showed that hbo - pc leaded to an inhibition of cox-2 expression, improved neurofunctional performance, and even decreased the incidence of seizures and mortality, while these beneficial effects of hbo - pc were weakened by cox-2 selective inhibitor pretreatment. it was concluded that hbo - pc may provide brain protection against global ischemia via the suppression of cox-2. thereby, cox-2 probably acts as a mediator of hbo - pc within the transient ischemic brain tissue. (8) we reviewed a research referring to the early functional outcome and bbb integrity after co - administered hbot and thrombolysis treatment using tissue - plasminogen activator (tpa) in the early phase of experimental stroke (michalski., thrombolysis tended to increase bbb permeability while hbot tended to stabilize bbb but surprisingly failed to improve the early neurofunction as hypothesis. treatment applied both hbot and tpa improved early functional outcome but bbb permeability was found to be increased to a certain degree than hbot alone, potentially owing to enhanced reperfusion in the infarct area and increased bbb permeability and mmp-2 activation via tpa. in another report addressing long - term neurofunctional outcome, combined treatment of tpa and hbot in early phase of stroke even leaded to delayed brain damage and resulted in neurological deterioration in the long - term follow - up phase (michalski., 2009). as above, simultaneous treatment with hyperoxia and thrombolysis may result in unfavorable therapeutic effects out of our expectation. so further studies are warranted to identify the effect of this combined treatment at molecular level and avoid unfavorable courses of combined treatment in acute stroke. (9) in addition to decreasing infarction volume and ischemia - reperfusion injury, neuronal repair after stroke is also crucial. investigators have demonstrated that hbot can stimulate the expression of neurotrophic factors, promote neurogenesis and gliosis. bone marrow stem cell (bmsc) transplantation, which is important in regenerative therapy, has been demonstrated favorable to improve the outcomes of many neuronal diseases. in cases of animal stroke, the mobilization and migration of bmscs in brain are also found enhanced by long - course hbot (lee., 2013). (10) thrombolysis potentially improves the risk of post - thrombolytic intracerebral hemorrhage by 6-flod in clinical trials related to cerebral infarction (hacke., 2004). in a mcao model treated with thrombolysis, hbot tended to decrease the secondary hemorrhage and reduce the infarct volume if reperfusion was successful (sun., 2010). (11) hobt can enhance the efficiency of some neuroprotective drugs and provide additive neuroprotection against ischemia - induced neurodegeneration, for example, when combine hbot and the c - jun n - terminal kinases inhibitor xg-102, the infarct size caused by mcao was diminished by 78%, while xg-102 and hbot alone only 43% and 63% (liu., 2010). moreover, the combination also reduced brain edema and improved neurological outcome more robust than each alone. nevertheless, not every combined treatment will provide additional benefit, such as combination of hbot and second generation perfluorochemicals (schneider., 2014), it does not tend to show significantly smaller necrosis than hbot only. (12) hemorrhagic stroke which is more fatal and complex generally involves sah and intracerebral hemorrhage (ich) (pandey and xi, 2014). effect of hbot in hemorrhagic stroke was also studied in animals, mainly involving the suppression of brain edema, neuroinflammation, cerebral vasospasm and the promotion of both angiogenesis and neurogenesis (peng., 2014 ; xiong and yang, 2015 ; yang., 2015 ; zhou., 2015). the first reported clinical application of hbot was performed about half a century ago, shortly after the first experimental study in animal. to date, hbot has been broadly and commonly used as an optional treatment for both ischemic and hemorrhagic stroke (figure 2), although lack of uniform therapeutic standard, such as time window of treatment and optimal dose (oxygen pressure level). in recent years, more and more new clinical trials have provided evidence base for hbot induced cerebral plasticity which can lead to brain function recovery and significant life quality improvement for post - stroke patient. nevertheless, most clinical studies still lack of standard outcome measurement and negative control. to the best of our knowledge, only three well - designed randomized controlled trials have been published (anderson., 1991 ; nighoghossian., 1995 ; rusyniak., 2003), but the discrepancy among the conclusions leaves the final efficacy in human stroke treatment still unclear. the common clinical application of hyperbaric oxygen therapy (hbot) in stroke. note : sah : subarachnoid hemorrhage ; ich : intracerebral hemorrhage. to better understand the current application of hbot, (1) hbot exerts therapeutic effects on cognitive recovery from stroke, even at late chronic stage. in a retrospective clinical trial conducted by ploughman. (2015), they analyzed the data of 91 patients suffering memory impairments due to either hemorrhagic or ischemic stroke. the hbot protocol administered in the participants was set at 2.0 ata, 40 - 60 sessions per day, 90 minutes each, 5 days per week. before and after the therapy, the memory function was both measured by a specific test and compared with the brain metabolic changes assessed by single - photon emission computed tomography. finally, the results illustrate statistically significant memory improvements in almost all the patients and the improvements was in good agreement with an improvement in brain metabolic state, mainly in the temporal lobe. recently, another retrospective analysis of chronic cognitive impairments caused by cardiac arrest has shown a similar result, reconfirmed the therapeutic effect on cognitive functions and the well correlated brain metabolic changes in relevant areas (hadanny., 2015). hence in the future, hbot might play as a considerable effective treatment for more and more patients with post - stroke memory impairment. (2) hbot is known capable to modulate vasoreactivity and cerebral blood flow (cbf). the response of regional cbf to hbot in human was firstly investigated and confirmed in 2013. when hbot at a pressure of 2.5 ata and a perfusion tracer was used in healthy subjects observing cbf distribution, an increased regional cbf distribution mainly on the dominant hemisphere was observed in sensory - motor area, premotor, posterior cingulate and visual cortices, middle / inferior temporal gyrus, superior frontal gyrus, angular gyrus and cerebellum (micarelli., 2013). the findings in this research unfold a possible underlying mechanism of hbot related beneficial effects on the cognitive and motor improvement in stroke patients. (3) a regression statistical analysis on the basis of the heyman 1966 hbot study focused on treatment time window and time in chamber as well as dose of hbot. in conclusion, only time window post stroke affects the recovery efficacy significantly and the chance of recovery is decreased over time. as a result, the most promising time window for hbot efficacy in acute stroke is within the first 3 hours. in addition, the earlier the time window, the better the hbot efficacy (mccormick., 2011). (4) stroke induced by iatrogenic cerebral air embolism can occur in a lot of invasive therapy, such as catheter insertion and removal, laparoscopic surgery, cardiac surgery, but a potential fatal complication is uncommon. in our review, there are two articles associated to hbot in this condition. they both retrospectively reviewed the outcome and some factors related to the response to hbot, appraised the evidence base for the use of it in this setting. a large proportion of the subjects achieved a favorable outcome - full recovery or neurological improvement to varying degrees. the multivariate analysis further indicated hbot within 6 hours from event increased the therapeutic effect whereas the infarct and edema shown on brain ct or mri will reduce the benefit from hbot. so far, hbot is the only definitive treatment for gas embolism caused stroke with acute neurologic deficits, so timely administration of hbot appears to be essential to the patients function recovery. (5) as shown above, early hbot in acute stroke need to be applied within the time window of 3 to 6 hours, but if patients arrive too late, whether hbot should be used ? it has been suggest that delayed but repeated hbot can also provide salvage of brain cells and promotion of neurofunction. as described in a case report, a patient with acute infarction on the corona radiate was admitted to hospital more than 5 hours after symptom onset (> 4.5 hours), so intravenous thrombolysis could not be performed. however, on the 3 day, a daily hbot at 2.0 ata was preferred and continuously administered for 2 weeks. at last, prominent neurofunctional improvement was demonstrated by several clinical parameters, correlated with the regional cbf and penumbra amelioration noted in image tests (chen., 2011b). (6) post - stroke depression frequently affects the quality of life and functional recovery of the patients. fortunately, hbot combined with antidepressants has been declared to have a supplementary beneficial effect. in a prospective clinical trial, the combination of hbot and fluoxetine resulted in significantly higher efficacy than hbot or fluoxetine alone (yan., (7) the correlation between hbot and clinical outcome in patients with postoperative intracranial aneurysm has also been investigated. early hbot initiated within 1 - 3 days post - operation has been proved to be a valuable neuroprotective therapy, mainly via ameliorating cerebral vasospasm and ischemia (ostrowski and zhang, 2011 ; tang., (8) clinical trials concerning hbot in ich are scarcely reported, although they have been widely used in this field. our experience indicates that hbot should be applied as early as possible if the patient is in stable condition, and it may provide an additional chance for the neurological deficits caused by ich. hbot is considered safe and adverse effects are rarely seen in patients treated in pressures below 3.0 ata. however, extreme hyperbaric condition or excess duration may result in oxygen toxicity, mainly including central nervous system toxicity, pulmonary injury, middle ear barotrauma, and retinopathy of prematurity (calvert., 2004). elevated pressures (5.0 ata) can increase the risk of agitation and seizures substantially (chavko., 2001). hbot at 4.0 ata or higher will aggravate oxidative stress in brain tissue, probably via the upregulation of lipid peroxidation and ros and other free radicals. thus, the guideline for hbot recommended the maximum therapeutic pressure no greater than 3.0 ata (matchett., 2009). beneficial effects of hbot in stroke have been reported in a lot of experimental and clinical trials, although assessed by different outcome measurements. in most experimental studies, strongest positive effects of hbot were observed ; but in patients with stroke injury, the effectiveness has not been well - proven due to the lack of good - quality multicenter randomized controlled trials. nevertheless, the favorable neurological outcome so far published in our review should support the administration of hbot in patients suffering stroke. furthermore, in order to attain optimum efficiency, the protocol including the optimal pressure, duration for each session, the number of sessions and the time - window of starting hbot should be specified. therefore, more studies are needed to establish uniform standards of hbot for each specific phase and condition.
|
stroke, which is defined as a neurologic deficit caused by sudden impaired blood supply, has been considered as a common cause of death and disability for decades. the world health organization has declared that almost every 5 seconds a new stroke occurs, placing immense socioeconomic burdens. however, the effective and available treatment strategies are still limited. additionally, the most effective therapy, such as thrombolysis and stenting for ischemic stroke, generally requires a narrow therapeutic time window after the event. a large majority of patients can not be admitted to hospital and receive these effective treatments for reperfusion timely. hyperbaric oxygen therapy (hbot) has been frequently applied and investigated in stroke since 1960s. numerous basic and clinical studies have shown the beneficial efficacy for neurological outcome after stroke, and meanwhile many underlying mechanisms associated with neuroprotection have been illustrated, such as cerebral oxygenation promotion and metabolic improvement, blood - brain barrier protection, anti - inflammation and cerebral edema, intracranial pressure modulation, decreased oxidative - stress and apoptosis, increased vascular and neural regeneration. however, hbot in human stroke is still not sufficiently evidence - based, due to the insufficient randomized double - blind controlled clinical studies. to date, there are no uniform criteria for the dose and session duration of hbot in different strokes. furthermore, the additional effect of hbot combined with drugs and other treatment strategies are being investigated recently. therefore, more experimental and clinical research is imperative to identify the mechanisms more clearly and to explore the best protocol of hbot in stroke treatment.
|
the patient was diagnosed with hodgkin s lymphoma in 1985 and treated with 30 gy of mediastinal and pelvic external - beam irradiation. in 1998, the patient suffered from an anterior heart infarction, and postinfarction heart failure (new york heart association class iii / iv) developed. the patient s concomitant daily medication was : cyclosporin 100 mg 2, mycophenolate mofetil 1,000 mg 1, prednisolone 6.25 mg 1, doxazosin 8 mg 1, bendroflumethiazide 5 mg 1, metoprolol 50 mg 1, allopurinol 100 mg 1, pantoprazole sodium sesquihydrate 40 mg 1, potassium 1,500 mg 3, bumetanide 4 mg + 2 mg, pravastatin 40 mg 1, long - acting insulin 16 iu 2, and short - acting insulin 1416 iu 3. because the patient s prostate - specific antigen (psa) level was 10 ng / ml, a series of prostate gland biopsies was performed in 2006. two of eight biopsies showed prostate carcinoma with gleason score of 3 + 3 = 6. the clinical prostate cancer stage was t1c, and with the patient s consent, he was enrolled in an active surveillance program. a new set of octant biopsies was taken in april 2010, at which time the patient s psa had risen to 14 ng / ml. two of eight biopsies now showed gleason score of 4 + 4 = 8 in a length of 3.5 mm of 99 mm. the clinical stage of the prostate cancer was deemed to be t1c. because the patient had previously received external - beam radiation treatment (ebrt) for pelvic manifestations of hodgkin s lymphoma, ebrt was not favored as a radical treatment in this case. cardiologists preoperative assessment of cardiac function : a preoperative transesophageal echocardiographic examination revealed a well - functioning left ventricle and a slightly dilated right ventricle, with middle tricuspidal insufficiency. preoperative cardiac investigations showed no definite contraindication to surgery, as judged by the cardiologist. the surgeons were advised not to change the patient s immunosuppressive therapy preoperatively, but to continue his immunosuppressive regimen in the pre- and postoperative periods. a three - armed robotic da vinci system was docked to the patient, together with two robotic trocars. the intra - abdominal pressure was 10 mmhg. in the left robotic arm, a maryland bipolar grasp (40 w power) was used, and curved monopolar scissors (60 w power) were placed in the right robotic arm. the differences apparent when operating on previously irradiated tissue were mainly attributable to the slightly modified appearance of the tissue. the fatty tissue seemed to be less perfused in the perivesical space, and the normal avascular planes were not present in the same way as they are in nonirradiated tissue. because of the previous irradiation and the stickier appearance of the tissues surrounding the prostate, the apical portion of the prostate was mainly dissected using cold scissors, to minimize the negative consequences of electrocoagulation on urinary sphincter function. similarly, the dissection of the bladder neck was slightly more complicated because the tissue between the bladder neck and the prostate was slightly less clearly demarcated. therefore, monopolar scissors were used to dissect the bladder neck, instead of blunt dissection with cold scissors, in the space between the urinary bladder and the basal portion of the prostate. a charriere 18 silicone urinary catheter was placed in the urinary bladder, and the bladder urethra anastomosis was sewn continuously with a monofilament biosyn 2.0 suture with two needles according to van velthoven. anesthesiological considerations : the robotic operation time was 70 min ; total operative time was 101 min. two intravenous lines and standard monitoring were established, with electrocardiography, pulse oxymetry, and noninvasive blood pressure, end - tidal carbon dioxide, and sevoflurane monitoring. anesthesia was induced with fentanyl 0.25 mg, midazolam 5 mg, thiopental 350 mg, and cisatracurium 15 mg. the patient was intubated and ventilated with 40% oxygen in air, using the pressure - controlled ventilation mode. anesthesia was maintained with sevoflurane (with minimum alveolar concentration of 0.71.0) and fentanyl. blood pressure measurements were deemed to be in acceptable ranges, with lowest systolic pressure of 95 mmhg. the maximal ventilation pressure did not peak above 26 mmhg, and end - tidal co2 was below 5.6 kpa at all times. histopathological results and postoperative convalescence : the patient s postoperative convalescence was normal, and he was discharged on the second postoperative day. the urinary catheter was removed on postoperative day 14, according to the routine in our department. the final histopathological report showed adenocarcinoma of the prostate with gleason score of 4 + 3 = 7b, surprisingly at pathological stage pt3b (fig. 1), with free resection margins. the patient s postoperative psa levels at 6 weeks and 6 months were < 0.2 ng / ml. at 3-month outpatient clinical follow - up 1whole hematoxylin eosin - stained section of the prostate with multiple foci of adenocarcinoma illustrated with black - circled areas (a). b adenocarcinoma infiltration of the seminal vesicles (200) whole hematoxylin eosin - stained section of the prostate with multiple foci of adenocarcinoma illustrated with black - circled areas (a). only two case reports of four heart - transplanted patients treated with radical prostatectomy can be found in the literature [3, 4 ]. the patients were treated with retropubic radical prostatectomy. to the best of our knowledge, we present here the first case of a heart - transplanted patient treated with ralp. the steep trendelenburg positioning of the patient, which is required for robot - assisted radical prostatectomy, is an anesthetic challenge, especially in heart - transplanted patients. an anesthetized patient with heart transplant may show exaggerated responses to hypovolemia, sudden changes in posture, or reductions in systemic vascular resistance. no autonomic reinnervation occurs in humans after heart transplantation, and therefore the normal sympathetic responses to stimuli are absent. the heart does respond to circulating catecholamines, although this response may take 56 min to manifest. the normal baroreceptor reflexes are absent, and carotid sinus massage and the valsalva maneuver have no effect on the heart rate [5, 6 ]. however, these challenges did not present any practical problems for our patient, who underwent the procedure with no clinical problems. another challenge illustrated by this case is the possibility of operating on patients who have previously been treated with pelvic irradiation. the feasibility of operating on patients previously treated with ebrt, with only minor changes in the procedure, offers an opportunity to consider neoadjuvant radiation therapy as part of a multimodal treatment approach, which has been of significant benefit in the treatment of locally advanced rectal carcinoma. patients at risk of profound peroperative bleeding might therefore be considered for ralp, rather than open retropubic radical prostatectomy.
|
we report the case of a 68-year - old man who had previously undergone heart transplantation and pelvic irradiation for hodgkin s lymphoma and who was under active surveillance for prostate cancer. in response to his increased prostate - specific antigen levels and elevated gleason score, he was offered robot - assisted laparoscopic prostatectomy.
|
prolonged excessive intake of fluoride has been associated with fluorosis [1, 2 ]. although dental fluorosis is the most obvious clinical manifestation of increased fluoride intake, many other organs such as the bones, thyroid, kidney, liver, lung and brain may be affected by the increased fluoride level [18 ]. due to the substantial role that neural health plays on the individual s quality of life, numerous studies have been conducted on the effect of excess fluoride on neurological development. most of these investigations, which support the neurotoxic effect of fluoride, have been performed in animals, demonstrating generation of free radicals and alterations in the level of neuro - transmitters in the brain [711].these changes may interfere with normal development of the central nervous system (cns) during the fetal and early childhood development. this period is the most critical phase in neurobehavioral development, in which the brain is sensitive to absent or increased levels of certain elements. any cerebral impairment in this stage of the child s growth, leads to future cognitive and intellectual deficits [1214 ]. although human subjects are more vulnerable to excessive fluoride compared to animals, controversies exist among the data obtained from various studies on the effect of fluoride on human s intellectual abilities. a major shortcoming in this area of research is the small pool of regions in which research has been carried out, with most of the data having been collected from china with various methodological limitations [1319 ]. geographically, iran lies on one of the high fluoride belts, with endemic fluorosis existing in various regions including makoo. makoo is located in the north west of azarbaijan province, in the north west of iran, between longitudes 44 21 39 34. it is restricted between turkey on the west and aras river on the east. the mean annual temperature varies between 16.2c and 35.1c and is considered as a cold climate region. local groundwater is the chief source of water supply for its inhabitants.this study investigates the effect of different levels of fluoride in drinking water on the intelligence quotient (iq) of children living in five rural areas in makoo / iran from 2009 to 2010. groundwater samples were collected in uniform clean plastic bottles from wells and springs distributed over the study area. the fluoride and iodine in the drinking water were analyzed by spadns (sulfophenylazo dihydroxynaphthalene - disulfonate) method, utilizing 4000 uv - vis spectrophotometer (hach company, germany) in the environmental health engineering laboratory of public health school of tehran university of medical sciences. according to the data obtained by water analysis, the villages were categorized into normal, moderate and high fluoride content groups. to minimize the effect of other factors, such as velocity of flowing water and the seasonal temperature, on the water - fluoride level during the last 12 years, the mean fluoride content of all seasons for this time period, as registered by the local health clinics, was calculated and set as the final fluoride concentration of that region. the reported fluoride levels by the local clinics were in line with our findings of water fluoride analysis. in addition to fluoride, the amount of iodine and lead in the regions drinking water was determined using 4000 uv - vis spectrophotometer (hach company, germany) and polarograph with mercury electrode (hach lange, france), respectively. two - hundred ninety - three participants (142 boys and 151 girls) out of 314 children (611 year olds) living in five villages in makoo were recruited for the study. the five selected rural areas were similar in their general demographic and geographic characteristics with the inhabitants having a comparable level of socioeconomic status and similar occupations. as fluoride excess toxicity is increased by iodine deficiency, we measured the amount of iodine in their drinking water and made sure that all households received iodine enriched salts for cooking and eating purposes. the villages (babur, panjarlu, dizaj, small donalau and large donalau) were classified into three groups based on the fluoride content of their water supplies (normal, medium and high). according to who guidelines, the standard range for water fluoride concentration is 0.51 mgl and levels greater than that were classified as medium (3.10.9 ppm) and high (5.21.1 ppm) [1, 14, 21 ]. all participants were long - life residents of the villages under study, with their mothers having lived in the area during their pregnancies. the exclusion criteria included a history of genetic disease, systemic disorders or brain trauma in the family. a written informed consent was obtained from the parents of all eligible subjects after explaining the nature and aim of the study. a detailed questionnaire was completed with the assistance of parents, including information about child s and parents medical and residential history, their educational level and source of drinking water. following theoretical training for fluorosis, the examiner supervised by an experienced pedodontist examined 40 children who had been selected from the subjects previously. if there was any doubt about the diagnosis, a decision was made after discussion. four weeks later the examined subjects were re - examined in order to assess the intra - examiner reliability. the dental examinations were carried out by a dentist according to the who- recommended dean s index. following theoretical training for fluorosis, the examiner supervised by an experienced pedodontist examined 40 children who had been selected from the subjects previously. if there was any doubt about the diagnosis, a decision was made after discussion. four weeks later the examined subjects were reexamined in order to assess the intra - examiner reliability. all dental examinations were performed in the school s medical room using a mirror and cotton rolls under day light. the intellectual ability of each child was calculated using raven s color progressive matrices (rcpm). the rcpm is a non verbal multiple choice iq test designed for 5 to 11-year - old children. the models were presented in the form of matrixes. in each test item, the child was asked to identify the missing part that completes the model. the test was administrated in a convenient school classroom under the supervision of a trained psychologist, a teacher and an assistant in a blind manner, following the procedures laid down in the manual of raven s progressive matrices. the test comprised of 30 problems, beginning with easy problems and ending with difficult ones. each question contained a matrix of geometric design with eight alternatives for one removed cell. the children s iq scores were divided according to the stanford - binet classification in eight groups : genius (164 and over), very superior (148164), superior (132148), above average (116132), average (84116), dullness (6884), borderline (5268) and mental deficiency (below 58). groundwater samples were collected in uniform clean plastic bottles from wells and springs distributed over the study area. the fluoride and iodine in the drinking water were analyzed by spadns (sulfophenylazo dihydroxynaphthalene - disulfonate) method, utilizing 4000 uv - vis spectrophotometer (hach company, germany) in the environmental health engineering laboratory of public health school of tehran university of medical sciences. according to the data obtained by water analysis, the villages were categorized into normal, moderate and high fluoride content groups. to minimize the effect of other factors, such as velocity of flowing water and the seasonal temperature, on the water - fluoride level during the last 12 years, the mean fluoride content of all seasons for this time period, as registered by the local health clinics, was calculated and set as the final fluoride concentration of that region. the reported fluoride levels by the local clinics were in line with our findings of water fluoride analysis. in addition to fluoride, the amount of iodine and lead in the regions drinking water was determined using 4000 uv - vis spectrophotometer (hach company, germany) and polarograph with mercury electrode (hach lange, france), respectively. two - hundred ninety - three participants (142 boys and 151 girls) out of 314 children (611 year olds) living in five villages in makoo were recruited for the study. the five selected rural areas were similar in their general demographic and geographic characteristics with the inhabitants having a comparable level of socioeconomic status and similar occupations. as fluoride excess toxicity is increased by iodine deficiency, we measured the amount of iodine in their drinking water and made sure that all households received iodine enriched salts for cooking and eating purposes. the villages (babur, panjarlu, dizaj, small donalau and large donalau) were classified into three groups based on the fluoride content of their water supplies (normal, medium and high). according to who guidelines, the standard range for water fluoride concentration is 0.51 mgl and levels greater than that were classified as medium (3.10.9 ppm) and high (5.21.1 ppm) [1, 14, 21 ]. all participants were long - life residents of the villages under study, with their mothers having lived in the area during their pregnancies. the exclusion criteria included a history of genetic disease, systemic disorders or brain trauma in the family. a written informed consent was obtained from the parents of all eligible subjects after explaining the nature and aim of the study. a detailed questionnaire was completed with the assistance of parents, including information about child s and parents medical and residential history, their educational level and source of drinking water. following theoretical training for fluorosis, the examiner supervised by an experienced pedodontist examined 40 children who had been selected from the subjects previously. if there was any doubt about the diagnosis, a decision was made after discussion. four weeks later the examined subjects were re - examined in order to assess the intra - examiner reliability. the dental examinations were carried out by a dentist according to the who- recommended dean s index. following theoretical training for fluorosis, the examiner supervised by an experienced pedodontist examined 40 children who had been selected from the subjects previously. if there was any doubt about the diagnosis, a decision was made after discussion. four weeks later the examined subjects were reexamined in order to assess the intra - examiner reliability. all dental examinations were performed in the school s medical room using a mirror and cotton rolls under day light. the intellectual ability of each child was calculated using raven s color progressive matrices (rcpm). the rcpm is a non verbal multiple choice iq test designed for 5 to 11-year - old children. the models were presented in the form of matrixes. in each test item, the child was asked to identify the missing part that completes the model. the test was administrated in a convenient school classroom under the supervision of a trained psychologist, a teacher and an assistant in a blind manner, following the procedures laid down in the manual of raven s progressive matrices. the test comprised of 30 problems, beginning with easy problems and ending with difficult ones. each question contained a matrix of geometric design with eight alternatives for one removed cell. the children s iq scores were divided according to the stanford - binet classification in eight groups : genius (164 and over), very superior (148164), superior (132148), above average (116132), average (84116), dullness (6884), borderline (5268) and mental deficiency (below 58). all analyses were performed by spss version 11.5 for windows (spss inc., chicago, ill, usa). the villages were classified as normal, medium and high fluoride content according to their water fluoride concentrations. the mean level of fluoride in medium and high groups was approximately 3 and 5 times higher than who standards, respectively. a concentration of 0.08 - 0.1 mg / l for iodine and 00.5 mg / l for lead was found by the water content analysis. two hundred and ninety three 6 to 11-year - old children 6 to 11 took part in this study. dental examination revealed that all children in medium and high - fluoride groups demonstrated mild to severe fluorosis. in comparison, only 22% of the subjects in the normal group showed very mild and mild fluorosis and the remaining 78% were unaffected (table 1). an increase in water fluoride content above the standard level was associated with the incidence of more severe dental fluorosis (p<0.001). although iq scores for children with normal fluoride content were significantly higher than the medium and high fluoride level (p=0.001), there was no statistically significant difference between the iq of children residing in medium and high fluoridated areas (p=0.995). furthermore, we did not observe any significant difference between the scores of girls and boys in any of the groups examined (p=0.07). iq scores of children living in areas with various water fluoride content (normal, medium and high) have been demonstrated in table 3, exhibiting that nearly half of the children residing in the normal fluoride area showed normal iq levels. we investigated the influence of the child s age, gender, parent s and child s educational level on the child s iq scores. there was no difference between the intellectual ability of pre - school children (6 years) and school children in the present study, indicating that the child s educational level had no impact on the iq scores. in addition, a relationship between the child s age, gender, parent s educational level and the iq scores was also not observed (table 4). fluoride in small amounts is essential for the child s development. although excessive fluoride ingestion may result in visible side effects, some effects may go unnoticed if unchecked [1, 8 ]. in this study, we investigated the consequence of high fluoride content water on children s intelligence in iran, a country lying on one of the geographical fluoride belts. here we demonstrated that the average iq of children living in the area with a high fluoride content in the drinking water was significantly lower than children with standard water fluoride levels. since all potentially confounding factors were adjusted, the difference in iq scores may reveal the potential effect of high fluoride exposure on the intellectual development of children. these results are consistent with findings reported by xiang., who confirmed a decrease in children s neurobehavioral ability when exposed to elevated fluoride levels. however, no adjustment was made to remove the confounding factors in their investigation and the water fluoride content in the control area was lower than the standard water fluoride concentration. this may be important, as a reduced level of fluoride content may also give rise to adverse neurological impacts [3, 13,18,24,25 ]. in a similar study, xiang. reported an inverse concentration - respond relationship between the fluoride content of drinking water and the iq scores of children. in contrast, we could not find any significant difference between the intellectual ability of children residing in locations with medium and high - fluoride water. most of the assessments on the influence of water - fluoride content have been performed in china. the fluoride concentration in our investigation was higher than previous studies in china [1, 13,14,18 ]. furthermore, we compared two fluoride levels above the normal limits to evaluate the effect of different concentrations of fluoride on children s iq and dental fluorosis. in addition, our results demonstrated a higher percentage of children with above the normal iq range in the standard fluoride group compared to medium and high - fluoride groups. this was in line with the findings of trivedi., who reported that an elevated fluoride level would affect the higher levels of intelligence more vigorously than normal and low intelligence levels. hong and colleagues demonstrated that although an elevated fluoride level in drinking water lowers the iq, the amount of iodine in the water of the investigated area was a more significant factor influencing the average iq we found a concentration of 0.08 - 0.1 mg / l for iodine and 00.5 mg / l for lead, which were in accordance to standard levels for these two elements [27, 28 ], which may accuse the high level of fluoride for the decreased iq scores in the present study. possible mechanisms for the neurotoxic effect of fluoride may be explained by several animal studies [710 ]. fluoride can pass through the placenta by maternal exposure to elevated fluoride levels during the prenatal period or it may be ingested through the child s diet. high levels of absorbed fluoride in children (8090%) and adults (60%) are retained in the body. once absorbed in the blood, fluoride forms lipid soluble complexes which cross the blood - brain barrier and accumulate in cerebral tissues [1, 8,11 ]. the penetrated fluoride complexes adversely affect the cns development by different neurotoxic and exciotoxic mechanisms, such as free radical generation, inhibition of anti - oxidant and mitochondrial energy enzymes and inhibition of glutamate transporters. the structural and functional alterations in cns, specifically in the fetal period and the first 8 years of life, may lead to learning and intellectual deficits and cognitive dysfunctions [710,29 ]. in addition, fluoride interferes with the activity of the thyroid gland, which has a deleterious effect on brain development and function in children. our findings showed that the prevalence and severity of dental fluorosis was greater among children with a higher water fluoride content. as a probable result of the halo effect, we found a 22% prevalence of fluorosis in children living in the village with a standard fluoride level, which was in accordance with who guidelines explaining that at an optimal fluoride level (1 ppm), about 20% of the population demonstrate fluorosis. however, in villages with a higher than standard fluoride level, all children demonstrated dental fluorosis with a severity index of moderate to severe. in this study, we administrated raven s colored progressive matrices (rcpm) test to evaluate the child s intellectual development, a validated test for basic cognitive abilities and widely used to evaluate the normal development of brain functions. it consists of problems containing a matrix of geometrical design, with a part removed. owing to the high correlation of this test in evaluating children s iq (ranging from 0.70.92) of this test in evaluating children s iq (ranging from 0.70.92) compared to the conventional iq test, rcpm is recommended for measuring the intellectual and conceptual ability of young children (5 to 10.5 years). furthermore, due to the non - verbal characteristics of the test, it is successfully administrated in pre - school children, as it does not require any verbalization or reading skills [3032 ]. based on the general concept that intellectual development is a consequence of different neurological and environmental factors, we have evaluated some of the environmental factors on the child s intellectual ability. our finding showed that child s age and educational stage had no correlation with iq scores, this was in line with studies performed by li. and seraj., indicating that the fetal and early childhood periods are the most susceptible stages in brain development and any induced neurological impairments are not reversible. as it is well accepted, the neurobehavioral development may be influenced by many genetical, socioeconomical and geographical factors. thus, we have recruited our samples from a homogenous rural population in makoo, diminishing the effect of some environmental and inherited factors, yet it is obvious that complete exclusion of such factors is impossible. in a study, the urinary fluoride level was implemented as the basic indicator for the child s fluoride exposure. however, since urinary fluoride excretion may vary from one subject to the other or even in the same person and because drinking water was typically the greatest single contributor to daily fluoride intake in this area, we have evaluated the effect of different amounts of fluoride in drinking water. in the present study, the effect of fluoride concentration on the child s iq was assessed ; however, it is possible that other trace elements in drinking water may have some neurological side effects. thus, further studies are required to investigate the effect of other environmental or geological contaminants. the data from this research may support the hypothesis that excess fluoride in drinking water has neurological toxic effects. therefore, a close monitoring of fluoride levels in local water - supplies from areas with endemic fluorosis and implementing public health measures to reduce the fluoride exposure levels in high fluoridated regions seem necessary. within the limitation of this cross - sectional study, these conclusions may be drawn : the iq scores of children living in areas with above the standard water fluoride levels were lower compared to children living in normal fluoride level regions.the proportion of children with above the normal intelligence in the group with the standard level of fluoride in their drinking water was greater than those with medium and high fluoride content.age, gender, child s and parent s educational level had no significant impact on the iq scores. the iq scores of children living in areas with above the standard water fluoride levels were lower compared to children living in normal fluoride level regions. the proportion of children with above the normal intelligence in the group with the standard level of fluoride in their drinking water was greater than those with medium and high fluoride content. age, gender, child s and parent s educational level had no significant impact on the iq scores.
|
objective : prolonged excessive intake of fluoride during child s growth and development stages has been associated with mental and physical problems. the aim of this study was to investigate the effect of excessive fluoride intake on the intelligence quotient (iq) of children living in five rural areas in makoo / iran.materials and methods : in this cross - sectional study, 293 children aged 611 years were selected from five villages in makoo with normal fluoride (0.80.3 ppm), medium fluoride (3.10.9 ppm) and high fluoride (5.21.1 ppm) in their water supplies. the iq of each child was measured by the raven s test. educational and residential information and the medical history of each child was recorded by a questionnaire completed by the parents. data were analyzed by anova test with a significance level of 0.05.results:the mean iq scores decreased from 97.7718.91 for the normal fluoride group to 89.0312.99 for the medium fluoride group and to 88.5816.01 for the high fluoride group (p=0.001).conclusion : children residing in areas with higher than normal water fluoride levels demonstrated more impaired development of intelligence. thus, children s intelligence may be affected by high water fluoride levels.
|
primary malignant melanoma of the cervix constitutes a rare disease [14 ], representing less than 2% of cases of malignant melanoma that affects the female genital tract. it was not until 1960, after the description by cid of melanocytic cells in the cervix, when the concept was accepted of primary melanoma in uterine cervix. it is considered as a very aggressive neoplasia, whose diagnosis is untimely due to the unusualness of the disease and the scarce suspicion of the clinician. at present, there is no consensus on the therapeutic approach to follow [1, 2, 7 ] ; in the reports found, initial treatment is referred of radical hysterectomy accompanied or not by radical pelvic lymphadectomy or superior vaginectomy [1, 2, 611 ]. although there are no significant statistics, prognosis in general is poor [2, 9, 11 ] and unpredictable and is even worse when early visceral metastases are discovered. in the current literature, there are no more than 60 cases reported of this entity. our purpose is to report the case of a patient with this neoplasia who was treated with ultraradical surgery followed by radiotherapy and who has had long - term followup. a female patient 34 years of age, mexican mestizo, nubile. history of 2 months of abnormal genital bleeding, for which she was evaluated by abdominal ultrasound (us) with a report of uterine myomatosis. carrying out a gynecological examination is decided upon, in which a blackish lesion is observed in the area of the uterine cervix. the patient was therefore referred to the national cancerology institute (incan) in mexico city in january 2001. on initial physical exploration at this institute, cervix - dependent tumor was noted that extended to the right pelvic wall, of petraeus consistency, and another at the level of the anterior wall of the vagina. chest x - ray, cystoscopy, and colonoscopy were performed, and reported as normal, in addition to complete revision of skin and eyes, discarding other sites of melanocytic lesions. additionally, a computed tomography (ct) was requested, which reported tumor in the pelvic floor toward the right annex of approximately 8 6 cm, which displaced the bladder and ureters (figure 1). due to the extension of the lesion, the patient was considered to be a candidate for exploratory laparotomy, and total pelvic exenteration reconstruction of the digestive and urinary tracts was carried out with a terminal colostomy and bricker ileal conduit operation, respectively. the final histopathological report of the surgical specimen obtained demonstrated malignant melanoma of the cervix of 7.5 5 cm, surgical margins were reported as negative. adjuvant radiotherapy was administered, 21 gy in three sessions, concluding in june 2001. the patient has been under routine surveillance for 8 years, and has only referred four occasional urinary tract infections, which have been resolved medically. to the moment of this report, there has been no evidence of local or distant recurring disease. for histopathological studies, the product of the total pelvic exenteration was received, in which a neoplastic lesion of the cervix measured 7.5 5.5 cm with involvement of the upper third of the vagina into anterior vaginal septum. microscopically, the neoplasia was formed by nodules of broad cytoplasmic cells with poorly defined borders with pleomorphic nuclei with prominent nucleolae. these areas displayed transition with areas with fascicules of elongated cells of moderate cytoplasm and similar elongated nuclei to those described previously (figure 2). immunohistochemical stains were positive for s-100 protein, melan a, and hmb 45 in neoplastic cells. a total of 15 pelvic lymph nodes were removed with the specimen, one of them was positive for disease on h&e, all the surgical margins were negative. malignant melanomas are generally found in areas of skin exposed to the sun, but can also be present in nonexposed sites, such as genital tract and esophagus, among others. cervical melanoma arises from melanocytic cells of the cervix ; in fact, the cervical epithelium is capable of forming the complete spectrum of melanocytic lesions, from benign lentigines to blue nevi to melanoma. the usual form of presentation of primary melanoma of the cervix on physical examination is a polypoid exophytic mass, red, brown, grey, black, or blue in color, or a colorless in the case of amelanotic melanomas, which constitute up to 55% of cases at this anatomic site, presented with vaginal bleeding [1, 6, 8, 9 ]. age range varies from 20 to 78 years, being more common between 60 and 70 years. due to that the cervix is an unusual site for this type of neoplasm, the international federation of gynecology and obstetrics (figo) staging system for cervical cancer is used, rather than the clark and breslow scales, because the figo staging system correlates better with the prognosis. diagnosis of primary melanoma of the cervix entertains a high probability of being confused with another entity, due to the rarity of the disease. differential diagnosis between a primary cervical melanoma and a metastatic tumor is important because the latter can be part of a metastatic disease spreading to the cervix. norris and taylor criteria are used to distinguish whether it is a primary malignant melanoma of the cervix [6, 8, 12, 13 ] : (a) presence of melanin in the cervical epithelium ; (b) absence of melanoma in another site of the body ; (c) presence of binding activity in the cervical epithelium near the lesion ; (d) if metastatic disease is found, it should be according to the cervical carcinoma pattern. at the present moment there is no standard treatment for this disease, while there is no doubt that the surgical approach is the most usual and radical hysterectomy with or without pelvic lymphadectomy and/or superior vaginectomy is reported most frequently [1, 2, 7, 8 ], some authors entertain doubts concerning survival if pelvic lymphadectomy is performed. although there is no enough information about the real role of negative margins in primary melanoma of the cervix, the primary surgery should have the purpose of obtaining negative margins ; some authors recommend 2-cm margins as minimum [7, 9 ]. the role of radiotherapy (rt) has not been well established, but it has been demonstrated that rt reduces the tumor size [1, 8, 11 ]. the use of adjuvant pelvic rt is considered in the case of not obtaining a satisfactory surgical resection margins, when the parametrium is involved, or when lymph nodes are found to be involved. despite the low level of radiosensitivity exhibited by melanoma, the use of external or intracavitary rt is recommended after surgery, or palliatively when the tumor is inoperable because of its own conditions or those of the patient [1, 6, 8, 10 ]. dacarbazin is utilized in advanced disease, and it has been observed that up to 20% of patients may have response [6, 7 ]. it has been proposed that the combination of cisplatin, bleomycin, and vinblastine can provoke a better response than the use of solely dacarbazine, while in other cases, the greater effectiveness of combining dacarbazine with vincristine and carmustine has been reported as well as immunotherapy utilizing local bcg or the transfusion of activated lymphocytes. average survival reported in the world literature of these patients ranges from 6 months to 14 years. the majority of them report that they succumb to the disease in the first 3 years after diagnosis. five - year survival after radical hysterectomy as only treatment is very low : less than 40% in stage i and 14% in stage ii [1, 14 ]. the limited experience in the management of these cases, the unpredictable biological behavior of the disease, and the great variety of treatments employed render the choice of an optimal therapy for primary malignant melanoma of the cervix difficult [4, 7 ]. in our case, due to the magnitude of the tumor, it was decided to employ total pelvic exenteration, showing extraordinary results, because the patient continues to be alive and disease - free at 8 years of surgery, which is in contrast importantly with that reported in the literature after treatment with radical hysterectomy. we propose consideration of this surgical approach and adjuvant rt for primary melanoma of the cervix as the initial treatment of choice. it is necessary to carry out long - term followup and biological research to obtain a consensus with regard to the diagnosis, treatment, and prognosis of the disease. primary malignant melanoma of the cervix is a rare disease with a poor prognosis, especially if it is not detected in a timely fashion or if it is not treated correctly. to date, no consensus has been established concerning treatment of primary melanoma of the cervix, but it is recommended that this be surgical, procuring the establishment of 2-cm margins, accompanied by radio- or chemotherapy. the majority of the case reports found suggest radical hysterectomy as the treatment indicated for these patients ; notwithstanding this, survival is less than three years in general when managed in this manner. total pelvic exenteration for primary malignant melanoma of the cervix offers a feasible initial treatment for these unusual cases. it is necessary initiate collaborative studies and followup of patients to be able to achieve establishing a therapeutic approach that may offer the best results to these unfortunate patients.
|
primary melanomas of the uterine cervix are rare tumors with no more than 60 cases reported in the world literature. poor prognosis is considered for the neoplasia itself as well as for diagnostic tardiness. there is no standard treatment ; however, radical surgery is the treatment cornerstone. our aim was to present the case of a 34-year - old woman with a primary malignant melanoma in the uterine cervix with affectation of the posterior face of the vagina without metastasis. total infraelevator pelvic exenteration and adjuvant radiotherapy was performed. the patient was under surveillance for 8 years of followup without evidence of local or distant disease. the majority of case reports found suggests radical hysterectomy as the treatment indicated for these patients. notwithstanding this, survival is very short when patients are treated in this manner. based on our results and on those reported in the literature, we propose initial treatment with total pelvic exenteration as optimal management for this neoplasia in its initial form.
|
injuries are a major cause of morbidity and mortality in both developing and developed countries, while fractures account for a substantial proportion of injuries [13 ]. fractures not only cause temporary or permanent physical disability but may also impair the overall life quality and mental health of affected individuals [4, 5 ] and lead to significant burden on healthcare systems as well as family carers [1, 57 ]. a number of european epidemiological studies have focused on the effects of age and gender among adult [914 ] and child [1518 ] populations. there are limited data available on the overall lifetime incidence rate of fracture among the general australian population [19, 20 ], and the majority of australian studies have focused on site specific fractures [2022 ]. in this study, we aim to investigate the effect of age and gender on the risk of fracture among the western australian population and apply age to model fracture risk over the life course with good precision. this population - based cohort study used hospital separation data on injuries and fractures due to injuries for the period january 1991 to january 2013 among western australians (wa) born between 1915 and 1990 (participants are 750 years old at baseline). data were extracted from the wa hospital morbidity data system by the wa department of health. the wa hospital morbidity data system included separations from all wa public and private acute hospitals. hospitalisation records were coded using icd-9 between 1990/91 and 1998/99 (fiscal year) and icd-10 classification system from 1999/00. in this study primary diagnosis, codes including icd-9 codes (800829) and icd-10 codes (s12, s22, s32, s42, s52, s62, s72, s82, s92, t02, t08, t10, and t12) were used to identify fracture cases, whereas external causes of injury and poisoning (icd-9) and external causes of morbidity and mortality (icd-10) were used to define hospitalisations due to injuries (rather than pathologic causes). annual estimates of wa gender and age - specific residential populations over the observation period were provided by the australian bureau of statistics (abs). in the descriptive analysis, overall and age - specific incidence rates of fracture were estimated by age between 0 and 85 years in 2-year intervals, separately for males and females. the age - specific incidence rates were then used to compute the cumulative risk of having at least one fracture hospitalisation for males and females. the risk of hospitalisation due to any injury (including nonfracture cases) was also described using gender and age - specific incidence rates. to investigate how the effects of gender may change over the lifetime log - linear models with age, age to the power of 2, and age to the power of 3 as predictors were fitted based on the age - specific risk of fracture for ages 18 to 85, separately for males and females. the average incidence rates (per 10,000 person - years) of fracture hospitalisation (95% confidence interval) were 50.12 (49.90, 50.35), 55.14 (54.82, 55.48), and 45.02 (44.71, 45.32) for both males and females, males only, and females only, respectively. the incidence rates (per 10,000 person - years) for overall injury hospitalisations (95% confidence interval) were 151.24 (150.85, 151.63), 168.82 (168.2, 169.40), and 133.37 (132.85, 133.89) for both males and females, males only, and females only, respectively. the gender - age - specific incidence rates of fracture hospitalisation are shown in figure 1. figure 2 provides a close - up illustration of the risk pattern for ages 1850 years. overall, the risk of fracture increased continuously up to 8 years of age and remained unchanged between 6 and 11 years for both genders. from the age of 12, the risk of fracture increased gradually until the age of 19 in males, whereas the risk of fracture decreased over adolescent period for females. the risk of fracture declined in males from age 20 years through to the late 40s ; among females, however, the risk of fracture began increasing from about the age of 42 years. up to the age of 54 years, the incidence rate of fracture was consistently higher for males compared to females ; thereafter, female rates exceeded male rates and remained higher to the end of the observation period. accordingly, the age - specific female - to - male incidence rate ratios of fracture increased from the age of 20 (figure 3). the pattern of age - specific injury hospitalisation rates appeared to be similar between the two genders, except for ages 55 to 65, when the risk of injury continuously increased in females but remained largely unchanged in males (figure 6). the age - specific rate of fracture (in natural logarithm form) in adults (> 18 years) was well predicted by age at its 1st, 2nd, and 3rd power in males with an adjusted r - squared of 0.98 (p 0.8) with an adjusted r - squared of 0.99 (p < 0.001) (see table 1). comparison between the observed incidence rates of facture and estimates from the model are shown in figure 4. for males and females, respectively, the cumulative risk of having at least one fracture hospitalisation due to injury was 11.8% and 6.3% by the age of 18 years, increased to 23.8% and 11.4% by the age of 45 years and increased again to 37.4% and 37.6% by 80 years (figure 5). this study provided a detailed picture of the risk of fracture hospitalisations among the western australia population. overall trends in age and gender specific risk of fracture were similar to observations from previous studies conducted on other populations [914, 20, 24 ]. the relative increase in fracture risk among females compared to males throughout the 20s and 30s (figure 3) was also evident although this has not been explored in detail in some of the earlier studies [12, 13, 19 ]. this increasing trend of female - to - male fracture incidence rate ratios appears to be driven by a decrease in risk for males and stable risk for females in that age period (figure 2). however, the age - specific risk of all injuries appeared to decrease at a similar rate for the two genders (figure 6), and therefore the increase in female - to - male incidence rate ratio in the 20s and 30s is unlikely to be entirely due to reductions in involvement of injury - related activities among males as they mature. the observed gender difference in the age - specific trend of fracture over this age period may be due to sex - specific changes in musculoskeletal fitness. this study also showed that the changes in the probability of fracture in adults over the life course can be expressed as a function of age. this suggests that the variation in fracture risk at different life stages is driven by risk factors (causes) that are determined or strongly associated with age. there is good evidence suggesting that the progression of osteoporosis [6, 25 ], changes in musculoskeletal fitness [2, 26 ], probability of involvement in injury - related behaviours [26, 27 ], and having certain health conditions [8, 28 ] are dependent on age ; however, it is unclear what other factors may underpin the strong association between fracture risk and age, and further research is required. the analyses relied entirely on hospitalisation cases, which do not include fractures that are treated by outpatient services (such as at emergency departments and gp clinics) and which may be relatively less severe. however, strengths of the study include its very large population - based sample, long follow - up period, application of a number of statistical methods, and the provision of detailed estimates of the absolute risks and cumulative risk of facture from birth to 85 years. in addition, this study showed that the trend in fracture risk over the life course can be almost fully explained (i.e., predicted) by age. overall trends in age and gender specific risk of fracture among the wa population were similar to estimates reported from previous studies. there is a relative increase in fracture risk among females compared to males throughout their 20s and 30s which could not be explained by reductions in injury - related activities among males. the trend in fracture risk over the life course can be almost fully explained by age.
|
aim. to precisely estimate the effect of age on the risk of fracture hospitalisation among the western australia population over the life course. methods. this population - based cohort study used hospital data on fractures for the period january 1991 to january 2013 among western australians born between 1915 and 1990. results. the average incidence rates (per 10,000 person - years) of fracture hospitalisation (95% confidence interval) were 50.12 (49.90, 50.35), 55.14 (54.82, 55.48), and 45.02 (44.71, 45.32) for both males and females, males only, and females only, respectively. the age - specific rate of fracture hospitalisation (in natural logarithm form) in adults (> 18 years) was well predicted by age at its 1st, 2nd, and 3rd power in males with an adjusted r - squared of 0.98 and p 0.8) with an adjusted r - squared of 0.99 and p < 0.001. conclusions. overall trends in age and gender specific risk of fracture among the western australian population were similar to estimates reported from previous studies. the trend in fracture hospitalisation risk over the life course can be almost fully explained by age.
|
adoptive immunotherapy holds great promises in the scenario of potential new approaches for the treatment of solid tumors refractory to conventional therapies. crucial issues for all adoptive immunotherapy strategies include the obtainment of sufficient numbers of immune effectors, recognition of tumor targets and possible restriction to specific hla - haplotypes. cytokine - induced killer (cik) cells are a heterogeneous subset of ex - vivo expanded t lymphocytes whose biological features make them appealing for adoptive immunotherapy, addressing some limitations associated with other strategies targeting specific tumor - associated antigens (taa).the main functional properties that favorably characterize cik cells are : 1) ex - vivo expansion 2) reduced alloreactivity ; 3) mhc - unrestricted tumor - killing. an important limitation preventing the successful clinical translation of several adoptive immunotherapy strategies is the obtainment of sufficient numbers of anti - tumor immune effectors and their in - vivo persistence after infusion into the patients. an important positive characteristic of cik cells is their easy, and relatively inexpensive, ex - vivo expansion 1, 2. cik cell precursors are cd3 + t lymphocytes, mainly with a nave, cd4cd8 double negative (cd4-cd8-) phenotype 3. they can be classically expanded starting from peripheral blood mononuclear cells (pbmc) but may also be generated from bone marrow or umbilical cord blood precursors 3, 4. the standard culture conditions require three to four weeks with the timed addition of ifn-, ab - anti cd3 and il2 3. ifn- is only added on day 0, its main activity is to activate the monocytes, present in the initial bulk culture, which provide both contact - dependent (cd58/lfa-3) and soluble (il12) crucial signals that favor the acquisition of a final th1 phenotype and cytotoxic power of cik cells 5 - 7. the ab anti - cd3 provides mitogenic signals to t lymphocytes subsequently sustained by il2 that drives the expansion 8, 9. some groups have reported the addition of il7 as beneficial to increase the cytotoxic potential of cik cells 10. after 3 - 4 weeks of culture the expansion rate is reported to be variable from few to more than 1000 fold 2, 11 - 13. such levels of expansion, also considering the availability of cd3 + starting precursors, are extremely favorable for subsequent clinical applications. the reason of the reported variability in the range of expansion rates is not clear, additional experimental strategies are currently under investigation to further ameliorate such numbers, especially for those patients who may be in the lower range (poor expanders) and may less benefit from such approach. alternative strategies are based on additional soluble factors added to culture conditions (thymoglobulin, il1, il7) 14 10, addition of transient allogeneic stimulation or depletion of t regulatory cells during the expansion culture 15. our group recently reported that a transient allogeneic stimulation with allogeneic irradiated pbmc may provide an important additional expansion boost to cik cells without affecting their antitumor activity of safety profile 16. standard ciks ' culture conditions have been successfully validated under good manufacturers practice (gmp) conditions 4 and have allowed recent applications into clinical trials. at the end of the expansion there is a heterogeneous population of cd3 + t lymphocytes, with two main subsets, respectively positive (cd3+cd56 +) and negative (cd3+cd56-) for the simultaneous expression of cd56 membrane molecule. the cd3+cd56 + fraction is considered the main responsible for the mhc - unrestricted antitumor activity 3, 13. mature cik cells are mainly cd8 + but cd4+cd8- cells can also be present in the bulk culture, less frequent are subsets with a double positive (cd4+cd8 +) or double negative (cd4-cd8-) phenotype. the terminally differentiated late effector phenotype (cd45ro+ ; cd27low ; cd28low ; cd62l- ; ccr7-) is the more represented among cd3+cd56 + cik cells while the cd3+cd56- counterpart exhibits more earlier memory characteristics 17. a second clinically relevant property of cik cells is their reduced alloreactive potential across mhc barriers that may result in a reduced risk for gvhd if adoptively infused after allogeneic hemopoietic cell transplant (hct) 13. early preclinical data, obtained from murine models of hct, demonstrated that the adoptive infusion of allogeneic cik cells across mhc - barriers was associated with a lower risk of acute gvhd compared to conventional t cells. the main biological explanation for this beneficial effect is likely linked to the abundant production of ifn-, by expanded cik cells, and its known protective action against gvhd 18, 19. compared to conventional t lymphocytes, allogeneic cik cells displayed a significant lower acquisition of homing molecules, required for the entry of inflamed and gvhd target organs (47, ccr9, e - selectin, cxcr3 and ccr5) and a higher susceptibility to apoptosis 20. even if murine studies confirmed a reduced gvhd potential, initial clinical trials infusing donor cik cells after hla identical hct, reported a 36% of gvhd incidence 21. these events were of low grade but sufficient however to raise concerns about a residual alloreactivity of cik cells that might become clinically relevant when challenged across major hla - barriers. preclinical studies confirmed that human cik cells retain a behavior similar to conventional t lymphocytes, being able of intense proliferation if stimulated across major hla - barriers. the first important implication is that a depletion of the alloreactive (cd3+cd56-) cik fraction from the expanded bulk population may further reduce their alloreactive and consequent gvhd potential. this approach may be of particular relevance in peculiar hct settings with augmented degree of hla - mismatch between donor and recipient (i.e. haploidentical hct) and high risk of gvhd. a second possible implication of ciks ' residual alloreactivity is its exploitation to ameliorate their ex - vivo expansion. a little modification in the standard ciks ' culture conditions, with the transient addition of allogeneic irradiated pbmc as stimulators, was shown to significantly increase the final expansion rate and augment the percentage of cd3+cd56 + cells without negatively affecting the antitumor activity or increasing their alloreactivity versus third party 16. in general these findings are in favor of a possible use of cik cells as alternative donor lymphocyte infusion (dli) following allogeneic hct, with the possibility of further decreasing the gvhd in high - risk settings by depleting the cd3+cd56- fraction before the infusion. a second - generation dli with cik cells might increase the overall antitumor activity of hct and improve its safety profile. such positive evolution might help new experimental perspectives of hct like those exploring its application as immunotherapy treatment for solid tumors. the ability to efficiently kill tumor cells is the ultimate basic ability requested to immune effectors candidate for adoptive immunotherapy. cik cells are endowed with a mhc - independent tumor killing capacity against both solid and hematologic malignancies. the antitumor activity is mainly, even if not exclusively, associated with the cd3+cd56 + fraction and it is not due to the highest percentage of cd8 + cells compared to the cd3+cd56- subset13. the exact mechanism involved in tumor recognition and killing is not completely known but a main role seems to be played by the nkg2d molecule expressed on the membrane of cik cells that interacts with mhc - unrestricted ligands on tumor cells 22. the main targets recognized by nkg2d are mic a / b (mhc class i related molecules) and proteins of the ulbp family (ulbps 1,2 and 3) 23 - 25 while the final killing is perforin and granzyme mediated. nkg2d has a co - stimulatory role on conventional t lymphocytes, while on cik cells it acquires a tumor - receptor function, following the ex - vivo activation with il2 and upregulation of the dap10 adaptor molecule 22. mic a / b are stress - induced proteins expressed by a wide range of malignant or transformed cells, their expression is mhc - unrestricted and not limited to a specific hystotype 26. the expression of such ligands may also vary within the same tumor type, according to variations in the biological behavior and aggressiveness of tumor phenotype. we recently reported, in a breast cancer preclinical model, that acquisition of resistance to treatment with trastuzumab could associate with the increased expression of mic a / b on tumor cells and consequent augmented susceptibility to immune - mediated killing by cik cells 27. the antitumor activity of cik cells have been described in vitro against several hematologic and solid malignancies including lung, gastrointestinal and mesenchymal tumors 13, 28 - 31. the tumor killing activity was confirmed in vivo with murine models of tumor xenograft 32 - 34. cik cells are usually infused intravenously in the animal, they were shown to efficiently infiltrate tumor sites and demonstrated a superior activity compared to classic lak cells against non hodgkin lymphoma 2, 3, 35. the majority of preclinical data were produced using allogeneic tumor cell lines as targets to demonstrate the efficacy of cik cells against solid tumors. while cell lines may represent a useful tool to generate important proof of concepts, they may not fully account for the unique patient - specific biological and immunogenic characteristics of autologous tumor cells. furthermore results may be influenced, at least in part, by hla - mismatches between cik cells and tumor targets. it is of great importance that future experiments may consider a design involving autologous tumor settings, to generate reliable patient - specific data that could serve as basis for subsequent clinical translation. in this direction first reports came by the stanford group that showed activity of cik cells against primary human ovarian cancer 33 and our group that recently reported data of intense tumor killing by patient - derived ciks against autologous bone sarcoma cells 36. an intriguing perspective for adoptive immunotherapy strategies with cik cells is the emerging possibility to redirect and potentiate their antitumor activity with taa bispecific antibodies 37 or their engineering to produce specific cytokines enhancing the cytotoxicity 38 or with tumor - receptor molecules 39 40, 41. the clinical translation of adoptive immunotherapy with cik cells as treatment for patients with solid tumors is currently the object of clinical trials and their number has increased in the very recent years. the first clinical experience included 10 patients with metastatic renal carcinoma, colorectal cancer and lymphoma. circulating cik cells persisted for up to 2 weeks after the infusion, no relevant associated toxicities were reported. one patient with lymphoma obtained a complete response while six patients had progressive diseases and three did not experience any change. in this first study, other clinical trials subsequently confirmed the safety and feasibility of this immunotherapy approach along with demonstration of initial clinical activity. in a phase i study reported on 12 patients with advanced non - hodgkin 's lymphoma (nhl), metastatic renal cancer or hepatocellular carcinoma (hcc), the adoptive infusion of cik cells resulted in three complete responses and two stabilizations of disease. two of the complete responses were observed in metastatic renal cancer and hcc, these responding patients received the simultaneous subcutaneous injection of low dose il-2 and ifn- respectively 42. the above mentioned are, to our knowledge, the only two trials with cik cells for solid tumors that have currently been published in europe or u.s. a higher number of clinical studies have been recently performed in asia with very interesting clinical results. in the setting of hepatocellular carcinoma, adjuvant infusions of autologous cik cells after surgical resection, showed a significant increase in disease - free survival 43, 44 ; an interesting observation was the reduction of hbv viral load associated with cik treatments 45. the adoptive infusion of cik cells produced interesting clinical responses in patients with lung and gastric cancers with a reported positive impact on survival in association with chemotherapy 46 - 49. a summary of clinical trials with cik cells for the treatment of solid tumors is reported in table 1. overall these studies confirmed the high safety of adoptive immunotherapy with cik cells with important indications suggestive for a clinical activity ; the heterogeneity in methods and criteria for response assessment make still early and difficult to draw definitive statements concerning tumor response or impact on survival. recently it has been created an international registry on cik cells (ircc) with the aim of collecting data worldwide and setting standard criteria to report results from clinical trial with cik cells 50. similar initiatives are very important as they could help a rational development of clinical research in the field and provide useful tools to analyze past and future results. these issues are crucial in order to derive objective and reliable conclusions on the efficacy of cik cells as adoptive immunotherapy for cancer. cik cells represent a promising tool in the scenario of cancer adoptive immunotherapy strategies. their easy and inexpensive ex - vivo expansion, along with the mhc - unrestricted tumor killing ability may overcome some crucial problems that have limited the diffusion and clinical translation of other immunotherapy approaches. the reduced alloreactivity across major hla - barriers may open new perspective applications of cik cells as alternative to conventional dli after hct, helping the extension of hct to other experimental settings like the treatment of solid tumors.
|
cytokine - induced killer (cik) cells are a heterogeneous subset of ex - vivo expanded t lymphocytes which present a mixed t - nk phenotype and are endowed with a mhc - unrestricted antitumor activity. the main functional properties of cik cells may address some of the main limitations that are currently preventing the successful clinical translation of adoptive immunotherapy strategies. clinically adequate quantities of immune effectors, sufficient for multiple adoptive infusions, may be obtained based on their relatively easy and inexpensive ex - vivo expansion starting from peripheral blood mononuclear cells. the mhc - unrestricted tumor - killing is mainly based on the interaction between nkg2d molecules on cik cells and mic a / b or ulbps molecules on tumor cells ; it has been proved effective against several solid and hematological malignancies and does not require any hla - restriction increasing the number of patients that might potentially benefit from such approach. finally, cik cells present a reduced alloreactivity across hla - barriers with important clinical implications for their potential use as alternative to conventional donor lymphocyte infusions after allogeneic hemopoietic cell transplant with a reduced risk of gvhd. in the present report we review the main functional characteristics of cik cells discussing recent findings and future perspectives to improve their antitumor activity and potential clinical applications.
|
alzheimer 's disease (ad) is a common neurodegenerative disorder characterized by altered processing of specific proteins, formation of neurofibrillary tangles, imbalance of redox homeostasis, and degeneration of synapses and neurons. although the mechanism of neurodegeneration in ad is not clearly understood, several studies presently indicate that apoptosis might occur and contribute to ad onset and progression [15 ]. though it remains to be determined whether true apoptosis is a necessary event in neurodegeneration, a growing number of studies support the activation of apoptosis in general, and caspases specifically, as an early event that contributes to neurodegeneration and promote the pathological hallmarks associate with ad. transgenic animal models have been useful tools to study ad, but currently many of them do not fully replicate the cascade of amyloid deposition, neurofibrillary tangles, and neurodegeneration that characterize the human disease. thus, as far as the studies about ad are concerned, the lack of an animal model that sufficiently resembles this disease is the reason why research should still proceed along parallel lines : studies carried out in animal models should be integrated and correlated to ad hoc - devised neuronal models in which the identification of single molecular steps is made possible. rat cerebellar granule neurons (cgns) are a neuronal model widely used to study events linking apoptosis and neurodegeneration [8, 9 ] due to the ease of cgn culture production, their high degree of cellular homogeneity, and the findings revealing that during the onset of apoptosis several molecular events reminiscent of ad are activated. in this paper, the role of key players of the neuronal apoptotic process is discussed with particular attention to the results obtained in cgns. the production, effect, and interplay of beta - amyloid (a), tau protein and its fragments are discussed together with the action of these proteins on mitochondria, and this is integrated in the scenario of cgn apoptosis. cgns survive and differentiate in vitro in the presence of depolarizing concentrations of kcl (25 mm) without additional need for neurotrophic factors. the mechanism of action of kcl is still controversial but, generally, it is believed that the increase in intracellular ca concentration [12, 13 ] and the activation of mitogen - activated protein kinase (mapk) induced by depolarization are involved. if the serum is removed, and the concentration of kcl is kept below depolarizing levels (k5), the majority of cgns die by an apoptotic process. under these conditions, that are equivalent to in vivo deafferentation, neuronal death is initiated and follows a general scheme that has been extensively characterized in recent years (for a review see). the production of reactive oxygen species (ros) and nitric oxide (no), the increase in proteasome, antioxidant enzyme, and nitric oxide synthase (nos) activities, and release of cytochrome c (cyt c) into the cytosol are some of the main events taking place soon after apoptosis induction in cgns and for which a cause - effect relationship has been defined. in the early phase of apoptosis, ros, no, and cgmp production increases as well as the activities of antioxidant enzymes and nos [1620 ], as the cell 's attempt to counteract the ongoing oxidative stress. however, due to superoxide production, cyt c is released into the cytosol where it carries out a triple function since it acts (i) as an antioxidant compound and an ros scavenger, (ii) as a respiratory substrate which can generate the mitochondrial transmembrane potential, and (iii) as the activator of the caspase cascade [2123 ]. as a consequence of both no and superoxide anion production, an increase in the levels of nitrated proteins has been found in the late phase (ranging from 3 to 15 hours after apoptosis induction). with apoptosis progression, the oxidative damage proceeds, antioxidant enzymes are inactivated by caspases and proteasome [18, 24 ], and, at the mitochondrial level, the adenine nucleotide translocator (ant) is progressively impaired thus contributing to the transition pore opening in the late phase of the death process [25, 26 ]. furthermore, it has been demonstrated that during the onset of apoptosis of cgns, several molecular events reminiscent of ad are induced. an amyloidogenic process is activated with an increased production of a which initiates a sort of autocrine toxic loop. contextually to the increase in a deposition, tau protein, which is the main constituent of ad neurofibrillary tangles, is cleaved by the concerted action of calpain and caspases with the production of toxic fragments [28, 29 ]. the mechanism of action of a tau toxic fragment has been elucidated, and ant has been identified as the specific mitochondrial target of such fragment. one of the central points in the physiopathology of ad is the altered function and/or structure of two alzheimer 's proteins, namely the amyloid precursor protein (app) and tau. roles in cell adhesion, neuronal migration, cell proliferation, neurite outgrowth, axonal transport, neuroprotection, and signal transduction have been proposed. the abnormal cleavage of app leads to the production of a which is the main component of senile plaques in ad and per se can induce neuronal cell death. tau is a neuron - specific microtubule - associated protein and a critical component of the neuronal cytoskeleton which progressively disaggregates during apoptosis. the proper function of tau depends upon a precise equilibrium between different isoforms and its state of phosphorylation. in ad, as well as in other human dementias, tau undergoes a series of posttranslational changes including abnormal phosphorylation, glycosylation, glycation, and truncation (see), which may render tau more prone to form aggregated structures, the neurofibrillary tangles, which constitute a major hallmark of ad. following such aggregation, the microtubules disintegrate, collapsing the neuron 's transport system, with consequent altered communication between neurons, eventually ending in cell death. interestingly, in the experimental model of cgns, it has been proposed that tau and app form a complex in vivo via the adaptor protein fe65 which is abundantly expressed in the central nervous system of mammals and in particular in the cerebellum and hippocampus. as a consequence, the full - length tau can play a role in regulating the proper localization of app and of its partners. during apoptosis, the disruption of the tau - fe65 interaction leads to a mislocalization of the app - fe65 complex within the cell that in turn could induce a change in the proteolytic fate of both app and tau proteins (figure 1). as far as a production is concerned, it has been reported that in the commitment phase (6 hours) of cgn apoptosis, an amyloidogenic process is activated which rapidly and irreversibly leads to increased production of a. a may be released outside the cell and act as a soluble and diffusible apoptotic death mediator, affecting neighbouring healthy neurons and activating a toxic loop that further accelerates and propagates the process of neurodegeneration. accordingly, it has been found that coincubation of cgn apoptotic cultures with antibodies directed against a significantly slows down the extension of cell death and quantitatively increases the neuronal survival rate. studies carried out on cgns as well as on various cell models indicate that both nonaggregated and, to a greater extent, aggregated a peptides of the short toxic fragment a2535 can induce apoptosis when externally added to cell cultures [35, 36 ] and that different a aggregation forms (monomers, protofibrillar intermediate, and mature fibrils) can have diverse effects [3739 ]. in the same experimental model (i.e., cgns), a2535-induced apoptosis has been found to be associated with the activation of multiple executioner caspases (caspases-2, -3, and -6), and the shorter a fragment (a3135) is able to induce neurodegeneration with an early increase in bax mrna level followed by delayed caspase-3 activation. finally, it has been reported that a may interfere with k channel trafficking [42, 43 ], altering k currents and therefore causing an increase in cell death as a result of a decrease in cytoplasmic k concentrations. consistently, the selective upregulation of the expression of two voltage - dependent potassium channel subunits (kv4.2 and kv4.3) has been found in cgns after a2535 exposure. in cgns, contextually to the significant increase in amyloidogenic metabolism of app, tau also undergoes posttranslational modifications. as soon as 6 hours after apoptosis induction, a change in tau phosphorylation state occurs in concomitance with caspase and calpain - mediated cleavages (figure 1). as a consequence, several fragments of tau protein are produced during apoptosis, the most abundant of which is a 17 kda residual fragment, probably located at the nh2-terminus of tau, which is unable to bind to microtubules and is diagnostic for the ongoing apoptotic process. truncated forms of tau, besides being produced during apoptosis, can also be effectors of apoptosis by themselves and operate as toxic fragments that further induce cell death so contributing to the progression of neurodegeneration by an autocatalytic process [29, 4547 ]. both c - ter and n - ter tau fragments have been analyzed for their neurotoxicity. while the microtubule - binding capacity of the c - ter fragment is well documented, relatively little is known about the function of the n - terminal domain. transfection of neuronal cells with c - terminal tau fragments induces cell death [46, 47 ] while exogenous overexpression of n - ter tau fragments in cgns can be either neuroprotective or neurotoxic depending on its length. the long n - ter tau fragment (1230) is antiapoptotic and promotes the prosurvival effect of the akt pathway. on the other hand, the short n - ter tau fragment (144) exerts a toxic action involving glutamate receptors. moreover, further analysis performed in the cgn model system further narrowed the extent of the aminoacid stretch which is toxic to the cells, and the n - ter-2644 tau fragment was found to be the minimal active moiety which retained a marked neurotoxic effect. on the other hand, mounting evidence indicates that mitochondrial dysfunction occurs early in ad, worsens with clinical deterioration, and is associated with impairment of energy homeostasis ; deficit in the function of complexes of the respiratory chains reduced atp synthesis as well as altered mitochondrial structure [4951 ]. consistently, a reduced activity of the cytochrome c oxidase (complex iv of respiratory chain) has been reported in different brain regions as well as in platelets and fibroblasts of ad patients, but the involvement of other mitochondrial oxidative phosphorylation complexes is less documented and more controversial. cardoso and collaborators found a decreased atp level in ad cybrids, and other authors report that the activity of complex iv, but not the activity of f1f0-atpase (complex v), decreases in the hippocampus and platelets of ad cases [55, 56 ]. because mitochondria are the powerhouse of cells, damage to mitochondria, such as impairment of complex iv activity, could have functional consequences on energy metabolism. furthermore, mitochondrial dysfunction has been proposed to be the link between the histopathological hallmarks of ad, caused by a and tau deposition, and neuronal and synaptic loss. the emerging picture is one in which, at the level of mitochondria, both alzheimer 's proteins exhibit synergistic effects finally leading to the acceleration of neurodegenerative mechanisms (figure 2). as far as a is concerned, although the classical view is that a is deposited extracellularly, both cellular and biochemical studies carried out in different models of ad and aging have provided evidence that this peptide can also accumulate inside neurons, target mitochondria, and contribute to disease progression [5861 ]. by using in vivo and in vitro approaches, it has been demonstrated that a is transported into rat mitochondria via the translocase of the outer membrane (tom) and localizes within the mitochondrial cristae. a similar distribution pattern of a in mitochondria has been shown by immunoelectron microscopy in human cortical brain biopsies. interaction of a with mitochondria could be considered a general route common to different cell types since both in dividing cells (i.e., neuroblastoma cells) and in terminally differentiated neurons (i.e., primary neuronal cultures), either extracellulary applied or secreted a can be internalized, and it colocalizes with mitochondrial markers [62, 63 ] (figure 2). interaction of a with the matrix protein abad (amyloid - binding alcohol dehydrogenase) has been described, whereas caspersen. reported that in mouse and human brain samples from ad patients, a colocalizes with the mitochondrial matrix protein hsp60. recent biochemical studies imply that the formation of the mitochondrial permeability transition pore (mptp) is involved in a-mediated mitochondrial dysfunction, and by using a computational approach and predictive analysis tools, it has been hypothesized that a can strongly interact in the inner membrane with ant and cyclophilin d, two components of the mptp. a connection between tau protein and mitochondria has recently been proposed ; by overexpressing the n - ter tau fragment truncated at asp-421 to mimic caspase cleavage in immortalized neurons, it was possible to induce mitochondrial fragmentation and elevated oxidative stress levels. to the best of our knowledge, the toxicity of n - ter tau fragments on mitochondria has been deeply investigated only in the cgn model system and has been found to involve a mitochondrial dysfunction with impairment of oxidative phosphorylation (figure 2). both complex iv and ant proved to be targets of the short nh2 - 2644 tau fragment, but ant is the only mitochondrial target responsible for the impairment of oxidative phosphorylation. detailed biochemical studies have revealed that inhibition of ant is noncompetitive, suggesting that the nh2 - 2644 tau fragment does not interact with the catalytic site but with some other site of the enzyme which could distort the enzyme structure thus also affecting the catalytic binding site. this finding is consistent with the picture of the apoptotic process in cgn that to date has been built up : in late apoptosis, a noncompetitive - like inhibition of ant has been found, probably due to caspase activity, but it is not dependent on a direct caspase however since nh2 - 2644 tau fragment is likely to be generated during apoptosis given that the n - terminal domain of tau contains consensus sequences suitable for cleavage by caspase(s) [28, 45 ], which are activated in apoptotic degenerating neurons in ad [69, 70 ], the possibility exists that caspase(s) gradually inhibit / s ant as a result of nh2-tau cleavage and the generation of toxic nh2 - 2644 tau fragment. in this case no produced by nos, is a molecule endowed with a double role acting as either a prosurvival or a toxic molecule. as a prosurvival molecule, no plays a role in cell signaling in the nervous system and in synaptic plasticity [71, 72 ], and it may be involved in diverse biological functions acting through either cgmp - dependent or -independent pathways. when the role of the no / nos system was investigated in cgns, it was found that no exerts its dual and opposite effects on the neurodegenerative process, depending on the time after induction of apoptosis (figure 3). in an early phase, up to 3 h of apoptosis, there is an increase in the expression of the neuronal isoform of nos (nnos) as well as in the production of no, which in turn supports the survival of cgns through a cgmp - dependent mechanism. consistently with these results, it has also been reported that : (i) no may be responsible for neuroprotection during a-induced cell death [73, 74 ], (ii) low concentration of no produced by a healthy cerebrovascular endothelium was found to influence the parenchymal brain cells in a protective way, and (iii) in cultured human neuroblastoma cells, low concentrations of no upregulate the expression of alpha - secretase, while downregulating that of beta - secretase, suggesting that, in the relative absence of superoxide, cerebrovascular no might act to suppress brain production of a. on the other hand, sustained generation of no has been implicated in the cellular death occurring in different neurodegenerative diseases as well as in ad. as far as the experimental system of cgns is concerned (figure 3), it was found that, in the late phase of the apoptotic program, after 3 h, nnos expression and activity decreased, resulting in the shut down of no and cgmp production, and the toxic role of nitric oxide prevailed due to the reaction with superoxide anions to produce peroxynitrite (onoo) which in turn is able to induce neuronal injury mainly through nitration of tyrosine residues in cellular proteins, whose level increases. these events together with other apoptotic events already described in this cell model [15, 23, 25, 26 ] would commit these cells irreversibly to death. thus, it can be assumed that once accumulated inside the cell, no can play different roles, depending on its level, cell context, and amount of superoxide anion. in figure 4, a general picture is shown which takes into account the main findings on the involvement of nitrosative stress in the neurodegenerative process. in brains from ad patients, an early and striking upregulation of all three isoforms of nos has been reported [78, 79 ]. this finding is further supported by experimental data obtained in different systems, ranging from in vivo animals to cell lines, which indicates that no is responsible for a toxicity and highlights a link between no / nos level and a-induced brain dysfunction [80, 81 ]. activation of the neuronal isoform of nos (nnos) and an increased production of no were also found in rat cerebral cortex and hippocampus after intracerebroventricular administration of a2530 and in app - transfected cells, respectively. in an early phase, no could induce a cgmp - mediated prosurvival signaling pathway in an attempt to counteract the ongoing neurodegenerative process [19, 84 ]. however, no can also directly trigger mitochondrial dysfunction, a process which is believed to play a causative role in ad onset and progression. indeed it has been reported that no both induces a bioenergetic failure, with impairment in the function of complex iv, and triggers mitochondrial fission / fragmentation thus causing cell death in primary culture of cortical neurons [86, 87 ]. s - nitrosylation, a covalent redox reaction of no with specific protein thiol groups, could be one mechanism contributing to the no - induced mitochondrial fragmentation. accordingly, it has been reported that in ad patients and animal model, no induces s - nitrosylation of dynamin - related protein 1 (drp1), a protein specifically involved in mitochondrial fission [88, 89 ]. on the other hand, bossy although there are no data on the involvement of drp1 in the cgn model, it has been recently reported that mitochondrial fragmentation occurs as an early event in response to injury in cgns, and increased activation of mitofusin 2 (mfn2), a protein involved in mitochondrial fusion, blocks mitochondrial fragmentation and protects neurons against cell death [91, 92 ]. in addition to no, oxidative damage has been reported in aging and age - related neurodegenerative diseases, including ad [93, 94 ], and superoxide anion production has been induced by a-treatment in neurons [95, 96 ]. it is known that in the course of neurodegeneration, the superoxide anion can act directly on mitochondria thus inducing cyt c release and precocious impairment of ant (see and references therein). on the other hand, no readily reacts with superoxide anions to form the strong oxidant onoo which in turn induces protein nitration. consistently, an increase in protein nitration has been found in brain tissue from cases of ad which correlates with neurodegeneration. tau protein can also undergo a onoo - mediated process, and nitration of the tyr29 residue has been proposed as a specific disease - related event. furthermore, peroxynitrite can also induce ad - like tau hyperphosphorylation via activation of both glycogen synthase kinase-3beta (gsk3beta) and p38 mapks. nitration, as well as phosphorylation, of tau protein induces conformational changes that facilitate aberrant tau assembly. consistently, it has been reported that nitrated tau is colocalized with neurofibrillary tangle in ad brain, shows a significantly decreased binding activity to microtubules, and is involved in the formation of filamentous tau inclusions. in these conditions, tau fragmentation might occur, and n - ter tau fragments, together with a and superoxide, can further decrease mitochondrial efficiency thus contributing to mitochondrial dysfunction. treatment of declared ad with any compounds may have either a poor effect due to the severe neuronal death occurring in ad or a questionable risk / benefit ratio such as in the case of estrogen. in this regard, estrogen has been shown to block a-induced neuronal cell death in several studies thus suggesting that estradiol replacement therapy should show improvement in patients with ad. however, the efficiency of estradiol in the treatment of ad has been seriously questioned due to its fourth unwanted side effect, that is, proliferative and oncogenic effects on non - neuronal cells. a clear point emerging from the bulk of studies dealing with ad etiopathology is that all factors involved in ad are associated with oxidative stress. in the light of this, natural oxidants have recently received much attention as promising agents for reducing the risk of oxidative stress - related diseases. among them genistein (4.5.7-trihydroxyisoflavone) is the most active compound of soy isoflavones, the one which reaches the highest concentration in human blood, possesses an antioxidant activity, shows an affinity to estrogen receptors, thus acting as an estrogen - like compound but without the negative effects of estrogens, and is able to cross the blood - brain barrier (see). it has been reported that in the nervous system, isoflavones attenuate primary neuronal apoptosis by activating estrogen receptors and genistein is able both to suppress a2535-induced ros overproduction in isolated rat brain synaptosomes and to increase cell viability in cooperation with other trophic factor such as folic acid in cortical neurons. describe the protective effect of genistein on cultured hippocampal neurons against a-induced apoptosis and have demonstrated that genistein inhibits the elevation of intracellular free ca, the production of oxidant free radicals caused by a2535, the dna fragmentation, and the activation of caspase-3, thus suggesting that genistein acts upstream of caspase-3 to block apoptosis (figure 4). genistein may also decrease the hyperphosphorylation of tau protein by inactivating gsk3beta, the kinase involved in tau phosphorylation in homocysteine - mediated neurodegeneration in sh - sy5y human neuroblastoma cells. recently, in cgns undergoing apoptosis, the effect of genistein was studied at subcellular level and for the first time at mitochondrial level. genistein and to a lesser extent its analogue daidzein, both used at dietary concentrations, can prevent low potassium - dependent apoptosis in cgns by reducing the impairment of both aerobic glucose metabolism and mitochondrial uncoupling, two processes occurring in cgn apoptosis. furthermore, genistein is also able to prevent cyt c release, ant alteration, and mptp opening ; that is, some steps of the mitochondrial pathway to apoptosis that are somehow related to the ros production which takes place during apoptosis. thus, since both genistein and daidzein have been proved to decrease ros levels, it has been suggested that the prevention of apoptosis is essentially due to the antioxidant properties of these flavonoids. nonetheless, the effect of genistein proved to be rather specific since other flavonoids such as catechin and epicatechin failed to prevent cgn death in spite of their shared antioxidant capability. consistently, genistein also abolishes neuronal ros production induced by a administration to primary culture of cortical neurons and enhances the activities of other antioxidant molecules and enzymes (superoxide dismutase, glutathione peroxidase and reductase) both in vitro and in vivo [112, 113 ]. the etiology of alzheimer 's disease is complex and not fully elucidated. on the other hand, it is important to develop a better understanding of the different biochemical pathways, their role, and their link with the amyloid hypothesis in ad, since it may lead to the development of more effective treatment strategies for this disease. it seems clear then that promising developments as for the prevention and/or delay of the onset of ad can be derived from definition of antiapoptotic treatments acting on the precocious steps of the death process, such as blockade of generation of reactive oxygen species and implementation of the no prosurvival signaling pathway that, although not able to fully prevent the disease, can at least delay onset or reduce the severity of neurodegeneration. in this furthermore, the knowledge emerging from studies conducted on cgns, that ant impairment contributes in a significant manner to bioenergetic failure and mitochondrial dysfunction in the course of neurodegeneration, may open a window for new therapeutic strategies aimed at preserving and/or improving mitochondrial function, representing an exciting challenge for biochemists. more studies are required to determine whether phytoestrogens, protease inhibitors and mitochondrial - targeted compounds could fulfill these expectations.
|
in this paper, we discuss the interplay between beta - amyloid (a) peptide, tau fragments, oxidative stress, and mitochondria in the neuronal model of cerebellar granule neurons (cgns) in which the molecular events reminiscent of ad are activated. the identification of the death route and the cause / effect relationships between the events leading to death could be helpful to manage the progression of apoptosis in neurodegeneration and to define antiapoptotic treatments acting on precocious steps of the death process. mitochondrial dysfunction is among the earliest events linked to ad and might play a causative role in disease onset and progression. recent studies on cgns have shown that adenine nucleotide translocator (ant) impairment, due to interaction with toxic n - ter tau fragment, contributes in a significant manner to bioenergetic failure and mitochondrial dysfunction. these findings open a window for new therapeutic strategies aimed at preserving and/or improving mitochondrial function.
|
development of hemiplegia causes difficulties in weight bearing on the affected side and maintaining balance, both of which are required for correct posture. an imbalanced posture results in instability during standing, muscle weakness, and a limited range of motion.. the risk of falls may increase after a patient has experienced one fall, even in the absence of physical damage, because of an increased fear of falling2. schoenfelder. suggested that fall prevention education and muscle strengthening can decrease the fear of falling and risk of falls3. a fall prevention program that includes balance, muscle strengthening, and flexibility training is effective for improving gait, balance ability, and perception of the risk of falling4. because falls have multiple causes, multifactorial interventions including patient education and improvement of muscle strength, balance, and gait are required for fall prevention. however, most fall prevention programs consist of a single item, and because falls are influenced by physical, psychological, environmental, and social factors, an effective fall prevention program would include exercise and educational interventions5. although many studies have reported ways to prevent falls6, 7, the subjects in these investigations were elderly people in the community, and only a single program was applied. fall prevention interventions have to begin in high - risk facilities and hospitals8. therefore, the purpose of this study was to study baseline data and decrease the risk of falls using a multifactorial fall prevention program (mfpp) in post - stroke patients. thirty patients (16 males, 14 females) who had experienced a stroke within the previous year at the m hospital in seoul - si were included. based on previous studies, the following inclusion criteria were used : age 24, and able to understand the study procedures and communicate9. the exclusion criteria were medication use, which can influence gait ability and balance, visual deficits, and vestibular impairment. subjects were randomly allocated to the mfpp group (n=15, mfpg) or treadmill exercise group (n=15, teg). five patients were excluded from the mfpg. from the teg, 1 male and 3 female patients were excluded due to discharge before completion of the experiment, and 1 female patient was excluded for personal reasons. all study procedures were explained to the subjects prior to participation, and written informed consent was obtained from all subjects. this study was approved by the sahmyook university institutional review board. before the intervention program, the subjects gait speed and endurance were assessed using the korean performance - oriented motor assessment (poma - k) scale10, 10-m walk test, and 6-min walk test. the korean falls efficacy scale11 (fes - k) and korean activities - specific balance confidence12 (abc - k) scale were used to assess the balance self - assurance of the patients. the multifactorial exercise program included education regarding fall prevention, neuro - developmental treatment (ndt), and training for muscle strengthening, balance, and flexibility. it was carried out for 30 min per day, five times a week, over a 5-week period. the treadmill exercise program included ndt and treadmill exercise, with a 0.4 km / h increase in speed per week. the details of both exercise programs are described in tables 1table 1.multifactorial fall prevention programexercise typetime (sets / duration)exercisestrengthening interventioncalf stretching3060 sec 5 repetitionsheel / toe raise510 secmarchingfloor / stairsslr : forward, side, backward510 sec, 10 repetitions, 3 setsleg curlin sitting on chairbalance interventionankle rom exercisedraw a to zstanding on air cushionup and down the leg alternatelydiagonal movement exercisein holding both hands with trunk rotationflexibility interventionstanding with head movementgeneral standing 30 sec tandem standing 30 secstanding on balance padeye open / closeeducationregulation of fall environmental factorbefore starting exercise for 5 minutesgeneral physical therapyndtpnfgeneral stretching and strengtheningstatic and dynamic balance training2 times / day, 5 days / weekrom : range of motion ; slr : straight leg raise ; ndt : neurodevelopmental technique ; pnf : proprioceptive neuromuscular facilitation and 2table 2.treadmill exercise programexercisetreadmillincrease the speed by 0.4 km / h per weekf possible independent walkingexercise stopped in cases of fatigue, dyspnea on exertion, or on patients requestgeneral physical therapyndtpnfgeneral stretching and strengtheningstatic and dynamic balance training2 times / day, 5 days / weekndt : neurodevelopmental technique ; pnf : proprioceptive neuromuscular facilitation. rom : range of motion ; slr : straight leg raise ; ndt : neurodevelopmental technique ; pnf : proprioceptive neuromuscular facilitation ndt : neurodevelopmental technique ; pnf : proprioceptive neuromuscular facilitation the spss version 19.0 statistical software was used for all analyses. statistics were used to describe patient characteristics after confirming that the data were normally distributed. a comparison of the general characteristics was performed using the independent t - test or test. pre- and post - data were analyzed using the paired t - test to test differences within the groups. scheff s post - hoc test was used to test the significance of differences between the groups. the general characteristics of the subjects are presented in table 3table 3.general characteristicsparametermfpgteggender male / female (%) 10/5 (66.7/33.3)5/5 (50.0/50.0)age, years47.910.653.212.3height, cm165.17.7164.810.8weight, kg64.78.462.38.4disease cause infarction /hemorrhage8/7 (53.3/46.7)5/5 (50.0/50.0)affected side right / left (%) 10/5 (66.7/33.3)4/6 (40.0/60.0)disease duration (months)8.022.96.222.2mmse - k26.72.326.31.8values are expressed as n (%) or meansd. mfpg : multifactorial program group ; teg : treadmill exercise group ; mmse - k : mini - mental state examination - korean. no significant differences in general characteristics were observed between the mfpg and teg (age, 49.9 years vs. 53.2 years ; height, 168.1 cm vs. 164.8 cm ; body weight, 64.7 kg vs. 62.3 kg). mfpg : multifactorial program group ; teg : treadmill exercise group ; mmse - k : mini - mental state examination - korean differences in pre- and post - test values within and between the groups are summarized in table 4table 4.comparison of poma - k, 10-m walk test, 6-minute walk test, fes - k, and abc scale - kmfpg (n=15)teg (n=10)pretestposttestpretestposttestpoma - k19.67 (6.04)23.80 (5.17)17.30 (4.24)17.40 (5.58)10-m walk test (m / s)0.48 (0.23)0.65 (0.28)0.43 (0.26)0.55 (0.29)6-minute walk test (m / s)0.49 (0.25)0.60 (0.26)0.40 (0.23)0.44 (0.27)fes - k59.00 (21.03)72.93 (15.61)57.30 (19.32)55.50 (25.67)abc scale - k47.35 (18.14)62.40 (17.28)39.45 (19.78)40.70 (25.50)values are expressed as mean (sd). within group differences mfpg : multifactorial program group ; teg : treadmill exercise group ; poma - k : performance - oriented motor assessment - korean ; fes - k : fall efficacy scale - korean ; abc scale - k : activities - specific balance confidence scale - korean. the poma - k scores were significantly higher in the mfpg (p0.05). in addition, the fes - k score was significantly different between the groups (p0.05). in other words, exercise intervention improved balance and gait ability, and educational intervention improved the psychological aspect of the fear of falling. reported that home visits can prevent falls among older people who are at increased risk of falling. however, this effect may not be the result of improved balance and strength alone, but also due to a decreased fear of falling8. the risk of falling within 12 months in those with a decreased fes score was half that in patients whose fes score had not decreased9. therefore, interventions for fall prevention need to begin at hospital facilities, and programs must consist of a variety of approaches. using the abc - k scale with the fes scale is an efficient method of evaluating the fear of outdoor activities as well as indoor activities18. first, although balance, gait ability and fes scores significantly improved after the mfpp, it can be difficult to prove the frequency of falls using these factors alone ; the validity of this study is therefore limited. second, a reduction in fall frequency is the eventual goal, but an intervention period of 5 weeks is too short to allow an assessment of this factor. it is therefore suggested that further studies include longer intervention and follow - up periods.
|
[purpose ] this study investigated the effects of a multifactorial fall prevention program on balance, gait, and fear of falling in stroke patients. [subjects ] twenty - five stroke patients were divided randomly into multifactorial fall prevention program group (n=15) and control treadmill group (n=10). [methods ] all interventions were applied for 30 min, five times per week, for five weeks. the fall prevention program included interventions based on the step up to stop falls initiative and educational interventions based on the department of health guidelines. for those in the treadmill group, the speed was increased gradually. the korean falls efficacy scale and korean activities - specific balance confidence scale were used to assess fear of falling. to assess balance and walking ability, the korean performance - oriented mobility assessment scale and the 10-m and 6-minute walk tests were used. [results ] the fall prevention program interventions were found to be very effective at improving gait, balance, and fear of falling compared with the treadmill intervention and therefore seem appropriate for stroke patients. [conclusion ] a multifactorial fall prevention program is effective at improving balance, gait ability, and fear of falling. it is a more specific and broad intervention for reducing falls among inpatients in facilities and hospitals.
|
we present a nanoscale color detector based on a single - walled carbon nanotube functionalized with azobenzene chromophores, where the chromophores serve as photoabsorbers and the nanotube as the electronic read - out. by synthesizing chromophores with specific absorption windows in the visible spectrum and anchoring them to the nanotube surface, we demonstrate the controlled detection of visible light of low intensity in narrow ranges of wavelengths. our measurements suggest that upon photoabsorption, the chromophores isomerize from the ground state trans configuration to the excited state cis configuration, accompanied by a large change in dipole moment, changing the electrostatic environment of the nanotube. all - electron ab initio calculations are used to study the chromophore - nanotube hybrids and show that the chromophores bind strongly to the nanotubes without disturbing the electronic structure of either species. calculated values of the dipole moments support the notion of dipole changes as the optical detection mechanism.
|
|
the frequency with which the general public use the community pharmacy provides an ideal opportunity to screen patients for undiagnosed conditions. there may be up to 1 million people in the uk with undiagnosed type 2 diabetes, and many may not know they have the condition, as they may have few or none of the classic symptoms. opportunistic screening tests at a random encounter with a health - care professional can be used to identify patients with type 2 diabetes before they start to develop complications. diabetes uk, the university of leicester and the university hospitals of leicester nhs trust have developed a type 2 diabetes risk assessment that uses a short questionnaire designed to highlight a person 's risk of developing the condition over 10 years, with a moderate score indicating a 1 in 7 chance and a high score indicating a 1 in 3 chance. seen as preferable to a random capillary blood test, it avoids false reassurance and potentially over - referral to the general practitioner and can direct people to make lifestyle changes before the risk develops into the condition. it is a recommended first step to identifying those at risk of developing the condition, and community pharmacists have been encouraged to use it with their patients and customers. the aim of this service evaluation was to identify whether a service provided by community pharmacies can identify people at risk of developing type 2 diabetes. the university of east anglia 's research ethics committee approved this study as a service evaluation. the risk assessment took place in all community pharmacies belonging to one large chain across the uk. the diabetes risk assessment involves seven simple questions along with measurements of waist circumference and body mass index. responses to each question are scored and combined to indicate a risk level of developing type 2 diabetes (low, increased, moderate or high). professional advice is dependent on the final score and ranges from positive feedback (low score) and simple advice (increased risk) to advice to see one 's general practitioner for a blood test (moderate and high risk). the assessment and advice were largely provided by pharmacy assistants, who had received some electronic and face - to - face training. the consultation was designed to last 10 min, and consent was implied when the patient provided information to allow service participation and form completion. people over 18 years old, not pregnant and not previously diagnosed with any form of diabetes were eligible for inclusion. leaflets and posters within each pharmacy were used to advertise the service to all patients and customers. discussion of the service also took place in pharmacy consultations (e.g. medicine use reviews) and within the company 's optician stores, where the service was advertised to patients. pharmacies were not paid for delivering the service. all completed risk assessments were registered on the pharmacy system, and the paperwork was retained. anonymous data were then transferred to an independent team (m.t. and d.w.) for analysis. all forms returned up to september 2013 were analysed (note that the difference in numbers is due to not all pharmacies returning the paperwork). descriptive analysis was performed on the data received in the first 9 months of the service, using the spss v. 18 package (ibm, armonk, usa). medians and interquartile ranges (iqrs) were used where the data were not normally distributed. a total of 21 302 risk assessments in 1513 pharmacies were recorded in the pharmacy system between the beginning of january 2013 and the end of september 2013 (median (iqr) 6 (214)). a total of 3513 risk assessments were returned, and 3427 with a complete dataset were analysed. postcode analysis on the pharmacy location demonstrated that this subsample came from the same geographical distribution as the total number of risk assessments performed, which was in itself spread across the uk. the median age was 44.9 years (iqr 30.458.2) ; 30.1% of patients were male, and 86.6% were white european. nearly one - third (29.8%) of assessments were performed on someone with a family history of diabetes. table 1 illustrates the results for the other questions on the risk assessment, including the outcome score. nearly one - third (29.1%) of assessments yielded a result of a moderate or high chance of developing the condition, with 60.4% being conducted on people considered overweight or obese. profile of patients identified as a result of the diabetes risk assessment sd, standard deviation ; iqr, interquartile range. in this particular subsample, the community pharmacy - based risk assessment helped to identify nearly a thousand people for whom the risk of developing type 2 diabetes was either moderate or high, as well as a further thousand at an increased risk of developing the condition in the next 10 years. this service demonstrates that pharmacists may be a useful resource for many patients who do not routinely access health services, as evidenced by the range of ages seen. one limitation is a lack of follow - up of patients to determine their actions as a result of the assessment. further work should be undertaken to determine whether lifestyle, diet and referral advice provided to this group of people by the community pharmacy to reduce their level of risk is actually followed by patients. another limitation centres on the relatively small number of assessments conducted in each pharmacy every month and the low numbers of forms returned to be input electronically. the return of the forms was not a priority for pharmacists, as it was not essential for service delivery, although the company highly encouraged it. recent research has supported the view that risk assessment followed by a blood test for those patients at a high risk is the most cost - effective approach to identification. however, the cost - effectiveness of such a service in community pharmacies as compared with screening within the medical practice (on a population basis) remains to be established and should be the focus of future work. this evaluation has shown that pharmacists are able to identify patients who are at an increased risk of developing diabetes, something that has not been demonstrated in the literature thus far. however, it does not indicate whether this is a cost - effective approach to risk assessment or whether patients follow the advice provided. the author(s) declare(s) that they have no conflicts of interest to disclose. this research received no specific grant from any funding agency in the public, commercial or not - for - profit sectors. tracey thornley and lisa haynes designed the study, collated the data and assisted with drafting the manuscript. all authors state that they had complete access to the study data that support the publication. this research received no specific grant from any funding agency in the public, commercial or not - for - profit sectors. tracey thornley and lisa haynes designed the study, collated the data and assisted with drafting the manuscript. all authors state that they had complete access to the study data that support the publication.
|
objectivesto determine the demographics and risk results of patients accessing a community pharmacy diabetes risk assessment service.methodparticipating patients underwent an assessment using a validated questionnaire to determine their 10-year risk of developing type 2 diabetes. patients were given appropriate lifestyle advice or referred to their general practitioner if necessary.key findingsin total, 21 302 risk assessments were performed. nearly one - third (29%) of 3427 risk assessments analysed yielded a result of moderate or high chance of developing the condition.conclusionscommunity pharmacies can identify a significant number of patients at risk of developing type 2 diabetes in the next 10 years. further follow - up work needs to be done to determine the cost - effectiveness of such a service and the consequences of receiving a risk assessment.
|
many studies have attempted to explain the interaction of bone tissue with various alloplastic biomaterials, such as titanium, that are often used to fabricate dental implants.1,2 improvement of the integration of biomaterials into bone tissue is one of the challenges in the biomaterials fields. to bring bone tissue integration on implant surfaces various techniques have been used to improve tissue responses to implant surfaces.3 - 5 many in vivo and in vitro studies have compared the efficiency of various surface treatments in improving bone tissue integration of implants.4,6 histological as well as biochemical data from these studies describe a variety of cellular responses to various implant surface conditions.7 - 12 many in vitro evaluations of cell responses to implant roughness have been performed in order to discern the surface properties influencing the cell response to implant surface.13 - 17 to date, comparative studies regarding differences in surface composition and topography effects on cell responses have been scarce. runx2 (cbfa1) is a transcription factor that belongs to the runx family, and is expressed as two isoforms. type i and ii runx isoforms are expressed in chondrocytes, as well as osteoblasts, although, type ii runx2 expression is predominant in osteoblasts.18 - 20 runx2 binds to an osteoblast - specific cis - acting element, activates the expression of osteocalcin, the most osteoblast specific gene, and regulates osteoblast differentiation and expression of key osteoblast genes necessary for development of a mineralized phenotype. runx2 plays an essential role in steering multipotent mesenchymal precursor cells toward an osteoblastic lineage21 and promotes osteoblast differentiation at an early stage. however it inhibits osteoblast differentiation at a late stage.22 runx2 is a positive regulator that can upregulate the expression of bone matrix genes, including type i collagen, osteopontin, bone sialoprotein (bsp), osteocalcin, and fibronectin.20,23,24 lastly runx2 was shown to have a role beyond development and differentiation by regulating the rate of bone matrix deposition.23 thus, runx2 is a critical gene not only for osteoblast differentiation but also for osteoblast function. however, the effects of different implant surface topographies on gene expression of key osteogenic factors are not fully understood. the hypothesis of the current study was that different implant surface treatments differentially affect runx2 gene expression. readily available human osteosarcoma te-85cells were used. in this study, cells were grown on machined, sandblasted, anodized cpti discs and control tissue culture plates for 1st, 3rd, and 5th days. the purpose of this study was to address molecular events with respect to the osteogenic key marker, runx2 gene expression in relation to different implant surface treatments. using these samples, it is intended to study the different effects of not only surface roughness but also topography on osteoblast gene expression. te-85 cells were maintained as sub - confluent monolayers in rpma 1640 (gibsco brl, grand island, ny, usa) supplemented with 10% (v / v) fetal bovine serum (fbs) at 37. commercially pure titanium (cpti) discs with dimensions of 23 mm diameter 1 mm height were used. the 72 discs ' surfaces were prepared and original machined surfaces were used. among the discs, 24 discs ' surfaces were sandblasted with 75 m al2o3, while 24 other discs ' surfaces were anodized under constant voltage, 350 v. table i shows the result of the optical interferometer (acura 2000, intek plus, daejon, korea) analysis. sandblasted surface showed rougher surface than anodized one, and anodized surface had rougher surface than machined surface. and 8 titanium discs were placed on a 100 dish, and te-85 cells were cultured (1 10 cells / ml) on to titanium surfaces with 2 ml 10% fbs growth medium for 1, 3 and 5 days. growth media and extra cells (not attached to discs) were suctioned and cells attached to the discs, then washed with pbs solution. total cellular rna was extracted using the rneasy protect kit (qiagen, hilden, germany), dnase 1-treated then quantified by measuring absorbance at 260 nm on a uv160u spectrophotometer (rb-10. an initial rt mixture was treated [2 g total rna, 1 mm dntps, 50 pmol poly (dt)-15, 30 mm kcl, 8 mm mgcl2, and 1 mm dithiothreitol, in 25 mm tris - hcl ] and incubated at 65 for 5 minutes, then quenched on ice. 10l of diluted cdna was transferred into a 10 l pcr reaction mixture that contained 5 pmol/l of sense and antisense oligonucleotide primers, 1pcr buffer (10 mm tris - hcl, 50 mm kcl, 1.5 mm mgcl2), 0.1 mm dntps, and 0.5 u taqdna polymerase. the forward primer (5-tctggccttccactctcagt-3) and reverse primer (5-tatggagtgctgctggtctg-3) of runx2 were synthesized based on the runx2 mrna sequence. amplification reactions for the runx-2 cdna and the house keeping gene glyceraldehydes phosphate dehydrogenase (gapdh) were carried out. amplifications were performed using an authorized thermal cycler (eppendorf, mastercycler gradient, hamburg, germany), with the temperature cycling being set as follows : 94 for 60 s, 58 for 30 s, 72 for 60 s : 5 cycles, 94 for 30 s 56 for 30 s, 72 for 60 s : 5 cycles, 94 for 30 s, 54 for 30 s, 72 for 60 s : 25 cycles, followed by a final extension at 72 for 10 minutes. visualized pcr product bands were sliced from the gel and fluorescence within the gel was detected using a lumi - imager f1 workstation (roche molecular biochemicals, indianapolis, in, usa). the relative intensity of each band was determined and plotted as the relative abundance of cbfa1/gapdh amplification product abundance. te-85 cells were maintained as sub - confluent monolayers in rpma 1640 (gibsco brl, grand island, ny, usa) supplemented with 10% (v / v) fetal bovine serum (fbs) at 37. commercially pure titanium (cpti) discs with dimensions of 23 mm diameter 1 mm height were used. the 72 discs ' surfaces were prepared and original machined surfaces were used. among the discs, 24 discs ' surfaces were sandblasted with 75 m al2o3, while 24 other discs ' surfaces were anodized under constant voltage, 350 v. table i shows the result of the optical interferometer (acura 2000, intek plus, daejon, korea) analysis. sandblasted surface showed rougher surface than anodized one, and anodized surface had rougher surface than machined surface. and 8 titanium discs were placed on a 100 dish, and te-85 cells were cultured (1 10 cells / ml) on to titanium surfaces with 2 ml 10% fbs growth medium for 1, 3 and 5 days. growth media and extra cells (not attached to discs) were suctioned and cells attached to the discs, then washed with pbs solution. total cellular rna was extracted using the rneasy protect kit (qiagen, hilden, germany), dnase 1-treated then quantified by measuring absorbance at 260 nm on a uv160u spectrophotometer (rb-10. an initial rt mixture was treated [2 g total rna, 1 mm dntps, 50 pmol poly (dt)-15, 30 mm kcl, 8 mm mgcl2, and 1 mm dithiothreitol, in 25 mm tris - hcl ] and incubated at 65 for 5 minutes, then quenched on ice. 10l of diluted cdna was transferred into a 10 l pcr reaction mixture that contained 5 pmol/l of sense and antisense oligonucleotide primers, 1pcr buffer (10 mm tris - hcl, 50 mm kcl, 1.5 mm mgcl2), 0.1 mm dntps, and 0.5 u taqdna polymerase. the forward primer (5-tctggccttccactctcagt-3) and reverse primer (5-tatggagtgctgctggtctg-3) of runx2 were synthesized based on the runx2 mrna sequence. amplification reactions for the runx-2 cdna and the house keeping gene glyceraldehydes phosphate dehydrogenase (gapdh) were carried out. amplifications were performed using an authorized thermal cycler (eppendorf, mastercycler gradient, hamburg, germany), with the temperature cycling being set as follows : 94 for 60 s, 58 for 30 s, 72 for 60 s : 5 cycles, 94 for 30 s 56 for 30 s, 72 for 60 s : 5 cycles, 94 for 30 s, 54 for 30 s, 72 for 60 s : 25 cycles, followed by a final extension at 72 for 10 minutes. visualized pcr product bands were sliced from the gel and fluorescence within the gel was detected using a lumi - imager f1 workstation (roche molecular biochemicals, indianapolis, in, usa). the relative intensity of each band was determined and plotted as the relative abundance of cbfa1/gapdh amplification product abundance. the expression of runx2 gene was examined using reverse transcription pcr and the electrophoresis result is shown in fig. 2. runx2 expression differences in te-85 cells over a 5-th day time course with varied implant surface treatments are shown in fig. the results demonstrate more runx2 expression in cells grown on sandblasted surface at the first day of culture, on anodic oxidized surface at 3-rd day of culture, on machined surface at 5-th day of culture. the patterns of the gene expression with different surface treatment were noted along the time table. the runx2 mrna from cells cultured on the control plate increased to 3 days and at a constant level to 5 days of culture. mrna from cells cultured on sandblasted surface discs showed highest level expression on the first day, then remained constant during the 5-th day of culture period. mrna from cells cultured on anodized surface discs increased rapidly from the first day to the third day and then slightly decreased at the fifth day of culture. osteoblast differentiation, ecm formation, and subsequent mineralization are needed for bone formation associated with osteogenesis and subsequent osseointegration. osteoblast differentiation and responses during osseointegration vary and are affected by the implant surface microtopography, associated extracellular matrix proteins, and their respective integrin receptors.25 - 29 a lot of studies in examining cell adhesion and morphology, dna synthesis, integrin and extracellualar matrix expression, and enzyme activity have been done to elucidate osteoblastic response to titanium alloys.26,30 - 32 however, many of the molecular and genotypic events taking place at the osteoblast cell level during osseointegration are still largely unknown. the purpose of our study was to address these molecular events with respect to the osteogenic key marker, and runx2 gene expression in relation to different implant surface treatments. in this study, the amounts and patterns of runx2 gene expressions were different with time according to various surface treatments. roughness increased from tissue culture plate, machined discs, anodized discs and sandblasted discs respectively. during the study period, levels of cbfa1 expression increased with increasing roughness. from this result, we could hypothesize that the rougher the implant surface, the sooner the runx2 gene expresses. the early expression of runx2 in te-85 cells on cpti discs of increased surface roughness or topographic complexity is congruent with in vivo observations regarding the extent of osteogenesis on implants of increasing surface roughness.9 the surface properties of an implant seem to influence the components of the cell cytoskeleton involved in cell spreading and locomotion. another determinant of cell shape and spreading onto a surface is the establishment of cell contacts and adhesion to the surface. cell contact and adhesion are time - dependent phenomena and many studies support early spreading of osteoblasts on rougher surfaces.7,10 aside from the direct effects of the cytoskeleton, integrin - mediated signaling pathways are known to affect gene expression, as well as increased runx2 gene expression was noted on rougher surfaces.15 another study reported that differentiation of preosteoblasts is affected by implant surface topographies.16 similarly our data indicated that early runx2 gene expression was favored by the rougher surface. the highest expression was recorded on the machined surface at the fifth day of culture. however we should consider not only the amount, but also the timing of expression and the activity of runx2. however there was a lack of correlation between runx2 mrna or protein levels and the acquisition of the osteoblastic phenotype in these cells.18 franceschi. demonstrated that runx2 overexpression in immature osteoblast - like cells resulted in the acceleration and robust up - regulation of matrix mineralization.33 in this study osteosarcoma te-85cells were used, which are committed osteoblasts that are more mature osteoblast compared to preosteoblast or bone marrow stromal cell. in this cell line, early expression and activity of runx2 during that time could be more meaningful. the amount of expression itself could be critical for accelerating and enhancing osseointegration. however, additional studies about the activity of runx2 related to surface treatments in these cells are strongly recommended. third, the effect of not only roughness but also chemical composition and the characteristics of surface microstructure on runx2 expression should be considered. previous studies supported and established the effects of anodic oxidized treatment showed improvement of osseointegration and biologic responses. the microstructure along with phase and composition of oxide layers are significantly changed by micro arc oxidation (mao). the concentrations of ca or p ions in the oxide layer are increased with the applied voltage.6 furthermore, the changes in chemical composition and roughness of the ti surface played crucial roles in the biocompatibility of the implant. li. demonstrated roughness and the amount of ca and p ions incorporated into the titanium oxide layer strongly affect the cell response.6 this study showed that different implant surface microtopographies (machined, sandblasted, anodic oxidized) may alter the expression of key osteogenic regulatory genes such as runx2. this suggests that the interaction of osteoblasts with the extracellular matrix components on different implant surface microtopographies can influence gene expression. perhaps this occurs as a result of differences in cell adhesion and shape, as a result of integrin - mediated adhesion and regulation of downstream signaling cascades as reported.26 it could also be a result of extracellular matrix spatial and temporal expression profile changes that would appear under the control of the transcription factor runx2, such as bone sialoprotein (bsp2).20 thus, different surface treatments may contribute to the regulation of osteoblast differentiation by influencing the level of gene expression of key osteogenic factors. a better understanding of these molecular processes will lead to the development of more advanced therapeutic interventions associated with dental implant therapy and tissue - engineering biological applications. in future, we could use not only mechanical or chemical treatment to improve osseointegration, but also gene therapy - based strategies for bone regeneration may be achieved using the approach of over - expressing combinations of factors for improving the extent and type of bone formed in regenerating sites. human osteosarcoma te-85 cells were cultured on machined, sandblasted and anodic oxidized cpti discs. after the first, the third, and the fifth days cells were harvested and reverse transcription pcr was used for comparative analysis of runx2 gene expression to study the effect of various surface treatments of titanium surface on the expression of runx2 in vitro. more expression of runx2 in cells grown on sandblasted surface at the one - day culture were observed ; on anodic oxidized surface at the three - days culture, and on machined surface at five - days culture was noted. the lowest expression level was noted, and the level increased slightly by 3 days, and was maintained to 5 days. the expression level was intermediate at the first day, however increased constitutively to the fifth day. the expression level was highest in the 1 day sample and the level was maintained to 5 days. the expression level increased rapidly to 3 days, but decreased slightly in the 5 day sample. we can conclude that different surface treatments may contribute to the regulation of osteoblast differentiation by influencing the level of gene expression. however, it is considered that future studies with more controlled conditions and experimental samples are necessary to understand the mechanism of cellular responses to different implant surface treatments.
|
statement of problemthe aim of this study was to study the effects of various surface treatments to a titanium surface on the expression of runx2 in vitro.material and methodshuman osteosarcoma te-85 cells were cultured on machined, sandblasted, or anodic oxidized cpti discs. at various times of incubation, the cells were collected and then processed for the analysis of mrna expression of runx2 using reverse transcription-pcr.resultsthe expression pattern of runx2 mrna was differed according to the types of surface treatment. when the cells were cultured on the untreated control culture plates, the gene expression of runx2 was not increased during the experiments. in the case of that the cells were cultured on the machined cpti discs, the expression level was intermediate at the first day, but increased constitutively to day 5. in cells on sandblasted cpti discs, the expression level was highest in the first day sample and the level was maintained to 5 days. in cells on anodized cpti discs, the expression level increased rapidly to 3 days, but decreased slightly in the 5-th day sample.conclusiondifferent surface treatments may contribute to the regulation of osteoblast function by influencing the level of gene expression of key osteogenic factors.
|
long - term metabolic disorders in the course of type 1 diabetes mellitus cause irreversible damage to many organs [1, 2 ]. the leading cause of diabetic complications is chronic hyperglycaemia, which induces a series of mechanisms that generate excessive production of reactive oxygen species (ros). diabetes is also associated with the reduction in the total antioxidant capacity, which results from disruption of endogenous antioxidant enzyme activities as well as increased formation of ros. the oxidative stress is defined as a situation where the steady - state of ros is transiently or chronically the target of ros damage includes all groups of biomolecules which in the case of weakening of antioxidant systems may result in permanent changes in the redox state of dna, rna, proteins, lipids, and carbohydrates and leads to the loss of the biological function of the cells. it has been shown that the oxidation of amino acid residues results in a change of their native structure and biological activity of cellular proteins. it has also been demonstrated that lipid peroxidation inhibits activity of enzymes, transporters, and receptors present in cell membranes. the impact of ros on dna leads to damage of single nucleotide bases modifications, dna double - strand breaks (dsbs), and formation of dna adducts. the most widely used and applied approaches are generation of isoprostanes (8-isop), oxidized and/or mda - modified ldl - cholesterol (oxy - ldl / mda), and reactive aldehydes, such as malondialdehyde (mda) and 4-hydroxynonenal protein adduct (4-hne protein adduct), for protein - formation of protein carbonyls (pc) for dna 8-hydroxy - d - guanosine (8-ohdg). the concentration of reactive aldehydes such as malondialdehyde (mda) is determined via their direct reaction with thiobarbituric acid (tba). the pretreatment of biological samples for avoiding the possible interferences derived other reactive aldehydes which could be performed according to the recent sample preparation method. it was shown that long - lasting streptozotocin - induced diabetes increased the mda level only in the submandibular glands of rats in comparison to the control.. showed an increase in the mda content in parotid glands of rats 30 days after stz injection. zalewska. claimed that changes in mda depend on the duration of streptozotocin - induced diabetes and the type of the salivary glands of rats. the aforementioned oxidation biomarkers are among the most commonly used biomarkers, albeit not the only ones for the quantification of oxidative stress. moreover, in certain cases, the levels of ros modified molecules may also be decreased or unchanged as compared to the control due to their elimination by specific biological systems, which may falsely suggest a normal redox homeostasis. the oxidative stress index (osi) the osi helps to assess the relationship between total oxidants (tos) and total antioxidants (tas) and may be regarded as a validated standard when assessing the oxidative stress. the aim of our study was to assess the level and progression of oxidative damage measured by pc, 8-isop, 4-hne protein adduct, oxy - ldl / mda, 8-ohdg, and osi in the salivary glands of rats in two time periods of streptozotocin - induced diabetes. the association between various oxidative stress markers such as pc, 8-isop, 4-hne protein adduct, oxy - ldl / mda, 8-ohdg, and osi and the secretory function of the salivary glands in the course of diabetes has not been studied so far. we aim to increase the understanding of the connection between oxidative stress and the dysfunction of salivary glands in two time periods of streptozotocin - induced diabetes. experiments were carried out in accordance with the european communities council directive of 24 november 1986 (86/609/eec) and in accordance with local laws and regulations. the protocol of the present study was approved by the local committee on the ethical use of animals of the medical university in bialystok, poland (resolution number 96/2015 ; date of approval 09.06.2015). the experiment was carried out on male wistar rats, caged separately, kept in standard animal holding conditions (at 21 - 22c, in a cycle 12 h light/12 h dark, at constant humidity). rats had unrestricted access to water and food (agropol motycz, poland ; consisting of 10.3% fat, 24.2% protein, and 65.5% carbohydrate). one week after arrival, the 8-week - old rats were divided randomly into control (c, n = 16) and diabetic (dm, n = 16), followed by a subdivision into two subgroups (8 rats in each subgroup) based on the number of days counted from the date of induction of diabetes in the dm group to the date of the end of the experiment (7 and 14 days). after overnight fasting, rats assigned to the dm groups were injected with a single, intraperitoneal dose of streptozotocin (freshly prepared in ice - cold citrate buffer) (stz, sigma chemical co., st. louis, mo, usa ; 50 mg / kg of body weight, sufficient diabetogenic effect, 100% the survival of rats) by the same experienced person [2, 12 ]. we chose the intraperitoneal method for simplicity of handling ; moreover it was shown that intravenous injection of stz caused mortality around 25% of the rats within the 1st week. 48 hours after the stz injection, the development of diabetes was confirmed by tail blood glucose analysis. blood glucose levels, not urine glucose, were determined due to simplicity of handling. all 16 rats in both dm subgroups reached blood glucose level > 250 mg / dl, so they were considered diabetic. seven and fourteen days after the stz injection diabetic and control rats were anaesthetized by intraperitoneal injection with pentobarbital (80 mg / kg body weight), always in the morning (8.0011.00). the rats were placed on a heated couch (37c) at an angle 30. under anaesthesia, nonstimulated saliva secretion rate was measured for 15 min, using preweighted cotton balls inserted into the oral cavity. afterwards, salivation was stimulated with an intraperitoneal injection of pilocarpine nitrate (5 mg / kg bw, sigma chemical co., st. stimulated saliva secretion was measured in a way analogous to the unstimulated secretion, 5 minutes after the injection of pilocarpine, for 5 minutes. the salivary flow rate was calculated by subtracting the initial weight from the final weight of the cotton balls. next, still under anaesthesia, tail blood glucose analysis was performed (accu - check, roche) followed by blood sampled from the abdominal aorta and the parotid and submandibular glands excised for further analysis. the salivary glands were weighted and immediately freeze - clamped with aluminium tongs, precooled in liquid nitrogen, and stored at 80c. blood was collected into glass tubes containing heparin and centrifuged (5 min, 4c, 3000 g, mpw 351, mpw med. the salivary glands and plasma were defrosted (4c), washed with cold pbs, and reweighed. the salivary glands were cut into small pieces, following 10x dilution in ice - cold pbs (portion of the salivary gland intended for the determination of carbonyl groups were 10x diluted in 50 mm phosphate buffer), and homogenized with the addition of the protease inhibitor (1 tablet/10 ml of the buffer) (complete mini roche, france) on ice with a glass homogenizer (omni th, omni international, kennesaw, ga, usa). next, homogenates were sonificated with an ultrasonic cell disrupter (1800 j per sample, 20 s 3, on ice) (up400s, hielscher, teltow, germany). the homogenates were spun (10 min, 4c, 5000 g, mpw 351, mpw med. the plasma insulin and free fatty acids (ffa), plasma and salivary glands pc, 4-hne protein adduct, oxy - ldl / mda, 8-isop, and 8-ohdg, total protein, tas, tos, and osi were determined. data were shown as the total amount (ratio of the examined parameter to total protein). normalization to total proteins made it possible to assess differences in the ratio of biochemical analytes present in the biological fluids and tissue homogenates. the insulin, 4-hne protein adduct, oxy - ldl / mda, 8-isop, and 8-ohdg were determined by elisa using commercially available kits (shibayagi co., gunma, japan ; cell biolabs, inc. san diego, ca, usa ; immundiagnostik, bensheim, germany ; cayman chemicals, ann arbor, mi, usa ; and uscn life science, wuhan, china, resp.) following the attached instructions. the supernatants, plasma, controls, and standards were incubated in microplate wells coated with monoclonal antibody to insulin, 4-hne protein adduct, oxy - ldl / mda, 8-isop, and 8-ohdg. next, avidin conjugated to horseradish peroxidase (hrp) was added and incubated, followed by incubations with the tmb substrate. only plasma or supernatants that contained complex insulin, 4-hne protein adduct, oxy - ldl / mda, 8-isop or 8-ohdg, biotin - conjugated antibody, and enzyme - conjugated avidin changed their colour. the reaction was terminated by the addition of sulphuric acid and the colour change was determined spectrophotometrically (microplate reader, mindray mr-96, china). the supernatant and plasma were incubated with 10 mm dnph (2,4-dinitrophenylhydrazine ; poch s.a. (polskie odczynniki chemiczne spka akcyjna, gliwice, poland)) in 2.5 m hcl. the pc was calculated from the peak (355390 nm) absorbance using the molar absorption coefficient = 22,000 mcm. the tas was assessed with a kit supplied by randox (crumlin, uk). abts (2,2azino - di-[3-ethylbenzthiazoline sulphonate ]) was incubated with peroxidase (metmyoglobin) and hydrogen peroxide to yield the cation abts. abts had a blue - green colour, which was assessed spectrophotometrically at the wavelength 600 nm (microplate reader, mindray mr-96, china). the tos determination was performed by commercial kit (perox, tos / toc) supplied by immune diagnostic (bensheim, germany). in this assay, peroxidase reacts with peroxides in the sample followed by the conversion of tmb to a coloured product. absorbance of the sample was measured at 450 nm in a microtiter plate reader (microplate reader, mindray mr-96, china). the protein concentration was assessed by the bicinchoninic acid method (bca), with bovine serum albumin as a standard (thermo scientific pierce bca protein assay kit, rockford, il, usa). statistical analysis was performed using statistica version 10.0 (statsoft, cracow, poland). to show the significant differences between groups, streptozotocin - induced diabetes caused reduction in the body weight in the dm groups as compared to the control groups in the first (12%, p = 0.03) and second (19.5%, p = 0.042) week of the experiment. in the control group, the body weight of rats was significantly increased between the first and the second week of the study (7%, p = 0.026), whereas the diabetic rats weight remained the same during the study (table 1). furthermore, in both periods of streptozotocin - induced diabetes a dramatic reduction in fasting plasma insulin concentration was observed (below the lower limit of detection), followed by 2.5 (p = 0.001) and 5.6 times (p = 0.0001), respectively, elevation in glucose concentration in dm groups as compared to the control rats. in the control group the glucose concentration remained the same during the study, whereas the diabetic rats showed significantly increased blood glucose concentrations between the first and the second week of the study (131%, p = 0.003) (table 1). the plasma ffa concentration increased by 60%, p = 0.001 (1st week), and 78%, p = 0.001 (2nd week), in dm in comparison to the control group. in the control and dm groups, the plasma ph was similar in all groups during the experiment (table 1). the weight salivary glands were similar in both dm and control groups in the first and the second week of the experiment. in the control and the dm groups, the median of the unstimulated flow rate was significantly 15% (p = 0.034) reduced in the dm rats as compared to the control rats only in the second week of the study. the median of the stimulated flow rate was significantly reduced in the dm rats as compared to the control rats throughout the duration of streptozotocin - induced diabetes (28%, p = 0.03, and 39%, p = 0.011, resp.) one- and two - week lasting streptozotocin - induced diabetes resulted in a significantly higher median of the total amount of tos (p = 0.0001 and p = 0.0002, resp.), osi (p = 0.003 and p = 0.001, resp.), pc (p = 0.046 and p = 0.049, resp.), 4-hne protein adduct (p = 0.00001 and p = 0.00001, resp.), oxy - ldl / mda (p = 0.009 and p = 0.0006, resp.), and 8-isop (p = 0.01 and p = 0.007, resp.) in plasma of the dm rats as compared to the control rats. the median of the total amount of plasma tas of dm rats was significantly lower (p = 0.003) as compared to the median of the total amount of plasma tas of the control rats, whereas the median of the total amount of 8-ohdg (p = 0.009) in plasma of dm rats was significantly elevated in the second week of the study as compared to the control rats (table 3). the medians of the total amount of tas (17%, p = 0.002, and 48%, p = 0.0001, resp.) were significantly reduced, whereas the medians of the total tos (43%, p = 0.006, and 60%, p = 0.0001, resp.), osi (72%, p = 0.0001, and 207%, p = 0.00001, resp.), pc (20%, p = 0.03, and 25%, p = 0.01, resp.) (figure 1(a)), and 4-hne protein adduct (43%, p = 0.001, and 92%, p = 0.0001, resp.) (figure 1(b)) were significantly elevated in the parotid glands of the dm rats as compared to the control rats at each step of the experiment. the medians of the total oxy - ldl / mda (24%, p = 0.03), 8-isop (40%, p = 0.004), and 8-ohdg (30%, p = 0.001) were significantly higher in the parotid glands of the dm rats as compared to the control rats only in the second week of the streptozotocin - induced diabetes (figure 1(b)). the medians of tas were significantly higher (11%, p = 0.04) in diabetic submandibular glands as compared to the healthy control after one week of streptozotocin - induced diabetes, whereas the medians of the total amount of tos (43%, p = 0.03, and 50%, p = 0.02, resp.) and osi (28%, p = 0.03, and 61%, p = 0.002, resp.) were significantly upregulated in the submandibular glands of dm rats as compared to the control rats throughout the duration of streptozotocin - induced diabetes (figure 2(a)). the median of the total tas was significantly reduced (7%, p = 0.04) (figure 2(a)), whereas the medians of the total amount of oxy - ldl / mda (14%, p = 0.02) and 4-hne protein adduct (25%, p = 0.002) were significantly elevated in the submandibular glands of the dm rats as compared to the control rats only in the second week of the streptozotocin - induced diabetes (figure 2(b)). parotid glands of the diabetic rats showed significantly higher medians of the total amount of tas (10%, p = 0.039), tos (185%, p = 0.0002), osi (161%, p = 0.0001), pc (10%, p = 0.02), 4-hne protein adduct (15%, p = 0.032), oxy - ldl / mda (15%, p = 0.03), and 8-isop (21%, p = 0.04) in the first week of the streptozotocin - induced diabetes as compared to the submandibular glands of dm rats. however, in the second week of the study parotid glands of dm rats showed no significant differences only for tas ; all other parameters, tos (123%, p = 0.002), osi (181%, p = 0.0001), pc (11%, p = 0.04), 4-hne protein adduct (44%, p = 0.001), oxy - ldl / mda (14%, p = 0.03), 8-isop (21%, p = 0.039) and 8-ohdg (78%, p = 0.001), were significantly higher as compared to the submandibular gland of diabetic rats (table 2). parotid glands of the control rats showed higher medians of total amounts of tas (46%, p = 0.001 ; 42%, p = 0.001, resp.) and tos (185%, p = 0.0001 ; 110%, p = 0.001) as compared to the submandibular glands of the control rats, both the first and the second week of the experiment (table 2). correlation was observed between the total amount of tas and 4-hne protein adduct and 8-isop (p = 0.035, r = 0.45 ; p = 0.043, r = 0.37, resp.) correlation was observed between glucose concentrations and the total amount of 4-hne protein adduct and oxy - ldl / mda (p = 0.033, r = 0.37 ; p = 0.011, r = 0.57, resp.) parotid glands. correlation between the total amount of 4-hne protein adduct and sws (p = 0.017, r = 0.61) and correlation between glucose concentrations and a total amount of 4-hne protein adduct, oxy - ldl / mda, pc, and 8-isop (p = 0.023, r = 0.57 ; p = 0.009, r = 0.71 ; p = 0.034, r = 0.54 ; p = 0.01, r = 0.64, resp.) were observed. in this paper, we assessed the level and progression of the oxidative damage to the diabetic salivary glands using various biomarkers of oxidative stress and oxidative injury. we investigated the relationship between oxidative stress and secretory function of the salivary glands in the course of streptozotocin - induced diabetes. the present model of type 1 diabetes was based on streptozotocin- (stz-) induced diabetes. the dose of stz is a determining factor for the extent of its diabetogenic action. experimental diabetes type 1 is induced in animals using stz in doses from 45 to 100 mg / dl : doses of stz < 40 mg / dl may not induce diabetes and doses higher than 80 mg / dl may lead to excess rats mortality. based on the literature [22, 23 ] and our own experience, we chose a dose of 50 mg / dl, because this amount determines sufficient diabetogenic effect at 100% survival of rats over two time periods. stz model uses the fact that stz is selectively toxic to beta () cells of the pancreas and is recommended as a clinically relevant animal model and it is most commonly used to explore human diabetes type 1. in line with our expectations, we received severe hyperglycaemia with simultaneous reduction of fasting plasma insulin levels (below the limit of detection) as early as 1 week after stz injection. the obtained results demonstrated the destruction of pancreatic cells and, consequently, endocrine failure of this organ. we also experienced progression of the impaired endocrine function of pancreatic cells ; between the first and the second week of the study, diabetic rats showed significantly increased blood glucose concentrations. furthermore, despite the fact that diabetic rats consumed similar amounts of food as the control rats, their body weight was significantly lower as compared to the control group. under physiological conditions, there is a balance between the generation and elimination of ros in living organisms, and therefore oxidative damage can not be observed. however, when this redox balance is disrupted, an elevated production of ros is observed, followed by an increase in ros modified molecules, which are widely used biomarkers of oxidative damage. it is considered that the assessment of oxidative injury using only single oxidative modification marker is not sufficient in organisms due to the different sensitivity, dynamics, nature, and results of ros - involving process. several products derived from biomolecule oxidation were detected in various diabetic organs and plasma [2630 ] ; however, the only examined marker of oxidative stress in diabetic salivary glands is mda. lushchack claims that the reaction of mda with thiobarbituric acid is not specific and many compounds (amino acids, carbohydrates, and aldehydes) may react with tba and may interfere with the assay, so these methods as well as interpretation of the obtained results should be evaluated with caution. recently proposed that the pretreatment of biological samples for avoiding the possible interferences derived other reactive aldehydes which could be eliminated according to their recent sample preparation method. in the present experiment, we decided to evaluate the recommended and most commonly used oxidative injury biomarkers : pc, 8-isop, oxy - ldl / mda, 4-hne protein adduct, and 8-ohdg as well as osi which is an objective assessment of the relationship between total antioxidant mechanisms and the oxidants level. oxidative damage in the form of a significant increase in 4-hne protein adduct and pc in the first week after the stz administration was noted only in the salivary parotid glands. however, a significant increase in the total amount of osi in the diabetic submandibular glands as compared to the control demonstrates the redox imbalance also in this gland. the submandibular glands, in contrast to the diabetic parotid glands, seem to prevent their destruction in the process of os through antioxidant defence system activation (tas). the negative correlation between the total amounts of tas, 4-hne protein adduct, and 8-isop shows that the increase in the antioxidant capacity elevates cell resistance to oxidative damage and it is sufficient to maintain ros modified biomolecules within the basal state. it is difficult to explain these differences based solely on the results of the present experiment. increased tas levels in the submandibular glands may suggest, on the one side, the adaptive response to the excess production of ros in this gland ; however, on the other hand, it may be an attempt to compensate dysfunctional parotid glands in terms of antioxidant features. these changes may also suggest that, at least in the early stages of type 1 diabetes, the oral cavity will be sufficiently protected against free radicals, even if parotid glands, the physiological source of oral antioxidants, are deficient. hyperglycaemia promotes the generation of free radicals by modulation of the mitochondrial respiratory chain, nonenzymatic glucose autoxidation, and protein glycation and a reduction in the antioxidant capacity [33, 34 ]. the present results showed that oxidative injury in both glands is directly influenced by hyperglycaemia only in the second week of the experiment, which was observed by a positive correlation between plasma glucose levels and a total amount of 4-hne protein adduct and oxy - ldl / mda, for both glands, and 8-isop and pc for the parotid gland. it is not surprising that the progression of endocrine insufficiency of the pancreas was accompanied by an extensive oxidation of major cellular components in both salivary glands, in addition to a significant reduction in tas. however, in the diabetic parotid gland, in addition to the 4-hne protein adduct and pc and also oxy - ldl / mda, 8-isop and 8-ohdg were significantly higher as compared to the control glands. selectively, from all evaluated oxidation products, a significant increase in the lipid peroxidation products such as 4-hne protein adduct and oxy - ldl / mda in the diabetic submandibular glands versus control could be a proof that these diabetic glands undergo an early stage of oxidative damage. lipid peroxidation is thought to be the earliest marker of oxidative damage occurring via os, which results from the fact that cell membrane is first exposed to free radicals before the other cellular components undergo oxidative modification. it should be noted that in the present study we investigated only selected damage products. determination of the other markers of oxidative damage (e.g., advanced oxidation protein product, disulphide groups, and others) may partially contradict this conclusion. obviously, we can not exclude that hyperglycaemia, increased endothelial permeability, allows passage of oxidation products from vessels to salivary glands nor that evaluated oxidation products arise directly or only in the salivary glands, especially when we observed an increase in overall plasma oxidative modification and also cellular redox imbalance already in the first week after the stz administration. however, the lack of any correlation between plasma and salivary oxidative stress parameters suggests that observed results may be caused by processes taking place in the salivary glands, independently from plasma / general oxidative stress. interestingly, regardless of the oxidative stress and oxidative damage intensity, we observed that the capacity of the parotid glands in the response to external stimuli (sws) is depressed throughout the whole experiment. basal activity (uws) of the submandibular glands versus control is depressed only in the second week of the experiment ; in the first week of the study, despite the shifting of the antioxidants / oxidants balance towards the oxidative status (osi), the mechanisms of saliva secretion in the diabetic submandibular glands are unaffected, which is reflected as no significant differences in the uws as compared to healthy control. it should be noted that, in the absence of stimulation, the submandibular gland provides about 60% of total salivary secretion and it is the main source of unstimulated saliva. after saliva stimulation, only the parotid glands increase their secretion by about 1015%, and thus parotid glands may be considered to be the main source of stimulated saliva. the observed negative correlation between 4-hne protein adduct and a stimulated salivary flow in the second week seems interesting due to the fact that the 4-hne protein adduct is able to enhance the expression of proinflammatory cytokines and metalloproteinase production in the course of mitochondrial ros - mediated stimulation of akt / nf - kappab signalling pathways. it has been shown that inflammatory mediators and matrix metalloproteinase may decrease the response of residual acinar cells to acetylcholine and/or block their receptors leading to a reduction in saliva production and secretion. our results showed greater extent and diversity of oxidative injury in the parotid diabetic glands than in the submandibular diabetic glands, which we also observed in morbid obesity. perhaps the observed differences may result from differing intensity of morphological changes in both diabetic salivary glands [11, 40, 41 ]. histological analysis of dietary salivary glands revealed, amongst other things, a massive accumulation of adipocytes in the parenchyma of vesicular and mucosal cells, which can be seen particularly in parotid glands and slightly marked in submandibular glands. by releasing monocyte chemoattractant protein-1 (mcp-1) macrophages release cytokines (tnf, il6, and il1) and promote the development of inflammation which leads to the stimulation of respiratory processes in the phagocytic cells, activation of nadph oxidase, and formation of large amounts of ros. perhaps, these additional sources of free radicals exceed the antioxidant / repair capabilities of the parotid glands and their oxidative damage is also observed throughout the whole experiment. analyzing the results of our experiment, attention should be paid to its limitations. the present research has been conducted on an animal experimental model ; although such model provides invaluable assistance, it is not entitled to its direct impact on humans. the dose of stz, duration of stz diabetes, and determination of the other markers of oxidative damage could partially contradict our results. both parotid and submandibular glands undergo oxidative stress in the course of streptozotocin diabetes, irrespective of the duration of the disease.the parotid glands seem more exposed and vulnerable than submandibular glands to an oxidant attack generated in the course of streptozotocin diabetes, regardless of the duration of the disease.oxidative damage in the course of streptozotocin diabetes caused the dysfunction of the salivary glands, wherein only the reduction of the stimulated saliva secretion is observed in the first week of the experiment. in the advanced stages of the disease, simulated saliva secretion is significantly more reduced than the secretion of nonstimulated saliva.oxidative damage to the salivary glands in the course of stz diabetes seems to be caused by processes taking place in the salivary glands, independently from plasma / general oxidative stress. both parotid and submandibular glands undergo oxidative stress in the course of streptozotocin diabetes, irrespective of the duration of the disease. the parotid glands seem more exposed and vulnerable than submandibular glands to an oxidant attack generated in the course of streptozotocin diabetes, regardless of the duration of the disease. oxidative damage in the course of streptozotocin diabetes caused the dysfunction of the salivary glands, wherein only the reduction of the stimulated saliva secretion is observed in the first week of the experiment. in the advanced stages of the disease, oxidative damage to the salivary glands in the course of stz diabetes seems to be caused by processes taking place in the salivary glands, independently from plasma / general oxidative stress.
|
objective. this study evaluated oxidative damage caused to the salivary glands in streptozotocin - induced diabetes (dm). materials and methods. rats were divided into 4 groups : groups 1 and 2, control rats, and groups 3 and 4, dm rats. 8-hydroxy-2-deoxyguanosine (8-ohdg), protein carbonyl (pc), 4-hydroxynonenal protein adduct (4-hne), oxidized and/or mda - modified ldl - cholesterol (oxy - ldl / mda), 8-isoprostanes (8-isop), and oxidative stress index (osi) were measured at 7 (groups 1 and 3) and 14 (groups 2 and 4) days of experiment. results. the unstimulated salivary flow in dm rats was reduced in the 2nd week, while the stimulated flow was decreased throughout the duration of the experiment versus control. osi was elevated in both diabetic glands in the 1st and 2nd week, whereas 8-isop and 8-ohdg were higher only in the parotid gland in the second week. pc and 4-hne were increased in the 1st and 2nd week, whereas oxy - ldl / mda was increased in the 2nd week in the diabetic parotid glands. conclusions. diabetes induces oxidative damage of the salivary glands, which seems to be caused by processes taking place in the salivary glands, independently of general oxidative stress. the parotid glands are more vulnerable to oxidative damage in these conditions.
|
thoracic systemic venous anomalies when presenting without associated congenital heart disease are usually asymptomatic and found out incidentally while being planned for vascular interventions or other surgeries. persistent left superior vena cava with absent right superior vena cava is very rare and poses difficulty in positioning of the lead while being planned for permanent pacemaker implantation (ppi). we report another case of sick sinus syndrome who was incidentally found to have interrupted inferior vena cava with azygos continuation while being planned for temporary pacemaker implantation. we would like to stress the importance of having a high suspicion of the existence of these venous anomalies especially in young patients with sick syndrome. a 30-year - old male presented with breathlessness on exertion. clinical examination was unremarkable except for bradycardia. echocardiography (echo) showed prominent coronary sinus (cs) with persistent left superior vena cava (svc) [figure 1 ]. he underwent a venogram that showed persistent left svc draining into the cs [figure 2 ]. right brachiocephalic vein was draining into the left svc and in turn into the cs with right svc being absent [figure 2 ]. echocardiogram in parasternal long axis view (a) showing a prominent coronary sinus and the suprasternal view (b) with color doppler showing persistent left superior vena cava venogram via left subclavian venous access showed persistent left superior vena cava (svc) (rightward facing arrow) and absent right svc (upward facing arrow) left infraclavicular fossa was dissected and extrathoracic left subclavian venous access was taken. when the wire was passed, it entered through the left svc and cs toward the left side of the spine and in turn into the right atrium (ra), 58 cm passive fixation lead was chosen initially. a sharp curve in the terminal end of the stylet was made to facilitate the entry into right ventricle (rv). since the positioning of the passive fixation lead in the rv apex was difficult active fixation lead was chosen. with a similar curve in the stylet, the lead was pushed into the rv with a large loop in the ra abutting the free wall for better support [figure 3 ]. another 58 cm active fixation lead was positioned into the ra appendage with acceptable parameters [figure 3 ]. (a) right ventricle (rv) active fixation lead with a large loop in the right atrium positioned at rv apex (downward facing arrow) and right atrium (ra) active fixation lead positioned at ra appendage (rightward facing arrow) (b) left anterior oblique projection showing the leads in the coronary sinus (rightward facing arrow) posterior to the spine. (c) rv oblique projection showing the lead in rv apex (downward facing arrow) and ra appendage (upward facing arrow) we report another case who is a 30-year - old lady presented with symptomatic bradycardia. right femoral venous access was taken and attempts to cross the tricuspid valve from the ra failed. a venogram through the right femoral venous access showed an interrupted inferior vena cava (ivc) with azygos continuation that in turn drains into svc [figure 4 ]. patient finally underwent ppi in the left infraclavicular fossa with a screw in lead positioned in rv outflow tract with acceptable parameters [figure 4 ]. (a) venogram through right femoral venous access shows interrupted inferior vena cava with azygos continuation draining into superior vena cava (bold arrow) (b) permanent pacemaker implanted with a right ventricle lead positioned at outflow tract a persistent left svc is identified in 0.5% of the general population and 4% of patients with congenital heart disease (chd). persistent left svc with an absent right svc is very uncommon and occurs in 0.07 to 0.13% of patients who have chd. persistent left svc and absent right svc can make central venous access, in particular pacemaker lead insertion and cardiac resynchronization therapy very challenging due to unfamiliar venous course. preprocedure identification of these abnormalities with echo may help us to avoid on table surprises. changing the shape of the stylet once the lead reaches ra through cs is an option that may help us to negotiate the lead across the tricuspid valve. abutting the lead on the free wall of ra gives better support so that the lead can be pushed across the tricuspid valve. in our case there are reports of using long 40 cm worley sheath for better support for rv lead placement. surgical epicardial lead placement is an option where the endocardial rv lead positioning gets extremely difficult because of unfavorable venous anatomy. regarding the atrial lead placement, active fixation lead in the right atrial anterior free wall is preferred. but passive fixation lead can be positioned into the atrial appendage. in our case we used a 58 cm active fixation lead into the atrial appendage with acceptable parameters. an interrupted ivc is a rare anomaly with an incidence of 0.62% in patients with congenital heart disease and 0.3% with structurally normal heart. they may be associated with sick sinus syndrome (as in our case) or complete heart block. in individuals with ivc anomalies, there can be procedural difficulties during right heart catheterization, electrophysiological studies, and temporary pacing (as in our case) through transfemoral approach. preoperative imaging with echo may help in identifying cases of challenging venous anatomy allowing appropriate operative planning and avoid undue delay of an otherwise urgently needed procedure like temporary pacemaker implantation. subcostal echo may show aorta and inferior vena lie anterior to or on the same side of the spinal column and hepatic veins directly drains into the atria. but in most of the situations the interrupted ivc is suspected only during the procedure as in our case. there are case reports of positioning the temporary pacemaker lead via ivc, azygos vein, svc, ra and in turn into the rv. ivc drainage anomaly does not pose any difficulty during the placement of lead in ppi unless there is any associated anomalous svc drainage. anomalies of systemic venous drainage need to be kept in mind in young patients presenting with sick sinus syndrome. preprocedural echo may give us a clue regarding these abnormalities and help us to avoid on table surprises. in patients with persistent left svc and absent right svc requiring pacemaker implantation, we need to be prepared for difficult right ventricular lead positioning. in cases with interrupted ivc temporary pacemaker lead positioning through transfemoral access is difficult though it can be done.
|
we report two young patients with symptomatic sick sinus syndrome admitted for permanent pacemaker implantation (ppi). on evaluation with echocardiography, one of them was found to have persistent left superior vena cava and venography showed absent right superior vena cava also. he underwent ppi with leads inserted via left superior vena cava, coronary sinus, right atrium and right ventricle. the other patient was incidentally found to have interrupted inferior vena cava with azygos continuation while being planned for temporary pacemaker implantation. she underwent successful ppi. we would like to stress the importance of having a high suspicion for these systemic venous anomalies in patients presenting with sick sinus syndrome especially at young age. if we could diagnose preoperatively, we can avoid on table surprises.
|
to match or not to match ? is a question that often arises when a case - control study is designed. unfortunately, neither the logic of matching controls to cases nor the drawbacks of this procedure are widely understood. sometimes, researchers assume that matching prevents confounding bias by choosing controls that are identical to the cases with respect to the matched confounder(s).1 this truth - like argument is almost always false. other times, the true benefit of matching smaller variance of theoretical estimates is correctly identified, but the mechanism for such a gain is not explained. moreover, not many researchers know that matching does not guarantee a tradeoff between effort and variance. the variance is not always reduced in return for the extra effort that should be invested to find matched controls. we used causal diagrams to demystify the logic and analysis of frequency - matched and individually - matched case - control studies. a full explanation of causal diagrams in the context of bias can be found elsewhere.2 the most relevant ideas are summarized below. we write the names of variables and draw single - headed arrows between causes and their presumed effects (figure 1). since a cause always precedes its effects, a loop of self - causation does not exist. the effect of interest (ed throughout this article) is identified by a question mark above the arrow (figure 1). a natural path between two variables is any sequence of causal arrows regardless of their directionality that connects the two, and does not pass more than once through each variable. in figure 1, for example, e and d are connected by three natural paths : ed ; ecd and ecsd. a common cause of e and d is called a confounder (eg, c in figure 1). if two arrows on a path point at one variable, that variable is called a collider on the path (because the arrowheads collide there). for instance, s is a collider on the path ecsd (figure 1). by definition, a collider is a common effect of two variables (eg, c and d) the colliding variables. we distinguish among three types of natural paths between e and d : causal paths, confounding paths, and colliding paths. a causal path, as its name implies, is any path by which e affects d. for example, ed (figure 1) ; and exyd. a confounding path is any path in which e and d share a common cause (a confounder). a colliding path is any path that contains at least one pair of colliding variables and their collider, for example, ecsd (figure 1) and exyzd. the theorems of causal diagrams build a solid bridge between a causal structure and expected associations. both causal paths and confounding paths contribute to the marginal (crude) association between two variables ; they are, therefore, called open paths. in contrast, colliding paths are blocked ; they do not add anything to the association between the variables they connect. referring again to figure 1, the marginal association between e and d is the sum of the causal path, ed, and the confounding path, ecd (figure 2). if we estimate the magnitude of the effect of e on d by their marginal association, the estimator contains confounding bias the unwanted contribution of the confounding path (figure 2). to get an unbiased estimator of the effect of e on d, the confounding path must be blocked. all methods to block a confounding path (to deconfound) are based on conditioning, which means (in its basic form) restricting a variable to one of its values. since a value is not associated with any variable, conditioning dissociates a variable from both its causes and its effects. for example, after conditioning on the confounder c (figures 1 and 2), it will not be associated with e and d, so the confounding path will no longer exist. as will be seen, however, new paths and new associations might be created. conditioning on s, denoted by a box, dissociates s from its three causes (x, y, and z) and its three effects (l, m, and n), and is denoted by two lines over each arrow. but more might happen : under certain conditions,2 new associations (denoted by dashed lines) will be created between variables that collide at s (that is, between causes of s). as a result, we observe new connecting paths, some of which are composed of dashed lines alone (eg, x -- y, and x -- y -- z), whereas others are composed of dashed lines and arrows (eg, ex -- zd). since both types of paths arose after conditioning, we call them induced paths. an induced path, just like a natural path, may be blocked or open, depending on whether it contains a collider. for example, the induced path hi -- jkl is blocked not contributing to the association between h and l because the path contains the collider k. all induced paths in figure 3 are open ; they create, or contribute to, the association between the variables they connect. just like a confounding path, an open induced path between the cause - and - effect of interest (here, e and d) is a source of bias. we call that bias colliding bias,2 because the culprit is an open path through colliding variables. with these principles in mind, we first depict the causal structure of an unmatched case - control study, assuming only one confounder (figure 4, diagram a). as before since only the selected people are eventually studied, conditioning on s is built into all research designs (figure 4, diagram a). the distinguishing feature of a case - control study is the arrow ds, which shows that disease status affects selection status : your chances of being selected into the sample are higher if you have the disease than if you do not have it, at some index time. (this is also true for case - cohort sampling and incidence density sampling). here, however, conditioning on s carries no consequences for the estimated odds ratio, because no new paths are induced (so long as c does not modify e s effect on s).2 to deconfound, we condition on c (figure 4, diagram b). conditioning, as described so far, is often just the first step in the computation. rather than estimating the odds ratio for only one value of c, we may estimate the odds ratio for each value of c and compute a weighted average of all the estimates. if e and c are binary variables, the deconfounded estimator of the effect of e is computed as follows : where or denotes the odds ratio, w denotes the weight, and the subscript denotes the value (stratum) of c. the classic weights in equation (1) are the inverse of the variances of the c - specific estimates. sometimes, weighting is done on the log scale : in equation (2), the classic weights are the inverse of the variances of the log of the c - specific estimates. those weights minimize the variance of the log of the deconfounded odds ratio.3 alternatively, we may condition on c by adding the variable to an unconditional logistic regression model : whichever computation is used, deconfounding is a tradeoff between variance and bias, because the variance of the odds ratio always increases after conditioning. if the sample is restricted to only one value of c, the variance increases because the estimate is computed from a smaller sample. that is also the case for deconfounding by a weighted average or by regression.4 as far as the variance is concerned, breaking the sample and reassembling the pieces does not perfectly restore the intact sample size. of course, it is not necessary to compromise the variance. we may keep the sample intact that is, not condition on the confounder and tolerate the bias in return for a smaller variance figure 5 shows the causal structure of a matched case - control study, under the same conditions and notation : ed is the effect of interest ; c is a single confounder ; and s indicates selection status. one theoretical exception aside, a matched design is distinguished from its unmatched counterpart by the arrow cs. the value of the matched confounder also plays a role in deciding whether a person will be selected into the sample. for instance, a disease - free person will be selected for a 1:1 matched study only if a yet - to - be - matched case shares his (or her) value of c. similarly, a diseased person will not be retained in the sample if no c - matched control is found. that is also true for a frequency - matched case - control study, in which groups of disease - free people are periodically selected to match the distribution of confounders in accumulated groups of cases. adding the arrow cs turns s into a collider : csd (figure 5). following inevitable conditioning on s, an association is created between c and d, the colliding variables, and an open induced path now connects the cause - and - effect of interest (ec -- d). matching not only failed to block a confounding path, but also added colliding bias (ec -- d) on top of confounding bias (ecd). the magnitude of the net bias depends on the strength and direction of each path. before discussing the remedy, and later, the wisdom of matching, an intriguing question might be asked. having nullified the association between c and d, how can matching result in net bias ? the null association between c and d is the sum of three paths not two the third of which is ced. assuming the effect ced is not null, the arrow cd and the dashed line c -- d do not add up to a null association (figure 6). we note, in passing, that matching in a cohort study (cse) removes both types of bias, because the associational sum of ce and c -- e is null.2 one exception exists, as noted above. the paths cd and c -- d sum to a null association (no net bias), if the causal path ced is precisely null that is, no third path exists. that can happen if e is not a cause of d (figure 8, diagram a), or if c is not a cause of e (figure 8, diagram b). in those circumstances, there is no net bias upon matching, although matching is worthless in the second case (c is not a confounder in diagram b). notice that if c is a cause of e, but the arrow cd is absent, matching adds colliding bias in the absence of confounding bias (figure 8, diagram c). conditioning on the matched confounder, c, removes both colliding bias (denoted by the deletion of the dashed line) and confounding bias. whatever the motivation for matching might be, it has nothing to do with circumventing the need to deconfound : we still have to condition on a matched confounder. why invest the extra effort that goes along with finding matched controls instead of recruiting unmatched controls ? the answer comes from the domain of variance. given a fixed sample size, the variance of theoretical estimates from a matched design will often, but not always, be smaller than the variance of estimates from an unmatched design. and even when the variance is reduced by matching, it might not be reduced by much. to follow the logic of matching, we should first recall that the variance of the (log) odds ratio (marginal association) may be estimated as follows : where a, b, c, and d are the cell counts in the 2 2 table (cross - classification by e and d, two binary variables). the variance depends, in part, on the ratio (k) of the number of controls (m) to the number of cases (n). given a fixed number of cases, the larger the number of controls, the smaller the variance by equation (4), because the cell counts in controls (b, d) are also expected to be larger (b + d = m). close to the null (or = 1), the variance in a large study with n cases and m = kn controls is approximately (k + 1)/k times the variance in a theoretical study with an infinite number of controls.5 for example, with as many controls as cases (k = 1), the variance is twice as large, but with four times as many controls (k = 4), the variance is only 1.25 times larger. that is not always a good approximation, however for example, when the odds ratio is large. a case - control study is often designed under two constraints that fix the value of k. all available cases are retained (n), and the sample size (t) is limited due to cost : k = (t n)/n. in the absence of confounding, the causal path ed is estimated by the marginal odds ratio, and its variance can be reduced only by recruiting more controls (larger k). later, when k is fixed but deconfounding is needed, we will examine another option to reduce the variance matching. again, let c denote a binary confounder (c = 1 or c = 2), and let k1 and k2 denote, respectively, the control - to - case ratio in the strata c = 1 and c = 2. the variance of the deconfounded estimator, regardless of matching, is related to the variance of c - specific odds ratios (var1 and var2) as follows:6 as previously seen, var1 and var2 are functions, in part, of k1 and k2, respectively. in an unmatched design with a fixed k, we do not control the values of k1 and k2, and therefore, we can not influence the values of var1 and var2 which, in turn, determine the value of var [ln(ordeconfounded) ]. most important, k1 and k2 are expected to be different if c is a confounder. to realize the last key point, first consider the association between c (the confounder) and d (disease status) in an unmatched study. assuming no confounders, that association estimates the effect of c on d via the causal paths ced and cd (figure 4, diagram a). notice that the paths ce (which is part of ced) and cd also determine the magnitude of confounding bias for the effect of e on d.2 next, let us consider a hypothetical unmatched study of 100 cases and 400 controls (k = 4). suppose that the estimated odds ratio for the effect of c on d is 11 for the contrast between c = 1 and c = 2 (figure 10). then, the odds of being a control when c = 2 are eleven times the odds of being a control when c = 1 (figure 10). however, the last statement simply describes the ratio of k2 to k1 ! the control - to- case ratio in the stratum c = 2 (k2 = 22) is eleven times that of the ratio in the stratum c = 1 (k1 = 2). we therefore conclude : the stronger the combined effect of ced and cd, the larger the difference between k1 and k2. and often, though not always, a stronger effect of c on d is accompanied by more confounding bias. although matching does not eliminate the need to condition on the confounder, c, it does allow us to control the values of k1 and k2 by forcing the equality k1 = k2. if the distribution of c in controls is identical to the distribution of c in cases, the control - to - case ratio will be identical in the two strata of c (figure 11). of course, it will also be identical to the control - to - case ratio in the entire sample (k1 = k2 = 4). why force the equality k1 = k2 = k ? does that equality guarantee a smaller variance in a matched design than in an unmatched design of the same size and number of cases ? will the variance expression equation (5) be smaller when k1 = k2 than when k1 k2 ? unfortunately, the answer is not unequivocally positive. often, the variance will be smaller, and sometimes, substantially so. other times, however, the variance in a matched design will be similar to, or even larger than, the variance in an unmatched design.5 many predictions can be made, but no assumption - free algorithm can tell us whether matching will prove to have been the right decision. despite the intuitive merit in proportionate allocation of controls to the strata of c, the extra effort that matching requires does not guarantee a smaller variance. in retrospect, it is easy to come up with extreme examples where we can argue in favor of matching. if an unmatched design fails to include controls in one stratum of c, the entire table will be discarded, along with precious cases. if researchers insist on 1:1 matching, and they fail to find matched controls, precious cases will be discarded, too. students of epidemiology or biostatistics are taught that a matched design requires a special matched analysis, but nothing so far implies anything special about the analysis of a matched case - control study. indeed, we treat frequency - matched confounders just as we treat their unmatched counterparts, using equations (13) to deconfound. for instance, if c1 and c2 are a frequency - matched confounder and an unmatched confounder, respectively, the deconfounded odds ratio may be estimated by the following unconditional logistic regression model : the so - called special, matched but as we will see next, nothing is conceptually different. in individual matching, just as in frequency matching, we still have to condition on the matched confounder(s) to remove the mixture of confounding bias and colliding bias. suppose we have matched one control to each case on a continuous variable such as weight and that each case - control pair shares a unique weight. at first glance, it seems that we can not estimate a deconfounded odds ratio by equation (1) or equation (2), because each stratum of c contains only two people, and therefore, stratum - specific odds ratios can not be estimated (figure 12). equation (3) will also fail because the unconditional maximum likelihood estimate of 1 will be biased.7 nonetheless, solutions can be found for both a weighted average and regression. bi, ci, and di, denote the cell counts in the 2 2 table (cross - classification of e and d) in the i - th stratum of c (figure 12). with this notation, equation (1) haenszel weights,8 wi = bici / ti (where ti = ai + bi + ci + di), equation (7) takes the following form : although we derived equation (8) assuming bici 0, we may still use it, instead of equation (7), when bici 0 in some, but not all, strata of c. returning to figure 12, we observe that ti = 2 for any i, and that ai, bi, ci, and di take the values 0 or 1. therefore, we can simplify the computation in equation (8) by grouping the series of tables in figure 12 into four types of case - control pairs, as shown in figure 13 : a - pairs (ai = 1 and bi = 1) ; b - pairs (ai = 1 and di = 1) ; c - pairs (bi = 1 and ci = 1) ; and d - pairs (ci = 1 and di = 1). notice that neither a - pairs nor d - pairs contribute to equation (8), because the product of their diagonal cells is zero (ai di = bi ci = 0). in contrast, each b - pair contributes to the numerator of equation (8) (and nothing to the denominator), whereas each c - pair contributes to the denominator (and nothing to the numerator). let r and s denote the count of b - pairs and c - pairs, respectively. odds ratio (often written as b / c). as we have just realized, however, it is no more than a weighted average of the odds ratio equation (7) across the values of c, the matched confounder. similar formulae can be developed for 1:k matching (k > 1). to overcome the sparse data problem in regression, we may fit a conditional logistic regression model, in which the intercept, which is a nuisance parameter in effect estimation, is not estimated. rather than adding c, the matched confounder, as a covariate (equation (3)) if each matched set shares a unique value of the confounder c, a unique matched set identifier may substitute for c. that is, we may condition on the identifying variable instead of conditioning on c. the same is true in individual matching on several confounders, for example, c1, c2, and c3, where conditioning on a matched set identifier substitutes for simultaneous conditioning on the three matched variables. matched sets that share the same values of the matched confounder(s) should be combined under a common identifier. to summarize, the so - called matched analyses are no more than alternative mathematical ways to condition on individually - matched confounders. as shown here and elsewhere,912 causal diagrams prove to be an indispensible tool in research methodology. a few simple principles that connect causation with association were sufficient to explain why matching controls to cases not only fails to remove confounding bias, but also adds colliding bias on top of confounding bias. the same principles also show that both types of bias will be removed by conditioning on the matched confounder(s). tracing the logic of matched case - control studies reveals a possible tradeoff between effort and variance, not between effort and bias. of course, the extra effort, if not trivial, may also be invested in recruiting more controls for an unmatched study. that effort must be invested to gain scientific knowledge is well known, but it is also well known that investing extra effort does not guarantee a substantial gain, or even any gain, in knowledge.
|
it is tempting to assume that confounding bias is eliminated by choosing controls that are identical to the cases on the matched confounder(s). we used causal diagrams to explain why such matching not only fails to remove confounding bias, but also adds colliding bias, and why both types of bias are removed by conditioning on the matched confounder(s). as in some publications, we trace the logic of matching to a possible tradeoff between effort and variance, not between effort and bias. lastly, we explain why the analysis of a matched case - control study regardless of the method of matching is not conceptually different from that of an unmatched study.
|
patients were enrolled into a long - term study on psychiatric comorbidity in type 1 diabetes. the inclusion criteria were as follows : 1) age 8 years ; 2) diabetes duration 1 year ; 3) at least three hba1c measurements per year, and 4) lack of significant coexisting diseases (asthma, celiac disease, juvenile rheumatoid arthritis, cystic fibrosis, previous diagnosis of mental retardation, severe congenital malformations or chromosomal disorders). all examinations needed to be performed during hospital visits because of the time and supervision required for some of the tests ; patients admitted for monitoring of diabetes complications or those referred to the in - hospital department for reeducation and insulin regimen modification were therefore assessed for eligibility. the visits were not associated with any acute events and were not the first visits of this type for any of the patients. among 632 inpatients treated for type 1 diabetes between january 2010 and july 2011 in the lodzkie administrative region in central poland, 211 (33.3%) consecutively admitted children met the predefined inclusion criteria. of that group, parents or legal guardians of all participants provided written, informed consent before initiation of any study procedures. the children s depression inventory (cdi) is a self - report questionnaire consisting of 27 items widely used among youth with chronic health conditions, specifically diabetes (12). results from cdi were normalized by transformation into t - scores, which ranged from 0 to 100 and the score of 50 corresponds to mean value in the population. with respect to its epidemiological definition, cdi t - scores > 65 points (i.e., 1.5 sds above the mean) are considered clinically significant. parents completed the cdi : p, a parent report of the subject s depressive symptoms developed for use in conjunction with the youth - reported cdi. for cdi : p, t - scores in the range of 5961 correspond to clinical significance (13). in studies among children with type 1 diabetes, a cutoff point raw score of > 13 on the cdi or > 17 on the cdi : p may be used as a criterion for increased depressive symptoms without adjustment for sex or age (14). in the current study, both the child (cdi) and parent (cdi : p) reports of the tool were used for the purpose of time expenditure calculation, and we assumed that each child needed 15 min to fill in the form. the same amount of time was required the parent to answer the questions in cdi : p. the effort to review the questionnaire and to calculate and interpret the results according to appropriate reference ranges was assumed to equal 15 min of work for the clinical psychologist. in the study population, the internal consistency values (assessed with cronbach) of the cdi and cdi : p were 0.81 and 0.78, respectively. the cdi had moderate concurrent validity with the cdi : p (r = 0.30 ; p 65 points (i.e., 1.5 sds above the mean) are considered clinically significant. parents completed the cdi : p, a parent report of the subject s depressive symptoms developed for use in conjunction with the youth - reported cdi. for cdi : p, t - scores in the range of 5961 correspond to clinical significance (13). in studies among children with type 1 diabetes, a cutoff point raw score of > 13 on the cdi or > 17 on the cdi : p may be used as a criterion for increased depressive symptoms without adjustment for sex or age (14). in the current study, both the child (cdi) and parent (cdi : p) reports of the tool were used for the purpose of time expenditure calculation, and we assumed that each child needed 15 min to fill in the form. the same amount of time was required the parent to answer the questions in cdi : p. the effort to review the questionnaire and to calculate and interpret the results according to appropriate reference ranges was assumed to equal 15 min of work for the clinical psychologist. in the study population, the internal consistency values (assessed with cronbach) of the cdi and cdi : p were 0.81 and 0.78, respectively. the cdi had moderate concurrent validity with the cdi : p (r = 0.30 ; p 0.4). because of very low prevalence of md and mdd in the study group, all tested screening tools were characterized by high npvs (97.9100.0) and low ppvs (12.136.4). demographic, social, and clinical characteristics of participants comparison of diagnostic accuracies of hba1c level and psychometric measures for the diagnoses of any md and mdd efficacy and time expenditure were compared among the four screening protocols for md and mdd. furthermore, this procedure was associated with the lowest time expenditure of the psychiatrist because it was the most effective at filtering out false - positive cases at both stages (fig. the hba1c plus cdrs screening protocol used self - rated measures to reduce the number of patients who would be unnecessarily directed to psychiatric consultation from 42 patients to 2. center - wide application of the protocol would result in a reduction of the psychiatry consultant time expenditure by 83% (302 h) for md and by 91% (310 h) for mdd screening relative to use of the cdi and cdi : p (fig. 2). analysis of medical personnel s and patients time use yielded similar results, also choosing the hba1c and cdrs model of screening as the most efficient (supplementary table 1). efficacy and time expenditure data for four screening models for mdd showing scenarios used in clinical practice and potential combinations of metabolic and psychometric tools as in fig. fn, false negative ; fp, false positive ; na, not applicable ; tn, true negative ; tp, true positive. depression is diagnosed by the same diagnostic criteria (dsm - iv or icd-10) in the general population and in patients with comorbid physical illness. screening tools designed for physically healthy individuals are also used in patients with somatic diseases (25). unfortunately, the general depression questionnaires widely used in primary care show a low detection rate for diabetic patients. this necessitates the use of different cutoff thresholds for patients with chronic disease to ensure adequate screening performance (26,27). this study demonstrated that pediatric diabetologists have an excellent diabetes - specific measure, hba1c level, which could be used as a first step in md screening. the findings demonstrate that hba1c is a useful marker for detecting md among individuals with type 1 diabetes, and the use of hba1c as a screening test could reduce the workload on clinical psychologists. screening with the suggested approach may result in substantial savings of financial and human resources relative to the standard screening, which according to international society for pediatric and adolescent diabetes guidelines should be performed by mental health professionals (10). combination of hba1c and cdrs screening and examinations made on the basis of clinical decisions would provide a feasible way of implementing a formalized prevention program of md and mdd among children with type 1 diabetes. a potentially useful trait of hba1c level is that it may be converted to a center - specific percentile value through the use of a centile grid of hba1c for all patients from a given department or clinic. such transformation of hba1c levels makes this measure independent of the exact metabolic control rate of the patient and quality of care in a particular setting, thus providing an unbiased threshold. the thresholds obtained in the current study (8.7% for md and 9.0% for mdd) correspond to the 93rd and 95th percentiles of results in the center, respectively. this information allows generalization of results to target the 7% of patients with the poorest metabolic control of diabetes for further work - up for md. age of the studied patients may be considered as a confounding factor, because adolescents are expected to have higher hba1c levels than younger children ; however, the risks of md and mdd (and their complications) are also greater in adolescents. because of sample size limitations and relatively low prevalence of the studied disorders, we were unable to perform age - adjusted multivariate analysis of the diagnostic accuracy of either test. because of the previously described association of age with both higher hba1c and risk of md, however, we came to the conclusion that the percentile threshold will be crossed by more adolescents than younger children, which is in line with the expected likelihood of md. there may have been other factors affecting the risk of md associated with psychosocial factors. we therefore refrained from performing detailed analyses, although we plan to investigate further in follow - up studies. our study has several limitations resulting from the specific challenges of pediatric and adolescent psychiatry and diabetology. the proposed protocol aims to select patients with clinical depressive symptoms that worsen metabolic control of diabetes. the initial hba1c - dependent step may miss patients with subthreshold depressive symptoms and patients with hba1c values in the normal range. children with mild mood and behavioral changes could be directed to preventive interventions according to clinical judgment. thorough clinical observation still remains the best way to identify patients in need of the intervention who do not meet proposed thresholds for screening but have suspected mental illness. the single - center setting may have also introduced bias by factors such as socioeconomic background and organization of health care in the region ; however, such a setting provided standardized conditions of diabetologic care and diagnostic procedures delivered by mental health professionals. furthermore, 23% of patients initially meeting inclusion criteria could not be included in the analysis because of lack of agreement to participate (n = 36) or incomplete psychometric data (n = 13). there is a possibility that comorbid affective disorders could be the underlying reason for nonparticipation, because such a phenomenon has been observed in previous clinical trials (28). among the patients excluded from analysis, one was diagnosed by ksads - pl as having dysthymic disorder but refused to complete any other psychometric measures, which resulted in his exclusion from further analyses. there were no significant symptoms of md among the other 12 patients evaluated with ksads - pl who did not want to complete psychometric tests. in addition, the study was conducted on inpatients hospitalized for poor metabolic control (26 cases) or routine monitoring of diabetes complications (137 cases). consequently, 24% of the sample had hba1c levels above the estimated 93rd percentile of the whole center. the presence of md is expected to be a potential cause of metabolic deterioration, however, so screening for md should primarily target these patients. finally, the small sample size is a limitation, because it may have reduced the statistical power needed to detect some true differences between aucs of the different screening models. validation on a larger, independent cohort would validate the findings and help establish appropriate cutoff values of hba1c and cdrs. to sum up, our findings suggest that hba1c levels may be an effective first screening tool for md in children with type 1 diabetes. application of a threshold hba1c level screening followed by cdrs constitutes a highly accurate, time - efficient screening procedure for md in children with type 1 diabetes.
|
objectiveto compare the diagnostic accuracy and time expenditure of screening models based on glycated hemoglobin (hba1c) level and psychometric measures for mood disorder (md) among children with type 1 diabetes.research design and methodswith semistructured clinical interviews (schedule for affective disorders and schizophrenia for children present and lifetime version, 120 min / patient) as a reference for diagnosing md, including major depressive disorder (mdd), we tested 163 subjects, aged 8 to 18 years, with type 1 diabetes. we evaluated four screening approaches : 1) children s depression inventory (cdi) at 30 min / patient, 2) hba1c level, 3) hba1c level plus cdi, and 4) hba1c level plus children 's depression rating scale (cdrs) at 40 min / patient. these tests were conducted with all participants, and the total time expenditure for all four approaches was calculated as the total time needed to implement successfully the screening for md or mdd in the center.resultshba1c performed on par with individual psychometric tests in diagnosing md or mdd. the hba1c plus cdrs model was the best screening procedure for both md and mdd, with diagnostic thresholds for hba1c established at 8.7% and 9.0%, respectively. cutoff points for cdrs assessed after filtering by hba1c were 26 (md) and 30 (mdd) points. center - wide application of this procedure would result in an 83% reduction of the examination time necessary for the psychiatrist for md screening and a 91% reduction for mdd screening, as compared with standard screening with cdi.conclusionsuse of hba1c level followed by cdrs is a time - efficient procedure to screen for md in children with type 1 diabetes.
|
staphylococcal enterotoxins (ses) (superantigens) have been considered as one of the most common causative agents of bacterial food - borne disease outbreaks worldwide (1), and intensive research has been performed on both people s (2) and animal s staphylococcal toxigenic isolates (3). consequently, it is well established that ses are the major cause of food poisoning (4). in addition all ses possess superantigenic activity and induce the inflammatory cytokines storm and inflammatory disease (5, 6). in this regard, the non - gastrointestinal roles of these toxins, such as atopic dermatitis (ad), have been demonstrated (7). the results of one study indicated that the staphylococcal and group a streptococcal superantigens possess the ability to cause the toxic shock syndrome starting from a colonized mucosal surface (8). therefore, the inflammatory disease caused by staphylococcus aureus (s. aureus) superantigens also has been taken into consideration. several reports have suggested that superantigens may act as the triggering factor in the pathogenesis of rheumatoid arthritis (ra) and other inflammatory diseases (911). these findings provide adequate knowledge for the development of serological diagnostics, immune prophylaxis, individual prognosis tools, and therapies against the invasive s. aureus, based on extracellular toxins (12). therefore, achieving rapid, sensitive, and cost - effective diagnostic tools for the detection of staphylococcal superantigens in the body fluids of patients has become a health priority. in this regard, enzyme - linked immunosorbent assays (elisa) for the detection and quantization of antibodies against staphylococcal enterotoxins a, b, c, and toxic - shock syndrome toxin-1, which are expected to be significant tools for the study of superantigens in several diseases, were developed (13). in addition, recent research represented the sensitive and specific colorimetric elisas for s. aureus enterotoxins a and b detection in urine and buffer samples (14). the results of several studies are felt to be the most important for toxins (superantigens) detection instead of organisms detection, because the organisms were not isolated from pathological body fluids, while the superantigens existed or perhaps were produced by non - pathogenic organisms, such as coagulase negative staphylococci (15,16). in this respect, the integration of elisa and pcr methods may also enhance the accuracy and credibility of the test and could be useful in revealing the origin of the etiological agents. in this regards, our hypothesis was to show whether or not the most common classical superantigens existed in the synovial fluid (sf) of the patients with ra. thus, the purpose of this study was to assess the existence of sea (superantigen) in the sf of patients with ra by pcr and elisa methods. this experimental study was conducted on the synovial fluid of 103 ra patients from baqiyatallah university of medical sciences rheumatology clinic, tehran, iran, during 20112014. bacteriological, polymerase chain reaction (pcr) with specific primer pairs and enzyme - linked immunosorbent assay (elisa) methods were used separately. non - parametric statistical methods and descriptive analyses by spss version 19 were used. in our previous study, a clinically - isolated s. aureus strain contained the ent a gene (producing enterotoxin a had characterized as gen bank reference (atcc 25923) used as positive control (17). over a period of three years, synovial fluid (sf) samples were taken from 103 ra patients who were referred to our laboratory by rheumatologists. inclusion and exclusion criteria of the ra patients were based on the american college of rheumatologists (acr s) 2010 criteria (18). sampling was conducted based on the standard protocol for sampling with constant monitoring of perfect aseptic conditions. the procedure indicated that, after disinfection of the sampling area, 510 ml of sf were aspirated by an expert rheumatologist. immediately afterwards, 35 ml of the sf were inoculated onto castaneda medium (baharafshan co., tehran, iran, lot no : 9 nkb) and then incubated at 37 c for 48 hr. the remaining sf samples were subjected aseptically to dna extraction and stored at 80c of freezer. then, they agreed to be referred to the clinical laboratory to provide blood samples. the protocol of this study was approved by the ethics committee of the baqiyatallah university of medical sciences, tehran, iran, on november 29, 2011, with code no : 24, paragraph 28. after inoculation of the castaneda medium and incubation at 37c for 48 hr, 1 ml of the medium was aspirated and subcultured on a blood agar plate (blood agar base, conda sa, madrid, spain, lot 812171, cat no : 1108). after incubation at 37c for 24 hr, the isolated bacterial strains were assessed by using the bacterial standard protocol (19). the reference bacterial was inoculated into the lb broth medium (lot vm1322685, merck, darmstadt, germany), after 24 hr of incubation at 37c. dna extraction was performed by using the salting - out method (20) with minor modifications. free dna tubes containing 500 l of the patient s sf and 500 l of dna - free distilled water (dw) (mixed in aseptic conditions) were centrifuged for 1 min at 3000 g at 4 c. afterwards, the resulting supernatants were transferred to dna - free sterile tubes, and the genomes were extracted with the cinnapure - dna extraction kit (cat. according to the manufacturer s instructions, 200 l of diluted sf were added to the micro tube, and then 400 l of lyses buffer were added, and the mixture was spun for 20 s. afterwards, 300 l of the precipitation solution was added to the micro tubes and spun again for 5 s. during this stage, all of the contents of the micro tubes were transferred to a new column and centrifuged for 1 min at 13000 g at 5c. the column was transferred to the new micro tube and washed by 400 l washing buffer 1, and centrifuged for 1 min at 12000 g at 5c. the resulting mixture was transferred to a clean micro tube and washed by 400 l of washing buffer 2, and centrifuged for 1 min at 12000 g at 5c. after evaporation and changing the column, 30 l of elution buffer were added and centrifuged for 5 min at 12000 g at 5c. the quality and quantity of the dna were measured using a nanodrop 2000 spectrophotometer (thermo scientific, wilmington, de, usa). based on previously published primers pair (21), with the following sequences : forward 5-tgtatgtatggaggtgtaac-3 and reverse 5-attaaccgaaggttctgt-3. however, for increased reliability and to prevent the occurrence of errors, the primers pair was analyzed on primer3 software (whitehead institute for biomedical research, cambridge, ma, usa). in addition, multiple alignments were conducted by the dnasis max trial version software (hitachi solution america ltd. a set of specific primer pairs, which amplified a 270 bp fragment, were used for the diagnosis of enterotoxin a gene in sf and blood samples of the ra patients by polymerase chain reaction. the 25 l mastermix reaction contained 1 l dna template, 0.3 u of taq dna polymerase, 2.5 l of 10x pcr buffer, 0.16 mm of each dntps, 2 mm mgcl2 (all reagents were from cinnagen co, tehran, iran), 10 pmol (1 l) of each primer pair (synthesized by cinnagen co., teheran, iran) and double - distilled water. the amplification reactions were conducted in a thermal cycler (bio - rad c1000, bio - rad laboratories inc. pcr cycles were : initial denaturation at 95 c for 3 min followed by 35 cycles of denaturation at 94 c for 30 s, primer annealing at 61 c for 40 s and extension at 72 c for 40 s, followed by a final extension at 72 c for 5 min. the amplified pcr products were electrophoresed in a 1.5% agarose gel for 45 min and then stained with ethidium bromide (0.05 mg / ml) for 20 min. the gels were photographed under ultraviolet light using the universal hood ii gel doc (bio - rad laboratories inc. molecular size markers (50 and 100 bp) were included in each sample for analysis. all of the samples of sf genomes were assayed after pcr optimization. in order to validate the enterotoxin detection in the patients sf samples, the sf sample was centrifuged for 10 min at 5000 g at room temperature and the supernatant was subjected to elisa, as follows : based on a previous report (17), 50 l of sf with the 50 l of dw as diluents were mixed. then, 50 l of sample were added to the defined wells of elisa plates that were coated previously with a polyclonal non - specific antibody against staphylococcal enterotoxin a (rb. after one hour of incubation and being washed three times, 50 l of the conjugate antibody (horseradish peroxidase = hrpo) coupled to the secondary anti - igg antibody were diluted up to 10,000-fold in 0.5%, after which bsa was added. then, the enzyme substrate was added along with a final 100 l of the stop solution. after this color variation indicator, the wells absorption was measured by the elisa reader device at 450-nm wavelength and then the cut - off value was calculated for each plate. this experimental study was conducted on the synovial fluid of 103 ra patients from baqiyatallah university of medical sciences rheumatology clinic, tehran, iran, during 20112014. bacteriological, polymerase chain reaction (pcr) with specific primer pairs and enzyme - linked immunosorbent assay (elisa) methods were used separately. non - parametric statistical methods and descriptive analyses by spss version 19 were used. in our previous study, a clinically - isolated s. aureus strain contained the ent a gene (producing enterotoxin a had characterized as gen bank reference (atcc 25923) used as positive control (17). over a period of three years, synovial fluid (sf) samples were taken from 103 ra patients who were referred to our laboratory by rheumatologists. inclusion and exclusion criteria of the ra patients were based on the american college of rheumatologists (acr s) 2010 criteria (18). sampling was conducted based on the standard protocol for sampling with constant monitoring of perfect aseptic conditions. the procedure indicated that, after disinfection of the sampling area, 510 ml of sf were aspirated by an expert rheumatologist. immediately afterwards, 35 ml of the sf were inoculated onto castaneda medium (baharafshan co., tehran, iran, lot no : 9 nkb) and then incubated at 37 c for 48 hr. the remaining sf samples were subjected aseptically to dna extraction and stored at 80c of freezer. then, they agreed to be referred to the clinical laboratory to provide blood samples. the protocol of this study was approved by the ethics committee of the baqiyatallah university of medical sciences, tehran, iran, on november 29, 2011, with code no : 24, paragraph 28. after inoculation of the castaneda medium and incubation at 37c for 48 hr, 1 ml of the medium was aspirated and subcultured on a blood agar plate (blood agar base, conda sa, madrid, spain, lot 812171, cat no : 1108). after incubation at 37c for 24 hr, the isolated bacterial strains were assessed by using the bacterial standard protocol (19). the reference bacterial was inoculated into the lb broth medium (lot vm1322685, merck, darmstadt, germany), after 24 hr of incubation at 37c. dna extraction was performed by using the salting - out method (20) with minor modifications. free dna tubes containing 500 l of the patient s sf and 500 l of dna - free distilled water (dw) (mixed in aseptic conditions) were centrifuged for 1 min at 3000 g at 4 c. afterwards, the resulting supernatants were transferred to dna - free sterile tubes, and the genomes were extracted with the cinnapure - dna extraction kit (cat. according to the manufacturer s instructions, 200 l of diluted sf were added to the micro tube, and then 400 l of lyses buffer were added, and the mixture was spun for 20 s. afterwards, 300 l of the precipitation solution was added to the micro tubes and spun again for 5 s. during this stage, all of the contents of the micro tubes were transferred to a new column and centrifuged for 1 min at 13000 g at 5c. the column was transferred to the new micro tube and washed by 400 l washing buffer 1, and centrifuged for 1 min at 12000 g at 5c. the resulting mixture was transferred to a clean micro tube and washed by 400 l of washing buffer 2, and centrifuged for 1 min at 12000 g at 5c. after evaporation and changing the column, 30 l of elution buffer were added and centrifuged for 5 min at 12000 g at 5c. the quality and quantity of the dna were measured using a nanodrop 2000 spectrophotometer (thermo scientific, wilmington, de, usa). based on previously published primers pair (21), with the following sequences : forward 5-tgtatgtatggaggtgtaac-3 and reverse 5-attaaccgaaggttctgt-3. however, for increased reliability and to prevent the occurrence of errors, the primers pair was analyzed on primer3 software (whitehead institute for biomedical research, cambridge, ma, usa). in addition, multiple alignments were conducted by the dnasis max trial version software (hitachi solution america ltd., san bruno, ca, usa) for gene reference. a set of specific primer pairs, which amplified a 270 bp fragment, were used for the diagnosis of enterotoxin a gene in sf and blood samples of the ra patients by polymerase chain reaction. the 25 l mastermix reaction contained 1 l dna template, 0.3 u of taq dna polymerase, 2.5 l of 10x pcr buffer, 0.16 mm of each dntps, 2 mm mgcl2 (all reagents were from cinnagen co, tehran, iran), 10 pmol (1 l) of each primer pair (synthesized by cinnagen co., teheran, iran) and double - distilled water. the amplification reactions were conducted in a thermal cycler (bio - rad c1000, bio - rad laboratories inc., hercules, ca, usa). pcr cycles were : initial denaturation at 95 c for 3 min followed by 35 cycles of denaturation at 94 c for 30 s, primer annealing at 61 c for 40 s and extension at 72 c for 40 s, followed by a final extension at 72 c for 5 min. the amplified pcr products were electrophoresed in a 1.5% agarose gel for 45 min and then stained with ethidium bromide (0.05 mg / ml) for 20 min. the gels were photographed under ultraviolet light using the universal hood ii gel doc (bio - rad laboratories inc. molecular size markers (50 and 100 bp) were included in each sample for analysis. all of the samples of sf genomes were assayed after pcr optimization. in order to validate the enterotoxin detection in the patients sf samples, the sf sample was centrifuged for 10 min at 5000 g at room temperature and the supernatant was subjected to elisa, as follows : based on a previous report (17), 50 l of sf with the 50 l of dw as diluents were mixed. then, 50 l of sample were added to the defined wells of elisa plates that were coated previously with a polyclonal non - specific antibody against staphylococcal enterotoxin a (rb. after one hour of incubation and being washed three times, 50 l of the conjugate antibody (horseradish peroxidase = hrpo) coupled to the secondary anti - igg antibody were diluted up to 10,000-fold in 0.5%, after which bsa was added. then, the enzyme substrate was added along with a final 100 l of the stop solution. after this color variation indicator, the wells absorption was measured by the elisa reader device at 450-nm wavelength and then the cut - off value was calculated for each plate. from august 2011 to august 2014, synovial fluid samples from 103 ra patients were assessed. during this study and after sequential sub - cultures, only four (3.8%) bacterial species were isolated. based on the results of the biochemical diagnostic tests, in all four cases, the quality and quantity of the standard strain and patients sample genomes were examined by both gel electrophoresis (the gel concentration was 0.8%, in 100 v for 45 min) and nanodrop spectrophotometer (thermo scientific, wilmington, de, usa) measurement. after examination based on the standard strain genome and master mix components, pcr was set up and applied as a positive control for each test (figure 2). the results of pcr performed with amplifier primer of a 270bp fragment revealed that 40.7% of the samples have amplified a 270bp fragment as it was a part of ent a gene. because of sequencing of the pcr product confirmed the results. figure 2 exemplifies the results of pcr product electrophoresis with amplifier primer of a 270bp fragment for a number of samples. the results of the elisa method indicated that 49.51% of ra patients sf samples were positive for sea (figure 3). comparative study results of pcr, elisa, and bacterial culture for staphylococcal enterotoxin a assay of 103 rheumatoid arthritis patients synovial fluid were 40.7, 49.51, and 3.8%, respectively, and the assays of 103 blood samples were 37, 45, and 2.9%, respectively. from august 2011 to august 2014, synovial fluid samples from 103 ra patients were assessed. during this study and after sequential sub - cultures, only four (3.8%) bacterial species were isolated. based on the results of the biochemical diagnostic tests, in all four cases, the quality and quantity of the standard strain and patients sample genomes were examined by both gel electrophoresis (the gel concentration was 0.8%, in 100 v for 45 min) and nanodrop spectrophotometer (thermo scientific, wilmington, de, usa) measurement. after examination based on the standard strain genome and master mix components, pcr was set up and applied as a positive control for each test (figure 2). the results of pcr performed with amplifier primer of a 270bp fragment revealed that 40.7% of the samples have amplified a 270bp fragment as it was a part of ent a gene. because of sequencing of the pcr product confirmed the results. figure 2 exemplifies the results of pcr product electrophoresis with amplifier primer of a 270bp fragment for a number of samples. the results of the elisa method indicated that 49.51% of ra patients sf samples were positive for sea (figure 3). comparative study results of pcr, elisa, and bacterial culture for staphylococcal enterotoxin a assay of 103 rheumatoid arthritis patients synovial fluid were 40.7, 49.51, and 3.8%, respectively, and the assays of 103 blood samples were 37, 45, and 2.9%, respectively. staphylococcus aureus strains are the most common causative agents of septic arthritis, and it has been demonstrated that superantigens produced by s. aureus represent major arthritogenic factors (22) in septic ra cases. clarifying the causative agents of non - septic ra is crucial for successful treatment and reduction in the costs for the patient. however, staphylococcal superantigen a (enterotoxin a) is being increasingly recognized for its possible roles in many human diseases other than non - gastrointestinal disorders, such as atopic dermatitis, kawasaki syndrome, nasal polyposis, and certain autoimmune disorders, especially ra (23), which makes it mandatory to perform assays for the detection of the enterotoxin a. our previous report was focused on the elisa method to investigate the common staphylococcal enterotoxins (classical superantigens) in the sf of ra patients (24), the results of which raised the critical question concerning the source of these toxins in non - septic ra. therefore, in the present study, a total of 103 sf and synchronically blood samples of patients with ra were assayed for the presence of s. aureus enterotoxin a by using bacterial culturing, elisa, and pcr methods. the result of bacterial culturing showed that four isolated staphylococcal strains were non introducing enterotoxin a was isolated from sf samples, while in 2.9% of blood cases, bacteria were isolated. the result of the elisa and pcr assessments of 103 sf samples indicated in 51 cases (49.51%) the presence of enterotoxin a and in 42 cases (40.70%) the presence of enterotoxin a gene. in fact, these findings indicated that the accuracy and credibility of the elisa method was higher than that of the pcr method (49.51% vs. 40.70%). it is noteworthy that in only 31 cases (30.09%) of all samples, the pcr and elisa results were essentially the same. in nine cases (8.73%), the pcr results showed the presence of enterotoxin a gene, whereas the elisa results for the existence of enterotoxin a were negative. the reason may be related the lack of gene expression or inadequate production of enterotoxin, which was under the elisa sensitivity threshold. we found 19 cases (18.44%) that were positive for elisa, whereas negative results were obtained for pcr, but the pcr reactions were repeated by a different genomic dna extraction method. the output results showed that differences between pcr and elisa still persisted, and perhaps they were due to the similarities between enterotoxin a and other enterotoxins (cross reaction), such as enterotoxins e and p. the interpretation of these results is very difficult. first, s. aureus produces more than 20 types of enterotoxins with great similarities between them. second, the different structural features may have similar mechanisms of action. meanwhile, this study s aim was only focused on the detection of staphylococcal enterotoxin a in synovial fluid of patients with ra. however, the results of this study indicated that the pcr molecular method and elisa could detect enterotoxin a in the sf of patients with ra. the first question concerns why the toxin was found in the patient s sf even though the bacterial growth in the sf cultures was negative. the second important question concerned the role of staphylococcal enterotoxins as superantigens in inflammatory disease and rheumatoid arthritis. however, no direct attempt to detect these enterotoxins in patient s sf and/or blood has been reported to date. perhaps one reason is the lack of proper and valid methods for testing the measured superantigen. another important reason may be the fact that the sf aspiration is very difficult. we believe that the main reason concerns inaccurate reporting. for example, the lack of evidence for the role of staphylococcal enterotoxins in rheumatoid arthritis was reported (25). however, in recently - reported data, the majority of s. aureus strains colonized in the skin of atopic dermatitis patients carried genes encoding sea and demonstrated the importance of sea as an immunoinflammatory triggering factor of atopic dermatitis (26). however, this study was designed to determine the existence of staphylococcal enterotoxin a (superantigen a), by elisa and by pcr amplification simultaneously in ra patients sf and blood, and the pcr product sequencing confirmed the results. there were several important limitations in this study, including the limit on the collection of sf samples from the patients with confirmed cases of the disease. another important limitation was that, despite the fact that 270 bp pcr amplicon (part of ent a gene) was amplified in this study, sequencing confirmed that the partially enterotoxin a gene belonged, but further research is needed to perform for the full length gene determined. the findings of this study indicated that, despite the absence of enterotoxin a producing staphylococcal bacterium in the synovial fluid and blood of the ra patients, the existence of sea and also the encoded ent a gene were detectable by pcr methods. therefore, the hypothesis that different staphylococcal strains are present in the human body must be emphasized. therefore, they probably release and incorporate the encoded enterotoxins gene elements that are far from the site of colonization. however, due to the fact that there are no similar studies, this hypothesis should be compared and analyzed.
|
introductiondirect detection of microbial super antigens in synovial fluid of patients with rheumatoid arthritis may be able to guide to the design of cost - effective therapies. the purpose of this study was to assess the existence of staphylococcal enterotoxin a (superantigen a) in the synovial fluid of patients with ra by the pcr and elisa methods.methodsthis experimental study was conducted on the synovial fluid of 103 ra patients from baqiyatallah university of medical sciences rheumatology clinic in tehran, iran in 20112014. bacterial cultures, polymerase chain reaction with specific primer pairs and enzyme - linked immunosorbent assay (elisa) methods were used. the pcr products were subjected to sequence as a confirmatory molecular method results. the data were descriptively analyzed by spss version 19.resultsthe bacteriological study result indicated that, in four cases (3.8%) of the patients, bacterial strains were isolated. the result of pcr molecular method for staphylococcal enterotoxin a gene showed that, 42 of the patients (40.7%) tested positive for the ent a gene. the results of elisa were positive for staphylococcal enterotoxin a (superantigen a) in 51 cases (49.51%) of the patients synovial fluids. the results indicated that the possibility of detecting superantigen a in the sf of ra patients, but the origin of the enterotoxin a gene remained unknown.conclusionsthe findings of this study may be able to alter the actual theory on the pathogenesis, diagnosis, and treatment of ra patients. in addition, the results have shown the probability of an endogenous origin for the involved superantigen a in ra patients synovial fluids.
|
floppy eyelid syndrome (fes) is a condition firstly described in 1981 by culbertson and ostler [17 ]. several studies have enriched the original description : affected patients (men and women), in the big majority overweight, present eyelids with increased laxity that evert easily or even spontaneously during sleep. an important number of pathologies have been associated to the syndrome either concerning the lids (ptosis, lash ptosis, blepharitis, superior lid entropion, or inferior lid ectropion) or the eye itself (papillary conjunctivitis, superficial punctate keratopathy, scarring, corneal neovascularization, keratoconus, progressive epitheliopathy, or even corneal perforation) [3, 5, 79 ]. fes has also been associated to a variety of systemic diseases as obesity, hypertension, ischemic heart disease, diabetes mellitus, skin pathologies, and most commonly sleep apnea syndrome (sas) [5, 6, 9 ]. the presence of a floppy eyelid in a remarkable number of sas patients has turned this group of patients an interesting one for investigation. sas is a serious sleep disorder characterized by abnormal pauses of breathing or instances of abnormally low breathing during sleep. each pause may last from a few seconds to minutes and may occur up to 30 times or more per hour. sas prevalence is 5 - 6% in the general population, the main problem being that most cases remain undiagnosed. typically, the condition is more common in older people, men predominate, and women are more often affected during pregnancy. the fact that sas is generally associated to obesity and obese patients present more frequently floppy eyelids raises the question whether fes is a characteristic of obesity or of sas patients. the aim of this study is to investigate whether there is an association of fes and body mass index (bmi) in sas patients and normal subjects based on our method of lid laxity evaluation. participants were recruited from the respiratory medicine clinic of the university hospital of larissa assessed for suspicion of sas. all participants provided written informed consent, and the study was conducted according to the declaration of helsinki, approved by the ethical committee of the university hospital. subjects with previous ocular history (anterior / posterior segment disease, eye trauma, eye surgery, or photocoagulation) or diabetes mellitus were excluded. the study finally included a total of 135 subjects : 81 patients with sas (sas group) and 54 normal subjects (normal group). the sas group was subdivided into two groups : sas low - bmi group (patients with bmi 29, n : 59). in a similar way, the normal group was subdivided into normal low - bmi group (n : 33) and normal high - bmi group (n : 21). body mass index (bmi) was defined as the individual 's body weight divided by the square of his / her height. the final diagnosis of sas was made by the sleep unit of the respiratory medicine clinic. all subjects were screened for age, gender, and bmi, and a complete medical and ophthalmological history was taken. they underwent a full physical examination as well as a polysomnography and stayed overnight at the hospital at the respiratory medicine clinic. all subjects were examined by the same ophthalmologist blindly that proceeded to a complete ophthalmologic evaluation including eyelid, visual acuity and visual field assessment, slit lamp biomicroscopy, tonometry, gonioscopy, fundus examination, keratotopography, and endothelioscopy. both upper and lower lids were assessed in terms of lateral and medial canthal laxity as well as horizontal laxity. regarding the upper lid, eversion resulting in exposure of the tarsus that remained despite inferior gaze position for over than three (3) seconds was characterized as hyperelasticity. following the same examination technique when the lid was easily but not spontaneously everted and remained everted for up to six (6) seconds despite the down gaze position of the eye or voluntary contraction of the orbicularis oculi muscle, the patient was characterized as having asymptomatic floppy eyelid stage 1. when the eyelid was everted easily or even spontaneously, and remained remained everted for over than six (6) seconds despite the down gaze position of the eye or voluntary contraction of the orbicularis oculi muscle, the patient was characterized as having symptomatic floppy eyelid stage 2. stage 1 patients did not present signs of conjunctivitis or keratitis, whereas stage 2 patients presented giant papilla conjunctivitis, keratitis, and sometimes even corneal neovascularization. categorical variables (tables 1 and 3) were compared using the x - test or the fisher 's exact test (for 2 2 tables). the presence of a floppy eyelid (regardless of the stage) predominated in the sas group (n : 81, 28 patients presenting fes) than in the normal subject group (n : 54, 9 subjects presenting fes) (p 29. the comparison between sas patients and normal subjects did not show a statistical significant difference for either stage (table 3). finally, in order to answer whether the fes bmi 29 are a characteristic of sas or of obesity, a comparison was made between the sas group and the normal high - bmi group. floppy eyelid syndrome was present in sas patients in 35, 34% (28 of the 81 patients) and in normal obese patients in 28, 57% (6 of the 21 subjects). the difference of the two groups was not statistically significant (p > 0.05). floppy eyelid syndrome is a clinical entity that has already been extensively investigated in terms of clinical characteristics, local and systemic associations, and treatment since its first description in 1981[16 ]. several studies have affirmed that the loss of elastin fibers is responsible for the lax attitude of the eyelid. an important reduction is observed in the stroma of the tarsal plate in the stroma, whereas they remain mostly present around the meibomian glands. an immunohistological study has shown an increase of elastolytic protease in the areas exhibiting less elastin compared to normals. additional mechanisms described were ischemia - reperfusion injury or repeated minor trauma or mechanical stress, provoking the same changes. in the literature, there is a discrepancy regarding lid laxity, especially the lack of a common consensus for laxity classification in fes. several authors attempted to define hyperlaxity either by the length of vertical distance between the palpebral rim and the pupil, horizontal distraction, snapback, vertical lid pull, horizontal distraction of the lid to the globe, proportion of the tarsal plate everted, by measuring the effort made to evert the lid and other. the hallmark characteristic of fes being the eversion (spontaneous or not) was estimated to base the evaluation classification on this characteristic. the two stages of fes regarding lid laxity described above are based on the fact, that, as the disease evolves, more elastin fibers are lost. in early stages where a limited number of the fibers are lost and the lid has still some rigidity, it is evident that eversion can be realised but lasts less. on the other hand, in more advanced stages of the disease, when a larger number of elastin fibers are lost, the lid losses completely its rigidity, everts easily or even spontaneously, and may stay everted for a longer period. so a fair description of our theory may result to stage 1 for manual eversion lasting up to 6 sec and stage 2 for eversion (spontaneously or not) for over 6 sec. regardless of the pathogenesis mechanism, the main characteristic of the sas syndrome remains the increased laxity of the eyelid and its evaluation could be useful in terms of early diagnosis : many sas cases are not diagnosed in time, and a full ophthalmologic assessment consisting of a careful lid laxity evaluation could assist to that. the initial description of the floppy eye syndrome concerned 11 obese patients, but the studies that followed reported varied associations [2, 3, 5, 6 ]. the results of the current study did not confirm that obese patients present the syndrome more often. although there exists an important number of obese patients having floppy eyelids, it is evident that fes is mainly associated to sas than obesity. it is clear from the results of the current study that hyperelasticity is associated to obesity as it was present more frequently in overweight participants (both sas and normals). on the other hand, the fact that fes is not associated to obesity is also confirmed in our study from the results. comparison of obese normal subjects and obese sas having fes did not reveal any relation between obesity and floppy eye. the current study confirms the association of floppy eyelid syndrome and sas as well as its association to hyperelasticity that could be considered as an initial stage of lid laxity. our findings confirm no relationship between fes and obesity, and this is in accordance to previously published studies. an evaluation of the lid laxity is proposed based on the loss of elastin fibers that are normally responsible for the lid rigidity.
|
background. the aim of this study is to present a method of lid laxity evaluation and investigate whether there is an association between floppy eyelid syndrome (fes) and body mass index (bmi) in sleep apnea syndrome (sas) patients compared to normal subjects. method. a total of 135 participants (81 patients with sas and 54 normal subjects) had a full ophthalmologic examination. the presence of fes was estimated in relation to sas and bmi. results. the floppy eyelid was characterized hyperelastic, fes stage 1 (asymptomatic), or fes stage 2 (symptomatic) depending on its laxity capacity. hyperelastic floppy eyelid in sas patients was statistically significant (p 0.05). conclusion. a classification of fes is proposed based on lid laxity. in addition to this, our data suggests a clear association of hyperelasticity and fes to sas patients but no association between obesity and fes.
|
cellular genomes are constantly damaged by endogenous agents, such as oxygen radicals formed during aerobic respiration. this oxidative dna damage is proposed to be a major contributor to carcinogenesis and aging. one of the most common oxidative dna lesions generated within cells is 8-oxo-7,8-dihydro-2-deoxyguanosine (8-oxodg). although structural studies indicate that 8-oxodg induces only minor distortions to the helical structure of dna that are localized to the modified base, 8-oxodg is highly mutagenic due to its dual coding potential. during dna replication, 8-oxodg adopts either an anti or syn conformation within a polymerase active site. while in the syn conformation, a templating 8-oxodg lesion utilizes the hoogsteen edge of the damaged base to preferentially form base pairs with incoming datp. if left unrepaired, these 8-oxodg : da mispairs will lead to g t transversion mutations, which have been linked to cancer induction. although 8-oxodg does not completely block dna synthesis catalyzed by replicative dna polymerases, this lesion does induce the pausing of dna polymerases alpha (pol), delta (pol), and epsilon (pol). such a stalling event may provide an opportunity for a cell to switch to a dna polymerase that is specialized for the bypass of dna lesions, a process known as translesion dna synthesis (tls). notably, humans encode four y - family enzymes : dna polymerases eta (hpol), iota (hpol), kappa (hpol), and rev1 (hrev1). these four low - fidelity dna polymerases are characterized by a lack of proofreading 3 5 exonuclease activity, low processivity, and a relatively spacious, solvent - exposed active site. importantly, the human y - family enzymes demonstrate a large degree of functional divergence due to the fact that during tls, the nucleotide incorporation fidelity and efficiency of each y - family polymerase is lesion specific. therefore, it is likely that each y - family polymerase has evolved to catalyze tls of a specific set of lesions. investigation of the lesion bypass efficiencies and fidelities of the y - family polymerases may help illuminate the in vivo roles of these polymerases for the tls of specific lesions. to this end, earlier reports have examined the 8-oxodg bypass abilities of hpol, hpol, hpol, and hrev1 separately by using various enzymatic assays. however, these studies have utilized different reaction conditions and dna substrates to individually investigate each enzyme, complicating direct comparisons between the activities of all four human y - family enzymes. furthermore, the kinetic methods previously utilized were unable to accurately measure deletion or insertion events induced by tls. therefore, we sought to systematically compare the 8-oxodg bypass efficiency of each y - family enzyme under the same reaction conditions and to determine the type and frequency of errors induced by tls of 8-oxodg through a high - throughput short oligonucleotide sequencing assay (ht - sosa) that was recently developed in our laboratory. the ht - sosa method is advantageous for a comprehensive analysis of replication errors induced by tls of a damaged site as this method (1) provides a complete mutagenic profile of dna damage - induced mutations by accounting for all mutagenic events, such as base deletions, insertions, and substitutions ; (2) supplies sequencing information for incorporation events opposite, upstream, and downstream from the lesion site ; and (3) allows for analysis of multibase mutations from a single full - length product. here, we use a combination of primer extension assays and ht - sosa to investigate for the first time the efficiency and accuracy of 8-oxodg bypass catalyzed by the human y - family dna polymerases both alone and in combination. optikinase was purchased from usb corporation, dntps were purchased from ge healthcare, and [-p]atp was purchased from perkinelmer. human pol with a c - terminal his6 tag, human pol with an n - terminal his6 tag, and human rev1 with an n - terminal his6 tag were expressed in escherichia coli and purified as previously described. human pol with an n - terminal gst tag was expressed in escherichia coli and purified, and the n - terminal gst tag was subsequently removed by proteolytic cleavage with tobacco etch viral protease as previously described. the synthetic 40-mer dna template containing 8-oxodg (40-mer-8oxodg) was purchased from midland certified reagent company (table 1). all other synthetic dna oligomers were purchased from integrated dna technologies (table 1 and table s1, supporting information). all dna oligomers were gel purified by denaturing polyacrylamide gel electrophoresis (page, 10% polyacrylamide, 8 m urea). primers were 5-[p]-radiolabeled by incubating each primer with optikinase and [-p]atp for 3 h at 37 c. dna substrates were generated by annealing a 5-[p]-radiolabeled primer with either the control 40-mer template or damaged 40-mer-8oxodg template at a molar ratio of 1.00:1.15. annealing solutions were heat denatured by incubation at 75 c for 5 min, followed by slow cooling to 25 c over several hours. all kinetic and ht - sosa reactions were performed in optimized reaction buffer r (50 mm hepes, ph 7.5 at 37 c, 50 mm nacl, 5 mm mgcl2, 0.1 mm edta, 5 mm dtt, 10% glycerol, and 0.1 mg / ml bsa) at 37 c. a preincubated solution containing either a single polymerase (100 nm) or all four human y - family polymerases (25 nm each) and 100 nm of a 5-[p]-radiolabeled dna substrate (17-mer/40-mer or 17-mer/40-mer-8oxodg) was rapidly mixed with a solution of all four dntps (200 m each). the reaction mixtures were quenched at various times by the addition of 0.37 m edta. a rapid chemical quench flow apparatus (kintek) was used for kinetic experiments with reaction times ranging from milliseconds to several minutes. the reaction products were resolved by using denaturing page and quantified by using a typhoon trio (ge healthcare). analysis of the running start assays was performed as previously described by calculating the relative lesion bypass efficiencies (8-oxodg bypass%) of each polymerase as a function of reaction time. for each time point t, 8-oxodg bypass% was calculated as the ratio of the bypass events to the encounter events (eq 1):1where the total 8-oxodg bypass events (b) was the sum of the concentrations of all products with sizes greater than or equal to the 22-mer, and the total 8-oxodg encounter events (e) was the summation of the 21-mer product concentration and the total 8-oxodg bypass events (b). the 8-oxodg bypass% as calculated by eq 1 was then plotted as a function of reaction time. to compare the 8-oxodg bypass efficiency of each polymerase, the t50 was defined as the time required for each y - family polymerase to bypass 50% of the total 8-oxodg lesions encountered. this t50 value was calculated from the 8-oxodg bypass% plots assuming a constant rate of lesion bypass between the time point immediately before and the time point immediately after the bypass of 50% of the lesion sites encountered. a preincubated solution of 100 nm or 400 nm of hrev1 and 100 nm of a 5-[p]-radiolabeled dna substrate (21-mer/40-mer or 21-mer/40-mer-8oxodg) was rapidly mixed with a solution containing all four dntps (200 m each). where indicated, hpol (300 nm) was added to the reactions 30 s after the addition of the dntp solution. lesion bypass products were generated by mixing either the radiolabeled 13-mer/40-mer substrate or the 13-mer/40-mer-8oxodg substrate (100 nm) into a solution containing a single enzyme (100 nm) or all four enzymes (25 nm each). this solution was incubated briefly and subsequently mixed with a solution of all four dntps (200 m each). the reactions containing only hpol or only hpol were incubated at 37 c for 1 h, and the reactions containing only hpol or all 4 human y - family polymerases were incubated at 37 c for 4 h. to produce lesion bypass products with the combination of hrev1 and hpol, either the 16-mer/40-mer or 16-mer/40-mer-8oxodg dna substrate (100 nm) was briefly preincubated with hrev1 (100 nm) and subsequently mixed with a solution containing all four dntps (200 m each). after 10 or 60 s for the control or damaged dna substrate reactions, respectively, hpol (300 nm) was added, and the reactions were incubated for an additional 1 h at 37 c. after generation of the lesion bypass products, the full - length, newly synthesized dna strands were effectively separated from the template strands by using denaturing page, as the 13-mer and 16-mer primers annealed 5 bases upstream of the 3-end of the 40-mer and 40-mer-8oxodg templates (scheme 1). next - generation sequencing libraries were generated by first amplifying each purified, single - stranded dna lesion bypass product by using 1 of 10 unique barcoded primers (table s1, supporting information) and a common reverse primer. the pcr products were then gel purified, and the remaining adapter sequences required for next - generation sequencing were added in a second round of pcr by using illumina pcr primers 1 and 2 (table s1, supporting information). the completed sequencing libraries were then gel purified and mixed in equal molar ratios. the sequencing libraries generated from the lesion bypass products were then mixed with an equal molar amount of bacteriophage x sequencing libraries to increase sequence diversity. finally, the sequencing library solution was sequenced by using a hiseq 2000 dna sequencer (illumina). to compare the ability of each human y - family dna polymerase to bypass 8-oxodg under identical in vitro conditions, we carried out running start primer extension assays. to this end, dna substrates were generated by annealing a 5-[p]-radiolabeled 17-mer primer to either the undamaged 40-mer template or the damaged 40-mer-8oxodg template, which contained a site - specifically placed 8-oxodg lesion (table 1 and figure 1k). these dna substrates were then extended by the action of a y - family dna polymerase. the 8-oxodg lesion did not induce any noticeable stalling of hpol when compared to the undamaged control (figure 1a and b). thus, the efficiency of hpol nucleotide incorporation was not inhibited by the lesion during the bypass or extension step of 8-oxodg tls. in contrast, hpol paused during incorporations both opposite 8-oxodg and during the following extension step as indicated by the transient accumulation of the 22-mer and 23-mer products (figure 1c and d). this result is consistent with previous steady - state kinetic studies indicating that the efficiency of hpol nucleotide incorporation is reduced opposite this lesion and that during the extension step of tls, hpol more efficiently extends the 8-oxodg : da mismatch compared to the correct 8-oxodg : dc base pair. the 8-oxodg lesion significantly blocked nucleotide incorporation by hpol both opposite the lesion and for the extension step as indicated by the accumulation of the 21-mer and 22-mer products, respectively (figure 1e and f). these two consecutive pause sites were also observed with the control substrate but to a lesser extent, as hpol is known to preferentially misincorporate dg opposite template dt and inefficiently extend the mismatch. this combination of events reduces hpol activity opposite template dts, a phenomenon known as the t stop. thus, the relative efficiency of nucleotide incorporation catalyzed by hpol opposite 8-oxodg and during the extension step of tls is predicted to be sequence - dependent. polymerase hrev1 failed to extend past the lesion site within 20 h (figure 1h). this failure to produce full - length dna products was expected as hrev1 preferentially functions as a dctp transferase by predominantly incorporating dctp opposite dna lesions or undamaged bases. nevertheless, the running start assay indicated that the 8-oxodg lesion reduced the activity of this polymerase as hrev1 extended the control dna substrate to a 23-mer but was only capable of extending the damaged dna substrate to a 21-mer product (figure 1 g and h). running start assays for the human y - family dna polymerases on undamaged and damaged dna templates. a preincubated solution containing 100 nm of 5-[p]-radiolabeled (a, c, e, g, and i) 17-mer/40-mer or (b, d, f, h, and j) 17-mer/40-mer-8oxodg and either 100 nm of the indicated dna polymerase or 25 nm of each y - family polymerase was rapidly mixed with a solution containing all 4 dntps (200 m each). the reaction mixtures were quenched at the indicated times with 0.37 m edta and resolved by using denaturing page. the sizes of important products are indicated, and the 22nd position is denoted with an asterisk () to indicate an incorporation opposite the 8-oxodg lesion site. the position of the 8-oxodg lesion within the template strand is indicated by a y. to determine the effect of 8-oxodg bypass in the presence of all four human y - family dna polymerases in vitro, a running start assay was performed with an equal molar concentration of all four human y - family enzymes (figure 1i and j). the time required for all of the human y - family enzymes to bypass the 8-oxodg lesion was similar to that of hpol alone, suggesting that in the absence of any auxiliary factors, hpol dominates the replication of both undamaged and damaged dna. furthermore, as with hpol alone, no strong pause sites were observed opposite the lesion (figure 1j). interestingly, the only strong pause site observed in the presence of all four y - family enzymes was an accumulation of the 18-mer product. the only y - family enzyme that produced this strong 18-mer product was hrev1 (figure 1 g and h), suggesting that the accumulation of the 18-mer was due to a single extension by hrev1, followed by sequestration of this 18-mer product by bound hrev1. running start assays performed with the combination of hpol, hpol, and hpol lack this 18-mer product (figure s1, supporting information), indicating that the accumulation of the 18-mer product in the presence of all four enzymes is indeed due to hrev1. we concluded that when the human y - family polymerases were tested in combination, hpol catalyzed the majority of the nucleotide incorporation events. to define the relative lesion bypass efficiency of each y - family polymerase by using established methods, the percent of lesions bypassed by each polymerase with respect to the total number of lesions encountered (8-oxodg bypass%) within the autoradiograms shown in figure 1 was plotted as a function of reaction time (figure s2, supporting information). to compare the relative lesion bypass efficiency of each enzyme, the time required for each polymerase to bypass 50% of the 8-oxodg sites encountered (t50) relative to the replication of 50% of the corresponding dg sites (t50) this qualitative analysis confirmed that the activity of hpol was not reduced by the 8-oxodg lesion. in contrast, the lesion reduced the nucleotide incorporation rate of hpol and hpol by 2.2- and 4.5-fold, respectively. the calculated t50 values also indicated that hpol bypassed the 8-oxodg lesion 186-fold and 1160-fold faster than hpol and hpol, respectively. consistently, the efficiency of 8-oxodg bypass by all four human y - family enzymes combined was nearly identical to that of hpol alone. taken together, these data indicate that in the absence of auxiliary factors, hpol bypassed 8-oxodg more efficiently than either hpol or hpol. calculated as the time required to bypass 50% of the 8-oxodg sites. determined by using the 21-mer/40-mer and 21-mer/40-mer-8oxodg substrates. because hrev1 failed to extend the 17-mer primer past the lesion site within 20 h (figure 1 h), we chose to evaluate the ability of hrev1 to bypass the 8-oxodg lesion by using a standing start primer extension assay. to this end, an undamaged 21-mer/40-mer or damaged 21-mer/40-mer-8oxodg dna substrate (figure 2a) was extended by the action of hrev1 such that the first nucleotide incorporation by hrev1 was opposite either undamaged dg or the 8-oxodg lesion site (figure 2b and c). interestingly, the 8-oxodg lesion reduced the rate of nucleotide incorporation catalyzed by hrev1 opposite the lesion and eliminated the ability of hrev1 to extend the lesion bypass product as indicated by the lack of 23-mer product formation in the presence of 8-oxodg (figure 2c). the plot of dg and 8-oxodg bypass (figure 2d) revealed that 15% of the 8-oxodg lesions were not bypassed within 30 s, compared to only 6% of the undamaged dg sites that were not bypassed within the same time. this result suggests that approximately 9% of the hrev1 that encountered 8-oxodg formed nonproductive complexes due to interactions with the lesion. analyses of the standing - start t50 values indicated that the 8-oxodg lesion reduced the efficiency of hrev1 nucleotide incorporation by 6.8-fold (table 2). thus, of the four human y - family enzymes, hrev1 was most significantly inhibited by the 8-oxodg lesion relative to undamaged dg. however, due to the relatively fast rate of nucleotide incorporation of this enzyme, hrev1 was the second most efficient enzyme to bypass 8-oxodg overall and only 1.5-fold less efficient than hpol (table 2). to examine the ability of hrev1-generated lesion bypass products to be extended, the undamaged 21-mer/40-mer or damaged 21-mer/40-mer-8oxodg dna substrate was extended by the action of either hrev1 alone or in combination with hpol, the y - family enzyme purported to be specialized for the extension step of tls. within 30 s, hrev1 traversed the majority of the dg or 8-oxodg sites as demonstrated by the accumulation of the 22-mer product (figure 2e and f). as previously observed in the running start primer extension assays, these 22-mer products were also not extended to full - length products by the action of hrev1 alone. however, if the control or damaged substrates were reacted with hrev1 for 30 s to allow for the bypass of the lesion or undamaged dg, followed by the addition of hpol to facilitate the extension of the hrev1-generated lesion bypass products, these 22-mer products were extended to full - length within 1 h. thus, although hrev1 is capable of bypassing the 8-oxodg lesion efficiently, a second polymerase is required for the extension of the lesion bypass products. standing start assays for hrev1 and hpol on undamaged and damaged dna templates. the position of the 8-oxodg lesion within the template strand is indicated by a y. a preincubated solution containing 400 nm of hrev1 and 100 nm of 5-[p]-radiolabeled (b) 21-mer/40-mer or (c) 21-mer/40-mer-8oxodg was rapidly mixed with a solution of all 4 dntps (200 m each). the reaction mixtures were quenched at the indicated times with 0.37 m edta and resolved by using denaturing page. the control dg or damaged 8-oxodg bypass% was plotted as a function of reaction time. a preincubated solution containing 100 nm of hrev1 and 100 nm of 5-[p]-radiolabeled (e) 21-mer/40-mer or (f) 21-mer/40-mer-8oxodg was rapidly mixed with a solution of all 4 dntps (200 m each). where indicated, hpol (300 nm) was added to the reaction 30 s after the addition of the dntp solution. to examine the patterns and frequencies of mutations induced by tls of 8-oxodg catalyzed by the y - family dna polymerases, we used ht - sosa as summarized in scheme 1. by using this high - throughput method, greater than two million nucleotide sequences generated from lesion bypass products were analyzed to provide a statistically robust data set (table s2, supporting information). as a control for errors induced by the high - throughput sequencing approach, we calculated the average error rates within a control flanking region (positions 14 to 4 relative to the lesion site) of each sequence, which was initially derived from the 13-mer or 16-mer primers (table 1 and scheme 1). the average base insertion, deletion, and substitution frequencies within this flanking region were found to be 0.014%, 0.055%, and 0.080%, respectively. these rates combined for an overall background error rate of 0.15 0.01% at each template position. this background error rate was at least 51-fold below the error rate of each enzyme opposite the lesion site and more than 10-fold below the background error rate at virtually every other position analyzed within the undamaged or damaged templates. as an additional control, using ht - sosa we calculated the average base substitution error rates for hpol, hpol, and hpol replicating the undamaged, control template to be 1.8 10, 1.5 10, and 1.5 10, respectively. these values are similar to the nucleotide misincorporation fidelities of hpol (2.0 10 to 2.1 10), hpol (3.5 10 to 2.9 10), and hpol (9.3 10 to 1.1 10) as previously determined by presteady - state kinetic assays with undamaged dna substrates, and as previously measured by ht - sosa. therefore, ht - sosa is a viable technique for the study of the mutagenic profiles induced by tls of 8-oxodg catalyzed by the error - prone y - family polymerases. we found that hpol correctly incorporated dctp opposite 8-oxodg in 54.5% of the lesion bypass sequences analyzed (figure 3). therefore, hpol was 15.7-fold more error prone opposite the lesion than opposite template dg. opposite 8-oxodg, hpol misincorporated datp (41.7%) over misincorporating dttp (1.3%) or dgtp (1.2%) and rarely generated a base insertion (0.1%) or deletion (1.3%) mutation. interestingly, this result indicates that even though the nucleotide incorporation rate of hpol opposite undamaged dg and 8-oxodg was almost identical (figure 1a and b, and table 2), hpol was the second most error prone y - family enzyme opposite the lesion site. to compare the hpol error frequency opposite the 8-oxodg lesion to other template positions, we examined the errors generated by hpol both three template positions upstream and downstream from the lesion site (figure 4a and b). this analysis demonstrated that the error rates of hpol were nearly unchanged (within 1.6-fold) at these template positions in the presence or absence of 8-oxodg (tables s3, s4 and s5, supporting information). therefore, the lesion only influenced the error rate of hpol during incorporations opposite from 8-oxodg. comparison of the preferred actions of the human y - family polymerases opposite 8-oxodg or dg. the relative number of nucleotide incorporations, insertion mutations, or deletion mutations produced by each polymerase or polymerase combination opposite template (a) dg or (b) 8-oxodg are indicated. histogram of the relative errors generated by the human y - family dna polymerases as a function of template position. lesion bypass analysis for (a and b) hpol, (c and d) hpol, (e and f) hpol, and (g and h) a combination of all 4 y - family polymerases by using either the undamaged 17-mer/40-mer substrate or the damaged 17-mer/40-mer-8oxodg substrate. the relative number of base insertions (striped bar), substitutions (black bar), and deletions (white bar) as a percentage of the total dntp incorporations are indicated at each template position. y. the indicated template positions are relative to the 8-oxodg lesion site within the 40-mer-8oxodg template. of the four human y - family enzymes, hpol was the most error prone opposite 8-oxodg (figure 3b), preferentially misincorporating datp (78.0%) over correct dctp (18.5%). overall, we found that hpol was 14-fold more error prone opposite the lesion when compared to undamaged dg. interestingly, the hpol error rates at positions downstream from the lesion site were nearly unchanged between the damaged or control templates (figure 4c and d), even though the nucleotide incorporation rate of hpol was reduced at these positions within the primer extension assays (figure 1d). in contrast, at positions upstream from the lesion site, the frequency of base insertion mutations increased by an average of 3.6-fold in the presence of 8-oxodg (tables s3, s6, and s7, supporting information). however, these insertion mutation events were rare, occurring at an average frequency of only 0.16%, indicating that 8-oxodg seldom altered the fidelity of hpol before the lesion entered the polymerase active site. ht - sosa analysis indicated that hpol correctly incorporated dctp and incorrectly incorporated da opposite 8-oxodg in 65.8% and 21.7% of the sequences analyzed, respectively (figure 3). thus, even though 8-oxodg reduced the nucleotide incorporation efficiency of hpol to a greater extent than either hpol or hpol (table 2), hpol was less error - prone than hpol or hpol opposite the lesion. overall, hpol generated more errors than either hpol or hpol at nearly every template position (figure 4e and f). the fidelity of hpol has been shown to be lower opposite template pyrimidines than template purines and to violate normal watson consistently, we observed the fidelity of hpol to be the lowest opposite template base dt followed by dc, dg, and finally da when replicating the undamaged template (figure 4e) and found hpol to preferentially incorporate dg opposite template dt (figure s3, supporting information). although hpol produced a significant number of frameshift mutations while replicating the undamaged control template, the average hpol base deletion rate at template positions downstream from the 8-oxodg site increased by an average of 3.0-fold (tables s3, s8, and s9, supporting information). this increase in the average base deletion error rate of hpol downstream from 8-oxodg indicates that the lesion perturbed nucleotide incorporation by hpol after the lesion exited the polymerase active site. to determine the frequencies and types of mutations induced by 8-oxodg bypass catalyzed by hrev1, the control 16-mer/40-mer substrate or damaged 16-mer/40-mer-8oxodg substrate were first reacted with hrev1 to allow for hrev1-mediated incorporation opposite undamaged dg or the 8-oxodg lesion, respectively. then, because hrev1 is incapable of completely extending similar dna substrates (figure 2e and f), hpol was subsequently added to extend the dna products to full - length for ht - sosa analysis (figure 5). of all the y - family polymerases investigated individually or in combination, we found the combination of hrev1 and hpol was the least error prone opposite 8-oxodg by inserting correct dctp (92.3%) over incorrect datp (6.9%). importantly, the standing start primer extension assays indicated that approximately 15% of hrev1 formed unproductive complexes with the damaged 21-mer/40-mer-8oxodg dna substrate (figure 2d). therefore, we hypothesize that hpol catalyzed a portion of these observed datp incorporation events after the liberation of the 21-mer/40-mer-8oxodg substrate from unproductively bound hrev1. this finding suggests that the error rate of hrev1 opposite 8-oxodg may be even lower than the error frequency observed here. nevertheless, this result is consistent with the demonstrated activity of hrev1 as a specialized dctp transferase, preferentially inserting dctp opposite damaged or undamaged templating bases. thus, we conclude that hrev1 is the best suited y - family polymerase to catalyze error - free tls of 8-oxodg. interestingly, the combination of hrev1 and hpol produced a significant number of deletion mutations at template positions + 1 and + 2 (tables s10 and s11, supporting information). the majority of these deletion mutations are double base deletion mutations, suggesting that these double base deletion mutations arose after hrev1 incorporated two dc nucleotides into the primer strand, followed by realignment of the primer strand to loop out the + 1 and + 2 template positions, and subsequent extension by hpol. this proposed loop out mechanism is consistent with the previously reported ability of hpol to extend primers that contain limited sequence complementarity at the 3 primer terminus. histogram of the relative errors generated by the combination of hrev1 and hpol as a function of template position. sequence analysis of the lesion bypass products generated by the combination of hrev1 and hpol with (a) the undamaged 21-mer/40-mer substrate or (b) the 21-mer/40-mer-8oxodg substrate. the relative number of base insertions (striped bar), substitutions (black bar), and deletions (white bar) as a percentage of the total dntp incorporations are shown at each template position. the template bases are denoted, and the 8-oxodg lesion is represented as y. the indicated template positions are relative to the 8-oxodg lesion site within the 40-mer-8oxodg template. all four human y - family enzymes are present within the nucleus during s - phase. however, the question of how an individual y - family polymerase is recruited to a stalled replication complex in order to bypass a particular lesion in vivo remains unanswered. we hypothesize that the inherent properties of each polymerase, such as affinity for the lesion site and lesion bypass efficiency, are predictive of the potential for each enzyme to bypass a particular lesion in vivo. in order to establish a direct competition between the human y - family enzymes for 8-oxodg bypass, ht - sosa was performed with an equal molar concentration of all four dna polymerases (figure 4 g and h). this combination of all four enzymes misincorporated datp (50.0%) over correctly incorporating dctp (43.5%), misincorporating dgtp (1.2%) or dttp (1.3%), or generating a deletion mutation (4.0%) or an insertion mutation (0.6%). therefore, the fidelity of lesion bypass by the combination of all four human enzymes most closely resembled the 8-oxodg bypass fidelity of hpol alone (tables s4, s5, s12 and s13, supporting information). consistent with the running start primer extension assays (figure 1i and j), we concluded that in the presence of all four human y - family polymerases, hpol catalyzed the majority of nucleotide incorporation events, including opposite the lesion site. therefore, even though hpol is not the best suited human y - family member to catalyze error - free tls of 8-oxodg, the properties hpol allow this polymerase to outcompete hpol, hpol, and hrev1 for bypass of 8-oxodg. the highly mutagenic 8-oxodg lesion is one of the most prevalent lesions induced by oxidative dna damage. in this article, we systematically compared the 8-oxodg bypass efficiencies and fidelities of all four human y - family dna polymerases for the first time in order to predict the enzyme(s) that have evolved to catalyze tls of 8-oxodg in vivo. we conclude that (1) hpol outcompetes hpol, hpol, and hrev1 for nucleotide incorporations opposite 8-oxodg in vitro ; (2) hpol is the only y - family member to traverse 8-oxodg with the same efficiency as undamaged dg ; (3) the efficiency of nucleotide incorporation by hrev1 is most significantly reduced opposite the lesion when compared to incorporations opposite undamaged dg ; (4) hrev1 fails to extend 8-oxodg lesion bypass products ; and (5) the combination of hrev1 to bypass 8-oxodg and a second polymerase to extend the lesion bypass product is the most accurate polymerase combination to perform tls of 8-oxodg, followed by hpol, hpol, and hpol individually. the relative 8-oxodg bypass efficiencies based upon the calculated t50 values of the human y - family polymerases are hpol > hrev1 hpol hpol (table 2). these findings agree with a previous report investigating 8-oxodg bypass by hpol, hpol, and hpol by using a gapped dna substrate strand displacement assay, although hrev1 was not included in that study. importantly, we found that the ability of hrev1 to perform the extension step of tls was almost completely eliminated by 8-oxodg (figure 2c and f). therefore, even though 8-oxodg is efficiently bypassed by hrev1, a switch to a second polymerase is required for the extension step. in fact, this inherent inability of hrev1 to extend the lesion bypass products may promote polymerase switching in vivo. if the switching does not occur, the extension of any lesion bypass product by hrev1 would result in one or more dctp incorporations into dna due to the function of hrev1 as a dctp transferase, likely leading to the substitution or frameshift mutations. thus, we hypothesize that the mostly error - free extension of lesion bypass products generated by hrev1 would be carried out in vivo by a second polymerase, such as hpol or dna polymerase, a b - family polymerase that is also suitable for the extension step of tls. by using ht - sosa, we found that the most common mutation induced by 8-oxodg bypass catalyzed by all four human y - family polymerases either alone or in combination was the incorporation of da opposite 8-oxodg (figure 3b). these results are consistent with previous kinetic studies indicating the predominant substitution catalyzed by hpol, hpol, and hpol opposite 8-oxodg is the misincorporation of datp. this miscoding potential of 8-oxodg is strongly influenced by the ratio of the anti and syn conformations of 8-oxodg within a polymerase active site. interestingly, this dual coding potential of lesions such as 8-oxodg is irrelevant to nucleotide incorporations by hrev1, as structural studies indicate this enzyme uses a novel mechanism whereby incoming dctp interacts and forms two hydrogen bonds with the side chain of arg357 within the n - digit domain of hrev1, rather than the templating base. this dctp transferase activity is also supported by kinetic analysis demonstrating hrev1 preferentially incorporates dctp opposite any templating base, damaged or undamaged. here, we found that the combination of hrev1 and hpol was nearly error - free opposite 8-oxodg (figure 3b). indeed the low frequency of datp incorporation (6.9%) detected by ht - sosa may be due to the displacement of unproductively bound hrev1 by active hpol, which in turn bypassed the lesion and predominantly incorporated datp opposite 8-oxodg. therefore, hrev1 may be almost completely error free when bypassing 8-oxodg. in this study, we demonstrate that when all four human y - family polymerases are tested in combination, hpol outcompetes hpol, hpol, and hrev1 for tls of 8-oxodg (table 2). notably, previous studies indicate that among the human y - family polymerases, hpol possesses the highest efficiency of nucleotide incorporation into undamaged dna substrates and a 2- to 5-fold greater affinity for undamaged dna substrates when compared to that of hpol, hrev1, or hpol. furthermore, it has been shown that the presence of 8-oxodg as a templating base does not reduce the binding affinity of either yeast pol or the model y - family polymerase dpo4 for a dna substrate, suggesting that the y - family polymerases are well suited to accommodate this small lesion within their relatively large active sites, without a reduction in dna binding capacity. thus, the superior dna binding affinity of hpol likely contributes to its dominance within the four enzyme combination assays (figures 1i and j). however, differences in dna binding affinity alone are not sufficient to explain the 100- to 100,000- fold difference in the t50 values between hpol and the other three y - family dna polymerases (table 2). instead, we conclude that a superior nucleotide incorporation efficiency of hpol is the primary contributor to the dominance of hpol for 8-oxodg bypass. importantly, we chose to test the abilities of the human y - family polymerases to bypass 8-oxodg at equal molar concentrations in order to gain insight into the intrinsic abilities of these polymerases to compete for tls of 8-oxodg. however, the relative in vivo expression profiles of the human y - family polymerases under conditions of oxidative dna damage are not known. indeed the expression of each of the y - family polymerases may not be similar between cell types or may be dynamic during the cell cycle. further studies are especially needed to elucidate the regulation of the expression and activities of the y - family polymerases in response to cellular dna damage in vivo, which remains an important, unanswered question. eukaryotes utilize a number of mechanisms to reduce the mutagenic consequences of 8-oxodg, including (1) excision of the damaged base from 8-oxodgdc pairs by 8-oxoguanine dna glycosylase 1 (ogg1) to initiate base excision repair (ber), (2) excision of the da base from 8-oxodg : da mispairs by myh adenine glycosylase to facilitate a new incorporation event opposite the lesion, and (3) hydrolysis of 8-oxodgtp to 8-oxodgmp by mth1 to prevent incorporation of the damaged dntp into replicating dna. despite these important repair mechanisms, 8-oxodg lesions do persist during s - phase and are encountered by the replication fork. the majority of mutations induced by 8-oxodg in vivo are g t transversion mutations, indicating that the error - prone tls of 8-oxodg principally results in datp misincorporation. our finding that hpol outcompetes hpol, hpol, and hrev1 for nucleotide incorporation opposite 8-oxodg is most consistent with a model wherein hpol is the predominant y - family member to catalyze the error - prone bypass of 8-oxodg in vivo. however, in the absence of functional pol, another y - family polymerase may catalyze the bypass 8-oxodg. consistently, plasmid - based mutation assays conducted within wild - type or hpol-deficient human cell lines demonstrated that in the absence of hpol, the action of an unknown polymerase increased the total 8-oxodg - induced mutation frequency by 1.2- to 2-fold, primarily due to an increase in g t transversion mutations. our data suggest that hpol is the unknown polymerase since it is the only y - family enzyme which misincorporates datp opposite 8-oxodg with a higher frequency than hpol (figure 3b). the elucidation of which tls - specialized polymerases are responsible for the error - free or error - prone bypass of specific types of dna lesion sites in vivo remains an unanswered and challenging question. here, we used primer extension assays paired with the recently established ht - sosa approach to directly compare the efficiency and fidelity of 8-oxodg bypass catalyzed by each of the human y - family polymerases individually and in combination. overall, our data indicate that even though hpol is error - prone opposite 8-oxodg, the superior efficiency of hpol for tls of 8-oxodg suggests that this enzyme is the primary y - family enzyme to catalyze the bypass of 8-oxodg in vivo. however, we can not completely rule out a role for the other three y - family members for tls of 8-oxodg in vivo. indeed, many dna polymerases may catalyze the bypass of 8-oxodg lesions in vivo to different extents. the comprehensive biochemical studies reported here will provide a basis for further evaluation of these possibilities by in vivo studies.
|
one of the most common lesions induced by oxidative dna damage is 8-oxo-7,8-dihydro-2-deoxyguanosine (8-oxodg). replicative dna polymerases poorly traverse this highly mutagenic lesion, suggesting that the replication fork may switch to a polymerase specialized for translesion dna synthesis (tls) to catalyze 8-oxodg bypass in vivo. here, we systematically compared the 8-oxodg bypass efficiencies and fidelities of the tls - specialized, human y - family dna polymerases eta (hpol), iota (hpol), kappa (hpol), and rev1 (hrev1) either alone or in combination. primer extension assays revealed that the times required for hpol, hrev1, hpol, and hpol to bypass 50% of the 8-oxodg lesions encountered (t50bypass) were 0.58, 0.86, 108, and 670 s, respectively. although hrev1 bypassed 8-oxodg efficiently, hrev1 failed to catalyze the extension step of tls, and a second polymerase was required to extend the lesion bypass products. a high - throughput short oligonucleotide sequencing assay (ht - sosa) was used to quantify the types and frequencies of incorporation errors produced by the human y - family dna polymerases at and near the 8-oxodg site. although hpol bypassed 8-oxodg most efficiently, hpol correctly incorporated dctp opposite 8-oxodg within only 54.5% of the sequences analyzed. in contrast, hpol bypassed the lesion least efficiently but correctly incorporated dctp at a frequency of 65.8% opposite the lesion. the combination of hrev1 and hpol was most accurate opposite 8-oxodg (92.3%), whereas hpol alone was the least accurate (18.5%). the t50bypass value and correct dctp incorporation frequency in the presence of an equal molar concentration of all four y - family enzymes were 0.60 s and 43.5%, respectively. these values are most similar to those of hpol alone, suggesting that hpol outcompetes the other three y - family polymerases to catalyze 8-oxodg bypass in vitro and possibly in vivo.
|
amyotrophic lateral sclerosis (als) is a rapidly progressive, fatal degenerative disorder, involving the first and foremost motor neurons of the cerebral cortex, brainstem and spinal cord. the world federation of neurology (wfn) research group on motor neuron diseases have developed the 1994 el escorial diagnostic criteria and the revised 2000 criteria, to assist in identifying and classifying als patients for investigational studies. there are a number of als syndromes that must be recognized, these include : sporadic als : most of the cases are sporadic als, occurring alone or present incidentally with other preexisting disease processes. familial or hereditary als : a minority of patients that als manifests in one or more generations, associated with different modes of inheritance. als - mimic syndromes : this syndromes present as a result of other pathogenic processes and do not represent other forms of als. als with laboratory abnormalities of uncertain significance (als - laus) : als occurring in association with laboratory defined abnormalities that are of uncertain significance to the pathogenesis of als and since it seems to be untreatable, all efforts must be directed to exclude other diagnoses. in addition, electrodiagnostic investigations typically comprise neuroimaging studies to exclude anatomic structural disorder such as cervical myelopathies, and typical laboratory investigations to search for any latent treatable metabolic abnormality. als - laus includes patients with clinically definite or clinically probable als associated with : autoantibodies (high - titer gm1 ganglioside antibody, etc.), endocrine abnormalities (hyperthyroidism, hyperparathyroidism, etc.), monoclonal gammopathy (monoclonal gammopathy of unknown significance, waldenstrom 's macroglobulinemia, osteosclerotic myeloma, etc.), infection (hiv-1, htlv-1, varicella - zoster, brucellosis, etc.), lymphoma (hodgkin 's and non - hodgkin 's lymphoma) and exogenous toxins (e.g. lead, mercury, aluminum). there have been various reports of patients with both monoclonal gammopathy and motor neuron disease (mnd). monoclonal antibodies are produced by expanded single b - cell clones and are variously recognized as monoclonal protein, m protein, m component, monoclonal gammopathy, or paraprotein. the non - malignant monoclonal gammopathies have been identified as monoclonal gammopathies of undetermined significance. the medical literature suggests that patients with mnd may have a higher incidence of lymphoproliferative disorders (lpd). when mnd does occur in association with lpd, it appears to have both upper motor neuron (umn) and lower motor neuron (lmn) involvement compatible with a diagnosis of als. the association between mnd and lpd could be accidental, but lpd seems to be unduly common in patients with mnd compared to the general population. despite an initial report suggesting that major improvements occurred occasionally with reductions in paraprotein levels using immunomodulatory treatments even in some patients who had the clinical appearance of als, most of the subsequent literature disagreed. showed that most of the patients with mnd with lpd had hodgkin 's or non - hodgkin 's lymphoma, such as myeloma or macroglobulinemia. among these patients, only some had a favorable neurological response to immunotherapy, and most died of the neurological disease. other reports highlight the association of mnd and the presence of a lymphoplasmacytoid infiltration of waldenstrom 's macroglobulinemia in particular, and the lack of neurologic improvement after treatment of the underlying disorder with plasmapheresis and immunosuppressive therapy. the association of muscle weakness with primary hyperparathyroidism (php) dates back to the 1800s, and since then numerous patients have been reported with php, muscle weakness, hyper - reflexia, and muscle atrophy. there were even reports of patients with php, and signs of als who underwent parathyroid adenoma resection and demonstrated improved muscle performance. however, rodriguez. reported on a series of patients with the diagnosis of als and concluded that there was no pathogenic association between thyroid or parathyroid dysfunction and als. jackson. reported five patients with als and php that underwent parathyroid adenoma resection. each patient subsequently had normal serum calcium and pth levels, but unfortunately they all had progressive weakness that eventually resulted in death within 3 years. patients with php often have brisk muscle stretch reflexes with flexor or extensor plantar responses. severe respiratory muscle and bulbar involvement resulting in hoarseness and dysphasia, as well as abnormal tongue movements have been reported in php. however, there are some important differences between als and php symptoms. patients with php may develop muscle weakness and atrophy in lower limbs that tends to be symmetric and involves predominately the proximal muscles. patients with php may also have associated ataxia and abnormal upper limb posturing along with cognitive dysfunction, emotional lability, personality changes, anxiety, and hallucinations. although there are remarkable correlations between php and mnd, most of the literature does not indicate a conclusive relationship between als and hyperparathyroidism and its treatment does not lead to improvement of mnd. by 2002, there had been reports of 19 patients with mnd, with no evidence that hiv infection increases the likelihood of developing als. most of them had a disorder that was unlike als in one major way, the rapidity of progression. the time from onset of symptoms to severe disability was in weeks and not months. csf protein content was increased in most cases, but the most remarkable difference from als was the regression of symptoms by the treatment of infection. therefore, als in hiv - positive people may take either of two forms, one that responds to treatment and another that does not. predictors of therapeutic response are young age at onset, progression in days or weeks, and abnormal csf. the unresponsive form may be sporadic als that occurs by chance. in htlv-1 infection, als syndrome has been described, but in some cases chance could not be excluded. typically, htlv-1-infected patients with symptoms and signs suggestive of als have a high htlv viral load and present symptoms and sings suggestive of tropical spastic paraparesis jointly with symptoms and signs typical of als. in general, these patients tend to progress more slowly than typical sporadic als. thus, patients from endemic areas with symptoms and signs suggestive of als combined with sensory symptoms or bladder dysfunction should be tested for htlv infection. saadatnia., described a 55-year - old persian man with typical presentation of als in whom raised level of antiphospholipid antibodies was found. after 3 months of treatment, the symptoms improved and antiphospholipid antibody titres decreased. furthermore, a small number of studies have described the association of als with systemic lupus erythematous (sle) even with neurolupus. als - laus includes patients with clinically definite or clinically probable als associated with : autoantibodies (high - titer gm1 ganglioside antibody, etc.), endocrine abnormalities (hyperthyroidism, hyperparathyroidism, etc.), monoclonal gammopathy (monoclonal gammopathy of unknown significance, waldenstrom 's macroglobulinemia, osteosclerotic myeloma, etc.), infection (hiv-1, htlv-1, varicella - zoster, brucellosis, etc.), lymphoma (hodgkin 's and non - hodgkin 's lymphoma) and exogenous toxins (e.g. lead, mercury, aluminum). there have been various reports of patients with both monoclonal gammopathy and motor neuron disease (mnd). monoclonal antibodies are produced by expanded single b - cell clones and are variously recognized as monoclonal protein, m protein, m component, monoclonal gammopathy, or paraprotein. the non - malignant monoclonal gammopathies have been identified as monoclonal gammopathies of undetermined significance. the medical literature suggests that patients with mnd may have a higher incidence of lymphoproliferative disorders (lpd). when mnd does occur in association with lpd, it appears to have both upper motor neuron (umn) and lower motor neuron (lmn) involvement compatible with a diagnosis of als. the association between mnd and lpd could be accidental, but lpd seems to be unduly common in patients with mnd compared to the general population. despite an initial report suggesting that major improvements occurred occasionally with reductions in paraprotein levels using immunomodulatory treatments even in some patients who had the clinical appearance of als, most of the subsequent literature disagreed. showed that most of the patients with mnd with lpd had hodgkin 's or non - hodgkin 's lymphoma, such as myeloma or macroglobulinemia. among these patients, only some had a favorable neurological response to immunotherapy, and most died of the neurological disease. other reports highlight the association of mnd and the presence of a lymphoplasmacytoid infiltration of waldenstrom 's macroglobulinemia in particular, and the lack of neurologic improvement after treatment of the underlying disorder with plasmapheresis and immunosuppressive therapy. the association of muscle weakness with primary hyperparathyroidism (php) dates back to the 1800s, and since then numerous patients have been reported with php, muscle weakness, hyper - reflexia, and muscle atrophy. there were even reports of patients with php, and signs of als who underwent parathyroid adenoma resection and demonstrated improved muscle performance. however, rodriguez. reported on a series of patients with the diagnosis of als and concluded that there was no pathogenic association between thyroid or parathyroid dysfunction and als. jackson. reported five patients with als and php that underwent parathyroid adenoma resection. each patient subsequently had normal serum calcium and pth levels, but unfortunately they all had progressive weakness that eventually resulted in death within 3 years. patients with php often have brisk muscle stretch reflexes with flexor or extensor plantar responses. severe respiratory muscle and bulbar involvement resulting in hoarseness and dysphasia, as well as abnormal tongue movements have been reported in php. however, there are some important differences between als and php symptoms. patients with php may develop muscle weakness and atrophy in lower limbs that tends to be symmetric and involves predominately the proximal muscles. patients with php may also have associated ataxia and abnormal upper limb posturing along with cognitive dysfunction, emotional lability, personality changes, anxiety, and hallucinations. although there are remarkable correlations between php and mnd, most of the literature does not indicate a conclusive relationship between als and hyperparathyroidism and its treatment does not lead to improvement of mnd. by 2002, there had been reports of 19 patients with mnd, with no evidence that hiv infection increases the likelihood of developing als. most of them had a disorder that was unlike als in one major way, the rapidity of progression. the time from onset of symptoms to severe disability was in weeks and not months. csf protein content was increased in most cases, but the most remarkable difference from als was the regression of symptoms by the treatment of infection. therefore, als in hiv - positive people may take either of two forms, one that responds to treatment and another that does not. predictors of therapeutic response are young age at onset, progression in days or weeks, and abnormal csf. the unresponsive form may be sporadic als that occurs by chance. in htlv-1 infection, als syndrome has been described, but in some cases chance could not be excluded. typically, htlv-1-infected patients with symptoms and signs suggestive of als have a high htlv viral load and present symptoms and sings suggestive of tropical spastic paraparesis jointly with symptoms and signs typical of als. in general, these patients tend to progress more slowly than typical sporadic als. thus, patients from endemic areas with symptoms and signs suggestive of als combined with sensory symptoms or bladder dysfunction should be tested for htlv infection. saadatnia., described a 55-year - old persian man with typical presentation of als in whom raised level of antiphospholipid antibodies was found. after 3 months of treatment, the symptoms improved and antiphospholipid antibody titres decreased. furthermore, a small number of studies have described the association of als with systemic lupus erythematous (sle) even with neurolupus. als - laus meets the clinical and electrophysiological criteria for clinically probable or clinically definite als but has laboratory - defined features which may be relevant to the development of the als phenotype, or may be coincidental finding. owing to a relentless progression of als towards death, all efforts must be made by the clinician to exclude alternative and more treatable entities.
|
amyotrophic lateral sclerosis (als), the most common form of motor neuron disease, is a progressive and devastating disease involving both lower and upper motor neurons, typically following a relentless progression towards death. therefore, all efforts must be made by the clinician to exclude alternative and more treatable entities. als with laboratory abnormalities of uncertain significance is a subgroup of als that occurs in association with laboratory defined abnormalities that are of uncertain significance to the pathogenesis of als. the clinical utility of these abnormalities and what they ultimately mean in patients with als is discussed here, along with a review of the literature.
|
the prevalence of overweight and obesity in the united states has increased at an alarming rate over the past several decades [1, 2 ], and large disparities between racial and socioeconomic groups have been documented. different levels of education, suggested as the single most important social influence on health, likely contribute to these obesity disparities [57 ], and explanations for the positive association between educational attainment and health are well established. for instance, gradients in health by educational attainment have been long recognized with greater years of education generally associated with healthier behaviors (e.g., no smoking, physical activity, drinking in moderation) as well as access to resources that lead to greater perceived health and physical functioning in addition to lower levels of morbidity and mortality compared to individuals with less years of education [8, 9 ]. years of education also appears to be monotonically and linearly associated with cognitive development that my influence health - reasoning ability leading to adoption of prevention strategies that protect health [10, 11 ]. associations between educational attainment and overweight / obesity by race and sex, however, remain complex and difficult to understand and mitigate. acknowledging that few studies have explored race - specific trends in overweight / obesity according to levels of educational attainment over time [2, 5 ], we identified a study with a nationally representative us sample that reported noteworthy differences between men and women as well as across racial / ethnic groups. while obesity prevalence increased in all race - sex groups from 1971 to 2000, white women had a clear inverse association between obesity and educational attainment over time, and white men in the low socioeconomic status (ses) group experienced a decrease in obesity from 1999 to 2002. in black women, the association between obesity prevalence and education switched from inverse to the medium - ses group having the highest prevalence by 1999, and obesity increased at a much faster pace among low - ses black men in comparison to their other ses groups. the majority of prior studies have had limited power to robustly investigate racial trends, and have included few black participants [1, 5, 12 ]. some studies have relied on nonrepresentative samples, focused on obesity (excluding overweight) or included only one racial / ethnic group [5, 6, 1316 ]. to gain a better understanding of current temporal trends related to the influence of educational attainment on overweight / obesity disparities while addressing important gaps in the literature, we used a considerably large, nationally representative sample of the noninstitutionalized us black and white population. we hypothesized that (1) the prevalence of overweight and obesity will have reached a peak among blacks over time, with whites steadily catching up and (2) the racial disparity in overweight / obesity will be wider in groups with higher compared to lower educational attainment, especially among women. we analyzed data from nhis a series of cross - sectional, nationally representative surveys which used a three - stage stratified cluster probability sampling design to conduct in - person interviews in samples of noninstitutionalized us civilian households. a complete description of nhis procedures is available elsewhere. in short, each week (on a continuous basis throughout the calendar year), a probability sample of households was interviewed by trained personnel from the us bureau of the census to obtain information about health and other characteristics of each member of the sampled household. information collected for all family members included household composition and sociodemographic characteristics, as well as indicators of health status, activity limitations, injuries, health insurance coverage, and access to and utilization of health care services. from each sampled family, one adult and one child (not included in this analysis) were randomly selected to provide more extensive health - related information. the 12-year average survey response rate among sampled adults was 71.8% (range : 62.680.4%). our study was approved by the institutional review board 's committee on human research of the johns hopkins bloomberg school of public health. participants included self - reported non - hispanic white or non - hispanic black (henceforth, white and black) adults aged 25 through 75 years. participants were excluded if they (1) were born outside the us ; (2) reported having a history of cancer and/or heart disease ; (3) were pregnant ; (4) had missing data on height, weight, educational attainment, or smoking status ; or (5) had an extreme body mass index (bmi)that is, either 55 kg / m. our final sample comprised of 174,228 adults (figure 1). self - reported height and weight were used to calculate bmi (kg / m). obesity was defined as bmi 30 kg / m, overweight as 25.029.9 kg / m, normal weight as 18.524.9 kg / m, and underweight as bmi hs) (any education beyond high school). lifetime alcohol drinking status was assessed and categorized as either ever or never. leisure - time physical activity was categorized as none, low, or high based on the participant 's answer to the following questions : (1) how often do you do light or moderate leisure - time physical activities for at least 10 minutes that cause only light sweating or a slight to moderate increase in breathing or heart rate ? and (2) how often do you do vigorous physical activities for at least 10 minutes that cause heavy sweating or a large increase in breathing or heart rate ? individuals who answered never or those engaging in at least some level of activity and providing a specific number of activity bouts were dichotomized at the midpoint of these bouts into low or high. marital status was categorized as married / living with partner, divorced / separated / widowed, or never married, and regions of the country as south, midwest, northeast, and west. we used 12 years (19972008) of nhis data merged by the integrated health interview series, a federal effort to create consistent codes and documentation based on public - use data files of the nhis. for all analyses, sampling weights that account for the unequal probabilities of selection resulting from the sample design, nonresponse, and oversampling of certain subgroups were used. command was used for correct variance estimation of estimates, and different sampling designs in 1997 to 2005 versus 2006 to 2008 were accounted for by the integrated health interview series. modeling assumptions were evaluated where appropriate, and a two - sided p value < 0.05 was considered statistically significant. stata statistical software version 12 (stata corporation, college station, texas, usa, 2007) was used for all analyses. continuous variables were expressed as means standard errors (se), whereas categorical variables were presented as absolute values with corresponding percentages. to test for differences in prespecified sociodemographic, clinical, and behavioral characteristics between whites and blacks and by obesity status poisson regression models were used to estimate prevalence ratios and corresponding 95% confidence intervals adjusted for age (in 4 categories : 2534, 3549, 5064, and 6575 years), marital status, smoking status, alcohol consumption, leisure - time physical activity level, and region of the country. to obtain prevalence ratios for the entire sample, we pooled survey years from three time periods (19972000, 20012004, and 20052008) based on the assumption that the black - white differences in mean bmi remained largely proportional and without crossovers between races by educational level within these study periods. whites were used as the reference categories for the black - white comparisons. differences in linear trends in mean bmi from 1997 to 2008 between blacks and whites within each educational attainment category were formally tested (at the = 0.05 level) using sex - specific multivariable - adjusted linear regression models where survey year was treated as a dummy variable. sociodemographic, clinical, and behavioral characteristics of the final sample of 174,228 nhis study participants are shown by race and educational attainment in table 1. the mean age was 45.8 0.05 years (se), 51% were men, and 87% were non - hispanic white. forty - six percent of all participants reported ever smoking in their lifetime, 32% never consumed alcohol, and 34% never engaged or were unable to engage in leisure - time physical activity. participants ' mean bmi was 27.8 0.02 kg / m for men and 26.8 0.03 kg / m for women ; 26% were obese, 24% reported a diagnosis of hypertension, 6% reported having diabetes, and 10% reported their general health status as either fair or poor. blacks were slightly younger than whites, less likely to be married, and more likely to reside in the southern region of the united states. blacks were more likely to have less than a high school education, to be obese, to report having hypertension, to report never consuming alcohol, and to report having no leisure - time physical activity. we compared participants with complete data versus their counterparts with missing data and found no significant differences in age, sex, race, health status, poverty status, or household size. from 1997 to 2008, bmi increased by at least 1 kg / m in all race - sex - education groups (except black men with less than high school education), and mean bmi appeared to increase at a faster pace among whites compared to blacks (figure 2). black women had higher mean bmis compared with white women across the entire study period and across levels of educational attainment, although the greatest racial disparity occurred in women with more than a high school education. in contrast, mean bmi, in black and white men were similar, except among men with more than a high school education, where black men had higher bmis. although white women remained the leanest group throughout the study period, their mean bmi exceeded 26 kg / m by the end of the study period. among those with greater than a high school education, blacks had a consistently higher bmi over time than whites in both women (28.3 0.14 to 29.7 0.18 kg / m versus 25.8 0.58 to 26.5 0.08 kg / m) and men (28.1 0.17 kg / m to 29.0 0.20 versus 27.1 0.04 kg / m to 28.1 0.06 kg / m). while mean bmis were different by race (especially among women) the unadjusted slope of bmi increase was significantly different for men (p for interaction < 0.001) and women (p for interaction < after adjustment for age, marital status, smoking status, leisure - time physical activity, alcohol consumption, poor income, region of country and self - reported general health status, the slope differences remained significant for men but not for women (p for interaction = 0.44). black men with less than a high school education had stable mean bmis over time compared to their white counterparts whose bmis increased over the study period (p for interaction = 0.02). black women had substantially higher bmis than white women, but the rate of bmi increase did not differ between races with educational attainment combined (p for interaction = 0.02) or for any specific level of education. figure 3 shows that the black - white overweight / obesity disparity was greatest for women and at education levels greater than high school, which persisted over the study period. for participants of all levels of educational attainment, age - adjusted overweight / obesity was greater by 44% (95% ci : 1.421.46) in black versus white women and 2% (95% ci : 1.011.04) in black versus white men. among those with more than a high school education, prevalence of overweight / obesity was much higher (pr 1.52 ; 95% ci : 1.491.55) in black versus white women, but only slightly higher (pr 1.07 ; 95% ci : 1.051.09) in black versus white men. the disparity in overweight / obesity among blacks and whites appears highest among those with more than a high school education for both men and women. this disparity decreased over time as the prevalence of overweight / obesity appears to increase more rapidly for whites compared to blacks. our analysis of overweight / obesity prevalence trends by sex, race, and educational attainment among us - born non - hispanic black and white adults showed that bmi has increased steadily from 1997 to 2008 in all race - sex and education groups, with the exception of black men with less than a high school education, whose prevalence of obesity appeared steady. the racial disparity in overweight / obesity prevalence remained largely proportional over time for each respective education group among women, but the disparity differed by level of educational attainment among men. as a result of the rate of bmi increase being lowest among black men with less than a high school education, there is currently little difference in bmi between black and white men. although white women remained the leanest group throughout the study period, their mean bmi was above 26 kg / m at the end of the study. the coronary artery risk development in young adults (cardia) study included participants (5,115 black and white men and women) with ages that ranged from 18 to 30 years and found an inverse, cross - sectional association of education with obesity among white women, a positive association among black men, and no significant relationship among both white men and black women. cardia participants with limited age ranges had bmi measurements taken once in the late 1980s and were recruited from 4 urban areas of the usa. nonetheless, this population may not be nationally representative. another study without trend data found that the largest racial / ethnic disparity in obesity was between us - born black and white women. however, this study also found that high education attenuated the black - white disparity among women and increased the disparities in men, which was in contrast to our study findings. they used data collected from 1988 to 1994 and employed a concentration index to assess socioeconomic inequality in the distribution of obesity. using nhanes data pooled from 1999 to 2000, overall, persons in the united states with less than a high school education had a higher prevalence of obesity than their counterparts with more education, with the exception of black women with less than a high school education who had the lowest obesity prevalence compared to those with a higher level educational attainment. in contrast, our study found that the highest overweight / obesity prevalence rates were observed in black women with less than a high school education. we identified two studies that investigated time trends in racial differences in obesity prevalence by ses [2, 5 ]. as previously mentioned, zhang and wang investigated trends using the national health and nutrition examination survey (nhanes) data and found that obesity increased in a complex manner among all ses groups by race / ethnicity and sex from 1971 to 2000. between 1976 and 2002, obesity in high- and medium - ses groups of black women increased at a higher rate than low - ses groups. obesity in the low - ses group of black men increased at a pace faster than other ses groups while the prevalence decreased for white men in the low - ses group between 1988 and 2002. another study investigated trends in obesity over time using nhanes data from 1999 to 2004 and found that obesity increased in adults at all education levels. they also found no significant trend in obesity by education among men, but in women a college education was related to a lower prevalence of overweight / obese in comparison to those with less education. in our study, the overweight / obesity disparities increased as educational level increased among blacks and whites for both men and women. the racial difference in overweight / obesity for men was significant only in those with greater than a high school education. these studies had limited sample sizes (especially for black men and women) as well as survey years that only slightly overlapped with our study period. results may have also differed because nhanes has measured heights and weights to calculate bmi while nhis relies on self - reported data. results based on self - reported data from the behavioral risk factor surveillance system (brfss), for instance, showed a clearer linear relation between obesity and education in all race - sex groups compared to nhanes. similar to our findings, these rates among black women declined with increasing education, although they remained higher than those of white women for all educational levels. although few studies with nationally representative data report small differences in weight and height self - reporting error between blacks and whites of both genders [2225 ], the majority of studies conclude that there are no significant differences in weight and height self - reporting error between blacks and whites [2631 ]. yun. concluded that the brfss (using self - reported data) can correctly identify the population with the highest overweight / obesity burden but did not appear to accurately rank obesity prevalence across various demographic groups (i.e., race and education). they found that the prevalence of obesity based on self - report was approximately twenty percentage points lower than measured data for black women with more than a high school education, which was substantially greater than for other race - sex groups. the discrepancy between nhanes and brfss data, therefore, suggests that a difference in self - reported versus measured height and weight data in determining overweight and/or obesity prevalence may be most pronounced among black women. however, the brfss collected self - reported height and weight data using telephone surveys, a different modality with stronger associated biases than with in - person interviews used in nhis. nonetheless, if these results are accurate, our findings would merely be conservative estimates of overweight / obesity prevalence for black women (in particular).. suggested mechanisms for the generally inverse education - overweight / obesity association include differences in healthy lifestyles and social - psychological resources, in addition to work and economic conditions. a higher educational level has also been shown to encourage health information seeking and comprehension and may act as a builder of social capital and increased personal control of health. through economic and social advancement, individuals with more education are likely to have, achieve, or maintain high social status or occupations with more earning potential, prestige, and control over decision - making [4, 8 ]. educational attainment may specifically influence racial / ethnic disparities in overweight / obesity trends as it has been shown to shape an individual 's ses and access to resources (e.g., grocery stores with fresh produce) and opportunities (e.g., sidewalks for physical activity) that afford or compromise healthy lifestyles and weight status through historical and pervasive differential acquisition of occupations, incomes, and neighborhood choices [7, 34 ]. supportive relationships and social support, self - image related to desired weight, knowledge of nutrition, and access to tools for weight control are also likely contributors to observed disparities [7, 34 ]. although it has been widely accepted that low - ses us groups are at increased risk of obesity, complexities still exist regarding relationships of sex, ethnicity, and ses with obesity [36, 37 ]. less - educated persons in the usa have been consistently shown to have a higher prevalence of obesity than their more educated counterparts, with the exception of black women. black women with less than a high school education have been shown to have the lowest obesity prevalence compared to black women with higher educational levels. first, our data are based on self - report, and thus differential misclassification by race in ascertaining height and weight to estimate bmi is possible. second, the three educational levels were fairly broad, and it is likely that blacks are closer to the lower cut - off of each education level than whites, which may result in residual confounding. additionally, even at the same levels, education, as a marker of ses, may not have the same social and health benefits or construct validity across racial / ethnic groups [5, 14 ]. important to our relationships of interest, we were also unable (like many studies) to assess education quality versus attainment, adjust for finer categories of smoking status, which is associated with lower bmi, or discern cohabiting couples from those who were married or single. despite these limitations, first, the sample size was large, allowing stratification by race and educational attainment. second, we had a relatively large black population, which affords more robust estimates than those from previous studies as this is the largest sample of the us population. these data help enable planners to develop more effective public health strategies and direct resources to subpopulations with exceptionally high (or increasing) obesity for targeted intervention and in - depth research. as most race - sex - education groups have been affected by the obesity epidemic, a growing consensus of stakeholders agrees that population - based policies and programs emphasizing environmental changes are most likely to be successful in addressing the obesity epidemic. this study underscores substantial and complex differences in obesity prevalence by education (especially among women), which have persisted over time. black women with greater than a high school education had substantially higher mean bmis than even white women with less than a high school education. our study suggests that mean bmi appears to be increasing at a faster pace among whites than blacks and racial disparities in overweight / obesity trends and prevalence were more prominent among more educated individuals as compared to their less - educated counterparts. higher education does not appear protective against the obesity epidemic nor racial / ethnic disparities in overweight / obesity.
|
background. few studies have examined racial and educational disparities in recent population - based trends. methods. we analyzed data of a nationally representative sample of 174,228 us - born adults in the national health interview survey from 1997 to 2008. we determined mean bmi trends by educational attainment and race and black - white prevalence ratios (prs) for overweight / obesity (bmi > 25 kg / m2) using adjusted poisson regression with robust variance. results. from 1997 to 2008, bmi increased by 1 kg / m2 in all race - sex groups, and appeared to increase faster among whites. blacks with greater than a high school education (ghse) had a consistently higher bmi over time than whites in both women (28.3 0.14 to 29.7 0.18 kg / m2 versus 25.8 0.58 to 26.5 0.08 kg / m2) and men (28.1 0.17 kg / m2 to 29.0 0.20 versus 27.1 0.04 kg / m2 to 28.1 0.06 kg / m2). for participants of all educational attainment levels, age - adjusted overweight / obesity was greater by 44% (95% ci : 1.421.46) in black versus white women and 2% (1.011.04) in men. among those with ghse, overweight / obesity prevalence was greater (pr : 1.52 ; 1.491.55) in black versus white women, but greater (1.07 ; 1.051.09) in men. conclusions. bmi increased steadily in all race - sex and education groups from 1997 to 2008, and blacks (particularly women) had a consistently higher bmi than their white counterparts. overweight / obesity trends and racial disparities were more prominent among individuals with higher education levels, compared to their counterparts with lower education levels.
|
antiretroviral drugs are medication for treatment of infection by retroviruses, primarily human immunodeficiency virus (hiv). when several such drugs, typically three or four, are taken in combination, the approach is known as highly active antiretroviral therapy, or haart. the american national institute of health and other organizations recommend offering antiretroviral treatment to all patients with aids. because of the complexity of selecting and following a regimen, the severity of the side effects and the importance of compliance to prevent viral resistance, such organizations emphasize the importance of involving patients in therapy choices and recommend analyzing the risks and the potential benefits to patients with low viral loads. there is no doubt that haart has been the most important progress in the therapy of hiv - infected patients in the last decade. a growing number of observations suggest that the beneficial effects of haart also include improvement of hiv - related haematological complications. current guidelines for treatment of human immune - deficiency virus (hiv) infection recommend the combination of three antiretroviral agents, two reverse transcriptase inhibitors (rtis) plus one protease inhibitor, or the association of three rtis [1, 3 ]. these regimens of haart have dramatically reduced the morbidity and mortality of hiv infection. the values of haematologic parameters are affected by a number of factors even in apparently healthy populations. these factors include age, sex, ethnic background, body build, and social, nutritional, and environmental factors, especially altitude [46 ]. it has also been shown in several studies that some of the heamatological parameters exhibit considerable variations at different periods of life and disease conditions [79 ]. although haart has dramatically improved survival in hiv - infected patients, precautions still need to be taken to prevent haart - related haematotoxicity and other life - threatening side - effects. due to the fact that there are no available preclinical safety data on the treatment with the combinations of lamivudine, zidovudine, and nevirapine in animals, the aim of the present study was to examine the potential haematotoxicity of combinations of lamivudine, zidovudine, and nevirapine in albino wistar rats. the three (3) fixed - dose antiretroviral combination drugs used for the study were obtained from one of the accredited united states presidential emergency plan for aids relief (pepfar) centers in enugu, enugu state, nigeria. the haart considered in the study was a fixed - dose combinations (fdcs) of lamividine (150 mg), zidovudine (300 mg), and nevarapine (200 mg) per tablet. 313, bachupally village, quthubullapur mandal, ranga reddy district (a.p) india. this was according to the guidelines issued by world health organization (who), geneva, switzerland and the indian national science academy (insa), new delhi, india on the care and use of laboratory animals. the albino wistar rats which were three (3) months old and weighing 200250 g were selected from the colony maintained under the controlled conditions of temperature (33 2c), humidity, and light (12 hours of light and dark) in the animal house of university of nigeria, enugu campus (unec), enugu, enugu state, nigeria. the animals had free access to food (standard pellet diet, starter feed) and clean tap water. the animals were housed in standard environmental conditions in wire - mesh - bottomed stainless steel cages. fifty (50) three (3) months old male albino wistar rats weighing between 200250 g were randomly assigned to five (5) groups (a, b, c, d, and e) according to similar body weight with ten (10) animals per group. groups b, c, d, and e received graded doses (3, 6, 12, and 24 mg / kg body weight, resp.) two (2 mls) of venous blood was aseptically collected on days 5, 10, 15, 20, and 25 of treatment after overnight fasting from each animal into tripotassium ethylene diamine tetra acetic acid (k3edta) anticoagulant bottle. this was immediately mixed by gentle inversion and used in the determination of the haematological profile using a haematology auto analyser (sysmex kx-2 in) following the manufacturer 's guidelines. two (2) animals were bled painlessly under chloroform anesthesia by ocular puncture through the retro - bulber plexus of the medial canthus. data were analysed using students ' t-test and one - way analysis of variance (anova) to determine significant differences between means. red blood cells (rbcs) count mean value recorded statistically significant increase (p 0.05) in all the parameters evaluated when the test groups was compared with the control group on day 20 (table 4). however, only total wbc showed a statistically significant decrease (p 0.05) in all the parameters evaluated when the test group were compared with the control on day 25. the most probable explanation may be that in the test groups, the animals must have adapted or adjusted to its normal body physiology through a negative feedback mechanism, hence, must have compensated for the reduction in some blood parameters at the start of drug administration. however, this was disproved by a statistically significant decrease (p < 0.05) in the total wbc on day 25 in groups c and e indicating that the drug may possess both dose- and time - dependent leucopenic inhibitory effects on the progenitor cells in the bone - marrow as earlier reported by umar. or directly on the matured cells in the peripheral system. there was a time - related statistically significant increase (p < 0.05) in the two major blood cells rbc and platelet count suggesting that administration of fixed - dose combination of haart stimulated both erythropoietic and thrombopoietic activities by indirectly stimulating erythropoietin and thrombopoietin in the kidney or directly stimulating the pluripotential stem cells in the bone marrow. it could also be contested that the pancytopenia observed in hiv / aids patients may probably be due to either the virus infection or other latent malignancies not as a result of haart administration. hence, from the result of this present study, it can be concluded that haart when administered in fixed - dose combinations have no subacute haematotoxic effects. its use in the treatment of hiv and other viral related infection should be encouraged and haematological parameters should be monitored.
|
highly active antiretroviral therapy (haart) is considered toxic and has other life - threatening side effects. our aim was to evaluate the haematotoxic effects of lamivudine, zidovudine, and nevirapine fixed - dose combinations in albino wistar rats. fifty (50) three (3) months old male albino wistar rats weighing between 200 and 250 g were randomly assigned to five (5) groups (a, b, c, d, and e). group a served as control. two (2 mls) of venous blood was aseptically collected on days 5, 10, 15, 20, and 25 of treatment. red blood cell (rbc) mean value recorded statistically significant increase (p 0.05) in all the parameters evaluated when the test group was compared with the control on day 25. furthermore, there was a time - related statistically significant increase (p < 0.05) in the two major blood cells rbc and platelet counts. from the result of this present study, it can be concluded that haart when administered in fixed - dose combinations have no subacute haematotoxic effects.
|
reconstruction of breast bu deep inferior epigastric perforator (diep) flap is popular throughout the world. however, we are still concerned about how to improve the aesthetic results. in this respect what we are still trying to improve is breast -symmetry in terms of volume and shape, bulkiness of the inferior lateral quadrant of the new breast (if anastomosis were performed in axilla), loss of volume of the upper pole and lack of projection of the inferior pole. the aim of our work is to describe our personal techniques in order to improve the final aesthetic outcome in diep flap breast reconstruction. since 1997, we have been performing 226 breast reconstructions with diep flap in the department of plastic and reconstructive surgery at s. orsola - malpighi hospital. the mean average age of our patients was 49.6 years old (range : 29 - 73). the reconstruction was immediate in 96 cases (42, 48%) and delayed in 130 cases (57, 52%) ; in this last group 16 patients were previously reconstructed using other techniques (11 by prosthesis and 5 with lipofilling). most of these refinements were performed intraoperatively, but when this is not possible, we perform secondary revisions a few months later, usually under local anaesthesia. during the flap insetting, we usually leave the lateral part of the flap bulky in order not to have any risk with flap vascularisation. during the flap modeling, we harvest a subcutaneous pocket superiorly, in order to fill the upper pole of the new breast with the flap, partially de - epithelialised and fixed to the pectoral major muscle with re - absorbable stitches. in order to reduce the risk of secondary liponecrosis, we usually try not to remove too much fat from the adipose layer of the superior edge of the flap. this can sometimes lead to a gap between the diep flap and the skin in the upper pole, particularly evident in obese patients where the abdominal fat layer is very thick. when it is possible, we try to correct lateral bulkiness and the upper pole gap at the same time harvesting local flaps or using a combination of lipoaspiration and lipofilling. local flaps are our first choice. under local anaesthesia, we harvest a vertical flap, based superiorly, from the new breast 's lateral side, exactly where the bulkiness is. the flap is then de - epithelialised and transposed to a subcutaneous pocket in the upper pole where the defect is. the flap is fixed with transcutaneous stitches and the donor site is closed primarily [figure 1 ]. the flap was de - epithelialised and transposed to a subcutaneous pocket in the upper pole our second choice is to make a lipoaspiration of the lateral bulky side and use this tissue, harvested following the principles described by coleman, to lipofill the upper pole. in many cases, the amount of adipose tissue obtained from the bulky area is not sufficient, so we use other donor sites. in young patients with a projected contralateral breast or after mastopexy, we often need to improve diep flap projection in order to obtain a better symmetry. the lack of projection can easily be solved by recreating the inframammary fold in the reconstructed breast as we usually do with implants breast reconstruction. the position of the fold is decided after abdominal donor site closure to avoid tension effects induced by abdominoplasty. in delayed reconstructions, flap projection improvement can be reached using local flaps. during diep flap modelling, the inferior margin of the flap slides at the level of the inframammary fold we started to use this skin paddle to harvest a small flap that is de - epithelialised and pedicled inferiorly at the level of the inframammary crease. the flap pedicle is exactly positioned at a sternal distance corresponding to the other breast major projection point. then the flap is rolled on itself to reproduce a cone like shape [figure 2 ]. the pedicle was centred on the major projection point and the flap was sutured on itself to obtain a cone shape this is a challenging technique to obtain a good projection, especially in young patients with a projected contralateral breast that does not need mastopexy. we performed this reconstruction in a 36-year - old female patient who affected by a recurrence of a mucinous carcinoma of the right breast. our surgical plan was to harvest diep flap and contralateral breast reduction, but the patient was not prepared to accept any contralateral breast scar. as the patient was slightly overweight, the abdomen was sufficient to harvest a double diep flap to reconstruct one breast, in order to give it more volume and projection. during the flap harvesting, we found two good perforators, one on the right side of the abdomen and the other one on the left side, near the lateral border of the rectus abdominis muscle. we harvested two distinguished flaps : areas 1 - 3 composed the left side flap and the right side flap was composed of area 4. the smaller flap was v - shaped and de - epithelialised obtaining a cone, similar in shape to a prosthesis ; flap modeling was made before pedicle section. the two flaps were then transferred and immediately vascularised with end - to - end anastomosis to thoracodorsal vessels, for the bigger one and circumflex scapular vessels, for the buried flap. the smaller flap was buried under the other to obtain an increased volume and a better projection. the inframammary fold was fixed with a 2/0 polypropylene non - reabsorbable suture and the lower side of the bigger flap was sutured to the thorax at this level [figure 3 ]. monolateral double deep inferior epigastric perforator flap : the small one was v - shaped and sutured on itself on the medial edge obtaining a shape similar to prosthesis. the final effect was the increase of volume and projection of the reconstructed breast breast asymmetry is always observed in unilateral breast reconstruction. more frequently the contralateral breast is bigger and needs to be reduced. rarely, especially in young patients, the contralateral breast can be hypoplastic and a second diep flap can be used like an auto - prosthesis for breast augmentation, thus avoiding the need of an implant. the flap used for breast reconstruction included areas 1 - 3 of diep flap and is transferred and modelled as usual. a smaller flap corresponding to area 4, based on a different perforator, is de - ephitelialised and sutured on itself medially to obtain a cone similar in shape to prosthesis., a sub - glandular pocket is harvested on the side of breast augmentation and the flap is inserted in it and fixed to the major pectoralis muscle with reabsorbable stitches. the anastomoses are performed in the axilla, leading the pedicle through a subcutaneous tunnel, to the thoracodorsal or circumflex scapular vessels [figure 4 ]. double deep inferior epigastric perforator flap for contralateral breast augmentation : the two flaps were harvested based on the two deep inferior epigastric pedicles. the small flap was inserted in a subglandular pocket through an inframammary access during the flap insetting, we usually leave the lateral part of the flap bulky in order not to have any risk with flap vascularisation. during the flap modeling, we harvest a subcutaneous pocket superiorly, in order to fill the upper pole of the new breast with the flap, partially de - epithelialised and fixed to the pectoral major muscle with re - absorbable stitches. in order to reduce the risk of secondary liponecrosis, we usually try not to remove too much fat from the adipose layer of the superior edge of the flap. this can sometimes lead to a gap between the diep flap and the skin in the upper pole, particularly evident in obese patients where the abdominal fat layer is very thick. when it is possible, we try to correct lateral bulkiness and the upper pole gap at the same time harvesting local flaps or using a combination of lipoaspiration and lipofilling. local flaps are our first choice. under local anaesthesia, we harvest a vertical flap, based superiorly, from the new breast 's lateral side, exactly where the bulkiness is. the flap is then de - epithelialised and transposed to a subcutaneous pocket in the upper pole where the defect is. the flap is fixed with transcutaneous stitches and the donor site is closed primarily [figure 1 ]. the flap was de - epithelialised and transposed to a subcutaneous pocket in the upper pole our second choice is to make a lipoaspiration of the lateral bulky side and use this tissue, harvested following the principles described by coleman, to lipofill the upper pole. in many cases, the amount of adipose tissue obtained from the bulky area is not sufficient, so we use other donor sites. in young patients with a projected contralateral breast or after mastopexy, we often need to improve diep flap projection in order to obtain a better symmetry. the lack of projection can easily be solved by recreating the inframammary fold in the reconstructed breast as we usually do with implants breast reconstruction. the position of the fold is decided after abdominal donor site closure to avoid tension effects induced by abdominoplasty. in delayed reconstructions, flap projection improvement can be reached using local flaps. during diep flap modelling, the inferior margin of the flap slides at the level of the inframammary fold we started to use this skin paddle to harvest a small flap that is de - epithelialised and pedicled inferiorly at the level of the inframammary crease. the flap pedicle is exactly positioned at a sternal distance corresponding to the other breast major projection point. then the flap is rolled on itself to reproduce a cone like shape [figure 2 ]. the pedicle was centred on the major projection point and the flap was sutured on itself to obtain a cone shape this is a challenging technique to obtain a good projection, especially in young patients with a projected contralateral breast that does not need mastopexy. we performed this reconstruction in a 36-year - old female patient who affected by a recurrence of a mucinous carcinoma of the right breast. our surgical plan was to harvest diep flap and contralateral breast reduction, but the patient was not prepared to accept any contralateral breast scar. as the patient was slightly overweight, the abdomen was sufficient to harvest a double diep flap to reconstruct one breast, in order to give it more volume and projection. during the flap harvesting, we found two good perforators, one on the right side of the abdomen and the other one on the left side, near the lateral border of the rectus abdominis muscle. we harvested two distinguished flaps : areas 1 - 3 composed the left side flap and the right side flap was composed of area 4. the smaller flap was v - shaped and de - epithelialised obtaining a cone, similar in shape to a prosthesis ; flap modeling was made before pedicle section. the two flaps were then transferred and immediately vascularised with end - to - end anastomosis to thoracodorsal vessels, for the bigger one and circumflex scapular vessels, for the buried flap. the smaller flap was buried under the other to obtain an increased volume and a better projection. the inframammary fold was fixed with a 2/0 polypropylene non - reabsorbable suture and the lower side of the bigger flap was sutured to the thorax at this level [figure 3 ]. monolateral double deep inferior epigastric perforator flap : the small one was v - shaped and sutured on itself on the medial edge obtaining a shape similar to prosthesis. the lack of projection can easily be solved by recreating the inframammary fold in the reconstructed breast as we usually do with implants breast reconstruction. the position of the fold is decided after abdominal donor site closure to avoid tension effects induced by abdominoplasty. in delayed reconstructions, flap projection improvement can be reached using local flaps. during diep flap modelling, the inferior margin of the flap slides at the level of the inframammary fold we started to use this skin paddle to harvest a small flap that is de - epithelialised and pedicled inferiorly at the level of the inframammary crease. the flap pedicle is exactly positioned at a sternal distance corresponding to the other breast major projection point. then the flap is rolled on itself to reproduce a cone like shape [figure 2 ]. the pedicle was centred on the major projection point and the flap was sutured on itself to obtain a cone shape this is a challenging technique to obtain a good projection, especially in young patients with a projected contralateral breast that does not need mastopexy. we performed this reconstruction in a 36-year - old female patient who affected by a recurrence of a mucinous carcinoma of the right breast. our surgical plan was to harvest diep flap and contralateral breast reduction, but the patient was not prepared to accept any contralateral breast scar. as the patient was slightly overweight, the abdomen was sufficient to harvest a double diep flap to reconstruct one breast, in order to give it more volume and projection. during the flap harvesting, we found two good perforators, one on the right side of the abdomen and the other one on the left side, near the lateral border of the rectus abdominis muscle. we harvested two distinguished flaps : areas 1 - 3 composed the left side flap and the right side flap was composed of area 4. the smaller flap was v - shaped and de - epithelialised obtaining a cone, similar in shape to a prosthesis ; flap modeling was made before pedicle section. the two flaps were then transferred and immediately vascularised with end - to - end anastomosis to thoracodorsal vessels, for the bigger one and circumflex scapular vessels, for the buried flap. the smaller flap was buried under the other to obtain an increased volume and a better projection. the inframammary fold was fixed with a 2/0 polypropylene non - reabsorbable suture and the lower side of the bigger flap was sutured to the thorax at this level [figure 3 ]. monolateral double deep inferior epigastric perforator flap : the small one was v - shaped and sutured on itself on the medial edge obtaining a shape similar to prosthesis. rarely, especially in young patients, the contralateral breast can be hypoplastic and a second diep flap can be used like an auto - prosthesis for breast augmentation, thus avoiding the need of an implant. the flap used for breast reconstruction included areas 1 - 3 of diep flap and is transferred and modelled as usual. a smaller flap corresponding to area 4, based on a different perforator, is de - ephitelialised and sutured on itself medially to obtain a cone similar in shape to prosthesis., a sub - glandular pocket is harvested on the side of breast augmentation and the flap is inserted in it and fixed to the major pectoralis muscle with reabsorbable stitches. the anastomoses are performed in the axilla, leading the pedicle through a subcutaneous tunnel, to the thoracodorsal or circumflex scapular vessels [figure 4 ]. double deep inferior epigastric perforator flap for contralateral breast augmentation : the two flaps were harvested based on the two deep inferior epigastric pedicles. the small flap was inserted in a subglandular pocket through an inframammary access the average time of surgery is about 7 h. only in double diep flap the time is slightly longer (average time : 9 h). hospitalisation was the same in all cases (average 8 days, range : 7 - 9). with regard to major complications, in this series, we observed 9 cases of total necrosis of the flap and 15 cases of partial necrosis. no complications, such as necrosis or loss of volume, were observed in patients treated by local lateral flaps. this means lack of softness of the new breast. in the early treated cases, we observed liponcreosis in 20% of flaps while in the last ones we observed a failure rate decreasing (< 5%) due to a better planning and particularly to a reduction of the height / length ratio of the lateral flaps. the results were obtained in patients treated with the presented techniques were good in terms of symmetry and shape of the breasts with a high level of satisfaction reported by patients. this last consideration may not be indicative because also patients treated using a traditional method usually reported a similar level of satisfaction. improvement of lateral bulkiness and upper pole deficiency could be easily achieved using local flaps or lipo - scuplture. these two methods allow correction of both defects at the same time, with a simple surgery under local anaesthesia. we usually plan these corrections at an average time of 6 months after primary reconstruction, when the result can be considered as quite stable. we performed these techniques in almost 40% of our patients and very often we combined the two techniques together. we usually harvest the local lateral flap even if it 's almost always not sufficient to bridge the gap because it 's a simple procedure under local anaesthesia, which use tissues that other ways will be thrown away. on the other hand, in our experience, the lateral bulkiness can be better corrected with tissue excision than liposuction ; this is due to a certain degree of fibrosis developed in this region after surgery. improvement of lower pole projection has two main goals : better shape of the new breast and better symmetry with contralateral breast. applying both inframammary suture and local flaps we noticed no significant increase in surgical time. with a better planning of the base / high ratio of the flap we were been able to reduce the incidence of partial liponecrosis from 20% to 5% of cases. incidentally, no major complications like infection or fistulae due to liponecrosis were observed, but only a lack of softness of the inferior pole. the results obtained with the use of local flaps alone are not satisfactory, but this is a very simple technique, with no adjunctive costs for the patients, which can be associated to the inframammary fold recreation improving the results. we have used this technique in all cases of delayed reconstruction since 2010. in our experience, unilateral reconstruction and contralateral breast augmentation with double diep flap could be useful and innovative. area 4 could be harvested as a free flap on its pedicle, modelled and used as autoprosthesis for contralateral augmentation. we used this technique in five cases : two immediate and three delayed reconstructions after failure of reconstruction with prosthesis. addictive mammaplasty with diep flap is indicated in all cases of young patients with hypoplastic contralateral breast or in patients that required breast augmentation with no implants. the inframammary access used for flap in setting is not evident as in a common augmentation mammoplasty and the same is for the scar made in the axilla for anastomosis. area 4 based on its pedicle, we obtained a flap that could be easily modelled as an auto - prosthesis and buried under the other flap. we think that this method could be indicated in patients with a large contralateral breast when it is not possible to re - shape it for oncological reasons or to respect the wishes of the patient. based on the above study it can be concluded that microsurgical breast reconstruction has almost reached optimum standards both in terms of surgical techniques and aesthetic results. the aim of autologous tissue breast reconstruction is to achieve a good aesthetic result without implants. in our work, we describe our personal techniques in order to improve the final aesthetic outcome in diep flap breast reconstruction. our experience with refinements like the use of local flaps in delayed reconstructions or the inframammary fold recreation to increase projection is an example of how you can save surgery time and costs, achieving increasingly better aesthetical results in the very first breast reconstruction. lateral bulkiness and upper pole deficiency can easily be corrected at the same time, under local anaesthesia and with a very little additional sacrifice for the patient. unilateral or bilateral breast reconstruction with double diep flap could be a valuable option to consider when indicated. no major complications were reported and post - operative recovery was not affected by the procedure. any increase in surgery time is related to additional complete pedicle dissection and anastomosis. in our opinion, this disadvantage is not sufficient to avoid using this procedure that must be considered as a valuable option in selected cases.
|
background : now - a - days, deep inferior epigastric perforator (diep) flap breast reconstruction is widespread throughout the world. the aesthetical result is very important in breast reconstruction and its improvement is mandatory for plastic surgeons.materials and methods : the most frequent problems, we have observed in breast reconstruction with diep flap are breast asymmetry in terms of volume and shape, the bulkiness of the inferior lateral quadrant of the new breast, the loss of volume of the upper pole and the lack of projection of the inferior pole. we proposed our personal techniques to improve the aesthetical result in diep flap breast reconstruction. our experience consists of more than 220 diep flap breast reconstructions. results : the methods mentioned for improving the aesthetics of the reconstructed breast reported good results in all cases.conclusion:the aim of our work is to describe our personal techniques in order to correct the mentioned problems and improve the final aesthetical outcome in diep flap breast reconstruction.
|
for this analysis, we constructed a model of diabetic dyslipidemia based on pathways described by ginsberg (3) (fig. this decreases the effects of insulin on uptake of glucose in muscle and fat and production of glucose by the liver (insulin resistance). insulin resistance in adipocytes results in greater release of ffa from fat into the circulation. the resulting increased ffa flux to liver increases synthesis of vldl cholesterol (4), resulting in increased levels of triglycerides and apob, smaller and denser ldl cholesterol, and decreased availability of hdl cholesterol. ffa also increases insulin resistance in liver (5,6). while there is some evidence that ffas may influence cad risk through additional mechanisms, such as endothelial dysfunction (7), hypercoagulation, impaired fibrinolysis (8,9), and increased blood pressure, these effects are not quantifiable at this time. figure 1 also shows the effects of other variables and risk factors that contribute to cad. briefly, the model is a person - by - person, object - by - object simulation written at a relatively high level of biological, clinical, and administrative detail using object - oriented programming. the core of the model is a set of continuous equations that represent the physiological pathways pertinent to diseases, such as those illustrated in fig. 1. currently, cad, diabetes and its complications, congestive heart failure, stroke, obesity, smoking, and metabolic disorders are included in a single integrated model, enabling it to address comorbidities and syndromes in a realistic way. the use of differential equations preserves the continuous nature of biological variables. to conduct simulations, the archimedes model creates virtual people, each of whom has his or her own simulated physiology and can get diseases, develop symptoms, seek care, and so forth. to ensure that the virtual people are representative of real people, the archimedes model creates copies of real people using person - specific data from datasets such as the national health and nutrition examination survey (nhanes), health risk appraisals, personal health records, and electronic medical records. it does this at the level of detail captured in the dataset including, if available, demographic characteristics, physical examination results, behaviors, family history, current medical conditions, past medical history, biological variables (lab results), symptoms, and current medications. the methods for creating copies ensure that the distributions and correlations of all of the important variables are the same in the simulated population as in the real population. in the model, when patients seek care, providers apply protocols and follow guidelines for tests and treatments. test results are functions of the underlying variables being measured and can have systematic and random errors. simulated patients have behaviors relating to seeking care and adhering to treatment recommendations. because the model is continuous in time, symptoms and the ensuing clinical events can occur at any time and are different for every patient. care processes pertinent to this analysis were based on guidelines of the american diabetes association and american heart association. briefly, we use the model to simulate real clinical trials and compare the simulated and real results. to date, this has been done for 48 clinical trials relating to diabetes and cad. the variables and pathways in the model that are most pertinent to diabetes and cad are shown in fig. 1, with the arrows indicating equations that relate the variables to each other and to the progression of atherosclerosis. in the model, the insulin resistance variable represents not only the resistance of fat, muscle, and liver to the effects of insulin but also the change in production of insulin by pancreatic -cells (initial -cell compensation and eventual -cell fatigue). in the model, insulin resistance affects not only glucose but other risk factors for cad, such as sbp, hdl cholesterol, triglycerides, and apob. equations relating insulin resistance with these variables were estimated from data derived from the uk prospective diabetes study (14,15) for glucose, from nhanes (19982004) for triglycerides and hdl cholesterol, and from data on blood pressures in various populations of people with and without diabetes (16). for this analysis, our objective was to estimate the effects of the variables in fig. 1. our approach was to simulate the clinical trials that would ideally be performed if they were possible : treat each variable one by one to its normal value and measure the change in cad events over a long period of time. the results provide an estimate of the proportion of cad caused by each variable, taking into account its effects on other variables downstream in the physiological pathways (fig., for the simulated trial for insulin resistance, we created a hypothetical treatment that maintained the effects of insulin on liver, fat, and muscle at their normal levels. the normalization of the effects of insulin then affected downstream variables such as triglycerides and hdl cholesterol, which in turn affected the development of atherosclerotic plaque and myocardial infarctions. for the simulated trials, we used person - specific data from the 19982004 nhanes survey to create a simulated population representative of young adults aged 2030 years in the u.s., we created a control arm in which the subjects were followed with no treatments for cad prevention. this arm determined the natural, untreated progression of cad to the point of an event (fatal and nonfatal myocardial infarction). each trial also included a hypothetical treatment in which the variable of interest was controlled as soon as it became abnormal compared with a target value intended to represent good health. to determine the target values that represent good health, we used the average values for people aged 2030 years in the u.s. today is 26 kg / m, which is generally considered overweight. rather than using this as the value to represent good health, we arbitrarily chose a value of 22.5 kg / m. the values for young adults obtained by this method are shown in the first data column of table 1. we call these normal values and use the term abnormal to describe values above (or, in the case of hdl cholesterol, below) these levels. we use the term normalize to describe a protocol that tests everyone annually, identifies people whose values of a variable exceed (or, in the case of hdl cholesterol, fall below) the normal value, and then treats those people to the normal values. treatments were hypothetical and designed to control variables precisely such that they reach the normal level. in this sense, the treatments were analogous to clamp studies or knockout mice. treatment of any particular variable would affect any downstream variables, as illustrated in fig. 1. people with values below (or, in the case of hdl cholesterol, above) the normal values were not treated. what - if trials in which we calculated their possible effects on cad on the assumption that the variables are causal, just to determine the possible magnitudes of their effects. each simulated trial was conducted using the same 10,000 simulated people for both the treatment and control arms for a given trial. although a large number of outcomes were recorded, for this analysis we used the cumulative probability of fatal and nonfatal myocardial infarction (including repeat myocardial infarctions) as the primary end point. as calculated by the model, young adults aged 2030 years in the u.s. today have about a 43% lifetime rate of fatal or nonfatal myocardial infarctions (95% ci 4244). the effects of normalizing insulin resistance on myocardial infarctions are shown in the right column of table 1 ; normalization prevents approximately 42% of myocardial infarctions. figure 2 shows the rates of myocardial infarctions in people who are destined to get insulin resistance and those who are not. approximately 50% of young adults are destined to get some degree of insulin resistance, although insulin resistance progresses to the point at which diabetes develops in less than one - fifth of young adults. those who are destined to develop some degree of insulin resistance face nearly three times greater risk of cad than those who are not. in people who are destined to develop insulin resistance today 's young men face a higher rate of myocardial infarctions than today 's young women : 55 vs. 32%. however, insulin resistance plays a larger relative role in women than in men, with normalization of insulin resistance reducing the myocardial infarction rate 57% for women (from 32 to 14%), compared with 29% (from 55 to 39%) for men. as causes of cad, they range from high sbp (determining 36% of cad) to family history (responsible for 4%). the five new variables for which causality was assumed are shown in the bottom half of table 1. if they are eventually established to be causal, normalizing them should decrease cad rates by the amounts shown in the table. otherwise, the values in the table for these variables indicate the proportions of cad risk for which they are markers. in this study, we estimate the proportion of cad due to insulin resistance, other metabolic variables, and other cardiovascular risk factors. our analysis takes into account the large number of people who develop some degree of insulin resistance, the long time course of developing insulin resistance, the pathological effects of a low degree of insulin resistance, and the effects of insulin resistance on other metabolic variables. of the risk factors that we believe are sufficiently well studied to permit quantitative analysis, insulin resistance is the most important single risk factor for cad. its effect on cad is indirect, mediated through its effects on other variables such as sbp, hdl cholesterol, triglycerides, glucose, and apob. each of those variables, in turn, is affected by other variables such as age, sex, and race / ethnicity. if each risk factor is considered by itself, the next most important cause of cad is high sbp ; normalization of sbp would prevent 36% of myocardial infarctions. after sbp are hdl cholesterol (31%), bmi (at least 21%), ldl cholesterol (16%), triglycerides (10%), fasting plasma glucose (9%), smoking (9%), and family history (4%). our analysis also highlights the role of obesity in the etiology of both diabetes and cad. there is good evidence that obesity is a major cause of insulin resistance, and through insulin resistance, obesity affects blood pressure, triglycerides, hdl cholesterol, fasting plasma glucose, and apob. just by these effects, insulin resistance is a powerful risk factor for cad ; in our analysis, normalizing bmi at 22.5 kg / m would prevent more than one - fifth of myocardial infarctions in the u.s. (table 1). beyond this, it is possible that obesity has other direct effects on cad that are not represented in our model. our results are not directly comparable with those of clinical trials, where the effects of glucose lowering on cad were either much smaller (19,20,21) or null (22,23). the reason is that in the clinical trials, the focus was on lowering blood glucose not preventing or curing insulin resistance. the drugs used in the trials either lowered glucose without affecting insulin resistance (e.g., sulfonylureas and insulin) or lowered insulin resistance to some extent but did not eliminate it (e.g., metformin and rosiglitazone). furthermore, we normalized insulin resistance over the entire lifetimes of the subjects, whereas the treatments in the trials were given only after individuals had developed diabetes and were given only for the limited durations of the studies. thus, the results of the trials do not represent the full effect of normalizing insulin resistance and are actually consistent with our results. our finding that insulin resistance is responsible for 42% of cad suggests the possible value of a 100% effective treatment of insulin resistance, should there eventually be one. although insulin resistance can be ameliorated by weight loss, our data indicate that other interventions will be needed. increased physical activity, diet modification, and drug therapy are obvious approaches, although we could not model the effects of these interventions on insulin resistance because their quantitative effects are unknown or unclear. also, as we come to better understand the underlying etiology and effects of insulin resistance (e.g., its relationship with ffa flux or the inflammatory process), new interventions to prevent or treat insulin resistance or factors upstream from it will likely be developed. our results indicate that because of the effects of obesity on insulin resistance, curing obesity could be expected to prevent at least 21% of myocardial infarctions. thus, interventions that prevent excess weight gain or maintain weight loss should have a major effect on cad. because of insufficient data, we could not model the separate effects of visceral obesity, ectopic fat, or other measures of weight - related metabolic abnormalities. the main limitation of this analysis is that it is based on a mathematical model rather than on empirical studies. we have tried to make the model as realistic and accurate as possible by reproducing current theories of metabolic pathways, by ensuring that each equation is derived from and validated against empirical evidence, and by testing the accuracy of the full set of equations by calculating the occurrence of diabetes and cad in a wide variety of clinical trials. based on these validations, it is reasonable to say that the model is entirely consistent with the best available published evidence. nonetheless, our analysis is limited to variables for which there are data sufficiently good for writing and validating equations. in the archimedes model, data must not only establish a qualitative relationship between variables but also enable writing and validating equations that describe that relationship quantitatively. it is possible that a relationship between variables exists but can not yet be described quantitatively from the available data. our results also depend on the targets chosen for treating the variables. for family history and smoking, the targets are obvious : eliminate the effects of family history and have people stop smoking. but other variables are continuously valued, and there are no levels that can unequivocally be designated we had to specify the targets to which the variable values would be controlled. possible choices were the thresholds that organizations use to define diseases such as diabetes or the treatment targets used in national guidelines or performance measures. we chose not to use any of these because in addition to being inconsistent with one another, they are all considerably higher than average values, often representing top quartiles or quintiles, and they typically represent people with moderately advanced disease. aged 2030 years on the assumption that this better represents a healthy, nondiseased state. it addresses the relative importance of well - known variables in the genesis of cad and suggests areas that should be the focus of research and treatment. more specifically, our results indicate that insulin resistance itself has a profound effect on cad additional research into the underlying pathogenesis of insulin resistance and its downstream effects, prevention, and cure should receive high priority for the prevention of cad. ideally, the questions we address in this paper would be answered through empirical research.. there is no way to normalize insulin resistance, get everyone to stop smoking, or implement most of the other interventions required. even if the interventions existed, the empirical studies would be infeasible because of size, duration, cost, and speed of technological change. yet, the questions are undeniably important. it converts the observations that have been made and the theories that have been developed into a form that can be used to estimate the approximate magnitudes of outcomes, stimulate debate and research, and begin a cycle that should gradually converge on a deeper and more accurate understanding of physiological pathways than would otherwise be possible.
|
objective people with diabetes have an increased risk of coronary artery disease (cad). an unanswered question is what portion of cad can be attributed to insulin resistance, related metabolic variables, and other known cad risk factors.research design and methods the archimedes model was used to estimate the proportion of myocardial infarctions that would be prevented by maintaining insulin resistance and other risk factors at healthy levels. person - specific data from the national health and nutrition examination survey 19982004 were used to create a simulated population representative of young adults in the u.s. this population was then entered into a series of simulated clinical trials designed to explore the effects of each risk factor. each trial had a control arm (all risk factors were allowed to progress without interventions) and a treatment arm (a risk factor was held to its value in young healthy adults). the trials continued for 60 years. the effects of these hypothetical cures of each risk factor provide estimates of their impact on cad.resultsin young adults, preventing insulin resistance would prevent 42% of myocardial infarctions. the next most important determinant of cad is systolic hypertension, prevention of which would reduce myocardial infarctions by 36%. following systolic blood pressure, the most important determinants are hdl cholesterol (31%), bmi (21%), ldl cholesterol (16%), triglycerides (10%), fasting plasma glucose and smoking (both 9%), and family history (4%).conclusions insulin resistance is likely the most important single cause of cad. a better understanding of its pathogenesis and how it might be prevented or cured could have a profound effect on cad.
|
the practice of ayurveda works with an aim to preserve and protect the health and prolong the life of the patient by relieving the suffering and pain. to achieve this aim, healthcare practitioners are largely dependent on easy access to patient 's accurate, adequate and complete information in a timely manner along with the availability of domain knowledge at their fingertip. unavailability of these may lead to medical error or delay in providing care to the patient, but these can easily be eliminated if the practitioners are equipped and supported by a well - managed health information system. since the last few decades, information and communication technology has supported the hospitals in streamlining their health information system. health information technology (hit) is a promising tool of information and communication technology, involving both computer hardware and software to store, retrieve, share and use of healthcare data and information for clinical decision making in patient care. it has all the potentials to improve the health of the individual and the community as well as the performance of the healthcare providers by supporting them with accurate, complete and timely healthcare data that ultimately improve their clinical efficiency and lead to a better outcome of patient care. hit applications such as electronic health records, clinical decision support system, telemedicine, ehealth and mhealth are evident and more prevalent among the allopathic practitioners, but the literature search evidence the existence of these kinds of applications in ayurveda practice also, such as body tune - computerized ayurvedic medicare, prakes, prakriti, madhava, rasex, pilex, etc. these applications assist the ayurvedic practitioners to detect, communicate and interpret data for accurate diagnosis, estimate the body constitution, suggest health advice about diet and instruct for daily activities as well as support them in managing the patient data in an easy and more accessible manner. the ayush research portal also acts as a knowledge base repository that allows the researchers, academicians and students to update their knowledge related to ayurveda, yoga and naturopathy, unani, siddha and homoeopathy along with ayush - related research performed by the allied sciences. the details of the research are listed and provided under clinical research, pre - clinical research, drug research and fundamental research headings, which is easily accessible to the end users. it also provides various links and allows the researcher to learn about icpc, icd and evidence - based criteria for clinical studies. ayusoft, a decision support system designed and developed by the center for development of advance computing, assists the ayurvedic health care practitioners, academicians and researchers in diagnosis and treatment of patients as well as in conducting various researches. the repositories presented in ayusoft assist the practitioners in physiological and psychological assessment, diagnosis and treatment of the patient based on symptoms and causative factors. it also allows the practitioners to refer the case to other consultants for expert review and collaborative consultation, which ultimately promote evidence - based practice. in addition to benefits, a few challenges such as privacy, confidentiality and security of patient data, doctors resistance toward paper - based documentation system, cost of maintenance of such a system, user - friendly access, lack of awareness about hit and its application, etc., may impede the successful implementation and use of these applications. hence, it is always advisable that the attitude of healthcare practitioners toward these challenges need to be assessed and addressed before the actual implementation of any it application for better acceptability and sustainability. this study focuses on assessing the attitude of ayurvedic doctors toward the impact of hit in managing patient data, public health, patient care, education and research, which ultimately assists the planner in finding the scope of implementing and using a better application in ayurvedic practice. a cross - sectional survey was carried out among 140 doctors of an ayurvedic teaching hospital and research center of southern india. a structured and validated questionnaire consisting of 18 questions about the health care professional 's attitude toward the impact of hit was used for data collection. a 5-point likert scale from strongly agree to strongly disagree, with the score ranging from 5 to 1, was used to collect their response. the content of the questionnaire was derived based on the discussion with the domain expert, i.e. ayurveda doctors who had experience in working with hit applications, and also keeping in mind the respondents who were working in the center where a linux - based information management system was implemented and used for patient care, education, research and administration. as the respondents were already exposed to the computerized system, the content of the questionnaire was very specific to their day to day working with the system. the questionnaire was administered to the respondents after obtaining due permission from the concerned institutional authorities. a total of 140 doctors among 164 doctors were willing to participate and were available during the survey. the doctors were first briefed about the study and its objectives and the purpose of the survey. an informed consent was obtained from the respondents for being part of the study where the data were collected by distributing the questionnaire among those who were willing to respond. the doctors were asked to mark their response by choosing the appropriate options from strongly agree to strongly disagree for the given parameters. the completed questionnaire was then collected for further data analysis using spss 20.0 for the frequency and percentage. the chi - square test was carried out to determine the association of responses with other variables, where p < 0.05 was considered significant. to determine the respondent 's safety, certain ethical issues were addressed during and after the data collection, such as privacy and confidentiality of information supplied by them. the investigator had assured the respondents that their identification details and responses would not be revealed, but the relevant data for responding to the survey objective would be used. response related to the attitude about hit was collected from 140 healthcare professionals practicing ayurveda and presented in the form of tables and discussed hereunder : among 140 doctors, 91 (65%) were male and 49 (35%) were female, and majority of them, i.e. 87, were between the ages of 27 and 31 years, 47 (19.3%) were about 3236 years, 18 (10%) of were between 37 and 41 years and about 13 (9.5%) of them were above 42 years of age. the distribution based on their total years of practicing ayurveda indicated that 112 (80%) of the respondents had 05 years of experience, 13 (9.3%) had 610 years of experience, nine (6.6%) had 1115 years of experience and about five (4.2%) of the respondents found to be practicing for more than 15 years. only 56% (78) of the doctors claimed that they have undergone short - term training on use of computer and various hit applications. they were found to have very good knowledge of the computer and also exposure to an information management system for patient care, education, research and reporting purposes. this is due to the utilization of the present information management system of the hospital for more than 5 years. nearly 44% (62) found themselves to be comfortable with the system and would desire to undergo short - term training on the use of various hit applications in ayurveda. to understand the attitude of the doctors practicing ayurveda toward hit, a list of questions was imposed to 140 respondents and their response was collected and discussed. here, the limitations observed were in terms of discussing all the parameters included in the survey because the related literature search evidenced maximum studies in allopathic settings compared with an ayurveda setting. the benefits of the hit is similar and enormous, irrespective of the type of medical practice. thus, wherever indicated about its practice in ayurveda, the parameters are discussed else the evidence from the surveys performed in allopathic settings are included and discussed under the following heading. hits have proven well in managing patient data by streamlining the processes of collection, processing, analysis, retrieval, dissemination, etc. it decreases or eliminates the paperwork of the healthcare professionals by supporting with real - time communication facilities with peers and other professionals. when the respondents were asked about the impact of implementing hits in managing patient data, approximately 7580% of the respondents agreed on the fact that the electronic health record or hospital information system has the potential in reducing their duplication of work, is easy and has instant processing, real - time access and managing the flow of information [table 1 ]. the responses were found to be statistically significant with the age and gender of the respondents (p < 0.05). a similar finding was observed in the study by moustafa., where the healthcare professionals felt that the electronic medical record improve the quality of medical documentation and save time in disseminating the data to various stakeholders. also reported that the patient data from a single electronic source equips the healthcare professionals in avoiding the idle waiting time to access patient data from various sources. health information technology in management of patient data marchibroda. also claimed that the hit, including electronic health record, assist the health care professionals in addressing the barriers related to the exchange of patient 's data to the needed. the result of this study also indicated a similar response, where 80.5% of the respondents were in favor of hit to avoid unnecessary time in exchanging patient data to other professionals or institutions [table 1 ]. the literature search evidenced that the contribution of hit in public health is countless in terms of supporting the healthcare professionals in improving the data collection processes and real - time access of population data in providing elective, emergency and long - term clinical care, educating the community, improving nutrition and hygiene and providing more sanitary living conditions. moreover, the world health organization has marked it as a backbone of health care services to prevent, diagnose and treat disease and illness. the framework and standard guidelines for developing a country health information system by the world health organization also stressed the use of health information technology in streamlining the health information system of the institutions irrespective of ownership or practice. a similar attitude is reflected among the respondents about the application of hit in public health, where more than 80% of the respondents felt the need of such a system to report the local and national health institution about their practices as well as to improve the collection of patient data on a routine basis. they strongly claimed that the hit, such as online electronic health records and telemedicine, will be a boon for them in avoiding such barriers [table 1 ]. nearly 77.6% of the respondents agreed with the fact that the population - based database system can assist the program manager and planner in early detection and control of infectious disease when reported by the health care institution, whereas 78.3% felt that the data furnished by the system can assist them in monitoring various health programs of health care institutions and its reporting. the response was found to be significant with years of working experience of the respondents (p < 0.05) [table 1 ]. in spite of having several benefits, issues such as privacy, confidentiality and security of patient data in using hit a similar finding was observed in this study, where only 69% of the respondents felt that hit was reliable in maintaining the privacy and security of patient data, whereas 31 respondents did not have any opinion in this regard [table 1 ]. hit applications such as electronic health record, clinical decision support system, clinical reminder system, computerized providers order entry, telemedicine, etc., are very much in practice among allopathic practitioners, and they are getting benefited with these in improving the clinical workflow, reducing the medication error and updating themselves with clinical guidelines that ultimately improve the patient outcomes and promote evidence - based practice. among 140 doctors, 91 (65%) were male and 49 (35%) were female, and majority of them, i.e. 87, were between the ages of 27 and 31 years, 47 (19.3%) were about 3236 years, 18 (10%) of were between 37 and 41 years and about 13 (9.5%) of them were above 42 years of age. the distribution based on their total years of practicing ayurveda indicated that 112 (80%) of the respondents had 05 years of experience, 13 (9.3%) had 610 years of experience, nine (6.6%) had 1115 years of experience and about five (4.2%) of the respondents found to be practicing for more than 15 years. only 56% (78) of the doctors claimed that they have undergone short - term training on use of computer and various hit applications. they were found to have very good knowledge of the computer and also exposure to an information management system for patient care, education, research and reporting purposes. this is due to the utilization of the present information management system of the hospital for more than 5 years. nearly 44% (62) found themselves to be comfortable with the system and would desire to undergo short - term training on the use of various hit applications in ayurveda. to understand the attitude of the doctors practicing ayurveda toward hit, a list of questions was imposed to 140 respondents and their response was collected and discussed. here, the limitations observed were in terms of discussing all the parameters included in the survey because the related literature search evidenced maximum studies in allopathic settings compared with an ayurveda setting. the benefits of the hit is similar and enormous, irrespective of the type of medical practice. thus, wherever indicated about its practice in ayurveda, the parameters are discussed else the evidence from the surveys performed in allopathic settings are included and discussed under the following heading. hits have proven well in managing patient data by streamlining the processes of collection, processing, analysis, retrieval, dissemination, etc. it decreases or eliminates the paperwork of the healthcare professionals by supporting with real - time communication facilities with peers and other professionals. when the respondents were asked about the impact of implementing hits in managing patient data, approximately 7580% of the respondents agreed on the fact that the electronic health record or hospital information system has the potential in reducing their duplication of work, is easy and has instant processing, real - time access and managing the flow of information [table 1 ]. the responses were found to be statistically significant with the age and gender of the respondents (p < 0.05). a similar finding, where the healthcare professionals felt that the electronic medical record improve the quality of medical documentation and save time in disseminating the data to various stakeholders. also reported that the patient data from a single electronic source equips the healthcare professionals in avoiding the idle waiting time to access patient data from various sources. health information technology in management of patient data marchibroda. also claimed that the hit, including electronic health record, assist the health care professionals in addressing the barriers related to the exchange of patient 's data to the needed. the result of this study also indicated a similar response, where 80.5% of the respondents were in favor of hit to avoid unnecessary time in exchanging patient data to other professionals or institutions [table 1 ]. the literature search evidenced that the contribution of hit in public health is countless in terms of supporting the healthcare professionals in improving the data collection processes and real - time access of population data in providing elective, emergency and long - term clinical care, educating the community, improving nutrition and hygiene and providing more sanitary living conditions. moreover, the world health organization has marked it as a backbone of health care services to prevent, diagnose and treat disease and illness. the framework and standard guidelines for developing a country health information system by the world health organization also stressed the use of health information technology in streamlining the health information system of the institutions irrespective of ownership or practice. a similar attitude is reflected among the respondents about the application of hit in public health, where more than 80% of the respondents felt the need of such a system to report the local and national health institution about their practices as well as to improve the collection of patient data on a routine basis. they strongly claimed that the hit, such as online electronic health records and telemedicine, will be a boon for them in avoiding such barriers [table 1 ]. nearly 77.6% of the respondents agreed with the fact that the population - based database system can assist the program manager and planner in early detection and control of infectious disease when reported by the health care institution, whereas 78.3% felt that the data furnished by the system can assist them in monitoring various health programs of health care institutions and its reporting. the response was found to be significant with years of working experience of the respondents (p < 0.05) [table 1 ]. in spite of having several benefits, issues such as privacy, confidentiality and security of patient data in using hit a similar finding was observed in this study, where only 69% of the respondents felt that hit was reliable in maintaining the privacy and security of patient data, whereas 31 respondents did not have any opinion in this regard [table 1 ]. hit applications such as electronic health record, clinical decision support system, clinical reminder system, computerized providers order entry, telemedicine, etc., are very much in practice among allopathic practitioners, and they are getting benefited with these in improving the clinical workflow, reducing the medication error and updating themselves with clinical guidelines that ultimately improve the patient outcomes and promote evidence - based practice. hits have proven well in managing patient data by streamlining the processes of collection, processing, analysis, retrieval, dissemination, etc. it decreases or eliminates the paperwork of the healthcare professionals by supporting with real - time communication facilities with peers and other professionals. when the respondents were asked about the impact of implementing hits in managing patient data, approximately 7580% of the respondents agreed on the fact that the electronic health record or hospital information system has the potential in reducing their duplication of work, is easy and has instant processing, real - time access and managing the flow of information [table 1 ]. the responses were found to be statistically significant with the age and gender of the respondents (p < 0.05). a similar finding was observed in the study by moustafa., where the healthcare professionals felt that the electronic medical record improve the quality of medical documentation and save time in disseminating the data to various stakeholders. also reported that the patient data from a single electronic source equips the healthcare professionals in avoiding the idle waiting time to access patient data from various sources. health information technology in management of patient data marchibroda. also claimed that the hit, including electronic health record, assist the health care professionals in addressing the barriers related to the exchange of patient 's data to the needed. the result of this study also indicated a similar response, where 80.5% of the respondents were in favor of hit to avoid unnecessary time in exchanging patient data to other professionals or institutions [table 1 ]. the literature search evidenced that the contribution of hit in public health is countless in terms of supporting the healthcare professionals in improving the data collection processes and real - time access of population data in providing elective, emergency and long - term clinical care, educating the community, improving nutrition and hygiene and providing more sanitary living conditions. moreover, the world health organization has marked it as a backbone of health care services to prevent, diagnose and treat disease and illness. the framework and standard guidelines for developing a country health information system by the world health organization also stressed the use of health information technology in streamlining the health information system of the institutions irrespective of ownership or practice. a similar attitude is reflected among the respondents about the application of hit in public health, where more than 80% of the respondents felt the need of such a system to report the local and national health institution about their practices as well as to improve the collection of patient data on a routine basis. they strongly claimed that the hit, such as online electronic health records and telemedicine, will be a boon for them in avoiding such barriers [table 1 ]. nearly 77.6% of the respondents agreed with the fact that the population - based database system can assist the program manager and planner in early detection and control of infectious disease when reported by the health care institution, whereas 78.3% felt that the data furnished by the system can assist them in monitoring various health programs of health care institutions and its reporting. the response was found to be significant with years of working experience of the respondents (p < 0.05) [table 1 ]. in spite of having several benefits, issues such as privacy, confidentiality and security of patient data in using hit a similar finding was observed in this study, where only 69% of the respondents felt that hit was reliable in maintaining the privacy and security of patient data, whereas 31 respondents did not have any opinion in this regard [table 1 ]. hit applications such as electronic health record, clinical decision support system, clinical reminder system, computerized providers order entry, telemedicine, etc., are very much in practice among allopathic practitioners, and they are getting benefited with these in improving the clinical workflow, reducing the medication error and updating themselves with clinical guidelines that ultimately improve the patient outcomes and promote evidence - based practice. the advances in hit, such as telemedicine, allow the healthcare practitioners to simultaneously attend several patients at a time using audio and videos conferencing facilities. these services reduce the cost of patient care and proved to be very helpful during emergency patient care when the patient at a geographically isolated area required advice and consultation from the experts. the electronic health records associated with the same, assisting the healthcare professionals in sharing the collected data with the patient and various other stakeholders. these technologies are very effective in conducting multidisciplinary research and collaborating between geographically dispersed researchers. the literature search evidenced few telemedicine applications in ayurveda, such as unarv, dhare and telemedicine, which not only support the patient in accessing experts consultation facilities but also assist the experts in documenting patient data as well as reaching the outreach. in view of this, about 7080% of the respondents felt that there are several elements that may adversely affect the patient 's body and, if these are captured during the first visit of a patient and stored permanently in an electronic form, can alert the attending clinicians during any wrong prescription and avoiding many medication errors. they also expected to have a common knowledge repository in electronic form to access the domain knowledge during patient care to take an evidence - based informed decision making, which ultimately improves the patient outcome. these responses were found to be statistically significant with the age and year of working experience of the respondents (p < 0.05). about 87.4% of them felt that the telemedicine and web conferencing facilities can provide a platform to the healthcare professionals in multidisciplinary collaborative research [table 2 ]. health information technology in patient care the electronic health records or any online information management system can be seen as an important tool in gathering complete data of the patient during routine, follow - up and emergency care. in view of this, about 85% of the respondents agreed and mentioned that the electronic health records or any online information system can make the collection and accessibility of patient data during emergency and follow - up much easier compared with paper - based records. they also felt that the hit applications highly support evidence - based practice in the provision of quality healthcare to the individual and the community [table 2 ]. only 66.4% of the respondents agreed that the hit should be implemented and practiced in every healthcare institution, irrespective of ownership and size, as it is unavoidable in health care practice, whereas 20.3% of them had no opinion about it as they claimed themselves as being beginners in ayurveda practice and less exposed to the information management system in their day to day activities in patient care, education and research (p < 0.05) [table 3 ]. health information technologies are unavoidable in health care practice as the study was conducted in an ayush center for excellence, where the respondents were found to have access to computer and information management system, but those who were new to the practice looked more enthusiastic to learn about various hit applications and its benefits. the majority of them expected to have telemedicine facilities at their center to reach out to the distant patient and families for providing quality health services. the training could be seen as one of the areas that the respondents were looking forward to undergo to enhance the usage of present applications and other future implementations. similar studies can be conducted in many more ayurveda centers to understand the level of perception and requirement of ayurveda doctors, which will allow the researchers in suggesting a common hit solution to not only integrate all the ayurveda centers on a common platform to access health information but also to share their knowledge and expertise in achieving quality health care. similar studies can be conducted in many more ayurveda centers to understand the level of perception and requirement of ayurveda doctors, which will allow the researchers in suggesting a common hit solution to not only integrate all the ayurveda centers on a common platform to access health information but also to share their knowledge and expertise in achieving quality health care. the hit is seen as one of the promising tools in providing a new way to the healthcare professionals practicing ayurveda in managing patient data and domain knowledge. the result of the study reported the respondent 's agreement on various facts related to the impact of hit in patient care, education, research and public health, but many of them also had no opinion about it. the reason could be their non - exposure to the various applications such as electronic health records, telemedicine or any other electronic patient database, as they have indicated during the survey. the result also indicated the need of these technologies in ayurveda to improve the practices of documentation, dissemination and availability of patient data to the practitioners as well as to reach out to the maximum. those who reported no opinion expected to have an induction and training program to understand the better utilization of these technologies in their practice. as the implementation and utilization of these technologies are scarce or very minimum in the practice of ayurveda, the need identified is to design and develop cost - effective applications with the involvement of actual user and also to disseminate the benefits and availability of these to the institutions practicing and promoting ayurveda. hit applications will not only support in health information management but will also take these practices to a greater height.
|
background : health information technology (hit) equips healthcare professionals with the required information and tools for making quality decisions in patient care, but it is always advisable to assess their attitude before its actual implementation.objectives:to assess the attitude of ayurvedic doctors toward the impact of hit.materials and methods : a cross - sectional survey was carried out among 140 doctors of an ayurvedic center of southern india. a validated questionnaire consisting of 18 questions based on a 5-point likert scale was administered to the participants after receiving their due consent.results:about 7580% of the respondents concurred that the hit application, such as electronic health record, has the potentials to reduce the duplication of documentation work, is easy and has an instant processing and real - time access to patient information. they also felt the need of such application to report the patient data to local and national health institutions. a total of 85% of them mentioned that these applications can make the collection and accessibility of patient data much easier compared with paper - based records, whereas 87.4% of them claimed telemedicine as a platform for multidisciplinary collaborative research and patient care.conclusion:even though most of the respondents agreed about the role of hit in improving the quality of health care, there were many who held no opinion about hit, including privacy and security of patient data. the need of proper awareness and training program is identified to make them aware about the hit and its application in patient care, education and research.
|
the trial is described in detail elsewhere and summarized below. infants with a bw of 501 to 1000 g were enrolled 12 to 36 hours after birth. exclusion criteria included terminal illness (ph 2 hours), major congenital anomaly, severe hemolytic disease, and congenital nonbacterial infection. after parental informed consent was obtained, infants were stratified by center and bw (501750 g ; 7511,000 g) and randomized using a centralized computer system. total serum bilirubin was measured in the first week at least once daily and in the second week when phototherapy had been given in the previous 24 hours or the last bilirubin exceeded 7mg / dl. phototherapy was provided at the bilirubin values noted above and administered for at least 24 hours whenever started or restarted. irradiance was increased within this range at bilirubin thresholds of 13 mg / dl for infants 501750 g and 15 mg / dl for infants 7511,000 g. an exchange transfusion was indicated whenever the bilirubin exceeded the threshold after 8 hours of intensified phototherapy. as appropriate for an effectiveness trial, the caregivers selected the fluid regimens, feedings, brand of phototherapy lamps, indications for mechanical ventilation and other interventions. the outcomes included death, impairment, profound impairment, death or impairment (primary trial outcome), and death or profound impairment at 1822 months corrected age. outcomes at 18 to 22 months of corrected age were assessed by blinded neurological examiners and neurodevelopmental assessors trained to reliability during a 2-day workshop. impairment was defined as blindness (no functional vision in either eye), severe hearing loss (hearing loss for which bilateral hearing aids were prescribed), moderate or severe cerebral palsy, or a score below 70 on the mental or psychomotor development index of the bayley scales of infant developmentii. profound impairment was defined as a score of 50 for either index or a level of 5 for gross motor function by the modified palisano criteria. (profound impairment was not initially defined as an outcome for the trial but was added partly because profound impairment is less likely than less severe impairment to improve with age. this definition was based on prior network studies and selected before any comparison of the outcomes of treatment groups. infants were classified as having moderate or severe cerebral palsy if they were unable to walk or required assistive devices. multiple variables that may influence risk of bilirubin neurotoxicity or need for phototherapy (resuscitation drugs, chest compressions, early - onset sepsis, administration of pressors, acidosis (ph 0.10 was used to reduce the risk of false negative findings.) each final model included all main effects. the same approach was used in conducting secondary analyses for each outcome that included additional predictor variables (gestational age, sex, ethnicity, and inborn / outborn status). bayesian statistics were used to estimate the probability of a rr 1.1 at 2%. in reporting the bayesian analyses, infants with a bw of 501 to 1000 g were enrolled 12 to 36 hours after birth. exclusion criteria included terminal illness (ph 2 hours), major congenital anomaly, severe hemolytic disease, and congenital nonbacterial infection. after parental informed consent was obtained, infants were stratified by center and bw (501750 g ; 7511,000 g) and randomized using a centralized computer system. total serum bilirubin was measured in the first week at least once daily and in the second week when phototherapy had been given in the previous 24 hours or the last bilirubin exceeded 7mg / dl. phototherapy was provided at the bilirubin values noted above and administered for at least 24 hours whenever started or restarted. irradiance was increased within this range at bilirubin thresholds of 13 mg / dl for infants 501750 g and 15 mg / dl for infants 7511,000 g. an exchange transfusion was indicated whenever the bilirubin exceeded the threshold after 8 hours of intensified phototherapy. as appropriate for an effectiveness trial, the caregivers selected the fluid regimens, feedings, brand of phototherapy lamps, indications for mechanical ventilation and other interventions. the outcomes included death, impairment, profound impairment, death or impairment (primary trial outcome), and death or profound impairment at 1822 months corrected age. outcomes at 18 to 22 months of corrected age were assessed by blinded neurological examiners and neurodevelopmental assessors trained to reliability during a 2-day workshop. impairment was defined as blindness (no functional vision in either eye), severe hearing loss (hearing loss for which bilateral hearing aids were prescribed), moderate or severe cerebral palsy, or a score below 70 on the mental or psychomotor development index of the bayley scales of infant developmentii. profound impairment was defined as a score of 50 for either index or a level of 5 for gross motor function by the modified palisano criteria. (profound impairment was not initially defined as an outcome for the trial but was added partly because profound impairment is less likely than less severe impairment to improve with age. this definition was based on prior network studies and selected before any comparison of the outcomes of treatment groups. infants were classified as having moderate or severe cerebral palsy if they were unable to walk or required assistive devices. multiple variables that may influence risk of bilirubin neurotoxicity or need for phototherapy (resuscitation drugs, chest compressions, early - onset sepsis, administration of pressors, acidosis (ph 0.10 was used to reduce the risk of false negative findings.) the same approach was used in conducting secondary analyses for each outcome that included additional predictor variables (gestational age, sex, ethnicity, and inborn / outborn status). bayesian statistics were used to estimate the probability of a rr 1.1 at 2%. in reporting the bayesian analyses, we follow the guidelines developed by sung. multiple variables that may influence risk of bilirubin neurotoxicity or need for phototherapy (resuscitation drugs, chest compressions, early - onset sepsis, administration of pressors, acidosis (ph 0.10 was used to reduce the risk of false negative findings.) each final model included all main effects. the same approach was used in conducting secondary analyses for each outcome that included additional predictor variables (gestational age, sex, ethnicity, and inborn / outborn status). bayesian statistics were used to estimate the probability of a rr 1.1 at 2%. in reporting the bayesian analyses in all analyses, the bayesian and frequentist models produced similar values for the rr. the tables include these values and to provide information not obtainable from frequentist statistics the (posterior) probability of a rr 0.31) the results consistently favored agpt (rr = 0.690.89) among all infants enrolled and among all survivors assessed with 96% to > 99% estimated probability of a reduction in impairment or profound impairment and a 95%97% probability of a rr 0.31), all subgroups were combined in the analyses. the results consistently favored agpt (rr = 0.690.89) among all infants enrolled and among all survivors assessed with 96% to > 99% estimated probability of a reduction in impairment or profound impairment and a 95%97% probability of a rr < 0.90 in profound impairment. overall agpt was associated with a marginally significant and potentially important overall reduction in death or impairment (rr = 0.910.93 ; upper 95% confidence or credible limits for both of 1.01) and a 95% estimated probability that the composite outcome of death or impairment was reduced (a rr < 1.0). however, the findings differed by subgroup (an interaction of treatment with bw and mechanical ventilation ; p<0.05) with less than a 50% estimated probability of a reduction in this composite outcome among ventilator treated infants 750 g and among nonventilated 7511000 g infants. overall, there was a significant reduction in death or profound impairment (rr = 0.880.89) with a 99% estimated probability that agpt reduced this composite outcome. the effect of treatment differed by bw stratum irrespective of mechanical ventilation (p=0.06). infants greater than 750 g bw had a rr of 0.81 with a 99% estimated probability of a reduction in death or profound impairment. agpt did not reduce this outcome among infants in the smaller bw stratum (rr= 0.98). results similar to those above were found using secondary models that also included gestational age, sex, ethnicity, and whether the infants were born within or outside their network center. despite concerns about extrapolating treatment effects from larger and healthier infants to the most immature infants, phototherapy has been considered both effective and safe in all newborns. yet, preterm infants have been randomly assigned to treatment with phototherapy or no phototherapy in only one large trial, and it was performed decades ago. the findings were compatible with a substantial increase in mortality with phototherapy among not only elbw infants as noted above but also among all low bw (< 2500 g) infants (n=1,063 ; rr = 1.32 [0.961.82 ]). these findings have been largely ignored because they were not significant at a p<0.05, an error often made in failing to recognize and seriously consider important potential treatment hazards when statistical power is limited. in our network trial, 80% of the conpt group received phototherapy, a factor likely to make it difficult to identify phototherapy hazards except perhaps in the most vulnerable infants. we previously reported that the absolute number of deaths among 501750 g infants was 5% greater with aggressive than conpt, a difference equal to the 5% absolute reduction in the number of infants with impairment and only slightly more than the 4% reduction in infants with profound impairment in this bw group. although the p value for a two - way interaction between treatment group and bw was not significant (p=0.15), power was limited, and this finding, like those in the collaborative phototherapy trial, suggests the possibility of an increased mortality in the smallest infants in the trial. composite outcomes have the disadvantage that treatment may have opposite effects for the outcome components. however, the use of composite outcomes may be unavoidable for such questions as the effect of agpt on survival without impairment when the components (death or impairment) are competing outcomes. when, as in our analysis of ventilated 501750 g infants, the effect of treatment appears to differ for the different components of outcome, the results for each component should be separately analyzed. the analyses reported herein were conducted to provide the best assessment possible with the available data to evaluate whether the benefits and hazards of agpt among the smallest and sickest infants differ from those in other elbw infants. because the effects of any therapy may differ considerably in different subgroups, such differences are particularly important in identifying treatment hazards to which the highest risk patients may be especially vulnerable. our trial, like almost all clinical trials, had high power only to identify overall treatment effects using conventional frequentist statistics. even so, we identified a significant three - way interaction suggesting that agpt increased mortality among ventilated infants 750 g bw. however, subgroup analyses are most likely to be valid when, as in our study, they are supported by preexisting evidence, their assessment was preplanned, and they are biologically plausible. the reduction in bilirubin with phototherapy might increase the susceptibility of elbw infants to oxidative injury. moreover, phototoxicity might directly result in oxidative injury to cell membranes or other adverse effects. while larger and healthier infants might escape injury discernible in our trial, phototoxicity would be most likely to be identifiable in the most immature infants whose skin readily transmits light and who would be most vulnerable to oxidative injury the use of agpt for the smallest and sickest newborns might be analogous to use of surgery (rather than radiation or chemotherapy alone) for some cancer patients to improve their long term outcome despite a greater initial risk of death. the possibility that agpt increases mortality of ventilated infants 750 g bw treated is supported by our bayesian analyses performed to complement the frequentist analyses. frequentist analyses assess the probability that the observed or a larger difference between groups would occur assuming the null hypothesis is correct. in contrast, bayesian analyses directly assess the question : how likely is the treatment to have benefit / harm ? these analyses may be most helpful in estimating treatment benefits and hazards when power is limited as subgroup analyses. bayesian analyses allow prior estimates of treatment effect to be updated using new data in estimating the (posterior) probability of benefit. concerns about bayesian analyses have largely been concerns that the prior probability would be derived from methodologically weak studies and be overly optimistic. the posterior probability that agpt increased mortality was estimated using a neutral prior probability despite the evidence of an increased mortality in the one large prior trial of phototherapy, and the values for rr were similar in the bayesian and frequentist analyses and identified a high probability that agpt increases mortality while reducing profound impairment, an outcome that some people consider worse than death. in recent observational analyses of the network trial, higher plasma bilirubin levels on day 5 were associated with a higher risk of death or impairment among unstable infants (infants who at five days had any of various risk factors [primarily mechanical ventilation but also blood ph < 7.1, pressor therapy, a positive blood culture, or apnea and bradycardia requiring bag and mask ventilation or intubation during the prior 24 hours ]). these analyses did not involve any assessment of the effect of agpt, have the limitations inherent in observational analyses for making treatment inferences, and thus do not contradict our analyses. clinical instability at age 5 days may be the result -- not the cause --- of bilirubin toxicity that resulted in hypoventilation, recurrent apnea, or clinical instability prompting the use of respiratory or pressor support. the presence or absence of these problems ordinarily, evidence of treatment heterogeneity like we identified in our analyses would generate a hypothesis to be tested in future trials. in this instance, there may never be another large trial comparing phototherapy to no phototherapy or agpt to conpt in elbw infants. we considered whether to extend the network trial to randomize additional infants less than 750 g bw to more precisely assess the risks and benefits of agpt and conpt in this subgroup. we decided against doing this partly because the findings with 684 such infants randomized suggested that any increase in survival with conpt would be almost entirely offset by an increase in survivors with profound impairment. the mortality findings in the network trial prompted watchko and maisels to conclude that in infants < 750 g, it seems prudent to initiate phototherapy at lower irradiance levels. irradiance levels can be increased, if necessary, or more surface exposed to phototherapy if the bilirubin rises. it remains to be determined whether the approach would avoid an increase in mortality while maintain the reduction in profound impairment with agpt in the network trial. the appropriate irradiance levels and how they would be best achieved is unclear, partly because the manufacturing changes in phototherapy lamps since the prior collaborative phototherapy have substantially increased the irradiance levels that they deliver (mean of 2223 w per square centimeter per nanometer each day as measured at the infant s skin during the network trial). in summary, the findings from the network trial -- the only large trial of agpt yet performed -- suggest that agpt may increase mortality while reducing impairment and profound impairment among the smallest and sickest infants. as for other neonatal therapies, phototherapy should not be assumed to have the same risks and benefits in the smallest and sickest infants as in more mature infants. our results indicate an urgent need to develop other treatment approaches using lower irradiance levels or other treatment methods that may reduce severe bilirubin neurotoxicity without risking an increase in the mortality of these infants. these treatment approaches could then be rigorously tested by comparing them to agpt in a large randomized trial.
|
objectiveaggressive phototherapy (agpt) is widely used and assumed to be safe and effective for even the most immature infants. we assessed whether the benefits and hazards for the smallest and sickest infants differed from those for other extremely low birth weight (elbw ; (1000 g) infants in our neonatal research network trial, the only large trial of agpt.study designelbw infants (n=1974) were randomized to agpt or conservative phototherapy at age 1236 hours. the effect of agpt on outcomes (death ; impairment ; profound impairment ; death or impairment [primary outcome ], and death or profound impairment) at 1822 months corrected age was related to bw stratum (501750 g ; 7511000 g) and baseline severity of illness using multilevel regression equations. the probability of benefit and of harm was directly assessed with bayesian analyses.resultsbaseline illness severity was well characterized using mechanical ventilation and fio2 at 24 hours age. among mechanically ventilated infants 750 g bw (n = 684), a reduction in impairment and in profound impairment was offset by higher mortality (p for interaction < 0.05) with no significant effect on composite outcomes. conservative bayesian analyses of this subgroup identified a 99% (posterior) probability that agpt increased mortality, a 97% probability that agpt reduced impairment, and a 99% probability that agpt reduced profound impairment.conclusionsfindings from the only large trial of agpt suggest that agpt may increase mortality while reducing impairment and profound impairment among the smallest and sickest infants. new approaches to reduce their serum bilirubin need development and rigorous testing.
|
irritable bowel syndrome (ibs) is the most prevalent of functional gastrointestinal disorder (1). it is exhibited with abdominal pain or discomfort associated with disturbance in defecation and intestinal habits, in the absence of an organic cause that justifies the signs (2). about 54% to 100% of patients with ibs may be associated with psychiatric disorders (such as emotional disorders) and personality pathology (3). inasmuch, stress, anxiety and depression are prevalent in ibs patients and they are related to onset and severity of symptoms (4), affective and emotional symptoms should be considered as specific and inseparable symptoms of the syndrome (5).there are significant differences between the patients and healthy individuals in terms of anxiety, neuroticism and extraversion. hence, the patients with irritable bowel syndrome who seek medical help because of their intestinal symptoms, demonstrate emotional problems such as depression and anxiety and neurotic personality characteristics (3). it is beneficial to remember that optimal emotion regulation (or emotion dysregulation) may vary for different individuals, in different situations and with different goals. due to emotion regulation involved heterogeneous developmental processes, individual differences in emotion regulation for example, individuals seemingly differ in their knowledge of the need for emotion regulation, awareness of alternative strategies, flexibility in applying different regulatory strategies, and other components of emotion regulation (7). the relationships between personality traits and processes of emotion regulation have been confirmed in several studies. some factorial models have acquired the consistent evidence for the relation between affect and personality (8). behavioral characteristics (e.g. attention, sociability, stability or reactivity in response to frustration) are as internal sources of individual differences in emotion regulation (10). the relationships between 5 big traits and difficulties in emotion regulation have also been indicated (11). openness to experience was correlated with the ability to recognize emotions (13) and agree - ableness has been related to how a person expresses his / her negative emotions (14). in principle, the relations between personality and emotion regulation strategies are indirect, considering that personality causes individuals to become more vulnerable toward certain emotions (15). hardiness as a personality trait is a configuration of attitudes and skills that motivate the individuals to do strategic and hard actions in face to stressful circumstances, and also, to activate tenaciously to cope with the conditions. hence, it can help individuals to turn stressful circumstances from potential disasters into growth opportunities (16). the components of mental health, including somatization, anxiety, social dysfunction, hostility, avoidance of stressful thoughts and depression, are negatively related to hardiness (17, 18). findings of previous studies regarding the effects of hardiness on stress and health are inconsistent, possibly due to neglect (failure to approve) the influence of variables such as negative affectivity. klag & bradley 's study examined the main, moderating and mediating effects of hardiness. in the study, controlling for negative affectivity, enough evidence was not obtained for the direct effects of hardiness on stress and illness (20). hardiness has a significant impact on adaptive and maladaptive emotion regulation strategies (21). in fact, cognitive hardiness moderate the effects of emotional coping on psychological distress (22). forgiveness is another trait whereby individual who has been annoyed (insult or betrayal) to inhibit relationship - destructive responses and to behave constructively toward someone who has behaved destructively toward him / her. in fact, forgiving is a motivational transformation, namely, one becomes decreasingly motivated to avenge an insulting behavior, and vice versa, increasingly motivated to compromise with offender, despite the offender s hurtful actions (23). forgiveness not only reduces negative emotions such as anger, hate, hostility, and also thought and behaviors associated with them, but also increases empathy, kindness and compassion toward the offender contemporarily (24, 25). the trait is positively correlated with life satisfaction, positive affect and emotional - focused coping (26 28) and negatively with anxiety, depression, neuroticism, stress, anger and hostility (2629). agreeableness is the strongest predictor of forgiveness, however, two characteristics related to neuroticism (irritability and temperamentalness) prevents forgiveness. these characteristics of neuroticism may lead to the re - experience of negative emotions toward a transgressor and thus postpone the development of positive emotions (30). therefore, the association between forgiveness and health may be mediated by stress and negative emotions (31). forgiveness can indirectly improve health by stress reduction (32, 33). considering the literature of the study, positive personality traits are likely to affect emotion regulation and ability of individuals emotionally, but researches are not enough about the role of the traits in emotion dysregulation and its factors, and also any study has investigated the role of such abilities in digestive patients. hence, the purpose of this study was to determine the relationship between personality traits (forgiveness and hardiness) and emotion dysregulation in ibs. the research was a cross - sectional study among the patients with irritable bowel syndrome who were referred to the psychosomatic disorders clinic of isfahan in 2013. overall, 123 patients were selected by census method, according to criteria of research and during a particular period (10 months). study criteria included : satisfaction from participating in the study, age range of 1870 years, lack of acute psychiatric disorders, and the diagnosis of ibs on the basis of rome iii criteria by gastroenterologists. after assuring to patients about the confidentiality of the information, data on demographic characteristics, emotional dysregulation and personality traits were collected by self - administered questionnaires. demographic characteristics applied in this study were age, sex as male and female, educational level and disease duration. the scale is a self - report measure developed by gratz & roemer (34) to assess difficulties in emotion regulation. the scale is composed of 6 factors, including, non - acceptance of emotional responses (non - acceptance), difficulties engaging in goal - directed behavior (goal), impulse control difficulties (impulse), lack of emotional awareness (awareness), limited access to emotion regulation strategies (strategy), and lack of emotional clarity (clarity). the ders has 36 items that are rated on a five - point likert scale, ranging from 1 (almost never) to 5 (almost always), and are recoded so that higher scores in every case indicate greater difficulties in emotion regulation (i.e., greater emotion dysregulation). the scale has high internal consistency, cronbach s =0.93 for total ders & cronbach s >:80 for each factors (34). in an iranian normal sample, internal consistency of the scale using cronbach s ranged from 0.66 to 0.88 for all factors (35). the lghs is a 45-item self - report instrument designed to measure psychological hardiness in stressful situations (35). respondents rate each item on a 1 (strongly disagree) to 5 (strongly agree) scale. the scale has a good internal consistency based on cronbach s (36). (38), consists of 25 items aimed at assessing a respondent s self - appraisal of his / her proneness to forgive interpersonal transgressions. higher scores on this scale reflect higher levels of forgiveness. in the iranian sample, internal consistency of the ifi based on cronbach pearson correlation coefficient was used to evaluate the correlation between emotional dysregulation and personality traits. multivariate and binary logistic regression analyses were performed to determine the predictive ability of personality traits (hardiness and forgiveness). the dependent variable was personality traits and the independent variables were emotional dysregulation and its factors. the research was a cross - sectional study among the patients with irritable bowel syndrome who were referred to the psychosomatic disorders clinic of isfahan in 2013. overall, 123 patients were selected by census method, according to criteria of research and during a particular period (10 months). study criteria included : satisfaction from participating in the study, age range of 1870 years, lack of acute psychiatric disorders, and the diagnosis of ibs on the basis of rome iii criteria by gastroenterologists. after assuring to patients about the confidentiality of the information, data on demographic characteristics, emotional dysregulation and personality traits were collected by self - administered questionnaires. demographic characteristics applied in this study were age, sex as male and female, educational level and disease duration. the scale is a self - report measure developed by gratz & roemer (34) to assess difficulties in emotion regulation. the scale is composed of 6 factors, including, non - acceptance of emotional responses (non - acceptance), difficulties engaging in goal - directed behavior (goal), impulse control difficulties (impulse), lack of emotional awareness (awareness), limited access to emotion regulation strategies (strategy), and lack of emotional clarity (clarity). the ders has 36 items that are rated on a five - point likert scale, ranging from 1 (almost never) to 5 (almost always), and are recoded so that higher scores in every case indicate greater difficulties in emotion regulation (i.e., greater emotion dysregulation). the scale has high internal consistency, cronbach s =0.93 for total ders & cronbach s >:80 for each factors (34). in an iranian normal sample, internal consistency of the scale using cronbach s ranged from 0.66 to 0.88 for all factors (35). the lghs is a 45-item self - report instrument designed to measure psychological hardiness in stressful situations (35). respondents rate each item on a 1 (strongly disagree) to 5 (strongly agree) scale. the scale has a good internal consistency based on cronbach s (36). (38), consists of 25 items aimed at assessing a respondent s self - appraisal of his / her proneness to forgive interpersonal transgressions. higher scores on this scale reflect higher levels of forgiveness. in the iranian sample, internal consistency of the ifi based on cronbach pearson correlation coefficient was used to evaluate the correlation between emotional dysregulation and personality traits. multivariate and binary logistic regression analyses were performed to determine the predictive ability of personality traits (hardiness and forgiveness). the dependent variable was personality traits and the independent variables were emotional dysregulation and its factors. a total of 123 ibs patients were recruited for the study (100 women, 83.3%, and 30 men, 16.7%). mean and standard deviations scores of personality traits and emotional dysregulation mean scores of emotional dysregulation, psychological hardiness and interpersonal forgiveness were almost the same in both gender. correlations between personality traits and emotional dysregulation and its subscales were computed. as showed in table 2, psychological hardiness was negatively correlated with total emotional dysregulation and its subscales, except awareness. besides, interpersonal forgiveness was negatively correlated with total emotional dysregulation and most of its subscales, except awareness and clarity. pearson s correlation coefficients between personality traits and emotional dysregulation and its subscales multivariate regression analyses were used for evaluating the predictive ability of psychological hardiness and interpersonal forgiveness. the results showed that hardiness was a predictor of total emotional dysregulation and the subscales of non - acceptance, goals, impulse, strategy and clarity, and also, forgiveness was a predictor of total emotional dysregulation and the subscales of non - acceptance, goals, impulse and strategy, with adjusting demographics characteristics (age, sex, educational level and disease duration). the results of multivariate regression analyses between personality traits and emotional dysregulation and its subscales model2 : adjusted for demographic characteristics (age, sex, educational level and disease duration) in addition, the results of a binary logistic regression showed (table 4) that hardiness and forgiveness were protective factors for emotional dysregulation with or, 95% ci : 0.93 (0.89,0.97), and 0.96(0.93,0.98) sequentially (in crude analysis), and with adjusting demographics characteristics (age, sex, educational level and disease duration) did n't show sensible changing in or emotional dysregulation (in model1). binary logistic regression analyses for variables of predicting emotional dysregulation model1 : age, sex, educational level and disease duration adjusted or (odds ratio), ci (confidence interval), this research was conducted with the purpose of investigating the relationship between personality traits, psychological hardiness, interpersonal forgiveness and emotion dysregulation in patients with irritable bowel syndrome. hardiness was a negative predictor of emotional dysregulation and most of its sub - scales. that is, individuals who acquire high score on hardiness measure, are more probably to accept their emotional responses and subsequently experience fewer negative emotions, to able to recognize their emotions, to control their behaveiors and to accomplish tasks when experiencing negative emotions, and finally, to use adaptive strategies in problematic conditions. thus, hardiness as a positive characteristic associated with less emotional dysregulation in irritable bowel syndrome. this finding is consistent with the results of other studies (21, 22, 39). in explaining this finding it can be elucidated that hardy individuals assess unpleasant conditions as a challenging rather than as a threatening, have a commitment to activities and their interpersonal relationships and to self, recognize their own values, goals and priorities in life, and believe that they can influence events and turn stressful circumstances from potential disasters into opportunities for personal growth. furthermore, hardy individuals can maintain their mental health under unpleasant and unexpected circumstances, because of optimistically style, feeling of ability in the face with difficulties, using problem - solving coping, having positive expectations about consequences, and believing to dependency of outcome to action (40). belief to change, variation, dynamism of life and to this attitude that any event does not necessarily mean a threat to human health, cause cognitive flexibility and tolerance with respect to stressful difficult events and ambiguous situations (41). hardiness as an internal source mediates the choice of emotion regulation strategies by altering the individuals cognitive appraisal process, so that, the individuals can reframe or reinterpret adverse experiences. consequently, it is expected that the levels of psychological distresses experienced by them to be reduced (21) and they encounter with fewer problems in their emotion regulation. in this regard, this study also showed that hardy persons tend to experience less negative emotions and get into less maladaptive coping strategies. thus, it can such be assumed what produce a buffer in hardy people is to control negative affectivity against stress. according to past studies (20, 21) forgiveness was a negative predicttor (a protective factor) of emotional dysregulation and some its subscales. this study showed that persons with characteristic of interpersonal forgiveness experience lower level of emotional dysregulation, due to they accept their emotional responses and able to do appropriate actions with concentration on them when experiencing negative emotion. besides, they inhibit their impulsive behaviors and utilize more adaptive coping strategies. this finding is in line with sansone. and hirsch. individuals with borderline personality disorder (characterized by severe disturbances in emotion regulation) show lower forgiveness (42). the effect of self - forgiveness on suicidal behavior was indirect and it was mediated by depression. inconsistent with the current study, in another study with aim of assessing the role of forgiveness of self as well as forgiveness of others, lack of self - forgiveness was associated with engaging in self - destructive behaviors along with the greater longevity frequency of that for specific reasons related to emotions regulation and social functioning, namely to get rid of unwanted emotions, to feel something due to feeling numb or empty, and to communicate with others. but no relationship was found between forgiveness of others and self - destructive behaviors (44). unforgiveness has been defined as a set of delayed emotions toward a transgressor (45) and produces severe negative emotions (25). instead, forgiveness not only reduce sun forgiveness through diminishing the negative thoughts, emotions, motivations, and behaviors toward the offender, but also increases positive emotions and perspectives such as empathy, hope, or compassion (45). thus, since trait forgivingness was positively correlated with ability of empathy and agreeableness (46) and was negatively correlated with anger and vengeful rumination (47), the individuals who are more forgiveness in interpersonal relationships, experiences fewer anger and revenge and their motives are more altruistic. these individuals in the face with an annoying interpersonal situation can control their negative emotions faster and maintain their intimate relationships with giving an opportunity to trespasser to recommunicate (46). forgiving individuals alter their attributions toward causality and personality of transgressors. hence, the impact of rumination reduces and negative emotions such as resentment, bitterness, disgust, hostility, anger, fear are subsided (48, 49). rumination has been recognized as a mediator between forgivingness and emotional outcomes (47). a structural equation model has been used to examine the relationship between forgiveness and mental and physical health. its results indicated that the forgiveness - health relation was mediated by positive and negative affect, perceived stress, and the interrelationship between negative affect and stress. in other word, the results show that the relationship between forgiveness and health more is indirect and under other factors (49). patients who had higher scores on forgiveness - related variables, reported lower levels of pain, anger, and psychological distress. furthermore, anger largely mediated the association between forgiveness and psychological distress (50). hence, according to the results of the present study, patients with irritable bowel syndrome who are more forgiving, tend to experience less emotion dysregulation and/or have probably more ability in their emotion regulation. this is a cross - sectional analysis ; therefore, we can not determine causality. other limitations are that variables scores were based on self - report measures and sampling was not based on simple random because limited statistical population. besides, other social factors that may affect the relationship between variables have been overlooked. positive internal resources such as interpersonal forgiveness and psychological hardiness are as protective factors for emotional dysregulation in ibs patients. thus, the patients who are more hardy and more forgiving toward others, are likely more successful at adaptive emotion regulation. it emphasizes the positive and beneficial role of the personality traits in regulating of emotional problems of ibs patients. hence, these variables should be considered as effective factors in the treatment process of the patients. according to the findings of this study, it is recommended that intervention programs based on positive psychology be implemented for patients in the psychosomatic disorders clinics. ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors.
|
background : personality traits and emotion regulation processes play an important role in human health. the purpose of this study was to investigate the role of positive personality traits (psychological hardiness and interpersonal forgiveness) in emotion regulation of patients with irritable bowel syndrome.methods:the research was a cross - sectional study. statistical population included all of ibs patients referred to the subspecialty center of psychiatry in isfahan in 2013. overall, 123 subjects (100 women, 83.3%, and 30 men, 16.7%) were selected by census method, according to criteria of research and during a particular period. to collect data, the difficulties in emotion regulation scale (ders), lang and goulet hardiness scale (lghs) and interpersonal forgiveness inventory (ifi) were used. data was analyzed using pearson s correlation coefficient and multivariate and binary logistic regression analyses.results:mean age of patients was 33.8210.45 years and 83.3% (100) of them were female. regression analyses showed that both personality traits of hardiness and forgiveness were as protective factors for emotional dysregulation with or, 95% ci : 0.93 and 0.96 sequentially, with adjusting demographic variables (age, gender, and education level and disease duration).conclusion : patients who are more hardy and forgiving toward others, are likely more successful at adaptive emotion regulation. it emphasizes the positive and beneficial role of the personality traits in regulating of emotional problems of ibs patients. hence, these variables should be considered as effective factors in the treatment process of the patients.
|
precise measurement of the anterior chamber is important in many aspects of ophthalmology, such as assessing glaucoma risk [1, 2 ] and surgical planning and intraocular lens (iol) power calculation [3, 4 ]. previous studies have focused on the measurement of anterior chamber depth (acd) or the anterior chamber angle (aca). accurate measurement of anterior chamber volume (acv) has been difficult historically due to technology limitations. recent development of swept - source optical coherence tomography (ss - oct casia ss-1000 oct, tomey corporation, nagoya, japan) is a form of fourier - domain oct (fd - oct), which uses a monochromatic tunable fast scanning laser source and a photodetector to detect wavelength - resolved interference signal instead of using a spectrometer as in spectral - domain oct (sd - oct). thus, with 30,000 a - scans per second, ss - oct allows rapid and precise anterior chamber measurement. as a variation of fd - oct, ss - oct has advantages of measurement speed and sensitivity over time - domain oct. besides, ss - oct also has advantages over sd - oct, such as higher robustness and capability of separating the real oct image from its mirror image [8, 9 ]. previous studies comparing ss - oct and sd - oct in posterior segment measurements have proved these advantages. ss - oct is also superior in detecting details of choroid - scleral interface and choroidal sublayer [11, 12 ]. studies comparing ss - oct to other octs in observations of anterior segment were rare, yet ss - oct has been widely used in the measurement of anterior chamber [1316 ]. anterior chamber anatomy may vary with aging, thickening of the lens, liquefaction of the vitreous, corneal changes, gender differences, and elongation of the axial length (axl) in high myopia [18, 19 ]. however, few studies have evaluated the effects of all these factors on the volume of the anterior chamber in normal cataract patients. in this study, we used the ss - oct, to investigate acv in normal cataract patients and to better understand factors that impact acv measurement. the institutional review board of the eye and ent hospital of fudan university approved this prospective study. all procedures adhered to the tenets of the declaration of helsinki and were conducted in accordance with the approved research protocol. ninety - two eyes of consecutive cataract patients at the eye and ent hospital of fudan university, between may 2015 and august 2015, were enrolled. exclusion criteria included zonular weakness, corneal disease, glaucoma, previous trauma, or any ocular surgical history. posterior vitreous detachment (pvd) was evaluated by b - scan by the same senior technician. axl was measured with an iol master (carl zeiss ag, oberkochen, germany). the lens opacity was assessed according to the lens opacities classification system iii (locs iii developed by dr. leo chylack, mass eye and ear) under slit lamp examination by one investigator. locs iii system has 4 categories : nc = nuclear color, no = nuclear opalescence, c = cortical cataract, and p = posterior subcapsular cataract. according to the previous study, nc and no were graded from 0.1 to 6.9 and ss - oct anterior segment scan mode was used with 128 radial scans, with a depth of 6 mm and a length of 16 mm. patients were instructed to fixate on the internal target and pull down the lower lid while the technician elevated the upper lid to expose the limbus. a total of 64 b - scans taken from the anterior segment scan mode were analyzed for measurement of acv. the instrument software automatically detected the boundaries of cornea, iris, and lens for each image, as shown in figure 1. manual adjustment was made if the software failed to detect the boundaries at the correct location. angle width parameters derived from ss - oct included the angle opening distance 500 (aod 500), the trabecular iris space area 500 (tisa 500), the angle recess area 500 (ara 500), and the trabecular iris angle 500 (tia 500), which were determined as previously described for the superior, inferior, nasal, and temporal angles. student 's t - test was used to compare differences in mean measurements between men and woman after normality tests and homogeneity of variance tests. pearson and spearman 's correlation analyses were used to investigate the relationships between acv and demographic data (pearson for continuous variables and spearman for categorical variables). there were 29.35% (27/92) high myopic (< 6.0 d) patients and the average axl was 25.09 2.96 mm. the average acv was 139.80 38.21 mm, range 59.41 to 254.09 mm. we performed univariate analysis for influencing factors of acv and multivariable analysis to adjust for independent covariates. the average acv was significantly larger in male patients than in female patients (figure 2(a), p = 0.001). acv was negatively correlated with age and locs iii c grade of the lens (figures 2(b) and 2(c), pearson 's correlation analysis, r = 0.443, p < 0.001, and spearman 's correlation analysis, = 0.450, p < 0.001). locs iii nc, no, and p grades were not correlated with acv narrowing (spearman 's correlation analysis, = 0.127, p = 0.246, = 0.146, p = 0.180, = 0.024, and p = 0.819, resp.). acv was also increased with increased axl (figure 2(d), pearson 's correlation analysis, r = 0.552, p < 0.001). table 3 presents the result from the multiple linear regression. with all of the covariates entered into the model, female gender (p = 0.002), greater age (p = 0.015), higher locs iii c grade (p = 0.043), and less myopia axl (p = 0.001) were all correlated with decreased acv (f = 10.252 p < 0.001 r = 0.498). objective, precise measurement of the anterior chamber volume has importantsignificance as a predictor of narrow angle glaucoma risk, assessment of pupil block, in addition to surgical planning in ac iol and phakic iol placement. previous reports of anterior chamber volume measurements relied on the scheimpflug system, which requires protracted cooperation of patients during testing. by using scheimpflug system, previous studies found that, with increasing age, acd and acv diminished and no correlation was found between acv and anterior chamber angle. however, the scheimpflug system could only provide an estimation rather than a direct visualization of the anterior chamber, resulting in an inaccurate assessment of acv which also lacks reproducibility. casia ss-1000 oct used a swept laser source, which could show high - resolution 3-dimensional images of anterior chamber by a very high - speed scanning system. previous studies reported variable influencing factors on acv, including gender, acd, and age. however, it remains unclear whether these factors remain significant after adjusting for independent covariates. in the study, we reported ss - oct data in healthy cataract patients and found that acv varied significantly among different subjects. influencing factors that contributed to reduced acv were female gender, increased age, locs iii c grade, and lower axl. the female gender was related to decreased acv possibly because generally females have shorter axl, smaller body habitus, eyes, and therefore a narrower anterior chamber than males. however, there were almost twice as many females as males in our study, which might be a bias. this was a limitation and we will verify the result in a population with similar percentages of men and women in the future. besides, the anterior chamber became shallower over time with thickening of the crystalline lens, which partly explained the negative correlation between increased age and acv. consequently, locs iii c grade was also negatively correlated with acv. after adjusting for independent covariates, gender, age, locs iii c grade, and axl these factors, along with ss - oct evaluation, are important for assessing risk in glaucoma patients and may impact the timing of therapeutic cataract surgery in patients with anatomic narrow angles or those with cataract - induced narrow angles. moreover, patients needing ac iol or phakic iol placement can benefit from ss - oct assessment as a preoperative tool to assess risk and aid surgical planning. further studies can examine if these risk factors are also found in patients before senile cataracts develop, in patients with open or narrow angle glaucoma, and how cataract surgery impacts the postoperative acv in patients at risk of narrow angles. in addition, several anterior segment imaging modalities, such as scheimpflug system, anterior segment oct, and ultrasound biomicroscopy (ubm), can be used to evaluate the volume of the anterior chamber. however, compared to other instruments, the ss - oct used in the current study has several advantages : (1) it is a noncontact optical system compared to ubm, which avoids distortion of the eye anatomy and angle and reduces contagion. (2) it is faster than the scheimpflug system or ubm because of the swept laser source and captures data of acv in less than 1 second. thus, patients could cooperate with this test easier than the scheimpflug system or ubm. (3) similarly to ubm, ss - oct provides direct angle visualization and generates an acv which is more precise and objective than the scheimpflug system of angle estimation. besides, this ss - oct could automatically show accurate measurements of anterior chamber angle, which has advantages over ubm. however, other methods still have their value in clinical ophthalmology. for instance, in cases of corneal scaring, ubm could still evaluate anterior chamber parameters while octs could not. to conclude, ss - oct could provide faster, objective, and more precise measurement of anterior segment than other methods in some conditions, which may have advantages in evaluation of acv but still need further confirmation in the future study. with ss - oct, we found female gender, increased age, higher locs iii cortical grading, and decreased axl to be important predictors for smaller acv in normal cataract patients.
|
purpose. to evaluate the anterior chamber volume in cataract patients with swept - source optical coherence tomography (ss - oct) and its influencing factors. methods. anterior chamber volume of 92 cataract patients was evaluated with ss - oct in this cross - sectional study. univariate analyses and multiple linear regression were used to investigate gender, age, operated eye, posterior vitreous detachment, lens opacity grading, and axial length (axl) related variables capable of influencing the acv. results. the average acv was 139.80 38.21 mm3 (range 59.41 to 254.09 mm3). the average acv was significantly larger in male patients than in female patients (p = 0.001). acv was negatively correlated with age and locs iii cortical (c) grading of the lens (pearson 's correlation analysis, r = 0.443, p < 0.001, and spearman 's correlation analysis, = 0.450, p < 0.001). acv was also increased with axl (pearson 's correlation analysis, r = 0.552, p < 0.001). multiple linear regression showed that, with all of the covariates entered into the model, gender (p = 0.002), age (p = 0.015), locs iii c grade (p = 0.043), and axl (p = 0.001) were still associated with acv (f = 10.252 p < 0.001 r2 = 0.498). conclusion. with ss - oct, we found that, in healthy cataract patients, acv varied significantly among different subjects. influencing factors that contribute to reduced acv were female gender, increased age, locs iii c grade, and shorter axl.
|
a santorinicele is a focal cystic dilatation of the terminal portion of the dorsal pancreatic duct at the minor papilla, and has been reported in patients with pancreas divisum (1). clinically this rare anomaly has been suggested to be a possible cause of a relative stenosis of the minor papilla, which in association with pancreas divisum, results in a high intraductal pressure and resultant pancreatitis (1 - 7). although there is only one report of a santorinicele without pancreas divisum, it was combined with bifid pancreas, which is a congenital anomaly where the primitive pancreatic channels fail to fuse into a single main duct during the development of the pancreas (8). we describe a typical case of a santorinicele without pancreas divisum or other congenital pancreatic anomalies that was identified incidentally by multidetector row computed tomography (mdct). a 67-yr - old woman was admitted complaining of paraumbilical and lower left abdominal pain with intermittent hematochezia. she had been previously treated for diabetes mellitus and hypertension with an oral hypoglycemic agent and a calcium channel blocker for the previous 10 yr. she was a non - smoker, and non - drinker with no family history of gastrointestinal disease. the laboratory studies, including a complete blood count, liver function tests, serum amylase level, were within the normal range. the colonoscopic findings were diffuse erythema, edema, ulcer, and friability of the mucosa through the proximal descending and distal transverse colon, which was consistent with ischemic colitis. mdct (lightspeed pro ; ge medical systems, milwaukee, wi, u.s.a.) was performed after the colonoscopy. the ct scan protocol was as follows : 150 ml of iopromide (ultravist 370 ; schering, berlin, germany) was injected through an 18-gauge angiographic catheter that was inserted into a forearm vein at a flow rate of 3 ml / sec by using a mechanical injector. portal venous phase images were acquired following a scanning delay of 70 sec from the time of initiation of contrast material injection, and the delayed phase images followed after a scanning delay of 3 min. the ct parameters included a detector configuration of 1.25 mm16, a gantry rotation speed of 0.5 sec, and a table feed of 20 mm per gantry rotation. ct showed mild and diffuse wall thickening from the distal transverse colon to the descending colon. it also showed a small round low - density lesion at the distal dorsal pancreatic duct, which was adjacent to the duodenal wall (fig. the 1.25-mm transverse ct scans were reconstructed at 0.625-mm intervals on a dedicated workstation (advantage window 4.2 ; ge medical systems). the coronal reformatted image using a minimum intensity projection technique clearly showed a cystic dilatation of the distal dorsal pancreatic duct and a communication between the ventral and dorsal pancreatic ducts (fig. the dorsal pancreatic duct was equal to or slightly more prominent than the ventral pancreatic duct. the subsequent magnetic resonance cholangiopancreatography (mrcp) confirmed the cystic dilatation of the distal dorsal pancreatic duct. there was no evidence of pancreas divisum or any other congenital anomaly of pancreas (fig. the patient did well after supportive cares including intravenous fluids and antibiotics for ischemic colitis, and then was discharged on the 9th day of admission without any problems. a santorinicele is believed to be analogous to a dilatation of the most distal common bile duct, which is commonly known as a choledochocele. (1), who reported 4 patients with pancreatitis and pancreas divisum accompanied by a focal cystic dilatation of the terminal portion of the dorsal pancreatic duct by endoscopic retrograde cholangiopancreatography (ercp). since the first description, santoriniceles have been reported in patients with pancreas divisum, either complete or incomplete (2 - 7). the santorinicele has been suggested to be a possible cause of the relative stenosis of the accessory papilla, which in association with unfused dorsal and ventral ducts results in the high intraductal pressure responsible for the recurrent episodes of acute pancreatitis. therefore, a sphincterotomy or balloon dilatation is believed to be effective in patients with a santorinicele and pancreatitis (3 - 5, 7). the prevalence of this rare anomaly is unknown, and it is unclear if it is congenital in origin or is an acquired lesion secondary to a stenosis of the dorsal duct orifice. because most santoriniceles have been reported in elderly patients, it has been assumed that a santorinicele is most probably an acquired rather than a congenital condition. structural changes might contribute to the acquired mucosal weakness, thereby facilitating the formation of a santorinicele. however, a report of a santorinicele in a pediatric patient without a duodenal diverticulum suggests that the pathogenesis is congenital in some cases (4). since all santoriniceles reported were detected in patients with pancreatic divisum, it was unclear if a santorinicele might be present in patients without this anomaly. in 2003, a santorincele without pancreatic divisum was reported by byeon. (8). this is the only report of a santorinicele not associated with pancreas divisum. however, instead of pancreas divisum, the patient had another congenital anomaly, bifid pancreas, which is an anatomical variant where the main pancreatic duct is bifurcated along its length. on the other hand, our case was characteristic in two ways. since all santorinicele reported were diagnosed by mrcp or ercp, this is the first case reported of a santorinicele without pancreas divisum detected by ct. in conclusion furthermore, mdct is believed to be a very useful diagnostic technique for delicate lesions like as the present case.
|
a santorinicele is defined as a focal cystic dilatation of the terminal portion of the dorsal pancreatic duct at the minor papilla. most cases reported previously were associated with pancreas divisum and a santorinicele without pancreas divisum is known to be rare. we recently experienced a typical case of a santorinicele without pancreas divisum in a 67-yr - old woman with abdominal pain and hematochezia, subsequently proven to be the result of an ischemic colitis. the santorinicele was diagnosed incidentally with multi - detector row computed tomography using a minimum intensity projection technique, which clearly showed a cystic dilatation of the terminal portion of the dorsal pancreatic duct and a communication between the ventral and dorsal pancreatic ducts. this finding was also confirmed by a magnetic resonance cholangiopancreatography.
|
the high bioavailability and long halflives of radioactive isotopes of cs make them a significant environmental hazard. [1 - 3 ] to isolate this hazard, nuclear waste containment facilities may be separated from host bedrock by compacted bentonite liners, shown in laboratory experiments to slow the diffusion of cs.[1,2,4 - 7 ] the smectite minerals making up these liners are 2 : 1 layer type clay minerals. each layer consists of an alumina (dioctahedral) or magnesia (trioctahedral) sheet sandwiched between two silica tetrahedral sheets. the arrangement of silica tetrahedra in sheets results in the creation of a network of six - oxygen rings, at the center of each a distorted hexagonal cavity, across the surface of the mineral. isomorphic substitution of mg for al, or li for mg, results in negative octahedral charge sites, while substitution of al for si creates negative tetrahedral charge sites. these charge sites are balanced by cations in the interlayer which attract waters of hydration to this region, causing the clay mineral to swell. although cs - smectite hydrates have been studied for many years, little detailed information about the mechanisms involved in csadsorption, hydration, and diffusion has been adduced from experimental findings. molecular simulation thus has proven to be a useful adjunct to experimental work concerning the smectite interlayer. [10 - 15 ] a number of xrd studies show that the layer spacing of cs - smectites remains in the range 11.912.5 after exposure to water vapor at any relative humidity,[9,16 - 20 ] or even after immersion in an aqueous solution. water vapor adsorption isotherms [16 - 20 ] indicate increasing hydration of cs - smectite with increasing relative humidity, but calvet and prost argued that most of the water adsorbed resides in micropores, not in the interlayer region. indeed, measurements of the micropore volume in homoionic montmorillonites have established the extensive microporosity of cs - smectites. calvet and prost suggested that the 12.4 layer spacing in cs - smectite was achieved and stabilized after the adsorption of only about 1.21.4 h2o per unit cell of the clay mineral, well below the nominal monolayer water content of 4 h2o per unit cell observed for smectites containing the strongly hydrating lication. our recent monte carlo (mc) simulations of model cs - smectite hydrates at low water contents confirmed this speculation, showing that the 12.4 hydrate of cs - smectite likely contains no more than 2.7 h2o per unit cell (about 2/3 monolayer). the cs - smectites we investigated were (table 1) : cs - hectorite with 1.3 and 2.7 h2o per unit cell (1/3 and 2/3 water monolayer), cs - beidellite with 1/3 water monolayer, and cs - montmorillonite with 1/3 and 2/3 water monolayer. caesium - smectites with 1.0, 1.31, 0.844, and 0.75 monolayers of water also were modeled for up to 10 million mc steps, but did not meet our mc equilibration criteria of achieving both a minimum average potential energy and a stable layer spacing. that simulations containing more water molecules were inherently unstable is not surprising given experimental data indicating cs - smectites have low interlayer water contents. these latter results were analyzed for average properties, such as interlayer water self - diffusion coefficients, as well as for individual molecular properties, such as plots of xyz coordinates sampled by specific csions or by water molecules. these traditional simulation outputs were not able to characterize the full complexity of interactions among cations, water molecules, and mineral surface sites. to continue analysis of the md results, we constructed animations of molecular motions in the five cs - smectite hydrate systems to examine the effects of charge site and hydration state on the behavior of interlayer species. stereo - viewing and animated motion have been shown to increase comprehension of three dimensional structures. because humans understand and navigate through a dynamic, three dimensional world, depiction of md animations as a collection of spheres in three dimensional space that change position over time is a familiar metaphor that is intuitive to most viewers. other more traditional forms of presentation, such as a display of the entire path of a molecule over time, can result in a " tangled mess " that is not easy to interpret. animations thus can be helpful in understanding the complex three dimensional relationships between interacting molecules over time. the simulation cell used consists of two opposing halves of a rigid 2 : 1 clay layer surrounding an interlayer region filled with rigid water molecules and csions (fig. the crystallographic unit cell formulae of the three cs - smectites we modeled are : hectorite : cs0.75 [si8](mg5.25li0.75)o20(oh)4 beidellite : cs0.75 [si7.25al0.75](al4)o20(oh)4 montmorillonite : cs0.75 [si7.75al0.25](al3.5mg0.5)o20(oh)4 hectorite is a trioctahedral 2:1 clay mineral, whereas mont - morillonite and beidellite are dioctahedral. moreover, hectorite shows charge substitution exclusively in the octahedral sheet, whereas beidellite contains only tetrahedral charge substitution. montmorillonite has both types of charge substitution, with twice as much octahedral as tetrahedral layer charge. our simulation cell contains eight unit cells, and has lateral (ab) dimensions 21.12 18.28. interactions between the interlayer species, and between them and atoms in the clay layers, are represented para - metrically by a mcy - type potential function : where u is the potential energy of the system, i and j are sites on atoms within the simulation cell, rij is the distance between sites i and j, q represents atom charge, and a, b, c, and d are van der waals interaction parameters. we used this form of potential function because it has led to accurate modeling of experimentally accessible quantities such as layer spacing and interlayer species configuration and mobility. water interaction is optimized on dimer structures and, therefore, does not enforce the tetrahedral configuration of bulk water as strongly as do other, more empirically - based water this fact may explain its enhanced ability to model water molecules in the especially constrained geometry of the clay interlayer region. van der waals parameters for the cs o interaction were obtained through conversion of lennard - jones (lj) (612) potential function parameters taken from smith and dang, described previously. the mcy cs o interaction parameters were : a = 51.0 kj mol, b = 1.0850, c = 3.72 10kj mol, d = 4.2758. van der waals interactions for cs h, cs al, and cs si atom pairs were assumed to be negligible. allen and tildesley have outlined the general principles of mc and md simulations of liquids. chang. and greathouse and sposito have developed simulation methodologies customized for exploration of the interlayer region of 2:1 clay mineral hydrates. detailed description of mc calculations performed to establish the equilibrated cs - smectite hydrate structures has been provided previously. the program monte was used to run mc (nt ensemble) simulations on a variety of cs - smectite hydrates at 300 k and 100 kpa normal stress (). monte carlo calculations began with a simulation cell that had a 14 layer spacing and contained 6 csin the midplane of the inter - layer along with several randomly placed water molecules., consisting of 20,000 mc steps in which only water molecules were allowed to move, followed by another 20,000 steps in which water molecules could move and interlayer spacing could vary. after this optimization, all molecules were allowed to move in any direction, provided that the clay layer only moved about once for every five interlayer molecule movements. systems were considered mc - equilibrated when convergence profiles of total potential energy and layer spacing provided minimum average values. the standard deviation of the average layer spacing was further required to be consistent with the precision of available experimental data on layer spacing. the program moldy was used to perform md (nve ensemble) simulations of the cs - smectite hydrates which had converged under mc simulation. monte carlo - equilibrated configurations in which the layer spacing was held constant were used as initial coordinates for the md calculations. with the rigid clay layers fixed in position, initial velocities were assigned randomly to interlayer molecules following a maxwell boltzmann distribution. in order to stabilize the temperature at 300 k, the simulations began with 20 ps of temperature scaling using a 0.5 fs time step. temperature scaling was performed for each molecular species individually, with rotational and translational kinetic energies scaled separately. molecular center - of - mass coordinates collected at 0.1 ps intervals during the simulations were used as the input data for our animations. we used a custom animation tool to create a series of jpeg images, one for each set of coordinates, based on the center - of - mass information. the custom animation tool, created by the lawrence berkeley national laboratory / national energy research scientific computing center (lbnl / nersc) visualization group in collaboration with the authors, runs on windows or unix / linux platforms, and is based on openrm scene graph, an open source, cross - platform scene graph library. these images were then converted to mpeg-1 format using the media - convert tool and executed on a visualization server located in the visualization laboratory at lbnl. the simulation cell used consists of two opposing halves of a rigid 2 : 1 clay layer surrounding an interlayer region filled with rigid water molecules and csions (fig. the crystallographic unit cell formulae of the three cs - smectites we modeled are : hectorite : cs0.75 [si8](mg5.25li0.75)o20(oh)4 beidellite : cs0.75 [si7.25al0.75](al4)o20(oh)4 montmorillonite : cs0.75 [si7.75al0.25](al3.5mg0.5)o20(oh)4 hectorite is a trioctahedral 2:1 clay mineral, whereas mont - morillonite and beidellite are dioctahedral. moreover, hectorite shows charge substitution exclusively in the octahedral sheet, whereas beidellite contains only tetrahedral charge substitution. montmorillonite has both types of charge substitution, with twice as much octahedral as tetrahedral layer charge. our simulation cell contains eight unit cells, and has lateral (ab) dimensions 21.12 18.28. interactions between the interlayer species, and between them and atoms in the clay layers, are represented para - metrically by a mcy - type potential function : where u is the potential energy of the system, i and j are sites on atoms within the simulation cell, rij is the distance between sites i and j, q represents atom charge, and a, b, c, and d are van der waals interaction parameters. we used this form of potential function because it has led to accurate modeling of experimentally accessible quantities such as layer spacing and interlayer species configuration and mobility. water interaction is optimized on dimer structures and, therefore, does not enforce the tetrahedral configuration of bulk water as strongly as do other, more empirically - based water this fact may explain its enhanced ability to model water molecules in the especially constrained geometry of the clay interlayer region. van der waals parameters for the cs o interaction were obtained through conversion of lennard - jones (lj) (612) potential function parameters taken from smith and dang, described previously. the mcy cs o interaction parameters were : a = 51.0 kj mol, b = 1.0850, c = 3.72 10kj mol, d = 4.2758. van der waals interactions for cs h, cs al, and cs si atom pairs were assumed to be negligible. allen and tildesley have outlined the general principles of mc and md simulations of liquids. chang. and greathouse and sposito have developed simulation methodologies customized for exploration of the interlayer region of 2:1 clay mineral hydrates. detailed description of mc calculations performed to establish the equilibrated cs - smectite hydrate structures has been provided previously. the program monte was used to run mc (nt ensemble) simulations on a variety of cs - smectite hydrates at 300 k and 100 kpa normal stress (). monte carlo calculations began with a simulation cell that had a 14 layer spacing and contained 6 csin the midplane of the inter - layer along with several randomly placed water molecules., consisting of 20,000 mc steps in which only water molecules were allowed to move, followed by another 20,000 steps in which water molecules could move and interlayer spacing could vary. after this optimization, all molecules were allowed to move in any direction, provided that the clay layer only moved about once for every five interlayer molecule movements. systems were considered mc - equilibrated when convergence profiles of total potential energy and layer spacing provided minimum average values. the standard deviation of the average layer spacing was further required to be consistent with the precision of available experimental data on layer spacing. the program moldy was used to perform md (nve ensemble) simulations of the cs - smectite hydrates which had converged under mc simulation. monte carlo - equilibrated configurations in which the layer spacing was held constant were used as initial coordinates for the md calculations. with the rigid clay layers fixed in position, initial velocities were assigned randomly to interlayer molecules following a maxwell boltzmann distribution. in order to stabilize the temperature at 300 k, the simulations began with 20 ps of temperature scaling using a 0.5 fs time step. temperature scaling was performed for each molecular species individually, with rotational and translational kinetic energies scaled separately. molecular center - of - mass coordinates collected at 0.1 ps intervals during the simulations were used as the input data for our animations. we used a custom animation tool to create a series of jpeg images, one for each set of coordinates, based on the center - of - mass information. the custom animation tool, created by the lawrence berkeley national laboratory / national energy research scientific computing center (lbnl / nersc) visualization group in collaboration with the authors, runs on windows or unix / linux platforms, and is based on openrm scene graph, an open source, cross - platform scene graph library. these images were then converted to mpeg-1 format using the media - convert tool and executed on a visualization server located in the visualization laboratory at lbnl. molecular dynamics simulation and subsequent animation revealed complex and fascinating interactions between csions, water molecules, and the charged clay surface. short animations of twenty to fifty picoseconds (~ 12 mb) illustrating features relevant to the discussion below may be obtained from the links provided. for example, cstend not to roam, but instead to hover near the charge sites recessed within the clay layer. when the ions do move, they display jump diffusional behavior, in which the ions vibrate in one place for some time, then jump to new locations (see the animation in plate 1, cs - hectorite with 1/3 water monolayer). these motions tend to be confined to different locations around the charge sites attracting the cations. in contrast, the water molecules display continuous diffusion on the time - scale of these animations. both ions and water molecules move more frequently in the 2/3 monolayer systems, a trend indicated for water molecules by an increased self - diffusion coefficient (table 1). however, both csand water molecule movements in the interlayer are substantially slower than in bulk ionic solution, where these two species have self - diffusion coefficients of 2 10ms. animations allow us to see changes in the structure of hydrating water molecules around interlayer csover time. water molecules move from one csto another, but are rarely far from an interlayer ion (plate 1). this behavior leaves small regions of the smectite surface empty in the 1/3 monolayer simulations. despite the weak coulomb field of csand its large size, these ions are able to organize water molecules into partial hydration shells (water molecules within a radial distance of < 5 from the cation, as shown by our mc radial distribution function calculations). the number of water molecules within each shell varies substantially with time for each cation. the exchange behavior seen among cswaters of hydration contrasts with the results of md calculations of similarly low water content li - smectites, in which waters of hydration remained near the same ion for as long as 200 ps. the difference may be attributed to the smaller radius of the liions, which results in stronger electrostatic attraction for water molecules, as well as to the shorter timespan of the li - smectite simulations, which may not have been long enough to capture water exchange processes. recently have interpreted liii - edge exafs spectra of cs - montmorillonite to suggest the presence of two types of cs surface complex, distinguished by average cs o distances of 3.2 and 4.25, respectively. they consider the complex with the shorter cs o distance to be an outer sphere complex, fully hydrated and therefore separated from mineral surfaces by water molecules, while the complex with the longer cs o distance is thought to be an inner sphere complex, partially dehydrated and directly associated with a mineral surface. their analysis suggests that in a fully - saturated cs - montmorillonite, the majority of cations exist as outer sphere complexes directly coordinated by 23 water molecules. our simulations do not support a model of the interlayer which includes outer sphere cscomplexes. the cations modeled here have formed inner sphere complexes with the clay mineral surface and are surrounded by at least six oxygen atoms, yet have average cs o distances of around 3, similar to the distance bostick. the large size of csis inconsistent with the large energy of hydration needed to maintain an outer sphere complex near a charged mineral surface, as in the case of li - montmorillonite. a highly variable cs coordination environment caused by sample preparation may account for the discrepancies between our results and exafs interpretations. while simulations can focus specifically on the interlayer environment, spectroscopic analysis of cs - smectites inevitably averages signals from csin the interlayer, adsorbed to edge sites, and present in micropores. careful sample preparation after cssaturation, involving a drying step designed to encapsulate the ion between surface cavities in the interlayer, followed by a licl rinsing step to remove less tightly bound ions, would result in a sample containing primarily inner sphere cscomplexes residing in the interlayer of the smectite. a sample produced with this method would have a far less variable cscoordination environment, and could be useful as an end member describing inner sphere coordination for linear combination fitting of exafs spectra. data using this approach may result in a view of interlayer structure similar to that provided by our simulation. the animations bring to light the phenomenon of water molecule sharing between two csions, an effect seen in all five simulations to varying degrees (fig. a shared water molecule may be defined as one which lies within the < 5 hydration shells of two cssimultaneously for a period of hundreds of picoseconds or more. shared water molecules remain in a fairly fixed position relative to the two csthey hydrate during this period of sharing. our animations appear to be the first evidence for such an interaction, which likely requires the conditions of confined geometry, presence of surface charge, and close proximity of ions that are found in clay interlayers. as was suggested for the exafs study mentioned above, a reinterpretation of existing nmr data on cs - smectites [38 - 41]also may be in order. these data, which informed the exafs analysis, also suggest that outer sphere cscomplexes exist in the interlayer region. [38 - 41 ] this conclusion, not supported by molecular modeling, does not consider the possibility of two csbound by one or more shared water molecules. cs - hectorite with 1/3 water monolayer (plate 1) exhibits the least water sharing, with two cspairs (the top left and bottom right csare one pair, and the middle two cson either side of the simulation cell are another), each sharing one water molecule for hundreds of picoseconds. in contrast, cs - montmorillonite with 1/3 water monolayer (plate 2) contains two pairs of csthat share two water molecules per pair over the entire simulation (two csat the bottom of the simulation cell form one pair, while the other is made up of the middle two cson either side of the simulation cell). the molecules making up the two cs - two water complex near the bottom of the cs - montmorillonite, 1/3 water monolayer animation are so strongly bound that they can be seen to rotate as a unit (plate 2). in addition, other cspairs in this system share one or two water molecules, but only for a few hundred picoseconds or less. such entrapment of the water molecules could underlie the nonlinear relationship between their mean - square displacement (msd) and elapsed time noted for this system, which signaled the absence of self - diffusion in the interlayer water (table 1). cs - beidellite with 1/3 water monolayer (plate 3) features three pairs of cations which participate in water sharing of one or two water molecules for substantial portions of the 800 ps simulation (cations to the left and right of the animation are one pair, cations to the top and bottom of the animation are another, and the third consists of the top cation and its neighbor to the lower left). cs - beidellite with 1/3 water monolayer may be considered to have an intermediate level of water sharing, as compared to the hectorite and mont - morillonite systems, as it features more water sharing cation pairs than hectorite, but reduced number of shared water molecules and duration of water sharing per pair as compared to montmorillonite. a difference in cation location on the clay surface caused by both the orientation of structural hydroxyl groups and the relative proportion of tetrahedral charge sites, may account for the degree of water sharing present in each clay system. our previous research noted a larger range of movement among the interlayer cson montmorillo - nite, which we hypothesized to be a result of the disorder induced by the presence of both octahedral and tetrahedral charge (fig. closer inspection of the cs - montmorillonite, 1/3 water monolayer system (plate 2), relative to the hecto - rite and beidellite systems (plates 1 and 3) reveals the specific cation motions which result in this greater variation in location. the cations within montmorillonite frequently hover over and dip into the cavities of the mineral surface, while the cations within hectorite and beidellite interlayers rarely stray from positions directly over oxygen triads found at the edges of these cavities. entrapment of csbetween opposing surface cavities is a natural process that can be induced in the laboratory through alternate wetting and drying procedures, and is the basis for standard methods used to determine structural surface charge. our mc calculations, which provide the coordinates of the mineral layer used in the md simulations and established a water content of less than a monolayer, are not constrained to achieve the layer registration necessary to encapsulate a cation between opposing surface cavities, nor can they be used to simulate the process of wetting and drying. as a result, our simulations do not lead to cation fixation within surface cavities. the difference in csbehavior within the interlayer of the three minerals, which has an electrostatic explanation, may be contrasted with the behavior of the much smaller liion in similar low water content systems. the structural hydroxyl groups located at the bottom of the six - oxygen cavities of hectorite are oriented perpendicularly to the clay surface, such that the positive portion of this polar group repels the interlayer cation and discourages it from entering the cavity (fig. it is likely that this electrostatic repulsion is exaggerated in our simulations as a result of imposing a rigid clay structure, which prevents structural hydroxyl groups from relaxing into non - perpendicular orientations. the octahedral charge sites of hectorite, submerged within the clay layer, are too far away to counteract this repulsion effectively. csthus maintain midplane positions in the interlayer as a result of the distant octahedral charge and structural hydroxyl repulsion (fig. the smaller size of liprovides it with sufficient energy of hydration to form an outer sphere complex within hectorite, while the larger csforms an inner sphere complex with the clay surface. though the structural hydroxyls of beidellite are oriented at a shallow angle relative to the surface, which reduces electrostatic repulsion, the tetrahedral charge sites present in the mineral are located directly beneath some of the oxygen triads at the surface, making them attractive locations for interlayer cations (fig. 4). molecular modeling of li - beidellite resulted in lipositioned directly over oxygen triads. in contrast, cations within cs - montmorillonite interlayers can inhabit surface cavities as well as positions near oxygen triads. only the simulations of montmorillonite contain both structural hydroxyl groups with shallow orientations relative to the surface, and a small proportion of tetrahedral charge, conditions which allow csto occupy positions within or near six - oxygen cavities and close to oxygen triads (fig. 4). although liions within montmorillonite also displayed greater variation in position than their counterparts in hectorite and beidellite, they did not enter surface cavities, because these ions existed either as inner sphere surface complexes near oxygen triads, tightly bound to substitution sites, or as fully hydrated outer sphere complexes too large to enter a cavity. the difference in solvation of csand li, a result of their contrasting ionic radii, thus modifies the electrostatic effect of the different smectite minerals. it is possible that the ability to inhabit sites near oxygen triads as well as near or within six - oxygen cavities (fig. 3), promotes the optimized geometry required for water sharing interactions to develop and perpetuate within the cs - montmorillonite interlayer over the timescale of our md simulations. while cswithin beidellite does not show this flexibility, the cations show another type of spatial variation, in that they are segregated into two layers along the z axis (fig. 3), one containing ions attracted to charge sites in the upper mineral layer, the other containing ions attracted to charge sites in the lower mineral layer. although limited to positions close to oxygen triads, this vertical separation of cations may enhance the potential for sharing water molecules. in contrast, the charge of hectorite is located solely in the octahedral sheet, which compels csions to remain in stable, midplane positions near oxygen triads (fig. extensive water sharing occurs in cs - montmorillonite with 2/3 water monolayer (plate 4). in the lower right of the animation the ions are located in close proximity to one tetrahedral and one octahedral charge site, and are near other tetrahedral and octahedral charge sites. in addition, we see the two csnot involved in the shared configuration roaming over the clay surface in a typical diffusional manner, unlike the hovering motions seen in the other systems. plots of msd vs. elapsed time for the two more mobile csare nonlinear, which may indicate some form of entrapment. these cscan be seen to engage in ion exchange, as first one and then the other is attracted to an octahedral charge site submerged within the clay structure, located in the upper left corner of the simulation cell (plate 4). csare not the only interlayer species attracted to specific sites within the clay mineral surface. water molecules in cs - hectorite with 1/3 water monolayer (plate 1) frequently dip into the six - oxygen cavities, but rarely remain for more than a hundred picoseconds. the negative dipole of this interlayer species is attracted to the structural hydroxyl group of hectorite which rests at the bottom of each cavity (fig. 4), creating a population of water molecules with their dipole moments pointing away from the mineral surface. however, because the charges are small the interaction is not very strong. as a result, water molecules visit the cavities for tens of picoseconds or less. simulations of li - hectorite with low water content featured water molecules which inhabited cavities for the entire length of the 200 ps md calculation, likely due to entrapment caused by the substantially smaller layer spacing of the mineral. surface cavities receive more attention in cs - beidellite (plate 3) because the negative charge sites just below the mineral surface can attract the positive dipole of a water molecule just as they attract cs(fig. water molecules so attracted arrange themselves with a hydrogen ion directed toward the clay surface, as seen in distributions of water dipolar orientation from mc calculations. the orientation of hydroxyl groups at a low angle relative to the plane of the clay surface allows some water molecules in the cs - beidellite simulation to remain in the surface cavities for hundreds of picoseconds. simulations of li - beidellite with a similarly low water content did not contain water molecules which sample the six - oxygen cavities. the li - beidellite system had a larger layer spacing than that of li - hectorite, which allowed all water molecules to coordinate around the strongly hydrating liion. in cs - montmorillonite with 1/3 water monolayer, we see relatively little water entry into surface cavities (plate 2). because montmorillonite contains 1/3 as much tetrahedral charge as beidellite, and its hydroxyl groups are oriented at a low angle with respect to the clay surface, the surface does not strongly attract either the positive or the negative dipoles of water molecules. the observation that cswithin montmorillonite can enter six - oxygen cavities, unlike cswithin hectorite and beidellite, requires that cations out - compete water molecules for these locations. however, our mc results indicate that a portion of the water molecules within montmorillonite have a similar orientation to the fraction of water molecules in beidellite that are attracted to the mineral surface. like li - beidellite, li - montmorillonite md calculations did not show water molecules within six - oxygen cavities. this system also featured a larger layer spacing relative to li - hectorite, allowing for more complete solvation of the strongly hydrating ions. the amount of interlayer water modifies the extent of interaction of water molecules with the mineral surface. animations of both cs - montmorillonite and hectorite with 2/3 water monolayer (plates 4 and 5) show a crowded inter - layer featuring more extensive and lengthier sampling of the surface cavities by water molecules. as noted above, water movement in these systems is faster and more diffusional, and ions exhibit more rapid jump diffusion. why do the 2/3 water monolayer systems, though more tightly packed than the 1/3 water monolayer systems, exhibit more movement among their interlayer species ? an example of such competitive action takes place in the animation of the cs - hectorite system (plate 5). a csdisplaces a water molecule from a surface cavity near which it has hovered for tens of picoseconds. after only a few picoseconds, this cation is displaced in turn by another water molecule, as might be predicted given cation preference for locations over oxygen triads, rather than six - oxygen cavities, within hectorite. similar and more subtle interactions across the clay surface would lead to greater movement of both water and cs. the electrostatic attraction between csand the polar water molecules, responsible for the organization of the partial hydration shell, further encourages these competitive interactions by maintaining the two species in close proximity to each other as well as to the surface sites to which they are attracted. animations of 800 ps md simulations have provided new information concerning the structure and dynamics of the hydrated cs - smectite interlayer region. a comparison of the five animations presented here reveals the behavior of interlayer species as modified by water content and charge site location. cs - smectite systems feature ions as inner sphere complexes, hovering near charge sites and occasionally using jump diffusional movements to relocate. higher water contents encourage more rapid movement in the interlayer for both csand the water molecules which solvate them. different mineral charge patterns and structural hydroxyl group orientations create interlayer dynamics with different propensities for water molecule sharing between two cs. a low orientation angle for structural hydroxyl groups relative to the mineral surface, combined with a reduced amount of tetrahedral charge, as in montmorillonite, permits interlayer cations to occupy positions above and within six - oxygen cavities frequently. this may allow ions a greater flexibility in placement, and therefore increased ability to enter into water - sharing arrangements. tetrahedrally charged clays like beidellite provide a different form of flexibility in ion position, due to the separation of ions into two layers along the z axis. this segregation may encourage formation of water sharing arrangements as well. the combination of the octahedral charge and the perpendicular orientation of hydroxyl groups relative to the hectorite surface results in csbeing held in stable, midplane locations above oxygen triads on the clay surface, hindering cations from entering into water sharing arrangements. the water sharing phenomenon predicted by our animations reaches an extreme state in the cs - montmorillonite, 2/3 water monolayer hydrate, in which four csare held together throughout the 800 ps simulation period in an extended complex of ions and shared water molecules. our animations also document the attraction between water molecules and the clay mineral surface, which increases with higher water content. thus, animation of md data has provided substantial information not available from traditional simulation methods. our research was supported in part by the director, office of energy research, office of basic energy sciences, geosciences division, of the u. s. department of energy under contract no. the national energy research scientific computing center provided generous allocations of cpu time on its cray j90 and t3e supercomputers. the first author expresses gratitude to the clay minerals society for a grant supporting the purchase of a personal computer for use with her research, to wes bethel of the lbnl / nersc visualization group for creating the customized rm scene graph program and for valuable discussions on visualization, and to cristina siegerist of the same group for help with the mediaconvert tool. thanks also to the two anonymous reviewers who made valuable suggestions for the manuscript, and to reviewers john apps and satish myneni of lbnl. a view of the simulation cell, outlined in grey, for cs - montmorillonite, 1/3 water monolayer. interlayer csare represented by orange spheres, while interlayer water oxygens are represented by blue spheres and water hydrogens by white spheres. the surrounding mineral layers are displayed in ball and stick style, with the greyish purple balls representing the mineral oxygen atoms, white balls representing h, grey balls representing si, and green balls representing al. a view in the xy plane of the two cs - two water complex seen in the cs - montmorillonite, 1/3 water monolayer animation (plate 2). cumulative zy coordinates of cs(first 400 ps) for cs - smectites with 1/3 water monolayer. the surrounding clay layers are located out of the figure at 1.52, 1.44, and 1.54 along the z axis for cs - hectorite, cs - beidellite, and cs - montmorillonite, respectively. representations of preferred cspositions above six - oxygen cavities for (a) hectorite, (b) beidellite, and (c) montmorillonite. 1. side view of a water molecule nestling into a six - oxygen cavity in the cs - beidellite, 1/3 water monolayer system, as seen in plate 3. a 35 ps portion of the cs - hectorite, 1/3 water monolayer md simulation animation (85120 ps of the 800 ps simulation). interlayer csare represented by orange spheres, while interlayer water molecules are represented by blue spheres. the greyish purple spheres symbolize the surface oxygen atoms of the lower clay layer surrounding this interlayer region. the rest of the atoms making up this lower clay layer, as well as all the atoms making up the upper clay layer, have been removed to improve the visibility of the interlayer region. due to the periodic nature of the simulations, interlayer species which exit from one side of the simulation cell will reappear on the opposite side. the highlighted cs(red) can be seen to display jump diffusion, while the highlighted water molecule (lighter blue) in the center of the simulation cell is characterized by continuous diffusional behavior as it moves from one cspartial hydration shell to another. another highlighted water molecule to the left can be seen visiting a surface cavity site for a short time. a 20 ps portion of the cs - montmorillonite, 1/3 water monolayer md simulation animation (6585 ps). the two highlighted cs(red) share the two highlighted water molecules (lighter blue). the molecules making up this two cs two water complex are so strongly bound that they are observed to rotate as a unit during this animation. interlayer water molecules do not enter six - oxygen cavities in this portion of the simulation. a 30 ps portion of the cs - beidellite, 1/3 water monolayer md simulation animation (350380 ps). the three highlighted water molecules (lighter blue) reside within six - oxygen cavities of the lower clay surface for extended time periods. one of these water molecules, located near the top of the small view at the top left of the animation, and nearly hidden by a 2 cs-2 water molecule complex, stays within the six - oxygen cavity for the 30 ps length of this animation. a 50 ps portion of the cs - montmorillonite, 2/3 water mono - layer md simulation animation (750800 ps). the four cstoward the right of the animation are bound together by extended water sharing arrangements into a structure that is stable over the timespan of the simulation. the two cstoward the left of the simulation cell (red and brown) display continuous diffusional motion and participate in an exchange reaction, with first one and then the other taking up a position near an octahedral charge site in the clay layer. during the time that each cation is associated with this exchange site, a 20 ps portion of the cs - hectorite, 2/3 water monolayer md simulation animation (625645 ps). the highlighted cs(red) can be seen to compete with surrounding water molecules for favorable positions over six - oxygen cavities towards the end of this animation, when it moves forward to occupy a surface site closer to the viewer. layer spacing and molar potential energy of water (mc simulation)and self - diffusion coefficients for interlayer water (md simulation) in cs - smectite hydrates monte carlo steps required for convergence. (total potential energy of hydrate total potential energy of clay mineral) moles of water per simulation cell.value calculated from linear regression of the mean - square displacement (msd) on elapsed time with p = 0.05 confidence interval.this hydrate exhibited mc convergence only at the lower water content.this hydrate did not produce a linear relationship between msd and elapsed time.mcy wateryields dw = 2 10ms.
|
computer animation of center of mass coordinates obtained from 800 ps molecular dynamics simulations of cs - smectite hydrates (1/3 and 2/3 water monolayers) provided information concerning the structure and dynamics of the interlayer region that could not be obtained through traditional simulation analysis methods. cs+ formed inner sphere complexes with the mineral surface, and could be seen to jump from one attracting location near a layer charge site to the next, while water molecules were observed to migrate from the hydration shell of one ion to that of another. neighboring ions maintained a partial hydration shell by sharing water molecules, such that a single water molecule hydrated two ions simultaneously for hundreds of picoseconds. cs - montmorillonite hydrates featured the largest extent of this sharing interaction, because interlayer ions were able to inhabit positions near surface cavities as well as at their edges, close to oxygen triads. the greater positional freedom of cs+ within the montmorillonite interlayer, a result of structural hydroxyl orientation and low tetrahedral charge, promoted the optimization of distances between cations and water molecules required for water sharing. preference of cs+ for locations near oxygen triads was observed within interlayer beidellite and hectorite. water molecules also could be seen to interact directly with the mineral surface, entering its surface cavities to approach attracting charge sites and structural hydroxyls. with increasing water content, water molecules exhibited increased frequency and duration of both cavity habitation and water sharing interactions. competition between cs+ and water molecules for surface sites was evident. these important cooperative and competitive features of interlayer molecular behavior were uniquely revealed by animation of an otherwise highly complex simulation output.
|
according to the world health organization, cervical cancer is the second most common type of cancer among females, and was responsible for over 250,000 deaths in 2005., deaths due to cervical cancer are projected to rise by almost 25% over the next 10 years. cancer cervix has been considered preventable because it has a long preinvasive state and availability of screening programs and treatment of preinvasive lesions is effective. it has been well established that well - organized screening by cytology has substantially reduced the incidence of morbidity and mortality from cervical cancer in developed countries.[13 ] many developing countries do not have ample resources to implement cytology - based prevention programs, which necessitates well - organized laboratories to collects material and specialized personnel apt to render a diagnosis. newer approaches such as automated pap, liquid - based pap and hpv dna testing using hybrid capture ii (hc ii) are time consuming, expensive and not widely available. prompted by the need for optimal strategies for cervical cancer screening in low - resource settings, the role of visual inspection with acetic acid (via) and visual inspection with lugol 's iodine (vili) has been widely studied in several recent studies, which suggest that via and vili closely match the pap smear in its performance in detecting cervical cancer precursor. the present study is an endeavor to perform a comparative study of performance of via and vili used as a stand - alone test and combined with pap smear for mass screening of premalignant and malignant lesions of the cervix. the present study was carried out in the department of obstetrics and gynaecology at the northern railway central hospital, delhi, for a period of 1 year (june 2007 to may 2008). patients to be screened were explained the procedure to be performed, written informed consent was taken and the relevant obstetrical and gynecological history was also taken, with the patient being reassured that the procedure was painless. firstly, a pap smear was taken with ayre 's spatula and cytobrush and was evaluated by the bethesda system. following the pap smear, via was performed with 3% acetic acid followed by lugol 's iodine test (vili). results of via and vili were recorded after waiting for 1 minute as negative, single - positive and double - positive. all the tests were performed by trained residents and faculty who did not know the aims and objective of the study, and was also done separately by different residents / faculty. the cervix was inspected with the naked eye than with a colposcope. after taking the pap smear, the cervix was washed with normal saline and visualized, followed by application of 3% acetic acid and visualization by colposcope followed by application of lugol 's iodine and colposcopy. biopsy was done for confirmation of lesion if either of the three screening tests or colposcopy had a positive finding or if the pap smear reported ascus, for confirmation of lesion. collected data was statistically analyzed to determine specificity and sensitivity, ppv, npv of pap smear, via, vili alone and pap+via+vili and via+vili. the patients who reported normal on all screening tests and colposcopy were called for annual follow - up. patients who were positive at either of the screening tests or colposcopy underwent biopsy and were treated according to the grade of the lesion (6-monthly follow - up and repeat pap, loop electrode excision procedure (leep), hysterectomy, wertheime 's hysterectomy). approval from ethical committee of our institute was taken before commencing the study. table 1 shows that out of 210 patients enrolled in the study, 34 patients (16.27%) had a positive pap smear, 23 patients (11.00%) had inflammatory smears and 152 had normal smear. via was positive in 29 patients (13.81%) while the remaining 181 patients (86.19%) had normal via. vili was positive in 24 patients (11.43%) and the remaining 186 patients (88.57%) had normal vili. of the 210 patients, 31 patients (14.75%) showed features of cin on colposcopy ; the remaining were normal. result of pap smear, via, vili and colposcopy examination among the study group table 2 shows that of a total of 210 pap smears performed, 27 were reported positive excluding ascus. of these 27 positive cases, 16 (i.e., 59.26%) had cin on histopathological examination and three (14.29%) patients who reported negative on pap smear (but positive on other screening tests) had positive histopathological examination. of the 29 via - positive cases, 16 (i.e., 55.17%) had cin on histopathological examination and three (15.79%) patients who had negative via (but positive on other screening tests) were reported to have positive histopathological examination. of the 24 vili - positive cases, 17 (i.e., 70.83%) had cin on histopathological examination and two cases (10.53%) that were missed on vili (but positive on other screening tests) had positive histopathological examination. correlation of pap smear, via and vili with histopathological examination of the total 210 patients in whom all three screening tests (pap+via+vili) were performed, 40 patients were picked up as positive by a combination of these tests ; of these 40 positive cases, 19 (i.e., 47.50%) had cin on histopathological examination and no cases were missed by using a combination of these tests. this thus proved the adjunctive role of via and vili to pap smear in picking up premalignant and malignant lesions of the cervix, increasing the sensitivity of combination tests to 100% but at the cost of decreasing the specificity to 27.60%. of the total of 210 patients in whom via+vili was performed, 33 (68.75%) had positive results. of these 33 cases, 18 (i.e., 54.55%) had cin on histopathological examination, one case (5.26%) was missed on a combination of tests (via+vili), which was picked up to be positive on histopathological examination. the sensitivity, specificity, npv and ppv of different screening tests or their combinations are shown in table 3. sensitivity of pap smear=84.20% (ci 59.5095.80), specificity of pap smear=62.10% (ci 42.4078.70), ppv of pap smear=59.30% (ci 39.0077.00), npv of pap smear=85.70% (ci 62.6096.20), % of false positive=37.93% and % of false - negative=15.79%. tests characteristic of screening tests in detecting cin or worse lesion sensitivity of via=84.20% (ci 59.5095.80),pspecificity of via=55.20% (ci 36.0073.00), ppv of via=55.20% (ci 36.0073.00), npv of via=84.20% (ci 59.5095.80), % of false - positive=44.83% and % of false - negative = 15.79%. sensitivity of vili=89.50% (ci 65.5098.20), specificity of vili=75.90% (ci 56.1089.00), ppv of vili=70.80% (ci 48.8086.60), npv of vili=91.70% (ci 71.5098.50), % of false - positive=24.14% and % of false negative=10.55%. sensitivity of combination tests=100.00% (ci 79.10100.00), specificity of combination tests=27.60% (ci 13.4047.50), ppv of combination tests=47.50% (ci 31.8063.70), npv of combination tests=100.00% (ci 59.80100.00), % of false positive=72.41% and % of false negative=00%. sensitivity of combination tests (via+vili)=94.70% (ci 71.9099.70), specificity of combination tests (via + vili)=48.30% (ci 29.9067.10), ppv of combination tests (via+vili)=54.50% (ci 36.6071.50), npv of combination tests (via+vili)=93.30% (ci 66.6099.70), % of false positive=78.95% and % of false - negative=5.26%. table 4 shows that of the 210 women screened, 172 were called for annual follow - up and 22 patients who reported ascus on pap smear and cin-1 on colposcopy and histopathological examination and who were complaint were called after 6 months for follow - up and repeat pap smear. twelve patients who reported cin-1 (who were not complaint and had associated risk factors) and cin-2 underwent leep. two patients who had cin-3 and cis (with superficially invasive cancer with negative margins) underwent pan hysterectomy. intervention done in patients enrolled in the study on the basis of screening test results and positive histopathlogical findings in a metaanyalsis done by fahey. in 1995 involving 62 studies conducted between 1984 and 1992, the mean sensitivity and specificity of cytology was 58% (range 1199%) and 68% (range 1497%), respectively. in another recent metaanalysis by nanda. in 2000, the sensitivity of cytology to the detection of cin 2 or worse lesions ranged from 18% to 98% and the specificity ranged from 17% to 99%. in the iarc multicenter study done in india and africa by sankaranarayanan. in 2004, which included 11 cross - sectional studies, the sensitivity of via ranged from 56.10% to 93.90% and the specificity ranged between 74.20% and 93.80%. considering the various studies, our results of pap smear as a screening test are comparable. in the present study, the sensitivity of pap smear was 84.20% and the specificity was 62.10%. in the present study, the sensitivity of via was 84.20%, which was similar to that of pap smear, but had a lesser specificity than the pap smear (pap 62.00% vs. via 55.20%). the reason behind the high sensitivity and/or low specificity of via in our study could be due to : presence of infection and inflammation that take up acetowhite stainsome faint acetowhite areas might have been interpreted as being positivescoring those areas with distinct acetowhite uptake on cervix as positive. presence of infection and inflammation that take up acetowhite stain some faint acetowhite areas might have been interpreted as being positive scoring those areas with distinct acetowhite uptake on cervix as positive. because of the high number of false - positive cases and low specificity of via, the usefulness of this procedure is limited. but, due to the high sensitivity of via, it is still used as primary screening in some developing countries for early detection of cervical carcinoma. in the present study, the results are in comparison with that of the above - mentioned studies, suggesting that via may find a place as an alternative low - resource technology and low - cost method of screening and case finding. in the iarc multicenter study done in india and africa by sankaranarayanan. in 2004, which included 11 cross - sectional studies, the sensitivity of vili ranges from 76.00% to 97.00% and the specificity between 73.00% and 91.30%. in the present study, of the 210 patients, vili was positive in 24 (i.e., 11.43%) patients. (sensitivity 89.5% and specificity 75.90%). in our study, the reason for high sensitivity and low percentage of fp results of vili as compared with that of via (vili vs via 89.50% vs 84.2%) are because lugol 's iodine produces characteristic nonuptake yellow areas in suspected cases that are easy to interpret, and observation was based on the well - defined criteria to identify between iodine uptake and nonuptake, mahagony brown area versus yellow areas. an atlas also has been referred from time to time for characteristic identification of lesions in case of doubt. in the present study, the combined sensitivity of via and vili performed together was 94.70%, which was significantly greater than the sensitivity of individual procedures, thus showing that vili can be used as a parallel screening test to via to enhance its test performance. 2004 study showed a similar result and recommended the use of both via and vili in parallel to increase test sensitivity. in our study, we tried to find out whether the combination of tests (i.e., pap smear, via and vili) improves the sensitivity of the screening tests. our results showed that when all three (pap smear+via+vili) are used in combination, the sensitivity is 100%, but this happens at the cost of increasing the percentage of false - positive and decreasing the specificity. also, our study showed that when vili is used in combination with via, the sensitivity has improved to 94.70% from around 84.20%. 1995 study at the university of jimbanbe / jhpiego cervical cancer project 1999, denny. 2003 studies, which showed that combining via and vili with pap smear markedly improved their performance as screening tests at the cost of large number of women being referred for further treatment in view of false - positive results and decreased specificity of the test. an attempt has been made in present study to increase awareness of women about cervical cancer and preventive health - seeking behavior, screen all women of the reproductive age group at least once a year and motivate them for annual screening until three negative pap smears, to provide a screening test with high sensitivity as women have less frequent opportunities for repeated screening and treating women with high - grade dysplasia and cancer. therefore, in our study, we aimed at educating women about these signs and symptoms and to seek immediate medical care. thus, an attempt has been made to target the disease before its onset at the level of primary prevention by providing education and counseling and secondary prevention by effective screening and treatment. cervical cancer is preventable but not prevented remains the reality today, because no perfect screening tests are available that have 100% sensitivity and good specificity. therefore, in the present study, an attempt has been made to analyze pap smear, via and vili as standalone tests and when used in combination. we found that the combination tests had 100% sensitivity but at the cost of low specificity and more false - positive results. our study showed that via and vili had sensitivity comparable to pap smear and can therefore be a suitable potential alternative / adjunctive screening test not only in resource - poor settings but also in well - equipped centers. but, these drawbacks are low cost to pay for preventing and diagnosing disease at an early stage for effective control.
|
background and objective : cancer of the cervix is a leading cause of morbidity and mortality among women worldwide. therefore, to curb the disease, there is a need to develop a screening test that has good sensitivity and specificity. the present study is aimed to compare the effectiveness of the pap smear, visual inspection with acetic acid (via) and visual inspection with lugol 's iodine (vili) for mass screening of premalignant and malignant lesions of the cervix ; to evaluate the usefulness of via and vili as an adjunct to improve sensitivity of cervical cytology ; and to evaluate the role of vili as a parallel screening method with via to enhance its test performance.design and setting : this was a prospective, analytical study in which 210 patients of the reproductive age group attending the gynecology opd were enrolled.patients and methods : patients were first subjected to pap smear followed by via, vili, colposcopy and biopsy for confirmation of lesion, if needed. data was obtained and statistically analyzed.results:of the 210 patients, 34 (16.27%) had positive pap test, 29 (13.87%) had positive via and 24 (11.43%) had positive vili and 31 (14.75%) showed features of cervical intraepithelial neoplasia (cin) on colposcopy. of the total of 48 patients in whom either of the screening tests was positive and had undergone cervical biopsy, one had cin-3, three had cin-2, 12 had cin-1, three had carcinoma in situ cis and 29 reported normal. in our study, 40 patients were picked up as positive by combination of these tests, of which 19 (47.50%) had cin on biopsy.conclusion:our study showed that via and vili had sensitivity comparable to pap smear and can thus be a suitable potential alternative / adjunctive screening test not only in a resource - poor setting but in well - equipped centers also. and, use of a combination of tests (pap+via+vili) had 100% sensitivity but at cost of low specificity and more false - positive results.
|
diabetic retinopathy is a sight - threatening disease and represents the most frequent cause of blindness among people of working age in industrialized western nations.13 after a duration of diabetes mellitus of 5 years, 29% of type 2 diabetics suffer from diabetic retinopathy, 78% of patients are affected after 15 years, and 16% develop the proliferative stage of the disease.2 in type 1 diabetics, the numbers are reported to be very similar, with 17% of type 1 diabetics presenting with proliferative diabetic retinopathy after 5 years, 98% after 15 years, and 67% after 35 years of suffering from the disease.2,3 while the development of diabetic macular edema (dme) is the major cause of visual impairment in type 2 diabetics, proliferative diabetic retinopathy is predominantly seen in type 1 diabetics. approximately 90% of type 1 diabetic patients become legally blind because of proliferative diabetic retinopathy and/or the development of macular edema, despite several effective treatment options, such as laser treatment and vitreoretinal surgery being available.3 in addition to timely and tight glycemic control to achieve near - normal glycosylated hemoglobin levels and blood pressure below 130/80 mmhg, prevention of visual loss depends on timely detection of the sight - threatening complications of diabetic retinopathy, such as macular edema, and immediate initiation of adequate therapy. until recently, laser treatment was the only evidence - based treatment option available to preserve vision in patients with dme.46 however, laser treatment is not always beneficial, especially in diffuse dme involving the fovea. with regard to the variable and sometimes unsatisfactory functional results following laser photocoagulation, new pharmacological strategies have been proposed in order to improve the visual outcome, including use of vascular endothelial growth factor inhibitors and steroids.713 these pharmacological monotherapies are based on our growing understanding of the complex and multifactorial pathogenesis of dme. at present, two pharmacological treatments are approved in many european countries for the treatment of dme, ie, intravitreal injection of the vascular endothelial growth factor (vegf) inhibitor, ranibizumab (lucentis, novartis, basel, switzerland), as a first - line treatment and the fluocinolone acetonide - loaded insert (iluvien, alimera sciences inc, alpharetta, ga) as a second - line treatment in refractory cases of dme. the present review discusses predominantly the use of steroids for the treatment of dme and introduces the rationale for fluocinolone acetonide as a therapeutic agent for this condition. the common pathway for the pathogenesis of dme is breakdown of the blood - retina barrier, resulting in an abnormal inflow of fluid in the neurosensory retina. vascular leakage and retinal nonperfusion are mediated by numerous growth factors.14 however, according to our current understanding of the pathogenesis of macular edema, the formation of edema and leakage result not only from an overexpression of vegf - a, but also from inflammatory responses.15 in the multifactorial pathogenesis of dme, sustained hyperglycemia upregulates several vasoactive factors, including vegf, protein kinase c, and angiotensin ii. all these factors are interrelated in a very complex fashion, and contribute to development of the structural and functional changes seen in diabetic retinopathy.1520 upregulation of vegf leads to a breakdown of the blood - retinal - barrier and increased vascular permeability, resulting in leakage of fluid and plasma constituents, such as lipoproteins, into the retina.2022 vegf is now an important target in the treatment of dme using vegf inhibitors such as ranibizumab or bevacizumab. however, there are many other factors being upregulated in the vitreous cavity in the pathogenesis of dme which also affect the blood - retina barrier, ie, high glucose levels in endothelial cells are associated with mitochondrial overproduction of reactive oxygen species, which inactivate glyceraldehyde-3-phosphate dehydrogenase and also contribute to vascular endothelial damage.20,23 furthermore, it is not only the impaired blood - retina barrier that contributes to the pathogenesis of macular edema, but also dysfunction of mller cells, which are the principal glial cells of the retina. mller cells are important structures for fluid clearance from the retina and help to maintain the homeostasis of the retinal extracellular space. under normal conditions, mller cells facilitate transcellular water transport via ion (kir4.1) and water channels such as aquaporin 4. in the diabetic retina, mller cells downregulate expression of kir4.1 channels, leading to intracellular accumulation of potassium ions and increased intracellular osmotic pressure, finally resulting in intracellular edema facilitated by aquaporin 4 channels.24 animal models have shown that corticosteroids are able to regulate aquaporin 4 expression and to stimulate efflux of potassium ions associated with water transport out of the cell, which finally leads to reduction of the intracellular edema.24 in addition, it has been shown in experimental animal models of the diabetic retina that leukocytes accumulate in the diabetic retina mediated by increased expression of specific adhesion molecules, such as intercellular adhesion molecule-1, and may trigger relevant mechanisms in the pathogenesis of dme, such as retinal vascular leakage and nonperfusion.25,26 intravitreally applied corticosteroids have been shown to be able to attenuate leukostasis and the associated breakdown of the blood - retina barrier in dme, as seen by a downregulation of mrna expression of intercellular adhesion molecule-1 and its protein by 70.0% (p 1 ng / ml moderately increasing the risk of glaucoma in susceptible patients.39 the long - term clinical efficacy of the 0.2 g / day versus the 0.5 g / day fluocinolone acetonide insert was assessed in the fame (fluocinolone acetonide in diabetic macular edema) study,40 which was designed as two parallel, prospective, randomized, sham injection - controlled, double - masked, multicenter clinical trials. the study included 956 patients with persistent dme despite at least one previous laser photocoagulation. participants were randomized 1:2:2 to receive a sham injection, the low - dose insert, or the highdose insert. the percentage of patients with an improvement of 15 etdrs letters from baseline best - corrected visual acuity after 2 years of follow - up was the primary outcome measure of this study. the study demonstrated a significant improvement of 15 letters compared with baseline in 28.7% and 28.6% of the low - dose and high - dose insert groups, respectively, compared with 16.2% in the sham group. this benefit was observed at 3 weeks and at all subsequent time points thereafter. between baseline and 2 years, patients improved by 4.4 letters in the low - dose group and 5.4 letters in the highdose group, compared with 1.7 in the sham group. foveal thickness was significantly more improved in treated patients compared with the sham group for the entire duration of follow - up. lens opacification requiring cataract extraction and intraocular lens implantation was more frequent in the treated group. patients who were phakic at baseline and at the end of follow - up at 24 months experienced an improvement in visual acuity during the early phase of the trial, but then deteriorated significantly and had lower visual acuity than the sham group.40 cataract extraction was performed in 41.1% of patients on the low - dose insert group, 50.9% on the high - dose insert group, and 7% of the sham group, which constituted 74.9% of all phakic subjects at baseline in the low - dose insert group and 84.5% in the high - dose insert group compared with 23.1% in the sham group. the visual benefit for patients who underwent cataract surgery was similar to that in subjects who were already pseudophakic at baseline. increased intraocular pressure was seen in 3% of both treatment groups.40 when increased pressure was prolonged or could not be controlled by topical treatment, other intraocular pressure - lowering procedures were performed, such as incisional glaucoma surgery in 8.1% of the high - dose insert group, 3.7% in the low - dose insert group, and 0.5% in the sham group.40 retreatment was required in 20% of patients in all groups during follow - up, but patients from the active treatment groups were less likely to receive additional treatment for dme. all in all, the fame trial clearly showed a significant functional benefit for patients treated with fluocinolone acetonide 0.2 g / day or 0.5 g / day over a follow - up period of 24 months, with a superior risk - to - benefit ratio for the lower - dose insert. for a summary, please refer to table 1. a preplanned analysis at 36 months was conducted to assess the efficacy of iluvien as a function of median dme duration at baseline, and demonstrated that the percentage of patients who had gained at least 15 etdrs letters was 28.7% and 27.8% for patients treated with the low - dose insert or high - dose insert, respectively, compared with 18.9% (p = 0.018) in the sham group. values were slightly higher when considering only those patients still in the trial at month 36, ie, 33.0% in the low - dose insert group, 31.9% in the high - dose insert group, and 21.4% in the sham group (p = 0.030).41 of note, when looking at patients with a duration of dme of more than 3 years at baseline, the percentage of patients who gained 15 etdrs letters was doubled comparing the low - dose group with the sham group (34% versus 13.4%, p < 0.001). cataract development in initially phakic patients was seen in 81.7% of the low - dose insert group, 88.7% of the high - dose insert group, and 5.4% of the sham group, but again their visual benefit after cataract surgery (performed in 80%, 87.2%, and 27.3%, respectively) was similar to that in pseudophakic patients.41 the incidence of incisional glaucoma surgery at month 36 was 4.8% in the low - dose insert group and 8.1% in the high - dose insert group.41 in summary, this study underlined that the treatment benefit is maintained over a period of 3 years. another prospective, multicenter clinical trial investigated 3-year efficacy and 4-year safety in 196 eyes with refractory dme.42 in this study, patients received a fluocinolone acetonide implant (retisert, bausch and lomb) which is surgically implanted through a pars plana incision and designed to release fluocinolone acetonide at an initial rate of approximately 0.6 g / day, decreasing over the first month to a steady rate of 0.30.4 g / day for a duration of approximately 30 months and currently approved for patients with uveitis. patients were randomized 2:1 and compared with standard of care, ie, laser photocoagulation or observation. the primary efficacy outcome was an improvement in visual acuity of 15 letters at 6 months, while secondary outcomes included resolution of macular retinal thickening and change in diabetic retinopathy severity score. the authors observed an overall improvement in visual acuity of at least three lines in 16.8% of treated eyes at 6 months (p = 0.0012), 16.4% at one year (p = 0.1191), 31.8% at 2 years (p = 0.0016), and 31.1% at 3 years (p = 0.1566). after treatment, the number of eyes with flat maculae was higher, as was the rate of improvement in visual acuity, along with a lower rate of decline in diabetic retinopathy severity score. an increase in intraocular pressure to over 30 mmhg was recorded in 61.4% of implanted eyes versus 5.8% in the control group at any time, and 33.8% required surgery for ocular hypertension by 4 years. by 4 years, 91% of implanted phakic eyes had undergone cataract extraction compared with 20% in the standard of care group.42 fluocinolone acetonide, which is to date approved in european countries as a 0.2 g / day drug - release insert for the treatment of macular edema, provides significant and longlasting improvement of function and reduction in retinal thickness. as clinical studies have shown, the insert is more effective in chronic cases of dme compared with more recent onset disease. with regard to ocular complications, one needs to take into account that cataract surgery will become necessary in nearly all patients who are phakic at the initiation of treatment. an increase in intraocular pressure may occur, but surgical intervention becomes necessary only in a limited number of patients. therefore, fluocinolone acetonide may represent an effective second - line treatment option for patients with chronic, refractory, diffuse dme, which to date comprise a group of patients with limited prospects for visual recovery (figures 2 and 3). at present, as a first - line treatment, laser photocoagulation remains relevant for focal vasogenic dme not involving the fovea, and may help to maintain good visual acuity. anti - vegf treatment seems indicated in new focal dme involving the fovea or new diffuse dme. in clinical trials, the combination of intravitreal ranibizumab with prompt or deferred laser was more effective over a period of review of one year compared with prompt laser alone for the treatment of dme involving the central macula.43 with regard to 3-year follow - up comparing prompt or deferred laser combined with ranibizumab, visual outcomes were better in patients with deferred laser photocoagulation compared with laser treatment performed at initiation of treatment with ranibizumab.44 additional laser photocoagulation of peripheral ischemic areas should be considered in patients receiving anti - vegf treatment for dme (figure 4). however, the widened spectrum of pharmacological options will help us to maintain and improve visual acuity in patients with acute or chronic dme.
|
diabetic macular edema (dme) is a potentially sight - threatening disease that predominantly affects patients with type 2 diabetes. the pathogenesis is complex, with many contributing factors involved. in addition to overexpression of vascular endothelial growth factor in the diabetic eye, there is an inflammatory pathway that contributes to the breakdown of the blood - retina barrier and nonperfusion. in addition to vascular endothelial growth factor inhibitors, clinical and experimental investigations underline the great potential of steroids in the treatment of dme. fluocinolone acetonide is currently the only corticosteroid approved for the treatment of dme in europe. it is manufactured as an intravitreal insert, releasing fluocinolone acetonide at a rate of 0.2 g per day. phase iii clinical studies have demonstrated that the beneficial effect of the fluocinolone acetonide insert lasts up to 3 years. improvement in visual acuity was especially remarkable in patients with a prolonged duration of dme of at least 3 years at the initiation of therapy. cataract formation occurs in nearly all phakic eyes treated, and needs to be considered when the indication for treatment is made. given the efficacy versus potential complications of the insert, fluocinolone acetonide represents a promising second - line treatment option in patients with dme. fluocinolone appears to be especially beneficial for patients whose options for visual recovery have seemed limited up until now.
|
hernias through the foramen of winslow are rare and constitute only 8% of internal hernias. the rate of preoperative diagnosis has been reported to be < 10% of the intraoperatively confirmed cases. a delay in diagnosis and treatment is often observed and may be responsible for the high mortality rate of up to 49% associated with this hernia type. internal hernia is often revealed by intestinal obstruction associated with non - viable bowel at the time of operation. we present a case of a patient with moderate epigastric pain in whom a computed tomography (ct) scan of the abdomen revealed the unexpected finding of right colonic herniation through the foramen of winslow. a 69-year - old patient presented to our emergency room with progressive dull abdominal pain and distension without nausea, vomiting or change in bowel habits. physical examination showed pain with moderate guarding in the right upper and lower quadrants. a plain abdominal x - ray and a ct scan were performed. radiological findings suggested the diagnosis of an internal hernia through the epiploic foramen and containing the right colon with important distension of the caecum (fig. 1). surgical exploration was then performed using an open approach. at laparotomy, we found an internal herniation of the caecum and the entire ascending colon through the foramen of winslow (figs 2 and 3). after hernia reduction, multiple patchy areas of caecal necrosis were observed (fig. figure 1:axial section through upper abdomen showing distended caecum with air - fluid level (a) with the displacement of the stomach (b) laterally. figure 3:coronal slice showing herniation of right colon through the foramen of winslow. axial section through upper abdomen showing distended caecum with air - fluid level (a) with the displacement of the stomach (b) laterally. foramen of winslow hernia can be defined as peculiar variant of internal abdominal hernia, since it is a normal peritoneal orifice kept closed by normal intra - abdominal pressure that may be permeated by the intra - abdominal viscera. there are multiple anatomical abnormalities reported as possible predisposing factors for a visceral herniation through this foramen : (i) abnormally enlarged foramen ; (ii) the presence of an unusually long small - bowel mesentery or persistence of the ascending mesocolon ; (iii) an elongated right hepatic lobe, which could be directing the mobile intestinal loop into the foramen ; (iv) a lack of fusion between caecum or ascending colon to the parietal peritoneum ; (v) a defect in the gastrohepatic ligament, (vi) incomplete intestinal rotations or malrotation. since the first report in 1834 by blandin in autopsies, < 200 cases of foramen of winslow hernia have been reported in the medical literature. the typical presentation is an acute severe mid - epigastric pain associated with nausea and vomiting. the severity of the pain is related to the presence of bowel strangulation with subsequent necrosis. in some very particular cases, the internal hernia through the winslow hiatus is revealed by an obstructive jaundice due to direct compression of the hepatic pedicle. the key to diagnosis relies on prompt radiologic studies and the ct scan is nowadays considered the technique of choice. various, more or less specific findings have been reported, such as an air - fluid collection in the lesser sac or signs of small bowel obstruction associated with the presence of mesenteric vessels stretching anterior to the inferior vena cava and posterior to the portal vein ; the absence of the ascending colon in the right gutter and an antero - lateral displacement of the stomach. the treatment invariably requires urgent surgery, and even if symptoms are limited as in our case, it should be considered in order to assess intestinal viability because of the risk of intestinal strangulation. treatment is based on careful inspection with subsequent hernial reduction that is frequently possible with simple and gentle traction. occasionally, this can be difficult ; in these situations the gastrocolic or gastrohepatic ligaments must be opened or, alternatively, a wide kocher manoeuvre performed. in the case of massive colonic dilatation a colotomy for decompression with a suction device can be useful [5, 6 ]. in the case of overt intestinal necrosis an adequate resection is obviously mandatory ; nevertheless there is no clear and established consensus on surgical management when the herniated contents are grossly viable. some surgeons report right colonic fixation or caecopexy to the lateral wall, whereas others advocate right colectomy especially when there is a lack of fusion between caecum or ascending colon to the parietal peritoneum in order to avoid subsequent volvulus. furthermore, in order to prevent recurrent herniation, some surgeons decide to definitively close the foramen of winslow. this option can however lead to meaningful complications such as accretions and/or portal vein thrombosis. thus, leaving the foramen open may be justifiable since the inflammatory post - operative adhesions will most often obliterate the foramen entrance with no evidence of recurrent herniation [3, 6 ].
|
herniation through the foramen of winslow is a rare condition that can lead to a delayed diagnosis and treatment with a high mortality rate. in most reported cases, patients present to the emergency department with symptoms suggesting intestinal obstruction or with sudden and severe pain in the upper abdomen. symptoms are non - specific. clinical diagnosis may be difficult or even missed. the widespread availability of cross - sectional imaging can improve the percentage of correct preoperative diagnosis. we report a case of a caecal and right colic herniation through the foramen of winslow found incidentally on abdominal computed tomography in a patient presenting with mild epigastric pain.
|
in 1965, parkinson, the first deviser of the triangular space around cavernous sinus (cs), described the triangle between the trochlear and ophthalmic nerves in order to safely approach the lesion at the internal carotid artery (1). since parkinson, the triangular spaces around the cs were devised by several studies by clinical anatomists and neurosurgeons (234567). recently, as noninvasive surgery such as radiosurgery or endovascular surgery develop, direct surgery through the triangular spaces around cs is less employed. however, patients with special condition still require the direct surgery through the cs triangles (8).. however, the definitions of the triangles of the studies differed, although the definition must be consistent to be able to be used in diagnosis and operation. moreover, the names of each triangle varied in each study, which impedes easy and convenient learning of the triangles.. however, in the photos and videos, the structures related to the triangles could not be well - observed and there was confusion of orientation because of inconsistent and subjective viewing angles of researchers. cts and mris did not have sufficient resolution and coloration for observing the small nerves and vessels around the cs. last, there was no proper schematic diagram for easy and accurate understanding of the triangles. recently, because training opportunities of actual surgery as an observer or an assistant are narrowing due to noninvasive surgery, the need for new educational materials for clinical neuroanatomy including cs triangles is even greater. the purpose of this study is to provide two and three dimensional educational materials for accurate study of the triangles and nearby structures. to achieve these purposes, the triangles around the cs were rearranged and the educational materials for the triangles, consisting of schematic diagram and three dimensional (3d) models with sectioned images, were created. papers about the triangles around the cs since 1965 were searched in pubmed of united states national library of medicine and national institutes of health (http://www.ncbi.nlm.nih.gov/pubmed/). referring to numerous other studies, sequentially, the newly defined triangles were drawn into a schematic diagram using adobe illustrator (adobe systems, inc. schematic diagram and three dimensional (3d) models of reorganized triangles around the cavernous sinus (superior view of right side). in a schematic diagram, ten triangles are easily comprehended (a) and, in the 3d models, each structure related to the triangles is shown accurately (b). 1 = superoposterior triangle ; 2 = superior triangle ; 3 = middle triangle ; 4 = inferior triangle ; 5 = anteromedial triangle ; 6 = anterolateral triangle ; 7 = posterolateral triangle ; 8 = posteromedial triangle ; 9 = lateral triangle ; 10 = medial triangle ; ii = optic nerve ; iii = oculomotor nerve ; iv = abducens nerve ; v1 = ophthalmic nerve ; v2 = maxillary nerve ; v3 = mandibular nerve ; vi = abducens nerve ; tg = trigeminal ganglion. in our previous experiment, we made high quality and true color sectioned images of head (horizontal, coronal, and sagittal planes ; intervals, 0.1 mm ; pixel size, 0.1 mm 0.1 mm ; color depth, 48 bits color) (9). we also made segmented images of structures related to oculomotor, trochlear, and abducens nerves (10). among the segmented structures, 36 structures related to the cs were selected for this study (table 2). additionally, eight structures were newly outlined on the horizontal sectioned images using adobe photoshop (adobe systems, inc.) the outlined structures were filled with different colors using photoshop (table 2). in mimics version 10.01 (materialise, leuven, belgium), the outlines of each structure in the segmented images were built automatically by surface modeling to make 3d models., san rafael, ca, usa), the flaws of the models were found and amended using sculpt geometry tool ' (1314). according to reorganized triangles (table 1) and schematic diagram (fig. 1), the triangular surfaces were drawn between 3d models of each structure, using create polygon tool ' of maya. when the 3d models were observed, the subject 's cavernous sinus and surrounding structures had normal anatomy. the cranial nerves including the optic, oculomotor, trochlear, trigeminal, ophthalmic, maxillary, mandibular, abducens, and facial nerves had normal shape and were at proper locations. even the small branches of them like the meningeal branch of mandibular nerve and the greater petrosal nerve were intact. twenty three coronal sectioned images at 2 mm intervals were embedded in conforming position of the 3d models on maya as follows. using ' polygon plane : create a polygonal plane on the grid ', two blank surfaces the size of the sectioned image were created. in the 3d models of the structures, the first and last surfaces were placed at two exact positions with 44 mm intervals. the first surface was copied and pasted 21 times. with the ' snap align objects ', 23 surfaces (the first one, the last one, and the copied ones) were aligned at 2 mm constant intervals. through ' material attributes... ' of a surface, ' file attributes ' of ' lambert ' was opened and 23 coronal sectioned images were embedded. 3d models of the structure with triangular surfaces and the sectioned image were exported as virtual reality modeling language 2.0 (vrml2) files. in setting the alignment of the sectioned images, therefore, the position of the coronal images on 3d models was described referring to the midpoint of the anterior and posterior commissures (fig. three dimensional models (a) embedding the coronal sectioned images of each triangle. at coronal + 30 mm, the superior triangle (2) is located between the optic (ii) and oculomotor (iii) nerves (b). at coronal + 14 mm, the superoposterior (1), superior, middle (3), and inferior (4) triangles can be identified with the optic, oculomotor, trochlear (iv), and ophthalmic (v1) nerves (c). at coronal + 10 mm, the anteromedial (5) and anterolateral (6) triangles are found between the ophthalmic, maxillary (v2), and mandibular (v3) nerves, while posterior (post.) clinoid process which is the vertex of the superoposterior triangle is visible (d). at coronal + 4 mm, the medial triangle (10) is located between the dural entries of trochlear and abducens (vi) nerves, while the inferior and medial triangles are observed around the dural entry of trochlear nerve (e). at coronal 0 mm, the posterolateral (7) and lateral (9) triangles (8) is identified between the apex of petrous part of temporal bone and the greater petrosal nerve (g). when setting the positions of the images, the 1 = superoposterior triangle ; 2 = superior triangle ; 3 = middle triangle ; 4 = inferior triangle ; 5 = anteromedial triangle ; 6 = anterolateral triangle ; 7 = posterolateral triangle ; 8 = posteromedial triangle ; 9 = lateral triangle ; 10 = medial triangle ; ii = optic nerve ; iii = oculomotor nerve ; iv = abducens nerve ; v1 = ophthalmic nerve ; v2 = maxillary nerve ; v3 = mandibular nerve ; tg = trigeminal ganglion. after each 3d model in vrml2 files was imported on deep exploration version 6.3 (right hemisphere, ltd., pleasanton, ca, usa), the 3d models were categorized into 5 systems (table 2). the categorized 3d models with triangles and sectioned images were exported as a vrml2 file. on adobe 3d reviewer (accompanying software of acrobat 9.0 pro extended of adobe systems, inc.), 3d models in vrml2 file were colored and named properly. the 3d models were saved as a portable document format (pdf) file (figs. 1b, 2, and 3a). in the pdf file, windows showing each 3d model and bookmarks of clinical trials. images from left column are derived from references : b (22), d (18), f (20), and h (21). in the model tree, bookmark, and surface models windows of the pdf file, user can select 3d models of each structure, sectioned images, and clinical trial (a). regarding clinical approaches, textbook figures (b, d, f, h) and correspondence with 3d models of this study (c, e, g, i) are shown. interhemispheric approach through the superoposterior and superior triangles (b, c), pterional approach through the middle, inferior, anteromedial, and anterolateral triangles (d, e), middle cranial fossa approach through the posterolateral and posteromedial triangles (f, g), and retromastoid suboccipital approach through the lateral and medial triangles (e) can be operated virtually. in the pdf file, the selected approaches were interhemispheric approach (1617), pterional approach (1819), middle cranial fossa approach (20), and retromastoid suboccipital approach (21). for showing these surgical approaches, 3d models of each triangle and related structures were displayed at the surface model window ' and the combination was marked at the bookmark window ' (fig. by analyzing other studies, the triangular spaces around the cs were reorganized into ten triangles in three groups. all triangles were located around the sella turcica which are placed at the median plane ; therefore, we categorized the triangles into medial, lateral, and posterior groups. names of triangles were decided according to location (table 1). based on the analysis of triangles, the schematic diagram of the reorganized triangles was drawn. in the diagram, vertices and borders of triangles were indicated by each structure and only the superior view was employed in order not to confuse the orientation (fig. 1). in describing the parts of the internal carotid artery, terminologia anatomica was observed : cervical part, petrous part, cavernous part, cerebral part, and carotid siphon (2425). in the pdf file (file size, 228 mbytes), 3d models of 44 structures were presented and the ten triangular spaces were indicated (figs. 1 and 3, table 2). the models could be rotated or magnified freely to simulate a patient 's surgical position (13). furthermore, in the pdf file, 23 coronal sectioned images at 2 mm intervals corresponding to location of 3d structures could be shown (fig. 2). by comparing the schematic diagram of ten triangles with the 3d models and the sectioned images, the schematic diagram was proven to be accurate (figs. 1 and 2). the analysis results of ten triangles were described through the schematic diagram and the 3d models with the sectioned images as follows. interhemispheric approach can be virtually performed in the pdf file as follows (23). after virtually drilling the central portion of the frontal bone, virtual equipment can be accessed at superoposterior and superior triangles of the medial group. through the triangles, the relationship of each triangle and each part of the internal carotid artery at lateral view of the right side for clinical approaches. on schematic drawing, each part of the internal carotid artery can be identified through the triangles except lateral and medial triangles of the posterior group (a). on the three dimensional models, interhemispheric approach, pterional approach, middle cranial fossa approach, and retromastoid suboccipital approach are demonstrated to access the internal carotid artery (b). 1 = superoposterior triangle ; 2 = superior triangle ; 3 = middle triangle ; 4 = inferior triangle ; 5 = anteromedial triangle ; 6 = anterolateral triangle ; 7 = posterolateral triangle ; 8 = posteromedial triangle ; 9 = lateral triangle ; 10 = medial triangle ; ii = optic nerve ; iii = oculomotor nerve ; iv = abducens nerve ; v1 = ophthalmic nerve ; v2 = maxillary nerve ; v3 = mandibular nerve ; vi = abducens nerve ; vii = facial nerve ; tg = trigeminal ganglion. after virtually opening the pterion part of the cranium, a neurosurgeon can observe the carotid - cavernous fistula below the temporal lobe through the middle and inferior triangles of the medial group or the anteromedial and anterolateral triangles of the lateral group (figs. additionally, the cavernous - pterygoid venous anastomosis can be accessed by the anterolateral triangle (23). when intracranial inflammation causes the palsy of abducens nerve, the nerve 's most portions can be approached through the inferior triangle of medial group and its distal portion through the anterolateral triangle of lateral group (figs. 3b, 3c, and 4a). in case of the aneurysm of the petrous part of the internal carotid artery or the petroclival meningioma, bypass grafting can be done by through the middle cranial fossa approach (20). after retracting the temporalis, opening the pterion, and lifting the temporal lobe, the virtual equipment can reach the posterolateral and posteromedial triangles. through the triangles, the aneurysm of the petrous part or the petroclival meningioma can be treated (figs. 3f, 3 g, and 4) (27). these days, the rhomboid space expanded from the posteromedial triangle is employed for greater surgical freedom (28). when treating carotid siphon bleeding, temporary occlusion of the internal carotid artery can be performed through the posterolateral triangle (figs. rarely, retromastoid suboccipital approach is employed in accessing the small branches of the cavernous part of the internal carotid artery (21). after making a hole at the occipitomastoid suture, virtual equipment is inserted at the lateral and medial triangles of posterior group through the gap between the cerebellum and the petrosal part of the temporal bone. through the triangles, by analyzing other studies, the ten triangles were rearranged and new nomenclature of the triangles was suggested according to the positions or directions of the triangles. the accuracy of the rearranged triangles was proven by the 3d models and embedded sectioned images. in addition, we provided freely the educational materials of this study, which consisted of the schematic diagram (figs. 1a and 4a) and the realistic 3d models including coronal sectioned images (figs. 1b, 2, 3, and 4b). in this study, for example, a vertex of posterolateral and posteromedial triangles was defined with respect to the geniculate ganglion which is inappropriate (6). first, the geniculate ganglion can not be observed before breaking to open the petrous part of temporal bone. second, observation of intraosseous structures by breaking the cranium in the intracranial cavity is very difficult and dangerous. therefore, in this study, vertices of the triangles were defined using only visible structures in the intracranial cavity. a vertex of the posterolateral and posteromedial triangles was defined with the hiatus of the greater petrosal nerve, rather than the geniculate ganglion (figs. 1 and 2, table 1). borders in each triangle could be decided accurately based on precise vertices of this study. a researcher defined three borders of posterolateral triangle ; mandibular nerve, greater petrosal nerve, and between foramen spinosum and arcuate eminence of the petrous part of temporal bone (23). however three borders would not form a triangle because two borders (two nerves) and the other border (between the foramen and the eminence) were not joined. therefore, in this study, we rearranged three borders that could form a triangle. for example, in case of the borders of the researcher (23), we defined two borders (mandibular nerve and greater petrosal nerve) and another border (between the foramen ovale and hiatus of the greater petrosal nerve). since mandibular nerve and greater petrosal nerve enter bone through foramen ovale and the hiatus, they were joined to form a perfect triangle (figs. 1 and 2, table 1). accurate vertices and borders were determined and their accuracy was proved by our sectioned images and 3d models ; consequently, triangles in this study were also accurate (figs. 1 and 2, table 1). in understanding the triangles around the cs, however, the easily obtainable pdf file with the 3d models can be an auxiliary material for the preview or review of dissection. traditionally in anatomy, a simplified diagram is employed to assist rudimentary understanding of structures ' shape, location, or position, particularly to novice medical students. after understanding the structures, 3d models are used in order to present anatomy with regard not only to the location and position of the structures but also to their relationship. however, neither a simplified diagram nor 3d models were provided, although the triangles were very complicated. therefore, in this study, the schematic diagram of the triangles around the cs was drawn (figs. the pdf file including the 3d models was made (figs. 1b, 3, and 4b) in order to grasp the triangles stereoscopically. consequently, we suggest others to use the schematic diagram for their anatomy theory lecture and to utilize the 3d models with the sectioned images for cadaver dissection. we also included two supplementary materials, the surgical approaches bookmarks and the coronal sectioned images in the pdf file. the surgical approaches bookmarks would be useful in explaining the orientation of the surgery (fig. the coronal sectioned images are very helpful to understanding the sectional anatomy of the cs region. furthermore, if the a doctor used the 3d models with these features in this study, he or she could explain well and easily the findings on a patient 's mri or ct to the patient (fig. 2). the educational materials provided in this study can complement each other, producing a synergic effect. the schematic diagram can be used for easily understanding morphology of structures but can not be used for learning detailed anatomical knowledge of the structures because it is very simple. contrariwise, using the 3d models, the detailed anatomical knowledge of structures can be memorized easily, however understanding the knowledge is not easy because it is very complicated. given their complementary relationship, we suggest that both the schematic diagram and the 3d models be employed when teaching. nowadays, emerging radiosurgery and endovascular surgery are becoming the mainstream in brain surgery for its superior safety level and short recovery time. however, some brain diseases such as some tumors like meningioma, pituitary adenoma, schwannoma, and chondroid tumor still need to be invasively operated by a neurosurgeon (2930313233). the debate between endovascular coiling and extravascular clipping of aneurysm still requires more study (3435). when endovascular embolization or balloon occlusion of carotid - cavernous fistula is failed, conventional surgery is considered (36). therefore, neurosurgeons with competent surgical skill are still needed. in order to acquire competent surgical skill however, surgical training opportunity for doctors is narrowing because the noninvasive surgery is mainstream. therefore, in this study, we provided the educational materials, consisting of a schematic diagram for understanding the region, sectioned images for interpreting cts and mris, and 3d models for absorbing stereoscopic knowledge. by using our schematic diagram of this study, ten triangles around the cs can be understood easily. by using the 3d models with sectioned images, ten triangles and related structures we expect that our data will contribute to anatomy education, surgery training, and radiologic understanding. in addition, we are certain that the combination of our data and existing learning tools, such as surgery videos and cadaver dissection, will be highly effective. we are also sure that virtual approaching of ten triangles of this study is becoming increasingly necessary as real surgical training opportunity is decreasing due to radiosurgery.
|
for the surgical approach to lesions around the cavernous sinus (cs), triangular spaces around cs have been devised. however, educational materials for learning the triangles were insufficient. the purpose of this study is to present educational materials about the triangles, consisting of a schematic diagram and 3-dimensional (3d) models with sectioned images. to achieve the purposes, other studies were analyzed to establish new definitions and names of the triangular spaces. learning materials including schematic diagrams and 3d models with cadaver 's sectioned images were manufactured. our new definition was attested by observing the sectioned images and 3d models. the triangles and the four representative surgical approaches were stereoscopically indicated on the 3d models. all materials of this study were put into portable document format file and were distributed freely at our homepage (anatomy.dongguk.ac.kr/triangles). by using our schematic diagram and the 3d models with sectioned images, ten triangles and the related structures could be understood and observed accurately. we expect that our data will contribute to anatomy education, surgery training, and radiologic understanding of the triangles and related structures.
|
although the pathophysiology of chronic subdural hematomas (csdh) has not been clearly identified, there are many studies in progress, including the papers on the outer membrane 's role on csdh.37111718) past studies were mainly on the electron microscopic findings of the outer membrane.1314) and these are not easy to apply in practice. in one study, outer membrane was classified into 4 types pathologically according to maturity and intensity of the inflammatory reaction and hemorrhage.11) the study indicated that analyzing the clinical significance of each group of the outer membrane may be helpful to assume the prognosis of patients with csdh. we conducted this study in order to classify our specimen of the outer membrane of csdh histologically and to review the clinical features according to the histological types of the outer membranes. the outer membrane specimen of 31 patients who underwent surgery for csdh between november 2004 and january 2013 were acquired through small craniotomy and the samples were cut to the size of 11 cm for the study. in the treatment of csdh, we were able to remove organized hematomas or clots by irrigation much more easily and effectively with the small craniotomy (about 3 to 4 cm in diameter).9) by using the paraffin blocks of the specimen, we executed hematoxylin and eosin staining and elastica - van gieson staining. histological features of the outer membrane were classified into 4 types according to maturity and intensity of the inflammatory reaction and hemorrhage. type i is non - inflammatory membrane, containing immature fibroblasts and collagen fibers. it was associated with very slight or sparse cell infiltration and neocapillaries.. it is consisted of large capillaries on the side of the dura mater and marked cell infiltration with many thin new vessels on the hematoma cavity. type iv is scar - inflammatory membrane, which shows inflammatory cell infiltration, neovascularization and hemorrhage in the outer membrane of cicatrical tissue.11) we analyzed the clinical and the radiologic findings of the patients applicable to each type. the clinical symptoms on the admission day were divided into two groups, one with the symptom of headache alone, and the other that accompanied neurologic deficit such as motor weakness, mental change and dysarthria. and the analyzed radiologic features include subdural fluid density, hounsfield number, thickness of the hematoma, and the length of midline shift. the brain computed tomography (ct) findings of the subdural fluid density were classified by hyperdense, isodense, hypodense, and mixed density type ; mixed density type was categorized into laminar, separated, gradation, and trabecular type. to assess statistical significance, we used spss for windows version 19.0 (spss inc., chicago, il, usa). nonparametric data were compared using the kruskal - wallis and mann - whitney u - test. of those patients, one patient had a re - operation on account of recurrence in the same area after 8 months and two patients were operated the opposite side a few days after surgery due to increase the subdural fluid volume. the cause of the head trauma of the patients are as follows ; fourteen patients had the head trauma caused by falling while 10 did n't know the cause, 6 from traffic accident and 1 from the assault. histopathological analysis revealed 2 cases (6%) of type i, 9 cases (29%) of type ii, 12 cases (39%) of type iii, and 8 cases (26%) of type iv neomembranes (figures 1, 2, 3, 4). the cases of all 31 patients had the glasgow coma scale (gcs) scores of more than 14, therefore there was no severe consciousness decline. in the clinical symptoms on the admission day, 17 cases reported simple headache, while 14 cases accompanied with neurological manifestation ; 7 motor weakness, 5 mental changes and 2 dysarthria. the result of the analysis shows that according to the histopathological types of the outer membranes, neurologic deficit was accompanied highest with type iv by 63%, seconded by type ii, 56%, followed by 33% of type iii while type i did n't have any (table 1). the average period of trauma to surgery was 32.510.6 days in type i and 32.330.6 days, 36.340.1 days and 59.454.7 days in type ii, iii, iv respectively. and there was no statistical difference between each type (type i / ii p=0.994, i / iii p=0.779, i / iv p=0.345, ii / iii p=0.850, ii / iv p=0.404, iii / iv p=0.436). out of 31 cases, 24 were examined by brain ct before the surgery while 7 used only the mri. from the data of 24 brain ct performed before surgery, hounsfield unit was 44 in type i (only one case), and type ii, iii, iv were 43.35.2, 36.410.3, 38.37.4 respectively. immediate preoperative thickness of subdural hematoma was 20.50.7 mm in type i and 25.05.3 mm, 17.97.7 mm and 21.16.4 mm in type ii, iii, iv respectively. the midline shift of the preoperative image was 7.01.4 mm in type i and type ii, iii, iv was 11.76.1 mm, 8.65.0 mm, and 7.05.9 mm respectively (table 2). on the radiological findings of the above, on ct scans, 11 patients (46%) had mixed density types, 8 patients (33%) had isodense types, 3 patients (13%) had hyperdense types, and 2 patients (8%) had hypodense types. the analysis through histopathological types of the outer membrane shows that type ii had 2 hyperdense and 4 isodense type cases and type iii and iv had a mixed density type high with 5 and 4 cases respectively. of the mixed density, 6 cases were trabecular type, 3 were laminar type and 2 of gradation type (table 3). csdh is prevalent among elderly populations worldwide, and its pathogenesis have been discussed in the literature for decades. with the increase of the senior population, the prevalence rate of the disease is also increasing such interesting subject of study was particularly focused on the outer membrane of csdh diversely, 3456711151718) and the neoformation of capillaries and vascular hyperpermeability of outer membrane found from csdh is reported to be correlated with the progressive enlargement of csdh.18) the outer neomembrane of csdh contains multiple components, especially friable neovasculature, and local fibrinolytic factors, which may influence the formation of a hematoma.3) the newly formed blood vessels appear to be more permeable and fragile than pre - existing vessels.15) friede2) reported four pathologic type of membranous and membranous - hemorrhagic lesions in 46 necropsies. his classification was neomembrane (type i), hemorrhagic neomembrane (type ii), hematoma (type iii), and fibrosis (type iv). nagahori.11) classified the histological features of the outer membrane into four types based on the maturity and intensity of the inflammatory reaction and hemorrhage. they pointed out, based on a comparison of the density of hematoma on ct and the histological findings of outer membranes, that exudation from inflammation is involved in the early stage of hematoma formation, and the inflammation and hemorrhage are involved in the subsequent stage of hematoma enlargement. according to the histological features and the period of time from trauma to surgery, they suggested that the outer membrane is considered to have changed from type i to ii, iii, and iv, in order.13) in our study, due to the wide deviation of the data although there was no statistical significant, however we were able to find a similar trend to the result of nagahori.11) most of the acute subdural hematomas resolves into hypodensity on ct within 3 weeks. the wider the surface area of outer membrane is, the more extensive the neovascularity becomes, and the higher the fibrinolytic activity within the hematoma is, the more blood will be mixed.10) the ct scan attenuation values and the size of the hematoma tended to increase with the maturity of the neomembranes.4) in other words, the density of the csdh changes from isodensity to hypodensity into the mixed density as time passes. we have confirmed through our research that the most of type i and ii were isodense type while type iii and iv were mixed density with the exception of 2 cases of hypodense type belonging under type iii and 3 cases of hyperdense type, 2 coming from type ii and one from type iv. the result points toward the fact that the outer membrane changes from type i to iv, assuring the result of the study done by nagahori.11) however, a report contends that the mixed density of csdh is resulted from multiple episodes of trauma, usually in the aged, making it hard to conclude that mixed density occur only from the rebleeding from neovascularization. another report shows that although histological studies of the outer membrane can account for the development of csdh, the findings poorly correlate with clinical manifestations. a gcs score of 12 or less exclusively had type ii neomembranes which may correlate clinically to the period of rapid expansion of a csdh and subsequent decompensation. type ii neomembranes may represent an early stage of inflammatory membrane formation associated with a higher stage of membranous exudation into the hematoma cavity and therefore has a tendency to bleed.4) in the radiological analysis such as hounsfield unit, hematoma thickness and midline shift for each pathologic type, we had only one the statistical meaning from the hematoma thickness between type ii and iii alone. looking at the overall trend of other results, hounsfield unit show a gradual decrease in the type i, ii, and iii then a slight increase in type iv. this result is consistent with the above paper which suggested type ii membrane may be related to the rapid expansion of a csdh. as our study did not have the case of the significantly lower gcs score, we did the comparisons of the clinical features between the case only with the headache and the case accompanied by neurologic deficit. the result shows that type iv and ii had a high number of cases accompanied by neurologic deficit, which is dissimilar with the report from above. the appearance of hematoma on ct scans could be a predictor of the post - operative recurrence. in a clinical analysis of risk factors associated with the recurrence of csdh, they suggest that the incidence of recurrence in the high- or mixed - density groups was significantly higher than those in the low- or iso - density groups.18) and a prospective study of 107 operated patients reported a different result in isodense group and further subdivided mixed group. they concluded that the high recurrence rate was reported in the isodense, hyperdense, laminar, and separated type, whereas the low recurrence was in the hypodense, gradation, and trabecular type.16) based on the latter paper, the results of our experiments are as follows. the isodense, hyperdense and laminar type showed the high recurrence rate ; 75% of type ii and 67% of type iv while type iii had the low possibility of recurrence rate (33%). therefore, we suggested that type ii and iv needed to be observed closely as the possibility of recurrence is higher on those types. we classified the outer membrane of the csdh in 4 types histologically and analyzed each type with clinical and radiological findings. outer membrane was identified to have the tendency to develop from type i to iv in time and suggested that type ii and type iv may have more risk on neurologic deficit and the high possibility of recurrence. in the future, the experiments will be necessary for inflammatory change and angiogenesis of the outer membrane of csdh.
|
objectivethe aim of our study was to classify the outer membrane of chronic subdural hematoma (csdh) histologically and to determine the clinical and radiological meaning of the classified membranes.methodsthe outer membrane specimen of 31 patients who underwent surgery for csdh were acquired in this study. the specimen was classified into four types and each were analyzed of the symptoms on the admission day and during the period from trauma to surgery. the radiological features such as subdural fluid density, hounsfield number, thickness of the hematoma, and midline shift were analyzed.resultsthere were 6% of type i, 29% of type ii, 39% of type iii, and 26% of type iv neomembranes. the cases of csdh accompanied by neurologic deficit were highest from type iv of 63%, followed by type ii with 56%. on the radiological findings such as hounsfield unit, hematoma thickness and midline shift, only hematoma thickness between type ii and iii were statistically significant (p=0.021). the hematoma thickness and midline shift were greatest in type ii. on computed tomography scans, the isodense, hyperdense and laminar type that shows the high recurrence rate formed 75% of type ii and 67% of type iv while type iii had the low possibility of recurrence rate (33%).conclusionwe have identified that the outer membrane have the tendency to develop from type i to iv in time while type ii and type iv may have more risk of neurologic deficit and the high possibility of recurrence.
|
positive control preparations : the positive for cdv, cpiv and cadv-2 was obtained from the modified - live vaccine vanguard plus 5/cv - l (zoetis, kalamazoo, mi, u.s.a.), containing cpiv (10 tcid50/ml), cdv (10 tcid50/ml) and cadv-2 (10 tcid50/ml). meanwhile, the positive for crcov, cahv-1 and civ was derived from naturally infected dogs that were confirmed by nucleic acid sequencing. alongkorn amornsin, department of veterinary public health, faculty of veterinary science, chulalongkorn university. specimens : nasal (ns) and oropharyngeal swabs (os) were collected from 51 suspected cirdc suffering dogs ; they were brought to veterinary hospitals residing in metropolitan bangkok, thailand, during february - august 2014. those dogs that showed respiratory problems, such as nasal discharge, cough and evidence of bronchopneumonia, were included, whereas those that revealed secondary respiratory disease caused by cardiovascular and/or functional tracheal disease were excluded from the study. vaccination status of sampled dogs was also recorded. after taking the ns and os using sterile rayon tipped applicators (puritan, guifolrd, me, u.s.a.), the swabs were immersed in 1% phosphate buffer saline (pbs) and kept at 80c until assayed. the study protocol was approved by chulalongkorn university animal care and use committee (no. 1431005). viral nucleic acid extraction, quantification and reverse transcription : viral nucleic acid from the positive controls and specimens was extracted using the viral nucleic acid extraction kit ii (geneaid, taipei, taiwan) according to manufacturer s recommendation. nucleic acid was quantified and qualified using nanodrop lite (thermo fisher scientific inc., waltham, ma, u.s.a.) at an absorbance of 260 and 280 nm to derive the a260/a280 ratio. the extracted nucleic acid was divided into two aliquots, one for reverse transcription (rt) for detection of the rna viruses (civ, cpiv, cdv and crcov) and the other for a direct pcr assay for detection of the dna viruses (cadv-2 and cahv-1). the rt was performed using 100 ng rna as the template for complementary dna (cdna) synthesis using the omniscript reverse transcription kit (qiagen gmbh, hilden, germany). the cdna and dna were stored at 20c until used for further pcr amplification. specific primers for viruses causing cirdc : the sequences of the primers used for cadv-2 (e3 gene), cdv (np gene), civ (m gene), cpiv (np gene), crcov (s gene) and cahv-1 (gb gene) amplification were retrieved from previous studies [4, 6, 14, 16 ] and are shown in table 1table 1.primers used for the pcr amplification of cirdc virusesvirusprimer nameprimer sequence (5 to 3)target geneproduct size (bp)civciv_m_f151catggartggctaaagacaagaccm126civ_m_r276agggcattttggacaaakcgtctacdvcdv_n_f768aacagrrattgctgaggacytat np290cdv_n_r1057tccarrrataaccatgtayggtgccadv-2cadv_e3_f25073tattccagactcttaccaagagg e3551cadv_e3_r25623atagacaaggtagtartgytcag cpivcpiv_n_f428gccgtggagagatcaatgcctat np187cpiv_n_r614gcgcagtcatgcacttgcaagt crcovcov_16053_fggttgggaytaycctaartgtgas542 (first round pcr)cov_16594_rtaytatcaraayaatgtctttatgtccov_pan_16510_rtgatgatggngttgtbtgytataa 458 (second round pcr)cahv-1cahv_gbf439acagagttgattgatagaagaggtatggb136cahv_gbr574ctggtgtattaaactttgaaggcttta a) m = matrix, np = nucleoprotein, e3=early transcribed region, s = spike protein, gb = glycoprotein b.. in order to ascertain the sensitivity, specificity and interaction of those primers, more than 45 sequences of each target gene were compared by multiple alignments using bioedit sequence alignment editor version 7.1.3.0 (ibis biosciences, carlsbad, ca, u.s.a.). the in silico specificity test was performed to select the conserved regions using blastn analysis in order to ensure the primer specificity without cross amplification of canine genes. degenerate primers for civ, cdv, cadv-2 and crcov were applied (table 1). moreover, the canine glyceraldehyde-3-phosphate dehydrogenase (gapdh) gene was used as an internal control as reported previously. a) m = matrix, np = nucleoprotein, e3=early transcribed region, s = spike protein, gb = glycoprotein b. optimization of the simplex pcr : prior to performing the pcr for detection of rna viruses, a first round pcr for crcov was performed in order to increase the detection sensitivity. reactions were comprised of a mixture of 2x gotaq hot start green master mix (promega, madison, wi, u.s.a.), 0.4 m final concentration of each outer primer (cov_16053_f and cov_16594_r) and 2 l of cdna, and made up to 25 l with nuclease - free water. reactions were performed using 3prime g gradient thermal cycle (techne, bristol, u.k.). cycling conditions were comprised of an initial denaturation at 94c for 5 min, followed by 40 cycles of 95c for 30 sec, 55c for 30 sec and 72c for 30 sec. subsequently, the amplified crcov product of the first round pcr, and cdna of the other rna viruses (civ, cpiv and cdv) and extracted dna viruses (cadv-2 and cahv-1) were used as a template for further simplex pcr studies. all reaction compositions were as mentioned above, but the gradient annealing temperature (ta) was programmed ranging from 50c to 59c in order to optimize the reaction. thermal cycling was performed with 95c for 5 min, then 40 cycles of 95c for 1 min, varied ta for 1 min and 72c for 1 min, and then finally 72c for 10 min. the amplicons were resolved by 2% (w / v) agarose gel electrophoresis with 10% ethidium bromide in - gel staining and visualized by uv transillumination and compared to expected size of the pcr product (table 1). optimizations of multiplex pcr : the multiplex pcr was optimized separately for rna- and dna - associated cirdc viruses. the starting genetic material for rna virus detection was derived from two compartments : (1) product from the first nested pcr of crcov and (2) cdna of the other rna viruses. reaction composition and condition the suitable ta for all rna and dna viruses was selected for further comparative analysis with simplex pcr. sequencing of pcr amplicons was performed to confirm their correct identity and thus the specificity of the pcr reaction. amplicons were purified with a nucleospin extract ii (macherey - nagel, dren, germany) kit and submitted to the 1st base, pte. ltd. the derived nucleotide sequences were aligned using the bioedit sequence alignment editor version 7.0.9.0 software, and the respective consensus sequences were compared to those in the genbank database using blastn analysis. analysis of specificity, sensitivity and reproducibility specificity test : the analytical specificity of each simplex pcr assay was evaluated by cross - reaction tests with various cirdc - associated viruses, as well as canine parvovirus (cpv), canine enteric coronavirus (ccov) and bordetella bronchiseptica. sensitivity test : to access the analytical sensitivity of each simplex pcr assay, two - fold serial dilutions of nucleic extracted positive controls were amplified. reproducibility : both intra- and inter - assay variations were measured using the positive controls and sequenced clinical samples. to assess the intra - assay variation, triplicate amplifications of the 2 and 2ng / reaction templates for the positive controls and the samples were performed in a single multiplex pcr assay. to evaluate the inter - assay variation, the above single multiplex pcr was performed as three independent multiplex pcr assays. diagnostic performance of the multiplex pcr : to evaluate the reliability of the developed multiplex pcr for clinical testing, the performance of the assay was compared to those of the simplex pcr and a commercial test kit (antigen rapid cird-3 ag test kit, bionote, hwaseong, south korea). the sensitivity, specificity, positive predictive value and negative predictive value were determined. independent t - test was used to evaluate the difference between route of sample collection and number of viral detection using spss 22.0 (ibm corp., new york, ny, u.s.a.) study population : the 51 dogs with respiratory clinical illness included in this study were 29 males and 22 females. most of the dogs were puppies (37.3%) or senile (23.5%). most presented with a nasal discharge (80.4%), coughing (47.1%), loss of appetite (56.9%) and bronchopneumonia (41.2%). optimized and analytical performances of simplex and multiplex pcr assays : optimization of each simplex pcr was undertaken using positive controls and clinical samples with different cycling conditions. different annealing temperatures were evaluated, with the optimum ta for all virus detections being 58c, at which temperature no primer dimers or non - specific amplicons were detected (data not shown). in silico and in vitro analytical specificity tests revealed that each primer was able to amplify the specific target dna without any cross amplification among the cirdc viruses, cpv, ccov and b. bronchiseptica. in addition, the sequenced amplicons showed 100% sequence identity with their respective corresponding sequence in the genbank database. analytical sensitivity, specificity and reproducibility : the sensitivity of the multiplex pcr was tested by detection of the various viruses in serial dilutions and compared with that using the simplex pcr for each particular virus. the multiplex pcr products of the tested viruses were observed at the same template dilutions as with the simplex pcr, suggesting a similar sensitivity for the simplex and multiplex pcrs (figs. 1.analytical sensitivity test of the (a d) simplex and (e) multiplex rt - pcr of rna - associated cirdc viruses. (a) civ, (b) cpiv, (c) cdv and (d) crcov. two - fold serial dilutions of the positive controls ranging from 2 2ng / reaction were assayed. detection threshold was equal in both the simplex and multiplex modalities and revealed minimal detectable dilution at 2(civ), 2(cpiv) and 2(cdv and crcov) ng / reaction. 2.analytical sensitivity test of (a, b) simplex and (c) multiplex pcr of dna - associated cirdc viruses. detection threshold was similar in both the simplex and multiplex modalities and revealed minimal detectable dilution at 2(cadv-2) and 26 (cahv-1)ng / reaction. the highest detection threshold was found for cdv and crcov, then cahv-1 and civ, and finally by cpiv and cadv-2. analytical sensitivity test of the (a d) simplex and (e) multiplex rt - pcr of rna - associated cirdc viruses. (a) civ, (b) cpiv, (c) cdv and (d) crcov. two - fold serial dilutions of the positive controls ranging from 2 2ng / reaction were assayed. detection threshold was equal in both the simplex and multiplex modalities and revealed minimal detectable dilution at 2(civ), 2(cpiv) and 2(cdv and crcov) ng / reaction.. analytical sensitivity test of (a, b) simplex and (c) multiplex pcr of dna - associated cirdc viruses. detection threshold was similar in both the simplex and multiplex modalities and revealed minimal detectable dilution at 2(cadv-2) and 26 (cahv-1)ng / reaction. the specificity of the tested pcrs was evaluated by using other pathogens as mentioned above. for evaluation of the reproducibility, both intra- and inter - assay variations revealed similar results among the assays (data not shown). evaluation of the multiplex pcr using clinical specimens : the multiplex pcrs were tested on the 51 ns and 51 os samples (fig. 3.results of the (a) multiplex rt - pcr and (b) multiplex pcr tested on clinical samples (s1s14). m = dna marker 100 bp, ve = negative control, + ve = positive control.) and compared with the simplex pcr assays for each respective virus (table 2table 2.comparison of the results from the simplex pcr and multiplex pcr for detection of cirdc associated viruses in clinical samplessimplex pcrtotalsensitivityspecificityppvnpvcadv-2cadv-2 poscadv-2 negnsosnsosmultiplex pcrcadv-2 pos460010cadv-2 neg00474592total1092102100100100100cahv-1cahv-1 poscahv-1 negnsosnsosmultiplex pcrcahv-1 pos34007cahv-1 neg10474795total89410287.510010099civciv posciv negnsosnsosmultiplex rt - pcrciv pos41420083civ neg119819total851710297.710010089.5cpivcpiv poscpiv negnsosnsosmultiplex rt - pcrcpiv pos18150033cpiv neg12323469total366610291.710010095.7cdvcdv poscdv negnsosnsosmultiplex rt - pcrcdv pos14130027cdv neg21353775total30721029010010096crcovcrcov poscrcov negnsosnsosmultiplex rt - pcrcrcov pos23230046crcov neg00282856total4656102100100100100a) pos = positive, neg = negative. c) ppv = positive predictive value, npv = negative predictive value.). the cadv-2 and crcov detection had 100% sensitivity and specificity for both the ns and os sampling sites. false negative results were observed in cahv-1, civ, cpiv and cdv detection when performing multiplex pcrs, which resulted in a lower sensitivity of 87.597.7%. the ppv (100%) of all multiplex pcrs was consistent with the specificity (100%), while the npv (89.599.0%) of those reactions was contrary with their sensitivity. neither the multiplex rt - pcr nor the multiplex pcr showed false positive results when compared with its simplex counterpart. results of the (a) multiplex rt - pcr and (b) multiplex pcr tested on clinical samples (s1s14). the comparison between the multiplex pcrs and the rapid three - antigen test kit (cadv-2, civ and cdv) was performed on the same samples (table 3table 3.comparison of the results from the multiplex pcr and the rapid antigen test kit for the detection of cadv-2, civ and cdv in clinical samplesrapid antigen test kittotalsensitivityspecificityppvnpvcadv-2cadv-2 poscadv-2 negnsosnsos multiplex pcrcadv-2 pos014510cadv-2 neg00474592total 110110210091.0910100civciv posciv negnsosnsosmultiplex rt - pcrciv pos00414283civ neg0010919total 0102102uc18.630100cdvcdv poscdv negnsosnsosmultiplex rt - pcr cdv pos668727cdv neg00373875total 129010210083.3344.44100a) pos = positive, neg = negative. d)uc = unable to calculate.). with the clinical samples tested in this study, the rapid test kit yielded 100% sensitivity and a relatively high specificity for cadv-2 and cdv. however, for civ, there were high numbers of pcr - positive samples detected by multiplex pcr (83/102), whereas the test kits showed negative results. detection of cirdc viruses in clinical samples by multiplex pcr : in single infection civ was the predominant virus detected and accounted for 23.5% (12/51) and 19.6% (10/51) positive ns and os samples, respectively. the next most common virus was cpiv, detected at 3.9% (2/51) and 5.8% (3/51) of ns and os samples, respectively, with 2% (1/51) being positive for crcov infection in both ns and os samples. even though the cdv, cadv-2 and cahv-1 were not detected as a single infection, they were detected in multiple infections in these tested samples (table 4table 4.cirdc viruses detected by multiplex pcr in the 102 clinical samples from 51 dogssingle infection (n=29)ns (n=15)os (n=14)civ1210cpiv23crcov11dual infection (n=43)ns (n=20)os (n=23)civ + cpiv54civ + cdv11civ + crcov711civ + cadv-221civ + cahv-113cpiv + crcov10cdv + crcov32cdv + cadv-201triple infection (n=23)ns (n=13)os (n=10)civ + cpiv + cdv22civ + cpiv + crcov41civ + cpiv + cadv-201civ + cdv+ crcov33civ + crcov + cadv-201civ + crcov + cahv-111cpiv + cdv + crcov10cpiv + cdv + cadv-2214 co - infection (n=3)ns (n=1)os (n=2)civ + cpiv + cdv + crcov125 co - infection (n=2)ns (n=1)os (n=1)civ + cpiv + cdv + crcov + cadv-201civ + cpiv + cdv + crcov + cahv-110negative (n=2)ns (n=1)os (n=1)11total5151a) ns = nasal swab, os = oropharyngeal swab.). a) ns = nasal swab, os = oropharyngeal swab. for dual infections, the most frequently detected viruses were civ co - infected with crcov at 13.7% and 21.6% in ns and os, respectively, followed by civ with cpiv at 9.8% and 7.8% in ns and os samples, respectively. for triple infections, civ and crcov were frequently found together co - infected with other viruses, and especially with cdv and cpiv. however, one dog was negative for all tested viruses in both the ns and os samples. generally, dual infections were predominant in cirdc suffering dogs (42.2%), followed by single (28.4%) and triple (22.6%) infections. with regards to the sampling site, the frequency of positive results was not statistically different between the os and ns sampling sites (p>0.05). the cirdc is an important disease that impacts on dogs, especially puppies or immunosuppressed dogs, and is frequently associated with viral infections. it has gained attention recently, because many viruses have been discovered and co - infections with multiple pathogens are often fatal. thus, the development of diagnostic tools for cirdc - associated virus detection is necessary to enhance the diagnosis coverage. in this study, multiplex rt - pcr and multiplex pcr for the detection of cirdc - associated rna and dna viruses, respectively, were developed and compared with conventional methods. the two multiplex pcrs gave similar results equivalent to that obtained from the conventional simplex pcrs that could only detect one pathogen per reaction and so required six separate reactions per sample. nested amplification was performed for crcov detection in order to increase the sensitivity of detection (poovorawan, personal communication). although multiplex pcr has been developed previously to detect several pathogens of cirdc, such as civ, cdv and crcov, its application remained limited because of the narrow range of viruses covered, with other cirdc - associated viruses being neither detected nor ruled out. thus, our study might provide a novel platform for whole cirdc - virus detection. the overall sensitivity of the multiplex rt - pcr and multiplex pcr was more than 90% and 87%, respectively, compared to their simplex counterparts. however, the detection of crcov was modified as a hemi - nested rt - pcr to increase its sensitivity. the false negative reactions when performing multiplex pcrs in this study might be resulted from the selection of the single optimized ta for several primer pairs and the low amount of particular target genes. recently, some multiplex pcr assays were developed in order to detect the cirdc pathogens ; however, the test might be immature, because only civ, cdv and crcov could be detected but not for others. thus, our study expanded the coverage of cirdc virus detection. in an evaluation of the commercially available three - antigen rapid test kit (cadv-2, civ and cdv) a previous study reported that the developed multiplex rt - pcr for h3n2 civ, cdv and crcov detection had an almost 100% sensitivity and specificity compared with the conventional rt - pcr and rapid antigen test kit. in contrast, our study showed that the civ - positive samples by multiplex rt - pcr were negative when tested with the rapid antigen test kit. this is consistent with reports that many rapid test kits might have a low sensitivity to detect the influenza virus, but could still be suitable for rapid in - house clinical applications [11, 15 ]. this reflects that the type of kit, viral copy number, duration of storage, route of sample collection, and type or virus strain may all influence the test results. interestingly, in this study, about 70% (71/102) of samples from the clinical respiratory illness dogs were found to have multiple infections. this finding supports that symptomatically, the cirdc is a complex disease, which is mostly caused by co - infection with more than one pathogen. 2013) used both ns and whole blood samples for cirdc virus detection, but found that only cdv (and not civ and crcov) could be detected from the whole blood samples. correspondingly, respiratory swabs have been reported to be appropriate samples for the detection of respiratory pathogens [9, 16 ]. thus, ns and os served as appropriate sample sources in our study due to their ease of and non - invasive sampling nature and that they lie on the viral shedding routes. this study also suggested that the virus should be screened for in ns and os, with detection levels at each site depending on the type of virus. the cadv-2 and cahv-1 mostly replicate in the lower respiratory tracts and shed via respiratory discharge, consisting with our finding that they were mostly detected in the os, even though ns could often detect these viruses as well. the cadv-2 primer pair used in this study was able to amplify cadv-1 dna virus which also shows airborne transmission and replicates in tonsil. therefore, the positive pcr reaction for canine adenovirus could not discriminate between cadv-1 and cadv-2 in this study. additionally, cahv-1 can be latent in various nerve ganglions, resulting in negative results from nucleic acid - based cahv-1 detection in respiratory discharges in non - symptomatic dogs. in this study, 3 out of 15 vaccinated dogs receiving, at least once, combined vaccine against cpiv, cdv and cadv-2 showed pcr positive results for cirdc virus detection (2 cdv positive dogs and 1 cpiv positive dog). even though live attenuated vaccines can give false positive results with molecular testing, it is essential to discriminate between wild - type infection and recent vaccination for the prevention of false positivity in the future. this study documented cahv-1 and crcov circulation in thailand for the first time. in 2012, civ h3n2 was discovered in thailand from dogs with flu - like symptoms. here, civ and crcov were the most frequently detected viruses in cirdc - infected dogs, suggesting that the viruses might spread rapidly. these viruses were not only found in single infections, but they were also found as co - infections together or with other viruses. this study also exhibited a higher level of infections compared with a previous report, although this might be caused by the different timing of sample collection, population size and locations. however, it has previously been reported that infection with crcov and cpiv might facilitate or initiate the disease and, subsequently, enhance the entry of other pathogens, so the prevalence of infected dogs is then increased. moreover, we found that the dogs that were infected with civ, cpiv, cdv and crcov showed a greater severity of clinical symptoms, such as marked bronchopneumonia and sudden death (data not shown). this finding is consistent with other investigations suggesting that co - infections might augment the severity of clinical symptoms [7, 16 ]. thus, advanced genetic - based detection methods, such as multiplex pcr assays, are considered as an alternative diagnostic platform for a panel of suspected cirdc causing viruses with a high sensitivity and specificity. because of the cost benefit and practical usage, the developed multiplex pcr assays are suitable for a screening test for disease diagnosis, quarantine and prevention measures, especially in developing countries
|
canine infectious respiratory disease complex (cirdc) viruses have been detected in dogs with respiratory illness. canine influenza virus (civ), canine parainfluenza virus (cpiv), canine distemper virus (cdv), canine respiratory coronavirus (crcov), canine adenovirus type 2 (cadv-2) and canine herpesvirus 1 (cahv-1), are all associated with the cirdc. to allow diagnosis, two conventional multiplex polymerase chain reactions (pcr) were developed to simultaneously identify four rna and two dna viruses associated with cirdc. the two multiplex pcr assays were then validated on 102 respiratory samples collected from 51 dogs with respiratory illness by sensitivity and specificity determination in comparison to conventional simplex pcr and a rapid three - antigen test kit. all six viruses were detected in either individual or multiple infections. the developed multiplex pcr assays had a > 87% sensitivity and 100% specificity compared to their simplex counterpart. compared to the three - antigen test kit, the multiplex pcr assays yielded 100% sensitivity and more than 83% specificity for detection of cadv-2 and cdv, but not for civ. therefore, the developed multiplex pcr modalities were able to simultaneously diagnose a panel of cirdc viruses and facilitated specimen collection through being suitable for use of nasal or oral samples.
|
molecular crystal structure is governed by a delicate balance among intra- and intermolecular interactions, and even small changes in the crystallization process may lead to different crystal packing motifs, or polymorphs. despite having identical chemical compositions, different polymorphs often manifest significantly altered physical properties. in pharmaceutical applications, changes in crystal packing modern pharmaceutical development involves extensive polymorph screening, and it is often important to identify the structures of the resulting crystals. while single - crystal and powder x - ray diffraction remain the primary methods for crystal structure determination and fingerprinting solid forms, solid - state nuclear magnetic resonance (nmr) is an increasingly used alternative. the combination of solid - state nmr and powder x - ray diffraction has proven particularly potent for solving crystal structures. nmr chemical shielding is a function of the local electronic structure, making it sensitive to both the molecular geometry and local crystallographic environment, and is therefore an excellent tool for investigating polymorphism. in addition to solving or confirming crystal structures, pharmaceutical companies increasingly rely upon nmr to monitor crystallization, test samples, and investigate new formulations, especially when crystal structures can not be obtained easily. however, translating an nmr spectrum into a 3-d crystal structure is challenging and often requires computational chemical shift predictions to facilitate spectral assignment. chemical shift prediction is frequently used to confirm structures solved from powder x - ray diffraction, to identify structures consistent with the experimental nmr spectrum, to assign nmr spectra, or even to help refine crystal structures. despite its sensitivity to local crystal packing, the changes in chemical shift across different polymorphs or crystallographic environments can be subtle. in sulfanilamide, for example, key c chemical shifts vary by only 13 ppm across three polymorphs that differ primarily in their hydrogen bonding networks. in -testosterone, which has two testosterone molecules in the asymmetric unit (z = 2), most of the differences between pairs of c shifts corresponding to the two crystallographically inequivalent molecules are less than 2 ppm. the ability to discriminate among distinct crystallographic environments is one of the fundamental theoretical challenges in nmr crystallography. this is especially true when trying to identify the relevant structure(s) from a large set of candidate structures generated via crystal structure prediction techniques. for example, chemical shifts for h, n, and o nuclei can be more sensitive to changes in hydrogen bonding patterns than those for c, making those preferable to study in some cases. individual chemical shielding tensor components can also provide additional information about the crystallographic environment that is lost in the isotropic shifts. careful treatment of finite - temperature nuclear dynamics can also be important, even in the solid state. here we focus on a different strategy : can we increase discrimination among distinct crystallographic environments by improving the accuracy of the chemical shift prediction ? since the advent of the gauge - including projector augmented wave (gipaw) plane wave density functional theory (dft) method in 2001, it has become the de facto standard for chemical shift prediction in the solid state. gipaw provides high - quality chemical shifts and has been successfully employed in many nmr studies, as discussed in recent reviews. despite its successes, the statistical errors obtained with gipaw and the commonly used pbe density functional are comparable to the variations in chemical shifts that are often seen across different crystallographic environments or polymorphs. benchmark tests on gipaw pbe c chemical shifts in molecular crystals typically obtain errors around 2 ppm, for instance, which is on par with the magnitude of the chemical shift resolution needed to distinguish known crystal forms of molecules such as testosterone or sulfanilamide. reducing the errors in the predicted chemical shifts would improve discrimination in challenging nmr crystallography applications. before the widespread use of gipaw dft, molecular crystal chemical shift calculations often mimicked the crystalline environment using an individual molecule surrounded by a field of point charges or by a few key neighboring molecules. recently, there has been renewed interest in modernized versions of these sorts of methods. thanks to increased computer power and efficient algorithms for chemical shift calculations within the gauge - including atomic orbital (giao) formalism, chemical shift prediction on larger clusters of molecules can now be performed routinely. clusters consisting of 1015 molecules within a few angstroms of a molecule in the asymmetric unit mimic the effect of the extended molecular crystal lattice on the chemical shielding of the central molecule very effectively. various cluster - type models have also been employed in biological systems. when using the same density functional, the accuracy of these cluster models is competitive with gipaw for several different nuclei. however, the rapidly increasing computational cost with system size becomes a concern when computing shifts on a cluster of large molecules. fragment methods are similar to cluster models in that they treat one or more central molecules interacting with other nearby molecules in the crystal. however, they decompose those interactions into sums of contributions from small groups of molecules, or fragments. we have demonstrated that when coupled with electrostatic embedding, fragment methods allow one to predict isotropic h, c, and n chemical shieldings with accuracy similar to both cluster methods and gipaw, albeit with lower computational cost. the key advantage of these cluster and fragment methods is that they enable the practical use of a wider range of electronic structure methods for chemical shift prediction. in particular, extensive molecular crystal benchmark testing indicates that hybrid density functionals predict appreciably higher - accuracy isotropic chemical shifts for several different nuclei. in a plane wave method like gipaw, hybrid density functionals require at least an order of magnitude more computational effort than generalized gradient approximation (gga) functionals, which makes them impractical. in contrast, the computational cost premium for switching from a gga to a hybrid functional when using gaussian basis sets, as in fragment and cluster models, is only 50%. in other words, high - accuracy chemical shielding calculations are of particular interest in examining nmr shift differences between polymorphs or solvates and between crystallographically unique molecules in a given crystal, i.e., in crystals for which z is greater than one. paracetamol) and phenobarbital as well as the monohydrate and neat forms of testosterone. the differences in intramolecular conformation among the different crystal forms of each molecule are small, so much of the variation in the chemical shifts stems from differences in the (intermolecular) crystallographic environments. we find that fragment and cluster models generally predict the same c and n spectral assignments as gipaw. more significantly, we demonstrate that switching from a gga functional to a hybrid one both provides higher - accuracy chemical shifts and increases discrimination among the different crystallographic environments found in these crystal forms. finally, chemical shift referencing is always important in both experimental and theoretical studies. we demonstrate that the referencing models fitted in our previous benchmark studies are highly transferable to the crystals studied here, underscoring their suitability for broader use. fragment - based chemical shift prediction techniques have been described previously. in brief, they rely on a many - body expansion for the shielding tensor1which can be derived by differentiating the many - body expansion for the energy with respect to the nuclear magnetic moment and the external magnetic field. this expansion decomposes the shielding tensor of atom a on molecule i in the unit cell into the shielding tensor on the isolated molecule (ia) plus corrections due to the interactions of that molecule with other molecules in the crystal. the leading corrections involve pairwise interactions of molecule i with nearby molecules (ija), followed by nonadditive three - body (trimer) corrections (ijka). the pairwise correction ija is defined as the difference between the chemical shift of atom a in the dimer ij and the same atom in isolated monomer i2note that monomer j does not contain atom a, so ja = 0. the nonadditive three - body correction ijka is defined as3where all terms on the right - hand side of eq 3 which do not contain monomer i are zero. first, the two - body fragment model truncates this many - body expansion by neglecting long - range pairwise interactions and all three - body and higher terms. the two - body interactions are computed between the central molecule and any other molecule lying within a user - defined cutoff distance of the central one (typically r2bd = 6). because the neglected long - range and many - body terms involve substantial contributions from polarization, their effects can be approximately captured via electrostatic embedding. specifically, the one - body and two - body terms are calculated in a field of point charges that mimic the extended lattice. second, the cluster model performs a single supermolecular calculation on a central molecule surrounded by nearby molecules (typically those with any atom lying within 4). however, due to computational constraints that limit the overall size of the cluster, the cluster approach can miss potentially important longer - range interactions. electrostatic embedding is employed here to capture some of the polarization arising from the extended lattice. third, the combined cluster / fragment approach seeks to achieve the best of both models. it describes the local interactions (out to 4) with a cluster calculation, and longer - range interactions in a pairwise fashion (out to 6). again, electrostatic embedding is employed to approximate longer - range and missing many - body effects. fourth, fully periodic gipaw calculations make no such truncation, so should be equivalent to the many - body expansion carried out to all orders. illustration of the fragment, cluster and combined cluster / fragment models for computing nmr chemical shieldings. depicted is a cross section from the optimized acetaminophen form i molecular crystal with the crystallographically unique molecule shown in blue. the fragment model includes pairwise interactions between the central molecule and any other molecule whose atoms lie within the distance r2bd (blue sphere). the cluster model uses a cluster of molecules surrounding the central molecule, as represented by a licorice model. the cluster / fragment model combines the cluster with pairwise interactions involving other molecules in the blue sphere that are not present in the cluster. in all cases, electrostatic embedding is employed and extends well beyond the two - body cutoff region. benchmark studies on many different molecular crystals have demonstrated that, for a given density functional, the inexpensive two - body fragment model predicts h, c, and n chemical shifts on par with the cluster, cluster / fragment, and gipaw approaches. for o, many - body effects are more important, and cluster - type and gipaw models perform moderately better than the fragment approach. as noted in the introduction, fragment methods also enable the routine use of hybrid density functionals like pbe0 instead of the gga pbe, and this provides appreciable improvements in the chemical shifts. table 1 summarizes the root - mean - square (rms) errors from these benchmark studies for c and n, which are the two nuclei considered here. computationally, the two - body fragment approach is the least expensive of the four models considered here, especially for large unit cells. the computational effort scales linearly with the number of molecules in the asymmetric unit, so calculating the chemical shifts for a polymorph with two independent molecules (z = 2) requires roughly double the effort of one with z = 1. on the other hand, the computational cost is independent of the total number of molecules z in the unit cell. fragment approaches are also inherently parallel, since each fragment calculation can be performed on a separate group of processors. this allows the calculation to scale efficiently to hundreds of processors, so that chemical shifts can be obtained very quickly when sufficient processors are available (e.g., often within a few hours of wall time for the sorts of crystals described in this work). the three molecules studied here are depicted in figure 2, along with their atom numbering. room - temperature x - ray or neutron diffraction crystal structures for each polymorph were obtained from the cambridge structure database (csd). experimental solid - state nmr data under magic angle spinning (mas) conditions were taken from the literature. csd reference codes and citations to the experimental data for each crystal are given as follows : acetaminophen : form i (hxacan26), form ii (hxacan23), and form iii (hxacan29) ; phenobarbital : form ii (phbarb06) and form iii (phbarb09) ; testosterone : form (teston10) and (monohydrate) form (testom01). all c and n chemical shifts reported here are referenced relative to neat tms and external solid nh4cl, respectively. the chemical shifts were measured experimentally at room temperature for acetaminophen and phenobarbital, and at 273 k for testosterone. accordingly, testosterone might exhibit small discrepancies between the room temperature crystal structure used to predict the chemical shifts and the actual crystal structure at 273 k. the study here focuses on isotropic chemical shifts. to the best of our knowledge, chemical shielding anisotropy (csa) parameters have not been reported for most of the crystal forms studied here. they are available for form i acetaminophen, and we previously compared gipaw and fragment model predictions for those csa parameters as part of a larger benchmark study on predicting c chemical shifts. experimental crystal structures were refined using all - atom geometry optimizations with fixed room temperature unit cell parameters. using room - temperature lattice parameters mimics the effects of thermal expansion of the unit cell at finite temperatures, though it does not compensate for other finite - temperature dynamical effects. all geometry optimizations were carried out using the freely available, open - source quantum espresso software package. the pbe density functional and the d2 dispersion correction, ultrasoft pseudopotentials with a plane wave cut off of 80 ry, and a 3 3 3 monkhorst pack k - point grid were used for all geometry optimizations. we used the pseudopotentials h.pbe-rrkjus.upf, c.pbe-rrkjus.upf, n.pbe-rrkjus.upf, o.pbe-rrkjus.upf, s.pbe-n-rrkjus_psl.0.1.upf from http://www.quantum-espresso.org. structure overlays and root - mean - square deviations (rmsd) between the optimized and experimental structures are provided in supporting information. rmsd values in 15-molecule clusters are typically 0.050.15 (excluding hydrogen atoms). isotropic chemical shieldings were computed on the relaxed structures using the fragment, cluster, cluster / fragment, and gipaw techniques. for the fragment - based techniques, crystal structure fragmentation out to a 6 two - body radius from the asymmetric unit was carried out using our hybrid many - body interaction (hmbi) code. all cluster - based calculations used a 4 cluster to include many - body effects involving nearest - neighbor molecules. individual fragment shielding tensor calculations were performed using gaussian09 with the pbe0 and pbe density functionals and numerical integration grid involving 150 radial points and 974 angular lebedev points. atomic point - charges were computed for each crystal using distributed multipole analysis, and point charge embedding out to 30 was employed in all fragment and/or cluster calculations. a 6 - 311++g(2d, p) basis was used on the molecule(s) of interest, 6 - 311g(d, p) on all atoms within 4 of the central molecule, and 6 - 31 g on more distant atoms. gauge - including projector augmented wave (gipaw) chemical shielding calculations were performed using castep with the pbe functional, ultrasoft pseudopotentials generated on - the - fly and an 850 ev (62.5 ry) plane wave basis set cut off. electronic k - points were sampled on a monkhorst pack grid to give a maximum separation between k - points of 0.05. the basis set cut off and k - point density were chosen based on previous testing to converge relative chemical shifts to better than 0.01 ppm. full space - group symmetry was used in all gipaw calculations. for consistency with the other calculations reported here, the same quantum espresso - optimized crystal structures were used in the castep calculations without further relaxation. we previously found that gipaw chemical shifts obtained from crystal geometries optimized with either quantum espresso or castep differ by less than 0.1 ppm in root - mean - square error relative to experiment for a set of 169 c isotropic chemical shifts. experimentally observed isotropic chemical shifts are reported relative to a reference compound. therefore, the computed absolute isotropic shieldings must be appropriately referenced to compare with the experimental values. although numerous techniques exist for referencing the predicted shifts, one particularly useful method uses a linear regression model of the form4where a and b are obtained via a linear least - squares fit between calculated shieldings and experimental shifts. in the absence of systematic error, slope a would take a value of 1, and slope b would represent the absolute shielding of the reference compound. allowing a to deviate from 1 systematic errors can arise from, for example, basis set incompleteness, limitations of the approximate density functionals used, and from the neglect of nuclear dynamics, zero - point vibrational energy, and other nuclear quantum effects. the linear regression parameters used for c and n here were obtained from our recent benchmark study of 25 crystals/169 c isotropic shifts and 24 crystals/51 n isotropic shifts. note that form i acetaminophen was included in the c benchmark data set, but none of the other polymorphs studied in the current work were present in the training set upon which the linear regressions were fitted. the specific regression parameters used for each nucleus type and each of the four theoretical models are listed in table 2. two statistical metrics are used here to assess the quality of the predicted shifts. the second is a reduced -squared analysis,, which provides a measure of how consistent the errors observed for a given set of predicted shifts are with the expected distribution of errors. the is computed as5where n is the number of isotropic shifts, ipred is the predicted chemical shift, iexpt is the experimentally observed chemical shift, and rms is the width of the expected error distribution. here, the rms for each model / nucleus type is given by the rms errors for the benchmark test sets summarized in table 1. smaller values indicate that the errors for a given system are more consistent with the errors one expects based on the benchmark sets. those benchmark error distributions are roughly gaussian, albeit with longer tails (i.e., large errors occur more frequently than one would expect for an ideal normal distribution). this means that larger values are moderately more probable than one would typically expect, but they still provide a useful metric for comparing different potential assignments. in many ways, the differences in values for different potential assignments are more important than the values themselves. in several cases discussed later in this work, the values computed with pbe are smaller than those from pbe0, even though the pbe rms errors are larger than the pbe0 ones. this simply reflects the larger uncertainty (rms) expected for pbe than for pbe0 based on the benchmark sets. accordingly, larger errors are more likely to occur when using pbe on the systems here, and they therefore do not skew the pbe values as much. on the other hand, the differences among values computed with a given method for different shift assignments indicate the ability of that method to discriminate between correct and incorrect assignments. this is an important consideration when using nmr for validation of proposed crystal structures. to investigate this, we evaluate summed over all crystal forms of each molecule for the correct assignment of measured chemical shifts to the monomers in each structure, as well as for all possible permutations where the observed chemical shifts are assigned to the incorrect monomers. these differences in will be the primary focus of the discussion of the results. for each of the three chemical systems examined here, we compare the performance of gipaw and the two - body fragment model with the pbe density functional to check for the similarity between gipaw and fragment predictions. then we investigate how the quality of the predictions changes upon switching to the pbe0 functional using the two - body fragment, cluster, and cluster / fragment models. the ability of each method to discriminate between correct and incorrect assignments of the measured chemical shifts to the known crystal structures paracetamol) is a widely used, over - the - counter pain reliever and fever reducing agent which adopts three known crystal polymorphs (forms i, ii, and iii). the solid state versatility of acetaminophen serves as an excellent example of how crystal packing impacts the drug manufacturing process. form i is easily isolated and is characterized by puckered hydrogen - bonded sheets (see figure 3a). this packing configuration inhibits shearing, which in turn impacts the compressibility of the solid and the tableting process. on the other hand, form ii is more difficult to isolate and consists of flat hydrogen - bonded sheets which are more amenable to direct compression (figure 3b). form iii, with two molecules in the asymmetric unit, consists of alternating layers of symmetrically independent, flat two - dimensional sheets (figure 3c). historically, form iii has been much more difficult to obtain, and its structure was solved only in 2009. the intramolecular acetaminophen geometries are very similar across all four crystallographically unique molecules which occur in the three polymorphs, with only subtle variations in the hydroxyl and methyl groups. structure overlays among the four monomers (figure 4a) find root - mean - square deviations (rmsd) of only 0.070.19 for the non - hydrogen atoms. the two monomers in form iii are the most similar (rmsd 0.07), followed by form i and form ii (rmsd 0.09). accordingly, much of the variation in the observed nmr chemical shifts across the different polymorphs stems from differences in the crystallographic environment, rather than changes in the intramolecular geometry. see supporting information for a more detailed discussion of intra- versus intermolecular contributions to the chemical shielding in these systems. optimized acetaminophen crystal structures for (a) form i showing puckered hydrogen - bonded sheets, (b) form ii showing flat hydrogen - bonded sheets, and (c) form iii with two independent flat hydrogen - bonded sheets (colored red and green) which are similar to the sheets found in form ii. (a) acetaminophen : forms i (red), ii (blue), iiia (green), and iiib (purple). (b) phenobarbital : forms iia (red), iib (blue), iic (green), and iii (purple). (c) testosterone : u (red), v (blue), and (green). the literature contains multiple sets of c shifts for form i. data from ref (80) is used here because it includes c and n chemical shifts for all three forms. with revised referencing, the form i c shifts from ref (80) are consistently 0.30.4 ppm lower in frequency than the more recent ones reported by harper. similarly, the re - referenced values for the form i n isotropic shift from ref (80) agree with a more recent study to within 0.1 ppm. figure 5 compares the experimental and predicted c isotropic chemical shifts using (a) fragment pbe0 or (b) gipaw pbe for the three acetaminophen polymorphs. both models predict chemical shifts in good agreement with the experimental spectra. to our knowledge, the experimental structure of form iii solved via crystal structure prediction and powder x - ray diffraction has not been validated against the nmr spectrum. the consistency between the predicted and experimental spectra here provides additional support for this structure. overlay of experimental acetaminophen spectra and predicted shifts (in red) for (a) the two - body fragment pbe0 calculations and (b) gipaw pbe calculations. the c8 methyl peak at 23 ppm is not shown. because they arise largely from differences in intermolecular packing, the variations in experimental c shifts among the three polymorphs are often subtle. for instance, the minor differences in the hydrogen bonding to oxygen or nitrogen atoms between polymorphs lead to differences in c chemical shifts (c1, c4, and c7) of only 1 ppm. nevertheless, the individual peak assignments suggested by both two - body pbe0 and gipaw pbe are very similar. both reproduce the general trends in peak positions across the three polymorphs. the main difference between the two models occurs for the c3/c5 peaks near 115118 ppm in all three structures. the differences in chemical shift among these peaks is 1 ppm or less in each polymorph. interestingly, both two - body pbe and two - body pbe0 predict c5 at lower frequency than c3, while the cluster, cluster / fragment, and gipaw results predict the opposite ordering (see table s1). in other words, the ordering of these two resonances appears to be sensitive to many - body effects. a recent h / c heteronuclear correlation and c shielding tensor study on form i suggests the gipaw and cluster - based model assignment is correct for form i, and it is used throughout this work. for the sake of computing rms errors below, we assume the gipaw and cluster - based model assignment of c3/c5 is correct for form ii as well, though this is uncertain. in form iii, the ordering of c2 and c6 in form ii shows similar disagreement between the two - body models versus the cluster and gipaw results. in this case, the predicted difference in shifts between the two atoms is even smaller, at 0.5 ppm or less, while the two experimental shifts are unresolved. in all of these cases where the models disagree on the shift ordering, the differences in chemical shift between the resonances are small compared to the benchmark c rms errors (table 1). in other words, such differences probably can not be resolved with confidence with either gipaw or fragment methods. overall, the rms error across all 24 c chemical shifts is 2.0 ppm for gipaw / pbe and 1.9 ppm for two - body pbe. fragment, cluster, and cluster / fragment methods using the pbe0 hybrid functional nearly halve the overall rms error to 1.11.2 ppm (figure 6). reduced analysis using (a) c or (b) c and n isotropic shifts for the 24 possible acetaminophen polymorph assignments using fragment, cluster, and cluster / fragment methods. the best assignment (i, ii, iiia, iiib) is shown in red, while the blue line indicates the assignment that swaps the two monomers in form iii. the c rms errors (in ppm) for the best assignment with each model are reported near the bottom of (a). all the theoretical methods predict the shifts to occur at too high of chemical shifts compared to experiment. the largest errors versus experiment occur with gipaw pbe (rmse 7.5 ppm), while the two - body fragment pbe0 model gives the best agreement (rmse 3.6 ppm). interestingly, all the models tested here predict that the form i nitrogen shift should lie at lower chemical shift than the form iiia one, contrary to the experimental results. of course, all four experimental shifts span only 3.3 ppm, which is small relative to the 46 ppm rms errors found in the nitrogen benchmarks (table 1). comparison of the predicted and experimental n isotropic chemical shifts for the three polymorphs of acetaminophen. while the good agreement between predicted and experimentally observed chemical shifts is valuable, a more challenging question is to what extent can the chemical shift predictions discriminate among the different crystallographic environments of the acetaminophen molecules found in the various polymorphs ? the three polymorphs provide a total of four crystallographically unique molecules : forms i and ii each contribute one and form iii contributes two. there are 24 possible ways one can assign the predicted shifts from these four crystallographically unique molecules to the experimental shifts (assuming the carbon atom assignments within the monomer are fixed according to the discussion above). figure 6 illustrates the reduced values for each of the 24 possible assignments using either the c isotropic shifts or both the c and n isotropic shifts as computed with the various different models. first, the experimental assignment of the two inequivalent monomers in form iii is unknown, but all five models considered predict the same assignment to have the smallest values (i, ii, iiia, iiib in figure 6). however, the methods can not clearly distinguish this monomer assignment from the one that swaps the two monomers in form iii. the difficulty distinguishing these crystallographically unique monomers in form iii is unsurprising, since the two molecules adopt nearly identical intramolecular geometries (rmsd 0.07) and are in very similar crystallographic environments, which results in overlap of most of the c shifts. only the pair of peaks corresponding to c4 are clearly resolved in the experimental spectrum, and those two resonances are separated by only 1 ppm. we also note that, despite the geometric similarity of the hydrogen bonded layers in polymorphs ii and iii, the methods all effectively discriminate between the molecular environments in those two polymorphs : increases significantly if the set of shifts for either monomer in form iii is swapped with those of form ii. although the molecules in forms i and ii adopt very similar intramolecular conformations, their c spectra are comparatively easy to distinguish (particularly near 120 ppm) due to the appreciable differences in the crystallographic environments. second, although the rms errors with pbe are almost twice as large as those from pbe0, the pbe values tend to be smaller than those from pbe0. this reflects the fact pbe exhibits broader error distributions than pbe0 in the benchmark sets, which leads to a larger denominator in eq 5. a more useful interpretation of these plots focuses on the resolution between different crystallographic environments. the hybrid pbe0 functional provides increased separation among the values for different potential assignments, which corresponds to increased discrimination among the different crystallographic environments. interestingly, the more expensive combined cluster / fragment pbe0 mode exhibits marginally smaller rms errors than the fragment pbe0 model, but it provides no additional discrimination among the monomer assignments. third, combining both c and n shift predictions (figure 6b) does not appreciably alter the discrimination among the different potential assignments relative to the c - only data (figure 6a). as noted above, the 3 ppm variations among the four unique n shifts are smaller than the 46 ppm errors expected from the n benchmark set, so the analysis does not readily discriminate among the different potential n shift assignments in acetaminophen. the low discriminatory power of n compared to c shifts is unsurprising given the nature of the structural differences between the three polymorphs : the hydrogen bonding environment around the nitrogen atom in each polymorph is nearly the same in each structure, while the differences in the geometry of the layers and the way that these layers are packed has a much stronger influence on the crystalline environments of the carbon atoms (and hence the c shifts). phenobarbital (5-ethyl-5-phenyl-2,4,6(1h,3h,5h)-pyrimidine - trione) is a widely administered barbiturate and has been in clinical use for close to a century. with 12 polymorphs reported in the literature to date, only a few of which have been structurally characterized, phenobarbital makes a particularly interesting test - case for assessing the accuracy of nmr chemical shielding calculations. in the present work, we examine polymorph ii (z = 3) and iii (z = 1), for which experimental x - ray crystal structures, c, and n nmr isotropic chemical shifts have been reported. phenobarbital is more flexible than acetaminophen, which leads to two slightly different intramolecular conformations among the four crystallographically unique monomers found in these two polymorphs. the conformation of molecules iia and iib is very similar (rmsd 0.12), as is the conformation for molecules iic and iii (rmsd 0.08). however, these two pairs differ from each other by 0.280.36 in rmsd, due primarily to differences in the dihedral angles among the moieties surrounding the quaternary carbon. despite these modest differences in intramolecular conformation, much of the chemical shielding variation stems from intermolecular interactions (see supporting information), particularly the hydrogen bonding patterns (figure 8). the same chains are formed by monomers a and c in polymorph ii (blue and red molecules in figure 8a). the third crystallographically unique molecule b in form ii hydrogen bonds to monomer a, connecting the chains into a two - dimensional motif. (a) two hydrogen bonding motifs in phenobarbital form ii colored according to symmetry equivalency. (b) depiction of the linear chain hydrogen - bonding motif in form iii. the similarities between the linear hydrogen - bonded chains and intramolecular conformation manifests in similar experimental isotropic c chemical shieldings, provided in table 3. the experimental chemical shifts for the carbonyl carbons (c6 and c7) which are involved in hydrogen bonding in form ii monomer c and form iii differ by 1 ppm or less, while the same shifts on form ii monomers a and b differ from the c ones by 3 ppm. the c4/c6 signal for form ii molecule a exhibits the highest frequency chemical shift and displays the greatest degree of hydrogen bonding, having both strong hydrogen bonds (blue linear chain in figure 8) and weaker hydrogen bonds to molecule b. molecule b, on the other hand, which has no hydrogen bonds at c4 or c6, exhibits the lowest - frequency chemical shifts. table 3 provides the predicted isotropic c chemical shifts using a two - body fragment model with pbe0 for each crystallographically unique molecule in phenobarbital forms ii and iii, and the results from gipaw pbe and two - body fragment pbe0 are plotted in figure 9. complete predicted shieldings for the other computational methods used in this study are provided in table s2 of the supporting information. the carbon atoms in table 3 are labeled using the same convention used by abraham. designating ring carbons which are in closer proximity to the adjacent ring as edge. this data clearly shows that both trends regarding the impact of hydrogen bonding on the chemical shifts mentioned above are faithfully reproduced at the fragment level. the overall rms errors for fragment pbe0 are a couple tenths of a ppm smaller than those from either fragment pbe or gipaw pbe (1.5 vs 1.7 ppm). comparison between experimental and predicted c chemical shifts for forms ii and iii phenobarbital using either the (a) two - body fragment pbe0 or (b) gipaw pbe models. for convenience, shift assignments are based on those inferred from gipaw in ref (19), though those have not been confirmed experimentally. the gipaw / pbe calculations performed in this study, the fragment pbe0 calculations, and the cluster / fragment pbe0 calculations largely support the previously reported gipaw pbe assignments. there are some exceptions in the 129.7133.7 ppm range of the form ii spectrum, where peaks for eight distinct carbons appear. however, the ordering discrepancies typically involve closely spaced peaks where one would not necessarily expect the theoretical predictions to discriminate reliably. more notable, however, is one significant discrepancy at the fragment pbe0 level. fragment pbe0 reverses the gipaw pbe assignment of the resonances for c2 from monomer iia and c9 from monomer iic. while the true assignment here is uncertain, the cluster / fragment pbe0 model agrees with gipaw pbe assignment. therefore, it seems likely that the two - body fragment pbe0 model is in error in this case. this result hints that further refinements to the electrostatic embedding model might be useful for improving the approximate treatment of many - body effects in the two - body model. assignment of the n spectra is unambiguous with all of the different models (see table s2). however, table 4 illustrates a significant improvement in the agreement between the predicted and experimental shifts when using the hybrid pbe0 functional instead of pbe. the rms errors associated with both gipaw and fragment - based calculations using pbe are 99.5 ppm, compared to 5.56 ppm with the pbe0 models. comparison of individual n shifts computed with gipaw pbe and fragment pbe0 is plotted in figure 10. the fragment pbe0 model provides better agreement with the specific shift values and the relative shift differences. comparison between experimental and predicted n chemical shifts for forms ii and iii phenobarbital using either the (a) two - body fragment pbe0 or (b) gipaw pbe models. finally, figure 11 illustrates the for each of the possible permutations for assigning the four phenobarbital monomers in these two polymorphs to the four sets of chemical shifts. the correct assignment (shown in red) has the lowest for every model. the most difficult discrimination (shown in blue) involves interchanging the molecules iic and iii, which have very similar intramolecular conformations and the same intermolecular hydrogen bonding motif. each model identifies this incorrect assignment as having a larger, but the magnitude of the resolution is greater using the pbe0 fragment approach (see separation between red and blue lines in figure 11a). in addition, the overall c rms error (bottom of figure 11a) is close to 0.2 ppm smaller using the hybrid density functional. all other incorrect assignments interchange molecules with different hydrogen bonding and lead to a larger increase in. for example, molecule iia forms the same hydrogen bonded chains, but it also hydrogen bonds to iib and has a slightly different intramolecular conformation, making it easier to distinguish. reduced analysis for phenobarbital using either (a) c isotropic shifts or (b) both c and n isotropic chemical shifts. the red lines correspond to the correct assignment, while the blue lines swap the assignment of monomer c in form ii with the form iii monomer. gray lines correspond to other possible assignments. like the acetaminophen case, including n isotropic shielding data in the analysis (figure 11b) here does not significantly improve the resolution between the different possible assignments. assignment of the two nitrogens within a given phenobarbital monomer is unambiguous from the calculations (see figure 10). incorrect assignments between the polymorphs introduce errors of only 23 ppm, which is small relative to the errors expected for n. accordingly, the nitrogen shifts contribute little to the overall values. nevertheless, with or without inclusion of the n shift data, the fragment pbe0 shows roughly a 2-fold improvement in the resolution between the correct and incorrect structures over gipaw pbe. the results for acetaminophen and phenobarbital demonstrate that the chemical shift calculations are able to distinguish correct and incorrect assignments of c spectra, despite strong similarities in hydrogen bonding arrangements between polymorphs. another important situation is the distinction between neat and hydrate crystal forms, which we illustrate with the crystal forms of testosterone. two crystal forms of testosterone have been investigated using both cross - polarization mas and two - dimensional carbon the form contains two crystallographically distinct molecules in the asymmetric unit (denoted u and v), while the monohydrate contains one testosterone molecule and one water in the asymmetric unit (figure 12). the intramolecular conformation is very similar in all three crystallographically unique molecules, with molecular structure overlay root - mean - square deviations of 0.050.06 for the non - hydrogen atoms (figure 4c). the only major conformational difference is seen in the hydroxyl orientation between u and the conformation in v and, which affects the environment of c17. accordingly, variations in the chemical shifts stem primarily from differences in the crystallographic environments of the three monomers (see supporting information for more details). the presence of 19 unique carbon atoms in each testosterone molecule in the form gives rise to a congested solid - state c nmr spectrum with numerous closely spaced peaks, especially in the 3040 ppm region (see figure 13). the assignment of each doublet of peaks to molecules u and v is particularly challenging. structures showing the hydrogen bonding patters in the (a) and (b) forms of testosterone. comparison of experimental and predicted c chemical shifts in the low - frequency region for -testosterone using either (a) two - body fragment pbe0 or (b) gipaw pbe. shifts from molecule u and v are indicated in red or blue, respectively. were able to assign most of the c resonances through the use of two - dimensional inadequate carbon. however, the experiments alone did not allow unambiguous assignment of the shifts for c3 and c4 to molecules u and v. instead, they used gipaw pbe calculations on the experimentally determined crystal structures (with only hydrogen atom positions relaxed) to predict the chemical shifts for this system and make tentative assignments for each of these two sets of carbon shifts. in addition, the u / v assignments of c7, c13, and c16 are suggested by the experiments, although not definitive. finally, the experimental difference in chemical shift for c15 in molecules u and v is extremely small and might be interchanged. table s3 in the supporting information lists the carbon assignments from ref (17). the large number of chemical shifts in a small region of the spectrum make testosterone an excellent system for assessing the performance of cluster and fragment - based nmr chemical shielding calculations. figure 13 compares the predicted and experimental c chemical shifts for -testosterone in the low - frequency region for two - body fragment pbe0 and gipaw pbe. qualitatively, the gipaw pbe calculations underestimate many of the chemical shifts in this region, while the fragment pbe0 shifts show improved agreement with experiment. overall, the pbe0 fragment - based models reduce the rms error for the and forms to around 1.92.1 ppm, compared to 3.3 ppm with pbe (figure 15). most individual c chemical shifts are reproduced to within a few ppm (table s3), with the notable exception of c5. in the earlier gipaw pbe work by harris., this shift was overestimated by 1114 ppm, which they attributed to a possible artifact of having relaxed only the hydrogen atoms in the crystal structure. however, even with our structures in which all atomic coordinates were relaxed with pbe - d2, c5 still exhibits errors of 11 ppm in the form and 7.4 ppm in the form at the gipaw pbe level (table 5). switching to the pbe0 functional improves the results moderately, but the errors remain 58.5 ppm. the reasons for these unusually large errors are unclear, but they may indicate the importance of dynamics, temperature (the crystal structure was determined at room temperature, while the nmr was measured at 273 k), or some other issue with the crystal structure. figure 14 plots the chemical shift differences between the shifts for molecules u and v. gipaw pbe, fragment pbe0, and cluster / fragment pbe0 are generally in qualitative agreement with experiment. all three models predict the same assignments for the doublets ascribed to c3, c4, and c16. for c7 and c13, fragment pbe0 predicts the opposite sign for the chemical shift difference than either gipaw pbe or cluster / fragment pbe0. however, in both cases, the magnitude of the experimental shift differences are only 0.10.2 ppm, and the discrepancies among the predictions are less than 1 ppm. for c15, all the theoretical predictions suggest the opposite sign of chemical shift difference from the one inferred experimentally, which suggests that perhaps the experimental assignment should be reversed. of course, the small chemical shift differences associated with all of these discrepancies between the models are probably below the threshold of significance, based on the 1.52.2 ppm errors expected for these models from earlier benchmark tests. comparison of the differences between the chemical shifts for atoms in molecules u and v in -testosterone, according to prediction and experiment. atoms discussed in the text are highlighted. finally, we investigate the ability of the models to discriminate among the different crystallographic environments for the three unique monomers in the two crystal structures (using the atom assignments from ref (17)). six different ways of assigning the three structures to the three sets of isotropic shifts exist. figure 15 demonstrates that all four computational methods produce the smallest rms errors and reduced for the assignment that is consistent with the earlier work by harris., despite the strong similarities in the intramolecular testosterone geometries (see figure 12c). due to the anomalously large errors for c5, the smallest values for testosterone are roughly double the corresponding values for acetaminophen and phenobarbital nevertheless, using the hybrid pbe0 functional instead of pbe both lowers the rms error from 3.3 ppm to 1.92.1 ppm and modestly increases the resolution between the correct and incorrect monomer environment assignments (e.g., compare fragment pbe0 vs fragment pbe or gipaw pbe). reduced analysis for the monomer assignments in the and forms of testosterone. the blue line swaps molecules u and, while the green line swaps molecules u and v. the work here is predicated on the transferability of previously determined linear regression models for scaling the chemical shieldings computed in the systems here. as mentioned above, the earlier c regression model was fitted to data from 25 crystals and 169 isotropic shifts, while the nitrogen line was fitted to 24 crystals and 51 isotropic shifts. the resulting linear regression parameters were previously shown to be highly robust with respect to the specific composition of the test set through statistical cross - validation. to test this robustness further, we investigate the consistency between the chemical shieldings computed for the systems here and those from our previous work. as an example, figure 16 illustrates the previously published fragment pbe0 regression lines (in blue) along with the predicted c and n isotropic shieldings for the crystals in the present study (shown in red). note that acetaminophen form i was included in the original c regression (8 out of the 169 shifts), but none of the other crystal forms considered here were used in fitting the regression models. figure 16 demonstrates that the predicted c shieldings for each of the polymorphs in this study are in excellent agreement with the earlier regression model. the n regression line overestimates the 12 experimental n chemical shifts considered here, particularly for the 8 phenobarbital ones (calculated shieldings in the 7085 ppm range). these 8 shifts all involve functionally similar nitrogen atoms (nh groups bonded to a carbonyl and hydrogen - bonded to oxygen atoms), so the similar behavior observed for all of them is perhaps not too surprising. the regression line was fitted to a fairly diverse set of nitrogen atoms, but certain classes of nitrogen atoms do exhibit systematic errors. we previously noted the systematic overestimation of the shifts for sp2-hybridized nitrogen atoms hydrogen bonded to carboyxl groups, for instance. the neglect of dynamics and/or nuclear quantum effects association with the hydrogen - bonding could be a factor contributing to these systematic errors. nevertheless, the predictions still fall within 2 standard deviations (shaded region in figure 16) of the data from the original benchmark set. comparison between the shielding regression line from ref (78) (in blue) and the chemical shifts predicted here (in red) for (a) the c isotropic shieldings and (b) the n isotropic shieldings. the blue - shaded region indicates plus or minus two standard deviations in the errors from the ref (78) benchmarks. next, table 6 compares both the linear regression parameters and the rms errors for three different choices in fitting set : (1) regression parameters from the previously reported c test set with the acetaminophen form i shifts removed (24 crystals/161 shifts) ; (2) regression parameters fitted to only the c isotropic shift data from the polymorphic crystals studied in the present work (7 crystals/137 shifts) ; and (3) regression parameters for the union of both data sets (31 crystals/298 shifts). for the fragment - based pbe0 model, the overall rms errors on the polymorphic crystals considered here vary by less than 0.2 ppm across the three different sets, and the linear regression parameters vary only slightly (table 6). the gipaw rms errors and regression parameters exhibit slightly larger variability across the three different training sets (e.g., rms error variations of 0.4 ppm), but such deviations are well within the larger 22.5 ppm errors inherent in the model. these results provide strong support for the transferability of the regression parameters developed in ref (78) previously and used here. reported slopes and intercepts were fitted using (1) only the previously published benchmark test set shifts (excluding form i acetaminophen from the c test set), (2) only the polymorph shifts from this work, or (3) the combination of both the benchmark and polymorph shifts. the rms errors are reported for the polymorphic crystal c and n isotropic shifts in the polymorphic crystals studied in this work. the same three fitting scenarios were considered for n. fitting directly to the 12 n shifts here reduces the errors dramatically, down to 0.7 ppm with fragment pbe0. this could suggest problems in describing the nitrogen environments present in these molecules that are corrected in the direct fit, or perhaps some issues in the experimental shift referencing (particularly for phenobarbital). of course, dynamics can also play an important role, and deviations from a unit slope might also result from neglecting those effects. because the n benchmark set contains only 51 shifts, adding the dozen more shifts with a systematic error from this study does modestly alter the regression line and improves the errors for these 12 shifts by about 1 ppm at the fragment pbe0 level. nevertheless, because including so many nitrogen shifts from only two systems might overly bias the overall test set, we continue to advocate use of the original regression line from ref (78). qualitatively similar behavior is observed for n with gipaw pbe, but the regression lines and rms errors exhibit even higher sensitivity to the composition of the fitting set. in conclusion, the relative performance of gipaw, fragment, cluster, and combined cluster / fragment models for predicted c and n isotropic chemical shieldings has been assessed in several different polymorphic crystal systems. consistent with our recent benchmark studies, the hybrid pbe0 density functional provides higher - accuracy chemical shifts than the gga functional pbe. more importantly, this improved accuracy stemming from the use of a hybrid density functional provides increased discrimination among different crystallographic environments, which is an essential ingredient in nmr crystallography studies. the chemical shift prediction methods are able to reliably distinguish between the monomers in different crystal structures, even when the strong intermolecular interactions are nearly identical in the various structures. the two - body and gipaw methods generally agree on the assignments for individual isotropic c chemical shift assignments. in the handful of cases where the two models disagreed, the differences in chemical shifts were usually (but not always) 1 ppm or less, which is below the resolving power of the models. in those cases, switching to a cluster or cluster / fragment model produced assignments that are fully consistent with the gipaw ones, suggesting that these minor discrepancies result from the simplified description of many - body effects in the two - body fragment model. so, despite the successes of the two - body fragment model demonstrated here, there may be room for refining the electrostatic embedding treatment further to improve the approximate treatment of many - body effects. finally, we demonstrated that the linear regression parameters for scaling chemical shieldings to chemical shifts which were developed in our previous benchmark study are transferable to the systems studied here, which bodes well for their widespread application. in the examples studied here, c isotropic chemical shifts were sufficient to discriminate among the different crystal structures, but this is not always the case. in the future, it will be interesting to apply these fragment chemical shift prediction techniques to structure determination problems through their combination with crystal structure prediction techniques, where pbe gipaw c shifts alone have previously proved insufficient for identifying the correct structures.
|
chemical shift prediction plays an important role in the determination or validation of crystal structures with solid - state nuclear magnetic resonance (nmr) spectroscopy. one of the fundamental theoretical challenges lies in discriminating variations in chemical shifts resulting from different crystallographic environments. fragment - based electronic structure methods provide an alternative to the widely used plane wave gauge - including projector augmented wave (gipaw) density functional technique for chemical shift prediction. fragment methods allow hybrid density functionals to be employed routinely in chemical shift prediction, and we have recently demonstrated appreciable improvements in the accuracy of the predicted shifts when using the hybrid pbe0 functional instead of generalized gradient approximation (gga) functionals like pbe. here, we investigate the solid - state 13c and 15n nmr spectra for multiple crystal forms of acetaminophen, phenobarbital, and testosterone. we demonstrate that the use of the hybrid density functional instead of a gga provides both higher accuracy in the chemical shifts and increased discrimination among the different crystallographic environments. finally, these results also provide compelling evidence for the transferability of the linear regression parameters mapping predicted chemical shieldings to chemical shifts that were derived in an earlier study.
|
the millennium development goals, adopted in new york in 2000, promote universal education and gender equality, maternal and child health, and prevention and treatment for hiv / aids. worldwide, as many as one - third of the 357,000 annual maternal deaths are attributable to unintended pregnancies ; the majority of these mortalities occur in low- and middle - income countries [36 ]. enhanced access to family planning services in sub - saharan africa would result in marked reductions in unintended pregnancies and unsafe abortions and a projected 69% decrease in maternal deaths and a 57% decrease in newborn deaths. in addition to substantial risks of dying from pregnancy complications, women in a sub - saharan africa are also at increased risk of hiv and other sexually transmitted infections [8, 9 ]. providing safe, effective contraception to hiv - infected women who desire it has also been identified by the world health organization as a primary strategy for prevention of pediatric infections. in zambia, as in many other sub - saharan african countries, hiv - infected women of childbearing age represent a vulnerable population. the burden of stis is high among hiv - infected pregnant women in this setting. additionally, only 2040% of hiv - infected zambian couples, whether serodiscordant or concordant, report use of a modern contraceptive method other than condoms [12, 13 ]. public health programs that emphasize dual family planning methods highly effective modern contraception coupled with condom use will ensure protection from both unintended pregnancy, and stis, and should form the cornerstone of reproductive health care. in hiv care and treatment programs, medication adherence counseling provides a unique window of opportunity to address preventive health recommendations, including family planning and sti prevention. in this paper, we describe implementation of an integrated, reproductive health peer counselor program in 16 public - sector hiv clinics in lusaka, zambia. we also report (1) baseline modern contraceptive and dual method use among hiv - infected women receiving antiretroviral treatment, (2) uptake of modern contraceptive and dual methods following peer counseling, and (3) predictors of modern contraceptive and dual method use among hiv - infected women. the hiv prevalence rate among pregnant women is 21%, and the majority of women infected with hiv are of reproductive age. the ministry of health 's art program was established in 2004 and covers the entire city. over 100,000 hiv - infected individuals in lusaka are now receiving care in this system. due to the large volumes of patients and human resource shortages, peer educators conduct most art counseling sessions. prior to our intervention, neither routine family planning nor dual method counseling was provided during peer counseling sessions. to expand the scope and effectiveness of these counseling visits, we designed and implemented a reproductive health peer counselor program integrated within 16 primary care hiv clinics in lusaka. we trained 109 peer counselors to deliver a standardized counseling message, emphasizing dual methods. the counseling intervention was implemented within the context of routine clinical care. with the aid of a printed counseling tool, peer educators delivered a comprehensive reproductive health message, including information on the range of barrier methods, hormonal and intrauterine contraception, and permanent sterilization. women who desired access to reproductive health services were referred to a separate, on - site family planning department. in order to support public - sector reproductive health service provision training was based on the national family planning curriculum and nurses who successfully completed both a classroom - based course and a mentored, clinical practicum - received certification. public - sector family planning clinics provided condoms, oral contraceptive pills (ocps), depot medroxyprogesterone acetate (dmpa), jadelle levonorgestrel implants, and copper intrauterine devices (iuds). women who wished to undergo permanent sterilization were referred to a center with surgical facilities, such as the university teaching hospital. our analysis cohort included hiv - infected women aged 1650 years and on art at one of the 16 intervention clinics. to be eligible, a woman had to have at least one reproductive health counseling visit documented in her medical record between november 2009 and november 2010. we report baseline sociodemographic data, cd4 cell count (cells / ul), hemoglobin level (g / dl), and history of tuberculosis. peer counselors collected data relating to reproductive health counseling and contraceptive use on a clinical form developed for the project. we considered condoms, ocps, dmpa, jadelle, iuds, and sterilization as modern contraception. dual method use was defined as use of condoms to prevent stis coupled with use of a short- or long - term reversible contraceptive or sterilization. univariate and multivariate regression analyses were used to identify sociodemographic and other predictors independently associated with modern contraceptive and dual method use, as well as with access to family planning services within 90 days of a counseling visit. crude odds ratios (ors) and 95% confidence intervals (cis) were computed using logistic regression models. adjusted odds ratios (aors) and their corresponding 95% cis were generated using generalized estimating equations to account for clustering at the site level. all statistical analyses were performed using sas version 9.1.3 (sas institute inc, cary, north carolina). ethical approval for this study was obtained from the university of zambia biomedical research ethics committee (lusaka, zambia) and the university of alabama at birmingham institutional review board (birmingham, al, usa). between november 2009 and november 2010, 32,998 women had a least one clinic visit at a site where the counseling program had been implemented. project staffing levels had been calculated on an estimated 20,000 clinical visits during the one - year implementation period. therefore, for logistic reasons, not all women accessing hiv treatment services at participating clinics received reproductive health counseling. over the study period, documented reproductive health counseling visits were available for 18,407 (55.8%) hiv - infected women. baseline characteristics of women who completed at least one counseling visit compared with those who did not receive reproductive health counseling are detailed in table 1. with the exception of median cd4 cell count and median treatment duration, differences between women who received the counseling intervention and at enrolment, the median age was 34.6 years (iqr : 29.939.7 years), 60.1% of women were married, 87.4% had one or more living children, and 39.2% had completed some secondary education. 63.0% of women reported their monthly income as 200,000 zambian kwacha (approximately $ 45). the median cd4 cell count was 394 cells / ul (iqr : 256558 cells / ul), and the median hemoglobin level was 12.4 g / dl (iqr : 11.313.4 g / dl). less than half (42.5%) of the women in our cohort had disclosed their serostatus to a partner. furthermore, most women (77.1%) did not know or did not provide information about their partner 's hiv status at the time of enrollment into care. of the 18,407 women included in the analysis, 10,904 (59.2%) reported current use of a modern contraceptive method : 73.5% of women reported condom use, 9.9% dmpa use, 6.7% ocp use, 5.4% levonorgestrel implant use, 3.4% iud use, and 1.1% had undergone permanent sterilization (figure 1). among the 10,904 women who reported use of a modern contraceptive method at their counseling visit, 1,927 (17.7%) stated that they used dual methods for both pregnancy and sti prevention. of the 7,503 (40.8%) women in our cohort not using modern contraception, 737 (9.8%) women desired contraception after counseling and 71 stated an intention to use dual methods. 454 of 737 (61.6%) women who desired contraception successfully accessed family planning services within 90 days of their counseling visit. our data, therefore, indicate that nearly 40% of women who desired reproductive health services were unable to access public - sector services (i.e., free from point - of - service user fees). this represents substantial unmet contraceptive need within lusaka 's public health system. in univariate analysis, age was the only factor associated with successful access to contraceptive services within 90 days of a counseling visit. in multivariate analysis, women 2534 years (aor : 0.53 ; 95% ci : 0.300.92) or 35 years (aor : 0.49 ; 95% ci : 0.251.00) had lower odds of accessing contraceptive services than women 1624 years. women who reported a higher monthly income also had lower odds of accessing contraceptive services than women who were less wealthy (aor : 0.68 ; 95% ci : 0.470.98). by contrast, multiparae were more likely to access reproductive health services within 90 days than women with no living children (aor : 1.83 ; 95% ci : 1.172.88). in univariate analysis, women were less likely to report modern contraceptive use if 35 years, single, divorced, or widowed, with undisclosed hiv status, and if their partner 's hiv status was unknown (table 2). conversely, women 2534 years with one or more living children, those reporting higher monthly incomes, those with cd4 cell counts 250 cells / ul or hemoglobin levels 8.1 g / dl, and those without a history of tuberculosis infection had increased odds of contraceptive use. in multivariate analysis, age, marital status, hiv status disclosure, parity, cd4 cell count, and hemoglobin level remained associated with modern contraceptive use. women 35 years old (aor : 0.63 ; 95% ci : 0.520.77), single, divorced, or widowed women (aor : 0.30 ; 95% ci : 0.270.34), and those for whom hiv status disclosure was unknown (aor : 0.75 ; 95% ci : 0.640.87) had lower odds of using modern contraception. the odds of using modern contraception were higher among women with one or more living children (aor : 1.47 ; 95% ci : 1.211.78), and among healthier women with cd4 cell counts of 250350 cells / ul (aor : 1.18 ; 95% ci : 1.051.33) or 351 cells / ul (aor : 1.23 ; 95% ci : 1.101.38) than among nullipara and those with low cd4 cell counts. a similar association was observed for hemoglobin levels 8.19.9 g / dl (aor : 1.56 ; 95% ci : 1.241.97) and 10.0 g / dl (aor : 2.16 ; 95% ci : 1.722.71). in univariate analysis, women who were 35 years, single, divorced, or widowed and those who did not provide information regarding hiv status disclosure had a lower odds of dual method use (table 3). higher odds of dual method use were observed among women with one or more living children, those with cd4 cell counts 351 cells / ul, and those who did not report a history of tuberculosis. in multivariate analysis, women 35 years (aor : 0.51 ; 95% ci : 0.410.63) were less likely to report dual method use than those 1624 years. women who were single, divorced, or widowed were also less likely to use dual methods than married women (aor : 0.75 ; 95% ci : 0.660.86). conversely, women with one or more living children (aor : 2.07 ; 95% ci : 1.592.70), those with cd4 cell counts 351 cells / ul (aor : 1.25 ; 95% ci : 1.091.45), and those with no prior history of tuberculosis infection (aor : 1.17 ; 95% ci : 1.011.35) had higher odds of dual method use. we successfully implemented a peer - led counseling intervention in art clinics, focusing on dual family planning method use to prevent unintended pregnancies and stis. our initial projections were that 20,000 hiv - infected women would access care across the participating clinics during the 12-month implementation period. our team of peer educators counseled 18,407 hiv - infected women enrolled in care during this period, demonstrating the feasibility of this approach in a low - resource, african setting. at their baseline counseling visit, nearly 60% of women reported use of a modern contraceptive method ; the majority used solely condoms. among contraceptive users, older, single women with lower cd4 cell counts were less likely to be using modern contraception. these findings highlight a vulnerable population of hiv - infected women. as the health of women with lower cd4 cell counts improves on art and as unmarried women enter new sexual partnerships, both groups remain at risk for unintended pregnancy and stis. future reproductive health policy and programming should be expanded beyond a focus on married, healthy women. we were disappointed at the low numbers of women who desired access to family planning services and were unable to obtain it in a timely fashion. in lusaka, family planning services are not integrated within hiv clinics, and most family planning clinics are only open to patients in the afternoons. a woman who has already spent much of her morning in an art clinic is less likely to return to spend another half - day in a family planning clinic. periodic stock - outs of reproductive health commodities may also limit women 's access to family planning services. additionally, we speculate that most messages in the community promote condom use over use of more effective modern contraception or dual method use. providers ' attitudes towards sexual and reproductive healthcare for hiv - infected patients [18, 19 ] and misconceptions regarding the safety of hormonal contraceptive methods among women on art may also play a role in limiting hiv - infected women 's access to family planning. the strengths of our study include the successful implementation of a standardized and comprehensive reproductive health counseling intervention. this intervention was acceptable to both providers and patients. using a peer educator model, we demonstrate that it is possible to reach a sizeable number of hiv - infected women attending public art clinics. it also became evident through our intervention that strengthening reproductive health care requires stronger linkages between family planning clinics, sti services, and hiv screening and treatment, as well as improved community understanding. additionally, we did not assess the impact of our counseling intervention on pregnancy rates. this study confirms the findings of smaller zambian clinical trials [12, 22, 23 ] and demonstrates that 40% of hiv - infected women on art are not using any form of modern contraception. among contraceptive users, less than 30% demographic and health surveys have demonstrated that knowledge of modern contraception is high among zambians. additional quantitative and qualitative research should address fertility desires and barriers to dual method use in this population, guiding future public health interventions. our findings also underscore important challenges faced by hiv - infected women attempting to access family planning services within the public health system. unmet contraceptive need is as high as 40% among these women. strengthening public - sector service provision, with the goal of ensuring that no woman is turned away from a family planning clinic empty handed, should be an urgent priority finally, integrating family planning service provision into hiv care and treatment clinics will likely improve access to reproductive health services. we successfully demonstrate the feasibility of integrating comprehensive reproductive health counseling into hiv care and treatment. we confirm that nearly 60% of hiv - infected women receiving care within the zambian public - sector report use of a modern contraceptive method. however, only 27% of these women use highly effective hormonal or long - term reversible methods, and even fewer women report dual method use. additional efforts are needed to promote dual method use, particularly among older, unmarried women and those with more advanced hiv disease. these interventions should be coupled with health system changes that address critical bottlenecks in reproductive health service provision.
|
hiv - infected women in sub - saharan africa are at substantial risk of unintended pregnancy and sexually transmitted infections (stis). linkages between hiv and reproductive health services are advocated. we describe implementation of a reproductive health counseling intervention in 16 hiv clinics in lusaka, zambia. between november 2009 and november 2010, 18,407 women on antiretroviral treatment (art) were counseled. the median age was 34.6 years (interquartile range (iqr) : 29.939.7), and 60.1% of women were married. the median cd4 + cell count was 394 cells / ul (iqr : 256558). of the women counseled, 10,904 (59.2%) reported current modern contraceptive use. among contraceptive users, only 17.7% reported dual method use. after counseling, 737 of 7,503 women not previously using modern contraception desired family planning referrals, and 61.6% of these women successfully accessed services within 90 days. unmet contraceptive need remains high among hiv - infected women. additional efforts are needed to promote reproductive health, particularly dual method use.
|
acute ischemic stroke (ais) is associated with a variety of pathological changes affecting both glial and neuronal brain tissue. these changes are mirrored in the release of proteins into the cerebrospinal fluid (csf) and to lesser extent into the blood.1,2 experimental studies have found that cerebral ischemia promotes changes of cytoskeleton and activation of apoptosis - related genes, resulting in morphological reactions of neurons, astrocytes, oligodendrocytes, and microglia.3 one consequence of these hypoxic / anoxic processes is brain inflammation, further contributing to cell death and cerebral injury in acute stroke.4 neuroinflammation, a common mechanism that links various cerebral insults, has also been proposed as one of the pathways leading to alzheimer s disease5,6 as well as to cognitive decline after stroke.7,8 several animal studies have identified increased levels of certain csf biomarkers that reflect pathological events within the central nervous system (cns) in relation to ischemia.2,9,10 in humans, only a small number of studies have examined csf biomarkers in relation to stroke.11 however, so far, there are no studies measuring a broad range of markers related to neuroinflammation and neurodegeneration in patients with ais. while neuron - specific enolase (nse),12 protein s100b,13 and glial fibrillary acidic protein (gfap) have mostly been investigated as peripheral markers of brain damage,14,15 only a small number of studies have focused on csf biomarkers, despite the fact that csf concentrations better reflect cerebral damage.11 some of these studies have measured the levels of nse,16 amyloid precursor protein metabolites,17 gfap and protein s100b,18 and ferritin (which is actively produced by microglia after injuries within the cns).14 our aim in the present work was to investigate the profile of glia - related inflammatory csf biomarkers (ykl-40, gfap, mcp-1, scd14 ; see table 1) and cytoskeleton and myelin markers of neurodegeneration (nfl, t - tau, p - tau181, myelin basic protein (mbp) ; see table 1), and their relation to clinical stroke severity and white matter lesions (wml). a total of 20 patients with ais were included in days 510 after the debut of ais. the patients were recruited from the stroke care unit, sahlgrenska university hospital in gteborg, during 20092011. all subjects underwent a detailed clinical examination on admission to hospital, together with clinical history and functional assessment. stroke was defined as the acute occurrence of focal neurological signs lasting for more than 24 hours in a different neuroanatomical location from that of any previous stroke, or less than 24 hours if accompanied by a new lesion on neuroimaging.19 the severity of stroke was graded according to the national institute of health stroke scale (nihss).20 brain imaging was performed by computer tomography (ct). ais subtype was assessed according to the toast (trial of org 10172 in acute stroke treatment) classification.21,22 exclusion criteria were history of alcoholism, drug abuse, previously diagnosed mild cognitive impairment or dementia, any known psychiatric disorder, current treatment with anticoagulant therapy, coagulopathies, cerebral edema, stroke lesions located in the peduncular region and/or medulla oblongata, and cerebral vasculitis. in all, 13 patients declined participation. to obtain normative data for the findings in the csf, 20 controls were recruited at the memory clinic at sahlgrenska university hospital, gothenburg, sweden. the controls were age - matched individuals with no prior anamnesis of stroke or other cardiovascular pathology from the gothenburg mci study.23 a total of 10 ml csf were collected by lumbar puncture through l3l4 or l4l5 intervertebral space, in accordance with the standard procedure, between days 5 and 10 (mean 7.1 days 1.6) after stroke onset. after cell counting, samples were centrifuged at 2,000 g at + 4 c for 10 minutes. the supernatant was then gently mixed, to avoid possible gradient effects, and stored within one hour at 80 c pending biochemical analyses, without being thawed and re - frozen. the csf analyses of t - tau (innotesthtau ag) and phospho - tau181 (p - tau181) (innotest phospho - tau (181p)) were performed using innogenetics enzyme - linked immunosorbent assays (elisa, innogenetics, ghent, belgium). the nfl elisa (umandiagnostics nf - light, ume, sweden) was performed according to a previously established protocol,24 with minor modifications. the analysis of mbp was performed by an elisa (active mbp, diagnostic systems laboratories, webster, tx, usa) purchased from diagnostic systems laboratories. csf levels of ykl-40 and scd14 were analyzed by elisas (quantikine elisa, human chitinase 3-like 1 immunoassay and human scd14 immunoassay, both from r&d systems inc, abingdon, uk). mcp-1 was measured by an ultra - sensitive elisa (human mcp-1 ultra - sensitive kit, meso scale discovery, rockville, md, usa). gfap was measured by a previously described elisa procedure.25 the coefficients of variation for all biochemical analyses were below 10%. wml were classified using the age - related white matter changes (arwmc)26 scale, which defines wmc on ct images as ill - defined moderately hypodense areas of 5 mm. wmc is rated from 0 to 3, where 0 corresponds to no wmc, 1 to focal lesions, 2 to beginning of confluence of lesions, and 3 to diffuse involvement of the entire region. for the basal ganglia, 1 corresponds to focal lesions 5 mm, 2 to > 1 focal lesion, and 3 to confluent lesions. the arwmc scale classifies wmc separately for left and right hemispheres in five different brain regions : frontal, parieto - occipital, temporal, basal ganglia, and infratentorial. the wmc score is then added for the 10 different regions for a final score ranging from 0 to 30. the ratings were performed on one occasion, and the rater (ce) was blinded to the study participants clinical data. arwmc scores were stratified into two groups : mild (arwmc score of 05) and moderate / severe (arwmc > 5). mann in addition, multivariate analysis was performed by employing orthogonal projection to latent structures discriminant analysis (opls - da), which is implemented in the simca p+ software (v 13.0, umetrics, ume, sweden). the opls - da algorithm finds the projection direction, score vector, that gives the largest covariance between the variables and the pre - defined classes (ie patients and controls) and that maximizes the separation between the classes.27 the variables that are found to have an influence on the projection (vip) and that contribute to discriminate between the classes are summarized in the vip plot. the higher the vip bar, the more influential is the variable on the model. the vip plot also gives a 95% confidence interval (ci) for the contribution of each variable, and a large inaccuracy, ie variables with a ci exceeding the vip bar, is an indicator of a less useful variable from a biomarker point of view. receiver operating characteristic (roc) analyses were performed on the score vector values to visualize the diagnostic value of the multivariate analyses, and the cut - off was found by maximizing the sum of the sensitivity and specificity. roc analyses were performed in graphpad (graphpad software inc, la jolla, ca, usa). descriptive statistics and data comparison tests were carried out using spss 19.0 package (spss inc., differences between groups were analyzed by nonparametric tests, pearson chi - square or mann whitney u test, as stated. the relevance of parameters considered to predict stroke severity was analyzed by multiple linear logistic regression with backward stepwise removal based on the likelihood - ratios. a total of 20 patients with ais were included in days 510 after the debut of ais. the patients were recruited from the stroke care unit, sahlgrenska university hospital in gteborg, during 20092011. all subjects underwent a detailed clinical examination on admission to hospital, together with clinical history and functional assessment. stroke was defined as the acute occurrence of focal neurological signs lasting for more than 24 hours in a different neuroanatomical location from that of any previous stroke, or less than 24 hours if accompanied by a new lesion on neuroimaging.19 the severity of stroke was graded according to the national institute of health stroke scale (nihss).20 brain imaging was performed by computer tomography (ct). ais subtype was assessed according to the toast (trial of org 10172 in acute stroke treatment) classification.21,22 exclusion criteria were history of alcoholism, drug abuse, previously diagnosed mild cognitive impairment or dementia, any known psychiatric disorder, current treatment with anticoagulant therapy, coagulopathies, cerebral edema, stroke lesions located in the peduncular region and/or medulla oblongata, and cerebral vasculitis. in all, 13 patients declined participation. to obtain normative data for the findings in the csf, 20 controls were recruited at the memory clinic at sahlgrenska university hospital, gothenburg, sweden. the controls were age - matched individuals with no prior anamnesis of stroke or other cardiovascular pathology from the gothenburg mci study.23 a total of 10 ml csf were collected by lumbar puncture through l3l4 or l4l5 intervertebral space, in accordance with the standard procedure, between days 5 and 10 (mean 7.1 days 1.6) after stroke onset. after cell counting, samples were centrifuged at 2,000 g at + 4 c for 10 minutes. the supernatant was then gently mixed, to avoid possible gradient effects, and stored within one hour at 80 c pending biochemical analyses, without being thawed and re - frozen. the csf analyses of t - tau (innotesthtau ag) and phospho - tau181 (p - tau181) (innotest phospho - tau (181p)) were performed using innogenetics enzyme - linked immunosorbent assays (elisa, innogenetics, ghent, belgium). the nfl elisa (umandiagnostics nf - light, ume, sweden) was performed according to a previously established protocol,24 with minor modifications. the analysis of mbp was performed by an elisa (active mbp, diagnostic systems laboratories, webster, tx, usa) purchased from diagnostic systems laboratories. csf levels of ykl-40 and scd14 were analyzed by elisas (quantikine elisa, human chitinase 3-like 1 immunoassay and human scd14 immunoassay, both from r&d systems inc, abingdon, uk). mcp-1 was measured by an ultra - sensitive elisa (human mcp-1 ultra - sensitive kit, meso scale discovery, rockville, md, usa). gfap was measured by a previously described elisa procedure.25 the coefficients of variation for all biochemical analyses were below 10%. wml were classified using the age - related white matter changes (arwmc)26 scale, which defines wmc on ct images as ill - defined moderately hypodense areas of 5 mm. wmc is rated from 0 to 3, where 0 corresponds to no wmc, 1 to focal lesions, 2 to beginning of confluence of lesions, and 3 to diffuse involvement of the entire region. for the basal ganglia, 1 corresponds to focal lesions 5 mm, 2 to > 1 focal lesion, and 3 to confluent lesions. the arwmc scale classifies wmc separately for left and right hemispheres in five different brain regions : frontal, parieto - occipital, temporal, basal ganglia, and infratentorial. the wmc score is then added for the 10 different regions for a final score ranging from 0 to 30. the ratings were performed on one occasion, and the rater (ce) was blinded to the study participants clinical data. arwmc scores were stratified into two groups : mild (arwmc score of 05) and moderate / severe (arwmc > 5). mann in addition, multivariate analysis was performed by employing orthogonal projection to latent structures discriminant analysis (opls - da), which is implemented in the simca p+ software (v 13.0, umetrics, ume, sweden). the opls - da algorithm finds the projection direction, score vector, that gives the largest covariance between the variables and the pre - defined classes (ie patients and controls) and that maximizes the separation between the classes.27 the variables that are found to have an influence on the projection (vip) and that contribute to discriminate between the classes are summarized in the vip plot. the higher the vip bar, the more influential is the variable on the model. the vip plot also gives a 95% confidence interval (ci) for the contribution of each variable, and a large inaccuracy, ie variables with a ci exceeding the vip bar, is an indicator of a less useful variable from a biomarker point of view. receiver operating characteristic (roc) analyses were performed on the score vector values to visualize the diagnostic value of the multivariate analyses, and the cut - off was found by maximizing the sum of the sensitivity and specificity. roc analyses were performed in graphpad (graphpad software inc, la jolla, ca, usa). descriptive statistics and data comparison tests were carried out using spss 19.0 package (spss inc., differences between groups were analyzed by nonparametric tests, pearson chi - square or mann whitney u test, as stated. the relevance of parameters considered to predict stroke severity was analyzed by multiple linear logistic regression with backward stepwise removal based on the likelihood - ratios. there were 14 men among the stroke patients and 9 men in the control group. there was no statistically significant difference between the ais and control groups with respect to age (age of controls 72.7 years 3.7 ; age of stroke patients 76.0 years 6.5 ; p = 0.052). we found no correlation between age and biomarker levels and no differences in biomarker levels between men and women. the stroke patients suffered from diverse comorbidities (table 2). the correlation between specific comorbidities (hyperlipidemia, hypertension, diabetes mellitus, heart failure, and previous tia / stroke) and the tested biomarkers was investigated. the only significant correlations that we found were between hyperlipidemia and mcp-1 (p = 0.028) and scd14 (p = 0.047), respectively. based on the neuroimaging findings, the cerebral lesions were corticosubcortical in n = 17 patients (85%). we found increased levels of t - tau, nfl, and mbp in the csf of stroke patients compared with controls, see table 3 and figure 1. in patients with mild stroke (nihss 5 ; p = 0.033) ; for details see table 5. based on the neuroimaging findings, the cerebral lesions were corticosubcortical in n = 17 patients (85%). we found increased levels of t - tau, nfl, and mbp in the csf of stroke patients compared with controls, see table 3 and figure 1. in patients with mild stroke (nihss 5 ; p = 0.033) ; for details see table 5. in the present study, we found several marked neurochemical deviations reflecting neurodegeneration- and glia - related changes in patients with stroke compared with healthy controls. the most pronounced changes were found in markers reflecting subcortical lesions ie, nfl28,29 and mbp,30 but changes in t - tau31 corresponding to damage in cortical regions were also found. p - tau,32 which is known to be the single most specific csf biomarker for ad, was not at all affected. subcortical biomarker deviations have also been found in prodromal and manifest subcortical vascular dementia without obvious stroke episodes,33,34 which may indicate that subcortical lesions were present before the acute episodes. levels of the glia - related markers gfap and ykl-40 were also higher in ais patients compared with healthy individuals. both neurodegeneration- (t - tau, mbp) and glia - related biomarkers (gfap, ykl-40) were related to clinical stroke severity, but the only csf biomarker that was significantly associated to the degree of wml was nfl. neurofilaments being the most common sort of filaments are mainly localized to the axons of myelinated tissue. this is in line with the overall increase in nfl and the high presence of wml (95%) in our study population. the levels of nfl in csf have previously been found to correlate with both nihss on the day of lumbar puncture (1014 days after acute brain damage) as well as outcome assessed by extended glasgow outcome scale (gose), mmse (mini mental state examination), and nihss after one year in patients with aneurysmal subarachnoid hemorrhage.35 to our knowledge, data regarding csf concentration of nfl in patients with ais are extremely scarce, with only two available studies with contradictory results ; one study measured nfl in six patients, all of them with middle cerebral artery infarction;24 no correlation to stroke severity or radiological findings was available in this study ; the other study14 found no difference between csf levels of nfl in stroke patients compared with controls. we believe that their negative results might be because of a different time - point of csf sampling, extending up to 15 days after stroke onset. moreover, the patients included had mixed pathology : vasculitis, herpes zoster infection, antiphospholipid antibodies, and malignancy. other factors, such as non - age - matched controls and laboratory measurements, could also play a role. the dynamics of certain csf biomarkers in ischemic stroke is not very rapid ; sampling the csf on day 1 might not be relevant and/or consistent with the real dimension of the pathologic process, because several biomarkers reach their peak several days / weeks after the acute ischemia phase.36,37 the results of our study not only indicate that nfl is a good marker for discriminating between ais patients and controls, but also that nfl was the only biomarker associated to the degree of wml. this suggests that nfl might be a marker of small vessel disease of the brain, as recently shown by jonsson,38 because nfl was not significantly related to stroke severity. thus, our hypothesis is that nfl is primarily a marker of pre - existing small vessel disease in this stroke population with pronounced cardiovascular comorbidity. the few studies that have previously measured the csf levels of t - tau in ais have reported a marked increase of this biomarker, which also seems to correlate with the infarct volume.37 in agreement with the results of hesse and strand,39 we also found high t - tau in csf of patients with stroke, supporting the findings of tau as a marker of neuronal injury. p - tau, on the other hand, does not seem to be changed at all in stroke patients, which rather supports its role as a marker reflecting the neuropathological changes in patients with ad.40 astroglial cells change from their normal quiescent state into a reactive state whenever damage is inflicted on the cns. mbp, on the other hand, is expressed in oligodendrocytes and constitutes approximately 30% of the myelin.41 in the case of stroke, the most likely explanation for the elevated levels of mbp as well as gfap, except for astrogliosis, is acute / subacute tissue destruction. in our stroke patients, the levels of mbp and gfap correlate to each other ; furthermore, they are both significantly higher in patients with moderate to severe stroke than in those with mild stroke, thereby supporting their role as possible prognostic markers. to our knowledge, our findings of increased levels of ykl-40 in patients with more severe stroke compared to those with mild stroke indicate that ykl-40 might be a prognostic marker for neurological outcome. so far, data on human csf markers of neuroinflammation obtained from stroke patients are very limited. in one of the very few human studies on csf levels of mcp-1 in stroke patients, losy and zaremba found high mcp-1 levels at 24 hours after ischemic injury.43 another marker, glycoprotein cd14,44 which exists both as a membrane - bound receptor on monocytic cells, and as a soluble form, has been suggested to possibly enhance phagocytic activity as well as suppress glial neurotoxicity.45 in our study, neither mcp-1 nor scd14 was increased in ais patients. one possible explanation could be the timing, because collection of csf in our study was done at the earliest five days after stroke debut. all the csf markers that were elevated in ais were inter - correlated to each other, except nfl, which only correlated with t - tau (data not shown). this is an interesting finding, because tau is a protein found not only in neurons but also in glial cells, and tau immunoreactivity has been found both in astroglia and in oligodendroglia after tbi (traumatic brain injury) and stroke, respectively.46,47 this could possibly explain the increase in t - tau, while p - tau still remains unchanged. however, the correlations could also be explained by acute tissue destruction affecting both cortical and subcortical neurons and glia. one limitation of this study is the lack of data on the correlation of the location of cerebral lesions with the concentrations of csf biomarkers ; even if we tried to assess this relation, we could draw no conclusions, because the investigated material consisted predominantly of mixed type (corticosubcortical) infarctions, with very few purely cortical lesions. in addition, this study is weakened by the collection of samples at different time points after stroke debut. on the other hand, serial csf sampling in the clinical setting of ischemic stroke another limitation of our study is the relatively low number of patients, though this is quite common in studies involving csf sampling ; therefore, we regard the present work as a pilot study. also, the patients were treated according to the general treatment recommendations for stroke, and whether the treatment affected the csf biomarkers or not, it is a question that remains to be answered. brain barrier in normal conditions ; thus, any potential effect of the drugs used would be indirect, by affecting the vascular component, and not the neuronal component. finally, the nihss scores on admission are low, mirroring only mild / moderate stroke. there was a natural selection because of the fact that the patients included in this study were also subjected to cognitive screening (cognitive data in relation to csf concentrations of beta - amyloid are going to be presented in a future report). thus, patients with more severe deficits were not able to perform the above - mentioned screening. nevertheless, the strength of our study is that this is the first time that eight different csf biomarkers, reflecting both degeneration and inflammatory processes induced by ischemic injury, were simultaneously investigated. the results of this study show that nfl is not only higher in patients with stroke, but also a good marker of the degree of wml, indicating that it may be a reliable indicator of previous cerebrovascular disease. in addition, the study showed that specific biomarkers related to both neurodegeneration (t - tau, mbp) and neuroinflammation (gfap, ykl-40) were associated with clinical stroke severity. in summary, our findings add to the knowledge on the csf biochemical markers related to ischemic injury, and may thus help improving the diagnostic strategy and the treatment monitoring, as well as the estimation of clinical prognosis in patients with stroke.
|
backgroundcerebral ischemia promotes morphological reactions of the neurons, astrocytes, oligodendrocytes, and microglia in experimental studies. our aim was to examine the profile of csf (cerebrospinal fluid) biomarkers and their relation to stroke severity and degree of white matter lesions (wml).methodsa total of 20 patients (mean age 76 years) were included within 510 days after acute ischemic stroke (ais) onset. stroke severity was assessed using nihss (national institute of health stroke scale). the age - related white matter changes (arwmc) scale was used to evaluate the extent of wml on ct - scans. the concentrations of specific csf biomarkers were analyzed.resultspatients with ais had significantly higher levels of nfl (neurofilament, light), t - tau, myelin basic protein (mbp), ykl-40, and glial fibrillary acidic protein (gfap) compared with controls ; t - tau, mbp, gfap, and ykl-40 correlated with clinical stroke severity, whereas nfl correlated with severity of wml (tested by mann whitney test).conclusionsseveral csf biomarkers increase in ais, and they correlate to clinical stroke severity. however, only nfl was found to be a marker of degree of wml.
|
nonablative photorejuvenation has become an integral procedure in the emerging discipline of laser dermatologic surgery 1. however, asian patients seek to treat superficial pigmented lesions without complications and posttreatment downtime. although the high melanin content confers better photo protection, photo damage in the form of pigmentary disorders is common in asian skin 3. furthermore, postinflammatory hyperpigmentation (pih) occurring after cutaneous injury remains a hallmark of skin of color 2, 4. with increasing use of lasers and light sources to treated pigmentary disorders, prevention, and management of pih is of great interest in asian skin, which has a tendency for pih due to the melaninrich epidermis. intense pulsed light (ipl) therapy using incoherent broad spectrum light has been reported to be effective for treating superficial pigmented lesions 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15. a multipass, low fluence regimen is required when using large ipl handpieces in order to minimize patient discomfort and risk of side effects, as well as avoid unintended thermal effects in surrounding normal tissue 5. the ipl device used in this study possesses a small treatment tip to minimize irradiation to surrounding tissue. in this study, japanese patients received one treatment using a targeted ipl device with contact cooling and wavelengths ranging from 500 to 635 nm. treatment efficacy was evaluated using a novel method to objectively quantify color change of treated lentigines. forty japanese patients (32 females and 8 males) aged 3071 years (mean age, 47.3 12.4 years) with fitzpatrick skin type iii v were enrolled in this study. all patients had visited the clinica tanaka antiaging center to remove solar lentigines on their cheeks. patients who had received prior treatment for pigmentary lesions or had skin disease, ephelides, and/or melasma on the cheeks were excluded from this study. use of skin care products containing skin lightening agents such as tretinoin, hydroquinone, or arubutin was excluded throughout the study. all patients were advised of the potential treatment risks and provided written informed consent for participation in the study prior to initiation of procedures. the ipl device used in this study emits a light spectrum between 500 and 635 nm from a flashlamp to selectively target melanin (acutip500 ; cutera, inc., brisbane, ca) (fig. light was delivered to the targeted area with a 6.35 mm targeted tip, with minimum irradiation of the surrounding normal tissue. to avoid any burning sensation and side effects, the sapphire block was cooled with fluids using thermoelectric coolers circulated by a pump and a cooling system. the absorption coefficients of melanin (brown) and relative irradiance of the ipl device (green). the pigmented area of the patient 's face was wiped with an alcohol pad to remove any makeup. no topical anesthetics or medications were administered before, during, or after the treatment. traditionally, clear ultrasound gel is used during ipl treatment to improve light transmission into the skin and aid in epidermal cooling. however, in this study ultrasound gel was not used during treatment. the authors have determined after years of experience that safety and efficacy are not compromised when ultrasound gel is not used with this targeted small tip ipl device. a single treatment was performed on the pigmented lesion with three to four passes of adjacent pulses ranging in fluence from 10 to 14 j / cm and pulse duration of 6.79.3 ms. the average interval between passes was 12 minutes, and in total, 60150 pulses were administered to each lentigo. conventional ipl treatments usually regard a mild darkening of the pigmentation as the clinical end point, whereas in this study, pulses were delivered until a mild swelling and gray color were observed in the lesion (fig. 2). a schematic of ipl treatment for pigmentation with a large handpiece (top) and the ipl treatment with a small handpiece used in this study (bottom). if the patient reported a severe burning sensation, the time between pulses was extended to adequately cool the skin. immediately after the procedure, patients were allowed to apply makeup and instructed to apply sunblock daily. digital photographs and gray level histograms, at baseline and 26 months posttreatment, were evaluated as objective assessments. best practices were followed to ensure the conditions in both pre and posttreatment photographs were as identical as possible. the gray level histograms were created using enlarged grayscale images of the treated areas processed with adobe photoshop (adobe, san jose, ca). the number of pixels at each gray level value from 0 (darkest) to 255 (brightest) were plotted on a histogram. the pre and posttreatment mean values of the gray level histograms were compared and the difference was tested for statistical significance using wilcoxon 's signedrank test (p < 0.05 was set as a cutoff for statistical significance). patients rated their degree of satisfaction with improvement of the treated lesion, and convenience of the procedure. scores were based on a 5point scale ranging from 0 to 4 (0 = worse ; 1 = little satisfaction or not satisfied ; 2 = fairly satisfied ; 3 = satisfied ; and 4 = very satisfied). forty japanese patients (32 females and 8 males) aged 3071 years (mean age, 47.3 12.4 years) with fitzpatrick skin type iii v were enrolled in this study. all patients had visited the clinica tanaka antiaging center to remove solar lentigines on their cheeks. patients who had received prior treatment for pigmentary lesions or had skin disease, ephelides, and/or melasma on the cheeks were excluded from this study. use of skin care products containing skin lightening agents such as tretinoin, hydroquinone, or arubutin was excluded throughout the study. all patients were advised of the potential treatment risks and provided written informed consent for participation in the study prior to initiation of procedures. the ipl device used in this study emits a light spectrum between 500 and 635 nm from a flashlamp to selectively target melanin (acutip500 ; cutera, inc., brisbane, ca) (fig. light was delivered to the targeted area with a 6.35 mm targeted tip, with minimum irradiation of the surrounding normal tissue. to avoid any burning sensation and side effects, the sapphire block was cooled with fluids using thermoelectric coolers circulated by a pump and a cooling system. the absorption coefficients of melanin (brown) and relative irradiance of the ipl device (green). before the ipl treatment, the pigmented area of the patient 's face was wiped with an alcohol pad to remove any makeup. no topical anesthetics or medications were administered before, during, or after the treatment. traditionally, clear ultrasound gel is used during ipl treatment to improve light transmission into the skin and aid in epidermal cooling. however, in this study ultrasound gel was not used during treatment. the authors have determined after years of experience that safety and efficacy are not compromised when ultrasound gel is not used with this targeted small tip ipl device. a single treatment was performed on the pigmented lesion with three to four passes of adjacent pulses ranging in fluence from 10 to 14 j / cm and pulse duration of 6.79.3 ms. the average interval between passes was 12 minutes, and in total, 60150 pulses were administered to each lentigo. conventional ipl treatments usually regard a mild darkening of the pigmentation as the clinical end point, whereas in this study, pulses were delivered until a mild swelling and gray color were observed in the lesion (fig. 2). a schematic of ipl treatment for pigmentation with a large handpiece (top) and the ipl treatment with a small handpiece used in this study (bottom). if the patient reported a severe burning sensation, the time between pulses was extended to adequately cool the skin. immediately after the procedure, patients were allowed to apply makeup and instructed to apply sunblock daily. digital photographs and gray level histograms, at baseline and 26 months posttreatment, were evaluated as objective assessments. best practices were followed to ensure the conditions in both pre and posttreatment photographs were as identical as possible. the gray level histograms were created using enlarged grayscale images of the treated areas processed with adobe photoshop (adobe, san jose, ca). the number of pixels at each gray level value from 0 (darkest) to 255 (brightest) were plotted on a histogram. the pre and posttreatment mean values of the gray level histograms were compared and the difference was tested for statistical significance using wilcoxon 's signedrank test (p < 0.05 was set as a cutoff for statistical significance). patients rated their degree of satisfaction with improvement of the treated lesion, and convenience of the procedure. scores were based on a 5point scale ranging from 0 to 4 (0 = worse ; 1 = little satisfaction or not satisfied ; 2 = fairly satisfied ; 3 = satisfied ; and 4 = very satisfied). objective assessments evaluated by digital photographs and gray level histograms showed significant improvement in all patients at 26 months following one treatment. the mean values of the pre and posttreatment gray level histograms were 143.7 8.6 and 162.9 9.8, respectively. the mean difference of 19.2 gray level points indicated a clinically and statistically significant improvement of treated solar lentigines at followup (p < 0.0001) (fig. 3). forty percent of subjects had greater than 20 points increase in mean gray level value following treatment and demonstrated significant clearing of the treated lesion. five percent of subjects experienced very significant lesion clearing, defined as greater than 30 points increase in mean gray level value. moderate clearing, or an increase between 10 and 20 gray level points posttreatment, was observed in 40% of subjects and 15% of subjects showed mild or minimal improvement. the improvement measured by the values of the gray level histograms at the first pretreatment visit and the last posttreatment visit. ninety percent of patients reported satisfaction with both improvement of treated lentigines and convenience of the procedure (fig. the mean satisfaction ratings for improvement of treated lentigines and convenience of the procedure were 3.1 1.0 and 3.4 1.0, respectively. patients were satisfied with the high efficacy of the treatment as well as the minimal discomfort and side effects. patients also expressed satisfaction with the short procedure time, and minimal to no posttreatment downtime. subjective patient assessments are shown as follows : very satisfied (blue), satisfied (light blue), fairly satisfied (green), and not satisfied (red). a 30yearold japanese woman. enlarged color image (e, h), grayscale image (f, i), and gray level histogram (g, j) of the treated area pre and posttreatment, respectively. significant improvements were observed in digital photographs and gray level histograms. a 47yearold japanese man. enlarged color image (e, h), grayscale image (f, i), and gray level histogram (g, j) of the treated area pre and posttreatment, respectively. significant improvements were observed in digital photographs and gray level histograms. a 59yearold japanese woman. enlarged color image (e, h), grayscale image (f, i), and gray level histogram (g, j) of the treated area pre and posttreatment, respectively. complications were minor and transitory, with a slight burning sensation reported in four patients and mild erythema in two patients. additionally, there were no reports of pih, hypopigmentation, epidermal burn, scar formation, or lesion recurrence during the study. we previously reported that we can achieve various effects in the targeted tissue with a limited wavelength and contact cooling 16, 17, 18, 19, 20. wavelengths between 6001,300 nm affect a large volume and depth of tissue 21, and wavelengths near 800 nm are used for photodynamic cancer therapy and induction of thermal effects 22, 23, 24. wavelengths above 1,000 nm are not strongly absorbed by melanin and not ideal for pigmentation treatment. the ipl device used in this study shorter wavelengths, such as those within this range, are strongly absorbed by melanin and are highly effective for treating excess pigment. the mechanism of action for ipl treatment is based on the theory of selective photothermolysis. the controlled absorption of thermal energy by target melanin chromophores within pigmentary lesions leads to their destruction without significant thermal damage to surrounding normal tissue 25. we also theorize ipl treatment may stimulate a rapid differentiation of keratinocytes, accompanied by an upward transfer of melanocytes and subsequent elimination of melanocytes during desquamation of the microcrusts 16. this microcrust formation seemed to depend on the density and amount of pigment contained in the lesion. a tendency towards a reduction of pigmentation was observed in all subjects after the treatments ; however, the amount of pigment removed differed in each subject which seemed to depend on the melanin density and distribution. although active melanocytes are left behind and pigmentation may recur after the pigmented lesions are temporarily removed as extruded microcrusts 16, recurrence was not observed throughout this study. the efficacy of ipl therapy for superficial pigment removal is dependent upon the melanin density and distribution. ephelides and lentigo simplex that are severely pigmented are known to be more effectively treated by ipl, however additional treatment sessions, or a higher energy output, may be required for these patients. further studies are necessary to determine if higher output or a second treatment may enhance the effects. in this study we introduced the gray level histogram, a novel method for objective evaluation of posttreatment color change in solar lentigines. while not yet validated, the gray level histogram could serve as an effective patient communication tool to easily demonstrate measureable lightening of pigmented lesions. it should be noted that this was a preliminary study based on a fairly small number of patients. we can not exclude the possibility that intrinsic and extrinsic factors in everyday life may affect the changes demonstrated in this study. therefore, further studies which include a larger number of patients followed for a longer period of time are recommended to evaluate the treatment effects more exactly. this study demonstrated significant improvement of lentigines and high patient satisfaction in a japanese population, without severe complications and side effects, after a single intensive targeted ipl treatment using wavelengths between 500 and 635 nm and contact cooling.
|
background and objectivessolar lentigines are commonly found in sunexposed areas of the body including hands, neck, or face. this study evaluates the efficacy of an intense pulsed light (ipl) device, with wavelengths between 500 and 635 nm and delivered with a targeted tip, for the treatment of solar lentigines on japanese skin.study design / materials and methodsforty japanese patients with solar lentigines received one ipl treatment with a targeted treatment tip that emits wavelengths between 500 and 635 nm and contact cooling. pulses were delivered through a targeted tip to each lentigo until mild swelling and a gray color were observed. digital photographs and gray level histogram values were taken pre and posttreatment, and patient assessments were recorded posttreatment.resultssignificant improvement was observed for all patients in digital photographs and mean values of gray level histograms (p < 0.0001). ninety percent of patients reported satisfaction with the improvement of the treatment area and convenience of the procedure. complications were minor and transitory, consisting of a slight burning sensation and mild erythema which resolved within 5 hours of treatment. no serious adverse events were observed.conclusionsa shortwavelength ipl, delivered with a targeted tip and contact cooling, offers a highly efficacious treatment for solar lentigines in japanese skin with minimal downtime and complications. lasers surg. med. 48:3035, 2016. 2015 the authors. lasers in surgery and medicine published by wiley periodicals, inc.
|
over the last two decades, diabetes mellitus (dm) has become one of the most challenging health problems worldwide. it is estimated that there were 366 million people with diabetes in 2011, and the number is expected to rise to 552 million by 2030. potential causes for this rapid growth in the diabetic population include aging, urbanization, and increasing prevalence of obesity and physical inactivity. according to the eye diseases prevalence research group, the estimated crude prevalence rates of diabetic retinopathy (dr) and vision - threatening retinopathy are as much as 40.3% and 8.2%, respectively, in american adults 40 years and older known to have dm [3, 4 ]. half of the patients with untreated proliferative retinopathy will lose their sight within five years. although good glycemic control has been shown to significantly reduce the incidence of microvascular complication, unfortunately only 17% of patients could achieve the goal of reducing glycated hemoglobin (hba1c) to levels less than 7%. even with intensive metabolic control, up to 20% of patients will develop proliferative diabetic retinopathy (pdr) after having diabetes for 30 years. in developing countries such as china and india lack of a sound healthcare system and insufficient public awareness of the disease, together with uncontrolled hyperglycemia, hypertension, and hyperlipidemia, have imposed a much higher risk for the incidence of severe diabetic complications in these countries. therefore, understanding the pathogenesis of diabetic damage, while developing novel and effective therapies to prevent diabetes - related vision loss is significant unmet needs. in recent years, studies have demonstrated that dysfunction of the endoplasmic reticulum (er), or er stress, is involved in the pathogenesis of diabetes and its complications [7, 8 ]. the er is the central cellular organelle responsible for protein folding and maturation. to ensure the fidelity of protein folding, the er possesses sophisticated machinery to recognize aberrant proteins and target them for refolding or clearance this process is known as the unfolded protein response (upr). through comprehensive approaches that regulate er - associated protein degradation (erad), protein translation, and protein folding however, when prolonged er stress exceeds the ability of the upr, er homeostasis can not be reestablished. under these conditions, the upr will switch from adaptive to proapoptotic actions that induce cell death to remove severely stressed and unhealthy cells (reviewed in). therefore, the central role of the upr in human disease involves a life - or - death decision, according to an assessment of whether er stress can be relieved in a timely fashion. to date, there are three upr branches that have been identified, namely, the inositol - requiring protein-1 (ire1), activating transcription factor-6 (atf6), and protein kinase rna- (pkr-) like er kinase (perk) pathways. in recent years, studies have provided experimental evidence that all three upr branches are activated in dr, contributing to retinal inflammation, apoptosis, and angiogenesis [1218 ]. among these upr branches, the perk pathway and its downstream target atf4 have been thoroughly studied in retinal cells in dr, whilst the roles of the ire1 and atf6 pathways remain largely unexplored. x - box binding protein 1 (xbp1) is the transcription factor activated by ire1 during er stress. activation of xbp1 is critical for maintaining er function and dysregulated xbp1 expression / activity has been linked to apoptosis, cell death, and insulin resistance in diseased conditions. deletion or downregulation of xbp1 increases retinal cell sensitivity to apoptosis, inflammation, and oxidative stress. however, direct evidence of xbp1 in the development of dr is still lacking. in this review, we will focus on the xbp1 pathway and provide a perspective regarding xbp1 as a potential target in dr. the upr pathways are activated by three er stress sensors located on the er membrane, namely, ire1, atf6, and perk. in resting cells, the er luminal domain of these proteins binds to a chaperone molecule called the glucose - regulated protein 78 (grp78, also known as immunoglobulin binding protein, bip) and the binding prevents their activation. upon er stress, grp78 is sequestered from the sensors and binds to unfolded / misfolded proteins to facilitate their refolding. the dissociation of grp78 results in activation of the er stress sensors and subsequently activates the upr. the three upr pathways can be activated differentially and independent of each other and play distinct roles in inducing downstream target genes and regulating various physiological processes (figure 1). this pathway is the conserved core of upr, because of its similarity from yeast to humans. there are two different ire1 in mammalian cells, ire1 and ire1. ire1 is ubiquitously expressed, while ire1 is tissue specific [22, 23 ]. ire1 is a bifunctional protein acting as a transmembrane kinase and endogenous ribonuclease (rnase) [24, 25 ]. when activated, ire1 autophosphorylates and splices a 26-nucleotide intron from the mrna encoding a upr - specific transcriptional factor called xbp1, which results in a frame shift of the xbp1 gene. the frame shift gives rise to spliced xbp1 or xbp1s, which is a more stable and potent activator of upr genes. xbp1s induces downstream genes, including er chaperones and proteins involved in erad, and these proteins are thought to play a central role in restoring er homeostasis and promoting cell survival [2830 ]. perk superficially resembles ire1, which is activated by autophosphorylation, and then phosphorylates the -subunit of eukaryotic translation factor-2 (eif2) at ser51 with its cytoplasmic protein kinase domain. this phosphorylation inhibits the reactivation of eif2 into its gtp - bound form, resulting in global arrest of protein synthesis that, in turn, prevents further influx of er client proteins [19, 31 ]. in addition to reducing translation, perk - mediated phosphorylation of eif2 also induces preferential translation of activating transcription factor 4 (atf4), a transcription activator of the integrated stress response. atf4 induces a subset of er stress genes involved in inflammation, apoptosis, and oxidative stress by binding to the camp - response element (cre) located in their promoter or enhancer regions. two representative genes driven by atf4 are c / ebp homologous protein (chop) and growth arrest and dan - damage - inducible 34 (gadd34). chop is a transcription factor regulating the genes encoding components involved in apoptosis, while gadd34 encodes a perk - inducible regulatory subunit of the protein phosphatase ppic that counteracts perk by dephosphorylating eif2. recent studies show that the perk / p - eif2/atf4 pathway is required not only for translational control, but also for activation of atf6 and its target genes. the perk pathway facilitates both the synthesis of atf6 and trafficking of atf6 from the er to the golgi for intramembrane proteolysis and activation of atf6. atf6 has been identified as a basic leucine zipper (bzip) containing transcription factor that behaves differently than the other two sensors of upr, as it is packaged into transport vesicles and trafficked to the golgi apparatus instead of remaining in the er and acting via cytoplasmic effectors [37, 38 ]. it is then cleaved by site 1 and site 2 proteases that subsequently remove the transmembrane and luminal domains. cleaved atf6 moves to the nucleus and binds to the promoter of er stress response element related genes encoding er chaperones and enzymes, such as grp78, grp94, and protein disulfide isomerase (pdi) [38, 40, 41 ]. atf6 also regulates the transcription of other upr targets including xbp1 and chop as well as genes involved in er - associated degradation [19, 43, 44 ]. clinical features of dr first detected in the 19th century by ophthalmoscopy include retinal vascular abnormalities, such as microaneurysm, intraretinal hemorrhages, and cotton - wool spots. with disease progression, loss of blood vessels results in retinal ischemia, which may be accompanied by venous beading, loops, and intraretinal microvascular abnormalities (irma). these changes eventually lead to retinal neovascularization (a hallmark of proliferative diabetic retinopathy), fibrosis, and retinal detachment. breakdown of the blood - retinal barrier (brb) is another important feature of dr, which can occur at any stage of the disease, advancing from macular edema and exudation in the nonproliferative phase to highly permeable neovasculature in the proliferative phase. although brb damage primarily involves disturbed function of tight junctions between vascular endothelial cells (inner brb) and retinal pigment epithelial cells (outer brb), emerging evidence suggests that other neural and vascular cells (e.g., glial cells and pericytes), play a role in maintaining normal brb function. neuronal and glial cells release metabolites, such as lactate and nitric oxide (no), which regulate retinal blood flow to meet the metabolic needs of retinal tissue. alterations in the interactions between neural and vascular cells contribute to vascular dysfunction in the pathogenesis of dr. although the mechanisms underlying the neurovascular dysfunction in diabetes are not fully understood, recent studies have provided some encouraging evidence suggesting a role of the upr in dr - related retinal pathophysiology (table 1). recent studies have revealed that inflammation plays a causal role in diabetes - induced retinal vascular leakage. accumulation of serum components from leaking blood vessels causes thickening of the fovea or macular edema. diabetic retina also expresses high levels of proinflammatory cytokines, such as vascular endothelial growth factor (vegf), tumor necrosis factor- (tnf-), and intercellular adhesion molecular (icam)-1, which increase leukocyte- (mainly monocyte / macrophage-) endothelial cell interaction and disrupt tight junctions leading to vascular leakage (reviewed in [48, 49 ]). studies from several laboratories have demonstrated increased er stress and activation of all three upr branches in the retina in animal models of type 1 and type 2 diabetes [1215, 18 ]. increased grp78 and atf6 levels were also observed in retinal sections from type 2 diabetic patients with non - proliferative diabetic retinopathy [16, 17 ]. in contrast, local delivery of 4-phenobutyrate, a chemical chaperone that alleviates er stress, markedly reduces retinal inflammation and attenuates vascular leakage in diabetic animals. in cultured retinal endothelial cells, high glucose induces er stress and activates the perk - upr downstream transcription factor atf4. suppressing er stress or inhibiting atf4 activity reduces icam-1, tnf-, and vegf production in high glucose - treated cells. the role of er stress and atf4 in regulation of inflammatory factors is further confirmed in mller cells, which are considered to be the major source of vegf in diabetic retina. in retinal endothelial cells, activation of xbp1 by er stress preconditioning suppresses the tnf--induced icam-1 and vcam-1 and leukocyte adhesion and ameliorates retinal vascular leakage and leukostasis. pericyte loss from retinal microvessels or capillaries is an early pathological change in diabetic retina and is associated with microaneurysm formation and breakdown of the brb. a number of studies indicate that changes in pericytes in dr can be, at least partially, attributed to er stress. in 2006, ikesugi and colleagues reported that reduced glucose concentration induces activation of the upr, resulting in apoptosis in retinal pericytes. in a recent study, we demonstrated that fluctuation in glucose concentrations activates the atf / chop pathway of the upr resulting in increased expression of inflammatory cytokines such as vegf and mcp-1 in human retinal pericytes. interestingly, we found that exposure of cells to constant high glucose for 8 days does not activate the upr in pericytes ; this is consistent with previous findings that glucose deprivation but not high glucose causes er stress in pericytes. these results suggest that unstable serum glucose, seen frequently in diabetic patients, is harmful to retinal pericytes and may contribute to vascular damage. among many etiological factors, importantly, research by adachi and colleagues suggests that er stress and the upr regulate genes involved in modulating oxidative stress, such as extracellular - superoxide dismutase (ec - sod), an antioxidant enzyme that protects cells from oxidative injury caused by superoxide. more recently, fu and associates demonstrated that heavily oxidized and glycated low - density lipoprotein (ldl) activates oxidative stress and er stress in human retinal pericytes, resulting in mitochondrial dysfunction, apoptosis, and autophagy. these studies collectively indicate a critical role of er stress and the upr in pericyte loss and vascular dysfunction during dr development. however, signaling pathways of the upr branches and reciprocal regulations between oxidative stress and er stress, alterations in the er and mitochondrial dysfunction, the upr, and autophagy in diabetes - related pericyte damage remain to be investigated. retinal angiogenesis (neovascularization, nv), arising on the optic nerve and at the junction of nonperfused and perfused areas, is the hallmark of pdr, the advanced stage of dr. untreated neovascularization leads to vitreous hemorrhage and tractional retinal detachment resulting in sudden or permanent vision loss in diabetic patients. although the short - term effect of newly developed anti - vegf therapy is encouraging, a large percentage of patients do not respond favorably to these therapies, suggesting there are unknown mechanisms that regulate retinal nv in diabetes (reviewed in). while the upr has long been recognized as an important mechanism for cancer cell survival, activation of the upr by er stress has also been shown to contribute to tumor angiogenesis. as an example, the er chaperone grp78 plays an essential role in tumor proliferation, survival, and angiogenesis in tumor development. research from our lab demonstrated that er stress is induced in ischemic retina and contributes to retinal nv formation in oxygen - induced retinopathy (oir). excessive er stress induces vegf in human retinal endothelial cells, while inhibiting er stress by chemical chaperone 4-phenobutyrate successfully reduces vegf expression in retinal endothelial cells and mller cells exposed to hypoxia or high glucose and in retinas from oir and diabetic animals [12, 15 ]. furthermore, we showed that activation of atf4 is required for hypoxia- and er stress - induced vegf expression. more recently, a study from ghosh and associates revealed that all three upr branches, ire1-xbp1, perk - atf4, and atf6, are involved in vegf - a induction, which indicates an important role of the upr in angiogenesis. in contrast, liu. showed that hyperglycemia or vegf activates the ire1 and atf6 pathways but not the perk pathway, promoting vegf expression in retinal endothelial cells. nakamura and coworkers demonstrated that mild er stress, induced by low - dosage tunicamycin or thapsigargin, triggers proliferation and migration of retinal endothelial cells and promotes retinal neovascularization via induction of grp78. future investigations are needed to decipher the exact mechanisms by which the upr regulates endothelial angiogenic response and retinal angiogenesis. while the majority of research on diabetes - related brb dysfunction underlying the pathogenesis of diabetic macular edema focuses on alterations in endothelial tight junction complex and vascular leakage in dr, very few studies have looked into changes in the rpe during diabetes. yet there is evidence from new studies as well as from studies conducted over 20 and 30 years ago suggesting that diabetes - associated damage exists in the rpe, both in animal models and in diabetic patients [6163 ]. however, the effects of diabetes on the rpe barrier and other important rpe functions are poorly understood. in 2002, abcouwer and colleagues reported that amino acid deprivation induces er stress, resulting in vegf upregulation in rpe cells. this paper is one of the earliest studies that introduces er stress and the upr into retinal research and investigates a potential role of the upr in vegf regulation in rpe cells. in a later study, the same group demonstrated that activation of atf4 is implicated in homocysteine - induced vegf expression in rpe cells. furthermore, a recent study by miranda and colleagues identified increased phosphorylation of eif2, which reflects activation of the perk upr branch, in rpe from diabetic patients with nonproliferative dr. similarly, du and colleagues demonstrated that the er chaperone grp78 expression is increased in the rpe of diabetic subjects with retinopathy compared to those without retinopathy. the role of er stress and the upr in diabetes - related rpe injury and potential implication in rpe - photoreceptor degeneration warrants future investigation. eyes with dr exhibit neuronal dysfunction, including retinal ganglion cell (rgc) death, apoptosis of cells in the inner nuclear layer (inl), loss of synapses and dendrites, and related alterations in synaptic activities, as well as activation of microglial and glial cells (mller cell and astrocytes). growing evidence indicates that er stress is associated with retinal neuronal cell death in several disease models [10, 67, 68 ]. in an experimental model of chronic glaucoma, er stress has been shown to contribute to rgc death through activation of the perk / p - eif2/chop pathway. shimazawa and colleagues reported increased er stress in the retina correlated with apoptosis induced by n - methyl - d - aspartate (nmda) or by raising intraocular pressure (iop). a recent study by oshitari and colleagues shows that enhanced perk and chop levels in retinal neurons correlate with apoptosis of rgcs in retinas from diabetic rats, while similar observations were made in non - diabetic retinas after exposure to high glucose [71, 72 ]. apart from a role of er stress and the upr in rgcs, wu and associates demonstrated that oxidized and glycated ldl induce apoptosis of retinal mller cells by upregulating proteins involved in upr signaling, such as p - eif2, grp78, chop, and atf6, while activating proapoptotic bax, caspase-3, and parp. recently, a study by devi and colleagues shows that exposing mller cells to chronic hyperglycemia triggers prolonged er stress and activates autophagy. these results are consistent with our observation of increased atf4 and chop activation in mller cells, which partially colocalize with activated mller cells in diabetic retina, suggesting that er stress and the upr may play a role in regulation of cellular activity of mller cells. xbp1 was originally identified as a protein binding to the x - box motif in human major histocompatibility complex class ii gene in early 1990s. a decade later, its regulating effects on the upr were demonstrated by two laboratories independently, as the mammalian homolog of hac1 in yeast, which was spliced by ire1 [24, 27, 76 ]. over the last 10 years, the role of xbp1 splicing / activation in cell fate determination during stress has been studied extensively. xbp1 is a basic - region leucine zipper protein in the camp responsive element binding protein / activating transcription factor (creb / atf) family of transcription factors and regulates a subset of upr target genes. it is expressed ubiquitously in adult tissues as well as in fetal exocrine glands and osteoblasts. xbp1 is essential for hepatocyte growth, as global knockout of xbp-1 embryos die in day 12.5 from severe liver hypoplasia and fetal anemia. it is also required for er expansion and the development of highly secretory cells such as plasma cells and pancreatic and salivary gland epithelial cells. xbp1 mice exhibit increased er stress coupled with impaired glucose and insulin tolerance during high - fat diet (hfd)-induced obesity [7, 8 ]. accumulating evidence also implicates xbp1 splicing in many disease processes such as cancer, neurodegenerative diseases, and diabetes [8, 80, 81 ]. novel roles of the ire1-xbp1 branch in inflammation, cell survival, apoptosis, and angiogenesis have been revealed in recent years [21, 51, 82 ], and more are likely to be discovered. in diabetic akita mice, er stress was increased in the retina accompanied by increased xbp1 splicing (figure 2). furthermore, preconditioning with er stress activating xbp1 protects retinal endothelial cells from tnf--induced inflammation and retinal vascular leakage and leukostasis. in the following section, we will discuss the role of xbp1 in retinal vascular and neuronal cells and its potential role in dr development as well as in future treatment strategies. mice that lack xbp1 in intestinal epithelial cells develop spontaneous inflammation in small intestine and exhibit pathological features of human inflammatory disease (ibd). these changes are accompanied by increased er stress and enhanced susceptibility to inflammatory stimuli. in the same study, mechanistically, xbp1 deficiency causes increased er stress and ire1 activation, which recruits traf2 and induces activation of jnk and nf-b. these findings are consistent with an earlier study that demonstrates increased er stress and jnk activation in the liver and adipose tissues, coupled with insulin resistance, in heterozygous xbp1 knockout mice challenged with a high - fat diet. likewise, heterozygous xbp1 knockout mice are more susceptible to alcohol - induced pancreatitis due to increased acinar cell apoptosis and inflammation. in retinal endothelial cells, activation of xbp1 by preconditioning with er stress attenuates tnf--stimulated nf-b activation and adhesion molecule expression. similarly, overexpressing spliced xbp1 sufficiently reduces tnf--induced ire1/ikk / nf-b activation and leukocyte - endothelial cell adhesion. in these cell types, xbp1 appears to be an important modulator of inflammatory response and suppresses overt inflammation in the retina and other tissues. however, in other studies, activation of the ire1/xbp1 upr by mild er stress predisposes rat pancreatic -cells to an exacerbated inflammatory reaction to il-1 (but not tnf-) through regulation of the transcription factor fork head box o-1 (foxo-1) and nf-b activity. activation of xbp1 also regulates production of micrornas which in turn regulate target genes involved with immune response, such as the er antigen peptide transporter 1 (tap1), a key protein that coordinates the mhc class i - associated antigen presentation. discrepancies in the findings regarding the role of xbp1 in inflammation and immune response may reflect the complex and multifaceted function of xbp1 in regulation of the transcriptome. several studies have reported a potential role of xbp1 in the regulation of angiogenesis, yet the mechanism by which xbp1 regulates endothelial cell activity and the angiogenic process remains poorly understood. in a recent study, liu and colleagues demonstrated that targeting the ire1 or atf6 arms of the upr by sirna knockdown of ire1 or atf6 significantly reduces vegf - stimulated angiogenic response of endothelial cells and diminishes angiogenesis in mouse models of oir or choroidal neovascularization. these results are exciting in that activation of the upr by er stress in endothelial cells challenged with multiple potent stimulants of angiogenesis such as vegf, hypoxia and hydrogen peroxide is clearly important for retinal angiogenesis. however, activated ire1 demonstrates kinase activity that recruits and activates stress kinases such as jnk and ikk. these kinases play a proangiogenic role, independent of xbp1 splicing. thus, future studies that separate kinase activity from endoribonuclease activity of ire1 are needed to further refine the downstream pathways of ire1 in mediating its pro - angiogenic and pro - vegf effects. in order to examine the role of xbp1 in endothelial cells, zeng and associates generated endothelial cell - specific xbp1 knockout (xbp1ecko) mice. furthermore, xbp1s regulated endothelial cell proliferation in a pi3k / akt / gsk3/-catenin / e2f2-depandent manner. in contrast, nakamura and colleagues showed that low doses of er stress inducers, such as tunicamycin or thapsigargin, increase the proliferation and migration of retinal endothelial cells and induce retinal neovascularization without activation of xbp1 splicing. thus, the exact role of xbp1 in angiogenesis and retinal nv is yet to be confirmed. during er stress while misfolded polypeptides are transported to proteasome (erad i), large protein aggregates are primarily processed through the er, activating autophagy (erad ii). a low level of constitutive autophagy is also important for maintaining the quality of proteins and organelles, in order to maintain cellular function. autophagy also serves as a crucial element of the stress response needed to protect -cells under insulin - resistant states, and impaired autophagic machinery predisposes individuals to type 2 diabetes. xbp1s activates transcription of major genes encoding erad components, such as erdj4, hrd1, edem (er degradation enhancing -mannosidase like protein) and edem2. fouillet. found that autophagy induced by mild er stress selectively activates xbp1 splicing, which provides neuroprotection in drosophila and a mouse model of parkinson disease. interestingly, xbp1 activation in endothelial cells triggers autophagy, while knockdown of xbp1 abolishes autophagic response at the basal level or in the presence of endostatin-1. however, uncontrolled autophagy can be detrimental and cause autophagy cell death (type 2 programmed cell death). hetz and colleagues demonstrated that downregulation of xbp1 results in uncontrolled autophagy [94, 95 ]. induction of autophagy / erad ii by the ire1/xbp1 pathway likely involves activating the er membrane transporter at-1 and acetylation of the autophagy protein atg9a. thus, it appears that the ire1/xbp1 pathway plays a key role in integrating the upr, erad, and autophagy to regulate cellular stress response. this notion is also supported by recent work by adolph and colleagues demonstrating that deletion of xbp1 in intestinal epithelial cells results in er stress, which activates perk / eif2/atf4 pathway and augments autophagy. loss of xbp1 also induces pire1-mediated nf-b activation, which is, however, restrained by autophagy. when autophagy is suppressed by deletion of autophagy - related 16-like 1 (atg16l1) or autophagy - related 7 (atg7) genes, a far more severe intestinal inflammation was observed in epithelial cell - xbp1-deficient mice. these results suggest a compensatory mechanism by which autophagy suppresses inflammation triggered by er stress and xbp1 loss. emerging evidence shows that alterations in autophagy are implicated in retinal diseases, correlating with er stress [9799 ]. in addition, hyperglycemia has been shown to activate autophagy in retinal mller cells. however, it is still not clear how er stress - related activation of erad and autophagy contribute to vascular cell survival and neuronal function in diabetic retina. the role of xbp1 in erad and autophagy regulation in retinal cells also needs further investigation. er stress orchestrates the process of cell death and survival depending upon the extent of upr activation coupled with specific pathway components. it has been shown that activated xbp1 targets genes such as er chaperones and genes responsible for er - associated degradation (erad), such as p58 and pdi-5, to aid cell survival during upr. a recent study from ryoo and colleagues demonstrates that depletion of xbp1 in drosophila augments photoreceptor degeneration in ninae /+, a drosophila model for autosomal dominant retinitis pigmentosa (adrp) suggesting that xbp1 is essential for photoreceptor survival during er stress. our investigation demonstrated that xbp1s protects rpe and photoreceptor survival from light - induced apoptosis by suppressing oxidative stress and er stress. consistently, mild er stress (er stress preconditioning) induces a selective activation of xbp1, which exerts a protective effect for cell survival [101, 102 ]. by contrast, sustained and full - fledged upr involving gadd153/chop and asp12/caspase 12 activation is detrimental to the cell. in addition, the level and duration of xbp1 activation appears to be important for downstream signaling events and biological effects on cell fate. for example, zeng and colleagues reported that transient activation of xbp1 splicing may increase ec proliferation, while sustained activation leads to ec apoptosis, endothelium denudation, and atherosclerotic lesion development via multiple caspase activation, as well as downregulation of ve - cadherin through gene transcriptional effects and mmp - mediated degradation. sustained expression of xbp1s induces -cell dysfunction and apoptosis via inhibition of insulin, duodenal homeobox 1 (pdx1) and musculoaponeurotic fibrosarcoma oncogene homologue a (mafa). other gene products involved in xbp1 regulation during er stress - induced apoptosis are the bcl-2 family of proteins and xbp1 sumoylation [104, 105 ]. sumo is a novel ubiquitin - like protein that can covalently modify a large number of proteins and is reversed by a family of sentrin / sumo - specific proteases (senps). xbp1 can be sumoylated during er stress, which represses the transcriptional activity of xbp1 and leads to cell apoptosis. in recent studies, it was demonstrated that senp1 can increase the transcriptional activity of xbp1 through regulating xbp1 sumoylation. rodriguez and colleagues found that cells lacking bim and puma, two novel members of bcl-2 family of proteins, failed to maintain sustained xbp-1 splicing after prolonged er stress that caused early inactivation of xbp1. mutation in the bh3 domain of bim abrogates its physical interaction with ire1, resulting in inhibition of xbp-1 splicing and reduced expression of xbp1-target genes. with a drosophila model for autosomal dominant retinitis pigmentosa, ryoo and their results show that reducing the expression of xbp1 accelerates photoreceptor loss and retinal degeneration. in hippocampi from db / db mice, the expression of xbp1s was downregulated at both mrna and protein levels after 24 weeks of diabetes but not in early diabetes (8 weeks), implying a potential role of xbp1 dysfunction in long - term diabetes - induced cognitive declination. in contrast, overexpression of xbp1 protects rpe cells and rgcs from apoptosis induced by cytotoxin or axonal injury. these studies revealed the protective role of xbp1 in retinal neurons and the central nervous system. enhancing the er possesses a unique oxidizing environment that favors disulfide bond formation during the process of protein folding. er stress - initiated ros generation amplifies mitochondrial ros production and stimulates oxidative stress, which in turn enhances the er stress response, resulting in a vicious cycle of cellular damage. sustained er stress and oxidative stress can lead to cell dysfunction or even cell death. oxidative stress plays a pivotal role in the development of dr and also contributes to the resistance in reversing retinopathy after reinstitution of good glycemic control, a phenomenon known as metabolic memory. recent studies suggest upr signaling regulates oxidative stress through transcriptional regulation of antioxidant genes. in mouse embryonic fibroblasts, deletion of xbp1 resulted in decreased expression of several antioxidant genes, including catalase, sod1, and trx1, augmented ros generation and maintained p38 phosphorylation. mutation analysis of the catalase promoter region revealed a potential site for direct regulation by xbp1. in rpe - specific xbp1 ko mice, the expression of antioxidant genes (sod1, sod2, and catalase) was significantly decreased ; in contrast, the ros level was markedly increased accompanied by enhanced oxidative damage and apoptosis of rpe cells. however, overexpression of spliced xbp1 failed to increase the expression of these antioxidant genes in rpe cells, suggesting the possibility that xbp1 indirectly regulates these genes in rpe. shao and associates reported that high glucose treatment significantly reduced xbp protein in renal mesangial cells, and simultaneously increased expression of the cytosolic nadph oxidase subunit p47 and ros generation. overexpression of xbp1 reversed hg - induced ros production and reduced p47 expression, while knockdown of xbp1 led to increased ros. these findings suggest a potential role for xbp1 in maintaining cellular redox homeostasis by regulation of ros - generating enzymes such as nadph oxidase and antioxidant molecules ; however, the exact mechanism is still not clear. toll like receptors (tlrs) are part of the innate immune system that recognizes pathogen - associated molecules, induces inflammatory responses essential for host defenses, and initiates an adaptive immune response. tlrs are expressed in retinal cells, including rpe, microglia, mller cells, and astrocytes [111, 112 ], while their role in glial activation has been studied in uveitis and age - related macular degeneration [113115 ]. retinal glial cells (mller cells and astrocytes) and microglia are considered resident innate immune cells in the retina. these cells produce proinflammation cytokines, such as tnf-, il-1, il-8, il-6 and icam in pathological conditions through activation of pathways including tlrs and a myd88-dependent signaling cascade [113, 116 ]. intravitreal injection of tlr2 agonist or staphylococcus aureus activated tlr2 in mller cells, resulting in the activation of nf-b and p38 mapk in mouse retina. activation of glial cells and microglia also contributes to the pathological progression of dr, including retinal inflammation, brb breakdown and neuronal dysfunction [118120 ]. recent studies suggest that high glucose increases oxidative stress through downregulation of thioredoxin interacting / inhibiting protein (txnip) in mller cells. txnip, also known as vitamin d3 upregulated protein (vdup1), was first identified as an endogenous inhibitor of thioredoxin, an ros scavenger that maintains protein cysteine sulfhydryl groups by its redox - active disulfide / dithiol sites. exposing rat mller cells to high glucose for five days resulted in sustained upregulation of txnip accompanied by increased ros generation, atp depletion, er stress, autophagy, inflammation and apoptosis. these results indicate that a complex network of interdependent intracellular signaling pathways may contribute to diabetes - induced alternations in glial cells. in our recent study, we demonstrated that activation of er stress by high glucose leads to increased vegf and adhesion molecule expression through induction of atf4 in mller cells. how other upr branches (i.e., ire / xbp1 and atf6) are implicated in mller cell activation and inflammation is currently unknown. given the anti - inflammatory action of xbp1 in retinal endothelial cells, we speculate that activation of xbp1 during er stress could reduce inflammatory cytokine production and attenuate glial cell activation in dr. intriguingly, a recent study shows that xbp1 activation by er stress in macrophages enhances tlr signaling and innate immune response. it would be of great interest to elucidate how xbp1 regulate retinal glial cell activation and related inflammation in dr. although many clinical trials on novel therapeutic strategies have been conducted or are currently ongoing, dr remains the leading cause of blindness in working - age adults in the us. better understanding of the cellular and molecular mechanisms underlying diabetes - related vascular and neuronal damage is important to identify therapeutic targets to protect the retina and reduce vision loss in diabetic patients. emerging evidence suggests that increased er stress and activation of the upr in retinal cells promote the main pathophysiological events in dr, such as oxidative stress, inflammation, apoptosis, vascular leakage, and angiogenesis (figure 3). among the upr pathways, the ire1/xbp1 branch is considered to be the core check point, and a key determinant of cell fate. despite many elegant studies over the past decade demonstrating a crucial role of xbp1s in regulating inflammation, angiogenesis, and cell death, the exact functions of xbp1 in specific types of retinal cells and its implication in retinal adaptive response and retinal cell injury during the course of dr development and progression remain poorly understood. in addition, there is clear evidence of active cross - talk among signaling pathways of the upr and between upr signaling and other cellular stress responses. these complex and dynamic networks tightly control cell homeostasis and contribute to the pathogenesis of many diseases. therefore, investigation of xbp1 in a broader range of cellular events may help us understand its role in the retina and provide new insights into the mechanisms of retinal pathology in dr.
|
diabetic retinopathy, a common complication of diabetes, is the leading cause of blindness in adults. diabetes chronically damages retinal blood vessels and neurons likely through multiple pathogenic pathways such as oxidative stress, inflammation, and endoplasmic reticulum (er) stress. to relieve er stress, the cell activates an adaptive mechanism known as the unfolded protein response (upr). the upr coordinates the processes of protein synthesis, protein folding, and degradation to ensure proteostasis, which is vital for cell survival and activity. emerging evidence suggests that diabetes can activate all three upr branches in retinal cells, among which the perk / atf4 pathway is the most extensively studied in the development of diabetic retinopathy. x - box binding protein 1 (xbp1) is a major transcription factor in the core upr pathway and also regulates a variety of genes involved in cellular metabolism, redox state, autophagy, inflammation, cell survival, and vascular function. the exact function and implication of xbp1 in the pathogenesis of diabetic retinopathy remain elusive. focusing on this less studied pathway, we summarize recent progress in studies of the upr pertaining to diabetic changes in retinal vasculature and neurons, highlighting the perspective of xbp1 as a potential therapeutic target in diabetic retinopathy.
|
extradural arachnoid cysts are uncommon enlarging lesions of the spinal cord which originate from small diverticula of the subarachnoid space3). although termed " arachnoid cysts ", the inner arachnoid lining has been shown to be frequently absent, and the term has been used interchangeably with " extradural meningeal cyst"9). epidemiologically, these lesions demonstrate a male predominance and a peak incidence in the second decade of life1). these cysts occur most frequently in the mid to lower thoracic region, followed by the lumbosacral and thoracolumbar regions. being a space - occupying lesion, the clinical presentation of an extradural arachnoid cyst is usually due to spinal cord and/or nerve root compression. patients with thoracic cysts tend to suffer from spastic or flaccid paraparesis, while patients with lumbar and lumbosacral cysts complain of lower back pain, radiculopathy, or dysfunction of bladder and bowel2). cervical cysts have been reported to cause spastic quadriparesis, and the horner syndrome was observed to be associated with lesions at the lower cervical level2). in general, although symptoms manifest in a progressive manner, remission and fluctuation have been reported in 30% of cases2). also, exacerbation of symptoms due to the valsalva maneuver and the head - up position has been observed6). we have encountered an unusual presentation of an extradural arachnoid cyst located in the retroperitoneal space. the lesion was placed in retroperitoneal space without compression of neither spinal thecal sac nor nerve root. a 26-year - old man presented with abdominal discomfort mainly over the right lower quadrant for 4 months. although the patient did not have any significant medical or surgical past history, l4 hemivertebra had been incidentally found during a minor fall - off event in his teenage years (fig. 1). he denied any symptom related to l4 hemivertebra including lower back pain and never had sought any treatment for such abnormality. in the examination, he did not complain any pain in his leg and lower back or any difficulty in defecation, voiding, and walking. symptoms of the patient were refractory to common digestive medicines and gastrointestinal motility modulating drugs. during the course of treatment, he underwent a series of studies, and a large cystic mass was first noted on abdominal sonography. for further diagnosis, he underwent abdominal computed tomography (ct) and lumbar spine magnetic resonance imaging (mri), in turn. a large (6.24.08.0 cm) cystic mass originating from the right l4 spinal nerve root sleeve and extending to the prevertebral space of l2, l3, and l4 through the associated bony defect in the l4 vertebral body was revealed (fig. 2). mri demonstrated a homogenous signal, hypointense on t1-weighted imaging and hyperintense on t2-weighted imaging that was not enhanced by gadolinium contrast media. on conventional lumbar mri and magnetic resonance (mr) myelography, a long pedicle of the cyst was identified, but the communication between the cystic space and the spinal subarachnoid space was indistinct. in addition, the ' thecal sac - side ' end of the cystic pedicle was cone - shaped and appeared to be clogged (fig. 3). although in usual circumstances removal of a spinal extradural arachnoid cyst focuses on exploration and ligation of the fistulous channel1), a direct anterior retroperitoneal approach to the cyst was planned in this case, considering that removal of the main mass in the retroperitoneal space was essential for symptom relief, and that the communication between the cyst and the spinal subarachnoid space was unlikely. this decision was based on our experience with spinal extradural arachnoid cysts without identifiable communication points on imaging, in which detachment from the spinal cord was feasible and did not require ligation of the cystic origin. the patient was placed in a " three - quarter lateral " position, and an incision was made along the lateral margin of the rectus abdominis muscle. after retraction of peritoneum and dissection through the retroperitoneal fat, the right kidney was noted. the cyst was identified below the right kidney and was placed on the surface of psoas major muscle (fig. for convenient dissection, internal decompression was performed ; the cyst contained a clear liquid. the pedicle of the cyst originated from the intervertebral foramen, and the remaining cystic pedicle could be removed en bloc by undermining into the intervertebral foramen and gently drawing it. after the removal was completed we explored the cystic pedicle of the specimen with a blunt probe and observed that the ' thecal sac - side ' end was clogged (fig. the final tissue pathology diagnosis was reported to be consistent with an arachnoid cyst (fig. flatus was passed on the first postoperative day, and the patient was discharged on the sixth postoperative day without any problem. a postoperative lumbar mri was obtained one month after surgery and demonstrated no residual cyst and intact thecal sac without evidence of cerebrospinal fluid (csf) leakage (fig. 7). after the subsidence of postoperative pain, the patient was free of any abdominal discomfort although the pathogenesis of spinal extradural arachnoid cysts has not yet been clarified, extradural arachnoid cysts are thought to be diverticula of the arachnoid membrane due to a dural defect which can be either congenital5) or acquired following events such as spinal surgery, trauma, infection6,11), or percutaneous procedure7). the location of diverticula is known to be most commonly occurring at the junction of the theca and the nerve root sleeve followed by dorsal midline and the nerve root sleeve itself11). at first the cysts must be merely small diverticula of arachnoid space and should get enlarged to cause any symptom. several mechanisms have been postulated in order to explain the progressive nature of spinal extradural arachnoid cysts. this could not explain observation that secretory cells were frequently absent in the lining3). intrathecal csf dynamics change greatly by elevation of intra - abdominal pressure and this is far more influential than pressure change during the respiratory cycle. the change in intra - abdominal pressure result in enlargement of the cystic sac and persistent csf pulsation cause continuous growth of the cyst under the law of leplace11). one - way valvular mechanism was followed in order to complement the relationship between imposed hydrostatic pressure and continuous cystic growth. folds of meninges at the ostium of the cyst can act as a flap - like one - way valve, or rather slit - like communication with the subarachnoid space results in one - way valve11). more recently, a ' ball - valve ' theory was proposed to explain the valvular mechanism. when intrathecal pressure surges, the spinal arachnoid space is communicated with the cystic space and fluid flows into the cyst. as intrathecal pressure goes down, the cyst body exerts a force to impede the cystic pedicle following the law of leplace as the cyst has the larger radius and therefore has the greater wall tension than the cystic pedicle. this is actually a two - way system of unequal flow, however, csf is trapped in the cystic space6,11). various imaging modalities have been used to identify tissue communication points ; however, ct myelography using water - soluble contrast media has been the study of choice for illuminating the location of communication points between the cyst and the spinal thecal sac6). more recently, there has been a report using cinematic mri for detecting dural defects10). there have been cases in which the cyst was not filtrated by contrast media, or the pedicle was unidentifiable6). in our case, the patient has brought mr myelography from the referring hospital and refused additional ct myelography. the cystic pedicle and its communication with the spinal arachnoid space can be determined using mri and mr myelography6). to date, removal of extradural arachnoid cyst has focused on obliterating the fistulous channel, that is, the pedicle1). choi.1) reported a case of spinal extradural arachnoid cyst which was removed following ligation of the fistulous channel, and reviewed 17 additional cases of spinal extradural arachnoid cyst which was either excised or ligated in a similar manner. kulkarni.4) reported that, in their 7 cases of spinal extradural arachnoid cysts, they could not identify any connection between the cyst and the spinal arachnoid space in the operative field. in contrast, cloward2) reported that communication was verified in 43 of 92 cases of congenital spinal extradural arachnoid cysts. although there was no identifiable communication with the spinal arachnoid space, the characteristics of the cyst contents match that of csf in the majority of cases4). mccrum and williams8) explained the formation of these cysts without communication using osmosis or an active secretion mechanism previously mentioned. it has been proposed that the communication between extradural arachnoid cysts and the subarachnoid space gradually decreases as the pressure gradient fades and eventually becomes nonexistent5). in other words, spinal extradural arachnoid cysts may or may not communicate with the spinal subarachnoid space depending on the stage of evolution. what can be deduced from this theory is that, if the communication is not detectable on imaging studies, the probability of communication disruption is high, so that, when deciding on the surgical plan, it is possible to disregard ligation of a fistulous channel in the cystic pedicle. in the current case, communication of the cystic pedicle with the spinal subarachnoid space was not detected on mr myelography, and the cystic pedicle was confirmed to be clogged. this is an atypical presentation of a spinal extradural arachnoid cyst which extended into the retroperitoneal space, and was combined with a congenital vertebral malformation. the cystic pedicle was not communicating with the spinal arachnoid space on image study and the cyst was removed in en bloc manner with clogged ' thecal sac - side ' end of the cystic pedicle by an anterior approach. this case supports the hypothesis that, when the cystic pedicle is not identified on image study, removal of the cyst without ligating the fistulous channel can be possibly done.
|
spinal extradural arachnoid cysts usually cause symptoms related to spinal cord or nerve root compression. here, we report an atypical presentation of a spinal extradural arachnoid cyst combined with congenital hemivertebra which was presented as a retroperitoneal mass that exerted mass effects to the abdominal organs. on image studies, the communication between the cystic pedicle and the spinal arachnoid space was indistinct. based on our experience and the literature of the pathogenesis, we planned anterior approach for removal of the arachnoid cyst in order to focus on mass removal rather than ligation of the fistulous channel. in our estimation this was feasible considering radiologic findings and also essential for the symptom relief. the cyst was totally removed with the clogged ' thecal sac - side ' end of the cystic pedicle. the patient was free of abdominal discomfort by one month after the surgery.
|
painful bladder syndrome (pbs)/interstitial cystitis (ic) is characterized by suprapubic pain with bladder filling and increased daytime and nighttime frequency in the absence of proven urinary infection or other obvious pathology. the role of the central nervous system and pelvic floor dysfunction (pfd) in its pathogenesis and clinical manifestations has now been recognized. we report our case to demonstrate the possible role of peripheral and central sensitization as a cause of visceral pain in ic and neuromodulation as a therapeutic modality for the same. a lady of 52 years was referred to us by a urologist with a diagnosis of ics for pain management. the following treatment options were suggested to the patient and her relatives : neuromodulation using pregabalin and amitriptyline and interventional therapies like continuous caudal epidural infusion (ccei) of local anesthetics for 1 month to reduce central sensitization and botulinum toxin a injection into the pelvic floor muscles, including the urethral sphincter, to relieve the high - tone pelvic floor muscle spasm that has been theorized in ic. we usually start pregabalin with a dose of half a 75 mg capsule in women weighing less than 55 kg. in men and women weighing more than 55 kg, a single capsule of 75 mg pregabalin is prescribed. in the absence of side - effects like dizziness and excessive somnolence, after five more days, if the pain persists at a level greater than five on numerical rating scale nrs, we increase the dose to three - times daily. the starting dose of amitryptyline used is 5 mg at night, which may be increased to 10 mg if the patient is still in pain after 5 days. pregabalin 37 mg was advised initially and amitriptyline 10 mg was added 1 week later according to our protocol. the patient was advised to monitor and chart her urinary frequency and volume at home. after 1 month of neuromodulators, she showed a favorable response [table 1 ], but opted for ccei and botulinum toxin a injection because her social life continued to revolve round the severe restraints posed by her frequent distressing attempts to void. increase in voided urine volume to 500 ml was decided as an end point for terminating the ccei. the interventions were carried out in an operation theater with appropriate monitoring (oximeter, ecg, non - invasive blood pressure) and antibiotic cover with intravenous cefuroxime 750 mg. a high - frequency probe of s msk (sonosite bothell usa) ultrasonography - guided 18 gauge touhy needle was introduced into the sacral hiatus [figure 1 ]. needle entering the sacrococcygeal ligament - scl (arrow) the catheter was passed up to the second sacral segment and omnipaque dye spread was confirmed to be around the second to fourth sacral nerves with fluoroscopy [figure 2 ]. the distal end of the catheter was tunneled superolaterally in the subcutaneous tissue through a 10-cm touhy needle and connected to an infusion of 0.1% bupivacaine at a rate of 2 ml / h administered through an elastomeric pump (dosifusor leventon, spain) [figure 3 ]. the patient was advised oral antibiotics and was instructed to follow - up on an alternate day basis and take care of the caudal epidural infusion and its discontinuation in case of urinary retention. spread of dye (omnipaque) in the caudal epidural space the tunneled caudal epidural catheter connected to the elastomeric pump (dosifusor) after 2 weeks, the patient developed a fever of 100f with mild leukocytosis for 2 days. the ccei catheter was prematurely removed even though the catheter insertion and tunnel exit sites appeared normal, because it was placed in the central neuraxis. the fever resolved 1 day later. at this time, all parameters like pain, frequency (from 15 - 30 min to 2 - 4 hr) and urine volume (from 150 to 400 ml) had improved. one week after ccei termination, botulinum toxin a injection was given intramuscularly into the perineal muscles (external urethral sphincter -70 units, 5 units each into the ischiocavernosus, bulbospongiosus and transverses perinei muscles on both sides under topical analgesia with lignocaine jelly). the patient continued to maintain the improved parameters after catheter removal and 15 days after botulinum toxin a, she reported effortless voiding. the improvement continued to be present at 1, 3 and 6 months of follow - up [table 1 ], with continued treatment with pregabalin and nortryptyline at night and spasmoproxyvon as needed. clinical findings and urodynamic parameters at various stages of treatment and at 6 months a urodynamic study 1 month after therapy showed an unequivocal improvement of the patient health questionnaire, bladder volume (100 - 400 ml), frequency and residual volume (100 - 0 ml), which was maintained 6 months later without any pain. the clinical details and findings of the urodynamics studies before and after treatment are shown in [table 1 ]. pbs / ic is characterized by suprapubic pain associated with bladder filling and increased daytime and nighttime frequency in the absence of proven urinary infection or other obvious pathology. the diagnosis of ic is by exclusion as there is no consensus on its etiology, diagnostic criteria, pathophysiology and treatment strategies. the treatment of pbs has been recommended to aim at palliation and alleviation of symptoms. the management involves patient education, self - care (diet modification) and stress management as the first - line treatment. physical therapy, oral medications (amitryptiline, cimetidine or hydroxyzine, pentosanpolysulfate), bladder instillations (dmso, heparin or lidocaine) are considered if the first - line treatment fails. treatment of hunner 's ulcers and hydrodistention (low pressure, short duration) are applied for refractory cases. the next line of management would involve neuromodulation (sacral or pudendal nerve block) and cyclosposine a or botulinum toxin injection (btx - a) into the bladder. ultimately, if all other forms of treatment fail, surgical intervention may be the last resort in the form of urinary diversion or augmentation cystoplasty. however, there is an emerging consensus as to the central role of epithelial dysfunction, bladder sensory nerve up - regulation and mast cell activation in the genesis of ic. the importance of the central nervous system and pfd in the pathogenesis and clinical manifestations of ic is now recognized. we addressed central sensitivity and pfd in this patient to achieve a clinical and urodynamic improvement. we assumed that peripheral sensitization of bladder c fibers was triggered by the ongoing pain from neuroinflammation and straining against an unrelenting obstruction due to the pelvic floor neuromuscular dysfunction. peripheral hyperexcitability of pain fibers led to persistent activation of the spinal cord neurons, which evolved to be centrally maintained. progression to central sensitivity led to the development of a generalized irritable bladder that could not hold a normal volume of urine (reduced capacity) and developed irritative voiding symptoms. the response of our patient to the neuromodulator pregabalin emphasized the contribution of neuropathic mechanisms in her symptoms. this was confirmed by resolution of pain, frequency, urgency and nocturia after ccei, which attenuated the peripheral and central sensitization. however, the persistence of straining indicated that obstructive mechanisms from the dysfunctional pelvic floor muscles were still operational. we addressed this with pelvic floor botulinum toxin a injection rather than intravesical botulinum toxin a. this combination therapy addressed the two issues separately, with the belief that pelvic floor muscle spasm was the primary issue leading to peripheral and central sensitivity. this combination has been developed from our prior experience in the past decade in several patients. our report demonstrates that it is a possibility to be considered in a condition like ic where very few effective options are available for successful therapy.
|
a lady of 52 years with painful bladder syndrome / interstitial cystitis (pbs / ic) presented with chronic pelvic pain, irritative voiding with sphincter dominance on urodynamics. 3 yrs of oral analgesics, antispasmodics and intravesical therapy was ineffective. we surmised her pain, and irritative voiding to be secondary to constant straining against a dysfunctional pelvic floor. we treated pbs / ic as a neuropathic phenomenon with a combination of neuromodulator medications and continuous caudal epidural analgesia to reduce the pain induced peripheral and central sensitisation. botulinum toxin type a injection into pelvic floor muscles appeared to address their dysfuction. clinical and urodynamics response was encouraging.
|
this has long been recognised and even homer described the damage to metals indoors when odysseus returned to his home on ithaca and found his weapons damaged : (my son ! we must remove and safe dispose all these my well - forged implements of war ; and should the suitors, missing them, enquire where are they ? thou shalt answer smoothly thus-- i have convey'd them from the reach of smoke, for they appear no more the same which erst ulysses, going hence to ilium, left, so smirch'd and sullied by the breath of fire. " translator : william cowper this classical example illustrates the impact that combustion derived pollutants have on indoor objects. london michel faraday helped advised on the problems that paintings in the new national gallery might face through exposure to sulfur dioxide and coal smoke in the outdoor air. however, increasingly and especially as concentrations of the classical combustion derived pollutants decline it may not be these that are most critical for objects on display. furthermore, the pollutants that are harmful to health are not necessarily the same as those that cause damage to art objects. many objects are typically stored in cases, and some paintings in well - constructed frames, despite the contemporary interest in open display. of these indoor pollutants, carbonyls (carboxylic acids, aldehydes and carbonyl sulfide are possibly the most critical in damaging objects although alongside these one would have to place particles, hydrogen sulfide (although not especially common), hydrogen peroxide and some larger organic molecules (e.g. volent and baer). in addition to causing damage they can sometimes pose health risks especially the residual pesticides. formic acid and acetic acid are important compounds in the indoor environment because of the potential to degrade calcareous materials (shells, eggs, tiles and geological specimens). in the case of shells the remodelling of bankside power station by herzog and de meuron to create the tate modern led to considerable criticism in the media. some regarded the interior with "... raw oak floors, slightly soiled from use " as inspired, but there was an outcry that a warning from the tate 's flooring contractor 's over the dangers of using untreated oak had been ignored. amid denials from the gallery, conservators agreed that " that the floors could create acidic oak dust, one of the most corrosive forms of indoor pollution, and possibly damage some metals and ceramics ". formaldehyde has long been of concern because of its potential to cause damage as emphasised in the early booklet by hatchfield and carpenter, although as discussed by raychaudhuri and brimblecombe it is possible that the actions of formaldehyde came about largely from its oxidation to formic acid on the surface of metals. a large amount of work has been done by the building industry concerning the emission of formaldehyde from furnishings, fabrics, foams and glues because of the regulatory pressures to keep the formaldehyde content of constructional and decorative materials at a low level given fears that it may be a carcinogen. while not primarily aimed at museums hydrogen sulfide has long been of concern in the museum environment because of its ability to tarnish metals, but it is possible that the sulfide emitted from furnishings is carbonyl sulfide, as shown in the case of wool where at ambient temperatures it is carbonyl sulfide rather than hydrogen sulfide that is emitted. it is this that explains the ability of wool to tarnish metals such as copper and silver. other materials containing sulfur, such as rubber are also important sources of carbonyl sulphide. however, the changes that are likely go well beyond the temperature increases that features so widely in the media and in public perception. pressures to reduce the amount of energy used in buildings has not only meant a greater level of insulation (hence the potential increase of emissions of indoor pollutants from novel materials), but also lowered air exchange rates. new materials are also in use indoors and within museum cases, but in the heritage sector increasing care is taken in the choice of display materials through the use of the oddy test. indoors temperatures are likely to increase, perhaps in some environments due to a greater demand for comfort heating, although this may be countered by regulations over energy efficiency. in historic properties without active climate control temperatures the carbonyls relevant to the heritage environments are likely to respond in various ways to the changing temperature. changing thermohygrometric climate is likely to affect the carboxylic acid loss from wood indoors. in the simplest sense this might be related to their increasing vapour pressure with temperature, but to fully account for this it would be important to take the water content, ph and the activity coefficient into account. however, these are likely to be second order effects on the vapour pressure in unheated historic interiors. xiong and zhang have examined the dependence of formaldehyde concentration on time in the static chamber measurements between 25c and 50c. these experiments suggest that the flux rate and extent of loss of formaldehyde from building materials increases with temperature. however, the damage caused by formaldehyde is not necessarily dependent on its concentration, as much as its ability to be oxidized to formic acid. it has been argued that increased concentrations of volatile organic compounds in outdoor air and longer sunlight hours might enhance ozone concentrations. were this ozone to be advected indoors it might lead to a more rapid production of formic acid from formaldehyde at metal surfaces. the release of carbonyl sulfide from wool is strongly dependent on temperature, probably because higher temperatures encourage degradation of cystine. experiments with a range of woolen yarns suggest that changes between ambient (~20c) and 50c cause one to two orders of magnitude increase in the rate of loss of carbonyl sulfide. changing thermohygrometric climate is likely to affect the carboxylic acid loss from wood indoors. in the simplest sense this might be related to their increasing vapour pressure with temperature, but to fully account for this it would be important to take the water content, ph and the activity coefficient into account. however, these are likely to be second order effects on the vapour pressure in unheated historic interiors. xiong and zhang have examined the dependence of formaldehyde concentration on time in the static chamber measurements between 25c and 50c. these experiments suggest that the flux rate and extent of loss of formaldehyde from building materials increases with temperature. however, the damage caused by formaldehyde is not necessarily dependent on its concentration, as much as its ability to be oxidized to formic acid. it has been argued that increased concentrations of volatile organic compounds in outdoor air and longer sunlight hours might enhance ozone concentrations. were this ozone to be advected indoors it might lead to a more rapid production of formic acid from formaldehyde at metal surfaces. the release of carbonyl sulfide from wool is strongly dependent on temperature, probably because higher temperatures encourage degradation of cystine. experiments with a range of woolen yarns suggest that changes between ambient (~20c) and 50c cause one to two orders of magnitude increase in the rate of loss of carbonyl sulfide. in this section we explore the likely changes in indoor carbonyl concentrations as the result of future changes in temperature. we have chosen knole, a national trust property near sevenoaks in kent, as a site for our estimates. this historic house has an unheated interior and parts date back to the late medieval period. however, the interiors are largely of the early seventeenth - century and our study will focus on the cartoon gallery. this is a long room containing important drawings, most particularly some early copies (1624) of raphael 's cartoons (sackville - west, 1998). daily temperature observations are available for central england from the late 18th century as the central england temperature record, hadcet and these can be tuned to the heritage climate at knole. the possible changes in future climate of the british isles are available as high resolution outputs (ukcp09) that derive from the hadley model hadcm3 by downscaling with a weather generator to provide an increased resolution. climate models require emission scenarios and here we use output that comes from scenario a1f1 as it gives the largest changes and thus represents a type of worst - case. the scenarios make little difference to predictions of indoor climate in the near future, although beyond 2040 the highest predicted temperatures are associated with scenario a1f1. the ukcp09 output used in this research provided maximum and minimum temperatures and relative humidity on a daily basis for thirty year periods. the output consisted of a hundred different evaluations, essentially providing 3000 estimates of the daily weather conditions in each period. these thirty - year periods centre on 2025, 2035, 2045, 2055, 2065, 2075 and 2085 in addition to a baseline period centred on 1975. daily average temperatures were calculated, in the conventional way, by taking the mean of the maximum and minimum temperature each day. the thermo - hygrometric conditions within the interior of knole have been regularly monitored since 2000. however, such records cover a short timespan in comparison with the long history of the house and can not tell us of likely future climate. a simple transfer function has been developed, which can be used to estimate the indoor thermo - hygrometric environment in the cartoon gallery from external conditions. the process (covered in detail in lankester and brimblecombe) correlates daily indoor temperature and relative humidity with that of a nearby weather station using a simple regression equation and establishing different coefficients for each month to allow for seasonal climate and patterns of room use. this approach assumes the relationship between the interior and outdoors remains constant into the future, so is not robust against modifications to the building or its ventilation. the transfer coefficients for relative humidity indoors are calculated as specific humidity to conserve water during air movement. hindcasting the interior temperature in the cartoon gallery using the central england temperature record is possible at knole. the hadcet data were used to calculate daily indoor temperatures and expressed as medians of the annual means for the slightly overlapping 11-year periods centred at 1785, 1795... through to 2005. this is shown in figure 1, which gives both the outdoor temperature from observations and the estimated indoor temperature. the dispersion in the values is displayed as an error bar indicating the lower and upper quartiles. medians and quartiles have been adopted in preference to means and standard deviation as the former are more robust when the data are not normally distributed. the ukcp09 indoor and outdoor predictions for the future are also shown in figure 1. here the transfer function adopted also has an error, but it can explain more than 90% of the variance and give daily indoor predictions that show satisfying agreement with probable error at the 95% confidence interval of just under 2c. the indoor temperatures are somewhat higher than outdoor temperatures through solar gain. the difference gets smaller in the future because of the ability of the interiors to buffer against temperature extremes. median annual temperature outdoors and estimates for the cartoon gallery using hadcet (closed diamonds) and ukcp09 (open diamonds). at lower right : median annual relative humidity outdoors and estimates for the cartoon gallery from ukcp09. the relative humidity indoors and outdoors for the 30-year periods centred at various times from 1975 to 2085 is shown in the lower right of figure 1. we can see that despite drier conditions outdoors the relative humidity indoors is rather stable because the increase in temperature is not as great indoors as outdoors. there is the potential for seasonal shifts in the cartoon gallery with drier summer conditions indoors and slightly damper winters. indoor formic and acetic acid concentrations can be estimated theoretically from degassing rates as a function of temperature. the estimates into the future have made the assumption that the release rate is dependent on the vapour pressure of the acid. this assumption has a number of problems : (i) it assumes that the acid is not being depleted in the wood, but often wood takes a very long time to lose all the carboxylic acid and (ii) it does allow for changes in the moisture content of the wood or its ph. the vapour pressure of formic (pfo) and acetic (pac) acid, in pascals was estimated in terms of the antoine equation as : pfo=133.332 10(8.779 - 2162.39/(t+273.15)) pac=133.332 10(8.502 - 2177.1/(t+273.15)) where t is the temperature of the room (c). the initial estimates made no assumption about the importance of the moisture content of the wood. the daily partial pressure was calculated for the indoor temperatures and averaged for each year as estimated from hadcet and for the 3000 annual predictions from ukcp09. the medians and quartiles for the annual mean partial pressure of the carboxylic acids are shown in figure 2. median of the annual partial pressures of formic and acetic acid at temperatures predicted for the cartoon gallery. indoor concentrations of acetic acid in the cartoon gallery were estimated from emission factors combined with the measured dimensions of the room and the wood surface areas. this, combined with the air change rate has enabled us to predict the concentrations of acetic acid in the cartoon gallery as about close to 100 g m. (room volume 108 m, wood 54 m, air change 2 hr, emission rate from wood 400 g mhr). one would presume that this indoor concentration would increase in proportion to the mean partial pressure, so increases are to be expected over the coming century, so we might predict about 120 g m. thickett and lankester have shown that measured concentrations of acetic acid tend to be higher in summer in museum cases, which supports the importance of temperature in controlling carboxylic acid concentrations. our estimates presume that the acid in the wood is not depleted and there are such large quantities that this takes place only slowly. as changes in humidity are rather small these seem unlikely to alter the emission rate in the cartoon gallery over the next century. similar calculations might be attempted for carbonyl sulfide, but they are likely to show much the same increase (perhaps 20% increase for a few degrees rise in temperature) that was predicted for the carboxylic and acetic acids. however, it is possible that the carbonyl sulfide will deplete relatively quickly from wool. in the case of formaldehyde the potential heritage impact is less clear given that the subsequent oxidation is likely to affect the rate of damage the gas imposes on materials. the changes in carbonyls determined for historic rooms are also likely to be reflected in the changes in these compounds in the interiors of exhibition cases, but here lower ventilation rates mean that concentrations can be even higher. although the socio - economic significance of climate change is widely recognized, the potential impacts on our cultural heritage have not always been well studied. heritage is not explicitly mentioned in the outputs of the intergovernmental panel on climate change. despite this there have been a number of european commission funded projects that have examined climate change and heritage. focus has often been on the outdoor environment, although recent projects such as climate for culture and the uk projects preparing collections for climate change and collections demography have looked at the propagation of future climate change indoors. the results from this investigation of the indoor environment give guidance for collection managers in planning strategies to reduce the impact of long - term climate change and thus preserve our heritage for future generations. the projections here would suggest that where there are historic rooms and collections that are vulnerable, risks to carbonyls (especially the acids) may increase if indoor temperatures rise. there needs to be continued care over the choice of materials for use within cases, especially where temperatures rise substantially. future work could explore improved estimates of indoor carbonyls, not only with better models for the projections of indoor climate, but also making use of thermodynamic models to estimate the relationship between relative humidity (and of course water activity) and the partial pressure of acetic acid. they might also examine the impact of future ozone and other oxidants on the heritage impact of formaldehyde. cmg reviewed the literature on carboxylic acids and how their indoor concentration might be estimated. funding for part of this work was provided through the science and heritage programme to the collections demography project jointly funded by the arts and humanities research council (ahrc) and the engineering and physical sciences research council (epsrc).
|
backgroundformic acid, acetic acid and formaldehyde are important compounds in the indoor environment because of the potential for these acids to degrade calcareous materials (shells, eggs, tiles and geological specimens), paper and corrode or tarnish metals, especially copper and lead. carbonyl sulfide tarnishes both silver and copper encouraging the formation of surface sulfides.resultscarbonyls are evolved more quickly at higher temperatures likely in the cartoon gallery at knole, an important historic house near sevenoaks in kent, england where the study is focused. there is a potential for higher concentrations to accumulate. however, it may well be that in warmer climates they will be depleted more rapidly if ventilation increases.conclusionscarbonyls are likely to have a greater impact in the future.
|
vascular complications due to atherosclerosis are a main cause of death worldwide (1). atherosclerosis, which is the major risk factor, is accelerated in cardiovascular diseases (cvd). therefore, detection and quantification of atherosclerosis disease is important to monitor treatment and the possible restrictions of acute events (2, 3). angiography is the gold standard method to evaluate arterial lesions in medical research, but it has some disadvantages such as being invasive, surgical complications, and ionizing radiation risks ; therefore, it is not a good screening tool. hence, a non - invasive assessment method that is away from ionizing radiation risks to the prognosis of this fatal injury can be effective in the treatment (4). evaluation of artery sonography with b - mode method, including carotid artery is a simple and quantitative method. it not only shows the structural and functional changes in the carotid artery but it is also a non - invasive method for early diagnosis of atherosclerosis in artery wall (5, 6). different types of arterial wall markers such as arterial wall thickening and stiffening, endothelial dysfunction and coronary artery calcification are currently available (7 - 9). among them, intima - media thickness (imt) is a safe, simple, and inexpensive method to assess subclinical atherosclerosis, and an independent index of atherosclerosis events (10). in sonography with b - mode method, wall thickness and vessel diameter can be directly measured since image acquisition of arterial wall can be obtained in a dynamic behavior throughout the cardiac cycle as the artery expands and contracts with each cardiac pulsation and relaxation, respectively (6). repeated measurement of the arterial walls is possible by this technic, but most researchers use manual tracing to evaluate arterial properties (10, 11), which is unreliable since it is based on subjective operator assessment and is time - consuming. moreover, they lay the foundation for better accuracy and reproducibility of the studies and raise the specificity of the overall system by preventing the subjective settings. finally, automated techniques reduce the laborious and tedious operator dependency in ultrasound imt measurements (11 - 14). besides the above - mentioned matters, substantial temporal variability in imt during systole and diastole and among cardiac cycles is not widely used in clinical practice (15). to improve hindrances to the clinical implementation of carotid imt changes as a risk assessment tool, the current study aimed to evaluate imt changes on common carotid artery (cca) throughout the cardiac cycle by the proposed computerized semi - automated method in sequential 2d ultrasound images. in a cross - sectional design, an examination was performed on thirty subjects at a mean age of 40 5 years from april 2013 to june 2013 through random sampling. the group study included healthy volunteers who referred to beheshti hospital affiliated to the kashan university of medical sciences, kashan, iran. none of the subjects had a history of cardiovascular and/or cerebrovascular disease (all had normal physical examination, resting electrocardiography (ecg), echocardiography and none was taking medicine), hypertension (blood pressure 0.05). there was a significant correlation between the imt measured by the proposed and manual tracing methods (r = 0.94, p < 0.001 and r = 0.93, p < 0.001 for imts and imtd, respectively) (figure 3). the linear regression analysis predicted the regression function between imts measured by manual tracing and the proposed methods as : imts (manual) = 0.95 imts (proposed) + 0.03 the regression function between imtd measured by manual tracing and the proposed method was predicted as : imtd (manual) = 0.96 imtd (proposed) + 0.03 bland - altman analysis indicated the difference between the estimated imt changes and the middle line as the mean difference between the two methods, whereas the outer lines represent 1.96 sd or the 95% limits of agreement (loa) (figure 4). the mean difference for the measured imts and imtd were 0.006 0.002 mm and 0.005 0.001 mm, respectively. intraobserver and interobserver variabilities were 1.17 and 1.54% ; 2.04 and 2.36% for imts of semi - automated and manual methods, respectively. intraobserver and interobserver variabilities were 1.11% and 1.48% ; 2.12% and 2.47% for imtd of the proposed and manual methods, respectively. the coefficient of variation percent (cov%) in imts and imtd for the proposed method was 18%, and 16%, respectively. the coefficient of variation percent (cov%) in imts and imtd for manual tracing was 26% and 28%, respectively. abbreviations : imts, intima - media thickness in systolic phase ; imtd, intima - media thickness in diastolic phase. although the pathogenesis of cvd is difficult, atherosclerosis is thought to play a major role. preventive measures taken early in life might more properly overcome the cardiovascular disease epidemic by putting back atherosclerosis or delaying the occurrence of clinical cvd (23, 24). since the carotid artery is proper to study, because of its superficial position and its relative thickness, considerable attention is recently directed to the cca wall thickness as an early marker of asymptomatic cases over 40 years of age, and it can have a predictive role for risk assessment (23).. showed that detection of atherosclerosis in the cca using b - mode ultrasound is a simple, non - invasive, and reproducible clinical method to evaluate atherosclerosis in patients with coronary artery disease (cad) (25). the cca is close to the skin, pretty straight, and well imaged, allowing carotid imt to be measured easily (26). besides, the cca is approximately a cylinder and allows the use of mathematical models to measure stiffness and compliance (27). the early study demonstrated two double echogenic lines separated by a hypoechoic space in cca. the distance between the two lines (b - mode image of imt) was measured and correlated with the thickness of different compositions of layers evaluated by large and microscopic test (5). van den oord. (28) illustrated the correlations between extravascular and intravascular ultrasound analysis and histology of near and far wall measurements in cca. they showed a proper correlation between far wall measurement in cca ultrasound and histological analyses, whereas there was poor correlation in near wall measurement of cca between both examinations. another study showed that the relationship between carotid imt and risk factors were more potential for the far wall measurement rather than the near one (29). other studies deduced that the inherent drawback and error in evaluation edges of the cca near wall, as opposed to the leading edge of echogenic frameworks represented by an echolucent vessel lumen, explained the observed differences (30). according to these findings, the current study focused on the cca. with b - mode ultrasound, imt on cca far wall this technique can evaluate atherosclerosis progression. in most studies, the manual tracing method is used to measure arterial diameter and imt changes in cardiac cycle (12). the manual tracing method is not only subjective to operator assessment but also time - consuming (31). the current study showed that high resolution b - mode ultrasound can assess the wall properties of artery during the cardiac cycle using a computerized analysis method. different image analysis algorithms were investigated for automated ultrasonic boundary detection including the dynamic programming, maximum gradient, model - based, and matched filter algorithms. these methods were implemented to measure the imt and internal diameter of arteries, and among them, dynamic programming and maximum gradient had the highest accuracy (32). (33) used the dynamic programming algorithm to develop a computerized analyzing system to evaluate the boundaries of intima - media. gutierrez. (34) used an automatic method to measure lumen diameter and imt based on an active contour technique. they compared the automatic measurement of lumen diameter and imt with the results obtained from manual tracing of the vessels. they showed that the automated method was a reproducible and reliable way of assessing lumen diameter and imt in the carotid artery. (35) proposed an automatic system to detect the imt of the cca using the snake techniques. they showed that computerized system had the potential to automatically detect the imtimal and adventitial layers without any manual correction. jegelevicus. employed the dynamic programming and maximum - gradient algorithms to measure the imt in a single frame, separately (8). they suggested the use of maximum gradient for imt measurement. but all of the above - mentioned studies used a computerized analysis method to detect lumen diameter or imt in a single frame, and methods to make the actual measurements over the entire cardiac cycle to capture the mechanical nature of the vessel are sparse. whereas, dynamic programming algorithm has a higher accuracy than a maximum gradient algorithm, but a maximum gradient algorithm has a lower computation complexity than a dynamic programming algorithm, the current study combined them to measure arterial diameter and imt in cca. the reference points and the cost function were based on dynamic programming and a maximum gradient algorithm, respectively. few researches showed that changes in imt happen during cardiac cycle (26, 36). selzer. showed that imt on the far wall of cca was higher at the end of diastole than the peak of systole in 24 samples (6). polak. showed 5.3% reduction in carotid imt and the average change of imt was 0.04 mm with high resolution m - mode imaging (37). a limitation of the study was that the translation movement of the cca which came from the probe movement during scanning and suppression of artery pulsating movements were more complicated. the present study demonstrated that the proposed computerized analyzing method can provide accurate measurements of the far wall imt on the cca in sequential 2d ultrasonic images. by this method, not only the variation in the results of manual tracing by observers decreased, but also the duration of image processing was considerably reduced.
|
background : ultrasound measurement of carotid intima - media thickness (imt) is a suitable method to evaluate subclinical arteriosclerosis.objectives:the current study aimed to present a new computerized algorithm to detect instantaneous changes of the imt to common carotid artery (cca) of imt in sequential ultrasound images by applying the maximum gradient and the dynamic programming.patients and methods : in a cross - sectional design, an examination was performed on thirty healthy human subjects with the mean age of 44 6 years from april 2013 to june 2013 in beheshti hospital, kashan, iran. in all individuals, the instantaneous changes of the far wall imt on the cca were extracted. local measurements of vessel intensity, intensity gradient, and boundary continuity were extracted for all of the sequential ultrasonic 2d - frames throughout three cardiac cycles. the pearson correlation coefficients and bland - altman analysis were performed to assess the relationship and agreement between imt measured by the proposed and conventional manual methods.results:there was no significant difference between the proposed and manual methods with paired t - test analysis (in systole : 0.57 0.10 vs. 0.56 0.10 mm ; p = 0.188 and in diastole : 0.63 0.16 vs. 0.62 0.10 mm ; p = 0.122 for the manual and proposed methods, respectively). the pearson correlation coefficients were r = 0.94 and r = 0.93 for imts and imtd, respectively (both p < 0.001). limit of agreements were narrow and considerable agreement was found between the two methods.conclusions:the present study demonstrated that the proposed computerized analyzing method can provide accurate measurements of the imt of the cca in sequential 2d ultrasonic images.
|
the hippocampus is involved in cognitive tasks such as learning, memory, emotional behaviour, stress regulation and spatial navigation (foerster., 2012 ; muzzio, kentros, & kandel, 2009 ; nossin - manor., 2012). hippocampal volume reduction is associated with the development of alzheimer 's disease and other disorders of memory, with findings showing links between poor cognitive performance and smaller hippocampal volume (leung., 2010 ; sabuncu, yeo, van leemput, fischl, & golland, 2010). reduction in hippocampal volume has been linked to schizophrenia and multiple sclerosis (adriano, caltagirone, & spalletta, 2012 ; ceccarelli., 2007 ; cercignani, bozzali, iannucci, comi, & filippi, 2001). it is also thought to be involved in general age - related cognitive decline, though reports are often mixed with some research finding a significant inverse association (wolz., 2010) and others no association (sanchez - benavides., 2010). although these inconsistencies might be due to methodological differences, such as image segmentation techniques or the population studied (adriano., 2012), it is important to note that the main focus of these studies was on hippocampal size measured using conventional structural magnetic resonance imaging (mri) techniques (nossin - manor., 2012). age - related brain tissue loss is most likely to be preceded by cellular changes, such as synaptic loss and neuronal degeneration (hyman, vanhoesen, damasio, & barnes, 1984), which may not be detectable by conventional volumetric measurement. quantitative mri techniques such as relaxometry, magnetization transfer (mt - mri), diffusion tensor (dt - mri) and perfusion mri can detect subtle brain tissue changes not identifiable on conventional t1- or t2-weighted mri (ceccarelli., 2007 ; cercignani., 2001 ; davies., 2004 ; filippi & rovaris, 2000 ; parry., 2003 ; rovaris & filippi, 2000 ; vrenken, geurts,., 2006 ; vrenken, rombouts,., 2006 ; vrenken, rombouts, pouwels, & barkhof, 2006). some of these techniques have recently been used to uncover associations between brain - wide white matter integrity and cognitive ability in old age (penke., 2012). t1 is the longitudinal (or spin - lattice) relaxation time and is related to the tissue water content, with increased t1 indicating increased tissue water, e.g., oedema that might, for example, reflect axonal damage (bastin, sinha, whittle, & wardlaw, 2002). mtr measures the efficiency of the magnetization exchange between relatively free water protons and those water protons that are bound to protein macromolecules in cellular membranes. low mtr values indicate reduced transfer efficiency suggesting axonal damage and demyelination (bastin., 2002 ; mcdonald, miller, & barnes, 1992). dt - mri is most often used for measuring white matter integrity but it has also been proposed as a measure of grey matter integrity (bhagat & beaulieu, 2004 ; den heijer., 2012 ; pal., 2011). fractional anisotropy (fa) and mean diffusivity (md) are scalar indices obtained from the dt, with the former indicating the degree of directionality of the water molecule diffusion when subjected to cellular boundaries within a tissue, and the latter indicating the overall magnitude of water diffusion. when the microstructure of cells break down, water molecules can diffuse further and more uniformly in all directions (bhagat & beaulieu, 2004) resulting in increased md and reduced fa compared with healthy, structurally intact tissue. it has been reported in several small cohort studies that hippocampal structural changes are detectable using image relaxometry (van den bogaard., 2012 ; kosior, lauzon, federico, & frayne, 2011 ; sumar, kosior, frayne, & federico, 2011 ; wang., 2012) and mtr (diniz., 2011 ; margariti., 2007 ; increased relaxation time in the hippocampus has been associated with poorer cognitive performance in alzheimer 's disease compared to those with vascular dementia and matched controls (h. l. wang, yuan, shu, xie, & zhang, 2004) ; and mtr has been shown to detect brain changes in medial temporal lobe epilepsy suffers white and grey matter, in the absence of significant volume change (diniz., additionally, dt - mri has been reported to be sensitive at detecting hippocampal changes (carlesimo, cherubini, caltagirone, & spalletta, 2010 ; cherubini., 2010 ; den heijer., 2012 ;, 2010 ; muller., 2005). in view of these previous findings, we anticipate that multivariate analysis of a range of quantitative mri parameters in a large ageing sample could provide useful information about hippocampal structural changes and their role in cognitive ageing. however, to the best of our knowledge no studies have yet assessed the association between cognition in older people and hippocampal integrity characterised by multiple quantitative mr parameters such as longitudinal relaxation time (t1), magnetization transfer ratio (mtr) and water dt parameters. the aim of the current study was to investigate associations between major, ageing - relevant cognitive ability domains and hippocampal integrity measured using multi - parametric mri (t1, mtr, fa and md) in a large sample of community - dwelling older adults. we hypothesized that hippocampal integrity measured using these advanced mri techniques would be more sensitive at detecting age - related integrity than volumetric measurements alone and hence provide further insights into the role the hippocampus plays in cognitive functioning in old age. study participants were members of the lothian birth cohort 1936 (lbc1936 ; deary, gow, pattie, & starr, 2012 ; deary., 2007) who underwent brain mri at mean age 73 years. the lbc1936 are a community - dwelling sample, most of whom are surviving participants of the scottish mental survey of 1947 (deary., 2007 ; scottish council for research in education, 1949) living in the lothian (edinburgh and the surrounding regions) area of scotland. they were recruited for cognitive and medical assessments along with structural brain mri at mean age 73 years (deary., 2012, 2007) written informed consent was obtained from all participants under protocols approved by the lothian (rec07/mre00/58) and scottish multicentre (mrec/01/0/56) research ethics committees. amongst the 700 subjects who underwent mr imaging, a total of 627 subjects who had sufficient data for the current analysis the imaging protocol has been described elsewhere (wardlaw., 2011). briefly, all brain mri data were acquired on a ge signa horizon hdxt 1.5 t clinical scanner (general electric, milwaukee, wi, usa) using a self - shielding gradient set with maximum gradient strength of 33 mt / m, and an 8-channel phased - array head coil. structural imaging included : t1-, t2-, t2 -weighted and fluid - attenuated inversion recovery (flair) whole - brain scans. quantitative maps of t1 were obtained from two axial t1-weighted fast - spoiled gradient echo sequences with 2 and 12 flip angles (armitage, schwindack, bastin, & whittle, 2007), while mtr volumes were generated from two standard spin - echo structural sequences acquired with and without a magnetisation transfer pulse applied 1 khz from the water resonance frequency. the dt - mri protocol consisted of seven t2-weighted (b = 0 s / mm) and sets of diffusion - weighted (b = 1000 sec / mm) whole - brain axial single - shot spin - echo echo - planar volumes acquired with diffusion encoding gradients applied in 64 non - collinear directions. the acquisition parameters for component structural volumes acquired in the mt-, t1- and dt - mri mapping protocols, i.e. field - of - view (256 256 mm in all cases), imaging matrix (128 128 for dt - mri, and 256 256 for all other sequences), slice thickness and location (36 4 mm thick slices for flair, 160 1.3 mm for the high - resolution t1-weighted volume scan and 72 2 mm for all other sequences), were chosen to allow easier co - registration between sequences so that md, fa, mtr and t1 biomarkers could be accurately measured within the same specific region of interest. structural scans were co - registered to the t2-weighted volumes using flirt (jenkinson & smith, 2001) (http://www.fmrib.ox.ac.uk/fsl). a validated multispectral image processing tool, mcmxxxvi (hernandez, ferguson, chappell, & wardlaw, 2010) www.sourceforge.net/projects/bric1936), was used for segmentation of brain tissue volumes to measure : intracranial volume (icv ; all soft tissue structures inside the cranial cavity including brain, dura, cerebrospinal fluid (csf) and venous sinuses) ; grey matter (all grey matter in cortex and subcortical regions) and normal appearing white matter (areas of white matter not affected by white matter lesions) volumes. hippocampal structures were segmented from the high - resolution t1-weighted volume scans using flirt - first (patenaude, smith, kennedy, & jenkinson, 2011). all of the generated masks were visually inspected and, where necessary, corrected by manual editing resulting in a hippocampal mask and volume measurement for each subject. the editing was based on a manual segmentation protocol to reduce rater error and inter - rater reliability ratings were.98 based upon a subsample of 103. t1 and mtr maps were generated on a voxel - by - voxel basis as previously described (armitage. 2011), and hippocampal regions were extracted from t1 and mtr maps in the following steps. the t1-weighted volumes were first transformed into the native space of the t1 and mtr parametric maps using flirt (jenkinson & smith, 2001), and the transformation matrices applied to the hippocampal masks. these masks were then applied to the t1 and mtr maps. in order to remove potential partial volume errors due to interpolation and to ensure analysis of pure grey matter tissue within the hippocampal volume, grey matter masks were applied to the t1 and mtr maps, and average t1 and mtr values within hippocampal structures were computed. dt - mri data were pre - processed using fsl (http://www.fmrib.ox.ac.uk/fsl), to extract brain (smith, 2002), remove bulk subject motion and eddy current induced distortions by registering all diffusion - weighted volumes to the first undistorted baseline (b = 0 sec / mm) volume (jenkinson & smith, 2001), estimate the water dt and calculate parametric maps of fa and md from its eigenvalues using dtifit (behrens., 2003). to extract fa and md in the hippocampus the high - resolution t1-weighted volume scan was brain extracted using freesurfer (http://surfer.nmr.mgh.harvard.edu) and then transformed to dt - mri space using flirt (jenkinson & smith, 2001). the transformation matrix computed was applied to the hippocampal masks and the resulting masks in dt - mri space were then applied to the fa and md parametric maps. the grey matter mask previously segmented was also applied to the fa and md hippocampal mask producing pure grey matter segmentations, and the average fa and md values were computed. finally, the hippocampal masks in the t1, mtr, fa and md maps were visually checked by an image analyst (nar) before computation of average values was performed (fig. 1). the cognitive ability assessments have been described in detail elsewhere (deary., 2012, 2007). 12 (deary., 2007), a paper - and - pencil iq - type test with a preponderance of verbal reasoning items, at age 11 years and repeated at age 70 years. this allowed iq - type scores from childhood and old age to be derived. concurrently with mri scanning at mean age 73 years, subjects completed six subtests of the wechsler adult intelligence scale iii (symbol search, digit symbol, matrix reasoning, letter - number sequencing, digit span backward and block design) (deary. principal components analysis was used to extract a general cognitive ability (g) component score from the first unrotated principal component (luciano., 2001) that accounted for 51.0% of the total variance in these tests (penke, maniega,., 2010 ; penke, valdes hernandez,., 2010). in addition, subjects completed three cognitive processing speed tests (simple reaction time, 4-choice reaction time, and inspection time) (deary., 2012, 2007), from which a general processing speed factor (speed) (luciano., 2001) was extracted that explained 58.6% of the total variance in these speed tests (higher scores indicate better performance) (penke, maniega,., 2010 ; penke, valdes hernandez,., 2010). six subtests of the wechsler memory scale iii (logical memory immediate and delayed recall, spatial span forward and backward, verbal paired associates i (1st recall) and ii) (deary., 2007) formed a general memory factor (memory) (corley, gow, starr, & deary, 2010 ; corley., 2011), which accounted for 41.0% of the total variance in these memory tests (penke, maniega,., 2010 ; penke, valdes hernandez,., 2010). it should be noted that higher scores of the cognitive component variables (g, speed and memory) represent better performance at cognitive assessments. participants also completed the mini - mental state examination (mmse) (folstein, folstein, & mchugh, 1975). the test is scored out of 30 and scores less than 24 are often used to indicate possible cognitive impairment (filippi., 2000). our primary analysis used all subjects, but we also performed secondary analyses using a more commonly applied threshold in normal ageing studies of above 27 to ensure the investigation of those who are free from potential cognitive impairment. chicago iii, usa), with all statistical tests being two - tailed, and p values <.05 being considered statistically significant. the left and right hippocampal integrity measures were compared using paired t - tests, followed by bonferroni correction for multiple comparisons. associations between cognitive ability measures and hippocampal integrity measures were examined using multivariate linear regression models. in these models, each cognitive parameter (g, speed, and memory) was the dependent variable and each hippocampal integrity measure (t1, mtr, fa, md and volume) was the independent variable. all models included gender and age 11 iq because they are known to be associated with hippocampus integrity or cognition, while models that assessed associations between cognition and hippocampal volumes included icv to correct for individual differences in head size. a separate model, which predicted cognitive abilities from the combined measures of integrity was used to assess how much variance in cognition in old age is accounted for by multiple measures of hippocampal integrity, age and age 11 iq. we also assessed association between age 11 iq and hippocampal integrity, to do this we developed a model that predicted hippocampal integrity from cognitive abilities at age 70 years, age 11 iq and gender. to assess the effects of including subjects with possible cognitive impairment on any measured associations, analyses were performed for the entire population and for those with mmse scores above 27. amongst the 627 subjects who had complete data for image segmentation, 56 participants did not have complete cognitive ability test scores and 5 were excluded because of segmentation failure, leaving a final sample of 565 (301 men, table 1), aged 71.274.2 years (mean 72.7, sd.7 years). of these 565 subjects, 483 (245 men) had mmse scores above 27, and were aged 71.274.3 years (mean 72.8, sd.7 years). for the full cohort, left hippocampal volume (mean sd 3094.61 444.58 mm) was significantly smaller than right (3337.11 439.75 mm, p < the mean t1 relaxation time of left hippocampus (1.66.16 msec) was significantly shorter than that of the right (1.67.16 msec, p <.001). the left hippocampal fa (.12.01) was significantly higher than right (.11.01, p <.001). the left hippocampal md (942.38 69.44 10 mm / sec) was significantly smaller than that of the right (966.62 60.68 10 mm / sec, p <.001). there was no significant difference between left (47.99 2.56%) and right (48.02 2.49%, p =.60) hippocampal mtr. similar results were obtained when analysis used only those subjects with mmse scores above 27. in the regression models, after correcting for gender, icv and age 11 iq, larger volume of left hippocampus in the entire sample was significantly associated with higher scores of memory (=.11, p =.003, table 2, fig. 2) and larger volume of the right hippocampus was significantly associated with higher scores of g (=.09, p =.023). the model that predicted hippocampal integrity from cognitive ability variables, gender and age 11 iq showed that there was no association between age 11 iq and hippocampal integrity (supplementary table 1). associations between cognitive ability variables and hippocampal integrity were similar for those with mmse scores above 27 (supplementary tables 2 and 3). for other measures of hippocampus integrity, after correcting for gender and age 11 iq, shorter t1 and lower md values in the hippocampus were significantly associated with higher scores of g, speed and memory (: right and left, range =.10 to.20, all p <.001 ; table 2). higher mtr and fa values in the hippocampus were significantly associated with higher scores of g and speed (: right and left, range =.10.15, all p <.001). associations were similar when the model was based on subjects with mmse scores above 27 (supplementary table 3). thus t1 and md, followed by mtr and fa were significantly associated (in decreasing order of effect size) with cognitive ability after correcting for age 11 iq, whereas hippocampal volume did not show significant association in most cases. all significant associations between quantitative mri measures remained after correction for multiple testing using the false discovery rate method. the multivariate model that used the combined t1, mtr, fa and md showed that, after correcting for age and gender, the combined hippocampus integrity measure explained between 4.8% and 10.2% of the variance in cognitive ability variables. age 11 iq explained between 12.6% and 30.1% of the variations in cognitive ability variables when entered in the same analyses (table 3). we observed that the measures of hippocampus studied were significantly correlated with each other (supplementary table 4). in view of this we investigated whether the correlation could introduce multicollinearity problem by computing the variance inflation factors (vif) and tolerance. supplementary table 4 shows that the models did not suffer from multicollinearity problem as none of the tolerance was less than.2 and none of the vif was greater than 5 (neter, wasserman, & kutner, 1989 ; pan & jackson, 2008). the individual quantitative measures of hippocampus integrity explained between.2% and 3.6% of the variance in cognitive ability variables. in our sample of generally healthy older individuals, we found that : t1 relaxation time and md in the hippocampus were significantly associated with all cognitive ability variables investigated ; hippocampal mtr and fa were associated with general intelligence and speed but not with memory ; and only left hippocampal volume was significantly associated with memory, but not speed or intelligence. the findings support our hypothesis that hippocampal integrity, measured using quantitative mri parameters, is more sensitive at detecting brain tissue structural integrity than volumetric measurements alone. to the best of our knowledge, this is the first study to investigate associations between cognitive ability and hippocampal integrity measured using multi - modal quantitative mri techniques in a large sample of community - dwelling non - demented older adults. the conventional approach is to set the threshold to 24, which indicates possible cognitive impairment (filippi., 2000), but our choice of a more conservative threshold of 27 allowed us to include those who are unlikely to suffer from cognitive impairment. we found that there was no difference in associations when the analysis included only subjects with mmse scores above 27 compared with the use of the entire population. this was not a surprise because our participants were generally healthy individuals with no history of cognitive impairment or neuropsychological conditions. the associations between hippocampal volume and memory are consistent with previous studies (erickson., 2010 ; van der lijn, den heijer, breteler, & niessen, 2008 ; ystad., 2009) supporting the idea that the hippocampus is responsible for encoding and retrieval functions (muzzio., 2009 ; tamminga, stan, & wagner, 2010) and hence plays a key role in declarative memory (boyer, phillips, rousseau, & ilivitsky, 2007). our finding that higher md values in the hippocampus were associated with poorer cognitive ability is also consistent with previous studies (carlesimo., 2010 ; den heijer., this is also in agreement with previous studies (carlesimo., 2010 ; den heijer., 2012), although both groups measured cognitive ability using only memory performance but in addition to memory, we assessed cognitive ability using both speed of information processing and iq at older age, and our analysis accounted for age 11 iq which allowed us to carry out a detailed investigation of the associations between cognitive ability and hippocampal integrity. the observed associations between poorer performance on the cognitive assessments with increased t1, and increased md suggest an age - related increase in tissue water, and with reduced mtr supports potential axonal damage as possible mechanism for poorer cognitive ability. this observation is supported by the association between poorer cognitive ability and lower fa, reflective of further microstructural changes in cellular structure. the associations between quantitative mri parameters and cognitive measures suggest that subtle changes in hippocampal cellular structure may have begun to affect cognitive processes before changes in volume are detected. the currently ongoing longitudinal mri of this population will provide an opportunity to study these subtle, but potentially significant changes in cell structure, and allow a better understanding of the interaction between biological age - related changes and their cognitive correlates. (reuben, brickman, muraskin, steffener, & stern, 2011) have suggested that the hippocampus may be involved in logical reasoning, or fluid intelligence, which is itself correlated with processing speed (sheppard & vernon, 2008). our finding that mtr was associated with intelligence and processing speed but not memory may reflect this aspect of hippocampal function. we know that information processing speed mediates associations between intelligence and tract integrity (penke, maniega,., 2010), and that diffusion methods are more sensitive at detecting axonal damage, therefore it would seem that our findings of associations between cognitive ability and fa, and md reflect changes in the substrates of hippocampal tissue likely to contribute to poorer performance in cognitive measures more associated with neural networks. asymmetry in hippocampal volume is common, with a smaller left than right hippocampus being reported in healthy older adults (woolard & heckers, 2012) as well as in dementia and dementia subtypes (eckerstrom., 2008). it may be the case that hippocampal degeneration reaches a threshold whereby the volume has reduced significantly enough to affect cognition as maybe the case in alzheimer 's disease, where significant hippocampal atrophy is associated with poor memory when compared to age matched controls (leung., 2010). the association between left hippocampus and memory may indicate that it is differentially affected by the ageing process, though the potential biological underpinnings of this need to be explored in future research. the differential pattern of associations between cognitive performance and quantitative mri parameters in the hippocampus, compared to the associations found between hippocampal volume and cognitive measures may indicate that quantitative mri biomarkers are sensitive at detecting histopathological changes in the absence of severe neuronal loss. support for the idea that these measures are more sensitive at detecting microstructural changes comes from studies that have used md and fa (hong., 2010), and mtr (hanyu., 2005) to differentiate between various patient groups. the successful application of quantitative mri techniques to distinguish between subtle differences in the underlying pathology of diseases with overlapping characteristics, such as alzheimer 's disease and dementia with lewy bodies, lends strength to the use of multi - modal mri in studying age - related structural changes in the hippocampus of normal older adults. to test the pattern of change in multi - modal hippocampal parameters either a longitudinal or large cross - sectional dataset, which included participants with a range of dementia subtypes, mild cognitive impairment and normal older adults application of multi - modal mri in such a dataset would help to elucidate the parameter that is most sensitive to cognitive change, hopefully leading to a clearer understanding of the underlying mechanism that is influencing the cognitive outcome. the main strength of this study lies in the application of multi - modal mri to quantify structural integrity in the hippocampus in a large (n = 565), well - characterised group of older adults. this study is one of the largest so far to report associations between any measured hippocampal integrity and cognitive ability (adriano., 2012). where previous studies have successfully applied these techniques to pathological conditions such as brain tumour or multiple sclerosis (davies., 2004 ; liang., 2012), alzheimer 's disease (hanyu., 2005 ; hong., 2010 ; ropele., 2012), dementia with lewy bodies (hanyu., 2005) and cerebrovascular disease (foerster., 2012), we have shown their usefulness in providing more sensitive measures of brain structure than volumetric analysis in detecting subtle associations with cognitive performance. another strength of the study is the access to early life cognitive data, age 11 iq, allowing us to control for prior ability when looking at associations between cognitive ability in later life and brain size. we clearly demonstrate, through the assistance of age 11 iq, that hippocampus integrity is associated with cognitive decline over a lifespan, from youth to later life. failing to account for earlier life cognition would risk the erroneous assumption that all associations between hippocampus and cognition in later life are the consequence of ageing. the main limitation of the study is the lack of longitudinal data to assess time dependent changes in the hippocampus and their association with cognitive ability. however, the lbc1936 participants are currently undergoing repeat mri to provide such longitudinal data. in conclusion, we found that hippocampal integrity assessed using t1, mtr, md and fa were significantly associated with nearly all measures of cognitive ability investigated, even after accounting for early life age 11 iq, whereas volume was less sensitive. advanced multi - modal mri measures (obtainable from three mri sequences) may provide more sensitive measures of age - related changes in hippocampal integrity than volume measurements derived from conventional structural mri. furthermore this approach may be more useful in helping us to determine the brain 's role in cognitive ageing, specifically individual differences present in the associations between measures of the hippocampus and cognition.
|
hippocampal structural integrity is commonly quantified using volumetric measurements derived from brain magnetic resonance imaging (mri). previously reported associations with cognitive decline have not been consistent. we investigate hippocampal integrity using quantitative mri techniques and its association with cognitive abilities in older age.participants from the lothian birth cohort 1936 underwent brain mri at mean age 73 years. longitudinal relaxation time (t1), magnetization transfer ratio (mtr), fractional anisotropy (fa) and mean diffusivity (md) were measured in the hippocampus. general factors of fluid - type intelligence (g), cognitive processing speed (speed) and memory were obtained at age 73 years, as well as childhood iq test results at age 11 years. amongst 565 older adults, multivariate linear regression showed that, after correcting for icv, gender and age 11 iq, larger left hippocampal volume was significantly associated with better memory ability (=.11, p =.003), but not with speed or g. using quantitative mri and after correcting for multiple testing, higher t1 and md were significantly associated with lower scores of g (range =.11 to.14, p <.001), speed (range =.15 to.20, p <.001) and memory (range =.10 to.12, p <.001). higher mtr and fa in the hippocampus were also significantly associated with higher scores of g (range =.17 to.18, p <.0001) and speed (range =.10 to.15, p <.0001), but not memory.quantitative multi - modal mri assessments were more sensitive at detecting cognition - hippocampal integrity associations than volumetric measurements, resulting in stronger associations between mri biomarkers and age - related cognition changes.
|
severe sepsis and septic shock are life - threatening complications of infections and the most common cause of death in intensive care units. about 50% of patients with sepsis show myocardial involvement characterized by biventricular enlargement, reduced contractility, and diastolic dysfunction. this increases the risk of death and leads to an extremely poor prognosis in the case of severe sepsis or septic shock. heart failure in severe sepsis or septic shock is currently regarded although not yet classified as a symptom of a secondary cardiomyopathy, which is characterized by an altered cellular phenotype due to the impact of multiple mediators and toxins. triggering receptor expressed on myeloid cells-1 (trem-1) is a membrane molecule that is expressed on the surface of neutrophils and monocytes when they are triggered by bacteria and fungi. human tissues infected with bacteria are infiltrate with neutrophils and monocytes that expressed high levels of trem-1 [3, 4 ]. a soluble form of trem-1 (strem-1) is released from the activated phagocytes and can be found in body fluids. engagement of trem-1 has been shown to induce the production of proinflammatory chemokines such as interleukin (il-8) and cytokines such as tumour necrosis factor- (tnf-) and interleukin-1 (il-1) [5, 6 ], which have been implicated in ventricular dysfunction (depress ventricular contractility) associated with a variety of pathological conditions, including reperfusion injury and sepsis. the n - terminal prohormone of brain natriuretic peptide (nt - probnp) is a 76 amino acid n - terminal fragment of brain natriuretic peptide. nt - probnp levels in the blood are used for screening, diagnosis of acute congestive heart failure (chf) and may be useful to establish prognosis in heart failure, as the markers are typically higher in patients with worse outcome. the serum concentrations of nt - probnp are also typically increased in patients with asymptomatic or symptomatic left ventricular dysfunction and are associated with coronary artery disease and myocardial ischemia [911 ]. the purpose of this study was to track dynamic changes in serum strem-1, nt - probnp levels and cardiac function in patients with severe sepsis or septic shock and to investigate the association of serum myeloid cells of strem-1 levels with myocardial dysfunction in patients with severe sepsis. after the study was approved by the local ethics committee, informed written consent was obtained from all subjects or a close kin of the patient. a total of 40 patients with severe sepsis and 45 patients with septic shock were included in the study taking place from may 2011 to november 2011. all patients were hospitalized in the department of intensive care, affiliated hospital of guangdong medical college, and the required picco monitoring was evaluated for inclusion. these patients were diagnosed with severe sepsis or septic shock according to the 1991 accp / sccm joint meeting and by the diagnostic criteria developed at the 2001 international sepsis definition conference. inclusion criteria were as follows : the concomitant presence of age of 18 years and above, severe sepsis or septic shock presented within the last 24 hours. the concomitant presence of age of 18 years and above, severe sepsis or septic shock presented within the last 24 hours. exclusion criteria were as follows : neutropenia (500 neutrophils / mm),patients with acquired immune deficiency syndrome, administration of corticosteroids defined as any oral intake of more than or equal to 1 mg / kg equivalent prednisone within the last month, a history of hypertension, coronary atherosclerotic heart disease, chronic heart failure, chronic renal insufficiency, or liver disease, recent history (7 days) of the following caused by elevated cardiac markers reasons : cardiothoracic surgery, external cardiac massage, defibrillation, and dc cardioversion. neutropenia (500 neutrophils / mm), patients with acquired immune deficiency syndrome, administration of corticosteroids defined as any oral intake of more than or equal to 1 mg / kg equivalent prednisone within the last month, a history of hypertension, coronary atherosclerotic heart disease, chronic heart failure, chronic renal insufficiency, or liver disease, recent history (7 days) of the following caused by elevated cardiac markers reasons : cardiothoracic surgery, external cardiac massage, defibrillation, and dc cardioversion. severe sepsis was determined as the acute dysfunction of at least one organ, that is, the acute presentation of at least one of the following : acute respiratory distress syndrome (ards), as any value of po2/fio2 below 200 with the presence of diffuse shadows in lung x - ray;acute renal failure, as the production of 1.5. acute respiratory distress syndrome (ards), as any value of po2/fio2 below 200 with the presence of diffuse shadows in lung x - ray ; acute renal failure, as the production of 1.5. septic shock was defined as systolic blood pressure below 90 mmhg for 1 hour requiring the administration of vasopressors provided that the negative fluid balance of the patient was corrected. the patients were bundle treated referring to the adult serious infection and septic shock hemodynamic monitoring and support guide (2006). the patients were divided into myocardial dysfunction group (nt - probnp 450 pg / ml, age 50 years ; nt - probnp 900 pg / ml, age 5075 years ; nt - probnp 1800 pg / ml, age 75 years) and nonmyocardial dysfunction group (nt - probnp 450 pg / ml, age 50 years ; nt - probnp 900 pg / ml, age 5075 years ; nt - probnp 1800 pg / ml, age 75 years) according to levels of nt - probnp after 24 hours of admission to icu. demographic and disease data of patients included age, gender, chief complaint for admission, vital signs, routine blood test results, liver and kidney functions, coagulation indicators, acute physiologic assessment and chronic health evaluation (apache) ii scores, and sequential organ failure assessment (sofa) scores. serum was collected at these same time points and strem-1 and nt - probnp levels were determined. we used the picco system (pulsion medical system, germany) for the hemodynamic monitoring. this system is a transpulmonary thermodilution method that can provide information on volume status, including cardiac index (ci, 3.05.0 l / min / m), global ejection fraction (gef, 2535%), cardiac function index (cfi, 4.56.5 l / min), and left ventricular contractility index (dp / dt max,12002000 mmhg / s). a central venous catheter was inserted into the internal jugular vein or subclavian vein, and picco arterial catheter was inserted into the femoral artery. then, 1015 ml normal saline at the temperature of 0.05). however, the apache ii scores and sofa scores in the septic shock group were higher than those in severe sepsis group (p = 0.003 and p = 0.000, resp.), but the sbp and dbp in septic shock group were markedly lower than that in severe sepsis group, shown in table 1. serum concentrations of strem-1 and nt - probnp in the septic shock group were significantly higher than those in the severe sepsis group on days 1, 3, and 7. however, the ci, cfi, gef, and dp / dt max in septic shock group were significantly lower than those in severe sepsis group on days 1, 3, and 7 (p < 0.05), shown in table 2. strem-1 levels were significantly positively correlated with apache ii scores, sofa scores, and nt - probnp (r = 0.619, p < 0.05 ; r = 0.610, p < 0.05 ; r = 0.715, p < 0.05), respectively. however, strem-1 level was markedly negatively correlated with ci, cfi, gef, and dp / dt max (r = 0.732, p < 0.05 ; r = 0.698, p < 0.05 ; r = 0.726, p < 0.05 ; r = 0.768, p < 0.05), respectively. strem-1, apache ii score, and sofa score as independent variables and nt - probnp as dependent variable, multiple logistic regression analysis showed that serum strem-1 level in patients with severe sepsis was an independent risk factors to myocardial dysfunction (r = 0.619, 95% ci : 0.8421.550, p < 0.001), in table 3. the patients were divided into nonmyocardial dysfunction group and myocardial dysfunction group according to the levels of nt - probnp after 24 hours of admission to icu. roc curves of the sensitivity and specificity of strem-1 to discriminate between myocardial dysfunction and nonmyocardial dysfunction in patients with severe sepsis are given in figure 1. 468.05 ng / ml as the cut - off point, the sensitivity, and specificity were 80.6% and 75.7%, respectively. gene expression of trem-1 among patients with severe sepsis and septic shock is shown in figure 2. no significant correlation was found between serum strem-1 and trem-1 gene transcripts (rs : + 0.196, p : nonsignificant). septic shock is the most severe form of sepsis and is one of the most significant causes of death among critically ill patients. cardiovascular changes are important in septic shock ; peripheral vascular dysfunction, which can result in heterogeneous microcirculatory flow, can frequently induce myocardial depression. in this population, cardiovascular collapse can increase the risk of death in sepsis as much as two times, and myocardial depression occurs in almost 40% of septic patients. myocardial depression is characterized by a cardiac output that fails to meet metabolic demands [12, 13 ]. triggering receptor expressed on myeloid cells-1 (trem-1), discovered by bouchon. in 2000, is a member of the immunoglobulin superfamily of receptors that is specifically expressed on the surfaces of monocytes and neutrophils. its soluble form, named strem-1, has been detected in cell culture supernatants after stimulation of neutrophils and monocytes with endotoxins as well as in sera of patients with sepsis [14, 15 ]. the present study was focused on the differences of the levels of strem-1 in severe sepsis and septic shock patients and investigated the correlation of strem-1 with myocardial dysfunction. in the present study, the serum concentrations of strem-1 in septic shock patients were significantly higher than those with severe sepsis on days 1, 3, and 7. furthermore, a positive correlation was detected between strem-1 and the apache ii scores or sofa scores. the results demonstrate that strem-1 has a positive correlation with illness severity in patients with sepsis, and strem-1 might be involved in septic shock development. the present study also showed that strem-1 level was markedly positively correlated with nt - probnp and negatively correlated with ci, cfi, gef, and dp / dt max. multiple logistic regression analysis showed that serum strem-1 levels were independent risk factors to nt - probnp increasing. therefore, we hypothesized that strem-1 levels increased in serum might be involved in myocardial dysfunction in patients with severe sepsis or septic shock. firstly, trem-1 induces secretion of tumor necrosis factor (tnf-) and interleukin-1, interleukin-6, which may result in cardiac impairment. both microbial and endogenous proinflammatory mediators, such as bacterial endotoxin (lipopolysaccharide (lps)), il-1, and tnf-, may directly depress myocardial contraction. it was found from the cytological experiments that proinflammatory cytokines have the effects of stimulating nt - probnp synthesized on cardiomyocytes. several candidates with a potential pathogenetic impact on the heart were identified : bacterial toxins ; cytokines and mediators ; nitric oxide ; cardiodepressant factors ; oxygen reactive species ; and catecholamines. our study found that ci, cfi, gef, and dp / dt max in septic shock group were significantly lower than those in severe sepsis group on days 1, 3, and 7, but regardless of severe sepsis group and septic shock group, these index was slightly decreased. those results are consistent with those reported by zhou., who reported that cardiac contractility and structure are not significantly compromised even during the late, hypodynamic stage of sepsis. first, cardiac function is depressed during endotoxic shock ; however, septic shock in humans is usually characterized by a high cardiac output, a low systemic vascular resistance, and a hyperdynamic hemodynamic profile [1921 ], so, ventricular contractility is not altered at early phase of sepsis. besides, during human septic shock, reversible depression of left ventricular ejection fraction and dilatation of the left ventricle have been described using radionuclide angiography or echocardiography. these changes in left ventricular function and size are transient and return toward normal in survivors at seven to ten days after the onset of septic shock. in addition, sample size too little in our research, which may influence the result. the patients were divided into nonmyocardial dysfunction group and myocardial dysfunction group according to the levels of nt - probnp after 24 hours of admission to icu. we further evaluated the value of strem-1 for diagnosing whether or not patients are with myocardial dysfunction. 468.05 ng / ml as the cut - off point, the sensitivity, and specificity were 80.6% and 63.6%, respectively. the low sensitivity value may have been related to the small sample size, and follow- up studies may include larger samples. our results are consistent with those reported by dimopoulou., who reported that gene expression of trem-1 on monocytes in severe sepsis / shock is not increased compared with patients with sepsis. serum strem-1 increases early in sepsis at levels related to disease severity, which is not the case for trem-1 gene transcripts. this is consistent with the lack of statistical correlation between strem-1 in serum and trem-1 gene transcripts of monocytes. the origin of strem-1 is so far unclear ; two hypotheses have been advanced to explain the origin of strem-1 : alternative splicing of trem-1 mrna and proteolytic cleavage(s) of mature, membrane - anchored trem-1. found that proteolytic cleavage of membrane - anchored trem-1 by one or several matrix metalloproteinases is responsible for strem-1 generation. but our finding highlights that circulating strem-1 is affected by factors more complex than single gene transcription of trem-1 like the rate of shedding of the membrane - bound receptor. in summary, serum strem-1 levels correlated with disease severity and independent risk factors to myocardial dysfunction ; it may be as a valuable tool for determining the presence of myocardial dysfunction in patients with severe sepsis. these findings add considerably to our knowledge on the pathophysiological response of the severe sepsis patients with myocardial dysfunction.
|
objective. to investigate the association of serum strem-1 with myocardial dysfunction in patients with severe sepsis. methods. a total of 85 patients with severe sepsis were divided into severe sepsis group (n = 40) and septic shock group (n = 45). serum levels of strem-1, nt - probnp, apache ii score, sofa score, cardiac index, cardiac function index, global ejection fraction, and left ventricular contractility index were measured on days 1, 3, and 7 after admission to icu. results. serum strem-1 levels of patients with septic shock were significantly higher than those with severe sepsis on days 1, 3, and 7. serum strem-1 was positively correlated with apache ii scores, sofa scores, and nt - probnp. however, the strem-1 level was markedly negatively correlated with ci, cfi, gef, and dp / dt max, respectively. multiple logistic regression analysis showed that strem-1 was independent risk factor to nt - probnp increasing. the optimal cut - off point of strem-1 for detecting patients with myocardial dysfunction was 468.05 ng / ml with sensitivity (80.6%) and specificity (75.7%). there is no difference in trem-1-mrna expression between the two groups. conclusions. serum strem-1 is significantly associated with myocardial dysfunction and may be a valuable tool for determining the presence of myocardial dysfunction in patients with severe sepsis.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.